Cambridge Science for the WA Curriculum Year 10 2ed – uncorrected sample pages
Chapter 2 Genetics
Chapter introduction
Everyone is unique, but you may look similar to your parents. This is thanks to the genes that they passed on to you. Genes carry the information that determines your traits and are made of DNA. This chapter explores the structure and function of DNA and genes in heredity. You will consider how variation is increased in offspring and predict patterns of inheritance. You will also examine what happens when there are problems with DNA and how these may be caused by the environment.
UNCORRECTEDSAMPLEPAGES
Required to make proteins via processes involving:
Chapter map
Nucleotides which contain:
• a pentose sugar
• a phosphate group
• a nitrogenous base (A, G, C or T (or U in RNA))
Genetic material in humans and other living organisms undergoes changes can be made of
DNA
• Pedigrees transcription translation
Mitosis (for growth and repair, results in genetically identical cells) and meiosis (for reproduction, results in genetically different cells).
Bene cial Harmful Neutral
Can change (mutate)
Section 2.1
Section 2.2
Section 2.3
Section 2.4
Patterns of inheritance in characteristics are passed on.
Tools for analysis:
• Punnett squares
types of changes
Gene mutations Chromosome mutations
DNA can be purposely manipulated.
Genetically modified organisms (GMO) Gene therapy
UNCORRECTEDSAMPLEPAGES
Curriculum content
Biological sciences
Cell division processes of meiosis and mitosis produce new cells with chromosome numbers specific to their role; chromosomes contain genes that are composed of DNA (deoxyribonucleic acid)
• comparing the role and number of chromosomes in the cells produced by mitosis and meiosis
• modelling the structure of DNA
Patterns of monohybrid inheritance, including autosomal dominant/recessive and sex-linked recessive inheritance, can be predicted using pedigrees and Punnett square crosses
• interpreting pedigrees and predicting offspring for autosomal dominant/recessive alleles, such as hair colour in guinea pigs, leaf colour in barley, seed shape and colour and plant height in peas
• interpreting pedigrees and predicting offspring for sex-linked recessive alleles, such as red-green colour blindness and haemophilia
Collaborating and applying
Illustrate how advances in scientific understanding often rely on developments in technologies and engineering and technological and engineering advances are often linked to scientific discoveries
• exploring how the development of fast computers has made the analysis of DNA sequencing possible
• examining how the work of Rosalind Franklin, James Watson, Francis Crick and Maurice Wilkins contributed to the development of the double helix structure of DNA
Illustrate how proposed scientific responses to contemporary issues may impact on society
• examining karyotypes and applications of biotechnologies, such as DNA profiling, gene therapy and genetic engineering
1. Recall the components that make up the structure of DNA and RNA molecules.
2. Describe the relationship between DNA, genes and chromosomes.
3. Describe the steps in which DNA is used to synthesise proteins.
Genetics
Structure of DNA
genetics the study of genes, genetic variation and heredity
gene a length of chromosome made of DNA, the basic unit of inheritance heredity the genetic passing on of traits from one generation to the next DNA deoxyribonucleic acid; the molecular unit of heredity, containing the genetic information responsible for the development and function of an organism
polymer a molecule made from many repeating subunits called monomers
monomer a single subunit that when joined together repeatedly makes a polymer nucleotide a monomer subunit of a nucleic acid, consisting of a phosphate group bound to a fivecarbon sugar, which in turn is bound to a nitrogenous base
hydrogen bonds chemical bonds that hold the two DNA strands together
UNCORRECTEDSAMPLEPAGES
Genetics is the study of how certain traits (characteristics) can be inherited from a previous generation. It involves the study of genes, genetic variation and heredity. Genes are considered the basic unit of inheritance. They are made of deoxyribonucleic acid, or DNA for short. This hereditary material is passed from parents to offspring and contains the information needed to specify traits.
Structure of DNA
DNA is a double-stranded molecule that forms a ‘double helix’ shape, like a twisted ladder. DNA is a polymer as it is made up of many monomer subunits called nucleotides.
The nucleotides that make up DNA have three major components:
• a five-carbon (pentose) deoxyribose sugar
• a nitrogenous base – one of adenine (A), guanine (G), cytosine (C) or thymine (T)
• a negatively charged phosphate group.
The nucleotides bind together to form two long strands that wind around each other. Each strand has a backbone made of alternating deoxyribose sugar and phosphate groups.
The nitrogenous bases from one strand bind to complementary bases on the other strand using hydrogen bonds.
Figure 2.1 The double helix structure of DNA: the subunits called nucleotides all join up to form the double-stranded DNA. Note the sugar–phosphate backbone on the edge of the DNA molecule and the nitrogenous bases joining in the centre.
UNCORRECTEDSAMPLEPAGES
Adenine (A) always pairs with thymine (T), and guanine (G) always pairs with cytosine (C). One way to remember the A–T and G–C pairings is ‘Apple in the Tree, Car in the Garage’. This complementary base pairing occurs because of the shape of the nitrogenous bases and the number of hydrogen bonds they can form (Figure 2.3).
Guanine and adenine have a double-ring structure, which means they belong to a group of chemical molecules called purines. A helpful way to remember that adenine and guanine are purines is ‘Pure As Gold’. Cytosine and thymine have a single-ring structure and belong to the group called pyrimidines. Purines always pair with pyrimidines, but the number of hydrogen bonds between them depends on the structure. Guanine binds with cytosine with three hydrogen bonds, while adenine and thymine form two hydrogen bonds.
Figure 2.3 A closer look at the structure of DNA. The sugar–phosphate backbone forms the outer edge of the helix and the nitrogenous bases form complementary pairs in the centre. Hydrogen bonds hold the two strands together.
complementary base
Figure 2.2 Traits are passed on from generation to generation.
pairing adenine only binds with thymine and cytosine only binds with guanine
Try this 2.1
Modelling DNA using lollies
Materials
• liquorice ribbons or sour strips
• a handful of jelly babies
• toothpicks
Method
1. Sort the jelly babies into four groups of colours.
Be careful
Do not to consume lollies in the laboratory. Beware of allergies.
UNCORRECTEDSAMPLEPAGES
2. Pair up the jelly babies so that one particular colour always goes with another particular colour, for example, red with yellow and orange with green.
3. Place a pair of jelly babies onto each toothpick as if you were making lolly kebabs. Ensure that the pairs are always of matched colours.
4. Attach your lolly kebabs to the long strips of liquorice.
5. Keep doing this until you have about 5–7 horizontal toothpicks attached and it starts to look a bit like a ladder.
6. The paired coloured sweets represent the base pairs, while the liquorice is the sugar–phosphate backbone.
7. Pick up your lolly ladder and twist it to represent the double helix shape of DNA.
Practical 2.1
extracting DNA from cells
Time period
Approximately 1 hour
Aim
To investigate and extract DNA from strawberries.
Materials
Be careful
Wear safety glasses and a lab coat. Do not consume food items.
• plastic sandwich bag (or other material to contain strawberry and liquid)
• strawberry
• DNA extraction solution provided (10 mL)
• filter funnel and gauze (or other gauze-style filter)
• cold ethanol solution
• test tube (or small beaker)
• stirring rod
• plastic pipette
DNA extraction solution:
• dishwashing liquid or shampoo (5 mL)
• table salt (0.75 g)
• water (45 mL)
Method
1. Wash the strawberry with tap water and remove the green leaves. Add the strawberry to the plastic sandwich bag.
2. Add the DNA extraction solution (10 mL) and close the sandwich bag, removing the excess air
3. Squash the strawberry into the liquid using your hands until the strawberry is roughly crushed.
4. Pour the strawberry mixture through a filter funnel lined with gauze into a test tube.
5. Discard the gauze and strawberry remains into a bin.
6. Add an equal volume of cold ethanol to the test tube using a plastic pipette.
UNCORRECTEDSAMPLEPAGES
7. Slowly mix the two layers of liquid with a stirring rod.
8. Collect the white solid that forms on the stirring rod. This is DNA.
Results
Write observations for what occurs during each step of the method.
Discussion
1. Describe whether the white solid could contain all of the DNA of the strawberry.
2. Visually compare the amount of solid you collected to that of other groups in the classroom. Were results consistent? Explain your answer.
3. Describe the variables that were not kept consistent between groups in the classroom.
4. Suggest any changes that could be made to the method to improve the quality of the recorded data in future experiments. Justify your suggestions by explaining how each change would improve the data quality.
Conclusion
1. Draw a conclusion regarding the efficiency of this method at extracting all the DNA from a strawberry, based on your and other groups’ observations.
Did you know? 2.1
How long is DNA?
The DNA found in only one cell, if fully unravelled, would be around two or more metres long! The length of a piece of double-stranded DNA is commonly expressed as the number of complementary nitrogenous base pairs it contains. The DNA in an average human cell has an estimated 63 000 000 base pairs.
Quick check 2.1
1. Recall the three key components that make up a nucleotide.
2. Describe the overall shape of DNA.
3. If a strand of DNA contained the nitrogenous bases seen below, state the bases in its complementary strand. DNA strand: ATATAGATAGATCAGACA.
Explore! 2.1
the discovery of DNA
Friedrich Miescher was a Swiss biochemist who first observed DNA in 1869. However, it took almost a century for scientists to understand the structure of DNA and the mechanisms by which it carries genetic information.
Research the following scientists who, among many others, contributed to our understanding of DNA:
• Friedrich Miescher
• Erwin Chargaff
• Francis Crick and James Watson
UNCORRECTEDSAMPLEPAGES
• Rosalind Franklin and Raymond Gosling
• Maurice Wilkins.
Summarise their contributions and place them on a timeline.
2.4 Dr
and
fired X-rays at a DNA strand stretched across a paperclip in 1952. The resulting picture was critical to the discovery of the double helix structure of DNA, providing key information that enabled James Watson and Francis Crick to build the first correct model of the structure of DNA.
2.5 The relationship between DNA and chromosomes
Figure
Rosalind Franklin (right)
Raymond Gosling
Figure
What is a chromosome?
The DNA found in the nucleus of a cell is usually in a form called chromatin. This is a highly organised complex of DNA and associated proteins such as histones. By wrapping around histones, the long strands of DNA can fit inside the nucleus. When it is time for the cell to replicate, chromatin condenses into structures called chromosomes. Each molecule of DNA forms one chromosome. Along the chromosome are genes, which are the units of inheritance. Genes are sections of DNA that hold the specific instructions required for making every protein in our bodies.
Telomere
Centromere
Telomere
One chromosome
Sister chromatid
One chromosome (duplicated)
The familiar X-shape of a chromosome is only seen after DNA replication has occurred. Shortly before replication, the chromosome appears as a single condensed DNA molecule. DNA replication produces two identical sister chromatids that are joined together by centromeres to form the distinct X-shape (Figure 2.6). At the ends of each chromosome are protective structures made of DNA and protein called telomeres. These protect the chromosomes, but every time DNA replicates, the telomeres shorten. Eventually, the telomeres shorten to the extent that replication can no longer occur.
2.7 The
Cell
Figure 2.6 Before replication, a chromosome is a single molecule (left). After DNA replication, each chromosome consists of two molecules called sister chromatids (right).
chromatin
a mixture of DNA and proteins that form chromosomes
chromosome a thread-like structure of tightly wound DNA and proteins
sister chromatids two copies of the same chromosome, connected at a centromere
centromere
a structure that holds two sister chromatids together
telomeres
structures made from DNA and proteins that protect the ends of chromosomes
Chromosome
Chromatid
One of two strands of DNA that makes up a chromosome
Centromere
Connects the two chromatids and is the location where fibres attach during cell division
Telomeres
Protective molecular caps of repeating DNA located at the ends of chromosomes
X-shaped chromosome, showing the two sister chromatids and the
Making thinking visible 2.1
Compass points: telomeres and immortality
UNCORRECTEDSAMPLEPAGES
Telomeres contain thousands of repeated copies of the base sequence TTAGGG. When we are infants, our telomeres are approximately 10 000 bases long, but each time the cell divides, they slowly get shorter. A cell will die when its telomeres become too short. By the time we are in our eighties, our telomeres may only be 5000 bases long, but this varies from tissue to tissue and from person to person. A person in their thirties may well have telomere lengths of a person in their nineties and vice versa.
continued …
Figure
distinct
centromere
Figure 2.8 A scanning electron micrograph of a duplicated human chromosome
This means that telomeres are a key component of ageing, and there are efforts to use them to slow down or reverse the ageing process. Some companies say they can measure your telomere length, suggesting that it will indicate your true, biological age. Despite limited evidence, there are also companies that sell products that they claim can maintain or lengthen telomeres – in effect, making you younger or possibly allowing immortality.
Complete the Compass points activity about manipulating telomeres to prevent ageing:
1. E = Enthusiastic: What generates enthusiasm within you regarding this concept? What are the potential benefits?
2. W = Worries: What causes concern about this idea? What are the potential drawbacks?
3. N = Need for Information: What other details or facts are necessary to evaluate this idea? What additional knowledge would aid in assessment?
4. S = Suggestion for Progress: What is your current viewpoint or proposal regarding this idea? How can you continue to assess this concept?
