Nursing Leadership in Genomics Solved
Exam
Questions
Course Introduction
Nursing Leadership in Genomics explores the evolving role of nurses as leaders in the integration of genomics into healthcare practice. This course examines the foundational principles of genetics and genomics, the ethical, legal, and social implications of genetic information, and the impact of emerging genomic technologies on patient care. Students will develop strategies to advocate for patients, collaborate with interdisciplinary teams, and guide policy development while emphasizing the significance of culturally competent genomic care. Through case studies and real-world scenarios, the course prepares nursing professionals to assume leadership roles in education, management, and clinical practice settings, driving the adoption of genomic innovations in healthcare systems.
Recommended Textbook
Genetics and Genomics in Nursing and Health Care 2nd Edition by Theresa A. Beery
Available Study Resources on Quizplus
20 Chapters
432 Verified Questions
432 Flashcards
Source URL: https://quizplus.com/study-set/201
Page 2
Chapter 1: DNA Structure and Function
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/2914
Sample Questions
Q1) Where is telomeric DNA located?
A)At the tips of the p and q arms of chromosomes.
B)In the mitochondria of all somatic cells
C)Only in the germ cells (ova and sperm)
D)Within the histones of the solenoid
Answer: A
Q2) What is the most outstanding feature of a mature haploid cell?
A)It is usually homozygous.
B)The sex chromosomes are missing.
C)Only one chromosome of each pair is present.
D)DNA synthesis occurs after mitosis instead of before.
Answer: C
Q3) What would be the sequence of DNA that is complementary to a DNA section with the base sequence of GGTCAATCCTTAG?
A)GATTCCTAACTGG
B)TTGACCGAAGGCT
C)AACTGGCTTCCGA
D)CCAGTTAGGAATC
Answer: D
To view all questions and flashcards with answers, click on the resource link above.
3
Chapter 2: Protein Synthesis
Available Study Resources on Quizplus for this Chatper
31 Verified Questions
31 Flashcards
Source URL: https://quizplus.com/quiz/2915
Sample Questions
Q1) Which DNA segment deletion would cause a frameshift mutation?
A)TCT
B)GAGTC
C)TACTAC
D)GCATGACCC
Answer: B
Q2) Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA
A)AUGGUUAUUA
B)ACGCTCGATTATTT
C)CGCUCGAUUAUUU
D)AACGCUUGGUCUGAAUUUUAAUUU
Answer: A
Q3) Which statement about the introns within one gene is correct?
A)These small pieces of DNA form microRNAs that regulate gene expression.
B)They are part of the desert DNA composing the noncoding regions.
C)When expressed, they induce posttranslational modifications.
D)The introns of one gene may be the exons of another gene.
Answer: D
To view all questions and flashcards with answers, click on the resource link above. Page 4
Chapter 3: Genetic Influence on Cell Division, Differentiation,
and
Gametogenesis
Available Study Resources on Quizplus for this Chatper
32 Verified Questions
32 Flashcards
Source URL: https://quizplus.com/quiz/2916
Sample Questions
Q1) How many mature ovum result from the complete oogenesis of one oogonium?
A)One
B)Two
C)Three
D)Four
Answer: A
Q2) In which phases of the cell cycle is the normal cell tetraploid (4N)?
A)G<sub>1</sub> and G<sub>2</sub>
B)G<sub>1</sub> and S
C)S and G<sub>2</sub>
D)G<sub>2</sub> and M
Answer: C
Q3) Why is fertilization of a polar body unlikely to lead to normal embryonic and fetal development?
A)The resulting zygote would be 4N instead of 2N.
B)The lack of cytoplasm would inhibit cellular reproduction.
C)The polar body has spent too long of a time trapped in meiosis I.
D)The resulting zygote would be smaller, which increases the risk for apoptosis.
Answer: B
Page 5
To view all questions and flashcards with answers, click on the resource link above.
Chapter 4: Patterns of Inheritance
Available Study Resources on Quizplus for this Chatper
36 Verified Questions
36 Flashcards
Source URL: https://quizplus.com/quiz/2917
Sample Questions
Q1) A woman whose father does not have hemophilia gives birth to a son with classic hemophilia. This woman is found to have only 15% of the normal amount of clotting factor VIII (the clotting factor males with hemophilia are missing) and does have abnormal blood-clotting issues. Which phenomenon or factor is most likely responsible for her abnormal clotting factor expression?
A)The X chromosome most commonly inactivated in her bone marrow is paternally derived.
B)The X chromosome most commonly inactivated in her bone marrow is maternally derived.
