Human Genetics Practice Questions
Course Introduction
Human Genetics explores the principles and mechanisms of genetic inheritance in humans, examining how genes are structured, function, and are transmitted across generations. The course covers topics such as DNA structure and function, Mendelian and non-Mendelian patterns of inheritance, chromosomal abnormalities, genetic mutations, population genetics, and the role of genetics in health and disease. Students also discuss modern tools and methods in genetic analysis, the implications of genetic research for medicine and society, and ethical considerations in genetic testing and counseling.
Recommended Textbook
Human Genetics 10th Edition by Ricki Lewis
Available Study Resources on Quizplus
22 Chapters
1034 Verified Questions
1034 Flashcards
Source URL: https://quizplus.com/study-set/3104
Page 2
Chapter 1: What Is in a Human Genome
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61516
Sample Questions
Q1) One way that single-gene diseases differ from other diseases is that A)they affect consecutive generations.
B)they occur at the same frequency in every population. C)they are not treatable.
D)it is possible to predict occurrence in specific relatives.
Answer: D
Q2) The complete genetic material of an organism is its A)genome.
B)chromosome.
C)phenotype.
D)genotype.
Answer: A
Q3) A change in a gene's DNA sequence is a(n) A)genotype.
B)nucleotide.
C)mutation. D)genome.
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
3
Chapter 2: Cells
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61515
Sample Questions
Q1) DNA replicates during the _____ phase of the cell cycle.
A)G<sub>1</sub>
B)G<sub>2</sub>
C)G<sub>3</sub>
D)S
Answer: D
Q2) The two major stages of the cell cycle are
A)interphase and prophase.
B)interphase and mitosis.
C)mitosis and meiosis.
D)mitosis and apoptosis.
Answer: B
Q3) "Adult" stem cells are more accurately called tissue-specific or somatic stem cells because
A)they are also present at prenatal stages of development.
B)some adults do not have them.
C)whether they are present or not in an adult depends upon the individual's level of maturity.
D)an adult body also contains embryonic stem cells.
Answer: A
To view all questions and flashcards with answers, click on the resource link above. Page 4
Chapter 3: Meiosis,Development and Aging
Available Study Resources on Quizplus for this Chatper
73 Verified Questions
73 Flashcards
Source URL: https://quizplus.com/quiz/61514
Sample Questions
Q1) Human prenatal development takes _____ weeks.
A)32
B)38
C)44
D)52
Answer: B
Q2) The stem cells from which sperm cells descend are called A)spermatogoniA.
B)secondary spermatocytes.
C)spermatids.
D)patagonia.
Answer: A
Q3) Tanisha and Tawanda are twins but do not look alike.They are the result of fertilization of
A)one oocyte by two sperm cells.
B)two oocytes by one sperm cell.
C)two oocytes by two sperm cells.
D)one oogonium by one spermatogonium.
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
Page 5
Chapter 4: Single-Gene Inheritance
Available Study Resources on Quizplus for this Chatper
43 Verified Questions
43 Flashcards
Source URL: https://quizplus.com/quiz/61513
Sample Questions
Q1) In a family that starts with you,your grandchildren would be the _____ generation.
A)P<sub>1</sub>
B)P<sub>2</sub>
C)F<sub>1</sub>
D)F<sub>2</sub>
Q2) The original pedigrees,used in France in the fifteenth century,resembled
A)a bird's foot.
B)a cactus plant.
C)a snake eating a frog.
D)an insect's antennae.
Q3) The inheritance of eye color indicates that
A)many different genes determine eye color,each contributing to different degrees.
B)eye color is sensitive to what a pregnant woman eats.
C)other characteristics,such as the texture at the back of the eye,can affect the phenotype.
D)a person's sex influences inheritance of eye color.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 5: Beyond Mendels Laws
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/61512
Sample Questions
Q1) In Addam's family,there is an autosomal dominant condition in which webbing attaches the second toe to the third toe and the second toe is longer than the big toe.Only some of the members who have inherited the mutant allele have a second toe longer than the big toe.In addition,the extent of webbing varies.This phenotype is
A)both inherited and non-inherited.
B)dominant and recessive.
C)variably expressive and incompletely penetrant.
D)invariably expressive and completely penetrant.
Q2) Two different alleles for the same mitochondrial gene is called A)heterogamy.
B)heteroplasmy.
C)heterogeneity.
D)heterozygosity.
Q3) Geneticists construct linkage maps of chromosomes by
A)correlating a phenotype to an observable chromosomal abnormality.
B)determining the number of crossovers between genes on different chromosomes.
C)calculating the percent recombination between two genes on the same chromosome.
D)observing the number of genes on a chromosome.
To view all questions and flashcards with answers, click on the resource link above. Page 7
Chapter 6: Matters of Sex
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61511
Sample Questions
Q1) X inactivation is controlled by
A)the SRY gene.
