Skip to main content

Precision Medicine in Nursing Textbook Exam Questions - 432 Verified Questions

Page 1


Precision Medicine in Nursing

Textbook Exam Questions

Course Introduction

Precision Medicine in Nursing explores the integration of personalized healthcare approaches into nursing practice, focusing on how genetic, genomic, environmental, and lifestyle factors influence patient care. This course examines cutting-edge advancements in precision medicine and their implications for disease prevention, diagnosis, and treatment. Students will learn to assess individual variability among patients, appraise ethical and legal considerations, and apply evidence-based strategies for individualized care. Emphasis is placed on interdisciplinary collaboration and the competencies needed for nurses to advocate for and implement precision medicine in diverse clinical settings.

Recommended Textbook

Genetics and Genomics in Nursing and Health Care 2nd Edition by Theresa A. Beery

Available Study Resources on Quizplus

20 Chapters

432 Verified Questions

432 Flashcards

Source URL: https://quizplus.com/study-set/201 Page 2

Chapter 1: DNA Structure and Function

Available Study Resources on Quizplus for this Chatper

25 Verified Questions

25 Flashcards

Source URL: https://quizplus.com/quiz/2914

Sample Questions

Q1) What is the most outstanding feature of a mature haploid cell?

A)It is usually homozygous.

B)The sex chromosomes are missing.

C)Only one chromosome of each pair is present.

D)DNA synthesis occurs after mitosis instead of before.

Answer: C

Q2) What activity occurs during M phase of the cell cycle?

A)The cell undergoes cytokinesis.

B)Activity stops, and the cell "sleeps."

C)All DNA is completely replicated.

D)The cell greatly increases protein synthesis.

Answer: A

Q3) What is the purpose of phosphorous in a DNA strand?

A)Linking the nucleotides into a strand

B)Holding complementary strands together

C)Ensuring that a purine is always paired with a pyrimidine

D)Preventing the separation of double-stranded DNA into single-stranded DNA

Answer: A

To view all questions and flashcards with answers, click on the resource link above.

Chapter 2: Protein Synthesis

Available Study Resources on Quizplus for this Chatper

31 Verified Questions

31 Flashcards

Source URL: https://quizplus.com/quiz/2915

Sample Questions

Q1) What is the best meaning for the term gene expression?

A)The location of a specific gene allele on a specific autosomal chromosome

B)The specific trait or protein coded for by a single gene is actually present

C)The ability of a single gene to code for more than one trait or characteristic

D)The loss of a trait or characteristic from one family generation to the next generation

Answer: B

Q2) Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA

A)AUGGUUAUUA

B)ACGCTCGATTATTT

C)CGCUCGAUUAUUU

D)AACGCUUGGUCUGAAUUUUAAUUU

Answer: A

To view all questions and flashcards with answers, click on the resource link above.

4

Chapter 3: Genetic Influence on Cell Division, Differentiation,

and

Gametogenesis

Available Study Resources on Quizplus for this Chatper

32 Verified Questions

32 Flashcards

Source URL: https://quizplus.com/quiz/2916

Sample Questions

Q1) Which normal cell characteristic is represented by the production of insulin in the beta cells of the pancreas?

A)Performance of a differentiated function

B)Ability to undergo apoptosis on schedule

C)Tight regulation of cell division

D)Conservation of energy

Answer: A

Q2) Which event occurs during mitosis?

A)Homologous chromosomes synapse and then cross over.

B)The number of chromosomes decreases from diploid to haploid.

C)Daughter cells are produced that are genetically identical to the parent cell.

D)DNA density decreases, and the 46 separate pieces assemble into one linear strand.

Answer: C

Q3) Which stage of cell division is present in mitosis but is missing in meiosis?

A)G<sub>1</sub>

B)S

C)G<sub>2</sub>

D)M

Answer: C

To view all questions and flashcards with answers, click on the resource link above. Page 5

Chapter 4: Patterns of Inheritance

Available Study Resources on Quizplus for this Chatper

36 Verified Questions

36 Flashcards

Source URL: https://quizplus.com/quiz/2917

Sample Questions

Q1) Which situation most closely represents an example of "regression to the mean"?

A)Two hearing-impaired parents produce a child who has normal hearing.

B)A 40-year-old man whose father developed type 2 diabetes mellitus at age 50 is diagnosed with the disorder.

C)The three children of a mother who has an intelligence quotient (IQ) of 170 all have IQs in the 110 to 120 range.