DNA
Number of strands
Type of sugar
Nitrogenous bases
UNCORRECTEDSAMPLEPAGES
RNA
Two
Deoxyribose
Guanine
Cytosine
Adenine
Thymine
Where is the molecule found?Nucleus, mitochondria and chloroplasts (in eukaryotes)
Different forms
Cytoplasm (in prokaryotes)
DNA
Mitochondrial DNA (mtDNA)
Chloroplast DNA (cpDNA)
One
Ribose
Guanine
Cytosine
Adenine
Uracil
Cytoplasm
Nucleus
Associated with ribosomes
Messenger RNA (mRNA)
Transfer RNA (tRNA)
Ribosomal RNA (rRNA)
Table 2.1 The main differences between the two nucleic acids, DNA and RNA
The Compass points thinking routine was developed by Project Zero, a research centre at the Harvard Graduate School of Education.
Figure 2.9 Telomeres shorten every time a cell divides.
There are four types of biological macromolecules: proteins, carbohydrates, lipids (fats and oils) and nucleic acids. Nucleic acids are found in two forms: DNA and ribonucleic acid (RNA). The two types of nucleic acids differ in several key ways, which are outlined in Table 2.1 and shown in Figure 2.10.
Quick check 2.2
1. Describe the relationship between chromosomes, genes, DNA and base pairs. 2. Contrast the structures of DNA and RNA.
the purpose of DNA: Making proteins
Why do we need proteins?
Proteins are complex molecules that play a critical role in many body functions. We use approximately one billion proteins every day, just to function normally. Proteins help provide structure to cells and build and repair tissue. Protein molecules play many other varied roles in the body; they include haemoglobin molecules that carry oxygen around our body and the hormones that regulate our glucose levels and development. Collagen and keratin are structural proteins, making up the structural components of organs. Enzymes such as amylase and lipase are catalytic proteins that help control the rates of reactions. Other proteins help us fight pathogens, transport molecules and move our muscles.
base triplet a set of three nitrogenous bases that code for an amino acid transcription the first stage of protein synthesis in which the base sequence of DNA is copied into mRNA translation the second stage of protein synthesis in which a sequence of mRNA is translated into a sequence of amino acids
Explore! 2.2
Protein functions
The many roles of protein include structural, contractile, transport, catalytic, regulatory and immunological functions. Research the following proteins and determine their function.
Protein Function
Oxytocin
Actin
Ferritin
Insulin
The link between DNA and proteins
Genes are sections of DNA that hold the specific instructions required for making each of the proteins in our bodies. The sequence of the nitrogenous bases in a gene provides the instructions (or code) to produce a protein. A group of three nitrogenous bases is called a base triplet/codon, and these code for a particular amino acid. Amino acids are the monomers of proteins. The order of nitrogenous bases specifies the sequence of amino acids that forms a particular protein.
Quick check 2.3
1. Recall why proteins are important.
2. Describe the relationship between DNA, amino acids and proteins.
Protein synthesis
To synthesise (or build) proteins using the DNA code in genes, the gene must be expressed; that is, the instruction in the DNA is converted into a protein. This means two processes need to occur: transcription and translation
Uracil replaces thymine in the mRNA
To transcribe means to put into written form, so in this process the DNA code for a specific protein is ‘written down’ in the form of mRNA (messenger RNA).
To translate means to convert into another form, so in this process the code (written down as mRNA) is converted into a chain of amino acids known as a polypeptide chain. This can then be folded to become a protein.
Transcription
Transcription happens in the nucleus of the cell. The transcription process requires getting access to the DNA code in the genes, otherwise the code cannot be copied. Transcription begins when an enzyme (RNA polymerase) binds to the gene being copied. This causes the DNA double helix to unwind, allowing the enzyme to read the code on one of the DNA strands (called the DNA template strand). As the enzyme reads the code, it builds a complementary copy of the gene using RNA nucleotides: C, G, A and U. RNA follows the same complementary pairing rules as DNA, with one exception. Where DNA has the nitrogenous base thymine (T), RNA has uracil (U). The newly formed single-stranded RNA is called messenger RNA (mRNA). When transcribing DNA into mRNA, only one strand of DNA is used as a template. If both strands were transcribed, it would result in two different RNA sequences coding for different proteins, leading to confusion and potentially incorrect protein synthesis. When the mRNA peels away from the DNA template strand, the DNA double strands rejoin and wind back up into a helix. The mRNA then leaves the nucleus and goes to the site of protein production, the ribosomes.
Try this 2.2
Base pairings
Complete the base sequence of the DNA complementary strand and then the mRNA strand formed from the DNA template strand given below.
UNCORRECTEDSAMPLEPAGES
Translation
Once mRNA reaches the ribosomes in the cytoplasm, it must be ‘decoded’ or translated to make the necessary protein. The nitrogenous bases in the mRNA are decoded in groups of three called codons (base triplets in the original DNA template strand). Each codon in the mRNA specifies which amino acid is added to the polypeptide chain.
Figure 2.12 simplifies the process of translation. In reality, translation requires several enzymes and another type of RNA called transfer RNA (tRNA). It occurs at the ribosomes, which may be freely floating in the cytoplasm or attached to the endoplasmic reticulum (ER), creating the rough ER. Each tRNA molecule transports one specific amino acid towards the ribosome for delivery.
Table 2.2 shows the 20 different amino acids that form the building blocks for every protein. Using this table, you can identify the amino acid that each codon codes for. For example, if the first codon of your mRNA strand is AUG, you locate the A in the left column and the U in the top row and find where they intersect. At that spot is a box containing four different codons. You then find where the G in the right column of the table intersects and you will see your codon
codon three nucleotides (base triplet) on mRNA that code for an amino acid polypeptide a chain of amino acids, forming part or the whole of a protein molecule
AUG. Next to the codon it says Met, which means AUG codes for the amino acid methionine in eukaryotes. The codon AUG is unique as it is also a START codon. This means that it always is the first codon in the transcribed mRNA that undergoes translation. There are also three STOP codons which signal for the process of translation to stop rather than coding for another amino acid.
DNA strand DNA
UNCORRECTEDSAMPLEPAGES
Transcription (occurring in the nucleus)
mRNA
Translation (occurring in the cytoplasm) Protein Chain of amino acids
Figure 2.12 The process of transcription and translation from a DNA molecule to an amino acid chain
First letter in the codon
UUU Phe (F) UCU Ser (S) UAU Tyr (Y) UGU Cys (C) U UUC UCC UAC UGC C
UUA Leu (L) UCA UAA STOP UGA STOP A UUG UCGUAG STOP UGGTrp (W) G C CUU
Leu (L) CCU Pro (P) CAU His (H) CGU Arg (R) U
CUC CCC CAC CGC C CUA CCA CAA Gln (Q) CGA A CUG CCGCAG CGG G
AUU IIe (I) ACU Thr (T) AAU Asn (N) AGU Ser (S) U AUC ACC AAC AGC C
Second letter in the codon Third letter in the codon
AUA ACA AAA Lys (K) AGA Arg (R) A
GUU
GUC GCCGAC GGC C
Val (V) GCU Ala (A) GAU Asp (D) GGU Gly (G) U
AUGMet (M) START ACGAAG AGG G G
GUA GCAGAA Glu (E) GGA A
GUG GCGGAG GGG G
Table 2.2 Table of amino acids showing that the genetic code is degenerate, which means that more than one codon can code for a single amino acid. This redundancy means that 61 of the 64 codons code for the 20 amino acids (the other three are stop codons).
Explore! 2.3
using biotechnology to produce therapeutic proteins
Traditionally, vaccines contain a weakened virus, or a protein of the virus, to trigger the body’s immune response and provide immunity.
Two of the common COVID-19 vaccines work in that way. AstraZeneca (a viral vector vaccine) contains material from the SARS-CoV-2 virus within the shell of another virus. Novavax (a protein subunit vaccine) contains part of the coronavirus spike protein which is injected directly.
mRNA vaccines have been in development for decades but had been progressing slowly. Financial backing from governments and commercial organisations is critical for research, and the significant funding provided worldwide to address the COVID-19 pandemic accelerated mRNA vaccine biotechnology.
mRNA vaccines work differently to traditional vaccines. Instead of delivering a viral protein, the vaccines deliver mRNA. COVID-19 mRNA vaccines contain instructions for making the spike protein from the SARS-CoV-2 virus. The Pfizer and Moderna vaccines package the mRNA into a lipid nanoparticle that can pass through the cell membrane.
Vaccine mRNA is modified to be more efficient at protein synthesis and resistant to degradation. This means it can be used as a template many times. Manufacturers use computer-controlled techniques for generating the required strands of RNA. This method is cheaper and safer than manufacturing proteins or growing viruses. mRNA vaccines have huge potential for preventing and controlling future epidemics and pandemics.
Quick check 2.4
UNCORRECTEDSAMPLEPAGES
1. The following codons are found in a strand of DNA: TAA TTA TCG ACT ACT AGC. State the complementary mRNA strand.
2. Contrast transcription and translation.
3. Explain why you do not need to read the code on both strands of DNA when transcribing DNA into mRNA.
Figure 2.13 A colourised electron microscope image of SARS-CoV-2 virus particles. The spike proteins around the edge give coronaviruses their name, as corona is Latin for crown.
Go online to access the interactive section review and more!
Section 2.1 review
Online quiz
Section questions
Section 2.1 questions
Remembering
1. Name the basic building blocks or monomers of DNA.
2. Recall where proteins are created (synthesised) in the cell.
3. Recall the name for the shape of DNA.
4. Illustrate and label a nucleotide.
Teachers can assign tasks and track results
UNCORRECTEDSAMPLEPAGES
5. Recall the four bases found in DNA and the complementary base pair rule.
6. Recall why all mRNA strands start with the codon AUG.
Understanding
7. A template strand of DNA is found to contain the following bases: TAC GGA TCA TCG TGG GAA GCA GGC ATT.
a) State the complementary DNA strand.
b) Using the above template strand of DNA, state the bases on the mRNA strand.
c) Using Table 2.2, identify the amino acids that this strand of DNA would code for.
Applying
8. Describe the purpose of DNA.
9. Describe the relationship between DNA, genes and chromosomes.
10. Explain how the body produces so many different proteins with only four different nitrogenous bases.
11. Explain how the genetic information found in the chromosomes within the nucleus of a cell reaches the ribosomes for protein synthesis.
12. Make a flow chart to summarise the key steps in transcription and translation.
Analysing
13. Contrast the structures of mRNA and DNA.
14. Differentiate between the functions of a structural protein and a catalytic protein, providing examples of each.
Evaluating
15. A template strand of DNA is found to contain the following bases: TCC TGA TGA TGG GGG GCA AAA CGC GTA.
Something went wrong during the transcription of this template strand, and the mRNA strand contains the following bases:
AGG ACU ACU ACC CUC CGU UUU GCG CAU.
a) Determine the mistake in the mRNA strand above.
b) Propose the outcome of this mistake on the protein produced.
16. Propose what may occur if there was a problem with a certain protein in your body.
2.2 Passing on genetic information
Learning goals
At the end of this section, I will be able to:
1. Recall the steps involved in DNA replication.
2. Describe the stages of cell division in mitosis and meiosis.
3. Use a karyotype to determine infor mation about an individual. VIDEO Sexual reproduction WORKSHEET
Two different forms of reproduction occur among organisms: asexual and sexual reproduction. Sexual reproduction requires two organisms to each contribute a gamete; these are the sex cells that combine to produce a unique offspring. Gametes are formed in the gonads of the male (testes) and the female (ovaries). Each gamete contains half the genetic information needed to form a new organism of the same species. When the gametes – sperm and ova (eggs) – meet and fertilise, they form a zygote with a full set of genetic information. The zygote divides and as the number of cells increases, cells begin to take on special functions. Eventually, the zygote becomes an embryo
You will notice that Figure 2.14 has some new terms:
UNCORRECTEDSAMPLEPAGES
Fertilisation
Zygote (diploid)
Offspring
Figure 2.14 Sexual reproduction involves a gamete from a male and a female combining to form a zygote.
• Cells that contain only one set of chromosomes are known as haploid (n). Gametes are haploid.
• Cells that contain two sets of chromosomes are known as diploid (2n). Somatic cells (body cells) and the zygote are all diploid.
• Meiosis is the name of the process by which the gonads make the haploid gametes.
• Mitosis is the name of the process by which diploid somatic cells make identical diploid copies of themselves for growth and repair.
In humans, the haploid number (n) is 23. This means that gametes contain 23 single unpaired chromosomes. When the egg and sperm meet and fertilise, the two sets of chromosomes come together and form the diploid zygote (2n). The zygote contains 23 pairs of chromosomes, meaning the diploid number (2n) in humans is 46. The haploid and diploid numbers vary between species, but always remain the same for all the organisms within that species. For example, the platypus has a diploid number (2n) of 52, which means it has 26 pairs of chromosomes in its somatic cells. This also means the egg and sperm of the platypus contain half this amount of genetic information, so its haploid number (n) is 26 chromosomes.
sexual reproduction form of reproduction that involves the fusion of gametes from two parents and introduces variation to the offspring gametes sex cells (sperm and ova) with half the usual number of chromosomes gonads the sexual organs: testes in males and ovaries in females
ova (singular: ovum) mature female reproductive cells zygote a fertilised egg produced by the fusion of male (sperm) and female (ovum) gametes
embryo the initial stage of early development in multicellular
haploid (n) a cell containing only one set of unpaired chromosomes
diploid (2n) a cell containing two sets of chromosomes somatic cells the body cells of an organism meiosis the process by which the gonads make the haploid gametes mitosis the process by which diploid somatic cells make identical diploid copies of themselves for growth and repair organisms
Did you know? 2.2
Different diploid numbers
The diploid number of chromosomes in a species is not related to whether an organism is bigger or more complicated. For example, a koala, a tammar wallaby and garlic all have a diploid number of 16 but are very different!
