Skip to main content

UChicago PULSE Issue 4.1: Autumn 2017

Page 1

TCGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTATGGCAAAACCGATGGGGAATGATTCGGGTAGCGCTAAAAGTCCATAGCACGTACATCCCAAC AGCACGTACATCCCAACC TAAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAATTACGGAGTGGGCGGCCTGGCGGGAGCACTACCCCATCGACGCGTACTCGAATACTGTATATTG TCGAATACTGTATATTGC CAGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGTTGATGTGGATCGACTCTATAGAGGCATCTACTGATGCGTAGGGAGATCCGGAATGTATTGGCCTATGTCACTGAAACT CCTATGTCACTGAAACTG ACGCATACCTCCTTCGTTGAGAACTCACAATTATACAACTGGGGACATAATCCCTACGCCCATCTTCTACACCCGTCTCTGTGGGTCCAGTTCAAGTGCTGGGAGAGCATCCTCCA TGGGAGAGCATCCTCCAC TACTGTGATACATGCGACAGGGGTAAGACCATCAGTAGTAGGGATAGTGCCAAAGCTCACTCACCACTGCCTATAAGGGGTGCTTACCTCTAGAATAAGTGTCAGCCAGTATAACC TGTCAGCCAGTATAACCC AATCCGGAGGCACCGGGCTCAAAGCCGCGACACGACGGCTCACAGCCGGTAAGAGTAACCCCGGAGTGAACACCTATGGGGCTGGATAAAACTGCCCTGGTGACCGCCATCAACAA GTGACCGCCATCAACAAC GGGGGATGTTTTCTACTATTCGAGGCCGTTCGTTATAACTTGTTGCGTTCCTAGCCGCTATATTTGTCTCTTTGCCGACTAATGAGAACAACCACACCATAGCGATTTGACGCAGC TAGCGATTTGACGCAGCG GGCCATTGCGAATACCAGGTATCGTGTAAGTAGCGTAGGCCCGTACGCGAGATAAACTGCTAGGGAACCGCGTCTCTACGACCGGTGCTCGATTTAATTTCGCCGACGTGATGACA TCGCCGACGTGATGACAT GTGATTGGGTAGTTGGACATGCCCTTGAAAGATATAGCAAGAGCCTGCCTGTCTATTGATGTCACGGCGAAAGTCGGGGAGACAGCAGCGGCTGCAGACATTATACCGGAACAACA ATTATACCGGAACAACAC TCCTCTAGACCTTACTTGACCAGATACAGTGTCTTTGACACGTTTATGGATTACAGCAATCACATCCAAGACTGGCTATGCACGAAGCAACTCTTGAGTGTTAAAATGTTGACCCC GTTAAAATGTTGACCCCT GACTCCGACGTCAAGTACATTACCCTCTCATAGGCGGCGTTCTAGATCACGTTACCGCCATATCATCCGAGCATGACATCATCTCCGCTGTGCCCATCCTAGTAGTCATTATTCCT TAGTAGTCATTATTCCTA CCACGAATGAAAATGTTTTTCGCTGACAATCATAATGGGGCGCTCCTAAGCTTTTCCACTTGGTTGGGCCAGCTAGGCCTCCCTGCCCGGAGTTTCGGCGCAGTGCTGCCGACAGC GCAGTGCTGCCGACAGCC CCGGACCTAACTTGTCGGGACCACCCGGGGTAGTCATCGGGCTTATACAGCGAAAAGCCCAGCACCCGGCTCCCCGCTATGGAAGGTCATTAGCTCCGGCAAGCAATTAAGAACAA CAAGCAATTAAGAACAAC GAATACACCTGTTCGTGTCGTATCGGTAAATAGCCTCGCGGAGCCATGTGCCATACTCGTCTGCGGAGCACTCTGGTAATGCATATGGTCCACAGGACATTCGTCGCTTCCGGGTA TTCGTCGCTTCCGGGTAT GCTCAGCACCATTTAAATTAGACCGACTCCAGATCTGTAAGGTCCGCCACGCAGACGACAGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGG CATCTGTGTGGTACTGGG CTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGATTGTACGCTATTCAGGGATTGACTGATACCGGAAGACATCTCAAATGAAGTGGTCTATGCGACAGAGACCGTGCAC CGACAGAGACCGTGCACC TCGTACTTCGTTCAGAACTCACATTTTAACAACAGAGGACACATGCCCTACCTCCATGATCTACTGACGTCCCTGAGGCTGCAATACATGTAACGAGGCAGTATCCGCGGTAAGTC AGTATCCGCGGTAAGTCC AGAAGAGGGGACGCCGGTGCAGTCATCACTAATGTGGAAATTGGGAGGACTCTTGGCCCTCCGCCTTTAGGCGGTGCTTACTCTTTCATAAAGGGGCTGTTAGTTATGGCCTGCGA TTAGTTATGGCCTGCGAG GAGAGACGGGCTTCAAAGCTGCCTGACGACGGTTGCGGGTCCGTATCAAAATCCTCCCAATAAGCCCCCGTGACCGTTGGTTGAACAGCCCAGGACGGGCCGACCAGAAGCCCGAT CCGACCAGAAGCCCGATT TACCTTGCAGGAATCGAGGCCGTCCGTTAATTCCTCTTGCATTCATATCGCGTATTTTTGTCTCTTTACCCGCTTACTTGGATAAGGATGACATAGCTTCTTACCGGAGCGCCTCC CTTACCGGAGCGCCTCCG TACGTATACCAGGTGTCCTGTGAGCAGCGAAAGCCTAAACGGGAAATACGCCGCCAAAAGTCGGTGTGAATACGAGTCGTAGCAAATTTGGTCTGGCTATGATCTAGATATTCCAG TGATCTAGATATTCCAGG CGTTAGATAGTCTAGCCGCTGGTAAACACTCCATGACCTCGGCTCTCCATTGATGCTACGGCGATTCTTGGAGAGCCAGCAGCGACTGCAAATGTGAGATCAGAGTAATATTAGCA TCAGAGTAATATTAGCAA AGAGTGAACTTCATAACATATGCTGTCTCAGGCACGTGGATGGTTTGGACAAATCAGATTCAAGTCTGATCAACCTTCATACAGATCTAGAGTCTAAAGCAGTGATCTCCCGCGTG CAGTGATCTCCCGCGTGC GACGTTCTAAACGTTGGTCCGTCAGAAGCGCCATCCAGGATCACGTTACCCCGAAAAAAAGATATCAGGAGCTCTCCTCCTCTGCAGTCAGGTCTATAGAAACTACAGGACTAACC AAACTACAGGACTAACCT TTTCGGCCCCGCGCTGCGC ATTCCCTTGGGACAGACTTCCTACTCACAGTCGGTCACATTGGGCTACTCCATGGGTCTTCGGCTTGACCCGGTCTGTTGGGCCGCGATTGCGTGAGTTTCGGCCCCGCGCTGCGC GCACCGGCAAGCACCATTG GAAACCCCAACTTATTTAGATAACATCATTAGCCGAAGTTGCTGGGCATGTCCACCGTGGAGTCCTCCCCGGGCGTCCCTCCTTCAAATGACGATAAGCACCGGCAAGCACCATTG TAGCACGTACATCCCAACC CGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTATGGCAAAACCGATGGGGAATGATTCGGGTAGCGCTAAAAGTCCATAGCACGTACATCCCAACC CTCGAATACTGTATATTGC AAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAATTACGGAGTGGGCGGCCTGGCGGGAGCACTACCCCATCGACGCGTACTCGAATACTGTATATTGC GCCTATGTCACTGAAACTG AGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGTTGATGTGGATCGACTCTATAGAGGCATCTACTGATGCGTAGGGAGATCCGGAATGTATTGGCCTATGTCACTGAAACTG CTGGGAGAGCATCCTCCAC CGCATACCTCCTTCGTTGAGAACTCACAATTATACAACTGGGGACATAATCCCTACGCCCATCTTCTACACCCGTCTCTGTGGGTCCAGTTCAAGTGCTGGGAGAGCATCCTCCAC GTGTCAGCCAGTATAACCC ACTGTGATACATGCGACAGGGGTAAGACCATCAGTAGTAGGGATAGTGCCAAAGCTCACTCACCACTGCCTATAAGGGGTGCTTACCTCTAGAATAAGTGTCAGCCAGTATAACCC GGTGACCGCCATCAACAAC ATCCGGAGGCACCGGGCTCAAAGCCGCGACACGACGGCTCACAGCCGGTAAGAGTAACCCCGGAGTGAACACCTATGGGGCTGGATAAAACTGCCCTGGTGACCGCCATCAACAAC ATAGCGATTTGACGCAGCG GGGGATGTTTTCTACTATTCGAGGCCGTTCGTTATAACTTGTTGCGTTCCTAGCCGCTATATTTGTCTCTTTGCCGACTAATGAGAACAACCACACCATAGCGATTTGACGCAGCG TTCGCCGACGTGATGACAT GCCATTGCGAATACCAGGTATCGTGTAAGTAGCGTAGGCCCGTACGCGAGATAAACTGCTAGGGAACCGCGTCTCTACGACCGGTGCTCGATTTAATTTCGCCGACGTGATGACAT CATTATACCGGAACAACAC TGATTGGGTAGTTGGACATGCCCTTGAAAGATATAGCAAGAGCCTGCCTGTCTATTGATGTCACGGCGAAAGTCGGGGAGACAGCAGCGGCTGCAGACATTATACCGGAACAACAC TGTTAAAATGTTGACCCCT CCTCTAGACCTTACTTGACCAGATACAGTGTCTTTGACACGTTTATGGATTACAGCAATCACATCCAAGACTGGCTATGCACGAAGCAACTCTTGAGTGTTAAAATGTTGACCCCT CTAGTAGTCATTATTCCTA ACTCCGACGTCAAGTACATTACCCTCTCATAGGCGGCGTTCTAGATCACGTTACCGCCATATCATCCGAGCATGACATCATCTCCGCTGTGCCCATCCTAGTAGTCATTATTCCTA CGCAGTGCTGCCGACAGCC CACGAATGAAAATGTTTTTCGCTGACAATCATAATGGGGCGCTCCTAAGCTTTTCCACTTGGTTGGGCCAGCTAGGCCTCCCTGCCCGGAGTTTCGGCGCAGTGCTGCCGACAGCC GCAAGCAATTAAGAACAAC CGGACCTAACTTGTCGGGACCACCCGGGGTAGTCATCGGGCTTATACAGCGAAAAGCCCAGCACCCGGCTCCCCGCTATGGAAGGTCATTAGCTCCGGCAAGCAATTAAGAACAAC ATTCGTCGCTTCCGGGTAT AATACACCTGTTCGTGTCGTATCGGTAAATAGCCTCGCGGAGCCATGTGCCATACTCGTCTGCGGAGCACTCTGGTAATGCATATGGTCCACAGGACATTCGTCGCTTCCGGGTAT CCATCTGTGTGGTACTGGG CTCAGCACCATTTAAATTAGACCGACTCCAGATCTGTAAGGTCCGCCACGCAGACGACAGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGG GCGACAGAGACCGTGCACC TCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGATTGTACGCTATTCAGGGATTGACTGATACCGGAAGACATCTCAAATGAAGTGGTCTATGCGACAGAGACCGTGCACC CAGTATCCGCGGTAAGTCC CGTACTTCGTTCAGAACTCACATTTTAACAACAGAGGACACATGCCCTACCTCCATGATCTACTGACGTCCCTGAGGCTGCAATACATGTAACGAGGCAGTATCCGCGGTAAGTCC GTTAGTTATGGCCTGCGAG GAAGAGGGGACGCCGGTGCAGTCATCACTAATGTGGAAATTGGGAGGACTCTTGGCCCTCCGCCTTTAGGCGGTGCTTACTCTTTCATAAAGGGGCTGTTAGTTATGGCCTGCGAG GCCGACCAGAAGCCCGATT AGAGACGGGCTTCAAAGCTGCCTGACGACGGTTGCGGGTCCGTATCAAAATCCTCCCAATAAGCCCCCGTGACCGTTGGTTGAACAGCCCAGGACGGGCCGACCAGAAGCCCGATT TCTTACCGGAGCGCCTCCG ACCTTGCAGGAATCGAGGCCGTCCGTTAATTCCTCTTGCATTCATATCGCGTATTTTTGTCTCTTTACCCGCTTACTTGGATAAGGATGACATAGCTTCTTACCGGAGCGCCTCCG ATGATCTAGATATTCCAGG ACGTATACCAGGTGTCCTGTGAGCAGCGAAAGCCTAAACGGGAAATACGCCGCCAAAAGTCGGTGTGAATACGAGTCGTAGCAAATTTGGTCTGGCTATGATCTAGATATTCCAGG ATCAGAGTAATATTAGCAA GTTAGATAGTCTAGCCGCTGGTAAACACTCCATGACCTCGGCTCTCCATTGATGCTACGGCGATTCTTGGAGAGCCAGCAGCGACTGCAAATGTGAGATCAGAGTAATATTAGCAA GCAGTGATCTCCCGCGTGC GAGTGAACTTCATAACATATGCTGTCTCAGGCACGTGGATGGTTTGGACAAATCAGATTCAAGTCTGATCAACCTTCATACAGATCTAGAGTCTAAAGCAGTGATCTCCCGCGTGC GAAACTACAGGACTAACCT ACGTTCTAAACGTTGGTCCGTCAGAAGCGCCATCCAGGATCACGTTACCCCGAAAAAAAGATATCAGGAGCTCTCCTCCTCTGCAGTCAGGTCTATAGAAACTACAGGACTAACCT GGTGCCAACGCGCAGGCAT TGAGAAGGTATTTGCCCGATAATCAATACTCCAGGCATCTAACTTTTCCCACTGCCTTAAGCCGGCTTGCCCTTTCTGCCTGTAGATCCATTGGACTGGTGCCAACGCGCAGGCAT AATTAAAGGGAACGTATAT CAGCATCTCGGGTCTTGCCCAACCCGTCTACACGCTGTTATAGCGAATCAGCGGGAACCCGGTGCCACGCGATGGAACGTCCTTAACTCTGGCAGGCAATTAAAGGGAACGTATAT TGTTTTCGAAATTACCCTT TCTTCTCTCTGTCTATCGAAGAATGGCCACGCGGTGGCAACCGTCATGCTAGCGTGCGGGGTACACTTGCTAACCATTTGGGACACGGGACACTCGCTGTTTTCGAAATTACCCTT GTGAGCTACTGGAGCCGAG ATCGTTACAAGCAGACTCATACTAGATGTATTATGCCCGCCATGCAGACGAAACCAGTCGGAGATTACCGAGCATTCTATCACGTCGGCGACCACTAGTGAGCTACTGGAGCCGAG GGGTGCGTGTACCATGTAA GACGCAAGCGATTACACTCCTGTCACATCATAATCGTTTGCTATTCAGGGCTTGACCAACACTGGATTGCTTTTCACTTAAAGTATTATGCACGACAGGGTGCGTGTACCATGTAA TAGCGCTAGGTCCTAGTGC GTGGCTAGATCTTAGCTTACGTCACTAGAGGGTCCACGTTTAGTTTTTAAGATCCATTGATCTCCTAAACGCTGCAAGATTCGCAACCTGGTATACTTAGCGCTAGGTCCTAGTGC TACGAGATCCGTAGATTGA GAGTCGTCAGACCAGATAGCTTTGATGTCCTGATCGGAAGGATCGTTGGCCCCCGACCCTTAGACTCTGTACTCAGTTCTATAAACGAGCCATTGGATACGAGATCCGTAGATTGA ATGGGTCTTCGGCTTGACC GGACAGCTTGGTTCCCTATCAGAGCTTGGAGCCAATGATCAGGGTTATTCCCTTGGGACAGACTTCCTACTCACAGTCGGTCACATTGGGCTACTCCATGGGTCTTCGGCTTGACC the advent of CAR T CCACCGTGGAGTCCTCCCC CCCGCGCTGCGCTGTATAGTCGATTCTCATCCGGCCCTCACATCTGGAAACCCCAACTTATTTAGATAACATCATTAGCCGAAGTTGCTGGGCATGTCCACCGTGGAGTCCTCCCC TATGGCAAAACCGATGGGG CAAGCACCATTGATCAACGCAAGGATCGGTGATGTTAACAAAGATTCGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTATGGCAAAACCGATGGGG therapy, pg16 TTACGGAGTGGGCGGCCTG TACATCCCAACCTGGCGTGCGTACAGTTTGACGACCGCTTCACGCTAAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAATTACGGAGTGGGCGGCCTG TCTATAGAGGCATCTACTG ACTGTATATTGCTCTCACATGAACAAATTAGTAGAGTGCCGCTTTCAGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGTTGATGTGGATCGACTCTATAGAGGCATCTACTG CCTACGCCCATCTTCTACA TCACTGAAACTGTCCAAACACCCCATGTCGTTACTGAACGTATCGACGCATACCTCCTTCGTTGAGAACTCACAATTATACAACTGGGGACATAATCCCTACGCCCATCTTCTACA AAGCTCACTCACCACTGCC AGCATCCTCCACAAGGTCTAGTGGTATGGTGGTATAGTAAGCTCGTACTGTGATACATGCGACAGGGGTAAGACCATCAGTAGTAGGGATAGTGCCAAAGCTCACTCACCACTGCC GAGTAACCCCGGAGTGAAC CCAGTATAACCCCATGAGGAACCGAAAAGGCGAACCGGGCCAGACAATCCGGAGGCACCGGGCTCAAAGCCGCGACACGACGGCTCACAGCCGGTAAGAGTAACCCCGGAGTGAAC AGCCGCTATATTTGTCTCT GCCATCAACAACCCGAATACGTGGCATTTCAGGAGGCGGCCGGAGGGGGGATGTTTTCTACTATTCGAGGCCGTTCGTTATAACTTGTTGCGTTCCTAGCCGCTATATTTGTCTCT TAAACTGCTAGGGAACCGC TTTGACGCAGCGCCTCGGAATACCGTATCAGCAGGCGCCTCGTAAGGCCATTGCGAATACCAGGTATCGTGTAAGTAGCGTAGGCCCGTACGCGAGATAAACTGCTAGGGAACCGC CTATTGATGTCACGGCGAA ACGTGATGACATTCCAGGCAGTGCCTCTGCCGCCGGGCCCCTCTCGTGATTGGGTAGTTGGACATGCCCTTGAAAGATATAGCAAGAGCCTGCCTGTCTATTGATGTCACGGCGAA ACAGCAATCACATCCAAGA CCGGAACAACACTAAGGTGAGATAACTCCGTAACTGACTACGCCTTCCTCTAGACCTTACTTGACCAGATACAGTGTCTTTGACACGTTTATGGATTACAGCAATCACATCCAAGA TACCGCCATATCATCCGAG ATGTTGACCCCTGTATTTGGGATGCGGGTAGTAGATGACTGCAGGGACTCCGACGTCAAGTACATTACCCTCTCATAGGCGGCGTTCTAGATCACGTTACCGCCATATCATCCGAG TTTCCACTTGGTTGGGCCA TCATTATTCCTATGACCCTTTTGAGTGTCCGGTGGCGGATATCCCCCACGAATGAAAATGTTTTTCGCTGACAATCATAATGGGGCGCTCCTAAGCTTTTCCACTTGGTTGGGCCA AAAAGCCCAGCACCCGGCT CTGCCGACAGCCGGGCATTGTCTTTGGGGCGTTATTCGAGGGCACCCGGACCTAACTTGTCGGGACCACCCGGGGTAGTCATCGGGCTTATACAGCGAAAAGCCCAGCACCCGGCT ATACTCGTCTGCGGAGCAC ATTAAGAACAACGCAAGGATCGCGGATATAAACAGAGAAACGGCCGAATACACCTGTTCGTGTCGTATCGGTAAATAGCCTCGCGGAGCCATGTGCCATACTCGTCTGCGGAGCAC AGACGACAGCCCACGGAGA GCTTCCGGGTATGCGCTCTATGTGACGGTCTTTTGGCGCACAAATGCTCAGCACCATTTAAATTAGACCGACTCCAGATCTGTAAGGTCCGCCACGCAGACGACAGCCCACGGAGA CAGGGATTGACTGATACCG TGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGATTGTACGCTATTCAGGGATTGACTGATACCG

