Skip to main content

Genomics Test Preparation - 1164 Verified Questions

Page 1


Genomics Test Preparation

Course Introduction

Genomics is the comprehensive study of the complete set of DNA, including all of its genes, in an organism. This course covers the fundamental concepts, methodologies, and applications of genomics, such as DNA sequencing technologies, genome assembly, annotation, comparative genomics, and bioinformatics analysis. Students will explore the role of genomics in understanding genetic variation, evolution, and disease, as well as its transformative impact on fields like personalized medicine, agriculture, and environmental science. Through lectures, readings, and hands-on computational exercises, students will gain practical experience in analyzing and interpreting genomic data.

Recommended Textbook

Genetics Analysis and Principles 5th Edition by Robert Brooker

Available Study Resources on Quizplus

28 Chapters

1164 Verified Questions

1164 Flashcards

Source URL: https://quizplus.com/study-set/2464 Page 2

Chapter 1: Overview of Genetics

Available Study Resources on Quizplus for this Chatper

37 Verified Questions

37 Flashcards

Source URL: https://quizplus.com/quiz/48953

Sample Questions

Q1) Science may be conducted using a process called the scientific method.

A)True

B)False

Answer: True

Q2) The differences in inherited traits among individuals in a population are called

A)species variation

B)genetic mutations

C)genetic variation

D)natural selection

E)None of these

Answer: C

Q3) In humans, gametes are different than other cells of the body in that they are

A) diploid

B) haploid

C) genetic mutations

D) morphs

E) None of the answers are correct

Answer: B

To view all questions and flashcards with answers, click on the resource link above. Page 3

Chapter 2: Mendelian Inheritance

Available Study Resources on Quizplus for this Chatper

65 Verified Questions

65 Flashcards

Source URL: https://quizplus.com/quiz/48952

Sample Questions

Q1) In a Punnett square diagram, the outside of the box represents the _________.

A)Diploid offspring

B)Haploid offspring

C)Diploid gametes

D)Haploid gametes

Answer: D

Q2) In a dihybrid cross using Mendelian inheritance, if both parents are heterozygous for both traits, what will be the phenotypic ratio of their offspring?

A)3:1

B)1:2:1

C)1:1

D)9:3:3:1

Answer: D

Q3) The genetic composition of an individual is called its _____________.

A)Phenotype

B)Genotype

C)Hybrid

D)Dominance

E)None of the answers are correct

Answer: B

To view all questions and flashcards with answers, click on the resource link above. Page 4

Chapter 3: Chromosome Transmission During Cell Division and

Sexual Reproduction

Available Study Resources on Quizplus for this Chatper

49 Verified Questions

49 Flashcards

Source URL: https://quizplus.com/quiz/48951

Sample Questions

Q1) A dipoid organism that you are studying has 17 chromosomes. How many total chromosomes are found in a somatic cell from this organism? A sperm cell? An egg cell?

A) 17; 16; 16

B) 17; 17; 17

C) 34; 17; 34

D) 34; 17; 17

Answer: D

Q2) During this phase of the cell cycle the nuclear membrane reforms around the chromosomes:

A)Metaphase

B)Prometaphase

C)Telophase

D)Anaphase

E)Prophase

Answer: C

To view all questions and flashcards with answers, click on the resource link above.

Page 5

Chapter 4: Extensions of Mendelian Inheritance

Available Study Resources on Quizplus for this Chatper

46 Verified Questions

46 Flashcards

Source URL: https://quizplus.com/quiz/48950

Sample Questions

Q1) The interaction of two genes to produce a phenotype was first described by

A)Morgan and Bridges

B)Mendel

C)Darwin

D)Bateson and Punnett

E)None of the answers are correct

Q2) The trait of cream-colored eyes in Drosophila is an example of ________.

A)simple recessive alleles

B)incomplete penetrance of red eyes

C)a gene modifier effect in eye color

D)gene dosage

E) a spontaneous mutation

Q3) The presence of a group of antigens that determine blood type is an example of a(n) ____________.

A) semilethal allele

B) sex-linked trait

C) multiple allele system

D) incomplete dominance

To view all questions and flashcards with answers, click on the resource link above.

