Survey of Biology Final Exam
Course Introduction
Survey of Biology provides an introduction to the fundamental principles and concepts of the biological sciences. The course explores major topics including cell structure and function, genetics, evolution, ecology, and the diversity of living organisms. Students will examine the processes that underlie life, from the molecular and cellular level to the complexity of ecosystems. Emphasis is placed on scientific inquiry, the relevance of biology to everyday life, and the societal impact of advances in biological research. This course is designed to establish a broad foundation for further study in biology and related disciplines.
Recommended Textbook
Discover Biology Core Topics 4th Edition by Michael L. Cain LU;,SDK
Available Study Resources on Quizplus
45 Chapters
3022 Verified Questions
3022 Flashcards
Source URL: https://quizplus.com/study-set/841
Page 2
Chapter 1: The Nature of Science and the Characteristics of Life
Available Study Resources on Quizplus for this Chatper
75 Verified Questions
75 Flashcards
Source URL: https://quizplus.com/quiz/16700
Sample Questions
Q1) All animals have the capacity to sense and respond to their environment; humans, for example,
A) can see better than any other animal.
B) can hear better than any other animal.
C) have a better sense of smell than any other animal.
D) while not the fastest or strongest animal, have a set of sensory adaptations that are entirely compatible with human biology and environment.
Answer: D
Q2) A _______ is a group of individuals belonging to the same species.
Answer: population
Q3) In the scientific method observations are followed most often by___________ and then ___________.
Answer: hypotheses; experiments
Q4) Living organisms must be able to sense and respond to both their internal and external _______ in order to survive.
Answer: environments
Q5) Having first developed a _________, scientists can then propose testable predictions.
Answer: hypothesis
To view all questions and flashcards with answers, click on the resource link above. Page 3
Chapter 2: Organizing the Diversity of Life
Available Study Resources on Quizplus for this Chatper
75 Verified Questions
75 Flashcards
Source URL: https://quizplus.com/quiz/16701
Sample Questions
Q1) There is some debate regarding the recognition of reptiles as a legitimate lineage because
A) reptiles are no longer a dominant group nor particularly important to life on Earth.
B) reptiles and birds share a single common ancestor but are placed into different phyla within the Linnaean hierarchy.
C) reptiles reproduce using eggs, but are not grouped with other organisms sharing a similar reproductive method such as the fish and amphibians.
D) as a single group the reptiles contains too many species.
Answer: B
Q2) Analysis of body morphology and DNA indicate the closest living relatives of human beings are
A) chimpanzees.
B) orangutans.
C) gibbons.
D) lemurs.
Answer: A
Q3) Systematists can also be called _______.
Answer: taxonomists
To view all questions and flashcards with answers, click on the resource link above.
4
Chapter 3: Major Groups of Living Organisms
Available Study Resources on Quizplus for this Chatper
74 Verified Questions
74 Flashcards
Source URL: https://quizplus.com/quiz/16702
Sample Questions
Q1) Although exceptions exist, reproduction in most eukaryotes involves
A) two individuals combining DNA during the formation of a new organism.
B) one individual dividing to make two identical organisms.
C) two individuals fusing to form one organism.
D) the cells of an individual dividing.
Answer: A
Q2) Sponges are considered to be the most ancient of animals; although multicellular, sponges have not developed the _______ present in all other animals.
Answer: tissues
Q3) The organisms found living inside boiling-hot geysers can be described as thermophiles.
A)True
B)False
Answer: True
Q4) A waxy covering known as the _______ was an important adaptation for terrestrial life; it helps keep land plants from drying out when exposed to sun and wind.
Answer: cuticle
Q5) The earliest lineage of organisms living today are the _______.
Answer: bacteria
To view all questions and flashcards with answers, click on the resource link above. Page 5
Chapter 4: Chemical Building Blocks
Available Study Resources on Quizplus for this Chatper
77 Verified Questions
77 Flashcards
Source URL: https://quizplus.com/quiz/16703
Sample Questions
Q1) Of the following which indicates the most basic pH?
A) 3
B) 7
C) 8
D) 10
Q2) When you place a piece of red meat on a hot barbeque, it slowly changes from soft to firm. Meat is primarily made of proteins. Which of the following might account for the change in meat texture during cooking?
A) The heat causes the cells in the meat to produce more protein.
B) The heat causes the chemical bonds to form between the proteins and nucleic acids in the meat.
C) The heat from the barbeque converts proteins into lipids.
D) The addition of heat causes proteins to lose their three-dimensional shape and link together.
Q3) When phospholipids are added to water, they arrange themselves so that
A) their hydrophobic tails are on the inside of a lipid droplet.
B) their hydrophilic tails are on the outside of a lipid droplet.
C) their hydrophobic heads are facing the water.
D) both A and C
To view all questions and flashcards with answers, click on the resource link above.
Page 6
Chapter 5: Cell Structure and Internal Compartments
Available Study Resources on Quizplus for this Chatper
76 Verified Questions
76 Flashcards
Source URL: https://quizplus.com/quiz/16704
Sample Questions
Q1) The membrane known as the _____ contains light-capturing pigments like chlorophyll.
A) pore
B) envelope
C) crista
D) thylakoid
Q2) The plasma membrane of a cell and the membrane boundaries of organelles such as mitochondria and chloroplasts serve similar functions. What is one of the main functions of the membranes of both cells and organelles?
A) They keep reactants near each other to speed biological reactions.
B) They allow external chemicals to diffuse freely into and out of the cell.
C) They encourage cellular respiration at the membrane boundaries.
D) They keep water out of the cell and organelle interiors.
Q3) A screen door allows breezes to get in and aromas to get out but keeps out insects. Its function most resembles
A) the cytosol.
B) the plasma membrane.
C) the ER lumen.
D) a ribosome.
To view all questions and flashcards with answers, click on the resource link above.