PULSE VOLUME 3, ISSUE 1. AUTUMN 2017

THE LIVING DRUG


from the editor-in-chief Dear reader,

Welcome to a new school year, and welcome to a new issue of PULSE! To new readers, thanks for your interest and to our returning readers, glad you're back and hope we can bring you more intriguing reads! We're excited to announce that this quarter, we will be presenting hard copies to you all, so keep an eye out for a copy around campus. This quarter, we're experimenting with sections pertaining to different parts of the premed/pre-health life: with Education, we set the stage for anything application, test, or career-related; with Policy, recent developments in health and society; with Research, some of the hottest new areas of exploration; and with Reflection, a chance for our fellow premeds to expand on their experiences outside of the typical schoolwork/eat/sleep/repeat. Never fear, we're still the same magazine: our main goal remains providing the pre-health students of UChicago the opportunity to expand, explore, and expound upon their interests, as well as acting as an info bank of tips and tricks to make it through the next few years. More than anything, we're excited to share this journey forward with you all! Please reach out via email with any questions or comments. Enjoy the read, and enjoy your winter break! With regards, Irena Feng

editors Purujit Chatterjee Christie Du Anya Dunaif Irena Hsu Jui Malwankar Fatima Sattar general editors: Kalina Kalyan Medha Reddy

writers Jasmine Barnard Beatrix Brandfield-Harvey Sarah Nakasone Swathi Balaji Abhijit Ramaprasad Medha Reddy Scott Wu

production Purujit Chatterjee (cover design) Irena Feng

other contributors The Princeton Review

pulse - autumn 2017


CONTENTS

CONTENTS EDUCATION POPULAR COMBINED DEGREE PROGRAMS FOR MDs KAPLAN MCAT PRACTICE PROBLEM

2 5

POLICY BIRTH CONTROL IN THE TRUMP ERA SPOTLIGHT: ARE WE SURVIVING SEPSIS?

6 9

RESEARCH SEEING AN INVISIBLE DISEASE: FIBROMYALGIA HOW WE BECAME INTERESTED IN THE HUMAN MICROBIOME CAR T CELL THERAPY: A LIVING DRUG

10 14 16

REFLECTION THE FIGHT AGAINST BLINDNESS: 10 DAYS IN THE GAMBIA NOTES FROM THE FIELD: SOUTH AFRICA

20 24

table of contents || 1


POPULAR COMBINED DEGREE PROGRAMS

FOR MDS

Why consider a combined degree? If you’re ready to take on the extra time and commitment, a combined degree can maximize your options and opportunities after you complete med schools. The Association of American Medical Colleges offers a complete list of medical schools with combined degree programs. Here’s our overview of the most popular degrees to pursue while earning an MD: the MS, MPH, MBA, JD, and PhD.

MD/MS (Master of Science)

Medical students with a specific research interest can often pursue a Master of Science degree. At many universities, MS degrees are offered through the school of medicine, so it can be fairly easy to apply to complete a master's in a health-science field. Usually, students finish the first two years of medical school, then take a year of coursework towards their master's degree before returning to complete the final two years of their medical program. Depending on the school and the field, a combined MD/MS takes between five and six years of fulltime study.

MD/MBA (Master of Business Administration)

The MD/MBA attracts students who plan to serve on the executive team at a hospital or health-care facility, as a high-level executive in the healthcare industry, or as a consultant. The MD/MBA can also be enormously useful to doctors with private practices, which call for management skills and business savvy. If you're thinking of this route, you must complete prerequisite coursework for medical school and business school prior to matriculation at medical school. You must also take the GMAT as well as the MCAT. In addition, certain business schools have work requirements and recommendation preferences that differ from medical schools.

2 || pulse


EDUCATION

MD/JD (Juris Doctor)

JD/MD programs are typically suited to students who intend to work in government and policy, to serve on the executive team of a hospital, to practice as lawyer focusing on medical issues, or to practice forensic medicine. If you're considering this course, you'd be well advised to prepare for and take the LSAT before you start medical school. Gaining admission to both the law and medical school is no small feat at a top-tier university. Students who pursue the MD/JD generally apply to the law program at the university in their first or second year of medical school. Because special arrangements must be made for this joint degree, you should discuss your path with the admissions committees at both schools.

MD/MPH (Master of Public Health)

Public health degrees cover subjects from biostatistics and epidemiology to women's health, disease control and preventive medicine. Graduates of MD/MPH programs can combine their clinical expertise with knowledge of public-health issues, giving them the background for careers in research, policy, advocacy, and consulting. Most students apply for admission to the school of public health during their second year of medical school and begin coursework after the second or third year.

MD/PhD and Medical Scientist Training Programs

Students who are interested in a career in academic investigative medicine choose the MD/PhD path, garnering the clinical skills of medical school while becoming an expert in a specific research field. Typically, MD/PHD programs take about seven or eight years to complete and incorporate intensive, long-term research in the biomedical sciences. After graduation, the MD/PhD student usually works as a researcher or professor at a teaching hospital. These students may also earn substantial salaries working as medical scientists at private health-care companies. A number of U.S. medical schools allow students to pursue a combined MD/PhD, of which the most well recognized are members of the Medical Scientist Training Program (MSTP). Students who are admitted to these highly competitive programs receive full tuition coverage, living expenses, and a stipend.

autumn 2017 || 3


MORE on MD/PhDs Is an MD-PhD right for you? The MD-PhD is a dual doctorate degree program for students who are interested in careers as “physician-scientists." By graduation, you’ll have fulfilled requirements for both the MD and PhD degrees. The MD-PhD takes about 8 years to complete during which you receive medical training AND become an expert in a specific research field. The program also requires dissertation research in your field of graduate study, which can range from biomedical laboratory disciplines like biochemistry or genetics to fields like economics, sociology, or anthropology. After graduation, MD-PhD students usually work as researchers or as faculty members at medical schools and universities. What are Medical Scientist Training Programs? Medical Scientist Training Programs (MSTP) are MD-PhD programs that are funded by the National Institute of Health. Students who are admitted to these highly-competitive programs receive full tuition coverage, living expenses, and a stipend. There are currently 45 NIH-funded MSTP programs. Are all MD-PhD programs free? Over 60 medical and osteopathic medical schools maintain their own MD-PhD or DO-PhD programs that are not funded by the NIH. Depending on the school, these programs offer full or partial financial support for their students. Applying to MD-PhD Programs Nearly all MD-PhD programs use the same application process as MD admissions – via the American Medical College Application Service (AMCAS) application. One key difference? MD-PhD applicants submit two additional essays: the MD-PhD Essay and the Significant Research Experience Essay: • The MD-PhD Essay asks you to explain your reasons for pursuing the combined degree program. • The Significant Research Experience Essay asks you to describe your key research experiences, including your research supervisor's name and affiliation, the duration of the experience, the nature of the problem studied, and your contributions to the project. Do you need GRE scores to apply for the MD-Phd? Programs have different policies, so some schools may require both the MCAT and the GRE for combined degree applicants. For example, an MD-Phd in Anthropology at one school may require the GRE, while the MD-PhD in Immunology may not. Check with your prospective med schools to make sure you’re covered. Timeline for MD-PhD Admissions The MD-PHD application timeline is virtually the same as for MD admissions. (Remember you are using the same application service!) Here are the important dates for MD-PHD admissions: • Early May: AMCAS opens and begins accepting transcripts • Early June: AMCAS begins accepting application submissions • October – March: MD-PhD applicant interviews • December – March: Admissions decisions sent to applicants • March – April: MD-PhD applicants make their final decisions • June – August: MD-PHD programs begin!