Page 6

Chapter 5: Non-Mendelian Inheritance

Available Study Resources on Quizplus for this Chatper

39 Verified Questions

39 Flashcards

Source URL: https://quizplus.com/quiz/48949

Sample Questions

Q1) The Lyon hypothesis attempts to explain the molecular mechanism of _____.

A) X-inactivation

B) genomic imprinting

C) maternal inheritance

D) extranuclear inheritance

Q2) Which of the following is false regarding mtDNA?

A) It is around 17,000 bp in length

B) It is a linear chromosome

C) Multiple copies exist in each mitochondria

D) It mostly contains rRNA and tRNA genes

Q3) Which of the following does not inactivate an X chromosome?

A)Mammals

B)Drosophila

C)C.elegans

D)Marsupials

Q4) Monoallelic expression is associated with which of the following?

A)X-inactivation

B)Genomic imprinting

C)Maternal inheritance

D)Extranuclear inheritance

Page 7

To view all questions and flashcards with answers, click on the resource link above.

Chapter 6: Genetic Linkage and Mapping in Eukaryotes

Available Study Resources on Quizplus for this Chatper

50 Verified Questions

50 Flashcards

Source URL: https://quizplus.com/quiz/48948

Sample Questions

Q1) Which of the following defines the principle of linkage?

A)Two or more genes that are physically connected on a chromosome

B)Genes that are transmitted to the next generation as a group

C)The process by which genetic information is exchanged between homologous chromosomes

D)All of the answers are correct

E)Both two or more genes that are physically connected on a chromosome and genes that are transmitted to the next generation as a group

Q2) A testcross is always performed between the individual that is heterozygous for the genes to be mapped and an individual who is ____________.

A)Heterozygous for the genes

B)Homozygous dominant for the genes

C)Homozygous recessive for the genes

D)Lacking the genes

E)None of the answers are correct

Q3) An ascus that contains two parental spores and two nonparental spores is called a tetratype.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above.

Page 8

Chapter 7: Genetic Transfer and Mapping in Bacteria and Bacteriophages

Available Study Resources on Quizplus for this Chatper

59 Verified Questions

59 Flashcards

Source URL: https://quizplus.com/quiz/48947

Sample Questions

Q1) Loss of function mutations are easier to study in _______ organisms, such as bacteria.

A) haploid

B) diploid

C) triploid

Q2) The protein complex that initiates the process of conjugation following contact between two bacteria is called the _________.

A) origin of transfer

B) T DNA

C) relaxosome

D) nucleoprotein

Q3) Which of the following is correct concerning F factors?

A) It may integrate into the host chromosome

B) It stands for fertility factor

C) It allows conjugation to occur

D) F+ bacteria act as donor strains in conjugation

E) All of the answers are correct

Q4) A minute is the basic unit of map distance in bacteria.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 9

Chapter 8: Variation in Chromosome Structure and Number

Available Study Resources on Quizplus for this Chatper

50 Verified Questions

50 Flashcards

Source URL: https://quizplus.com/quiz/48946

Sample Questions

Q1) The short arm of a chromosome is denoted by the letter _______ and the long arm by the letter _______.

A) p, q

B) s, l

C) q, p

D) c, d

Q2) Hemophilia A is an X-linked blood clotting disorder. A normal man and a woman with hemophilia A have a child with Turner Syndrome. This child does not have hemophilia. In whom did non-disjunction occur? In meiosis I or meiosis II?

A)Woman; meiosis I

B)Woman; meiosis II

C)Man; meiosis I

D)Man; meiosis II

E) Woman; there is not enough information to tell if the nondisjunction happened in meiosis I or II.

Q3) The ends of chromosomes have areas of repeated DNA called centromeres.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 10

Chapter 9: Molecular Structure of DNA and RNA

Available Study Resources on Quizplus for this Chatper

41 Verified Questions

41 Flashcards

Source URL: https://quizplus.com/quiz/48945

Sample Questions

Q1) DNA is recognized as a left-handed molecule.

A)True

B)False

Q2) An RNA strand with sequence 5'-GUACAAUGACUUAUGUAC-3' can potentially form which structure?

A)bulge loop

B)internal loop

C)multibranched junction

D)stem-loop

Q3) A nucleoside consists of only a five-carbon sugar and a phosphate group.

A)True

B)False

Q4) What DNA form is most common in living organisms?