B)the XIST gene.
C)the XTASY gene.
D)the location of the spindle in mitosis.
Q2) A healthy man and a healthy woman have a son with Lesch-Nyhan syndrome,an X-linked recessive trait.What are the chances that a daughter of this couple will inherit Lesch-Nyhan syndrome?
A)0
B)1/4
C)1/2
D)3/4
Q3) Indifferent gonads develop
A)during the first two weeks of prenatal development.
B)during the fifth week of prenatal development.
C)during the ninth week of prenatal development.
D)when the embryo becomes a fetus.
To view all questions and flashcards with answers, click on the resource link above. Page 8
Chapter 7: Multifactorial Traits
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61510
Sample Questions
Q1) In humans,heritability of clubfoot is 0.8.This means that expression of this condition is
A)strongly influenced by environmental factors.
B)solely dependent on inheritance of the clubfoot gene(s).
C)strongly dependent on inheritance of the clubfoot gene(s)but also influenced by environmental factors.
D)inherited from an affected parent 80% of the time.
Q2) The pattern of genetic transmission typical of a multifactorial trait is
A)discontinuous distributions such as 3:1.
B)that of Mendelian inheritance.
C)continuous variation of phenotypic expression.
D)a 9:3:3:1 ratio.
Q3) DNA sequences that contribute to polygenic traits are called
A)qualitative trait loci.
B)quantitative trait loci.
C)multifactorial trait loci.
D)single nucleotide polymorphisms.
To view all questions and flashcards with answers, click on the resource link above. Page 9
Chapter 8: Genetics of Behavior
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61509
Sample Questions
Q1) The first narcolepsy gene was discovered in A)bats.
B)cockroaches.
C)hippos.
D)dogs.
Q2) In the 1980s,when researchers began seeking gene variants that caused or contributed to bipolar disorder,it seemed that each extended family had its own mutations.These findings,looking back,most likely mean that
A)bipolar disorder results from imitating the behavior of an affected family member.
B)many gene variant combinations cause or contribute to bipolar disorder,but only a few such variants are seen in any one family.
C)many people fake the symptoms of bipolar disorder.
D)bipolar disorder reflects changes in gene expression,but not in mutations.
Q3) As individuals age,heritability of IQ
A)increases.
B)decreases.
C)remains relatively constant.
D)becomes impossible to assess.
To view all questions and flashcards with answers, click on the resource link above.
10
Chapter 9: DNA Structure and Replication
Available Study Resources on Quizplus for this Chatper
54 Verified Questions
54 Flashcards
Source URL: https://quizplus.com/quiz/61508
Sample Questions
Q1) Chargaff showed that DNA that has 20% guanine has _____ cytosine.
A)20%
B)30%
C)60%
D)40%
Q2) Which of the following statements is true in DNA replication?
A)DNA polymerase unwinds the DNA at replication forks.
B)Primase removes short RNA primers and replaces them with DNA.
C)Ligase breaks the hydrogen bonds between complementary DNA strands.
D)DNA polymerase proofreads DNA,correcting mismatched nucleotides.
Q3) In a molecule of DNA,purine bases form _____ bonds with pyrimidine bases.
A)phosphate
B)hydrogen
C)disulfide
D)covalent
Q4) DNA is able to replicate as quickly as it does because it has many A)replication forks.
B)genes.
C)chromosomes.
D)histones.
Page 11
To view all questions and flashcards with answers, click on the resource link above.
Chapter 10: Gene Action: From DNA to Protein
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/61507
Sample Questions
Q1) _____ tRNAs are required to translate the DNA template sequence GTTACTCTGTGGGCT into amino acids.3-26-2013
A)Two
B)Three
C)Four
D)Twenty
Q2) The linear order of amino acids in a polypeptide is the _____ structure of a protein. A)primary B)secondary
C)tertiary
D)quaternary
Q3) There are _____ different sequences of codons possible in the genetic code.
A)3
B)4
C)16
D)64
To view all questions and flashcards with answers, click on the resource link above. Page 12
Chapter 11: Gene Expression and Epigenetics
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61506
Sample Questions
Q1) The most abundant type of DNA repeat sequence is called a A)genome.
B)lipidome.
C)proteome.
D)transposon.
Q2) Hemoglobin in the embryo consists of
A)two epsilon chains and two zeta chains.
B)two gamma chains and two alpha chains.
C)two gamma chains and two beta chains.
D)one alpha chain,one beta chain,one epsilon chain,and one gamma chain.
Q3) Understanding the signals that activate pancreatic stem cells to differentiate as beta cells could be used to treat
A)restless legs syndrome.
B)male infertility.
C)endometriosis.
D)diabetes mellitus.