Page 7
Chapter 6: Cell Membranes, Transport, and Communication
Available Study Resources on Quizplus for this Chatper
73 Verified Questions
73 Flashcards
Source URL: https://quizplus.com/quiz/16705
Sample Questions
Q1) The concentration of solutes is higher within the mitochondria than it is in the cytosol. The cytosol is ______ [hypertonic, hypotonic, or isotonic] to the inside of the mitochondrion.
Q2) Substances move into a cell by
A) pinocytosis.
B) endocytosis.
C) phagocytosis.
D) all of the above
Q3) The various connections between cells including cell junctions and signaling molecules allow the cells in a multi-cellular organism to "talk" to each other, a principle known as cell-to-cell _______.
Q4) The human hormone insulin is produced only by a single organ, the pancreas, yet insulin is used to move glucose from the bloodstream into cells all over the body. What aspect of hormones makes it possible for insulin to work throughout the body?
A) Hormones are able to stop cell-to-cell communication.
B) Hormones all cross cell membranes, and thus can move freely throughout the body.
C) Hormones cause rapid cell-to-cell signaling.
D) Hormones are long-range signaling molecules.
Page 8
To view all questions and flashcards with answers, click on the resource link above.
Chapter 7: Energy and Enzymes
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/16706
Sample Questions
Q1) In the reaction X + Y Z, Z is the A) substrate.
B) product.
C) enzyme.
D) carbon molecule.
Q2) The reuse of the same carbon molecules by plants, animals, and their environments through time is known as
A) activation energy.
B) a consumption tree.
C) carbon cycling.
D) the third law of thermodynamics.
Q3) Sugar molecules are more oxidized than carbon dioxide molecules.
A)True
B)False
Q4) In the reaction H O + CO + carbonic anhydrase HCO - + H + carbonic anhydrase, carbonic anhydrase is a(n)
A) reactant.
B) product.
C) enzyme.
D) active site.
Page 9
To view all questions and flashcards with answers, click on the resource link above.
Chapter 8: Photosynthesis and Cellular Respiration
Available Study Resources on Quizplus for this Chatper
70 Verified Questions
70 Flashcards
Source URL: https://quizplus.com/quiz/16707
Sample Questions
Q1) Each time you take a breath you are bringing in the oxygen you need to stay alive. That oxygen comes from
A) carbon dioxide.
B) ATP.
C) water.
D) NADPH.
Q2) A funnel is used to channel substances collected over a wide area into a narrow necked container. A funnel might be a good analogy for the A) reaction center.
B) antenna complex.
C) thylakoid.
D) stoma.
Q3) During alcoholic fermentation, pyruvate is converted to ethanol in order to A) increase the efficiency of cellular respiration by producing additional molecules of ATP.
B) release O as a by-product so that cellular respiration can continue.
C) create lactic acid to stimulate muscle contraction.
D) recycle NADH back into NAD+++ so that the cell can continue glycolysis.
Q4) The green pigment most commonly associated with photosynthesis is _______.
To view all questions and flashcards with answers, click on the resource link above. Page 10
Chapter 9: Cell Division
Available Study Resources on Quizplus for this Chatper
77 Verified Questions
77 Flashcards
Source URL: https://quizplus.com/quiz/16708
Sample Questions
Q1) The sequence of events in meiosis II is prophase II, ____________, anaphase II, and telophase II, then cytokinesis.
Q2) Which set of symbols represents the stages of interphase?
A) G , G , and G
B) S , S2, and G
C) S, G , and G
D) S, G , and G
Q3) Gametes contain _________ the genetic material that a generalized body cell contains.
A) half
B) the same amount of C) twice
D) four times
Q4) Which of the following statements is not generally true?
A) As an organism matures, it needs more cells.
B) As an organism matures, it needs different kinds of cells.
C) As an organism matures, it needs to replace the DNA in each of its cells.
D) As an organism matures, it needs to replace worn-out cells.
Q5) The spindle microtubules break down and new nuclear envelopes form during the _______ portion of mitosis.
To view all questions and flashcards with answers, click on the resource link above. Page 11
Chapter 10: Patterns of Inheritance
Available Study Resources on Quizplus for this Chatper
65 Verified Questions
65 Flashcards
Source URL: https://quizplus.com/quiz/16709
Sample Questions
Q1) Mendel's laws were able to predict accurately the pattern of inheritance for situations in which
A) alleles are affected by their environment.
B) alleles show complete dominance.
C) alleles of one gene alter the effect of a different gene.
D) a given character is determined by more than one gene.
Q2) The best way to get accurate results from a probability exercise is to
A) choose an example with incomplete dominance.
B) know the answer in advance.
C) choose an example that will come out 50:50.
D) make a large number of observations.
Q3) Most human genetic characters are
A) controlled by one gene.
B) not inherited according to Mendel's laws.
C) controlled by more than one gene.
D) not heritable.
Q4) A genetic _______ is a controlled mating experiment used to examine the inheritance of a particular gene.
Q5) The observable physical characteristics of an organism is its _______.
Q6) The genetic makeup of an organism, such as Gg, is its _______.
Page 12
To view all questions and flashcards with answers, click on the resource link above.
Chapter 11: Chromosomes and Human Genetics
Available Study Resources on Quizplus for this Chatper
70 Verified Questions
70 Flashcards
Source URL: https://quizplus.com/quiz/16710
Sample Questions
Q1) "New" chromosomes are generated when homologous chromosomes exchange genetic material during ___________.
Q2) The gender of a human child is determined by the A) loci.
B) autosome.
C) egg.
D) sperm.
Q3) Mary's mother is diagnosed with Huntington's disease while Mary is in the first trimester of her first pregnancy. Mary is tested and finds that she carries the Huntington's allele. Mary decides to have amniocentesis because amniocentesis
A) will cure Huntington's disease if it is done early enough in pregnancy.
B) will allow Mary to determine if her child also carries the Huntington's allele.