4 || pulse


EDUCATION

Kaplan MCAT PRACTICE PROBLEM QUESTION A patient comes in with a tumor of the pituitary gland, which grows upward into the optic chiasm and causes a visual field defect. The most likely defect from compression of the optic chiasm is:

A. complete blindness in one eye. B. loss of the upper visual fields in both eyes. C. loss of the nasal visual fields in both eyes. D. loss of the temporal visual fields in both eyes.

THINK YOU’RE READY FOR TEST DAY? Find out with this fun and FREE way to tackle practice MCAT questions from Kaplan Test Prep. Register to receive one sample question a day for the next three months. You’ll get: • A new MCAT-style question each day to test your knowledge and skills • Complete explanations and expert strategies with every question • Compete against your friends to see who’s really ready for test day To get started go to: https://www.kaptest.com/mcat/mcat-practice/free-mcat-practice-question-a-day

D. The optic chiasm houses the crossing fibers from each optic nerve. Specifically, the fibers coming from the nasal half of the retina in each eye cross in the chiasm to join the optic tract on the opposite side. Remember that the lens of the eye causes inversion, so images on the nasal half of the retina actually originate in the temporal visual field. This condition is called bitemporal hemianopsia. ANSWER autumn 2017 || 5


BIRTH CONTROL IN THE TRUMP ERA By

BEATRIX BRANDFIELD-HARVEY IRENA HSU (Editor)

Friday, October 6th of 2017, was a bleak day for many women across the United States as they watched President Trump release a set of federal regulations that allowed employers – both nonprofit and for-profit – to deny birth control coverage if they held religious or moral objections to such services. This decision, which may seem to be a black-andwhite issue for many employers, misses the nuance of birth control and the struggles that many women went through to make it publicly available. For much of the 19th and 20th century, birth control was not easily accessible for women, and due to anti-obscenity laws, doctors did not spread information on the topic. The birth control movement in the early 20th century surfaced around the same time as the feminist movements and stemmed from women’s desire to finally take control over their sexual decisions. At the forefront of this struggle was Margaret Sanger, the founder of Planned Parenthood, who popularized the term “birth control.” Through years of planning and campaigning, she and the many others working alongside her finally got the FDA to approve the first oral contraceptive for women in 19601. While birth control is still widely known as a form of pregnancy prevention, it is now used for a variety of cases. For example, birth control also

6 || pulse

helps to regulate menstrual periods, treat acne, and decrease menstrual cramps. Additionally, the American Cancer society found that women who used the Pill for at least 5 years had a 50% lower risk of developing ovarian cancer in their lifetime2. The NY Times reported that “according to the Guttmacher Institute, fifty-eight percent of all women who use the pill rely on it, at least in part, for something other than pregnancy prevention,”3 which strongly emphasizes that the Pill benefits women in multiple regards. In addition to this restriction on birth control, President Trump’s new regulations will require health insurers to inform their patients that should they choose to have one, they must pay for abortions out of a separate fund. Interestingly enough, past research has shown that this requirement is counterintuitive. In 2012, work done at the Washington University School of Medicine in St. Louis revealed that when 9,000 women were granted free contraceptives, the number of abortions fell by two-thirds to three-quarters of the national rate at the time.4 Additionally, according to the Guttmacher Institute, without contraceptive services covered by Planned Parenthood in 2015, the number of abortions would have been 15% higher. Therefore, the roll back on Obamacare may see an increase in abortions, and


POLICY

Wasserman, Dan. GOP and birth control. February 13, 2012. Illustration. Accessed November 9, 2017. http://archive.boston.com/ bostonglobe/editorial_opinion/ outofline/2012/02/gop_and_birth_ control.html.

for women who can’t afford them, oftentimes pricey procedures or dangerous at-home attempts. While people may share different views on the morality of birth control, the main point is that Trump is taking away the freedom of choice from the individuals most impacted by the loss of contraceptives. Since there isn’t a set standard for what constitutes religious or moral exemptions, the power to withhold one of the most used medications among women is completely within the hands of the employers. This rule came about as a result of the executive order Trump made in May of 2017 that aimed to promote religious freedom and offer “regulatory relief ”5 to individuals who opposed the Affordable Care Act’s (ACA) contraceptive coverage guarantee under the Obama administration. The ACA of 2010 had a significant impact on women’s health by making coverage of contraceptives a requirement under private health plans. More specifically, the mandate guaranteed coverage for eighteen methods of contraception, such as IUDs, as well as counseling services. The coverage meant that there were no patient out-of-pockets costs, including copayments and deductibles. A study conducted by Penn Medicine in 2015 found that the out-of-pocket costs for oral contraceptives dropped 38% and the costs of IUD’s fell by a steep

68% through the ACA.6 Contraceptives account for a huge part of what women spend on healthcare, an estimated 30 to 44% according to the Penn Medicine researchers; therefore, these lower costs are crucial for women’s well-being, especially low-income women. According to a Brookings Institute report done in 2015, low-income women are five times more likely to have an unplanned pregnancy than affluent women, and “since unintended childbearing is associated with higher rates of poverty,” the costs of birth control are insurmountable.7 The ACA under the Obama administration relinquished a significant barrier for women, but Trump’s policies raise the question: what are the consequences for women’s health? According to the Guttmacher Institute, preventing unintended pregnancy can also prevent health issues “such as diabetes, hypertension and heart disease,” and help women achieve their educational and professional goals. For instance, they found that 75% of pregnancies among 15 to 19-year-olds are unplanned. Planned Parenthood has reported that teen mothers are more likely to live in poverty and less likely to graduate high school. If teens and women have control over their bodies via birth control, they can support themselves and their families in ways that increases their standard of living.

autumn 2017 || 7


Another big concern, according to the Institute, is that many nonprofit companies such as hospitals and charities are affiliated with the Catholic Church – an entity that generally promotes the exclusion of contraception and values celibacy, especially among teenagers. Thus, there is uncertainty regarding whether or not these nonprofits will begin to deny contraception coverage to women under the new federal regulations. In the confusion that is sure to ensue as women try to deal with the consequences of these regulations, many states, including civil rights organizations such as the American Civil Liberties Union and the Center for Reproductive Rights, have risen up and announced lawsuits to challenge the Trump administration in protection of these lost rights. For instance, the ACLU and other various advocacy groups have spoken out saying that by denying its members birth control, the Trump administration is violating the Establishment Clause and the Equal Protection Clause of the Constitution “by authorizing and promoting religiously motivated and other discrimination against women seeking reproductive health care.”8 Furthermore, it is likely that there will be many public outcries, especially through social media, that will put pressure on institutions to keep contraception coverage in their contracts. On Instagram, people have already started posting with the hashtag “#HandsOffMyBC” to express their concerns for the new rule and to talk about why they personally use birth control. Individuals are refusing to accept the changes to Obamacare, and there are few better ways to raise awareness and create movements than through social media. Ultimately, there are harmful effects at stake for women and as long as health care for women lies in the hands of anyone other than themselves, the future of women’s health remains uncertain.

8 || pulse

1. Thompson, Kirsten M.J. "A Brief History of Birth Control in the U.S." Our Bodies OurSelves (blog). Entry posted December 14, 2013. Accessed November 9, 2017. http://www.ourbodiesourselves.org/ health-info/a-brief-history-of-birth-control/. 2. American Cancer Society. "Can Ovarian Cancer Be Prevented?" American Cancer Society. Accessed November 9, 2017. https://www. cancer.org/cancer/ovarian-cancer/causes-risks-prevention/prevention. html#written_by. 3. McDonald-Mosley, Raegan. "Trump Takes Away Fundamental Health Care for Women." The New York Times, October 6, 2017, Opinion. Accessed November 9, 2017. https://www.nytimes.com/2017/10/06/ opinion/trump-birth-control-contraception.html. 4. Fox, Maggie. "Trump Contraceptive Move Could Lead to More Abortions." NBC News, October 8, 2017, Health. Accessed November 9, 2017. https://www.nbcnews.com/health/health-care/trumpcontraceptive-move-could-lead-more-abortions-n808581. 5. Nedelman, Michael, Tami Luhby, Laura Jarrett, and MJ Lee. "Trump administration deals major blow to Obamacare birth control mandate." CNN. Last modified October 6, 2017. Accessed November 9, 2017. http://www.cnn.com/2017/10/06/health/trump-birth-controlmandate/index.html. 6. Duerr, Anna. "Affordable Care Act Results in Dramatic Drop in Out-of-Pocket Prices for Prescription Contraceptives, Penn Medicine Study Finds." Penn News. Last modified July 7, 2015. Accessed November 9, 2017. https://news.upenn.edu/news/ affordable-care-act-results-dramatic-drop-out-pocket-pricesprescription-contraceptives-penn-me. 7. Reeves, Richard V., and Joanna Venator. Sex, contraception, or abortion? Explaining class gaps in unintended childbearing. Washington, DC: Brookings Institution, 2015. Accessed November 9, 2017. https:// www.brookings.edu/wp-content/uploads/2016/06/26_class_gaps_ unintended_pregnancy.pdf. 8. "ACLU Filing Lawsuit Challenging Trump Administration Contraceptive Coverage Rule." American Civil Liberties Union. Last modified October 6, 2017. Accessed November 9, 2017. https://www. aclu.org/ news/aclu-filing-lawsuit-challenging-trump-administrationcontraceptive-coverage-rule.


POLICY

SPOTLIGHT: ARE WE SURVIVING SEPSIS? By

MEDHA REDDY IRENA FENG (Editor)

While modern medicine has made significant strides in the outcomes of many infections, physicians and researchers still struggle to find a protocol that improves SEPSIS survival rates. SEPSIS is a life-threatening excessive immune response to infections, resulting in tissue damage or organ failure; the body begins to attack itself in lieu of infection-causing pathogens. The CDC reports that one in three hospital deaths can be attributed to SEPSIS1. In response to the high mortality rate, the Surviving Sepsis Campaign was started in 2002 with the goal of outlining guidelines to reduce the mortality rate by 25% within 5 years2. One critical marker in tracking SEPSIS is the level of serum lactate in the body. Serum lactate of hypoperfusion and hypoxia. The guidelines recommended by the Surviving Sepsis campaign set strict serum lactate levels at which medical practitioners should begin supplying the patient with “oxygen, IV antibiotics and IV fluids�3. Due to the slight efficacy noted in regional case studies, these guidelines have been incorporated by the Center for Medicare and Medicaid Services. Nonetheless, the resources provided by the Surviving Sepsis campaign fail to track or estimate the success of these protocols on a national level.