D)A child whose biologic parents are thin is adopted by a family whose members are obese and eventually becomes overweight.

Q2) What is the risk for a person to inherit an autosomal-dominant genetic disease-causing allele from a parent who is heterozygous if the disorder has a penetrance factorof 75%?

A)100%

B)75%

C)50%

D)25%

To view all questions and flashcards with answers, click on the resource link above.

Chapter 5: Epigenetic Influences on Gene Expression

Available Study Resources on Quizplus for this Chatper

11 Verified Questions

11 Flashcards

Source URL: https://quizplus.com/quiz/2918

Sample Questions

Q1) How is alcohol consumption thought to increase methylation in cancer suppressor genes to increase the risk for head and neck cancer?

A)Preventing DNA repair

B)Enhancing cell division

C)Acting as a methyl donor

D)Activating select oncogenes

Q2) Which statement about the microbiome is true?

A)The microbiome does not undergo further changes after development is complete.

B)With aging, its influence on health is reduced.

C)The microbiome is necessary for good health.

D)Identical twins have identical microbiomes.

Q3) Which term or phrase is used to describe the ability of the environment to cause different phenotypes to develop from the same genotype?

A)Developmental plasticity

B)Histone modification

C)Phenotype variability

D)Nutrigenomics

To view all questions and flashcards with answers, click on the resource link above. Page 7

Chapter 6: Autosomal Inheritance and Disorders

Available Study Resources on Quizplus for this Chatper

20 Verified Questions

20 Flashcards

Source URL: https://quizplus.com/quiz/2919

Sample Questions

Q1) Which description is the best example of "genomic imprinting"?

A)A child inherits a trait that his paternal grandfather expressed but that his father did not express.

B)Boys can inherit only masculine traits from their fathers because women do not have a Y chromosome.

C)There is a qualitative difference in some gene alleles based on whether they are inherited from the mother or the father.

D)When the number of sex chromosomes is greater than normal, the resulting individual is most often infertile.

Q2) What is the risk for a man who has Down syndrome to produce a child with Down syndrome with a woman who has a normal karyotype?

A)100%

B)50%

C)5%

D)0%

To view all questions and flashcards with answers, click on the resource link above. Page 8

Chapter 7: Sex Chromosome and Mitochondrial Inheritance and Disorders

Available Study Resources on Quizplus for this Chatper

20 Verified Questions

20 Flashcards

Source URL: https://quizplus.com/quiz/2920

Sample Questions

Q1) At what specific location on an X chromosome is a break most likely to occur in fragile X syndrome?

A)The centromere

B)End of the p arm

C)End of the q arm

D)Within the nucleosome

Q2) What would be the expected consequence to two daughter cells after mitosis if the ability to produce mitochondria was lost?

A)Cell commitment and differentiation would fail to occur.

B)The process of protein synthesis could not be controlled.

C)The rate and amount of ATP production would be limited.

D)Future cell division would result in an uneven number of cells.

Q3) A male patient is tall and has some gynecomastia along with a low sperm count. During infertility testing, he was found to have a 47,XXY karyotype. Which disorder isconsistent with these findings?

A)Normal male

B)Turner syndrome

C)Klinefelter syndrome

D)Testicular feminization syndrome

Page 9

To view all questions and flashcards with answers, click on the resource link above.

Chapter 8: Family History and Pedigree Construction

Available Study Resources on Quizplus for this Chatper

20 Verified Questions

20 Flashcards

Source URL: https://quizplus.com/quiz/2921

Sample Questions

Q1) Which pair of relatives represents a first-degree relationship?

A)Grandfather and grandson

B)Aunt and nephew

C)Sister and brother

D)Two cousins

Q2) What is the primary purpose of a pedigree?

A)To identify family members' places within a kindred and describe their medical history.

B)To establish which person within a kindred is responsible for introducing a genetic mutation into the family.

C)To determine the specific risk of any one family member to develop or pass on a genetic-based health problem.

D)To establish which person within a kindred is responsible for bringing the family to the attention of a genetics professional.

Q3) Why is a pedigree considered an "unstable" product?

A)The person collecting the information may not be a genetics professional.

B)Some family members may have lied about their reproductive history.

C)The memories of older family members may be inaccurate.

D)The health of living family members continues to evolve.