C)This woman is demonstrating reduced penetrance of an X-linked-recessive disorder.
D)This woman is demonstrating full penetrance of an X-linked-recessive disorder.
Q2) Which factor allows inheritance patterns for a specific trait or health problem to be traced from one family generation to another?
A)Pleiotropy
B)Allele segregation
C)Regression to the mean
D)Gene-environment interaction
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: Epigenetic Influences on Gene Expression
Available Study Resources on Quizplus for this Chatper
11 Verified Questions
11 Flashcards
Source URL: https://quizplus.com/quiz/2918
Sample Questions
Q1) In fragile X syndrome, only noncoding regions within the gene for a protein that directs and maintains brain development are heavily methylated, resulting indecreasedcognitive ability and behavioral problems. What is the most likely mechanism of this abnormal expression?
A)Increased microRNA molecules reducing the synthesis of the gene product
B)Failure of the methylated regions to undergo translation
C)Suppression of the "splicing out" action for introns
D)Suppression of promoter function
Q2) How is eating a diet high in broccoli thought to reduce cancer risk?
A)Increasing the excretion rate of foods known to be methyl donors
B)Increasing histone acetylation, turning on anticancer genes
C)Decreasing the rate of microDNA synthesis and activity
D)Decreasing the exposure of carcinogens to nuclear DNA
Q3) What part of a chromosome's DNA is altered by histone modification?
A)Complementary base pairing
B)Attachment of phosphate groups
C)Development of telomeric "caps"
D)The degree of tension in helical tightness
To view all questions and flashcards with answers, click on the resource link above. Page 7
Chapter 6: Autosomal Inheritance and Disorders
Available Study Resources on Quizplus for this Chatper
20 Verified Questions
20 Flashcards
Source URL: https://quizplus.com/quiz/2919
Sample Questions
Q1) Which cancer type has an increased incidence among children with WAGR syndrome?
A)Acute leukemia
B)Brain tumors
C)Colorectal cancer
D)Nephroblastoma
Q2) Which syndrome or condition represents monosomy?
A)Cri du chat
B)Patau syndrome
C)Turner syndrome
D)Robertsonian translocation
Q3) Which chromosome is trisomic in Edward syndrome?
A)13
B)18
C)22
D)X
Q4) Which autosomal condition or syndrome commonly features a cleft lip and palate?
A)Angelman syndrome
B)Cri du chat
C)Edward syndrome
D)Prader-Willi syndrome
To view all questions and flashcards with answers, click on the resource link above. Page 8
Chapter 7: Sex Chromosome and Mitochondrial Inheritance and Disorders
Available Study Resources on Quizplus for this Chatper
20 Verified Questions
20 Flashcards
Source URL: https://quizplus.com/quiz/2920
Sample Questions
Q1) Which of the following mechanisms in fragile X syndrome (FXS) leads to expression of the disorder?
A)Trinucleotide repeat sequences interspersed with the exons of the FMR1 gene, resulting in the production of an abnormal protein
B)Trinucleotide repeat sequences causing methylation of the FMR1 gene, thus silencing its expression
C)Increased production of microRNA molecules that interfere with the transcription of the FMR1 gene
D)Increased production of microRNA molecules that interfere with the translation of the FMR1 gene
Q2) On which chromosome is the androgen receptor (AR) gene located?
A)1
B)21
C)X
D)Y
To view all questions and flashcards with answers, click on the resource link above. Page 9
Chapter 8: Family History and Pedigree Construction
Available Study Resources on Quizplus for this Chatper
20 Verified Questions
20 Flashcards
Source URL: https://quizplus.com/quiz/2921
Sample Questions
Q1) A man with syndactyly, an autosomal-dominant condition, has one child who also has syndactyly. His unaffected wife states, "Because the risk for having a child withthis problem is 50% and our first child has the problem, the next child will not be affected." What is the best response to this statement?
A)"That is not quite true because the risk is 50% with each pregnancy, so with all future children, you would have a 50% risk."
B)"That is not quite true because you could also have the mutation but not show the problem if there is variable expressivity."
C)"That is correct, but if you have more than two children, half of them will have syndactyly, and 50% will not have it."
D)"That is correct, and if you only have two children, the second one will not have syndactyly."
Q2) Which observations in a pedigree indicate a probable autosomal-dominant (AD) trait transmission?
A)Affected males and females appear in every generation.
B)The pedigree shows only one affected individual.
C)The trait appears to "skip" generations.
D)Only males are affected.