The campaign also fails to address the cases of patients with high serum lactate levels who are not experiencing SEPSIS. Suppose a patient has just run a marathon, and presents to the hospital for treatment of a condition unrelated to infection or SEPSIS. This patient will have high serum lactate levels for reasons unrelated to SEPSIS, yet some current Medicare and Medicare reimbursement policies regardless will require treatment with the SEPSIS bundle. Physicians are placed in the conflicting position of having to treat patients with the SEPSIS bundle who present with a different condition due to fiscal pressure from the Medicare and Medicaid system. This firm procedure changes the consideration of a pre-SEPTIC patient and casts doubt upon the true effectiveness of the campaign, which is furthered by the lack of large-scale data from the Society of Critical Care Medicine. "Sepsis." Centers for Disease Control and Prevention. August 25, 2017. Accessed November 16, 2017. https://www.cdc.gov/sepsis/datareports/ index.html. "History." Surviving Sepsis Campaign. Accessed November 16, 2017. http:// survivingsepsis.org/About-SSC/Pages/History.aspx. Cronshaw, Helen Lindsay, Ron Daniels, Anthony Bleetman, Emma Joynes, and Mark Sheils. "Impact of the Surviving Sepsis Campaign on the recognition and management of severe sepsis in the emergency department: are we failing?" Emergency Medicine Journal. January 01, 2010. Accessed November 16, 2017. http://emj.bmj.com/content/ early/2010/07/23/emj.2009.089581.short.

autumn 2017 || 9


SEEING AN INVISIBLE DISEASE By

SWATHI BALAJI CHRISTIE DU (Editor)

Denial. Anger. Bargaining. Depression. Acceptance. It’s expected that someone who has lost a loved one will experience these stages of grief. But what about a patient – a patient without a support network, without a solution from physicians, and with an invisible disease that some just do not acknowledge? Should this patient also be experiencing the stages of grief, eventually accepting his or her condition as an inescapable and painful reality? Unfortunately, more than 3 million people per year in the United States have the chance to sink into these stages due to their invisible disease: fibromyalgia. Fibromyalgia is a chronic disorder that affects 2 to 4% of adults, primarily women, and causes regular widespread pain and fatigue, insomnia, and cognitive dysfunction, i.e. memory and concentration issues, denoted as fibro-fog. Even though it is commonly associated with rheumatoid arthritis, fibromyalgia is a multifaceted disease with neurological, immunological, genetic, hormonal, and social factors1. While physicians do not know what exactly causes the disease, fibromyalgia in patients seems to be linked with genetics, physical or mental trauma, and other comorbidities. A potential cause of fibromyalgia is the repeated stimulation of central nerves via the increased levels of certain neurotransmitters that signal pain, which causes

10 || pulse

pain receptors to become more sensitive. Patients thus have painful responses to normally unpainful stimuli2. Fibromyalgia may also be associated with the damage of peripheral nerves, which can lead to chronic pain. As fibromyalgia is related to stress, patients with the disease demonstrate elevated cortisol levels and disruption of their circadian rhythm, which subsequently causes insomnia and other sleep disorders. Researchers have also found that some patients may have fibromyalgia due to accompanying infections, autoimmune diseases, gluten intolerance, depression, and/or their genetic makeup, such as a mutation in the serotonin transporter gene, affecting a patient’s mood and leading to psychological distress1. Regardless of these factors that may affect the pathogenesis of fibromyalgia, the causes of fibromyalgia are still under speculation. Diagnoses can only be made through assessments of a patient’s pain level, since the disease has varying symptoms and cannot be detected through laboratory abnormalities1. Because fibromyalgia is difficult to diagnose, both physicians and patients become frustrated – physicians annoyed by their inability to offer a long-term solution aside from pain medications and anti-depressants, patients fettered by a seemingly incurable disease that constantly affects their lives. As revealed in a study published in 2010, physicians reported insufficient knowledge and skill when confronting fibromyalgia, and a few even claimed that the condition cannot be diagnosed3. Although more physicians are aware of the disease today, the stigma surrounding the disease unfortunately has not disappeared.


RESEARCH

Physicians who do not believe in patients’ symptoms and dismiss them only add to this culture of stigma, doing more harm than they could imagine. Without support from their medical providers and loved ones, patients can sink into a “culture of fibromyalgia,” where they incorrectly assume that fibromyalgia is incurable and engage in counterproductive behaviors, such as seeking disability benefits or doing minimal exercise to reduce their pain. This behavior negatively affects physicians’ attitudes as well, leading doctors to believe that their patients are unwilling to take care of their health3. In a patient-doctor dialogue, Margaret Oldfield, a researcher and fibromyalgia patient, revealed that she avoids fibromyalgia culture by exercising vigorously, getting massages, and having her depression treated. Oldfield advises physicians to use words like “recover” and “feel better” to re-instill hope in fibromyalgia patients and help them avoid fibromyalgia culture4. But are words enough to truly re-instill hope? How about a more tangible form of hope – through better therapeutic options? Fibromyalgia is typically treated with medications including pain medications, anti-depressants like selective serotonin reuptake inhibitors (which increase levels of serotonin available for signaling), and anti-seizure medications. One of the first medications designated for fibromyalgia that is still widely prescribed is pregalbin, a drug that treats nerve pain, seizures, and muscle pain. Today, the gears are shifting, and new treatments are targeting inflammation in the brain. An example of a more recently developed treatment is low-dose

living-smarter-with-fibromyalgia.com

autumn 2017 || 11


naltrexone, which can reduce inflammation in the central nervous system and alleviate fibromyalgia symptoms by modulating glial cells, as found in clinical trials conducted at Stanford University5. Medical marijuana, which contains cannabidiol, a key psychoactive component, may also have therapeutic effects against fibromyalgia by reducing neuro-inflammation. While these medications can effectively relieve symptoms of pain, depression, stress, and insomnia, they do not necessarily facilitate lifestyle changes or a better quality of life for the patient. Some alternative therapeutic choices that would facilitate an improved lifestyle for fibromyalgia patients include yoga, exercise, acupuncture, massage, increased rest, reduced stress, meditation and relaxation, and improved nutrition. Aside from making lifestyle changes, fibromyalgia patients can also undergo new types of therapies, such as those that emphasize emotional support for the patient. For instance, in a 2017 paper, Lumley et al. proposes a newly devised therapy, known as Emotion Awareness and Expression Therapy (EAET), which addresses the key issues that fibromyalgia patients face, including “psychosocial adversity, trauma, and emotional conflict”6. The goal of EAET is to allow patients to engage with and express emotions that they might avoid, such as those associated with adversity and conflict, and to grapple with and understand their condition. Through EAET, patients are encouraged

to identify and express their avoided emotions by engaging in role-playing techniques, communicating honestly with their loved ones, being aware of their emotions, and using expressive writing6. EAET was found to be well accepted by and beneficial to fibromyalgia patients, especially those who have experienced trauma or psychosocial adversities. Regardless of these therapeutic options, fibromyalgia remains an invisible disease, predominantly because it is more common in women than it is in men – over 75% of people with fibromyalgia are women. Unfortunately, gender bias is a reality that affects the diagnosis and treatment of fibromyalgia. Since fibromyalgia is perceived to be a women’s disease, there is a lack of effort in the diagnosis of the disease and fewer concessions are offered in applications for disability allowance and unfitness for work7. This is especially a key problem in European and Latin American countries, where fibromyalgia is not as visible as it should be and is not given priority in national health plans7. Of course, gender bias also has repercussions in the United States, in that it drastically affects a fibromyalgia patient’s quality of life; for instance, men feel pressured to go to work despite their chronic pain, due to assigned gender roles, and women still feel obligated to fulfill domestic responsibilities such as housework7. Physician attitudes are also influenced by gender bias; some physicians were found to identify female patients as problematic, weak, and complaining, since male

nationalpainreport.com

12 || pulse


RESEARCH

patients do not seem to complain about the same issues. Thus, physicians can underestimate the pain that their patients actually face7. Thankfully, such attitudes are shifting as fibromyalgia becomes more visible, hopefully preventing more patients from sinking into fibromyalgia culture and break free from the stereotypes associated with the disease. Various organizations, such as the National Fibromyalgia Association (NFA) and the National Fibromyalgia and Chronic Pain Association (NFCPA), are working to improve the visibility of fibromyalgia and offering resources for patients and those who would like to advocate for increased awareness of the disease. Celebrities such as Lady Gaga, who was recently hospitalized due to her chronic pain, are also making significant and groundbreaking contributions to fibromyalgia awareness by sharing their own experiences of how they deal with the disease on a daily basis. But awareness efforts should not stop at the level of large organizations and celebrities – they shouldd come down to the level of every individual, spreading awareness by wearing purple wristbands and posting on social media, attending local awareness events, writing about the disease, and working with others to fundraise for fibromyalgia research. Fibromyalgia is not limited to one avenue of medicine. It requires treatment from many different fields, utilizing psychiatric, rheumatologic, neurological, and alternative approaches. To truly

transcend the invisibility of the disease, physicians must look beyond physical symptoms and view the patient as a whole, considering the patient’s attitude, support system, and lifestyle, and looking beyond stereotypes. Those who suffer from fibromyalgia should not have to succumb to stereotypes, and should feel free to advocate for themselves with the support of their caregivers and family members. Fibromyalgia is not invisible; we just need to open our eyes and acknowledge that it is a reality – a reality that can and should be addressed. 1. Bellato, Enrico, Eleonora Marini, Filippo Castoldi, Nicola Barbasetti, Lorenzo Mattei, Davide Edoardo Bonasia, and Davide Blonna. "Fibromyalgia Syndrome: Etiology, Pathogenesis, Diagnosis, and Treatment." Pain Research and Treatment 2012 (11/04, 06/28/received, 09/09/revised, 09/12/accepted 2012): 426130. 2. Clauw, D. J. "Fibromyalgia: An Overview." [In eng]. Am J Med 122, no. 12 Suppl (Dec 2009): S3-s13. 3. Hayes, Sean M., Genevieve C. Myhal, John F. Thornton, Monique Camerlain, Cynthia Jamison, Kayla N. Cytryn, and Suzanne Murray. "Fibromyalgia and the Therapeutic Relationship: Where Uncertainty Meets Attitude." Pain Research & Management : The Journal of the Canadian Pain Society 15, no. 6 (Nov-Dec 2010): 385-91. 4. Alghalyini, Baraa, and Margaret Oldfield. "That Sinking Feeling: A Patient-Doctor Dialogue About Rescuing Patients from Fibromyalgia Culture." Canadian Family Physician 54, no. 11 (2008): 1576-77. 5. Younger, Jarred, Luke Parkitny, and David McLain. "The Use of Low-Dose Naltrexone (Ldn) as a Novel Anti-Inflammatory Treatment for Chronic Pain." Clinical Rheumatology 33, no. 4 (02/15, 01/16/ received, 01/22/revised, 01/26/accepted 2014): 451-59. 6. Lumley, M. A., H. Schubiner, N. A. Lockhart, K. M. Kidwell, S. E. Harte, D. J. Clauw, and D. A. Williams. "Emotional Awareness and Expression Therapy, Cognitive Behavioral Therapy, and Education for Fibromyalgia: A Cluster-Randomized Controlled Trial." [In eng]. Pain (Aug 08 2017). 7. Briones-Vozmediano, Erica. "The Social Construction of Fibromyalgia as a Health Problem from the Perspective of Policies, Professionals, and Patients." Global Health Action 9 (12/19, 05/26/received, 10/30/ revised, 11/02/accepted 2016): 10.3402/gha.v9.31967.

nationalpainreport.com

autumn 2017 || 13


HOW WE BECAME INTERESTED IN THE HUMAN MICROBIOME By

JASMINE BARNARD ANYA DUNAIF (Editor)

The human microbiome is the collection of the 10 to 100 trillion microorganisms that live in and on the human body. While they are ten times smaller than any human cell, they are so numerous that they make up about 1 to 3 percent of our body mass. The human microbiome is comprised of bacteria, archaea, fungi, protozoa and viruses, but the main focus of academic and medical research has been bacteria, as they are the most numerous. We have had knowledge of the existence of microorganisms in our bodies since the late 1800s, when an Austrian pediatrician by the name of Theodor Escherich discovered and studied the presence of E. coli in the intestines of his patients with diarrhea. Since Escherich’s discovery, bacteria have been associated with disease, and the notion of a vast ecosystem of benign bacteria living symbiotically with humans was not popularized until the early 2000s. In 2005, a $153 million grant from the National Institute of Health established the Human Microbiome Project. This was in response to new DNA sequencing technology and early landmark studies on the human genome. One such study is the Human Genome Project, which was an international research project that mapped the location of all the known genes in the human genome. The study paved the way for the popularization of gene sequencing, producing better and less expensive technology. The Human Microbiome Project has essentially the same idea: sequence the DNA of all the bacteria in a human body, so that a database can be created as a starting point for future research.