To view all questions and flashcards with answers, click on the resource link above. Page 10

Chapter 9: Congenital Anomalies, Basic Dysmorphology, and

Genetic Assessment

Available Study Resources on Quizplus for this Chatper

17 Verified Questions

17 Flashcards

Source URL: https://quizplus.com/quiz/2922

Sample Questions

Q1) Which anomaly constitutes clinodactyly?

A)An extra toe on one foot

B)A laterally curved fifth finger

C)Complete absence of fingers and toes

D)Fusion of two fingers on the right hand

Q2) You are working in a clinic, and a 4-year-old child is brought in with a history of cleft palate repair. His parents say they want to have another child and ask youiftheir other children will have the same problem. They mention that Mom's uncle Bob had a cleft lip. What do you say?

A)"There is a 3% to 5% risk that your next child will be affected."

B)"Looking at your family history, I can tell that there is a 20% risk that your next child will be affected."

C)"Let's make an appointment with a genetic counselor who will help determine your next child's risk."

D)"You should have carrier testing to find out if your next child is at risk."

To view all questions and flashcards with answers, click on the resource link above.

Page 11

Chapter 10: Enzyme and Collagen Disorders

Available Study Resources on Quizplus for this Chatper

30 Verified Questions

30 Flashcards

Source URL: https://quizplus.com/quiz/2923

Sample Questions

Q1) What is the expected outcome of pregnancy for women with phenylketonuria (PKU) when the blood levels of phenylalanine are high throughout the pregnancy?

A)Most births are post-mature.

B)There is a high incidence of infertility.

C)The infant develops PKU.

D)There is a high incidence of cardiovascular birth defects.

Q2) What is the pathologic basis of Fabry disease?

A)Increased degradation of globotriaosylceramide

B)Increased accumulation of globotriaosylceramide

C)Deficiency in the number of liver lysosomes

D)Excessive number of liver lysosomes

Q3) For which disorder is the drug idursulfase (Elaprase) appropriate for enzyme-replacement therapy?

A)Hurler syndrome

B)Hunter syndrome

C)Gaucher type 2

D)Tay-Sachs disease

To view all questions and flashcards with answers, click on the resource link above.

12

Chapter 11: Common Childhood-Onset Genetic Disorders

Available Study Resources on Quizplus for this Chatper

34 Verified Questions

34 Flashcards

Source URL: https://quizplus.com/quiz/2924

Sample Questions

Q1) Which additional health problem commonly develops in boys with Duchenne muscular dystrophy?

A)Arthritis

B)Hypertension

C)Diabetes mellitus

D)Chronic heart failure

Q2) How does the drug Endari reduce the manifestations of sickle cell disease?

A)Promoting faster red blood cell production

B)Increasing the concentration of fetal hemoglobin (HbF)

C)Reducing oxidate stress and increasing the life span of red blood cells

D)Correcting the mutation of one allele so that the person has sickle cell trait instead of sickle cell disease

Q3) A 12-year-old girl was diagnosed with von Willebrand disease (VWD) when she developed profound anemia from very heavy menstrual periods. Her levels of von Willebrand (vWf) factor are normal. What specific type of von Willebrand disease is she most likely to have?

A)Type 1 VWD

B)Type 2 VWD

C)Type 3 VWD

D)Type 4 VWD

To view all questions and flashcards with answers, click on the resource link above. Page 13

Chapter 12: Common Adult-Onset Disorders

Available Study Resources on Quizplus for this Chatper

25 Verified Questions

25 Flashcards

Source URL: https://quizplus.com/quiz/2925

Sample Questions

Q1) Which type of maturity-onset diabetes of the young (MODY) is the most common?

A)MODY-1

B)MODY-2

C)MODY-3

D)MODY-4

Q2) A fasting blood glucose sample indicates that your 24-year-old male patient has hyperglycemia that was not present during a test 6 weeks ago. What is the mostlikely cause of this?

A)Type 1 diabetes mellitus

B)Type 2 diabetes mellitus

C)Maturity-onset diabetes of the young (MODY)

D)Gestational diabetes mellitus

Q3) Why are women usually older than men before symptoms of hereditary hemochromatosis manifest?

A)Women have a counterbalancing normal gene on their second X chromosome.

B)Women lose some iron with normal menstruation during childbearing years.

C)Men have a larger muscle mass and more iron-storing capability than women.

D)Men have greater expression of the gene for hemoglobin than do women.

To view all questions and flashcards with answers, click on the resource link above.