C) will let Mary know which of her eggs carry the Huntington's allele.
D) is the only way to determine if Mary's husband also has the Huntington's allele.
Q4) Genes become linked when crossing-over occurs between nonhomologous chromosomes.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 13
Chapter 12: DNA
Available Study Resources on Quizplus for this Chatper
62 Verified Questions
62 Flashcards
Source URL: https://quizplus.com/quiz/16711
Sample Questions
Q1) The difference between alleles of a gene is
A) their DNA base sequences.
B) the way they are copied when the cell divides.
C) the type of lipid they are composed of.
D) not heritable.
Q2) During DNA replication the enzyme ___________ _____________ builds a new strand of DNA while using the old strand of DNA as a template
Q3) The "rungs" in the DNA "ladder" consist of _______ pairs.
Q4) Along one side of a DNA molecule, the nucleotides are connected by
A) covalent bonds between phosphate groups and sugar molecules.
B) hydrogen bonds between adenine and guanine.
C) covalent bonds between bases and sugar molecules.
D) hydrogen bonds between adjacent sugar molecules.
Q5) When compared, the nucleotide sequences of different individuals are_______________.
Q6) Which of the following is not a base used during DNA synthesis?
A) thymine
B) adenine
C) guanine
D) uracil
Page 14
To view all questions and flashcards with answers, click on the resource link above.
Chapter 13: From Gene to Protein
Available Study Resources on Quizplus for this Chatper
73 Verified Questions
73 Flashcards
Source URL: https://quizplus.com/quiz/16712
Sample Questions
Q1) The sequence of nucleotides on an mRNA molecule
A) is complementary to the DNA template strand.
B) matches the sequence of the ribosome that will translate the mRNA.
C) exactly matches the template strand (except where U is substituted for T).
D) is identical to that of the promoter.
Q2) When one base is changed to another at a single position in the DNA sequence of a gene, a(n) _______ mutation has occurred.
A) insertion
B) deletion
C) frameshift
D) substitution
Q3) The base sequence of mRNA specifies the sequence of amino acids in a _______.
Q4) The sugar molecule present in RNA is
A) uracil.
B) deoxyribose.
C) ribose.
D) sucrose.
Q5) If a eukaryotic protein is to function properly ________ must be removed from the initial mRNA molecule and the remaining _____ must be joined together before translation.
Page 15
To view all questions and flashcards with answers, click on the resource link above.
Chapter 14: Control of Gene Expression
Available Study Resources on Quizplus for this Chatper
66 Verified Questions
66 Flashcards
Source URL: https://quizplus.com/quiz/16713
Sample Questions
Q1) Development is controlled by A) spacer sequences.
B) different homeotic genes in different organisms.
C) similar homeotic genes in different animals.
D) repressor proteins.
Q2) At any given time, most of the genes in the genome of an organism are actively undergoing gene expression.
A)True
B)False
Q3) In interphase, each chromosome in a cell consists of
A) four DNA molecules.
B) a paired DNA/RNA molecule.
C) one DNA molecule.
D) an RNA/enzyme complex.
Q4) A repressor protein binds to the operator of a group of genes to turn ______ [on or off?] their gene expression.
Q5) Specific types of proteins can attach to long-lived mRNA molecules to prevent their ___________ when the cell does not need their protein product.
Q6) Regulatory proteins bind to regulatory ___ sequences.
Page 16
To view all questions and flashcards with answers, click on the resource link above.
Chapter 15: DNA Technology
Available Study Resources on Quizplus for this Chatper
64 Verified Questions
64 Flashcards
Source URL: https://quizplus.com/quiz/16714
Sample Questions
Q1) The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. What sequences of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG
Q2) In RFLP analysis, which regions of DNA would provide the strongest evidence of a genetic relationship?
A) regions with noncoding and spacer DNA
B) regions that contain the genes for hemoglobin
C) regions that might contain genes related to personality disorders
D) regions that can be easily fragmented
Q3) Many different fragments of DNA from an oak tree genome are inserted into a plasmid vector, which is then taken up by bacteria that copy the inserted DNA every time they reproduce. This procedure is known as
A) DNA probing.
B) DNA fingerprinting.
C) the polymerase chain reaction (PCR).
D) the construction of a DNA library.
Q4) DNA _______ is the set of techniques with which scientists manipulate DNA.
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: How Evolution Works
Available Study Resources on Quizplus for this Chatper
65 Verified Questions
65 Flashcards
Source URL: https://quizplus.com/quiz/16715
Sample Questions
Q1) When comparing certain amino acid sequences in the protein hemoglobin of humans to those of other animals, scientists found that baboons had seven different amino acids (than the human protein), dogs had ten different amino acids, gorillas had one different amino acid and lemurs had eight different amino acids. Which of these animals is most closely related to humans?
A) baboon
B) dog
C) lemur
D) gorilla
Q2) A hurricane could cause genetic drift by
A) increasing the mutation rate of a population.
B) randomly killing more males than females in a population.
C) randomly killing more individuals of one genotype than another in a population.
D) relocating a population to a different habitat.
Q3) Evolution can cause so many changes among individuals of two populations of the same species that eventually the members of the two populations are no longer able to _______ with each other, thus forming a new species.
Q4) Evolutionary changes on a small scale are called ______________.
To view all questions and flashcards with answers, click on the resource link above.
Page 18
Chapter 17: Evolution of Populations
Available Study Resources on Quizplus for this Chatper
64 Verified Questions
64 Flashcards
Source URL: https://quizplus.com/quiz/16716
Sample Questions
Q1) Genetic drift has a greater effect on A) moths than on birds.
B) individuals than on populations.
C) small populations than on large populations.
D) natural selection than on gene flow.
Q2) The genetic variation in a population is increased by A) recombination.
B) allele fixation.
C) natural selection.
D) genetic drift.