Q4) The "methylome" is the collection of all the methylated sites in the genome.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 13
Chapter 12: Gene Mutation
Available Study Resources on Quizplus for this Chatper
56 Verified Questions
56 Flashcards
Source URL: https://quizplus.com/quiz/61505
Sample Questions
Q1) Individuals with _____ develop numerous skin cancers when exposed to sunlight.
A)Ataxia telangiectasis
B)Cockayne syndrome
C)Werner syndrome
D)Xeroderma pigmentosum
Q2) Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?
A)GTCCTGATTATTCA
B)GTCCACTTATT
C)GTCCTTATTCAACTTATTCCTG
D)GTCCTTATATTCA
Q3) Palindrome sequences are often found at mutation hotspots.Which of the following is a palindrome?
A)AAAATTTT
B)ATATGCGC
C)GATCCTAG
D)GATCGATC
Q4) Allelic disorders may result from mutations in different parts of the same gene.
A)True
B)False
Page 14
To view all questions and flashcards with answers, click on the resource link above.
Chapter 13: Chromosomes
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/61504
Sample Questions
Q1) Polyploidy can result when
A)a translocation occurs between two chromosomes.
B)one pair of homologous chromosomes does not separate during meiosis.
C)a developing gamete is haploid.
D)a haploid sperm fertilizes a diploid egg.
Q2) Only nine types of aneuploids are known in newborns because A)only nine chromosomes undergo nondisjunction.
B)most types of aneuploids are lethal early in development.
C)most aneuploids do not cause detectable defects.
D)most aneuploids do not affect the phenotype.
Q3) People with Turner syndrome have _____ chromosome constitution.
A)XX
B)XXY
C)XO
D)XXX
Q4) In the earliest karyotypes,chromosomes were distinguished by A)specific size order.
B)general size classes.
C)banding patterns.
D)stage of the cell cycle.
Page 15
To view all questions and flashcards with answers, click on the resource link above.
Chapter 14: Constant Allele Frequencies
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61503
Sample Questions
Q1) A suspect's guilt seems highly likely when a very rare combination of markers is
A)found in the population the suspect comes from and at the crime scene.
B)not found in the population the suspect comes from,but present at the crime scene.
C)found in the suspect's DNA but not at the crime scene or in the population the suspect comes from.
D)found in the population the suspect comes from,in the suspect's DNA,and at the crime scene.
Q2) For a very rare inherited disease,the frequency of heterozygotes in a population is
A)half that of the dominant allele.
B)double that of the recessive allele.
C)very close to 0.
D)near 1.
Q3) Gene flow is the
A)migration of individuals between populations.
B)transfer of genes within a population.
C)variation of alleles within a population.
D)movement of alleles between populations.
To view all questions and flashcards with answers, click on the resource link above.
16
Chapter 15: Changing Allele Frequencies
Available Study Resources on Quizplus for this Chatper
39 Verified Questions
39 Flashcards
Source URL: https://quizplus.com/quiz/61502
Sample Questions
Q1) Which of these best represents natural selection?
A)Recessive albinism is more common among the Hopi of Arizona than in the general population of the U.S.
B)A gradual change in specific human mitochondrial DNA sequences occurs along the Nile river in Egypt.
C)ABO blood type frequencies are similar in northern Africa,southern Spain,and the middle east.
D)Lactose tolerant alleles are very prevalent in herding populations that drink milk as a staple.
Q2) _____ in the human population reduced the incidence and virulence of tuberculosis in the early twentieth century.
A)Natural selection
B)Mutation
C)Migration
D)Nonrandom mating
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: Human Ancestry and Evolution
Available Study Resources on Quizplus for this Chatper
44 Verified Questions
44 Flashcards
Source URL: https://quizplus.com/quiz/61501
Sample Questions
Q1) A hypothesized "first woman" (Eve)probably lived about _____ years ago.
A)2,000
B)20,000
C)200,000
D)2,000,000
Q2) Which of the following represents the correct order,from oldest to most recent?
A)Australopithecus garhi,Homo erectus,Homo floresiensis,Aegyptopithecus
B)Aegyptopithecus,Australopithecus garhi,Homo erectus,Homo floresiensis
C)Aegyptopithecus,Australopithecus garhi,Homo floresiensis,Homo erectus
D)Australopithecus garhi,Aegyptopithecus,Homo floresiensis,Homo erectus
Q3) The definition of an indigenous people is a group that
A)is the oldest in its geographical area and has retained its culture.
B)has a genetic disease that is rare in other groups.
C)has most recently come into a geographical area.
D)has been the target of discrimination.
Q4) Haplogroups consist of
A)sets of species that share a recent ancestor.
B)the set of Y chromosomes in a population.
C)groups of SNPs that are linked on a chromosome.
D)preserved gametes,which are haploiD.
Page 18
To view all questions and flashcards with answers, click on the resource link above.