Quick check 2.5
1. Differentiate between the terms ‘haploid cell’ and ‘diploid cell’, providing an example of each.
2. If a sheep’s body (somatic) cell contained 54 chromosomes, calculate how many chromosomes would be found in its gametes.
How does DNA copy itself?
Before a cell divides, the DNA must be replicated to provide two copies of each chromosome, one for each new cell. This occurs before the processes of mitosis and meiosis. DNA replication must be precise, otherwise errors can affect the code in the DNA and lead to mutations (permanent changes in the DNA). The steps involved in DNA replication are outlined below and summarised in Figure 2.16.
1. The DNA molecule unwinds and ‘unzips’ (breaks the hydrogen bonds) between the nitrogenous bases. This happens with the help of an enzyme called DNA helicase.
UNCORRECTEDSAMPLEPAGES
Figure 2.16 DNA replication: (1) the DNA must first unwind and unzip and then (2) the new DNA nucleotides can be added following complementary base pairing rules. (3) This results in two identical strands of DNA.
2. Another enzyme called DNA polymerase attaches new nucleotides to the exposed nitrogenous bases. The enzyme follows the complementary pairing rule, where adenine can only join with thymine, and cytosine can only join with guanine. The two new strands of DNA will be identical to the original parent strand.
3. The newly added nucleotides are connected with new hydrogen bonds, which results in two identical strands of double-stranded DNA being formed. Each new strand is one-half of the original strand and one-half that was newly built. For this reason, replication is sometimes described as being semi-conservative because half of the original DNA molecule is conserved in each of the two new molecules.
Figure 2.15 Some very different organisms contain the same number of diploid chromosomes.
Original DNA strands
Newly synthesised DNA strands
Figure 2.17 DNA replication is described as semi-conservative because the two new strands of DNA each contain one parent strand and one newly synthesised strand.
Quick check 2.6
1. Explain the purpose of DNA replication.
2. Summarise the steps of DNA replication.
Mitosis
Growth and repair of damaged tissues requires a form of cell division called mitosis. Mitosis is also important in asexual reproduction to make identical copies of cells. The diploid (2n) parent cell divides to form two diploid cells that are genetically identical, called daughter cells. The sequence of steps in mitosis is shown in Table 2.3. Mitosis produces every cell in the human body, except gametes, which are produced by meiosis and result in haploid (n) cells.
The stages of mitosis
UNCORRECTED
Interphase
2n (before mitosis) replication replication
Prophase
Metaphase
Anaphase
SAMPLEPAGES
Table 2.3 The stages of mitosis
• Parent cell is diploid (2n).
• DNA replication occurs.
• Chromosomes are not visible.
• The cell gets bigger.
• Organelles replicate.
• The nuclear membrane breaks down.
• DNA condenses and appears as distinct chromosomes.
• Spindle fibres begin to form.
• Chromosomes are arranged along the centre of the cell.
• Each chromosome is attached to a spindle fibre by the centromere.
• The sister chromatids split at the centromere and are pulled to either end of the cell by the spindle, centromere first.
• Spindle fibres then begin to disappear.
Telophase
The stages of mitosis
Cytokinesis
2 × 2n (after mitosis)
Table 2.3 (continued)
Quick check 2.7
1. State which cells undergo mitosis.
2. Summarise the steps of mitosis.
• The nuclear membrane re-forms around the two sets of chromosomes, forming two new nuclei.
• The chromosomes decondense and are no longer visible.
• Division of cytoplasm starts.
• The cell pinches in half and divides into two genetically identical diploid daughter cells.
• In plant cells, a structure called the cell plate is formed that transforms into a new cell wall.
UNCORRECTEDSAMPLEPAGES
2.18 Plant cells in the process of mitosis viewed under a light microscope. The central cell shows the chromosomes moving to each end of the cell in anaphase. Can you identify some of the other stages?
Figure
observing cells in a dividing root tip
Aim
To observe cells carrying out mitosis in a growing onion root tip.
Materials
• prepared, stained slide of the growing section of an onion root tip caught at different stages of cell division
• microscope
Method
1. Using the lowest magnification, place a prepared slide of a growing onion root tip on the stage of the microscope.
Be careful
Ensure you carry the microscope appropriately: hold the arm with one hand and place one hand under the base. Ensure you don’t make big changes in magnification, so as not to damage the glass slide.
UNCORRECTEDSAMPLEPAGES
2. Position the slide so that the pointed narrow end of the root tip is clearly visible.
3. Look for a cluster of rapidly growing cells near this region.
4. Observe several different cells at various stages of cell division under the highest magnification of the microscope.
Results
Carefully choose one cell with a clearly outlined cell wall and showing chromosomes in a certain stage of cell division. Sketch a copy of what you observed, labelling the cell wall and the chromosomes. Remember to use a sharp pencil and to document the magnification the sketch is taken at.
Data processing
1. The mitotic index is a quantitative expression of the amount of cell division that a particular tissue is undergoing. It is the ratio of the number of cells undergoing mitosis to the number of cells that are not undergoing mitosis. It can be calculated using the following equation:
Mitotic index = number of cells in the field of view undergoing division total number of cells in the field of view
Calculate the mitotic index for the tissue sample you have observed in your microscope.
2. Using the field of view in your microscope, complete the table and calculate the percentage of cells in each cell cycle stage.
Cell cycle stage Number of cells in that stage Percentage of cells in that stage
Interphase
Prophase
Metaphase
Anaphase
Telophase
Total
3. Use the calculated percentages to predict which cell cycle stage is the longest and which is the shortest in your sample of cells. Explain your answer.
Discussion
1. Explain how you could tell which cells were dividing.
2. Describe the main features of each stage of cell division. Could you use these to identify the stage of mitosis for a particular cell?
3. List the structures in the cells you could observe. Which structures were present that you could not observe? Why might this be the case?
reduction division cell division which results in a reduction of genetic material in the daughter cells homologous chromosomes a matching pair of chromosomes, with one having been inherited from each parent; they have the same gene sequence and loci, length and centromere position crossing over the exchange of genetic material between homologous chromosomes during meiosis, leading to genetic diversity in gametes
Meiosis
Meiosis is the process by which animals and plants produce gametes for sexual reproduction. It starts with a diploid (2n) parent cell, which contains two sets of chromosomes—one from each parent. To ensure that offspring receive the correct number of chromosomes, meiosis reduces the chromosome number by half, producing four haploid (n) daughter cells (gametes). This reduction in genetic material is why meiosis is called a reduction division.
Meiosis occurs in two stages: meiosis I and meiosis II. Meiosis I separates homologous chromosome pairs, reducing the chromosome number from diploid to haploid. Meiosis II then divides the sister chromatids of each chromosome, similar to mitosis, ensuring that each gamete has a complete set of single chromosomes. These two divisions are essential for maintaining chromosome number across generations and increasing genetic diversity.
Meiosis I
UNCORRECTEDSAMPLEPAGES
Interphase 2n (before meiosis)
Prophase I
Metaphase I
Replication
• Parent cell is diploid (2n).
• DNA replication occurs.
• Chromosomes are not visible.
• The cell gets bigger.
• Organelles replicate.
• The nuclear membrane breaks down, the DNA condenses and chromosomes become visible.
• Homologous chromosomes pair up and crossing over can occur.
• Homologous chromosomes align at the equator.
Anaphase I
Telophase I
Cytokinesis (after meiosis I)
• Paired homologous chromosomes separate from each other and are pulled to opposite ends of the cell by the spindle fibres.
• The cell membrane pinches in.
• The nuclear membranes re-form.
• Two separate nuclei form.
• Division of cytoplasm starts.
• The cell pinches completely into two haploid (n) daughter cells.
Meiosis II
Prophase II
• Nuclear membranes disappear.
• Spindle fibres re-form in both cells.
Metaphase II
Anaphase II
Telophase II
Cytokinesis
4 × n (after meiosis II)
variation
Crossing over can occur in prophase I of meiosis I when homologous chromosomes get so close together that some of their genetic material gets exchanged. It results in the chromosomes recombining to form a new combination of alleles, increasing the diversity of a species and therefore increasing the ability to respond to changing environments over time. This is how meiosis can increase genetic variation.
• Chromosomes line up at the equator.
• The chromosomes are pulled apart, separating the sister chromatids, which are pulled to opposite sides of the cell.
• The spindle fibres disappear.
• The nuclear membrane re-forms.
• The chromosomes start to become less visible.
• Division of cytoplasm starts.
• The cells produce four genetically different haploid daughter cells (n), each containing half the amount of DNA that was in the parent cell.
allele different form of the same gene recombination the rearrangement of genetic material, especially by crossing over
Table 2.4 (continued)
Figure 2.19 Recombination occurs when homologous chromosomes undergo crossing over in prophase I.
fertilisation the fusion of male and female gametes to form a zygote stem cells undifferentiated cells with the ability to develop into various specialised cell types
fertilisation
In humans, fertilisation occurs when two haploid gametes fuse to form a diploid zygote. For fertilisation to occur, the sperm must complete the acrosome reaction. The acrosome is a structure, located in the head of the sperm, that is filled with enzymes. These enzymes are released to digest their way through the corona radiata and zona pellucida, the outer layers of the ovum. Once the sperm penetrate these layers, the cell membranes of one of the sperm cells and the ovum fuse together, and the sperm nucleus can enter the ovum. The fusing of cell membranes also triggers a reaction that causes the zona pellucida to harden. This is called the cortical reaction, and ensures that only one sperm fertilises the egg, preventing polyspermy, which would lead to an abnormal number of chromosomes and non-viable embryos.
Stem cells
The zygote will develop into an embryo, which initially consists of stem cells. These cells are undifferentiated and have the potential to become any cell type if removed from the embryo. As the embryo grows, the stem cells can differentiate into specialised cells that form various tissues and organs. These embryonic stem cells, derived from early embryos, can differentiate into a wide range of cell types but are challenging to obtain.
In contrast, adult stem cells, found in specific body tissues like bone marrow and skin, have a more limited differentiation potential but are more accessible. Stem cells hold significant promise for medical treatments, including replacing damaged cells in conditions like type 1 diabetes and spinal cord injuries.
Explore! 2.4
HeLa cells
HeLa cells are a line of human cancer stem cells that have been widely used in scientific research since their discovery in 1951. These cells originated from a tissue sample taken from Henrietta Lacks, an African–American woman diagnosed with cervical cancer. Without her knowledge or consent, cells from her tumour were cultured and found to have the ability to survive and proliferate indefinitely.
Find some reliable sources online to complete the following:
1. Investigate the history of HeLa cells, including the story of Henrietta Lacks and the ethical controversies surrounding the use of her cells without consent.
2. Explore various genetic technologies that utilise HeLa cells, such as cancer research, drug development and vaccine production.
3. Choose an ethical framework to guide your analysis (e.g. utilitarianism, deontology, virtue ethics, rights-based, care-based).
UNCORRECTEDSAMPLEPAGES
anniversary
4. Reflect on the ethical concerns related to consent, ownership and the use of biological materials.
5. Construct a well-organised written argument that incorporates evidence from your research.
6. Clearly outline your chosen ethical framework and how it applies to the use of HeLa cells.
7. Discuss the ethical implications of continuing to use HeLa cells in genetic research, considering both the benefits and the controversies.
Figure 2.20 A statue of Henrietta Lacks in Bristol, England, created by artist Helen Wilson-Roe. The statue was unveiled on the 70th
of Lacks’ death.
Figure 2.21 Once a sperm fertilises the egg, the nuclei of the sperm and the egg fuse.
UNCORRECTEDSAMPLEPAGES
1. Copy the table below and define the terms.
Term
Meiosis
Fertilisation
Zygote
Haploid
Diploid
2. Identify the missing words in the following sentence.
Definition
Male gametes are called ______________, whereas female gametes are called ______________.
Corona radiata
Zona pellucida
Figure 2.22 A human ovum
Sperm nucleus
Corona radiata
Egg nucleus
Zygote nucleus
Zona pellucida
Quick check 2.9
types of twins
You, or someone you know, might have a twin sister or brother. There are two main types of twins: identical (monozygotic) and fraternal (dizygotic). However, there is another, very rare form of twins known as semi-identical (sesquizygotic). Only two cases have ever been recorded, one in the US and one in South East Queensland. Conduct some research and answer the following questions:
1. Describe how monozygotic and dizygotic twins are for med.
2. Draw a diagram to show how these different types of twins are formed.
3. Discuss why sesquizygotic twins are so rare.
Meiosis versus mitosis
Although the processes of meiosis and mitosis have similarities, there are some differences:
• In meiosis, chromosomes recombine by crossing over, producing chromosomes with new combinations of genes. In mitosis, chromosomes are replicated to make identical copies of themselves.
• Meiosis involves two divisions that produce four haploid (n) daughter cells containing unique genetic material that is different to the parent cells. Mitosis involves one division that produces two diploid (2n) daughter cells with genetic material identical to the parent cell.
Parent cell (2n) (before chromosome replication)
UNCORRECTEDSAMPLEPAGES
Figure 2.23 A summary of the processes of mitosis and meiosis Explore! 2.5
Meiosis Mitosis
Meiosis I
Meiosis II
Karyotypes
The number of chromosomes varies between species, but in diploid organisms, chromosomes in body cells are always present in pairs. For example, humans have a total of 46 chromosomes, consisting of 22 pairs of homologous chromosomes and one pair of sex chromosomes in the nucleus of each body cell. However, gametes contain only 23 chromosomes – 22 autosomes and one sex chromosome – ensuring that the correct chromosome number is restored during fertilisation.