Q3) In your backyard, you step on a dandelion and one of its seeds gets trapped in the tread of your shoes. The next day, you go on a long hike in the wilderness wearing the same shoes. When you step in a mud puddle, the seed sticks in the mud. The seed grows into a dandelion, but no other dandelions are present to mate with it. This is an example of
A) gene flow.
B) genetic drift.
C) natural selection.
D) sexual selection.
Q4) Genetic drift causes random changes in _______ frequency.
Page 19
To view all questions and flashcards with answers, click on the resource link above.
Chapter 18: Adaptation and Speciation
Available Study Resources on Quizplus for this Chatper
66 Verified Questions
66 Flashcards
Source URL: https://quizplus.com/quiz/16717
Sample Questions
Q1) Geographic isolation limits the _______ between populations of a species.
A) genetic differences
B) adaptation
C) directional selection
D) gene flow
Q2) The improvement of the match between organisms and their environments over time is called ________ evolution.
Q3) A biological species is a group of interbreeding populations that is ________ isolated from other species of organisms living in the same region.
Q4) Which of the following is an example of reproductive isolation?
A) Male deer with large branching antlers are more likely to mate.
B) A blue lizard washes away from a population of mostly green lizards during a hurricane and ends up on an island containing no other lizards to mate with.
C) One population of frogs mates in the deep water of a pond and another population of frogs mates on the shore of the same pond.
D) One individual from a population of fruit flies from an apple orchard is blown by heavy winds into another orchard where it mates with a different population of fruit flies.
To view all questions and flashcards with answers, click on the resource link above. Page 20
Chapter 19: The Evolutionary History of Life
Available Study Resources on Quizplus for this Chatper
69 Verified Questions
69 Flashcards
Source URL: https://quizplus.com/quiz/16718
Sample Questions
Q1) The first group of vertebrates that could complete their life cycle without returning to water were
A) amphibians.
B) reptiles.
C) mammals.
D) birds.
Q2) The extinction of dinosaurs caused an end to the _______ between them and the mammals, thus allowing mammals to evolve to fill some ecological roles the dinosaurs had previously filled.
Q3) North America and Europe are slowly but surely drifting away from one another.
A)True
B)False
Q4) Many organisms decompose rapidly after death; some organisms had soft bodies; and some areas where organisms died have undergone massive geologic changes. For these reasons, the ______ record is incomplete.
Q5) Why isn't the fossil record complete?
Q6) The earliest forms of life evolved and lived in _______.
Q7) Ninety-five percent of marine invertebrate species went extinct during the _______ mass extinction
21
To view all questions and flashcards with answers, click on the resource link above.
Chapter 20: Maintaining the Internal Environment
Available Study Resources on Quizplus for this Chatper
66 Verified Questions
66 Flashcards
Source URL: https://quizplus.com/quiz/16719
Sample Questions
Q1) Urea is reabsorbed by the kidney because it acts as an antioxidant, protecting cells from damaging chemicals produced by metabolic reactions.
A)True
B)False
Q2) Animal A has a surface area of 6 cm² and a volume of 1 cm³. Animal B has a surface area of 24 cm² and a volume of 8 cm³. If each animal were in the same environment,
A) animals A and B would gain and lose solutes at the same rate, but animal A would gain heat faster.
B) animal B would gain water faster than animal A, but animal A would lose solutes faster.
C) animal A would gain or lose heat, water, and solutes faster than animal B.
D) animal B would lose heat faster than animal A but gain water faster.
Q3) Ectotherms depend more on heat from their environment than on _________ heat from internal chemical reactions.
Q4) Animals can gain, but not lose, heat by conduction.
A)True
B)False
Q5) In kidneys, the glomerulus is composed of a bed of __________.
To view all questions and flashcards with answers, click on the resource link above. Page 22
Chapter 21: Animal Nutrition and Digestion
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/16720
Sample Questions
Q1) Since vitamins are so important to metabolism, it is important to ingest large amounts of them in the form of vitamin supplements.
A)True
B)False
Q2) Which of the following is not secreted by the mammalian pancreas?
A) pepsin
B) bicarbonate
C) trypsin
D) chymotrypsin
Q3) The lower region of the small intestine is structured to create large amounts of surface area so that it can more efficiently
A) produce enzymes to break food down into smaller molecules.
B) grind food down into smaller molecules.
C) absorb the chemical building blocks produced by digestion.
D) eliminate waste products.
Q4) Describe how the structure of the small intestine aids in its role in nutrient absorption.
Q5) The colon contains bacteria that produce _____________, a small organic compound that is involved in blood clotting.
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Gas Exchange
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/16721
Sample Questions
Q1) Blood arriving at a cell that is performing cellular respiration would
A) contain red blood cells with oxygen bound to most of its hemoglobin and a lower concentration of carbon dioxide than the cell.
B) contain little remaining hemoglobin and a higher concentration of carbon dioxide than the cell.
C) deposit its hemoglobin onto the plasma membrane of the cell to release oxygen and pick up carbon dioxide.
D) contain hemoglobin largely depleted of oxygen and a lower concentration of carbon dioxide than the cell.
Q2) People with sickle-cell anemia have deformed hemoglobin molecules and often suffer muscle pains, even at low levels of exertion. These symptoms might come about because the deformed hemoglobin
A) is unable to carry the oxygen required for normal activities of muscles.
B) cannot diffuse across the cells' membranes from the blood plasma.
C) causes damage to the muscle cells as it enters the muscle.
D) decreases the person's surface area-to-volume ratio.
Q3) Gills were the first gas exchange organ to evolve in animals.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 24
Chapter 23: The Circulatory System
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/16722
Sample Questions
Q1) The pulse that can be felt in an artery is actually the
A) pressure due to muscular contractions of the veins.
B) pressure due to materials leaving the capillaries.
C) backflow of blood in the veins.
D) bulging of artery walls due to pressure generated by a contraction of the heart.