To view all questions and flashcards with answers, click on the resource link above. Page 10
Chapter 9: Congenital Anomalies, Basic Dysmorphology, and Genetic Assessment
Available Study Resources on Quizplus for this Chatper
17 Verified Questions
17 Flashcards
Source URL: https://quizplus.com/quiz/2922
Sample Questions
Q1) Naomi and her sister have the same allele for the gene of interest; however, Naomi has cleft lip, whereas her sister has only lip pits. What genetic process explains this difference?
A)Genomic imprinting
B)Decreased penetrance
C)Genetic heterogeneity
D)Variable expressivity
Q2) How does genetic assessment differ from routine physical assessment?
A)Routine physical assessment relies on personal history, and genetic assessment relies on the recorded family history.
B)Genetic assessment requires only inspection, and routine physical assessment involves inspection, palpation, and auscultation.
C)Genetic assessment encompasses routine physical assessment and always adds the consideration of genetic causes for findings.
D)Routine physical assessment is performed by all health-care professionals, and genetic assessment is performed only by genetic professionals.
To view all questions and flashcards with answers, click on the resource link above.
11
Chapter 10: Enzyme and Collagen Disorders
Available Study Resources on Quizplus for this Chatper
30 Verified Questions
30 Flashcards
Source URL: https://quizplus.com/quiz/2923
Sample Questions
Q1) A woman who is a carrier for Fabry disease has children with a man who does not have the disorder. Their son has the disease, and their daughter also has somesymptomsof Fabry disease even though she could only have inherited one affected allele. What is the explanation for the daughter having some symptoms of Fabry disease?
A)The girl must have a different father than her brother.
B)The daughter is seeking the same attention that is given to her brother.
C)The inactivation of one X chromosome in female cells is a totally random event.
D)In addition to inheriting one affected allele, the daughter has developed a somatic mutation.
Q2) What is the pathologic basis of Fabry disease?
A)Increased degradation of globotriaosylceramide
B)Increased accumulation of globotriaosylceramide
C)Deficiency in the number of liver lysosomes
D)Excessive number of liver lysosomes
To view all questions and flashcards with answers, click on the resource link above.
12
Chapter 11: Common Childhood-Onset Genetic Disorders
Available Study Resources on Quizplus for this Chatper
34 Verified Questions
34 Flashcards
Source URL: https://quizplus.com/quiz/2924
Sample Questions
Q1) How is sickle cell trait different from sickle cell disease?
A)People with sickle cell disease are homologous for the mutation, whereas those with sickle cell trait are heterozygous for the mutation.
B)People with sickle cell trait are homologous for the mutation, whereas those with sickle cell disease are heterozygous for the mutation.
C)Sickle cell disease results from an inherited mutation, and sickle cell trait results from an acquired mutation.
D)Sickle cell trait results from an inherited mutation, and sickle cell disease results from an acquired mutation.
Q2) What is the explanation for creatine kinase (CK) levels in a 14-year-old boy with Duchenne muscular dystrophy being much lower now than they were 5 years ago?
A)His disease is improving.
B)He now performs passive rather than active exercise.
C)Most of the muscle tissue has already been destroyed.
D)The disease is probably Becker muscular dystrophy (BMD) rather than Duchenne muscular dystrophy.
To view all questions and flashcards with answers, click on the resource link above.
Page 13
Chapter 12: Common Adult-Onset Disorders
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/2925
Sample Questions
Q1) Your patient's family comes from Ireland. Both her parents are carriers of gene mutations causing hereditary hemochromatosis (HFE-HHC). What is your patient'srisk of having the clinical signs of this disorder?
A)HHC is an autosomal-recessive condition; the risk is 25%.
B)HHC has incomplete penetrance; we cannot accurately predict the clinical risk.
C)HHC is a complex trait; we cannot accurately predict the clinical risk.
D)HHC is an autosomal-dominant trait; the risk is 50%.
Q2) Which factor is consistent with multifactorial (complex) genetic disease?
A)Expression of the trait often involves mutations in several genes.
B)Monozygotic (identical) twin concordance is 100%.
C)Genotype consistently predicts phenotype.
D)It tends to be autosomal dominant.
Q3) What can be interpreted about type 2 diabetes mellitus in monozygotic twins when it affects only one twin 70% of the time and affects both twins 30% of the time?
A)The trait is recessive.
B)Mutation repair is incompletely penetrant.
C)Nongenetic factors can influence expression.
D)Homologous genes can undergo chromatid exchanges.
To view all questions and flashcards with answers, click on the resource link above.