14 || pulse

The grant from the NIH Common Fund went towards sequencing bacterial DNA and categorizing bacteria based on the genes coding for 16S ribosomal RNA, a component of the 30S subunit of the ribosome. This is a heavily conserved group of genes across bacteria, making it useful for constructing phylogenetic trees. Over the course of the study, samples were collected from the oral cavities, nasal cavities, skin, gastrointestinal tracts and urogenital tracts of 300 healthy adults. The resulting database of bacterial genomes is open to the public for research purposes. The resulting boom of research has given us a new understanding of how vital our microbiome is to our body’s metabolism, immune system, and overall health. However, it is also striking how very far we have to go in this field of study. Many studies up to now have been largely correlational, and efforts are being made to improve our understanding of the mechanisms by which bacteria support our health. The importance of understanding this part of our biology has become much more urgent since our microbiomes are rapidly changing in response to urban environments and the use of antibiotics. There are correlations between lack of certain microbial species and diseases such as obesity, inflammatory bowel disease, weakened immune system, and digestive issues. Microbiome transplants are being used as an effective treatment for these diseases. In addition to investigating the link between deficient or unbalanced microbiota and various


RESEARCH

diseases, we are also in the process of “mapping” the microbiome – determining the functions of different types of bacteria in our bodies. Research is also being conducted on the microbiome of types of buildings, public transit vehicles, and hospitals, in an attempt to learn how ecosystems of bacteria function in built environments. This will also help us better understand how our environment influences our own microbiota. Hopefully we will reach a place where we understand how we can take care of our health by taking care of our microbiome. About the Human Microbiome.” NIH Human Microbiome Project - About the Human Microbiome, National Institute of Health, hmpdacc.org/ hmp/overview/. Ferranti, Erin, et al. “20 Things You Didn’t Know About the Human Gut Microbiome.” The Journal of Cardiovascular Nursing, U.S. National Library of Medicine, 2014, www.ncbi.nlm.nih.gov/pmc/articles/ PMC4191858/. Institute of Medicine (US) Food Forum. “Study of the Human Microbiome.” The Human Microbiome, Diet, and Health: Workshop Summary., U.S. National Library of Medicine, 1 Jan. 1970, www.ncbi. nlm.nih.gov/books/NBK154091/. Kim S, Thiessen PA, Bolton EE, Chen J, Fu G, Gindulyte A, Han L, He J, He S, Shoemaker BA, Wang J, Yu B, Zhang J, Bryant SH. “Caffeine.” National Center for Biotechnology Information. PubChem Compound Database, U.S. National Library of Medicine, pubchem.ncbi.nlm.nih. gov/compound/caffeine#section=Depositor-Supplied-Synonyms. “An Overview of the Human Genome Project.” National Human Genome Research Institute (NHGRI), National Institute of Health, www.genome. gov/12011238/an-overview-of-the-human-genome-project/. Rogers, Kara. “Human Microbiome.” Encyclopædia Britannica, Encyclopædia Britannica, Inc., 7 Apr. 2016, www.britannica.com/ science/human-microbiome. Shulman, Stanford T., et al. “Theodor Escherich: The First Pediatric Infectious Diseases Physician? | Clinical Infectious Diseases | Oxford Academic.” OUP Academic, Oxford University Press, 15 Oct. 2007, academic.oup.com/cid/article/45/8/1025/344528. Zhang, Yu-Jie, et al. “Impacts of Gut Bacteria on Human Health and Diseases.” International Journal of Molecular Sciences, MDPI, Apr. 2015, www.ncbi.nlm.nih.gov/pmc/articles/PMC4425030/.

autumn 2017 || 15


CAR T CELL THERAPY: A LIVING DRUG By

SCOTT WU PURUJIT CHATTERJEE (Editor)

During the late spring of 2011, two-year old Austin Schuetz of Wisconsin began exhibiting lumps on the side of his neck and was taken by his mother to his pediatrician. Misdiagnosing the lump as an ear infection, the pediatrician prescribed him antibiotics that were unsuccessful at resolving the issue. Following a visit to another pediatrician for a second opinion, Austin was suddenly rushed to a nearby children’s hospital in order to undergo a bone marrow biopsy. This biopsy confirmed 9-year old Austin Scheutz

Austin’s distressing diagnosis; the previously active and healthy infant had developed acute lymphoblastic leukemia (ALL), a form of cancer initiated by a mutation in the mixed lineage leukemia (MLL) gene. Thus began the dreary and intense cycle of chemotherapy and cranial radiation. However, these treatments as well as a bone marrow transplant were met with a series of relapses. Austin’s pediatric oncologist was soon out of conventional treatment methods. Enter CAR T cell therapy. A gene immunotherapy treatment approach, CAR T cell therapy, or chimeric antigen receptor (CAR) T cell therapy, displays the promise to conquer previously untreatable cancer relapses. Using retroviruses – single-stranded RNA viruses with the ability to target a host cell – to inject genetic material in the form of engineered transgenes that are capable of recognizing tumor-associated antigens, CAR T cells can target and kill a broad range of malignant cancer cells. Dr. John Murphy, current Vice President of the Rare Disease Research Unit at Pfizer Pharmaceuticals, puts this process and past research regarding CAR T cell therapy into temporal and scientific perspective: “Understanding on a basic level how T cells recognize their target antigen and how that

16 || pulse


RESEARCH

leads to signals that tell T cells to mount an attack on a target cell has been [an ongoing focus of research] since the late 1980s.” Often referred to as a “living drug,” the process of CAR T cell therapy resembles treatment one would initially expect to find in a science fiction novel. After drawing blood from a patient, the T cells are separated and genetically engineered to produce chimeric antigen receptors – CARs – on the cell surfaces. The engineering mechanism works similarly to a vaccine and involves exposing the extracted T cells to a disarmed virus in order to promote CAR production. These engineered T cells with newly formed antigens, which are synthetic, are injected back into the patient where they can multiply, recognize tumor antigens, and destroy the tumor cells. Unlike chemotherapy and radiation, the CAR T cell therapy injection process is not a recurring procedure and can be completed in minutes; this injection process is not a course and does not require boosters. Despite the multiple extraordinary benefits of CAR T cell therapy, accessibility to this treatment varies due to cost, safety risks, and availability. Due to the cost of manufacturing and its vast abilities to positively impact quality of life in once-terminally ill patients, therapy costs are not cheap. According to Dr. Murphy, the first CAR T cell therapy drug,

Kymirah, which is manufactured by Novartis Pharmaceuticals, will cost approximately $475,000 per round of treatment. Due to the relatively small number of CAR T cell cases – less than 1,000 per year in the United States – insurers usually pay for the therapy. However, as the number of CAR T cell therapy cases rises due to the United States Food and Drug Administration’s (FDA) approval of new drugs and an increase in the number of hospitals offering the therapy, the current American healthcare and insurance systems may be exposed as inadequate in their funding of the treatment. Costs of manufacturing are lofty due to special gene therapy product regulations enforced on CAR T cell therapy, as companies such as Novartis are required to make CAR T cell therapy products under immensely strict good manufacturing practice (GMP) standards to ensure product quality and safety. Furthermore, the arduous and customized nature of CAR T cell production elevates costs; as Dr. Murphy notes, “each individual patient has a customized product made. Cells are harvested, sent to a central facility, conditioned and treated with the CAR T therapy under highly controlled conditions, analyzed for various critical components, released, and then sent back to the hospital for administration.” In addition to costs, accessibility is affected by safety risks; as is common in emerging biotechnol-

autumn 2017 || 17


ogy, the cancer patient population is not immune to adverse reactions to CAR T cell therapy. Recent trials of CAR T cell therapy have seen an increase in fatalities from cytokine storm syndrome, which is an adverse immune reaction that results from a positive feedback loop between cytokines and white blood cells. Subsequently, the safety risks as well as cost concerns affect the availability of CAR T cell therapy throughout global hospitals. A new and expensive drug, CAR T cell therapy is currently only offered at select hospitals that have access to treatment facilities. However, Dr. Murphy notes that an increase in corporate research in process development will likely render treatment available to a much larger patient population by “[making] this a more efficient process so that it can be reliably manufactured and available to more patients. Some companies, including Pfizer, are looking at

18 || pulse

off-the-shelf rather than custom manufactured next generation cells.” Despite the obstacles currently in place, for Austin and many patients, the CAR T cell therapy he received at the Children’s Hospital of Philadelphia was quick and lifesaving. Other than a low-grade fever and bad headache five days after the treatment, the two CAR T cell injections Austin received have rendered him healthy with no sign of the leukemia. At nine years old, the cancerous lumps in the now energetic and smiling boy’s neck have ceased to exist for over four years. Over the past decade, CAR T cell therapy has transformed from a research miracle into a linchpin clinical treatment option. Dr. Murphy elaborates upon contemporary biotechnological advances by stating how “the gene therapy technology used to introduce the CAR into cells is the result of many years of


RESEARCH

retroviral research in academic labs honed into practicality by biotech companies working on gene therapy.” Innovative and revolutionary, the second CAR T cells therapy agent was recently approved by the FDA. This agent, axicabtagene ciloleucel, treats B-cell lymphomas in adults who have experienced multiple relapses or refractory periods. At University of Chicago Medicine, the medical center has just announced the launch of the first CAR T cell therapy program in Illinois. By using the newly approved axicabtagene ciloleucel drug, University of Chicago Medicine will treat patients with large-B cell lymphoma, the most common type of non-Hodgkin lymphoma among adults. In addition to success stories like Austin Schuetz’s, CAR T cell therapy has the potential to treat other cancers and autoimmune diseases such as HIV/AIDS. While current treatment is mainly reserved for children with acute leukemia such as Austin, the expansion of CAR T cell therapy rests on the medical horizon, looking into aggressive forms of lymphoma, multiple myeloma, and other forms of leukemia that form solid tumors. With regard to autoimmune diseases, the engineering of CAR T cells to recognize and target diseased cells of hemophilia and pemphigus vulgaris (PV) has been researched in vitro and could soon impact thousands of patients. Gene editing has long been a treatment mechanism relevant to human immunodeficiency virus (HIV), and advances in CAR T cell cancer therapy promise revolutionary treatment of HIV patients. Engineering T cells to be resistant or to target cells that express HIV antigen proteins may provide a medical breakthrough for the virus that has infected over 60 million people since the 1980s. Furthermore, Dr. Murphy emphasizes the broad range of CAR T cell abilities by stating that “while cancer is the disease in which you primarily want to destroy a specific cell type, in other indications the goal is to repair a defective cells or tissue [with CAR T cells].” However, at present, the ability of CAR T cell therapy to revolutionize the treatment of cancer is of utmost appeal. In addition to serving as an initial success narrative of innovative corporate biotechno-

logical advancements founded upon decades of academic research, stories such as Austin Schuetz’s serve as a map for the future of cancer treatment. Of exceptional interest for decades, research and implementation of CAR T cell therapy and the larger realm of gene therapy will continue to advance medicine. The author would like to thank Dr. John Murphy for his knowledgeable contributions. “CAR T Cells: Engineering Immune Cells to Treat Cancer.” National Cancer Institute, National Institutes of Health, 31 Aug. 2017, www. cancer.gov/about-cancer/treatment/research/car-t-cells. “Chimeric Antigen Receptor (CAR) T-Cell Therapy.” Leukemia & Lymphoma Society (LLS), Leukemia & Lymphoma Society (LLS), 10 Sept. 2015, www.lls.org/treatment/types-of-treatment/ immunotherapy/chimeric-antigen-receptor-car-t-cell-therapy. Flemming, Alexandra. “Autoimmune Diseases: CAR-T Cells Take Aim at Autoimmunity.” Nature News, Nature Publishing Group, 30 Aug. 2016, www.nature.com/articles/nrd.2016.180?WT.feed_ name=subjects_drug-discovery. “New Insights into CAR T-Cell Therapy's Potential Side Effects.” Fred Hutchinson Cancer Research Center, Fred Hutchinson Cancer Research Center, 11 Oct. 2017, www.fredhutch.org/en/news/ center-news/2017/10/car-t-cell-side-effects-study.html. Philadelphia, The Children's Hospital of. “CAR T-Cell Therapy for Relapsed Leukemia: Austin's Story.” The Children's Hospital of Philadelphia, The Children's Hospital of Philadelphia, 20 July 2017, www.chop.edu/stories/car-t-cell-therapy-relapsed-leukemiaaustin-s-story. “UChicago Medicine First Site in Illinois to Offer CAR T-Cell Therapy for Cancer.” University of Chicago - Department of Medicine, University of Chicago, 20 Oct. 2017, medicine.uchicago.edu/ uchicago-medicine-first-site-illinois-offer-car-t-cell-therapycancer/.

autumn 2017 || 19


THE FIGHT AGAINST BLINDNESS:

10 DAYS IN THE GAMBIA A Case Study of the Sheik Zayed Regional Eye Care Center By

ABHIJIT RAMAPRASAD JUI MALWANKAR (Editor)

Millions of people around the world suffer from serious near-blindness visual impairment1; ninety percent of them reside in developing countries and low-income areas. These combined factors cause severe and long-lasting difficulties, such as major difficulties for children in education due to their inability to read at a distance, or the loss of the ability to work, resulting in lifetime consequences. While the majority of visual impairment is treatable, doctors specializing in such treatment are exceedingly rare in the developing nations which face the brunt of the challenges of avoidable blindness, and experienced doctors are even rarer. Even then, treatment can be prohibitively expensive, and

20 || pulse

requires follow-up treatment over a long period of time. For many, it is arduous and exhausting, if not outright impossible, to get treatment, adding to the difficulties already present in their environment. Specifically, sub-Saharan Africa suffers from a disproportionately large amount of avoidable blindness, with a rate of blindness increasing faster than the rest of the world (Budenz et al., 2012)3. The Gambia is one such sub-Saharan nation, the smallest on the continent. Barely wider than 30 miles at its widest point and with more than ten percent of its area covered by water, it is dwarfed by its neighbors. A third of the country’s population lives below the international poverty line2. Though its history