Homologous chromosomes are present in body cells because we receive one from each parent. Homologous chromosomes have the same length, centromere position and gene band patterns and can be displayed in a karyotype (Figure 2.24). Chromosomes that do not match (chromosomes from different pairs) are called non-homologous chromosomes
Figure 2.24 The homologous chromosomes seen under a microscope (left) can be arranged according to size in a karyotype (right). Pairs 1–22 are autosomes, while pair 23 is the sex chromosomes. The presence of two X chromosomes indicates this is a karyotype from a female.
UNCORRECTEDSAMPLEPAGES
karyotype the chromosomes of an individual, often displayed according to size and gene band patterns non-homologous chromosomes chromosomes that do not belong to the same pair autosome any chromosome that is not a sex chromosome. In humans, these are chromosome pairs 1 to 22
sex chromosomes chromosomes that determine the sex of an organism
Autosomes
Of the 23 pairs of chromosomes in humans, pairs 1 to 22 are known as autosomes. These 44 chromosomes are found in both males and females.
Sex chromosomes
Figure 2.25 If an egg is fertilised by a sperm carrying an X chromosome, the child will be female. If an egg is fertilised by a sperm carrying a Y chromosome, the child will be male. Therefore, it is the male’s sperm that determines the sex of the child.
In humans, the chromosomes making up the 23rd pair are the sex chromosomes. They contain genes that determine the sex of the individual. Females receive two X chromosomes (one from each parent), whereas males receive an X chromosome from the mother and a Y chromosome from the father (Figure 2.25).
What are the chances?
Aim
To investigate the chances of conceiving a male or female at fertilisation.
Useful formulas
Theoretical probability (%) = × 100 number of a particular outcome (e.g. heads) total number of all possible outcomes (e.g. heads and tails)
Experimental probability (%) = × 100 number of a particular outcome (e.g. heads)
total number of all experimental trials (e.g. heads and tails)
Percentage error (%) = × 100 (experimental probability − theoretical probability) theoretical probability
Materials
• one coin
Method
1. Copy the results table into your science journal.
2. Calculate the theoretical probability of landing heads during a toss.
3. You will now calculate the experimental probability of your own experiment by tossing the coin 50 times, recording the number of heads and tails in the table.
Results
1. Calculate the experimental probability of receiving a head and a tail based on both the experimental data for your own and the class results.
2. Calculate the percentage error, comparing the difference between the theoretical and experimental probabilities for both your own data and the class data.
3. Optional: Graph the relationships between the number of trials and percentage error.
Individual results
Class results
UNCORRECTEDSAMPLEPAGES
Number of heads
Number of tails
Total number of trials (throws)
Experimental probability
Percentage error
Discussion
1. Compare the experimental probabilities of your own and the class results.
2. If a head represents the Y chromosome and a tail represents the X chromosome, explain how accurately this models the process of fertilisation. What would the coin represent?
3. Make a claim about the chances of conceiving a male or female based on this activity.
4. Discuss whether increasing the number of trials affects the percentage error of the experiment.
Did you know? 2.4
Sex chromosomes in the animal kingdom
In some animals, such as birds, females have two different sex chromosomes (ZW) while males have two of the same (ZZ). In some reptiles, the temperature of the incubating environment determines the sex of the embryo. In some insects, females are XX and males have one X chromosome (written XO).
Monotremes have a complex sex chromosome system. Female platypuses have five pairs of X chromosomes and males five X and five Y chromosomes. Female echidnas have five pairs of X chromosomes and males five X and four Y chromosomes.
Try this 2.3
UNCORRECTEDSAMPLEPAGES
Can you sort chromosomes into a karyotype? Go online and find a karyotype activity. There are many interactives that allow you to sort chromosomes into order and ones that allow you to analyse karyotypes.
Science inquiry 2.1
Genetic testing
When a person is pregnant, their doctor may conduct several tests to screen for genetic and chromosomal abnormalities in the foetus. Creating a karyotype lets the doctor check for abnormalities in the number or length of chromosomes. If anything appears abnormal, the doctor can undertake further genetic tests to check for specific disorders. One such test is chromosomal microarray (CMA) testing, which is much more detailed genetic testing than karyotyping. Chromosomal microarray testing detects around one abnormality in every 70 foetal samples with a normal karyotype. Scientists think that CMA testing will replace karyotyping for prenatal testing.
2.27 A well-known chromosomal abnormality is trisomy 21 or Down syndrome, where the foetus has three copies (instead of two) of chromosome 21.
Figure 2.26 Female platypuses have five pairs of X chromosomes.
Figure
Genetic testing will identify carriers of genetic mutations and help people make informed decisions, such as in embryo selection. Genetic counsellors work with people who are concerned about having, or have been diagnosed with, a genetic condition.
Many people are also having genetic testing to discover more information about their ancestry or to connect with unknown relatives. Although it is against the law to be discriminated against because of genetic information, there is some concern regarding its use, either personally or by organisations such as insurance companies or medical facilities.
UNCORRECTEDSAMPLEPAGES
Have a class discussion regarding the ethical issues of non-therapeutic genetic testing performed by commercial companies. You may want to consider privacy concerns, the possible emotional impact, potential lack of medical knowledge and possible exploitation of vulnerable individuals.
Asexual reproduction
Asexual reproduction is a mode of reproduction in which a single parent produces offspring that are genetically identical to itself, meaning they are clones of the parent organism. Unlike sexual reproduction, which requires the combination of genetic material from two parents, asexual reproduction doesn’t involve gametes or fertilisation.
There are various forms of asexual reproduction, each suited to different organisms:
• Binary fission: Common in single-celled organisms like bacteria, where the cell divides into two, each becoming an identical organism.
• Budding: Seen in organisms like yeast and hydra, where a new individual grows off the parent organism and eventually detaches to live independently.
• Fragmentation: Certain animals, like starfish and some plants, can grow into a complete organism from a fragment of the parent body.
• Vegetative propagation: In plants, new individuals grow from stems, roots, or leaves. Examples include strawberry runners and potato tubers.
• Spore formation: Many fungi, algae and some plants reproduce through spores, small structures that develop into new organisms without fertilisation.
• Parthenogenesis: Found in some reptiles, insects, and fish, where an egg cell develops into a new organism without fertilisation, producing offspring genetically similar to the mother.
A key advantage of asexual reproduction is its efficiency; organisms can reproduce quickly and in stable environments, allowing populations to grow rapidly. However, because offspring are genetically identical to the parent, there is less genetic variation, which can make the population vulnerable to diseases and changing environmental conditions.
Quick check 2.10
1. Compare mitosis and meiosis using a Venn diagram.
2. Explain what karyotypes can show and why this is useful.
Section 2.2 review Online quiz
Section 2.2 questions
Remembering
1. State one key difference between mitosis and meiosis.
2. Recall the phase of meiosis when pairs of matching chromosomes separate.
3. State the name of the syndrome that arises from trisomy 21.
4. State what the term ‘homologous chromosomes’ means.
Understanding
5. Explain why gametes need to be haploid.
6. Explain what is meant by the term ‘reduction division’.
7. Explain why a chromosome missing a part may lead to a disorder or syndrome.
8. Explain why the cells produced during meiosis are genetically unique.
Applying
9. Complete the following table to differentiate between mitosis and meiosis.
Where it occursPurpose
UNCORRECTEDSAMPLEPAGES
Features of daughter cells
Mitosis
Meiosis
10. Contrast the daughter cells produced in mitosis versus meiosis.
11. Illustrate a diagram to represent the steps of mitosis for a cell with two pairs of chromosomes. Be sure to use a different colour for each pair of chromosomes.
Analysing
12. Contrast anaphase I in meiosis and anaphase in mitosis.
13. Contrast prophase I and prophase II in meiosis.
Evaluating
14. Critique the following claim: It is the male that determines the sex of the child.
15. Predict the chances of a woman giving birth to a girl if she has already given birth to three boys, giving reasons for your response.
2.3 Patterns of inheritance
Learning goals
At the end of this section, I will be able to:
1. Define the terms ‘homozygous’, ‘heterozygous’, ‘dominant’ and ‘recessive’ with respect to genetic inheritance.
2. Use and interpret Punnett squares to identify possible genotypes and phenotypes of offspring.
3. Use pedigree diagrams to deter mine the type of inheritance that is occurring.
4. Explain codominance, incomplete dominance and sex linkage.
Aboriginal and Torres Strait Islander communities have understood inheritance patterns for a long time. They recognise how traits can be passed down to the next generation and how negative traits and illnesses often appear in the children of closely related parents. Because of this deep knowledge, communities created complex and sophisticated kinship systems which allow individuals to understand who they are and how they fit into the social structure and even the universe. These kinship systems are strictly adhered to and dictate who can or cannot marry through marriage laws. Kinship and family structures also determine how individuals behave towards others and the responsibilities each person has towards others, natural resources and the land. For example, a person may be obliged to care for their sibling’s offspring. These children usually address their aunt or uncle as ‘mother’ or ‘father’ and their cousins as ‘brothers’ or ‘sisters’. Although they are aware of their biological parents, the societal (kinship) laws assign equal importance to other relatives. When conversing with one another, Aboriginal and Torres Strait Islander people usually speak Aboriginal English and frequently use the terms ‘brother’ or ‘sister’, which are derived from the kinship terminology and connections.
Inheriting traits from our parents
UNCORRECTEDSAMPLEPAGES
This cultural understanding of inheritance is reflected in modern genetics. Inheriting traits from our parents is now known to be governed by genes – specific sections of DNA passed from parent to offspring. Each characteristic or trait that we inherit is controlled by one or more pairs of genes. Members of each gene pair are found at the same location on their respective homologous chromosomes. This is called the locus of a gene.
Genes are sections of DNA that code for a particular protein that contributes to our characteristics, such as a gene for eye colour. However, not all forms of a gene are the same; for example, different people can have different eye colours. We use the term ‘allele’ to describe the different forms of a gene.
Figure 2.30 This artwork from Kakadu National Park shows Namondjok, a Creation ancestor who broke kinship laws.
We get one copy of each chromosome from each parent, resulting in us inheriting one copy of each gene from each parent. The combination of alleles an organism has for a particular gene is known as the organism’s genotype. If two identical alleles are present in a person’s genotype, they are known as homozygous for that particular trait. However, if there are two different alleles present for the same trait, then the person is heterozygous for that trait.
For example, consider the trait of freckles. This trait is controlled by a single gene that is represented using two alleles. The allele of the dominant trait is the presence of freckles (we assign it the capital letter ‘F’ to show it is dominant), and the allele for the recessive trait is the lack of freckles (assigned a lower case ‘f’ to show it represents the recessive trait). A trait or characteristic is described as dominant if you need only one allele for it to be expressed (FF or Ff). For a recessive characteristic, the allele needs to be inherited from both parents for it to be expressed (ff).
The genome refers to all the genetic material in the chromosomes of an organism, including its genes and DNA sequences. The human genome is made of approximately 3.2 billion nitrogenous base pairs, which make up about 20 000 genes on 23 pairs of chromosomes. Other organisms have different genome sizes. Surprisingly, only a small percentage of the genome, around 1-2%, contains genes that code for proteins; the vast majority of the genome is made up of non-coding DNA which does not directly code for proteins, although it can still play important roles in gene regulation and other cellular functions.
genotype the combination of alleles an organism has for a particular gene homozygous having two identical alleles at a particular gene locus heterozygous having two different alleles at a particular gene locus
dominant a characteristic in which the allele responsible is expressed in the phenotype, even in those with heterozygous genotypes recessive a characteristic in which the allele responsible is only expressed in the phenotype if there is no dominant allele present
genome the complete set of genetic material in an organism
Figure 2.32 The first publication of the human genome was printed as 109 books in 23 volumes. The around three billion units of human DNA code are printed in a small font, and each book is a thousand pages long.
Figure 2.31 Gene loci on homologous chromosomes
If you inherit the freckles allele from both parents, you are homozygous dominant for that trait and your genotype will be FF. If you inherit the no-freckles allele from both parents, you are homozygous recessive for that trait and your genotype will be ff. If you inherit a freckles allele from one parent and a no-freckles allele from the other parent, you are heterozygous for that trait and your genotype will be Ff.
UNCORRECTEDSAMPLEPAGES
The interaction of an organism’s genotype with the environment results in its phenotype, or its physical appearance. Typically, multiple genes and multiple environmental factors interact in the development of most traits. In the example in Figure 2.33, the presence of freckles is the person’s phenotype for that trait. The freckles are present due to the person’s genotype and their environmental exposure to UV light.
To determine whether an allele represents a trait that is dominant or recessive, scientists look at the phenotype of a heterozygous organism. If the trait is expressed in this phenotype, it must be the dominant trait.
check 2.11
1. Copy the table below and define the terms.
Term Definition
Locus
Allele
Genotype
Phenotype
Dominant
Recessive
Heterozygous
Homozygous dominant
Homozygous recessive
2. Explain why a genotype can indicate that a person will have freckles, but there are not many on their face.
Practical 2.4
Inherited features
Aim
To use data to determine whether some key characteristics are dominant or recessive traits.
Materials
• mirror
Optional extension: Collect infor mation from other students or family members for further validity analysis.