14
Chapter 13: Cardiovascular Disorders
Available Study Resources on Quizplus for this Chatper
23 Verified Questions
23 Flashcards
Source URL: https://quizplus.com/quiz/2926
Sample Questions
Q1) For patients who have familial hypercholesterolemia, what should be the focus of teaching for blood cholesterol reduction?
A)Eliminating animal fats from the diet
B)Increasing the amount of fruit in the diet
C)Exercising at least 4 to 5 hours every week
D)Taking the lipid-lowering drug as prescribed
Q2) What term is used to describe the gene-to-gene interaction in which the action of one gene modifies the expression of a different gene?
A)Epistasis
B)Heterogeneity
C)Genomic imprinting
D)Epigenetic penetrance
Q3) What is the most accurate classification of the common forms of coronary artery disease and hypertension?
A)Secondary disorders caused by lifestyle choices
B)Sequential genetic disorders related to age, ethnicity, and gender
C)Complex disorders resulting from gene-environment interactions
D)Primary disorders with an autosomal-dominant pattern of inheritance
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: The Genetics of Cancer
Available Study Resources on Quizplus for this Chatper
30 Verified Questions
30 Flashcards
Source URL: https://quizplus.com/quiz/2927
Sample Questions
Q1) Which type of body tissue has the highest risk for cancer development?
A)Bone tissue because its absorption of radiation is cumulative
B)Connective tissue that remains functional throughout life
C)Brain tissue because it does not respond well to injury
D)Any tissue that retains the ability to divide
Q2) A 22-year-old college student tells his nurse practitioner in the student health center that his mother died of colon cancer at age 32. He asks if this couldhave an impact on his health. What is your best response?
A)"Yes, you need to have yearly stool tests for occult blood."
B)"Yes, it would be good for you to talk with a genetics counselor."
C)"No, because colon cancer is considered a type of sporadic cancer."
D)"No, your risk would only be increased if your father had the colon cancer."
Q3) By which process does "promotion" assist in cancer development?
A)Inflicting mutations at specific sites on the exposed cell's DNA
B)Stimulating or enhancing cell division of cells damaged by a carcinogen
C)Increasing the transformed cell's capacity for error-free DNA repair
D)Making cancer cells appear more normal and escaping immunosurveillance
To view all questions and flashcards with answers, click on the resource link above.
Page 16
Chapter 15: Genetic Contributions to Psychiatric and Behavioral Disorders
Available Study Resources on Quizplus for this Chatper
15 Verified Questions
15 Flashcards
Source URL: https://quizplus.com/quiz/2928
Sample Questions
Q1) What is the best description of the genetic contribution to the onset of autism?
A)Autism spectrum is caused by a single-gene mutation in most, but not all, cases.
B)Exposure to a teratogen can be a cause of autism spectrum in many cases.
C)Known causes of autism spectrum include copy-number variants and chromosomal problems.
D)Autism spectrum disorders have a much stronger environmental input than genetic input to expression of the phenotype.
Q2) What is the heritability estimate for addiction to alcohol in both males and females?
A)10% to 20%
B)20% to 40%
C)50% to 60%
D)60% to 80%
Q3) What is meant by the phrase "behavioral genetics"?
A)Identification of the single gene that corresponds to a specific undesired behavior
B)An area of research aimed at controlling behavior by genetic manipulation
C)The study of the behavior of genes in diverse settings
D)The examination of gene variants that influence behaviors
To view all questions and flashcards with answers, click on the resource link above.
Page 17
Chapter 16: Genetic and Genomic Testing
Available Study Resources on Quizplus for this Chatper
14 Verified Questions
14 Flashcards
Source URL: https://quizplus.com/quiz/2929
Sample Questions
Q1) Which type of genetic testing is the most sensitive method for detecting any mutation in a specific gene?
A)Immunohistochemistry
B)Direct DNA sequencing
C)Banded chromosomal analysis
D)Fluorescence in situ hybridization
Q2) What is the major disadvantage to the fluorescence in situ hybridization (FISH) method of genetic testing?
A)Single-nucleotide mutations cannot be detected.
B)Depending on the skill of the technician, the rate of false positives is high.
C)The sample for testing must be obtained from living tissue rather than from a preserved specimen.
D)Results are not available quickly because cells must first be grown in culture before testing can be performed.
Q3) How is cell-free DNA (cdDNA) testing being used clinically?
A)To determine a person's risk for developing breast cancer
B)As an inexpensive alternative to standard paternity testing
C)As a less invasive way to determine the characteristics of cancer cells
D)As a way to determine whether a specific suspect has committed a rape
To view all questions and flashcards with answers, click on the resource link above.