14

Chapter 13: Cardiovascular Disorders

Available Study Resources on Quizplus for this Chatper

23 Verified Questions

23 Flashcards

Source URL: https://quizplus.com/quiz/2926

Sample Questions

Q1) The process in which gene variants interact with other gene variants to cause disease can be described by what word/phrase?

A)Phenotype variation

B)Reduced penetrance

C)Epistasis

D)Variable expressivity

Q2) Your patient has been diagnosed with long QT syndrome (LQTS). What do you know about this heart rhythm problem?

A)LQTS is a congenital genetic disease that will be evident during the first 2 years of life.

B)It is relatively rare and often caused by private mutations.

C)LQTS is treated in the same way, no matter the cause.

D)Deafness always accompanies LQTS.

Q3) What is the most accurate classification of the common forms of coronary artery disease and hypertension?

A)Secondary disorders caused by lifestyle choices

B)Sequential genetic disorders related to age, ethnicity, and gender

C)Complex disorders resulting from gene-environment interactions

D)Primary disorders with an autosomal-dominant pattern of inheritance

To view all questions and flashcards with answers, click on the resource link above. Page 15

Chapter 14: The Genetics of Cancer

Available Study Resources on Quizplus for this Chatper

30 Verified Questions

30 Flashcards

Source URL: https://quizplus.com/quiz/2927

Sample Questions

Q1) What event occurring during the latency period of carcinogenesis is most likely to contribute to cancer development?

A)Cellular apoptosis

B)Error-free DNA repair

C)Exposure to promoters

D)Oncogene inactivation

Q2) Which statement about a "germline" mutation in either a cancer suppressor gene or an oncogene is accurate?

A)Cancer risk is increased only in sex hormone-sensitive tissues.

B)The gene now has expressive potential but not penetrant potential.

C)Cancer risk increases, but additional mutations are required for cancer development.

D)A person inheriting such a mutation has a 100% risk for developing a specific cancer type.

Q3) Which theory of carcinogenesis has the most support?

A)DNA damage, which permits overexpression of oncogenes

B)RNA damage, which results in incomplete protein formation

C)Autoantibodies, which attack specific "self" tissues and organs

D)The failure of embryonic tissues to undergo normal differentiation

To view all questions and flashcards with answers, click on the resource link above. Page 16

Chapter 15: Genetic Contributions to Psychiatric and Behavioral Disorders

Available Study Resources on Quizplus for this Chatper

15 Verified Questions

15 Flashcards

Source URL: https://quizplus.com/quiz/2928

Sample Questions

Q1) Why are single-nucleotide polymorphisms (SNPs), which have been associated with schizophrenia and bipolar disorder, currently not used to diagnose either of these disorders?

A)The changes in gene activity caused by the SNPs is not sufficient to cause disease expression.

B)SNPs are associated with nicotine dependence but not with schizophrenia or bipolar disorder.

C)The SNPs are too small to result in either a frameshift mutation or a point mutation.

D)These SNP-induced gene changes cannot be altered by pharmacologic therapy.

Q2) Why is pharmacogenetics/pharmacogenomics of particular interest in treating patients with psychiatric/mental health problems?

A)Psychiatric medications may be effective in only a small group of patients.

B)Genetics restricts patients to only one drug in each classification.

C)Most psychiatric illnesses are single-gene disorders with predictable drug responses.

D)Psychotropic medications have few side effects.

To view all questions and flashcards with answers, click on the resource link above. Page 17

Chapter 16: Genetic and Genomic Testing

Available Study Resources on Quizplus for this Chatper

14 Verified Questions

14 Flashcards

Source URL: https://quizplus.com/quiz/2929

Sample Questions

Q1) What type of genetic test provides information about an asymptomatic person's risk for having a child with a specific autosomal-recessive disorder in the future?

A)Carrier test

B)Diagnostic test

C)Newborn screening

D)Predictive test

Q2) Which type of genetic testing is the most sensitive method for detecting any mutation in a specific gene?

A)Immunohistochemistry

B)Direct DNA sequencing

C)Banded chromosomal analysis

D)Fluorescence in situ hybridization

Q3) Under which condition can preimplantation genetic testing be performed?