Q2) In the artery leaving the left ventricle, you would expect to find
A) oxygenated blood.
B) deoxygenated blood.
C) a smaller volume of blood than in any of the other vessels leaving the heart.
D) lower systolic pressure than in any of the other vessels leaving the heart.
Q3) A _________ _________ occurs when the supply of blood to the heart muscle is cut off because the arteries leading to the heart are blocked.
Q4) In an insect's _______ circulatory system, blood flows through the body cavity around the organs.
Q5) Blood reaching the lungs in the pulmonary circuit
A) is rich in oxygen and carries little carbon dioxide.
B) is poor in oxygen and carries carbon dioxide from body cells.
C) returns to the heart through the systemic circuit.
D) returns to the heart through the right atrium.
To view all questions and flashcards with answers, click on the resource link above. Page 25
Chapter 24: Animal Hormones
Available Study Resources on Quizplus for this Chatper
69 Verified Questions
69 Flashcards
Source URL: https://quizplus.com/quiz/16723
Sample Questions
Q1) Which of the following is not caused by insulin?
A) formation of glycogen
B) formation of glucagon
C) storage of fatty acids
D) storage of amino acids
Q2) Endocrine glands have ducts that open directly into blood vessels.
A)True
B)False
Q3) Once a hormone enters the bloodstream,
A) it is usually broken down within minutes.
B) it remains active for months.
C) it is broken down after it has performed its function on target cells.
D) it produces enzymes that affect target cells.
Q4) Epinephrine is produced in the
A) pancreas.
B) kidneys.
C) adrenal glands.
D) hypothalamus.
Q5) In a human male, the _______ secrete hormones that coordinate the development of male reproductive structures.
To view all questions and flashcards with answers, click on the resource link above. Page 26
Chapter 25: The Nervous System
Available Study Resources on Quizplus for this Chatper
69 Verified Questions
69 Flashcards
Source URL: https://quizplus.com/quiz/16724
Sample Questions
Q1) The distance between an axon terminal and the receiving cell must be very small because
A) the plasma membranes of the two cells must be almost touching for action potentials to pass from one to the other.
B) neurons use the diffusion of neurotransmitters to transmit stimuli between cells and diffusion is only rapid over short distances.
C) the short distance creates a large surface area so that the receiving cell can receive a large number of neurotransmitters at once, ensuring rapid signal transmission.
D) the short distance allows sodium to be exchanged between the two cells, ensuring that the receiving cell has enough sodium to create an action potential.
Q2) A neurotransmitter can inhibit the formation of an action potential in a receiving cell. A)True B)False
Q3) A signal-sending neuron releases a __________, a molecule that carries the signal across the synapse between nerve cells.
Q4) Nodes of Ranvier are found only in ___________ neurons.
To view all questions and flashcards with answers, click on the resource link above. Page 27
Chapter 26: Sensing the Environment
Available Study Resources on Quizplus for this Chatper
66 Verified Questions
66 Flashcards
Source URL: https://quizplus.com/quiz/16725
Sample Questions
Q1) Which of the following statements about insect eyes is true?
A) All insects have three kinds of eyes.
B) Insect eyes do not use light-sensitive cells to detect light.
C) Insect eyes can have numerous individual units.
D) Insect eyes do not have lenses.
Q2) We can distinguish pitch because different regions of the basilar membrane vibrate in response to different sound __________.
Q3) The vestibular apparatus also contains three fluid-filled ____________ canals oriented at right angles to one another.
Q4) The human skin has numerous sensory receptors that take in information about our environment, and these receptors are concentrated in areas where detailed information on touch is needed. Which of the following body areas is likely to have the smallest number of sensory receptors?
A) fingertips
B) face
C) buttocks
D) feet
Q5) We can distinguish volume because __________ sounds produce greater movement of the basilar membrane.
To view all questions and flashcards with answers, click on the resource link above. Page 28
Chapter 27: Skeletons, Muscles, and Movement
Available Study Resources on Quizplus for this Chatper
65 Verified Questions
65 Flashcards
Source URL: https://quizplus.com/quiz/16726
Sample Questions
Q1) Which of the following animals has a skeleton made of carbohydrates linked with proteins?
A) mouse
B) housefly
C) shark
D) swallow
Q2) Which animal below has a skeleton that is a hydrostat?
A) grasshopper
B) octopus
C) bluebird
D) catfish
Q3) Lobsters and insects have internal skeletons.
A)True
B)False
Q4) A hydrostat stiffens when a muscles contract around a body cavity filled with a
Q5) Ligaments are connective tissues that connect __________ to bone.
Q6) Cartilage bends more easily than bone does.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 29
Chapter 28: Defenses against Disease
Available Study Resources on Quizplus for this Chatper
67 Verified Questions
67 Flashcards
Source URL: https://quizplus.com/quiz/16727
Sample Questions
Q1) Once B cells become effector cells, they
A) produce the antigens that attach to antibodies.
B) release free-standing antibodies.
C) release free-standing antigens.
D) bind to infected T cells.
Q2) Which of the following statements about vaccinations given to humans is true?
A) The vaccination acts as the first exposure to a virus, allowing the much more effective second exposure response to occur when the virus actually infects the body.
B) A vaccination primes the body so that it will no longer respond to an invasion by a virus.
C) There is a chance of a person's getting the disease from a vaccination, since vaccination involves the injection of the entire living disease organism.
D) Vaccinations prime the virus so that the virus will not kill as many body cells as it would in an unvaccinated person.
Q3) The diagnosis of cancer represents a failure of the body's cancer ______________ system.
Q4) Our first exposure to a particular antigen brings on a _______ immune response.
Q5) Macrophages and neutrophils make up a _______ response to invaders.
To view all questions and flashcards with answers, click on the resource link above. Page 30
Chapter 29: Reproduction and Development
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/16728
Sample Questions
Q1) Different versions of the protein hemoglobin are found in a baby's blood cells at different stages of development. Changes in the hemoglobin type present are most likely the result of
A) what genes are transcribed.