Method
Part 1: Prepare the results table
1. Copy the results table into your science journal.
Figure 2.33 The presence of freckles is an example of a dominant trait.
of an organism, resulting from both genotype and the environment Quick
Part 2: Collect data on the variables
1. Identify whether you possess each of the inheritable features described below.
2. Record your results in the table.
3. Find out how many members of your class share the same features as you do. Record your results in the table.
Optional: Find out how many members of your family display the traits.
a) Attached ear lobes: are your earlobes attached or unattached to the side of your head?
b) Widow’s peak: do you have a V-shaped peak in the centre of your hairline as shown in Figure 2.34?
c) Tongue roll: can you roll your tongue as shown in Figure 2.35?
d) Front tooth gap: is there a definite gap between your two top front teeth as shown in Figure 2.36?
e) Mid-digital hair: is there any hair on the second joint of at least one of your fingers?
f) Long second toe: is your second toe longer than your big toe as shown in Figure 2.37?
Results
1. Calculate the total number of people sampled in this survey.
2. Calculate the percentage presence of the trait in your family and within the class.
3. Draw an appropriate graph (or graphs) to compare the percentage presence of each trait within your family with the percentage presence in the whole class.
Attached ear lobes
Widow’s peak
Tongue roll
Dimples
Mid-digital hair
Long second toe
SAMPLEPAGES
Sample size (Total number of people surveyed) 1
Figure 2.34 This girl has a widow’s peak (V-shaped peak) in the centre of her hairline.
Figure 2.35 This woman is able to roll her tongue.
Figure 2.36 This man has an obvious gap between his top front teeth.
Figure 2.37 The second toe is longer than the big toe on this foot.
Discussion
1. Describe which traits were commonly found in your family.
2. Describe which traits were commonly found in the class.
3. Describe which traits were commonly found in the whole sample.
4. Do your findings support the idea that a feature such as tongue-rolling is inherited? Explain your answer.
UNCORRECTEDSAMPLEPAGES
5. Predict from the data which traits are likely to be recessive and dominant. Justify your answer with data.
6. If you repeated the survey on the same people, would you get a similar result? Support your answer relating back to the theory behind inheritance of traits.
7. Can reliable conclusions and predictions be drawn from the results?
8. Compare the values from your family with those from the class. Were there any significant differences with some traits? Justify your answer with data.
9. Compare the values from your family with results from several other student families. Were there any significant differences with some traits? Justify your answer with data.
10. Can you draw valid conclusions as to which traits are dominant and recessive from this data? Justify your response.
11. Sample size is a factor that commonly affects data in small surveys. Discuss how this relates to the activity.
12. Can you identify possible limitations of this method? Justify your answer.
13. Suggest any changes that could be made to the method to improve the quality of the data in future surveys. Justify your suggestions by explaining how each change will improve the data quality.
Determining chances of inheritance
Gregor Mendel
Gregor Mendel is known as the father of genetics. Born in 1822, he was an Austrian monk who carried out experiments in his garden using pea plants and discovered some of the fundamental laws of heredity we still rely on today.
Mendel looked at the features of pea plants, which could be tall or short (dwarf). He assigned the following letters to represent these alternative characteristics (known today as alleles): T = tall and t = dwarf. Mendel bred the plants and observed the height of the plants in the next generation. He discovered that tall pea plants could be either pure breeding (TT or homozygous dominant) or hybrid (Tt or heterozygous). The dwarf plants could only be tt (homozygous recessive). Today, we call this the plant’s genotype.
Mendel also used the following notation to represent different levels of generations:
• P = parent generation
• F1 = first filial generation (first generation of offspring)
• F2 = second filial generation (second generation of offspring).
An easy way to predict the outcome of monogenic traits is to use a Punnett square, a specialised grid invented by Reginald Punnett. A Punnett square is a visual representation of a monohybrid cross, which is a breeding experiment involving two individuals that differ in a trait of interest. In a monohybrid cross, the parents are typically represented by letters to denote their respective alleles for the trait being studied.
Figure 2.38 Gregor Johann Mendel was the founder of the science of genetics, using pea plants to show dominant and recessive traits. He produced large amounts of data which all supported his theory, but later statistical analysis suggests that he may have falsified his data – it was simply too good to be true! Large data sets and statistical analyses are vital for validating scientific findings.
To use a Punnett square, you need to know the genotype of the parents to work out what genetic information they could pass on to their offspring via the gametes. For example, we know a heterozygous, tall pea plant has the genotype Tt. This means that when the plant makes its gametes, they could contain either a T or a t, as gametes only carry one of the alleles from the parent. In contrast, a homozygous tall pea plant has the genotype TT, so its gametes will all contain a T.
Worked example 2.1
Cross between a pure-breeding tall plant and a pure-breeding dwarf plant
Parents: TT × tt
You will notice that all the predicted F1 offspring (shaded) have the genotype Tt. We can write this as:
F1 genotype: 100% Tt
We can also see that offspring with Tt would all physically appear tall, as T stands for the tall allele which is dominant over the dwarf allele (t). So, we can write this as:
F1 phenotype: 100% tall plants
Worked example 2.2
Cross between two of the hybrid f1 plants from Worked example 2.1 F1: Tt × Tt
monogenic a trait that is controlled by a single gene
Punnett square a specialised grid to show genetic crosses
UNCORRECTEDSAMPLEPAGES
F2 genotype: 25% TT; 50% Tt; 25% tt
F2 phenotype: 75% tall plants; 25% dwarf plants
We can also write the predicted outcomes as ratios. In this case, when two heterozygous tall pea plants were crossed, there was a genotypic ratio of 1TT : 2Tt : 1tt and a phenotypic ratio of 3 tall : 1 dwarf.
monohybrid cross a type of genetic cross or breeding experiment that considers the inheritance of a single trait or characteristic, typically controlled by a single gene with two alleles
Choosing letters for genetic notation
When selecting letters to represent alleles, it is important to choose ones that are easily distinguishable in both uppercase and lowercase forms. Avoid letters that look similar in both cases, as this can cause confusion when reading genotypes.
Letters to avoid using include c, s, w, o, v and x.
Huntington’s disease
Huntington’s disease is inherited as a dominant trait on an autosome. It usually appears in an affected person as neurological symptoms that develop around 30–50 years of age resulting from an abnormal protein being made. The HH genotype is lethal because it disrupts early embryonic development, preventing survival to birth. This means that all living individuals affected by Huntington's disease will be heterozygous (Hh).
If we let H = abnormal Huntington’s protein allele (Huntington’s disease) and h = ‘normal’ protein allele (unaffected), then we can use these notations to help work out probable outcomes in the offspring.
Worked example 2.3
Cross between two individuals unaffected by Huntington’s disease
Parents: hh × hh
UNCORRECTED
F1 genotype: 100% hh
F1 phenotype: 100% unaffected
Worked example 2.4
Cross between an individual with Huntington’s disease and an unaffected individual
Parents: Hh × hh (Someone with two H alleles will not survive to birth so the individual with Huntington’s disease must be Hh). gametes
F1 genotype: 50% Hh; 50% hh
F1 phenotype: 50% with Huntington’s disease; 50% unaffected
Try this 2.4
Punnett squares
SAMPLEPAGES
1. A black mouse mates with a brown mouse. There is a large number of offspring and all of them are black.
a) Which trait is dominant?
b) Draw a Punnett square and determine the genotypes of the offspring.
2. A recessive gene causes a condition called cystic fibrosis. If a homozygous recessive individual has a child with a heterozygous individual, what are their chances of producing offspring with cystic fibrosis?
Quick check 2.12
1. Contrast genotype and phenotype.
2. Brown eyes are dominant over blue eyes.
a) Select letters for the brown eye and blue eye alleles.
b) Create a Punnett square for a couple who are both heterozygous.
c) State the genotypic and phenotypic ratios of the offspring.
d) State the chances of this couple producing a blue-eyed child.
Test cross
A test cross can be used to discover whether an organism showing a dominant trait is homozygous dominant or heterozygous. It involves observing the offspring of the individual in question if it mates with a homozygous recessive individual (for example, aa). This means the individual of unknown genotype mates with an individual of known genotype. By looking at the offspring ratio, we can deduce the unknown genotype of the individual in question.
For example, in guinea pigs, coat colour may be black (B) or white (b). You can find out if a black guinea pig is homozygous black (BB) or heterozygous black (Bb) by doing a test cross between the black guinea pig and a white guinea pig (bb).
If the unknown black guinea pig is BB, the cross would look like this:
Parents: BB × bb
UNCORRECTEDSAMPLEPAGES
F1 genotype: 100% Bb
F1 phenotype: 100% black
This means if all the offspring are black, the unknown black guinea pig is probably BB (or homozygous dominant).
If the unknown black guinea pig is Bb, the cross would look like this:
Parents: Bb × bb
F1 genotype: 50% Bb; 50% bb
F1 phenotype: 50% black; 50% white
This means if roughly half the offspring are black and half are white, the unknown black guinea pig is probably Bb (or heterozygous). Note that these expectations are only true when based on large numbers of offspring because they are probabilities. However, if even one white offspring is born, the black guinea pig must be heterozygous in order to have passed on a recessive b gene.
test cross a genetic cross between a homozygous recessive individual and an individual of unknown genotype showing the dominant trait to determine the unknown genotype
Worked example 2.5
Determining the genotype of a dominant parent
A breeder is investigating the inheritance of a dominant trait in rabbits, controlled by a single gene. The allele for black fur (B) is dominant over the allele for white fur (b). The breeder crosses a black-furred rabbit with a white-furred rabbit and records the following offspring:
Fur colourNumber of offspring
Black 24
White 26
Based on this data, determine whether the black-furred parent is homozygous dominant (BB) or heterozygous (Bb).
Step 1: Predict offspring ratios
If the parent is homozygous dominant (BB):
Cross: BB × bb
UNCORRECTEDSAMPLEPAGES
F1 phenotype: 100% black-furred
If the parent is heterozygous (Bb):
Cross: Bb × bb
F1 phenotype: 50% black-furred; 50% white-furred
Since the white-furred trait is recessive, we already know that the white-furred parent is homozygous (bb). If the blackfurred parent is homozygous dominant (BB), all offspring would inherit one B allele, making them 100% black-furred (Bb).
If the black-furred parent is heterozygous (Bb), offspring would be in a 1:1 ratio of black-furred (Bb) to white-furred (bb).
This is very close to a 1:1 ratio, which matches the expected outcome of a heterozygous (Bb) × homozygous recessive (bb) cross. Since a homozygous dominant (BB) parent would not produce whitefurred offspring, the data strongly suggests that the black-furred parent is heterozygous (Bb).
Quick check 2.13
1. Explain the importance of a test cross.
2. Silky feathers in a bird species are caused by a gene with a trait recessive to normal feathers. If you had a normal-feathered bird, describe a way to determine whether it is heterozygous or homozygous. Use Punnett squares to help with your answer.
Try this 2.5
Positive or negative
One vital gene located on chromosome 1 in humans is the gene controlling for Rhesus (Rh) blood type. Rh positive blood is dominant to Rh negative blood, so we can assign the alleles D (Rh positive) and d (Rh negative). Therefore, an Rh positive person can be either DD or Dd with respect to this gene, but an Rh negative blood type can only be homozygous, dd.
Instructions
In this activity, we will use coloured counters and felt-tipped pens to model the passing of Rh alleles from heterozygous individuals to their offspring.
1. Copy the results table into your science journal.
2. Choose one coloured counter. Print D on one side and d on the other to represent the alleles of the chromosomes. This counter represents an individual who is Dd for Rh blood type, that is, able to produce gametes (eggs or sperm) of the type D and d in equal proportions.
3. Find a partner in the room with a different coloured counter.
4. Make an unbiased toss of your two counters to produce an offspring. The labels facing up on the counters will represent the alleles of the gametes produced by the parents. Record the genotype of the offspring in the Family 1 row of the following table. Repeat this step three more times to produce a total of four children.
5. Generate a total of four families (by pairing up with three different students) with each having produced four children.
6. Record the number of each type of genotype found in the children of each family in the table following table. Pool your total results with those of the class.
Results
UNCORRECTEDSAMPLEPAGES
Genotype of children
Family 1
Family 2
Family 3
Family 4
Total numbers across the class
Analysing
1. Using the class data, calculate the probability of obtaining the offspring genotypes: a) DD
b) Dd
c) dd
2. What are the proportions of the different genotypes in your group of 16 children compared to those generated across the whole class? Discuss whether this is expected.
3. A woman with Rh positive blood insisted that she was the daughter of a rich, elderly couple who both had Rh negative blood. Use a Punnett square to show your working out to explain whether this woman’s statement could be valid.
carrier an individual with a recessive allele for a disease but who does not have the disease due to being heterozygous
Multifactorial inheritance
Most traits in organisms are shaped through interactions between multiple genes and a range of environmental factors. This concept, known as multifactorial inheritance, recognises that genes don’t work in isolation. Instead, different genes may each contribute small effects that, combined, influence traits like height, skin colour, and even the risk of developing certain diseases. These genetic contributions are then influenced by various environmental factors – such as diet, lifestyle, climate and exposure to toxins – which can further modify trait expression.
For example, height is determined by numerous genes that each play a role in growth, bone structure, and metabolism. However, factors like nutrition during childhood and adolescent development also significantly impact height, showing that genes set a potential range, while the environment helps determine where an individual falls within that range.
Sex linkage
As we have seen, in humans the sex chromosomes are the 23rd pair. Human females are homogametic for the X chromosome while males are heterogametic with one X and one Y chromosome.