Page 18
Chapter 17: Assessing Genomic Variation in Drug Response
Available Study Resources on Quizplus for this Chatper
17 Verified Questions
17 Flashcards
Source URL: https://quizplus.com/quiz/2930
Sample Questions
Q1) An Asian American man and his Caucasian wife are both taking warfarin (Coumadin) daily because of atrial fibrillation. The husband asks why he is prescribed amuch-smaller-than-average dose of the drug to keep his international normalized ratio (INR) at 2.0, whereas his wife takes the average dose, even though he is taller and heavier than she is. What is the nurse's best response?
A)"Body size is not important for warfarin, but gender differences are because testosterone improves its action."
B)"You are probably anemic, which would reduce your ability to form blood clots, so your doses can be lower."
C)"Many Asian Americans do not break down warfarin as fast as Caucasians, so the drug is more effective at lower dosages."
D)"Caucasians have higher levels of the enzyme that breaks down warfarin, requiring higher dosages for the same effect on INR."
Q2) Which processes of drug response are most subject to genetic variation?
A)Drug dissolution in body fluids and drug binding to plasma proteins
B)Rates of drug movement into and through the gastrointestinal tract
C)Drug activation or deactivation and duration of drug actions
D)Drug binding with receptors and drug blocking of receptors
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Health Professionals and Genomic Care
Available Study Resources on Quizplus for this Chatper
11 Verified Questions
11 Flashcards
Source URL: https://quizplus.com/quiz/2931
Sample Questions
Q1) Which action reflects promotion of genomic care as part of comprehensive health care?
A)Calculating the odds ratios and recurrence risks of common complex health problems for all people
B)Ensuring that genomic issues potentially influencing a person's health are incorporated into routine care
C)Encouraging all people to undergo genetic testing as part of a proactive health screening and prevention program
D)Instructing patients who undergo genetic testing about their obligation to inform family members regarding test results
Q2) Awoman's family history for breast cancer includes two paternal aunts who developed breast cancer before age 45. Which genetics professional would be most appropriatefor assistance in helping this patient understand the health risk posed by this family history?
A)Medical geneticist
B)Genetic counselor
C)Clinical geneticist
D)Clinical laboratory geneticist
To view all questions and flashcards with answers, click on the resource link above.
Page 20
Chapter 19: Financial, Ethical, Legal, and Social
Available
9 Verified Questions
9 Flashcards
Source URL: https://quizplus.com/quiz/2932
Sample Questions
Q1) Apatient asks you whether the Genetic Information and Nondiscrimination Act (GINA) means that his insurance company is required to pay for his genetic testingif heelects to have it done. What is your best response?
A)"Yes, if you agree to share the test results with your family, your health-care provider, and your insurance company."
B)"Yes, if other family members have already been found positive for a disease-causing mutation."
C)"No, unless testing finds a specific disorder for which a current medical intervention has been proven effective."
D)"No, it only protects against discrimination and does not require insurance companies to pay for testing."
Q2) Sometimes health-care providers with information about family members' genetic risk are confronted by conflicting ethical principles. Which principle is leastlikelytoconflict with the health-care provider's "duty to warn"?
A)Autonomy
B)Beneficence
C)Right to privacy
D)Genetic discrimination
To view all questions and flashcards with answers, click on the resource link above. Page 21
Chapter 20: Genetic and Genomic Variation
Available Study Resources on Quizplus for this Chatper
12 Verified Questions
12 Flashcards
Source URL: https://quizplus.com/quiz/2933
Sample Questions
Q1) Which practice is most likely to result in a change in the Hardy-Weinberg equilibrium of a population or geographic area?
A)Random mating from within the established population
B)Geographic isolation of the established population
C)Assimilation of immigrants into the existing population
D)Preponderance of autosomal-dominant traits in the existing population
Q2) Why is it important to consider population genetics?
A)Natural selection can increase genetic diversity.
B)Accurate assessment of a person's ethnicity can be identified from DNA.
C)Disease risk can vary as a result of the geographic origin of one's ancestors.
D)Knowing ethnicity allows accurate prediction of Huntington disease risk.
Q3) Asmall group of people left their homeland and set sail for a tropical island. They settled there, and their descendants lived for many generations. Unfortunately,a relatively high proportion of this new population is afflicted with an autosomal-recessive disease. What would explain this?
A)They encouraged immigration of people from the mainland.
B)An unidentified environmental radiation source was present on the island.
C)One of the original group members had the gene mutation from conception.
D)Their lack of genetic diversity made them more vulnerable to new mutations.
To view all questions and flashcards with answers, click on the resource link above.
Page 22