A)A DNA

B)B DNA

C)Z DNA

D)Triplex DNA

Q5) All living organisms use DNA as the genetic material.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 11

Chapter 10: Chromosome Organization and Molecular Structure

Available Study Resources on Quizplus for this Chatper

42 Verified Questions

42 Flashcards

Source URL: https://quizplus.com/quiz/48944

Sample Questions

Q1) Which of the following is correctly matched with its description?

A)Highly repetitive DNA contains transposable elements and genes that are expressed in abundance and thus have many copies.

B)Moderately repetitive DNA contains unique sequences, such as genes found in one or a few copies.

C)Non-repetitive DNA is composed of thousands of copies of many short repeats.

D)Moderately repetitive DNA contains retro elements, such as the Alu sequence.

E) Moderately repetitive DNA contains transposable elements and genes that are expressed in abundance and thus have many copies.

Q2) Unique sequences make up approximately what percent of the human genome?

A)5%

B)25%

C)40%

D)80%

Q3) How many types of histone proteins are there?

A)4

B)5

C)7

D)8

12

To view all questions and flashcards with answers, click on the resource link above.

Chapter 11: DNA Replication

Available Study Resources on Quizplus for this Chatper

48 Verified Questions

48 Flashcards

Source URL: https://quizplus.com/quiz/48943

Sample Questions

Q1) DNA polymerases add new nucleotides in what direction?

A)5' to 3'

B)3 ' to 5'

C)Both directions

Q2) The proofreading of the DNA occurs in the _________.

A)5' to 3' direction

B)3' to 5' direction

C)Both directions

Q3) What was the control in Arthur Kornberg's in vitro replication experiment described in this chapter?

A) The use of radiolabeled nucleotide triphosphates

B) The exclusion of template DNA in one test tube

C) Adding perchloric acid

D) The use of E)coli proteins

Q4) The ability of the DNA polymerase to remove mismatched bases is called exonuclease cleavage (proofreading).

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 13

Chapter 12: Gene Transcription and RNA Modification

Available Study Resources on Quizplus for this Chatper

44 Verified Questions

44 Flashcards

Source URL: https://quizplus.com/quiz/48942

Sample Questions

Q1) What kind of promoter is being used in this experiment?

A)Eukaryotic

B)Prokaryotic

C)Cannot tell from the information given

D)Neither eukaryotic nor prokaryotic

Q2) What is the correct order of elements that comprise a functional protein encoding gene in a prokaryote?

A) Promoter, regulatory region, transcribed region, terminator

B) Regulatory region, promoter, transcribed region, terminator

C) Regulatory region, promoter, terminator, transcribed region

D) Promoter, transcribed region, regulatory region, terminator

Q3) What modifications act to stabilize eukaryotic mRNA?

A)Alternative splicing

B)RNA editing

C)5' capping

D)Polyadenylation

E)Trimming

Q4) Basal transcription in eukaryotes involves the action of only the core promoter.

A)True

B)False

Page 14

To view all questions and flashcards with answers, click on the resource link above.

Chapter 13: Translation of MRNA

Available Study Resources on Quizplus for this Chatper

37 Verified Questions

37 Flashcards

Source URL: https://quizplus.com/quiz/48941

Sample Questions

Q1) The primary structure of a protein is directly associated with ______.

A)regular repeating shapes, such as beta-sheets

B)the three-dimensional shape of the protein

C)the linear sequence of the amino acids

D)the interaction of two or more peptide chains

Q2) How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

A)7

B)8

C)10

D)13

Q3) A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than

A)125 nucleotides.

B)376 nucleotides.

C)1128 nucleotides.

D)3384 nucleotides.

Q4) Transcription and translation may occur simultaneously in prokaryotic cells.

A)True

B)False

Page 15

To view all questions and flashcards with answers, click on the resource link above.

Chapter 14: Gene Regulation in Bacteria

Available Study Resources on Quizplus for this Chatper

35 Verified Questions

35 Flashcards

Source URL: https://quizplus.com/quiz/48940

Sample Questions

Q1) A mutation in the lacI gene prevents the gene product from binding allolactose. What will the expression level of the operon be in the absence of lactose?

A)no transcription

B)postive regulation

C)constitutively active

D)low level of expression

Q2) If CAP could not bind to its CAP site, then what would be the result? Assume lactose is present in each scenario.