A)During in vitro fertilization

B)Between 4 to 6 weeks' gestation

C)When paternity is unknown

D)When an ultrasound indicates the fetus has a structural abnormality

To view all questions and flashcards with answers, click on the resource link above. Page 18

Chapter 17: Assessing Genomic Variation in Drug Response

Available Study Resources on Quizplus for this Chatper

17 Verified Questions

17 Flashcards

Source URL: https://quizplus.com/quiz/2930

Sample Questions

Q1) What is the expected heart-rate response when a patient is taking a drug that is an adrenaline antagonist?

A)Heart rate is unchanged.

B)Heart rate decreases.

C)Heart rate increases.

D)Heart rate is irregular.

Q2) You are caring for a child with acute lymphoblastic leukemia. She has been genotyped and is homozygous for a TPMT polymorphism, producing very little of the enzymeneeded for this drug's metabolism. How would you expect this to affect dosing of the drug 6-mercaptopurine?

A)This child should receive only a small fraction of the standard dose.

B)This child should receive the drug intravenously rather than orally.

C)This child should receive higher doses than the standard dose.

D)This child should receive the standard dose.

Q3) Which organ has the greatest concentration of cytochrome P (CYP) 450 enzymes?

A)Stomach

B)Kidney

C)Brain

D)Liver

To view all questions and flashcards with answers, click on the resource link above.

Page 19

Chapter 18: Health Professionals and Genomic Care

Available Study Resources on Quizplus for this Chatper

11 Verified Questions

11 Flashcards

Source URL: https://quizplus.com/quiz/2931

Sample Questions

Q1) Which action reflects promotion of genomic care as part of comprehensive health care?

A)Calculating the odds ratios and recurrence risks of common complex health problems for all people

B)Ensuring that genomic issues potentially influencing a person's health are incorporated into routine care

C)Encouraging all people to undergo genetic testing as part of a proactive health screening and prevention program

D)Instructing patients who undergo genetic testing about their obligation to inform family members regarding test results

Q2) The patient who has been found to have a mutation in a gene allele that greatly increases her risk for a serious health problem has asked a generalist nurse tobe present when she discloses this information to her family. What is the nurse's role in this situation?

A)Primary health-care provider

B)Genetic counselor

C)Patient advocate

D)Patient support

To view all questions and flashcards with answers, click on the resource link above.

Chapter

Available Study Resources on Quizplus for this Chatper

9 Verified Questions

9 Flashcards

Source URL: https://quizplus.com/quiz/2932

Sample Questions

Q1) What should be told to the patient who has been found to have a genetic mutation that increases the risk for colon cancer and says he does not want any of hisfamilytoknow about this result?

A)"It is required by law that you inform your siblings and your children about this result so that they also can be tested and monitored for colon cancer."

B)"It is not necessary to tell your siblings because they are adults, but you should tell your children so that they can be tested before they decide to have children of their own."

C)"It is not required that you tell anyone about this result; however, because your siblings and children may also be at risk for colon cancer, you should think about how this information might help them."

D)"It is your decision to determine with whom, if anyone, you share this test result; however, if you do not tell any of your family members and they get colon cancer, you would be responsible for their development of the disease."

To view all questions and flashcards with answers, click on the resource link above. Page 21

Chapter 20: Genetic and Genomic Variation

Available Study Resources on Quizplus for this Chatper

12 Verified Questions

12 Flashcards

Source URL: https://quizplus.com/quiz/2933

Sample Questions

Q1) What is the main purpose of population genetics?

A)Determining the factors that allow allelic frequencies to change over time

B)Determining the geographic origins of specific genetic-based disorders

C)Assessing the effects of assortive mating on natural selection and evolution

D)Assessing the differences between race and ethnicity for susceptibility and resistance to infectious diseases

Q2) Why are people of Ashkenazi Jewish descent more likely to be carriers of the mutations that cause Tay-Sachs and Gaucher disease?

A)The environment of Eastern Europe increased their risk of developing a mutation.

B)The common diet shared by these people has reduced their genetic diversity.

C)Bottleneck effects have reduced the genetic diversity in this population.

D)Being heterozygous for these diseases allowed them to survive cholera.

Q3) Which practice is most likely to result in a change in the Hardy-Weinberg equilibrium of a population or geographic area?

A)Random mating from within the established population

B)Geographic isolation of the established population

C)Assimilation of immigrants into the existing population

D)Preponderance of autosomal-dominant traits in the existing population

To view all questions and flashcards with answers, click on the resource link above.

22

Turn static files into dynamic content formats.

Create a flipbook
Precision Medicine in Nursing Textbook Exam Questions - 432 Verified Questions by Quizplus - Issuu