B) whether or not the transcribed mRNA can leave the nucleus.
C) how translated RNA is cut up.
D) how mRNA is distributed in the red blood cells.
Q2) Morphogens act in humans as well as in other animals, such as fruit flies.
A)True
B)False
Q3) Males produce significantly larger numbers of gametes than females because their goal in reproduction is to ensure that they successfully fertilize just one egg.
A)True
B)False
Q4) To start a stem cell line from humans, a scientist would want to take a cell from the _______ of an embryo.
Q5) During apoptosis in the feet of chicken embryos, the activation of a single _________ causes the cells between the toes to die.
To view all questions and flashcards with answers, click on the resource link above. Page 31
Chapter 30: Animal Behavior
Available Study Resources on Quizplus for this Chatper
61 Verified Questions
61 Flashcards
Source URL: https://quizplus.com/quiz/16729
Sample Questions
Q1) Which of the following statements about fixed behaviors is true?
A) A given stimulus can have a variety of responses.
B) A given stimulus leads predictably to a specific response.
C) No stimuli will be responded to at all.
D) Fixed behaviors are not influenced by genes.
Q2) Pit bulls don't have the same behavior patterns as collies. The differences are
A) genetically based behaviors.
B) imprinted behaviors.
C) learned behaviors.
D) fixed behaviors.
Q3) If you decided to take this course based on talking to other people, you were A) taking advantage of social behavior.
B) imprinting based on communication.
C) responding to fixed behavior of others.
D) being altruistic.
Q4) Animals that live in groups do not have fixed behaviors.
A)True
B)False
Q5) An organism that exhibits _______ behavior helps other members of the group survive or reproduce while decreasing its own chances of doing so.
Page 32
To view all questions and flashcards with answers, click on the resource link above.
Chapter 31: Plant Structure, Nutrition, and Transport
Available Study Resources on Quizplus for this Chatper
63 Verified Questions
63 Flashcards
Source URL: https://quizplus.com/quiz/16730
Sample Questions
Q1) From root hair to xylem which of the following describes the journey of water entering a plant?
A) cortex to endodermis to dermal cell layer
B) endodermis to dermal cell layer to cortex
C) cortex to dermal cell layer to endodermis
D) dermal cell layer to cortex to endodermis
Q2) The tension produced during transpiration _________ a column of water extending all the way to the roots through the xyxlem.
Q3) The uptake of nutrients by roots requires energy, because
A) the concentrations of nutrients in the soil are greater than the concentrations in root cells.
B) the concentrations of nutrients in the soil are much more dilute than the concentrations in root cells.
C) the concentrations of nutrients in the soil and in root cells are equal.
D) the root hairs are covered by a waxy layer.
Q4) The simplest plants, lacking even vascular tissues, are the _____ .
Q5) Plants are protected from herbivores by ______ tissue, which also controls gas exchange.
Q6) The most abundant plant cell type in ground tissue is ______ .
Page 33
To view all questions and flashcards with answers, click on the resource link above.
Chapter 32: Plant Growth and Reproduction
Available Study Resources on Quizplus for this Chatper
67 Verified Questions
67 Flashcards
Source URL: https://quizplus.com/quiz/16731
Sample Questions
Q1) Plant and animal growth is indeterminate and determinant, respectively; why is indeterminate growth more beneficial to plants than to animals?
A) Plants are stationary in their habitat while animals can move; indeterminate growth allows a plant to respond to environmental conditions.
B) Plants are commonly eaten by animals while animals are rarely eaten by plants.
C) Indeterminate growth allows plants to become larger than animals.
D) Indeterminate growth allows plants to avoid reproducing when environmental conditions are unfavorable.
Q2) Growth of the cells of the lateral meristem is responsible for increasing the A) number of lateral roots.
B) number of formant buds.
C) thickness of the stem.
D) length of the stem.
Q3) Plants exhibit indeterminate growth. This means that A) they are perennials.
B) they may complete their life cycles in one, two, or three years.
C) the length of time it takes to grow to reach maturity is variable.
D) the final form of the plant is not entirely predictable.
To view all questions and flashcards with answers, click on the resource link above.
34
Chapter 33: The Biosphere
Available Study Resources on Quizplus for this Chatper
67 Verified Questions
67 Flashcards
Source URL: https://quizplus.com/quiz/16732
Sample Questions
Q1) When a predator is removed or displaced from its ecosystem generally only its preferred prey is affected.
A)True
B)False
Q2) During an El Niño event,
A) sea surface temperatures in the Pacific become significantly warmer.
B) a reversal of the Peru current brings Pacific Ocean water to the tip of South America where it mixes with Atlantic ocean water.
C) the Earth's rotational axis tilts beyond its normal 23.5°.
D) sea surface temperatures in the Atlantic become significantly warmer.
Q3) One of the primary forces that cause atmospheric circulation is convection, which occurs when
A) the rotation of Earth exerts friction on the atmosphere.
B) warm air at the surface rises and displaces the cooler air above it.
C) winds blowing north or south are deflected to the left or right by the Earth's rotation.
D) the tilt of the Earth's axis of rotation causes the atmosphere to slide toward the equator.
Q4) The Earth's tropical areas are found at _______ latitudes than temperate areas.
To view all questions and flashcards with answers, click on the resource link above.
Page 35
Chapter 34: Growth of Populations
Available Study Resources on Quizplus for this Chatper
65 Verified Questions
65 Flashcards
Source URL: https://quizplus.com/quiz/16733
Sample Questions
Q1) The size of a population can be decreased by A) a higher birth rate.
B) immigration.
C) emigration.
D) a reduced death rate.
Q2) Which of the following has the highest population density?
A) 1 grasshopper living in an area of 10 square meters.