A)Transcription would be difficult to repress in the presence of glucose

B)Transcription would be difficult to activate in the presence of glucose

C)Transcription would be difficult to activate in the absence of glucose

Q3) Antisense RNA does which of the following?

A)Inhibits the formation of the open complex in transcription

B)Occupies the A and P sites of the ribosome

C)Binds to the mRNA and prevents translation

D)Prevents the correct folding of a newly formed peptide

Q4) In the lac operon, the operator site is recognized by an activator protein.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 16

Chapter 15: Gene Regulation in Eukaryotes I: Transcriptional Regulation

Available Study Resources on Quizplus for this Chatper

39 Verified Questions

39 Flashcards

Source URL: https://quizplus.com/quiz/48939

Sample Questions

Q1) Which of the following might complicate the interpretation of ChIP-Seq data?

A)Because histones can be moved around or ejected from the chromatin, some DNA might not be sequenced if it is not wrapped around a histone

B)DNA wrapped around nucleosomes can never be sequenced

C)The regions of DNA wrapped around a histone is too long to be sequenced with current technologies

D)The DNA between nucleosomes are too compacted to be sequenced

Q2) What might happen if the insulator between two genes is missing?

A)Without the insulator, neither gene can be transcribed.

B)Transcription factors influencing one gene's expression may abnormally influence a neighboring gene's expression.

C)Transcription factors will not be able to influence the expression of either gene.

D)Without insulation, both genes will be expressed at maximal levels.

E) Transcription factors will not be able to bind to the insulator.

Q3) A repressor protein would enhance the ability of TFIID to bind to the TATA box of the promoter.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 17

Chapter 16: Gene Regulation in Eukaryotes II: Epigenetics and

Regulation at the RNA Level

Available Study Resources on Quizplus for this Chatper

36 Verified Questions

36 Flashcards

Source URL: https://quizplus.com/quiz/48938

Sample Questions

Q1) It is frequently desirable to experimentally regulate gene regulation and then study the consequences of expressing or suppressing the specific gene. To accomplish this, different gene sequences are fused to promoters or sequences that will be expressed as mRNA. Which of the following would most likely result in regulatable expression?

A) ARE

B) IRE

C) IBP

D) ICR

Q2) The best term for the process by which some exons are included in a mature mRNA from one cell but are absent from the mRNA in another cell is

A) RNA interference.

B) chromosomal remodeling.

C) alternative splicing.

D) Pre-mRNA splicing.

Q3) What genes appear to be controlled by the Xic?

A)Xist and Tsix

B)Xist

C)TsiX

D)Xic

To view all questions and flashcards with answers, click on the resource link above. Page 18

Chapter 17: Genetics of Viruses

Available Study Resources on Quizplus for this Chatper

25 Verified Questions

25 Flashcards

Source URL: https://quizplus.com/quiz/48937

Sample Questions

Q1) Most biologists consider viruses to be living organisms, which are classified with bacteria.

A)True

B)False

Q2) The virus that causes chickenpox can also cause ______ decades later when it switches from the latent state and starts making new viral particles.

A)shingles

B)herpes

C)cold sores

D)mononucleosis

Q3) Reverse transcriptase copies

A)DNA to DNA.

B)DNA to RNA.

C)RNA to DNA.

D)RNA to RNA.

Q4) The Gag polyprotein is cleaved into

A)Vif and Vpu

B)HIV protease, reverse transcriptase, and integrase

C)Matrix protein, capsid protein, nucleocapsid protein, and p6

D)Vpr, Rev, Tat, and Nef

Page 19

To view all questions and flashcards with answers, click on the resource link above.

Chapter 18: Gene Mutation and Dna Repair

Available Study Resources on Quizplus for this Chatper

55 Verified Questions

55 Flashcards

Source URL: https://quizplus.com/quiz/48936

Sample Questions

Q1) The mutation frequency is the ratio of the number of mutant alleles to the total number of alleles in a given population.

A)True

B)False

Q2) An example of a suppressor mutation would be

A)An intragenic mutation that restores the inactive protein's structure

B)An intergenic mutation that increases the activity of a protein performing a different function as the mutated protein

C)An intergenic mutation that activates a transcription factor that increases the espression of a normal protein

D)A mutation that suppresses cell growth

Q3) Which repair mechanism is responsible for repairing damage from UV radiation?