REFLECTION

has been relatively peaceful, the nation has never been prosperous, major reasons being the tiny amount of fertile land (small as the country may be, even less of its land is suitable for farming) and a lack of industrialization, leading to a weak economy and high unemployment. Therefore, the problem of avoidable blindness is serious, as there are very few doctors who can treat it, and of them many are younger doctors from other neighboring countries who only work in the Gambia for a few years. For this reason, a team of Indian ophthalmologists, led by Dr. KV Ravishankar, traveled to the Gambia for ten days in early September, intending to both to assist in treatment and to educate medical personnel in order to reduce the prevalence of avoidable blindness for the future. I went along with them as an undergrad student with an interest in medicine. The team consisted of eye surgery experts Dr. KV Ravishankar, of Usha Kiran Eye Hospital and Charitable Trust; Dr. Pradip Mohanta; oculoplasty specialist Dr. Arnab Biswas; anesthesiology professor Dr. KR Vasanthakumar; and myself as an observer, with additional logistical support from senior Rotary International member Dr. MV Ravikumar. Every member of the team was highly experienced and an expert in their field, and one aspect of their mission was to transfer some of this experience and knowledge to medical professionals in the Gambia. The team operated at Sheik Zayed Regional Eye Care Center in the city of Kanifing, near Banjul, the capital of the Gambia. The facility is the only one of its kind in Gambia, as the only place where Gambians in need of surgical correction for impaired vision can go. Even so, because of all of the factors involved, only three surgeons work at the center, two of whom are newer and trying to gain experience. For more basic procedures, a few other members of the staff also perform surgery, as cataract surgeons, for example. Still, the team at Sheik Zayed is very effective, and is able to treat many patients and perform many surgeries. Unfortunately, as it is the sole hospital in the country for procedures such as cataract removal and major corrective eye surgery, there is still more demand than can be easily handled, so often patients have to wait months after diagnosis to be

able to undergo surgery for their vision. Of the patients that were treated while Dr. Ravishankar’s team was there, some had even been waiting a full year. Such waits are worst for those with complex problems that could not be operated on simply, and could seriously affect the course of their lives. Children especially suffer, as their vision problems can make school difficult or impossible, costing them a great deal of time and causing them to fall behind their peers. This is why the team focused for the most part on pediatric cases for the ten days they were at work, and every procedure was, thankfully, very successful at correcting the patient’s visual problems. Many of the challenges at the eye center were logistical in nature. While the operating theaters were well set-up and some of the tools were modern, others were not, and some hadn’t been serviced in a long time. The limited tools restricted potential procedures that could have increased the efficiency in preparing for and shifting between surgeries. The Indian team brought a large number of their own tools and instruments, which greatly helped in their specific methods of surgery. Another logistical issue relating to the low number of tools and machinery was that while there were quite a few operating theaters, only a few could be efficiently used. Only two were in use when the team arrived, but they were only usable in conjunction for a few days, as one of them could only be used for local anesthesia cases, since there was only one anesthesia machine for general anesthesia. The vast bulk of cases had to be done in only one of the theaters due to this difficulty. This meant that only one surgery under general anesthesia could be performed at once, and most of the cases (as they were pediatric) had to be under general anesthesia. Even besides the two theaters that were functioning, the building had some others as well, but they were not in use when the team arrived. This is the result of equipment shortage, such as only having one functional surgical microscope and only one anesthesia machine, as well as lack of funding necessary to acquire more. The biggest logistical difficulty, and the one that was most completely and successfully solved

autumn 2017 || 21


when the team was at Sheik Zayed, was electricity. The Gambia has a power grid prone to blackouts, which also affected the eye center. While the surgical building had its own generator, it had been malfunctioning and could not power the building when the power went out, causing major difficulties. Without consistent electricity, the cases that could be safely undertaken was greatly reduced, meaning that, as long as a blackout was possible, the team could not take on general anesthesia cases (which, as aforementioned, were the majority of cases), especially long ones, as electric power was required for the anesthesia machine vacuum. The vacuum is necessary when concluding the operation and bringing the patient out of anesthesia; while they are anesthetized, they secrete fluids in their throat, which can block airways and cause major problems when bringing patients out of anesthesia if not vacuumed out. The longer a case, the more fluids secreted, increasing risk. In the case of a blackout, an operation would have to be ended prematurely to minimize risk and to have the patient ready to be brought out of anesthesia, as they couldn’t be revived from anesthesia until power returned. Thankfully however, the electricity problem was the logistical challenge the team was able to most successfully resolve. After the team met with and discussed their work and the issue with a local rotary club, one of the members who ran a generator business was willing to donate a generator to the hospital, which could be hooked up to power the surgical building constantly, without connection to the inconsistent main power grid. After the new generator was hooked up permanently, significantly more cases could be taken on. When speaking with the team, a hospital administrator mentioned that this was a huge advancement for the hospital, and would not only greatly help the team with performing surgery, but permanently improve the hospital’s ability to treat patients, for years to come, meaning many more patients in the future would be treated than otherwise could have been. There were also discussions of the Gambian government connecting the hospital to a more consistent specialized power grid (rather than the normal main power grid), as some other hospitals in the country are.

22 || pulse

Despite initially seeming like a daunting challenge, with help from everyone involved, the team was able to overcome the difficulty posed by the unreliable electricity, and because of it, were able to successfully treat many patients. Other than treating patients, the other goal of this mission was to convey some of the knowledge of the members of the Indian team to the staff at Sheik Zayed. Often, this took the form of suggestions for new, more efficient procedures inside and outside the operating theater. For example, for the first few days, there was some difficulty in scheduling patients, as often all the patients for the day would be fasting from the morning (fasting for six hours is necessary before being put under general anesthesia), regardless of when their operation was scheduled. This could be especially hard on children. After a few days, Dr. Ravishankar and the team explained how to prepare patients and the operating theatre for a day of many general anesthesia cases (a scenario the staff often didn’t find themselves in) in much more depth, resulting in much greater efficiency. There were also many suggestions for possible new equipment and tools worth investing in, as well as suggestions on how to better use the resources already present, such as explaining how to use all the functions of the surgical microscope and how to more quickly sterilize instruments in the autoclave. The two younger doctors who worked at the eye center also worked closely under the Indian surgeons, who mentored the less experienced doctors in superior surgical technique. Both of the younger doctors at the center were able to more thoroughly explore their areas of medical and surgical interest with the help of their mentors and their vast knowledge and experience. The Indian surgeons also directed the doctors at the center to other resources they could access in the future for study, such as archives of commentated surgery videos. At the end of the ten days, Dr. Ravishankar’s group left behind a highly capable team for the future, leaving lasting impact beyond their limited time. All told, the team completed roughly thirty-five operations, mostly of children, all highly successful. It was the result of the work of many people


REFLECTION

alongside the main team. Combat Blindness International helped initiate and plan the entire trip, and provided major support as well as surgical consumables. Rotary clubs from India, Portugal, the UK, the US, and the Gambia all provided assistance and logistical support. The Gambian Ministry of Health sponsored the program and was integral to its success in their logistical support of the team. Leaders of the Indian community in the Gambia also worked to help in any way they could. And of course, without the staff at Sheik Zayed, none of this would have been possible. This journey exemplifies both the challenges and the solutions in the fight against blindness in impoverished populations. Together, everyone was able to make a great change for the better, not just in the present, but for the future. For some of the surgeons on the team, this was one of their first surgical volunteering experiences. All of them were extremely interested in joining together again and volunteering their talents in the future. It is with great awe that I say that I hope that this journey is predictive of a brighter future.

1. "Vision impairment and blindness." World Health Organization. October 2017. Accessed November 10, 2017. http://www.who.int/ mediacentre/factsheets/fs282/en/. 2. "At a glance: Gambia." UNICEF. December 26, 2013. Accessed November 10, 2017. https://www.unicef.org/infobycountry/gambia_ statistics.html. 3. Budenz, Donald L., Jagadeesh R. Bandi, Keith Barton, Winifred Nolan, Leon Herndon, Julia Whiteside-de Vos, Graham Hay-Smith, Hanna Kim, and James Tielsch. "Blindness and Visual Impairment in an Urban West African Population: The Tema Eye Survey." Opthalmology 119, no. 9 (September 2012). June 5, 2012. Accessed November 10, 2017. http://www.sciencedirect.com/science/article/pii/ S0161642012003600?via%3Dihub.

autumn 2017 || 23


Living the Fight Against HIV from One of the Epidemic’s Epicentres By

SARAH NAKASONE FATIMA SATTAR (Editor)

24 || pulse


REFLECTION

It was raining the night I arrived in South Africa. Not a downpour, but the kind of rain that gets everything wet, all the same. Seven time zones away from home and more jetlagged than I was letting on, I mostly remember that night in small, insignificant details. It was raining as I walked across the tarmac, the radio was playing a Spanish song that had been popular the previous month in the States, and 22 hours of flying had left me with an absurd amount of emails to answer. Ordinary details. Nothing jarring. Nothing that made me feel as if I – through the magic of aviation and sheer dumb luck – had managed to find myself halfway around the world. Someone explained to me once that there is a science to the aura of places – the shock you feel when you step into a new environment. The newness is quantifiable – people of different places have different averages when it comes to stride length, speaking speed, even personal space radii. I’ve never quite believed this, mostly because I’ve never been able to sense it. Attribute it to a lack of attention to details or simply a lack of a baseline expectation for what things should feel like after a lifetime of being dragged around the world, but the minutia that make others feel out of place is lost on me. So, I don’t have any dramatic story of falling in love with South Africa. There was no singular moment where I looked up and looked around and realized that I was home. Nor was there a moment, even in the beginning, when I felt some, intense longing for a place I had left behind. I was jetlagged, yes. I was unsure how I was going to fill the long months that stretched ahead of me, true. But from the moment I touched down in country, I accepted that I belonged. (We were always told as military brats that we were like dandelions – able to grow and thrive anywhere we were planted. And here I was, 20 years old, seeds drifting in the wind, ready and eager after a long few months to start blooming all over.) – ·•· –

autumn 2017 || 25


The story of how I came to be in rural South Africa, where my town laid claim to exactly one stoplight (but two KFCs), begins in the way most of my stories do – with a couple of bottles of Goose 312, an inbred talent for never shutting up about my work, and a general level of confusion over my qualifications. (Nearly a year after hiring me, my boss still believes I’m working on a master’s degree.) Thanks to circumstances that sounded better suited to a networking conference than reality, I finagled my way onto a research team working with the DREAMS project in South Africa. And it wasn’t just another grunt research job with menial tasks (albeit in stunning surroundings) – my role was to lead all efforts related to the eventual PrEP rollout we as a team and they as a country were planning. It was the dream job I had described in every college application and, even now, at the close of my work here, I still can’t quite believe it happened. So, I ended up on the edge of a continent I had never seen before, sandwiched in between the Indian Ocean on one side and miles of safari territory on the other, with only the world’s smallest carry on and the conviction that I was doing something capital-I Important. – ·•· – Let me give you a map of what an ordinary day in this extraordinary part of my life looked like. The train hurtles by my room at 0433, waking me up every single morning. If I manage to make it back to sleep after that, I only have a few hours before the dogs who run the house are up and barking at any living (or non-living) thing that dares cross their field of vision. Early mornings are merely par for the course. The drive to work takes about 25 minutes if you drive like a normal person and 17 if you drive like a South African (for all the talk of violent crime in my town, the only time I truly feared for my life was watching my South African coworkers approximate a “normal” speed). The radio always plays a strange mix of songs that used to be popular in the U.S. and isiZulu conversations. Work is a mix of interviews with field workers, access to obscene amounts of data, and meetings where you debate the merits of using soap operas to stop HIV. It’s crying after talking to a nurse who describes the cries of people dying from AIDS

26 || pulse

and then taking the afternoon off to try to chase a chicken out of the office (it was too small to set off the automatic door). Thursday means fieldwork means trailing along after trackers whose job is to find and interview people for the demographic surveillance study. My only contribution is my bad isiZulu approximation of “May I take your picture?” Everyone laughs when I try to say this. Mtuba not being the sprawling metropolis London or Chicago or even Fairfax, Virginia is, my job is to be a researcher, so I go from home to work and then back to home where a terrible VPN connection and an underhanded propensity for saving important documents to my hard-drive makes it possible for me to continue to believe I am still at work. – ·•· – Maybe this sounds absolutely awful to you. Maybe the idea of living in a town where the one restaurant is also run by the local dentist, and is only open one night a week anyway, sounds mind-numbingly boring. But you have to remember that none of us who ended up in Mtuba were from there – we chose it because we thought the work would be meaningful. We thought we could be useful. The majority of us were expats, the rest of us were from other areas of the country and all of us were trying to make our home in a place we had never seen before. And because we chose this place, we also had to choose each other. We became each other’s doctors when one of us came down with tuberculosis, the planning committee when one of us had a birthday or graduation to celebrate, the taxi driver when one of us needed to go to the store but didn’t have a car. And if we cheered a little louder at celebrations or were a little bit kinder to each other because we knew we could never replace the people who were oceans away, then so be it. And those of us like me – younger researchers who still had the luxury of being overly transient and the aversion to staying any place long enough to need a work visa – we all lived in one, crowded, lively house. We were coworkers by day, siblings by night, and co-adventurers by weekend when the boredom of being in the middle of nowhere, South Africa finally hit us. There’s this special kind of bond you create when you’re all trying to save the world the same way. Not


REFLECTION

family by blood but by shared idealism. We were that for each other. – ·•· – The housemates and I became the center of each other’s universe. We made battle plans over cheap wine, drew up strategic attacks on our drives to the beach, thought that if we just read one more article, formulated one more convoluted diagram, ran the data one more time with one new test, then we’d be able to save someone. Anyone. The epidemic became the air we breathed, the water we drank, and we laughed because we were clever and driven and clearly meant to solve this problem. The WHO had promised us that we were going to end the epidemic by 2030 and so many of us wanted to believe that. So, I talked about PrEP and Dan researched life expectancy perceptions and Val worked on mobile applications and Siya argued with non-profits on

layering services, and we waited for the breakthrough to come. But the longer you stay here, the farther you get from the glossy brochures that promise we are almost there, almost done fighting this epidemic. You get entrenched in the statistics that are not improving (a drumbeat of incidence and prevalence rates that seemed like a funeral dirge, even with life-saving medications) and suddenly our glorious projects and plans and strategies felt a lot like lobbing water balloons at a forest fire. (Who can say that we were good and smart and kind and willing to fight like hell and sometimes it still wasn’t enough.) But we kept fighting. And this time it wasn’t the promises of the WHO or PEPFAR or UNAIDS and their beautiful pictures that drove us. It was the children who

autumn 2017 || 27


28 || pulse


REFLECTION

hid behind their mother’s skirts and smiled shyly when we ventured out to do field work. It was the old nurses who chattered distractedly, showing us how even though we had so much farther to go, we had still come so incredibly far. It was each other. The rare moments when we talked about the little improvements we saw. The laughter that spilled over everything, promising us that one day it would be better. It was the knowledge that it was going to take generations to defeat this disease here but someday, it would be defeated and our little water balloons would have made some tiny bit of difference. – ·•· – The stories we – especially as expats – tell about the places we live and work carry weight. We are purveyors of both the exotic and the mundane. The triumphs and tragedies of the work into which we throw our lives. We spin stories about the research we want to do for grants; for public sympathy; for more funding for the people and places that are not ours, but that we love just the same. I am still trying to figure out what stories I will tell of my time here. Because some of those stories are about birds with colors so bright you would have thought they’d been dunked in paint cans, blurs of bright yellow and deep turquoise against the cloudless sky outside my office building. About morning markets that are an endless chorus of laughter and bartering and women calling after me, asking me to be their “Makoti” (daughter-in-law), haggling the number of cows it will take for me to marry their sons. About the mornings my male housemate and I have to go buy 1050 condoms for his study and we glare at the cashier, daring them to say something. About the silent truce the monkeys and I have developed after what we shall only term here as “the great produce escapade of Winter 2017.”