The X chromosome also contains many genes not related to sex determination (in contrast, the Y chromosome has very few). Characteristics that are not related to determining the sex of the individual but are coded for by X chromosome genes are termed X-linked. When we predict X-linked traits using a Punnett square, we must use the sex chromosomes and superscripted letters above the X chromosomes to represent the trait.
UNCORRECTEDSAMPLEPAGES
For example, Duchenne muscular dystrophy (DMD), a disorder where the muscles progressively degenerate, is inherited as an X-linked recessive trait. The genotype for an unaffected female would be XDXD, a carrier female (who has a recessive allele for the disease but is heterozygous so does not have the disease) would be XDXd, and a female with DMD would be XdXd. On the other hand, an unaffected male would be XDY and a male with DMD would be XdY. As there is no gene for this condition found on the Y chromosome, we do not write D or d next to the Y. Because males have only a single copy of the X chromosome, they are more likely to be affected by sex-linked disorders. A single allele of a mutated gene on an X chromosome will cause the disease in a male but not in a female (who would need two DMD alleles to be affected).
Figure 2.39 In Duchenne muscular dystrophy, muscle fibres (red) are replaced by fat cells (white).
Worked example 2.6
Cross between a heterozygous normal-vision female (carrier) and a normal-vision male
Colour blindness is inherited as an X-linked recessive trait. The genotype of a heterozygous normal-vision (carrier) female is XBXb and of a colour-blind male is XbY.
Parents: XBXb × XBY
UNCORRECTEDSAMPLEPAGES
F1 genotype: 25% XBXB; 25% XBY; 25% XBXb; 25% XbY
F1 phenotype: 25% normal-vision female; 25% normal-vision male; 25% carrier normal-vision female; 25% colour-blind male
Try this 2.6
Sex-linked inheritance
Now it is your turn to practise. Remember that the gametes need to include the sex chromosomes, and the genotype and phenotype both need to include the sex chromosomes as well.
1. Using a Punnett square, cross a normal-vision female (homozygote) with a colour-blind male.
2. Using a Punnett square, cross a colour-blind female with a normal-vision male.
3. Explain why more males than females have colour blindness.
Codominance
When there are two equally dominant alleles for a trait, they will both be expressed in the phenotype of a heterozygote. This is codominance. Look at the picture of the chickens in Figure 2.40. The colours black and white are equally dominant (their alleles are given two different capital letters), so when you cross a pure black chicken with a pure white chicken, you get a heterozygote. In the heterozygote, both colours are expressed equally, so you get a speckled chicken with black feathers and white feathers!
VIDEO An example of codominance
codominance both alleles are expressed equally in the phenotype
Figure 2.40 White and black are equally dominant alleles and are said to be codominant. The evidence of this is their heterozygote offspring that has a mix of black and white feathers.
Blood types
In humans, our blood type is a codominant trait. Our red blood cells have proteins on the surface called antigens, and these determine whether our blood is A, B, AB or O. The I gene is often used in genetic notation for the ABO system. The I stands for the isoagglutinogen gene, which determines the presence of blood group antigens.
Each person has two copies of the isoagglutinogen gene, one from their mother and one from their father. This gene is found on chromosome 9, and there are three possible alleles:
• IA = production of antigen A (type A blood) is dominant.
• IB = production of antigen B (type B blood) is dominant.
• i = production of neither antigen (type O blood) is recessive.
As we have two copies of chromosome 9, there can be six different allele combinations:
• Type A blood can have genotypes IA IA or IA i.
• Type B blood can have genotypes IB IB or IB i.
• Type AB blood can only have the genotype IA IB.
• Type O blood can only have the genotype ii.
IA an IB are both dominant over i, but are codominant to each other.
Worked example 2.7
Cross between heterozygous blood type A and heterozygous blood type B
Parents: IAi × IBi
UNCORRECTEDSAMPLEPAGES
dominance a form of inheritance in which both alleles are partially expressed, producing a third intermediate phenotype
F1 genotype: 25% IA IB; 25% IB i; 25% IA i; 25% ii
F1 phenotype: 25% AB blood type; 25% B blood type; 25% A blood type; 25% O blood type
Explore! 2.6
Incomplete dominance
Incomplete dominance occurs when neither of the alleles is dominant over the other, resulting in a third phenotype which is an intermediate form of both alleles. Wavy hair is an example of incomplete dominance. A person with two curly hair alleles (CC) will have curly hair. A person with two straight hair alleles (SS) will have straight hair. However, a person with one curly and one straight allele (CS) will have wavy hair. To distinguish between different versions of the
Figure 2.41 Illustration of the different antigens on the surface of red blood cells
same gene, alleles are often written with the same letter but in superscript. For example, HCHC could represent two curly hair alleles, and HSHS could represent two straight hair alleles. In this way, HCHS would indicate the heterozygous condition, resulting in wavy hair as an intermediate phenotype.
1. The flower colour of snapdragons is an example of incomplete dominance. Draw an example of a cross for a white flower (CWCW) and a red flower (CRCR).
2. Eggplant colour is another example of incomplete dominance. Explain how the three colours of eggplant shown in Figure 2.43 are possible.
Quick check 2.14
1. Explain why males are more likely to be affected by recessive X-linked disorders than are females.
2. Describe codominance.
Pedigrees
One way of finding out how a trait is inherited is to follow the inheritance pattern over two or more generations. This technique is called pedigree analysis. To study patterns of inheritance in humans, geneticists investigate the frequency and occurrence of a particular gene over many generations to determine whether the traits are dominant or recessive. The chart formed is called a pedigree and it is like a family tree.
Each generation is numbered in Roman numerals and forms a row on the pedigree. Individuals are numbered using Arabic numerals (1, 2, 3 etc.) from left to right on each row. The symbols used are:
• Unaffected
•
•
•
•
• Mating is represented by a horizontal line
• A vertical line connects offspring to parents
WORKSHEET Pedigrees
pedigree a chart that shows relationships between family members and indicates which individuals have certain genetic traits
Figure 2.42 Wavy hair is an example of incomplete dominance.
Figure 2.43 Deep purple (left), violet (middle) and light green (right) eggplants
Reading a pedigree
There are some points to keep in mind when reading a pedigree and determining inheritance:
• A trait that is common in a population is not necessarily dominant.
• When asked to determine a genotype in a pedigree, you will need to establish the mode of inheritance. You can use Punnett squares to help you.
Mode of inheritance Pedigree chart
Autosomal recessive
Autosomal dominant
X-linked recessive
Figure 2.44 An example of a pedigree showing three generations of a family. Individuals affected by a particular trait are shown in black. Note how male I-1 and female I-2 had three children, and their eldest is an unaffected female (II-2).
What to look for Examples
Two unaffected parents can have an affected child.
Males and females are equally affected. The trait may disappear from a branch of pedigree and then reappear in later generations.
Two affected recessive parents must have all affected recessive children.
Two affected parents can have an unaffected child.
Males and females can be equally affected, yet all of the affected individuals must have at least one parent affected.
Affected mothers produce affected sons. Affected fathers cannot pass the trait to their sons.
Albinism, cystic fibrosis, sickle cell anaemia and thalassaemia
X-linked dominant
UNCORRECTEDSAMPLEPAGES
Affected fathers produce daughters that are all affected.
Affected fathers cannot pass the trait to their sons, but affected homozygous females will pass the trait on to all of their daughters and sons.
Huntington’s disease and haemochromatosis
Colour blindness, haemophilia and Duchenne muscular dystrophy
X-linked hypophosphatemic rickets Table 2.5
Did you know? 2.7
famous people have genetic disorders too!
Megan Fox has a condition called brachydactyly. This is an autosomal dominant condition that causes shortened fingers or toes. Jessie J has Wolff–Parkinson–White Syndrome, an autosomal dominant condition that causes a very fast heart rate.
1. Study the pedigree chart in Figure 2.46. It illustrates the inheritance of achondroplasia (dwarfism) in humans.
UNCORRECTEDSAMPLEPAGES
Figure 2.46 Pedigree chart
a) Identify a piece of evidence that suggests that this condition is recessive and not dominant.
b) Identify the genotype of individuals I-1, I-2, II-1 and II-2.
c) Suppose individual II-2 has children with a man who does not have achondroplasia but is a carrier for the condition. Determine the chance of having a child with achondroplasia and the chance of having a child without achondroplasia. Use a Punnett square to show how you arrived at your answer.
Figure 2.45 Megan Fox and Jessie J both have genetic disorders.
Section 2.3 review
Section 2.3 questions
Remembering
1. State how many copies of each gene we have and where they come from.
2. Recall the name of the person known for being the father of genetics.
3. Name an example of codominance and of incomplete dominance.
Understanding
4. Describe what pedigrees are useful for.
5. Explain how sex linkage is different from other types of inheritance.
6. Explain why, for a particular characteristic, two homozygous recessive individuals can only produce homozygous recessive children.
7. Explain what is meant by the term ‘carrier’.
8. Explain why a test cross is useful.
Applying
9. Dimples are dominant to no dimples.
a) Select appropriate letters for these alleles.
b) Identify the genotype and phenotype of a person who is:
i) homozygous recessive for dimples
ii) heterozygous for dimples
iii) homozygous dominant for dimples.
Analysing
10. The pedigree chart in Figure 2.47 shows the inheritance pattern of a disease that is caused by a single gene.
a) Identify the sex of the person labelled II-5.
b) State whether the disease is dominant or recessive, giving reasons for your answer.
c) State the genotype of individual II-5, giving reasons for your response.
Figure 2.47 Pedigree chart
11. Contrast codominance and incomplete dominance.
12. The pedigree chart in Figure 2.48 shows the inheritance patterns for haemophilia. Haemophilia is an X-linked recessive disorder.
Use evidence from the pedigree to justify that haemophilia is recessive.
UNCORRECTEDSAMPLEPAGES
2.48 A haemophilia pedigree
Evaluating
13. In fruit flies, eye colour is sex linked. The eye colour allele is located on the X chromosome. The red eye allele is dominant over the white eye allele.
a) Select appropriate letters for the alleles.
b) Using a Punnett diagram, determine the offspring a male heterozygous fly that mates with a female homozygous recessive fly will produce.
c) Decide the genotypic and phenotypic ratios of the offspring.
14. In mice, black hair is dominant to brown hair. Mice with black hair can be either homozygous or heterozygous.
Propose how you would find out if a mouse with black hair was homozygous or heterozygous. Support your response with a Punnett square.
15. A brown-eyed male and a blue-eyed female produced all blue-eyed children. Discuss whether that means blue eyes is the dominant trait.
Figure
WORKSHEET
Changes in DNA point mutation a mutation in which a single nucleotide is changed chromosome mutation a mutation involving large segments of DNA spontaneous mutation a naturally occurring mutation induced mutation a mutation produced by environmental factors
mutagenic causing mutations in DNA
germline mutation a mutation of DNA in gametes which can be inherited
somatic mutation a mutation that occurs in somatic (body) cells which cannot be inherited
2.4 Changes in DNA
Learning goals
At the end of this section, I will be able to:
UNCORRECTEDSAMPLEPAGES
1. Distinguish germline and somatic mutations.
2. Recall types of point and chromosome mutations.
3. Explore the applications of DNA manipulation.
Sometimes, the process of DNA replication makes errors, which cause changes to the genetic code. Often these errors are repaired, but when they are not, they become permanent changes in the genome of the cell. This is known as a mutation. Mutations may be small, such as a change in a single nucleotide (point mutation), or large, involving entire segments of DNA within a chromosome (chromosome mutation). Mutation is the only way that new alleles can be created within a population.
A mutation can be described as spontaneous (naturally occurring) or induced. Induced mutations are caused by exposure to mutagenic agents in the environment like radiation (X-rays, ultraviolet rays or nuclear radiation) or chemicals. Mutations that occur within the gametes are called germline mutations. These can be inherited and will influence the next generation. Mutations that occur within somatic cells will only affect the individual and will not be passed down to future generations. This form of mutation is known as a somatic mutation
Explore! 2.7
Mutagens
Many factors in the environment are known as ‘mutagens’ – that is, they cause mutations.
1. Research some environmental mutagens.
2. From the list created in Question 1, divide your mutagens into categories according to their source, such as chemical mutagens and radiation.
Figure 2.49 Melanoma is linked to UV light exposure as well as gene changes. A mole may be a sign of skin cancer if it has irregular borders, an asymmetrical shape or if it changes in colour, shape, size or height.
the Black Death left a genetic mark
Many individuals with European ancestry carry genetic mutations that protected their ancestors from the bubonic plague, a disease caused by Yersinia pestis, a species of bacterium spread by fleas. When plague struck Europe in 1348 and again in 1665, millions of people died. However, some people had mutations that made them more likely to survive.
By examining the DNA of people who died before, during and after the Black Death, researchers have found that carrying two copies of a mutated ERAP2 gene improved a person’s survival by 40%. The allele codes for a protein that is involved in the immune response, and the mutation produced a heightened response. This meant that the survivors of bubonic plague passed on this beneficial trait to their offspring. However, this mutation is also problematic. Individuals who carry the mutated ERAP2 gene are at an increased risk of autoimmune diseases.
A small mass burial pit of plague victims excavated in East Smithfield, London. The significant number of deaths during plague outbreaks resulted in many similar mass burials across Europe.
Beneficial, harmful, and neutral mutations
Mutations have three possible consequences:
• No effect – neutral. Neutral mutations are non-lethal and make no difference to the organism’s ability to survive and reproduce in its environment.