B) 100 rabbits living in an area of 10,000 square meters
C) 200 sparrows living in an area of 20,000 square meters
D) 1,500 oysters living in an area of 1,500 square meters
Q3) The maximum population size that can be supported by its habitat is known as A) maximum increase.
B) carrying capacity.
C) exponential growth.
D) population balance.
Q4) The initial success of a human civilization
A) is typically characterized by decreases in population density.
B) simply postpones its inevitable collapse.
C) does not guarantee its future existence.
D) has no effect on population factors.
To view all questions and flashcards with answers, click on the resource link above. Page 36
Chapter 35: Interactions among Organisms
Available Study Resources on Quizplus for this Chatper
70 Verified Questions
70 Flashcards
Source URL: https://quizplus.com/quiz/16734
Sample Questions
Q1) A species can participate in several symbiotic relationships simultaneously; for example, the invasive fire tree competes with native vegetation for soil nutrients and maintains a mutualistic relationship with root bacteria.
A)True
B)False
Q2) If a bird eats a monarch butterfly, the bird will vomit. Monarchs are brightly colored. This example demonstrates _______ coloration.
Q3) The relationship between humans and domesticated livestock is
A) symbiotic and competitive.
B) parasitic and predatory.
C) competitive and symbiotic.
D) predator and prey.
Q4) Which of the following animals would be most likely to simultaneously participate in seed dispersal and a gut inhabitant mutualism?
A) wolves
B) rattlesnakes
C) scorpions
D) deer
To view all questions and flashcards with answers, click on the resource link above. Page 37
Chapter 36: Communities of Organisms
Available Study Resources on Quizplus for this Chatper
65 Verified Questions
65 Flashcards
Source URL: https://quizplus.com/quiz/16735
Sample Questions
Q1) Which of the following choices best explains, from an ecological perspective, why there are laws that require a wildlife survey before certain building or other land-use projects may proceed?
A) If a keystone species is found, it can be moved to another area where it will establish a new community of organisms.
B) If the only local habitat for a keystone species is disturbed, the entire community of populations will be affected.
C) If the species are surveyed before the land is used they will all be more likely to survive the building project.
D) If the species are surveyed before the land is used they will all be more easily distributed to other habitats.
Q2) The only source of energy for life on Earth is the sun.
A)True
B)False
Q3) Burning of fossil fuels may affect climate but not communities.
A)True
B)False
Q4) A _______ is a single sequence of who eats whom in a community.
To view all questions and flashcards with answers, click on the resource link above.
Page 38
Chapter 37: Ecosystems
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/16736
Sample Questions
Q1) The marine ecosystem with the lowest net primary productivity is A) the coral reef.
B) the open ocean.
C) swamp and marsh areas.
D) the ocean upwelling zone.
Q2) The energy in sunlight is directly associated with the synthesis of A) carbon dioxide.
B) sugars.
C) fats.
D) nucleic acids.
Q3) All areas of the same landmass have the same net primary productivity. A)True
B)False
Q4) The primary contribution of decomposers to an ecosystem occurs when they A) capture solar energy.
B) recycle nutrients sequestered in organisms back to the physical environment.
C) regulate the number of producers.
D) prevent consumers overpopulation.
Q5) Human actions such as logging, building on a floodplain, or diverting rivers increases the probability of severe _______.
To view all questions and flashcards with answers, click on the resource link above. Page 39
Chapter 38: Global Change
Available Study Resources on Quizplus for this Chatper
65 Verified Questions
65 Flashcards
Source URL: https://quizplus.com/quiz/16737
Sample Questions
Q1) In comparison to past estimates extinction rates are currently high. Which of the following is the most plausible explanation?
A) Natural fluctuations in climate causes extinctions.
B) Continental drift is causing rapid changes in climate, which, in turn, causes extinctions.
C) Previous extinctions make survival of contemporary species more difficult.
D) Humans are affecting many aspects of the global environment.
Q2) Why do synthetic chemicals and metals tend to bioaccumulate so readily?
A) These substances are so rare in natural environments that living organisms have developed very efficient methods of collecting them.
B) Natural reservoirs are so large that when expressed as a concentration putting the same amount into an organism will always produce an elevated value.
C) Synthetic chemicals often have no nutritional value so they are simply stored in the body and passed on when an organism is eaten.
D) They are foreign to the metabolism of most organisms and the biochemical systems needed to remove them from the body do not exist.
Q3) The conversion of N to NH is called _______ _______.
To view all questions and flashcards with answers, click on the resource link above. Page 40
Chapter 39: Biodiversity and People
Available Study Resources on Quizplus for this Chatper
72 Verified Questions
72 Flashcards
Source URL: https://quizplus.com/quiz/16738
Sample Questions
Q1) During mass extinctions all existing species become extinct.
A)True
B)False
Q2) Although humans appear to be responsible for the current extinction crisis, scientists are confident that human did not contribute to any previous extinction event because
A) humans did not exist during those time periods.
B) the human population 350 million years ago was too small to have caused any environmental problems.
C) humans lacked the modern technologies in use today that cause so much environmental damage.
D) aggressive predatory dinosaurs have been shown to be responsible for these extinctions.
Q3) About half of the known species on Earth are insects.
A)True
B)False
Q4) Characteristic types of environments or places in which different species can live are called ___________.
Q5) An ecosystem is made up of _______ and the organisms that live in them.
To view all questions and flashcards with answers, click on the resource link above. Page 41
Chapter 40: Cancer: Cell Division Out of Control
Available Study Resources on Quizplus for this Chatper
69 Verified Questions
69 Flashcards
Source URL: https://quizplus.com/quiz/16739
Sample Questions
Q1) An overactive viral protein _______ can turn on signal cascades in a host, thus leading to cancer.
Q2) In many human colon tumors, the beginning of true malignancy is the result of the A) loss of part of chromosome 18.
B) inactivation of both oncogenes.
C) inactivation of both proto-oncogenes.