But there are other darker stories too. About the days and weeks we go without internet because people are so desperate for a little money to buy food that they will dig up the cables for that bit of copper to sell. About the girls who refuse to approach us in the field, terrified that we’re part of the group in this area who kidnaps young women to cut them up and sell them for body parts. About the way I can’t even walk to get groceries without someone trying to grab at me – without a crowd of men surrounding me, jeering and filming my every move. About the lines of people who wrap around the clinic, averting their eyes from us, as they wait for the medications that will keep the HIV at bay. I am not always sure where the intersection of these stories is. I have not yet figured out how to tell them in a way that does justice to both sides. – ·•· – Gabriel Garcia Marquez never visited Mtuba but he wrote of Caracas: “It is one of the beautiful frustrations of my life that I did not stay forever in that infernal city.” I’m thinking of that now, before my plane takes off and I leave the country for what may very well be years. How frustrating and beautiful it was to make my home here. How much the roving cast of roommates with plans and beer and laughter (the three ingredients to saving the world) both broke my heart and kept me sane. There is so much work we have yet to do. I’m sorry I could not stay forever in this infernal city. With utter thanks to the Study Abroad office at the University of Chicago who gave me the grant to go to South Africa to do research, and the family I made while in-country who taught be the importance of data collection and storytelling. All images taken by Sarah Nakasone.