• Negative effect – harmful. Harmful mutations produce proteins that malfunction or cause proteins not to be produced at all. They can cause genetic disorders or cancer and result in organisms that are less likely to survive, reducing the likelihood that the genetic material will be passed on to the next generation.
• Positive effect – beneficial. Beneficial or advantageous mutations give rise to new versions of proteins that increase the chance that the organism will survive and reproduce to pass its genetic material to the next generation. Beneficial mutations increase genetic variation in a population and are essential for evolution to occur.
UNCORRECTEDSAMPLEPAGES
1. If a mutation is to be passed on to the next generation, recall where it must occur.
2. Summarise the possible effects of mutations that occur in somatic cells.
Gene
mutations
Gene mutations refer to changes in the DNA sequence that makes up a gene. This involves changes to any of the four nitrogenous bases in the nucleotides that make up the genes. There are several types of gene mutations, including point mutations, insertions, deletions and inversions.
Figure 2.50
Quick check 2.16
substitution where one nucleotide is swapped for another
insertion where one or more extra nucleotides are inserted into the DNA
deletion where a nucleotide is deleted from the sequence
inversion where two nucleotides reverse their order
Changing the nucleotides could change the message carried by the gene, which may change the order of amino acids making up the protein.
• A point mutation is the most common type of gene mutation, and involves the substitution of one nucleotide for another (for example, ATG becomes ACG). This mutation only changes the DNA code for a single amino acid. If the new sequence codes for the same amino acid, it is called a silent mutation. An example of a disease caused by a substitution mutation is sickle cell anaemia.
• An insertion mutation occurs when an extra nucleotide (or more than one) is inserted into the DNA sequence (for example, ATG becomes ATCG). This type of mutation changes the DNA code for all amino acids that follow and is called a frameshift mutation. An example of a disease caused by an insertion mutation is fragile X syndrome.
• A deletion mutation occurs when a nucleotide is deleted from the sequence (for example, ATG becomes AG). This type of mutation changes the DNA code for all amino acids that follow and is also a frameshift mutation. An example of a disease caused by a deletion mutation is Duchenne muscular dystrophy.
• An inversion mutation occurs when two nucleotides reverse their order in the DNA (for example, ATG becomes AGT). This mutation only changes the DNA code for a single amino acid, and it could code for the same amino acid (silent mutation). An example of a disease caused by an inversion mutation is haemophilia.
Try this 2.7 remembering mutations
Find a way to remember the different types of mutations using normal words. For example:
• Normal code – WING
• Deletion – WIG
• Substitution – WIND
• Insertion – WRING
Chromosomal changes
Chromosome mutations
If a mutation occurs in a gene on one of the pair of homologous chromosomes, there will still be a normal copy of the gene on the other chromosome. The same applies with chromosome mutations. As chromosomes occur as homologous pairs, if one chromosome is abnormal, the other is still likely to be normal. The different types of chromosome mutations are illustrated in Figure 2.51.
UNCORRECTED
SAMPLEPAGES
Chromosome number abnormalities
Certain individuals may have one more or one fewer chromosome because of non-disjunction during meiosis. Non-disjunction means that the chromosomes failed to separate correctly when making gametes, so the gametes end up with an abnormal number of chromosomes (aneuploidy).
Trisomy occurs when an organism has a third copy of a chromosome that should only be present in two copies. Trisomy is therefore an example of aneuploidy. The most common trisomy among embryos that survive to birth is Down syndrome, or trisomy 21. People with this inherited disorder have distinct facial characteristics and experience developmental delays.
Did you know? 2.9
Sex chromosome abnormalities
Sex chromosome abnormalities occur when a person is missing a whole sex chromosome or has an extra sex chromosome due to non-disjunction. Problems can also occur when a person is missing part of a sex chromosome. Some disorders of sex chromosome are Klinefelter syndrome, XX male, XYY male, Turner syndrome, XXX female and XY female. Some of these disorders are surprisingly common. For example, many men with Klinefelter syndrome (who have two X chromosomes and one Y) have no signs or symptoms, and it is estimated that only one in six are ever diagnosed.
non-disjunction the failure of homologous chromosomes or sister chromatids to separate correctly in meiosis
aneuploidy the presence of an abnormal number of chromosomes in a cell
trisomy when an organism has a third copy of a chromosome
Figure 2.52 A karyotype of a male with Klinefelter syndrome
Figure 2.53 There are other types of trisomy apart from trisomy 21. Trisomy 13 and 18 result in more severe conditions. Which trisomy is depicted in this karyotype?
Did you know? 2.10
Madeline Stuart
Madeline Stuart is the first professional model with Down syndrome, and she is Australian! Although the fashion industry has a long way to go in terms of diversity, Madeline is one of the women who are changing the game. As well as being a model, she has also represented Queensland at the Special Olympics in cricket and basketball.
UNCORRECTEDSAMPLEPAGES
Figure 2.54 Madeline Stuart models at the New York Fashion Week.
DNA testing
A person’s DNA can provide information relating to their ancestry or parentage, confirm if they have a hereditary disease, and inform whether they are a carrier for genetic disorders that may affect their children.
Genetic screening is a type of genetic testing, but instead of identifying a genetic condition, it is used to evaluate an individual’s risk of developing a certain disease. These tests are routinely done for anyone in the population, even if they have not shown a family history of the disease. Genetic screening is usually done during pregnancy and at birth. In Australia, about 99% of babies are screened every year. Of the babies screened, around one in every thousand has a condition that would otherwise have gone undetected. Genetic screening provides an opportunity for preventive measures and early treatment.
2.55 In Western Australia, the newborn bloodspot screening test screens for conditions such as cystic fibrosis, phenylketonuria, hypothyroidism, galactosaemia and congenital adrenal hyperplasia.
think, feel, care: Genetic screening
2.56 A DNA sequence or ‘genetic fingerprint’ on a computer monitor. The development of fast computers made the analysis of DNA sequences possible.
UNCORRECTEDSAMPLEPAGES
In your class, divide into teams and engage in a discussion about perspectives within a scenario about genetic testing. You may wish to consider the following scenario, although your teacher may provide you with an alternative.
A woman who is 12 weeks pregnant attends a clinic and expresses her concern about her husband’s family history of Huntington’s disease (HD). Her sister-in-law tested positive last year, although she is not yet showing symptoms of the disease, but the woman’s husband refuses to be tested. Due to this, the woman is asking for her unborn baby to be screened to determine whether it carries the HD gene. If the test comes back positive, which means that her husband carries the HD gene, the woman will discuss terminating the pregnancy with her husband. Step inside each person’s point of view in this scenario. As you think about what you know, consider what each person might understand, respond to and value in the issues raised. Don’t forget to consider the legal and ethical issues.
The Think, feel, care thinking routine was developed by Project Zero, a research centre at the Harvard Graduate School of Education.
Figure
Figure
Making thinking visible 2.2
Precision medicine
Pharmacogenomic tests look for genetic variants that are associated with an individual’s response to specific medicines, by testing genes that affect drug metabolism. Its goal is to help doctors to select the drugs and doses that are best suited to each person.
Figure 2.57 Research has shown that people with red hair tolerate pain differently to people with other hair colours. Due to a mutation on the MC1R gene, they require more anaesthesia but need lower doses of opioids as they are more responsive to those painkillers.
UNCORRECTEDSAMPLEPAGES
1. Explain why an individual might choose to be screened for genetic diseases.
2. Identify some ethical issues with genetic testing.
Manipulating DNA
Genetic engineering technology allows scientists to manipulate genetic material and transfer genes between different organisms. One of the most exciting developments of the last decade is CRISPR, a technology that can edit genetic material quickly and cheaply. Developed by Jennifer Doudna and Emmanuelle Charpentier, the CRISPR tool lets scientists change or delete DNA bases and insert entirely new genes (Figure 2.58). The gene editing technology has almost endless potential, including editing crops so they’re more nutritious or able to survive in different conditions, curing genetic diseases, producing powerful new drugs or even resurrecting extinct species. In 2022, a New Zealand woman became the first to receive CRISPR treatment to treat heart disease by permanently lowering her cholesterol.
Genetically modified organisms
A genetically modified organism (GMO) is an organism whose genome has been altered by humans. Commonly, they are crop species that have been modified to improve growth rates, yield, quality and nutritional value. Genetic modification can decrease pest and disease susceptibility, reducing the need for pesticides.
Quick check 2.18
Chromosome
Healthy DNA strand DNA-cutting enzyme Defective DNA strand Guide molecule
A cell is transfected with an enzyme complex containing: a guide molecule, DNA-cutting enzyme and a copy of healthy DNA. The guide molecule finds the target DNA strand.
UNCORRECTEDSAMPLEPAGES
The enzyme cuts out the target DNA strand.
The healthy DNA copy replaces the defective DNA.
Figure 2.58 CRISPR gene editing technology allows DNA to be manipulated in a highly precise way.
Agricultural practices have changed to include the widespread use of genetically engineered crops. Crop plants are modified to have a greater tolerance to environmental stressors such as drought or heavy metals, allowing plants to grow in new areas. For example, some plants have been genetically engineered to grow with less water so that they are more resistant to climate change. Until recently, only three GM crops were approved to be grown in every mainland Australian state: canola (oilseed rape), cotton and safflower. After a ban was lifted, a wider range of GM crops can now be grown in every mainland state.
Try this 2.8
GM food
A great debate continues to rage within society regarding the health risks associated with eating GM food. Research two advantages and two disadvantages of the use of GM food and be prepared to debate with your classmates.
Figure 2.59 Cassava root has been genetically modified to have increased levels of beta carotene (right). This decreases post-harvest deterioration and also improves the nutritional value of the crop.
Did you know? 2.11
De-extinction
‘De-extincting’ is the process of bringing an extinct species back to life through genetic engineering by using fragments of DNA from preserved specimens. De-extincting species is a controversial idea, and many scientists argue that funding would be better spent conserving existing species and their habitats. A start-up biotechnology company called Colossal Biosciences quickly raised millions of dollars after announcing plans to de-extinct the woolly mammoth, the thylacine and the dodo. In 2025, the company claimed to have revived the dire wolf, last seen over 10 000 years ago. A white wolf featured on the cover of Time magazine, named as one of three 'dire wolf' puppies – Romulus, Remus and Khaleesi.
However, scientists soon clarified that these were genetically edited grey wolves. With dire wolf DNA too fragmented to clone, researchers had inserted selected gene sequences into grey wolf embryos to mimic some traits.
transgenic organism an organism that possesses a foreign gene or segment of foreign DNA in its genome because of human experimentation
Figure 2.60 Colossus Biosciences has produced three genetically engineered dire wolf puppies by using modern grey wolves and ancient DNA retrieved from the remains of extinct dire wolf ancestors. The DNA was inserted using CRISPR technology.
been genetically
to slow the growth of malaria-causing parasites in their gut, preventing transmission of the disease to humans.
Genetic engineering is also helping to alleviate global malnutrition and disease. A type of rice called golden rice has been engineered to prevent blindness in children caused by vitamin A deficiency (Figure 2.61). Another type of GM rice has been developed that has four times more iron than normal rice.
UNCORRECTEDSAMPLEPAGES
Transgenic organisms (TGOs) are the result of a type of genetic modification where a ‘foreign’ gene, or a segment of ‘foreign’ DNA is inserted into an organism’s genome such as in the mosquitoes in Figure 2.62. A foreign gene is one that is taken from another species. All transgenic organisms are GMOs, but not all GMOs are transgenic.
By inserting human genes into mice, human diseases can be mimicked, particularly as the genome and physiology of mice are so similar to humans. Transgenic mice are being used to study conditions such as obesity, heart disease, diabetes and Alzheimer's disease. Transgenic pigs are
Figure 2.61 Golden rice and normal rice
Figure 2.62 Mosquitoes have
modified
being investigated as a source of organs for transplants, which could address severe donor organ shortages. CRISPR technology has greatly reduced the complexity of the creation of transgenic animals, making the process faster and cheaper.
Explore! 2.8
UNCORRECTEDSAMPLEPAGES
Genetically modified tomatoes
Many foods come from genetically modified organisms, and we call them GM foods. The Flavr Savr tomato was the first commercially grown GM food that was granted a licence for human consumption. Released in 1994, the tomato had an improved shelf life and was developed for long-distance shipping. Recently, a GM tomato has been developed that contains higher levels of anthocyanins, a pigment that occurs naturally in purple or blue fruits and vegetables such as blueberries or red cabbage. By transferring a snapdragon gene into a tomato’s genome, they have produced a purple tomato that has the same levels of anthocyanins as blueberries.
1. Research why the team chose to genetically modify a tomato.
2. The high levels of anthocyanins in the purple tomatoes are beneficial for several reasons.
Research the effect of anthocyanins on:
a) shelf life
b) plant reproduction and survival
c) human health.
2.63 The process by which the John Innes Centre and the Sainsbury Laboratory created a GM purple tomato, which was approved for growing and breeding in the US in 2022. a) Existing purpleskinned tomatoes do not contain useful levels of anthocyanins. b) Genes from purple snapdragon flowers were added to the tomato. The snapdragon genes act like ‘on switches’, causing the purple pigment to be expressed throughout the tomato, instead of just in the skin. c) The resulting purple tomato is high in anthocyanins, which have a range of benefits for human health.
Human genes have been engineered into other mammals to supply the protein products of those genes, usually for medical purposes. For example, transgenic goats have been genetically engineered to produce milk that contains human antithrombin III. This is a protein that is used to prevent clots in patients with hereditary antithrombin deficiency when they are in surgery or giving birth. A herd of approximately 80 goats could supply enough human antithrombin III for all of Europe.