D) arrival of cancerous cells from other parts of the body.
Q3) The addition of a phosphate group to a protein activate the protein by causing it to change its ___________.
Q4) Cancer-causing chemicals increase the risk of cancer by promoting _______ in the DNA, causing changes in the DNA base sequences.
Q5) Which of the following statements about viruses is false?
A) Viruses can cause cancer.
B) Viruses can be used to destroy cancer cells.
C) Viruses do not contain a nucleic acid.
D) Viruses take over a cell's machinery in order to reproduce.
Q6) Mutations cause changes in __________ produced by a gene.
Q7) Positive growth regulators increase the rate of _____________.
Page 42
To view all questions and flashcards with answers, click on the resource link above.
Chapter 41: Harnessing the Human Genome
Available Study Resources on Quizplus for this Chatper
62 Verified Questions
62 Flashcards
Source URL: https://quizplus.com/quiz/16740
Sample Questions
Q1) Which of the following statements about the use of genomic research is false?
A) It allows the study of gene activity in the context of a whole cell or whole organism.
B) All the participants in a signal cascade can be observed working together.
C) It is possible to detect all the genes that are turned on or off in response to a hormone signal.
D) It does not produce much data, so the information is easy to analyze.
Q2) A doctor has a patient with high blood pressure. The doctor could use single nucleotide polymorphism (SNP) analysis to determine
A) whether the patient currently has high cholesterol.
B) what type of medication would most effectively treat this patient's condition.
C) how previously prescribed drugs have affected the patient's genome.
D) if the patient has recently had a heart attack.
Q3) James Watson and Francis Crick
A) created artificial DNA in the laboratory.
B) discovered that DNA was the genetic material.
C) discovered the structure of DNA.
D) sequenced the genome of a nematode worm.
Q4) SNP stands for single nucleotide _____________.
To view all questions and flashcards with answers, click on the resource link above.
Page 43
Chapter 42: Humans and Evolution
Available Study Resources on Quizplus for this Chatper
60 Verified Questions
60 Flashcards
Source URL: https://quizplus.com/quiz/16741
Sample Questions
Q1) Hominids adapted to life on the ground approximately _______ years ago.
A) 3.5 billion
B) 130 thousand
C) 600 million
D) 5-7 million
Q2) On a trip to the rainforest, a scientist finds a new species of animal. It looks a bit like a mouse, but it has opposable thumbs and lives in trees. Which of the following terms is least likely to apply to this animal?
A) primate
B) hominid
C) mammal
D) chordate
Q3) The publication of Darwin's Origin of Species led scientists to
A) place our species into the hominid family.
B) realize that we descended from earlier animals.
C) realize that the evolutionary lineage leading to humans split from the lineage leading to chimpanzees over 30 million years ago.
D) combine the families containing apes and humans.
Q4) The first members of the genus Homo originated on the continent of ______.
To view all questions and flashcards with answers, click on the resource link above. Page 44
Chapter 43: Smoking--Beyond Lung Cancer
Available Study Resources on Quizplus for this Chatper
63 Verified Questions
63 Flashcards
Source URL: https://quizplus.com/quiz/16742
Sample Questions
Q1) The reason you feel energized after smoking a cigarette is that nicotine stimulates the release of epinephrine from the adrenal glands.
A)True
B)False
Q2) The more a person smokes, the more sensitive that person's brain becomes to nicotine.
A)True B)False
Q3) Dopamine is the addictive agent in tobacco smoke.
A)True
B)False
Q4) When fluid collects in alveoli as a result of smoking, gas exchange is slower because A) gases are unable to dissolve in fluids.
B) the fluid blocks the flow of blood through the capillaries in the lungs.
C) the fluid increases the amount of surface area available for diffusion.
D) gases diffuse more slowly over the longer distance created by the fluid.
Q5) Edema results from the movement of ________ out of the blood vessels and into the surrounding tissues.
To view all questions and flashcards with answers, click on the resource link above. Page 45
Chapter 44: Feeding a Hungry Planet
Available Study Resources on Quizplus for this Chatper
55 Verified Questions
55 Flashcards
Source URL: https://quizplus.com/quiz/16743
Sample Questions
Q1) Organic farming is one of several new farming strategies. Although the yield are somewhat reduced organic farming is attractive because it
A) minimize or avoids completely the use of synthetic chemicals.
B) focuses exclusively on genetically modified food crops.
C) has developed strains that can tolerate exposure to herbicides.
D) doesn't utilize plowing which has been shown to damage top soil.
Q2) Areas where domesticated animals such as sheep and cattle can roam and graze are called _________.
Q3) In today's world which of the following is not a major method of improving crop yields?
A) preserving crop diversity
B) genetic engineering
C) irrigation
D) plant breeding
Q4) Which of the following is true?
A) Seeds are an aspect of farming that does not require the input of energy.
B) Irrigation does not require energy.
C) Organic farming consumes less energy than precision farming.
D) Fertilizing doesn't require energy.
To view all questions and flashcards with answers, click on the resource link above. Page 46
Chapter 45: Building a Sustainable Society
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/16744
Sample Questions
Q1) The United States uses a cap and trade system to regulate SO by first setting a nationwide emission limit and issuing emission allowances. At the end of the year,
A) unused allowances can be sold, traded, or saved for future use.
B) companies exceeding their allowance are heavily fined.
C) unused allowances must be remitted to the government.
D) the government identifies the most successful emission reduction strategy and requires its adoption for any future allowances.
Q2) The Index of Sustainable Economic Welfare is more inclusive than the Gross National Product index.
A)True
B)False
Q3) Green roofs carry out photosynthesis, and hence they help to
A) reduce the greenhouse effect.
B) absorb CO from the atmosphere.
C) decrease the amount of fixed nitrogen in the air.
D) a and b above
Q4) Carbon dioxide and CFCs are both greenhouse gases.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 47