autumn 2017 || 29


ATCAACGCAAGGATCGGTGATGTTAACAAAGATTC TGATGTTAACAAAGATTCGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTATGGCAAAACCGATGGGGAATGATTCGGGTAGCGCTAAAAGTCCATA GACGACCGCTTCACGCTAAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAATTACGGAGTGGGCGGCCTGGCGGGAGCACTACCCCATCGACGCGTACT TGGCGTGCGTACAGTTTGACGACCGCTTCACGCTA AGTAGAGTGCCGCTTTCAGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGTTGATGTGGATCGACTCTATAGAGGCATCTACTGATGCGTAGGGAGATCCGGAATGTATTGGC TCTCACATGAACAAATTAGTAGAGTGCCGCTTTCA TCCAAACACCCCATGTCGTTACTGAACGTATCGAC GTTACTGAACGTATCGACGCATACCTCCTTCGTTGAGAACTCACAATTATACAACTGGGGACATAATCCCTACGCCCATCTTCTACACCCGTCTCTGTGGGTCCAGTTCAAGTGCT AAGGTCTAGTGGTATGGTGGTATAGTAAGCTCGTA TGGTATAGTAAGCTCGTACTGTGATACATGCGACAGGGGTAAGACCATCAGTAGTAGGGATAGTGCCAAAGCTCACTCACCACTGCCTATAAGGGGTGCTTACCTCTAGAATAAGT CATGAGGAACCGAAAAGGCGAACCGGGCCAGACAA GCGAACCGGGCCAGACAATCCGGAGGCACCGGGCTCAAAGCCGCGACACGACGGCTCACAGCCGGTAAGAGTAACCCCGGAGTGAACACCTATGGGGCTGGATAAAACTGCCCTGG CAGGAGGCGGCCGGAGGGGGGATGTTTTCTACTATTCGAGGCCGTTCGTTATAACTTGTTGCGTTCCTAGCCGCTATATTTGTCTCTTTGCCGACTAATGAGAACAACCACACCAT CCGAATACGTGGCATTTCAGGAGGCGGCCGGAGGG AGCAGGCGCCTCGTAAGGCCATTGCGAATACCAGGTATCGTGTAAGTAGCGTAGGCCCGTACGCGAGATAAACTGCTAGGGAACCGCGTCTCTACGACCGGTGCTCGATTTAATTT CCTCGGAATACCGTATCAGCAGGCGCCTCGTAAGG TCCAGGCAGTGCCTCTGCCGCCGGGCCCCTCTCGT CCGCCGGGCCCCTCTCGTGATTGGGTAGTTGGACATGCCCTTGAAAGATATAGCAAGAGCCTGCCTGTCTATTGATGTCACGGCGAAAGTCGGGGAGACAGCAGCGGCTGCAGACA TAAGGTGAGATAACTCCGTAACTGACTACGCCTTC GTAACTGACTACGCCTTCCTCTAGACCTTACTTGACCAGATACAGTGTCTTTGACACGTTTATGGATTACAGCAATCACATCCAAGACTGGCTATGCACGAAGCAACTCTTGAGTG GTATTTGGGATGCGGGTAGTAGATGACTGCAGGGA AGTAGATGACTGCAGGGACTCCGACGTCAAGTACATTACCCTCTCATAGGCGGCGTTCTAGATCACGTTACCGCCATATCATCCGAGCATGACATCATCTCCGCTGTGCCCATCCT TGACCCTTTTGAGTGTCCGGTGGCGGATATCCCCC CGGTGGCGGATATCCCCCACGAATGAAAATGTTTTTCGCTGACAATCATAATGGGGCGCTCCTAAGCTTTTCCACTTGGTTGGGCCAGCTAGGCCTCCCTGCCCGGAGTTTCGGCG GGGCATTGTCTTTGGGGCGTTATTCGAGGGCACCC CGTTATTCGAGGGCACCCGGACCTAACTTGTCGGGACCACCCGGGGTAGTCATCGGGCTTATACAGCGAAAAGCCCAGCACCCGGCTCCCCGCTATGGAAGGTCATTAGCTCCGGC GCAAGGATCGCGGATATAAACAGAGAAACGGCCGA AAACAGAGAAACGGCCGAATACACCTGTTCGTGTCGTATCGGTAAATAGCCTCGCGGAGCCATGTGCCATACTCGTCTGCGGAGCACTCTGGTAATGCATATGGTCCACAGGACAT GCGCTCTATGTGACGGTCTTTTGGCGCACAAATGC CTTTTGGCGCACAAATGCTCAGCACCATTTAAATTAGACCGACTCCAGATCTGTAAGGTCCGCCACGCAGACGACAGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACC GCGGAGAGATAACTACGGTGCCGCTTACAGCCCCT GTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGATTGTACGCTATTCAGGGATTGACTGATACCGGAAGACATCTCAAATGAAGTGGTCTATGC TACCAAATCTCCTTAGTGTAAGTTCAGACCAATTC GTAAGTTCAGACCAATTCGTACTTCGTTCAGAACTCACATTTTAACAACAGAGGACACATGCCCTACCTCCATGATCTACTGACGTCCCTGAGGCTGCAATACATGTAACGAGGCA TAGTGCAATGGCGGTTTTTTACCCTCGTCCTGGAG TTTACCCTCGTCCTGGAGAAGAGGGGACGCCGGTGCAGTCATCACTAATGTGGAAATTGGGAGGACTCTTGGCCCTCCGCCTTTAGGCGGTGCTTACTCTTTCATAAAGGGGCTGT GATTCAAAAAGGTGAGCGAACTCGGCCGATCCGGA GAACTCGGCCGATCCGGAGAGACGGGCTTCAAAGCTGCCTGACGACGGTTGCGGGTCCGTATCAAAATCCTCCCAATAAGCCCCCGTGACCGTTGGTTGAACAGCCCAGGACGGGC ATATCGCTTAACGGCTCTTGGGCCGGGGTGCGTTA TTGGGCCGGGGTGCGTTACCTTGCAGGAATCGAGGCCGTCCGTTAATTCCTCTTGCATTCATATCGCGTATTTTTGTCTCTTTACCCGCTTACTTGGATAAGGATGACATAGCTTC TACACGGTACGATCGCACGCCCCGTGAGATCAATA CGCCCCGTGAGATCAATACGTATACCAGGTGTCCTGTGAGCAGCGAAAGCCTAAACGGGAAATACGCCGCCAAAAGTCGGTGTGAATACGAGTCGTAGCAAATTTGGTCTGGCTAT CGGTACGTCTGCTCTGGTCTGCCTCTAGTGGCTCG TCTGCCTCTAGTGGCTCGTTAGATAGTCTAGCCGCTGGTAAACACTCCATGACCTCGGCTCTCCATTGATGCTACGGCGATTCTTGGAGAGCCAGCAGCGACTGCAAATGTGAGAT GCGATAAGTCCCTAACTGGTTGTGGCCTTTTGTAG GGTTGTGGCCTTTTGTAGAGTGAACTTCATAACATATGCTGTCTCAGGCACGTGGATGGTTTGGACAAATCAGATTCAAGTCTGATCAACCTTCATACAGATCTAGAGTCTAAAGC GAGATAAAAATACTAGGTAACTAGAGGGACTGCGA TAACTAGAGGGACTGCGACGTTCTAAACGTTGGTCCGTCAGAAGCGCCATCCAGGATCACGTTACCCCGAAAAAAAGATATCAGGAGCTCTCCTCCTCTGCAGTCAGGTCTATAGA AGCCAATGATCAGGGTTATTCCCTTGGGACAGACTTCCTACTCACAGTCGGTCACATTGGGCTACTCCATGGGTCTTCGGCTTGACCCGGTCTGTTGGGCCGCGATTGCGTGAGTT TCCCTATCAGAGCTTGGAGCCAATGATCAGGGTTAT TCCGGCCCTCACATCTGGAAACCCCAACTTATTTAGATAACATCATTAGCCGAAGTTGCTGGGCATGTCCACCGTGGAGTCCTCCCCGGGCGTCCCTCCTTCAAATGACGATAAGC TGTATAGTCGATTCTCATCCGGCCCTCACATCTGGA TGATGTTAACAAAGATTCGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTATGGCAAAACCGATGGGGAATGATTCGGGTAGCGCTAAAAGTCCATA ATCAACGCAAGGATCGGTGATGTTAACAAAGATTCG GACGACCGCTTCACGCTAAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAATTACGGAGTGGGCGGCCTGGCGGGAGCACTACCCCATCGACGCGTACT TGGCGTGCGTACAGTTTGACGACCGCTTCACGCTAA AGTAGAGTGCCGCTTTCAGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGTTGATGTGGATCGACTCTATAGAGGCATCTACTGATGCGTAGGGAGATCCGGAATGTATTGGC TCTCACATGAACAAATTAGTAGAGTGCCGCTTTCAG GTTACTGAACGTATCGACGCATACCTCCTTCGTTGAGAACTCACAATTATACAACTGGGGACATAATCCCTACGCCCATCTTCTACACCCGTCTCTGTGGGTCCAGTTCAAGTGCT TCCAAACACCCCATGTCGTTACTGAACGTATCGACG TGGTATAGTAAGCTCGTACTGTGATACATGCGACAGGGGTAAGACCATCAGTAGTAGGGATAGTGCCAAAGCTCACTCACCACTGCCTATAAGGGGTGCTTACCTCTAGAATAAGT AAGGTCTAGTGGTATGGTGGTATAGTAAGCTCGTAC GCGAACCGGGCCAGACAATCCGGAGGCACCGGGCTCAAAGCCGCGACACGACGGCTCACAGCCGGTAAGAGTAACCCCGGAGTGAACACCTATGGGGCTGGATAAAACTGCCCTGG CATGAGGAACCGAAAAGGCGAACCGGGCCAGACAAT CAGGAGGCGGCCGGAGGGGGGATGTTTTCTACTATTCGAGGCCGTTCGTTATAACTTGTTGCGTTCCTAGCCGCTATATTTGTCTCTTTGCCGACTAATGAGAACAACCACACCAT CCGAATACGTGGCATTTCAGGAGGCGGCCGGAGGGG AGCAGGCGCCTCGTAAGGCCATTGCGAATACCAGGTATCGTGTAAGTAGCGTAGGCCCGTACGCGAGATAAACTGCTAGGGAACCGCGTCTCTACGACCGGTGCTCGATTTAATTT CCTCGGAATACCGTATCAGCAGGCGCCTCGTAAGGC CCGCCGGGCCCCTCTCGTGATTGGGTAGTTGGACATGCCCTTGAAAGATATAGCAAGAGCCTGCCTGTCTATTGATGTCACGGCGAAAGTCGGGGAGACAGCAGCGGCTGCAGACA TCCAGGCAGTGCCTCTGCCGCCGGGCCCCTCTCGTG GTAACTGACTACGCCTTCCTCTAGACCTTACTTGACCAGATACAGTGTCTTTGACACGTTTATGGATTACAGCAATCACATCCAAGACTGGCTATGCACGAAGCAACTCTTGAGTG TAAGGTGAGATAACTCCGTAACTGACTACGCCTTCC AGTAGATGACTGCAGGGACTCCGACGTCAAGTACATTACCCTCTCATAGGCGGCGTTCTAGATCACGTTACCGCCATATCATCCGAGCATGACATCATCTCCGCTGTGCCCATCCT GTATTTGGGATGCGGGTAGTAGATGACTGCAGGGAC CGGTGGCGGATATCCCCCACGAATGAAAATGTTTTTCGCTGACAATCATAATGGGGCGCTCCTAAGCTTTTCCACTTGGTTGGGCCAGCTAGGCCTCCCTGCCCGGAGTTTCGGCG TGACCCTTTTGAGTGTCCGGTGGCGGATATCCCCCA CGTTATTCGAGGGCACCCGGACCTAACTTGTCGGGACCACCCGGGGTAGTCATCGGGCTTATACAGCGAAAAGCCCAGCACCCGGCTCCCCGCTATGGAAGGTCATTAGCTCCGGC GGGCATTGTCTTTGGGGCGTTATTCGAGGGCACCCG AAACAGAGAAACGGCCGAATACACCTGTTCGTGTCGTATCGGTAAATAGCCTCGCGGAGCCATGTGCCATACTCGTCTGCGGAGCACTCTGGTAATGCATATGGTCCACAGGACAT GCAAGGATCGCGGATATAAACAGAGAAACGGCCGAA THE PRE-MEDICAL CTTTTGGCGCACAAATGCTCAGCACCATTTAAATTAGACCGACTCCAGATCTGTAAGGTCCGCCACGCAGACGACAGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACC GCGCTCTATGTGACGGTCTTTTGGCGCACAAATGCT STUDENTS ASSOCIATION GTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGATTGTACGCTATTCAGGGATTGACTGATACCGGAAGACATCTCAAATGAAGTGGTCTATGC GCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTC GTAAGTTCAGACCAATTCGTACTTCGTTCAGAACTCACATTTTAACAACAGAGGACACATGCCCTACCTCCATGATCTACTGACGTCCCTGAGGCTGCAATACATGTAACGAGGCA TACCAAATCTCCTTAGTGTAAGTTCAGACCAATTCG TTTACCCTCGTCCTGGAGAAGAGGGGACGCCGGTGCAGTCATCACTAATGTGGAAATTGGGAGGACTCTTGGCCCTCCGCCTTTAGGCGGTGCTTACTCTTTCATAAAGGGGCTGT TAGTGCAATGGCGGTTTTTTACCCTCGTCCTGGAGA GAACTCGGCCGATCCGGAGAGACGGGCTTCAAAGCTGCCTGACGACGGTTGCGGGTCCGTATCAAAATCCTCCCAATAAGCCCCCGTGACCGTTGGTTGAACAGCCCAGGACGGGC GATTCAAAAAGGTGAGCGAACTCGGCCGATCCGGAG THE UNIVERSITY OF CHICAGO TTGGGCCGGGGTGCGTTACCTTGCAGGAATCGAGGCCGTCCGTTAATTCCTCTTGCATTCATATCGCGTATTTTTGTCTCTTTACCCGCTTACTTGGATAAGGATGACATAGCTTC ATATCGCTTAACGGCTCTTGGGCCGGGGTGCGTTAC CGCCCCGTGAGATCAATACGTATACCAGGTGTCCTGTGAGCAGCGAAAGCCTAAACGGGAAATACGCCGCCAAAAGTCGGTGTGAATACGAGTCGTAGCAAATTTGGTCTGGCTAT TACACGGTACGATCGCACGCCCCGTGAGATCAATAC TCTGCCTCTAGTGGCTCGTTAGATAGTCTAGCCGCTGGTAAACACTCCATGACCTCGGCTCTCCATTGATGCTACGGCGATTCTTGGAGAGCCAGCAGCGACTGCAAATGTGAGAT CGGTACGTCTGCTCTGGTCTGCCTCTAGTGGCTCGT FACEBOOK /UCHICAGOPMSA GCACGTGGATGGTTTGGACAAATCAGATTCAAGTCTGATCAACCTTCATACAGATCTAGAGTCTAAAGC GGTTGTGGCCTTTTGTAGAGTGAACTTCATAACATATGCTGTCTCA GCGATAAGTCCCTAACTGGTTGTGGCCTTTTGTAGA WEBSITE PMSA.UCHICAGO.EDU CAGGATCACGTTACCCCGAAAAAAAGATATCAGGAGCTCTCCTCCTCTGCAGTCAGGTCTATAGA TAACTAGAGGGACTGCGACGTTCTAAACGTTGGTCCGTCAGAAGCGCCAT GAGATAAAAATACTAGGTAACTAGAGGGACTGCGAC TGGGAATCCGTCACATATGAGAAGGTATTTGCCCGATAATCAATACTCCAGGCATCTAACTTTTCCCACTGCCTTAAGCCGGCTTGCCCTTTCTGCCTGTAGATCCATTGGACTGG TCCTGGCAACCGGGAGGTGGGAATCCGTCACATATG CCGGGGGCAATGACAACCAGCATCTCGGGTCTTGCCCAACCCGTCTACACGCTGTTATAGCGAATCAGCGGGAACCCGGTGCCACGCGATGGAACGTCCTTAACTCTGGCAGGCAA AGTTCGAGGAGAATTATCCGGGGGCAATGACAACCA GAAAATTGGCGAGAGAATCTTCTCTCTGTCTATCGAAGAATGGCCACGCGGTGGCAACCGTCATGCTAGCGTGCGGGGTACACTTGCTAACCATTTGGGACACGGGACACTCGCTG ATAACGCAAAGAAGCTGGAAAATTGGCGAGAGAATC CCACGCTTATGCCCAGCATCGTTACAAGCAGACTCATACTAGATGTATTATGCCCGCCATGCAGACGAAACCAGTCGGAGATTACCGAGCATTCTATCACGTCGGCGACCACTAGT TATGCGCGGGTATTGAACCACGCTTATGCCCAGCAT CTAAGAACCTCTCGGTCGACGCAAGCGATTACACTCCTGTCACATCATAATCGTTTGCTATTCAGGGCTTGACCAACACTGGATTGCTTTTCACTTAAAGTATTATGCACGACAGG GGGTAACGTTGATGCCCCTAAGAACCTCTCGGTCGA TCAGACTAGTTGGAAGTGTGGCTAGATCTTAGCTTACGTCACTAGAGGGTCCACGTTTAGTTTTTAAGATCCATTGATCTCCTAAACGCTGCAAGATTCGCAACCTGGTATACTTA ACCTGTTATAACTTACCTCAGACTAGTTGGAAGTGT AAAGTCGTTGAGAGGAGGAGTCGTCAGACCAGATAGCTTTGATGTCCTGATCGGAAGGATCGTTGGCCCCCGACCCTTAGACTCTGTACTCAGTTCTATAAACGAGCCATTGGATA AGCGGGACTTTTTTTCTAAAGTCGTTGAGAGGAGGA CCCCGGACGCAATAGACGGACAGCTTGGTTCCCTATCAGAGCTTGGAGCCAATGATCAGGGTTATTCCCTTGGGACAGACTTCCTACTCACAGTCGGTCACATTGGGCTACTCCAT TAAGGGACACGGAATATCCCCGGACGCAATAGACGG ATTGCGTGAGTTTCGGCCCCGCGCTGCGCTGTATAGTCGATTCTCATCCGGCCCTCACATCTGGAAACCCCAACTTATTTAGATAACATCATTAGCCGAAGTTGCTGGGCATGTCC CGGTCTGTTGGGCCGCGATTGCGTGAGTTTCGGCCC ATGACGATAAGCACCGGCAAGCACCATTGATCAACGCAAGGATCGGTGATGTTAACAAAGATTCGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTA GGGCGTCCCTCCTTCAAATGACGATAAGCACCGGCA TAAAAGTCCATAGCACGTACATCCCAACCTGGCGTGCGTACAGTTTGACGACCGCTTCACGCTAAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAATT AATGATTCGGGTAGCGCTAAAAGTCCATAGCACGTA TCGACGCGTACTCGAATACTGTATATTGCTCTCACATGAACAAATTAGTAGAGTGCCGCTTTCAGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGTTGATGTGGATCGACTC GCGGGAGCACTACCCCATCGACGCGTACTCGAATAC GAATGTATTGGCCTATGTCACTGAAACTGTCCAAACACCCCATGTCGTTACTGAACGTATCGACGCATACCTCCTTCGTTGAGAACTCACAATTATACAACTGGGGACATAATCCC ATGCGTAGGGAGATCCGGAATGTATTGGCCTATGTC AGTTCAAGTGCTGGGAGAGCATCCTCCACAAGGTCTAGTGGTATGGTGGTATAGTAAGCTCGTACTGTGATACATGCGACAGGGGTAAGACCATCAGTAGTAGGGATAGTGCCAAA CCCGTCTCTGTGGGTCCAGTTCAAGTGCTGGGAGAG TCTAGAATAAGTGTCAGCCAGTATAACCCCATGAGGAACCGAAAAGGCGAACCGGGCCAGACAATCCGGAGGCACCGGGCTCAAAGCCGCGACACGACGGCTCACAGCCGGTAAGA TATAAGGGGTGCTTACCTCTAGAATAAGTGTCAGCC AAACTGCCCTGGTGACCGCCATCAACAACCCGAATACGTGGCATTTCAGGAGGCGGCCGGAGGGGGGATGTTTTCTACTATTCGAGGCCGTTCGTTATAACTTGTTGCGTTCCTAG ACCTATGGGGCTGGATAAAACTGCCCTGGTGACCGC CAACCACACCATAGCGATTTGACGCAGCGCCTCGGAATACCGTATCAGCAGGCGCCTCGTAAGGCCATTGCGAATACCAGGTATCGTGTAAGTAGCGTAGGCCCGTACGCGAGATA TTGCCGACTAATGAGAACAACCACACCATAGCGATT TCGATTTAATTTCGCCGACGTGATGACATTCCAGGCAGTGCCTCTGCCGCCGGGCCCCTCTCGTGATTGGGTAGTTGGACATGCCCTTGAAAGATATAGCAAGAGCCTGCCTGTCT GTCTCTACGACCGGTGCTCGATTTAATTTCGCCGAC CGGCTGCAGACATTATACCGGAACAACACTAAGGTGAGATAACTCCGTAACTGACTACGCCTTCCTCTAGACCTTACTTGACCAGATACAGTGTCTTTGACACGTTTATGGATTAC AGTCGGGGAGACAGCAGCGGCTGCAGACATTATACC AACTCTTGAGTGTTAAAATGTTGACCCCTGTATTTGGGATGCGGGTAGTAGATGACTGCAGGGACTCCGACGTCAAGTACATTACCCTCTCATAGGCGGCGTTCTAGATCACGTTA CTGGCTATGCACGAAGCAACTCTTGAGTGTTAAAAT TGTGCCCATCCTAGTAGTCATTATTCCTATGACCCTTTTGAGTGTCCGGTGGCGGATATCCCCCACGAATGAAAATGTTTTTCGCTGACAATCATAATGGGGCGCTCCTAAGCTTT CATGACATCATCTCCGCTGTGCCCATCCTAGTAGTC GGAGTTTCGGCGCAGTGCTGCCGACAGCCGGGCATTGTCTTTGGGGCGTTATTCGAGGGCACCCGGACCTAACTTGTCGGGACCACCCGGGGTAGTCATCGGGCTTATACAGCGAA GCTAGGCCTCCCTGCCCGGAGTTTCGGCGCAGTGCT ATTAGCTCCGGCAAGCAATTAAGAACAACGCAAGGATCGCGGATATAAACAGAGAAACGGCCGAATACACCTGTTCGTGTCGTATCGGTAAATAGCCTCGCGGAGCCATGTGCCAT CCCCGCTATGGAAGGTCATTAGCTCCGGCAAGCAAT TCCACAGGACATTCGTCGCTTCCGGGTATGCGCTCTATGTGACGGTCTTTTGGCGCACAAATGCTCAGCACCATTTAAATTAGACCGACTCCAGATCTGTAAGGTCCGCCACGCAG TCTGGTAATGCATATGGTCCACAGGACATTCGTCGC TGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGATTGTACGCTATTCA CCACTGACCGATCTACCTGAACGGCGACCATCTGTG

ulse p


Turn static files into dynamic content formats.

Create a flipbook
UChicago PULSE Issue 4.1: Autumn 2017 by PULSE Magazine - Issuu