Chapter 17: Genetics of Immunity
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/61500
Sample Questions
Q1) The part of an antigen binding site on an antibody that binds antigen is the A)idioblast.
B)idiotype.
C)epitope.
D)intron.
Q2) B cells secrete antibodies when they A)bind antigens.
B)are engulfed by macrophages.
C)are stimulated by activated T cells.
D)undergo apoptosis.
Q3) The human immune system consists of
A)about 10,000 cells that increase rapidly to trillions when an infection takes hold.
B)the heart and blood vessels and the blood cells within the vessels.
C)about 2 trillion cells,their secretions,and the organs where they are produced and stored.
D)all of the bacteria and viruses that are normally present in our bodies plus our blood cells.
To view all questions and flashcards with answers, click on the resource link above.
19
Chapter 18: Cancer Genetics and Genomics
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/61499
Sample Questions
Q1) BRCA1 and BRCA2 mutations are A)X-linked.
B)incompletely penetrant.
C)translocations.
D)somatic mutations.
Q2) A cancer cell is injected into a healthy mouse.The mouse develops tumors.This experiment indicates that cancer is A)contact inhibited.
B)transplantable.
C)benign.
D)invasive.
Q3) A cancer stem cell can divide to give rise to A)tumor cells,abnormal daughter cells,normal cells,and more cancer stem cells. B)more cancer stem cells only.
C)healthy stem cells and normally differentiated cells.
D)invasive cells and metastatic malignant cells.
Q4) Mitosis in a cancer cell can be compared to a runaway train that is racing along without signals and control points.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 20
Chapter
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61498
Sample Questions
Q1) Natural selection can be used in bioremediation by acting on pre-existing variations among organisms to select those that can detoxify pollutants.
A)True
B)False
Q2) _____ is a gene silencing technique that is based on the fact that RNA molecules can fold into short,double-stranded regions where the base sequence is complementary.
A)RNA repair
B)RNA amplification
C)RNA replication
D)RNA interference
Q3) Most of the effort involved in recombinant DNA technology involves
A)identifying and separating cells that contain the gene of interest.
B)finding a restriction enzyme to cut DNA from a donor cell.
C)identifying a cloning vector that can hold a gene.
D)finding uses for recombined DNA.
Q4) RNA interference was discovered in 1998.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 21
Chapter 20: Genetic Testing and Treatment
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61497
Sample Questions
Q1) Newborn screening reveals that newborn Jessica has inherited phenylketonuria (PKU).Her parents are distraught at the diagnosis,but a nutritionist explains that Jessica can be treated,right away.The treatment for PKU is
A)nonheritable gene therapy.
B)heritable gene therapy.
C)exchange of her blood supply.
D)dietary.
Q2) In substrate reduction therapy,a drug taken by mouth decreases the amounts of the molecule on which a deficient enzyme acts.
A)True
B)False
Q3) The field of genetic counseling began when the term was coined
A)in 1986,when the human genome project was first suggested.
B)in 1947,to help physicians explain inherited diseases to their patients.
C)in 1953,when Watson and Crick discovered the structure of DNA.
D)in 1865,when Gregor Mendel published his work on inheritance patterns in pea plants.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 21: Reproductive Technologies
Available Study Resources on Quizplus for this Chatper
41 Verified Questions
41 Flashcards
Source URL: https://quizplus.com/quiz/61496
Sample Questions
Q1) A woman who is infertile because she lacks ovaries would benefit most from A)intrauterine insemination.
B)GIFT.
C)ZIFT.
D)embryo adoption.
Q2) An ectopic pregnancy results when
A)an oocyte that has not been fertilized implants in the uterus. B)more than one oocyte is fertilized.
C)a fertilized ovum begins to develop in a blocked uterine tube.
D)a fertilized ovum begins to develop while attached to the cervix.
Q3) Frozen human sperm were first used to conceive a child in A)1910.
B)1953.
C)1969.
D)1978.
Q4) A normal sperm count is _____ sperm per ejaculate.
A)100,000 to 500,000
B)1 to 2 million
C)20 to 200 million
D)1 to 3 billion
23
To view all questions and flashcards with answers, click on the resource link above.
Chapter 22: Genomics
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61495
Sample Questions
Q1) A SNP that changes the amino acid sequence of an encoded protein is termed A)synonymous.
B)nonsynonymous.
C)transliteral.
D)mutagenic.
Q2) _____ was the first organism to have its entire genome sequenced.
A)The fruit fly
B)E.coli
C)Haemophilus influenzae
D)Mycoplasma genitalium
Q3) The efficacy of DNA sequencing is improved by _____.
A)high coverage
B)repeating DNA segments
C)lesser genome copies
D)minimal overlapping
Q4) Sequencing genomes provides much more information than sequencing exomes.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 24