Figure 2.64 Transgenic C5 plums contain a gene that makes them resistant to plum pox virus.
Figure
UNCORRECTEDSAMPLEPAGES
gene therapy a process by which a copy of a functional gene is introduced into an organism
Making thinking visible 2.3
I used to think ... now I think ... : Xenotransplantation
Xenotransplantation is the transplantation of living cells, tissues or organs from one species to another. Transgenic pigs are promising xenotransplantation donor organisms as they share many anatomical and physiological characteristics with humans. In 2022, the first pig-to-human heart transplant took place. The operation was successful and, due to genetic modification, the heart was not rejected by the patient’s immune system. Unfortunately, he died 60 days later; scientists are still investigating why this happened. Scientists have also been successful in transplanting genetically modified pig kidneys into a brain-dead patient, with them functioning normally throughout the study period.
Think about what you have learned about transgenic organisms and xenotransplantation and complete the following sentence stems.
In the past, my viewpoint was … Currently, my viewpoint is …
The I used to think ... now I think ... thinking routine was developed by Project Zero, a research centre at the Harvard Graduate School of Education.
Gene therapy
Gene therapy is a process by which a copy of a functional gene is introduced into an organism. The gene is then switched on to produce the functional protein that is missing. This technique aims to treat inherited disorders like cystic fibrosis by directly targeting the genotype (unlike treatments that target the symptoms). Technical difficulties may arise when trying to specifically target the cells of
Figure 2.65 A CSIRO study found that genetically modified sheep grow bigger and faster and can produce more milk and wool. However, they required more care than non-GM sheep.
affected tissue, and when targeting one specific gene without interfering with the function of other essential genes. Ethical issues also arise. Some people argue that gene therapy should be restricted to somatic tissue only, so the introduced gene is not transmitted through to the next generation. What do you think about this issue?
Science inquiry 2.3
DNA data storage
Digital technology currently works on the binary system, which only uses the digits 0 and 1. Any information that is input digitally is converted to this system, and digital devices will change those values to the necessary form of information. It’s predicted that by 2035 the total volume of digital data generated by humans is expected to reach 2142 zettabytes (a zettabyte is equivalent to 1 000 000 000 000 000 000 000 bytes). Currently, most data is stored in the ‘cloud’, but the cloud is actually huge data centres stored in warehouses that require large amounts of energy to run.
However, by translating binary (0 or 1) values into one of the four DNA bases, it is possible for DNA to be reliably used to store huge amounts of digital data. Some scientists say that the entire world’s data could be stored in DNA that would fill a shoebox.
Rather than storing 0s and 1s individually, DNA allows them to be stored in pairs such as this:
• 00 A
• 01 T
10 C
11 G.
UNCORRECTEDSAMPLEPAGES
Figure 2.66 Encoding data into DNA code might be the future of efficient data storage.
After storing data in DNA, it can then be read using a DNA sequencer. This reads all of the bases and then converts it to binary. Improvements in sequencing techniques allow for billions of DNA sequences to be easily read at once and, when kept in suitable conditions, DNA can be preserved for hundreds of thousands of years without any energy input.
New sequencing techniques are also allowing sections of DNA to be used as identification tags. This DNA barcoding is accelerating the pace of research in fields such as chemical engineering, materials science and nanotechnology.
Quick check 2.19
1. Recall what GMO stands for.
2. Describe the process of gene therapy.
3. State an example of the application of genetic screening.
4. Discuss the reasons for the adoption of genetic screening by groups in society.
5. State five conditions that are screened for in Western Australia through the newborn bloodspot screening tests.
Go online to access the interactive section review and more!
Section 2.4 review
Online quiz
Section questions
Section 2.4 questions
Remembering
1. If a mutation is to be passed on to the next generation, state where it must have occurred.
2. Define the term ‘mutagen’.
3. Recall the definition of a genetically modified organism.
Understanding
4. Using the table below, answer the following questions.
Teachers can assign tasks and track results Second letter in the codon
UNCORRECTEDSAMPLEPAGES
Third letter in the codon
(M)
Glu (E) GGA A GUG GCGGAG GGG G
The original DNA strand is GTC GGG ATA CGG CTC.
A gene mutation occurs, whereby the C in the first codon is replaced with a T, resulting in GTT GGG ATA CGG CTC.
a) State the name of this gene mutation.
b) State the mRNA strand that was copied from the original DNA strand.
c) State the new mRNA strand produced from the mutated DNA strand.
d) State whether the amino acids stay the same or change.
e) Another mutation occurs, whereby a C was added to the beginning of the above original DNA strand, giving CGTC GGG ATT CGG CTC.
State the name of this mutation and describe how it would affect the subsequent amino acids that it codes for.
f) Write out the mRNA code for this mutation and identify the corresponding amino acids.
Applying
5. Explain what will happen if a nucleotide is deleted from the sequence of nucleotides within a gene.
6. Explain what usually results when mutations occur in non-germ (somatic) cells.
7. Explain whether or not all mutations are detrimental (harmful).
8. Explain how a mutated gene can lead to a genetic disorder.
9. Illustrate a diagram to outline how non-disjunction may occur and cause aneuploidy.
UNCORRECTEDSAMPLEPAGES
Analysing
10. Contrast a genetically modified organism and a transgenic organism.
11. Contrast a spontaneous mutation and an induced mutation.
Evaluating
12. Using the DNA sequence ACAATTGGTAGCTGAGTTGGCCCGTA, create an example of the following mutations.
a) substitution
b) inversion
c) deletion
d) insertion.
13. Discuss why the substitution of one nucleotide may not be as critical to the functioning of the protein as the deletion or insertion of a nucleotide.
14. Propose an explanation for the relationship between increased rates of skin cancer and the thinning of the ozone layer.
15. Construct a mind map that shows the different types of mutations that may occur.
Chapter review
Chapter checklist
Success criteria Linked questions
2.1 I can recall the components that make up the structure of DNA and RNA molecules. 6, 13
2.1 I can describe the relationship between genes, DNA and chromosomes. 1
2.1 I can describe the steps in which DNA is used to synthesise proteins.7, 18
2.2 I can recall the steps involved in DNA replication. 3, 4, 15
2.2 I can describe the stages of cell division in mitosis. 17
2.2 I can describe the stages of cell division in meiosis. 17
2.2 I can use a karyotype to determine information about an individual.10
2.3 I can define the terms ‘homozygous’, ‘heterozygous’, ‘dominant’ and ‘recessive’ with respect to genetic inheritance. 5
2.3 I can use and interpret a Punnett square to identify possible genotypes and phenotypes of offspring. 20, 23
2.3 I can explain sex linkage. 11, 19
2.3 I can distinguish between codominance and incomplete dominance.22
2.3 I can use a pedigree diagram to determine the type of inheritance that is occurring. 19
2.4 I can explain the different types of mutations, including their causes and effects. 16
2.4 I can describe some ways in which DNA can be manipulated. 25
UNCORRECTEDSAMPLEPAGES
Remembering
1. State the name of the position on a chromosome where a particular gene is located.
2. Recall two autosomal recessive inheritable traits.
3. Recall the name of the enzyme that unwinds the DNA double helix during DNA replication.
4. Name the structure formed when DNA condenses and becomes visible before cell division.
5. Define the terms ‘homozygous’, ‘heterozygous’, ‘dominant’ and ‘recessive’.
6. Identify the parts of the nucleotide in the following figure.
7. State the location in the cell where transcription and translation occur.
8. State how many chromosomes you would expect to find in a:
a) human somatic cell
b) human gamete
c) human somatic cell with Down syndrome.
Understanding
9. Explain why males have more chance than females of inheriting an X-linked recessive trait.
10. Assuming eye colour in humans is controlled by a single pair of genes, and that brown eyes are dominant to blue eyes, determine the genotype of a brown-eyed man if he and a woman with blue eyes produce a baby with blue eyes.
UNCORRECTEDSAMPLEPAGES
11. Illustrate a diagram to show how two nucleotides join together with hydrogen bonds.
12. Explain why chromosomes are not always visible.
13. When cells reproduce themselves, the DNA is replicated. Explain why this is necessary.
14. Explain how aneuploidy occurs.
15. Contrast meiosis and mitosis.
16. Illustrate a diagram to show the processes of transcription and translation.
Applying
17. Identify what information can be gained from the following karyotype.
18. Using a Punnett square, determine the genotypes and phenotypes of the children if a normal-vision female carrier of colour blindness has children with a normal-vision male.
Parents: XBXb × XBX
19. Construct a pedigree with the following information.
A woman with Huntington’s disease marries a man who does not have Huntington’s disease. They have three children. The first child is a male, the second child is a female, and both do not have the disease. The third child, a male, does develop the disease. Remember that Huntington’s disease is an autosomal dominant genetic disorder.
Analysing
20. The table below shows several different organisms with their diploid chromosome number.
UNCORRECTEDSAMPLEPAGES
a) Identify the organism with the highest number of chromosomes in its gametes.
b) State the haploid number of the onion.
21. Use information from the following pedigrees to infer the inheritance pattern shown. a) b) c)
22. An abandoned baby was handed in at the police station. Later, two women claimed to be the baby’s mother. Blood studies revealed that woman 1 had blood type A, and that woman 2 was blood type AB. The baby was blood type O. Deduce which woman could possibly be the baby’s mother and which woman can be ruled out completely. Show your working.
23. Chondrodystrophy is an autosomal recessive condition that is governed by a single gene with two alleles. In turkeys, affected embryos die approximately 16 days after fertilisation, so they do not survive long enough to hatch. Two turkeys that are heterozygous for the condition are crossed. Show your working to determine the phenotypic and genotypic ratios of the offspring.
Let C = normal allele and c = allele with chondrodystrophy.
Evaluating
24. Personal genome screening can be readily ordered over the internet. Evaluate the pros and cons of having DNA testing so readily available at an affordable cost.
25. You had genome screening and found out that your genes conferred a 25% chance of developing a disease. However, you also know that environmental and lifestyle factors play a large role in whether you develop the disease.
a) Evaluate how this information would affect your life.
b) Discuss how this scenario is different from knowing about a disease that is not influenced by lifestyle factors.
Data questions
A student prepared an onion root tip slide and examined the cells using a light microscope. She recorded the number of cells in each stage of the cell cycle.
The table shows her results.
UNCORRECTEDSAMPLEPAGES
Table 2.6 Number of onion cells in each stage of the cell cycle
She then calculated the mitotic index for different areas of the root tip. The graph shows her results.
Distance from root tip (mm)
Figure 2.67 Mitotic index plotted against distance from root tip
1. The mitotic index of dividing tissue is calculated with the following formula:
Mitotic index = number of cells seen that were undergoing mitosis total number of cells seen
Calculate the mitotic index of the tissue shown in the table.
2. The duration of any phase of the cell cycle can be calculated with the following formula:
Phase duration (minutes) = × number of cells seen in that phase total number of cells seen cell cycle duration of the organism.
The cell cycle duration for the onion is 24 hours.
Calculate the duration of metaphase.
3. Identify the trend shown in the graph.
4. Extrapolate the data in the graph to estimate the mitotic index of the cells found 2 mm from the root tip. Stage
SteM activity: Designing and prototyping an assistive device for individuals with a genetic disease
Background information
When a mutation occurs that is not beneficial, complications occur. An example of a disease with genetic causes is scoliosis. Scoliosis is a sideways curvature of the spine that usually occurs before puberty. Genetic diseases such as cerebral palsy and muscular dystrophy can cause scoliosis, but the cause of most scoliosis is unknown.
DESIGN BRIEF
Research a genetic disease. Design and build an apparatus that can help to improve the quality of life for people with the selected disease.
Activity instructions
In groups of three or four, conduct basic research on a genetic disease. Then design an apparatus that will improve the quality of life for people with that condition. Consider how the product would be built and marketed. Each team member needs to have a clear role but must be able to contribute to all aspects of the project.
Suggested materials
• computer
• pencil
• paper
• ruler
• balsa wood
• papier mâché
• chicken wire
• 3D printer
• cardboard
• poster paper
UNCORRECTEDSAMPLEPAGES
• plaster
Figure 2.68 Various brace designs can be used for the treatment of scoliosis.
Research and feasibility
1. Research genetic diseases and as a group decide which genetic disease will be the focus.
2. Create a table of the causes and effects of the disease.
Genetic disease causeEffects on part of bodyIdeas to help
e.g. Muscular dystrophy
Muscle loss
e.g. Haemophilia
Blood doesn’t clot effectively
Reduced joint movementBrace and orthotics for feet
Whole body can be bruised easily
1. Creation of children’s play suit
2. Creation of some type of buffing edging that could be applied to furniture
3. Find pictures or diagrams of current equipment used, and annotate them with features and characteristics that relate to assisting people living with this disease.
Design and sustainability
4. Sketch potential design solutions (at least two) and annotate the purpose of the apparatus and what it is made of. Describe how it will improve the quality of life for people with this disease. How will it improve on current aids or tools (if any)?
5. Reflect on the materials you would use in real-world construction and comment on the durability and sustainability of the materials.
Create
6. Build a prototype of your design using available construction materials.
Evaluate and modify
7. Reflect on the prototype you have created and its effectiveness to help people with your chosen genetic disease.
8. Discuss as a group the modifications you would make in your solution to increase the effectiveness of design.
9. Present your prototype to the class. Outline the effectiveness of the prototype and demonstrate supporting ideas that show how the prototype would improve the quality of life of a person with this genetic disease.