A) Recombinational repair

B) Base excision repair

C) Mismatch repair

D) Nucleotide excision repair

E) Nonhomologous end joining (NHEJ)

To view all questions and flashcards with answers, click on the resource link above. Page 20

Chapter 19: Recombination and Transposition at the

Molecular Level

Available Study Resources on Quizplus for this Chatper

35 Verified Questions

35 Flashcards

Source URL: https://quizplus.com/quiz/48935

Sample Questions

Q1) In eukaryotic organisms, a single-stranded break in the DNA is required before recombination can begin during meiosis.

A)True

B)False

Q2) Site-specific recombination occurs between homologous sequences of DNA.

A)True

B)False

Q3) The human genome contains a unique gene for each immunoglobulin produced. A)True

B)False

Q4) High numbers of LINEs and SINEs may be due to transposable element activity. A)True

B)False

Q5) Which of the following most likely accounts for the majority of the recombination events during both DNA repair and meiosis?

A)A nick in only one strand of the DNA

B)Double-stranded breaks in DNA

C)DNA gap repair synthesis

D)Heteroduplex formation

To view all questions and flashcards with answers, click on the resource link above. Page 21

Chapter 20: DNA Technologies

Available Study Resources on Quizplus for this Chatper

40 Verified Questions

40 Flashcards

Source URL: https://quizplus.com/quiz/48934

Sample Questions

Q1) What is a DNA library?

A)A collection of vectors, each containing a fragment of the original genome

B)A complete sequence of the genetic material in an organism

C)An electronic file that may be used for additional genetic analysis

D)A collection of mRNA from a given cell

Q2) A cDNA library differs from a genomic DNA library in which way?

A)It consists solely of RNA molecules

B)It contains many copies of the gene of interest

C)It contains only coding sequences, not introns

D)It is typically 10-100 times the size of a DNA library

Q3) The use of fluorescent-labeled dideoxynucleotides is a characteristic of what type of sequencing?

A)sequencing ladders

B)automated sequencing

C)base-specific DNA cleavage

D)genomic libraries

Q4) A vector is a small segment of DNA that a gene of interest is inserted into for cloning.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 22

Chapter 21: Biotechnology

Available Study Resources on Quizplus for this Chatper

35 Verified Questions

35 Flashcards

Source URL: https://quizplus.com/quiz/48933

Sample Questions

Q1) Which of the following cells is not pluripotent?

A)ES cells

B)EG cells

C)EC cells

D)All of the answers are pluripotent

E)None of the answers are pluripotent

Q2) Which of the following is not an advantage of a transgenic plant?

A)Widely accepted by the public

B)Increased resistance to disease and pests

C)Adaptability to harsh environments

D)Improved shelf life

Q3) Which of the following is an example of a pluripotent cell?

A) embryonic stem cells

B) red blood cells

C) fetal heart cells

D) umbilical cord blood

E) nerve cells

Q4) Identical twins are an example of gene cloning.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 23

Chapter 22: Genomics I: Analysis of DNA

Available Study Resources on Quizplus for this Chatper

32 Verified Questions

32 Flashcards

Source URL: https://quizplus.com/quiz/48932

Sample Questions

Q1) A _______ is a combination of a plasmid vector and phage \(\lambda\).

A)contig

B)artificial chromosome

C)cosmid

D)positional clone

E)transposable element

Q2) Metagenomics refers to the molecular analysis of the entire genome of a species.

A)True

B)False

Q3) The human genome consists of approximately _______ base pairs of DNA.

A) 100,000

B) 1 million

C) 1 billion

D) 3 billion

E) 2 trillion

Q4) The most common microsatellite in humans is ____.

A)(AT)<sub>100</sub>

B)(CA)<sub>n</sub> C)(TG)<sub>n</sub>

D)(CAT)<sub>n</sub>

Page 24

To view all questions and flashcards with answers, click on the resource link above.

Chapter 23: Genomics II: Functional Genomics, Proteomics, and Bioinformatics

Available Study Resources on Quizplus for this Chatper

33 Verified Questions

33 Flashcards

Source URL: https://quizplus.com/quiz/48931

Sample Questions

Q1) Genetic sequences may be useful in predicting protein structure because

A) there is a high statistical frequency of specific amino acids within a given secondary structure

B) the folding of the protein is based on how the mRNA folds.

C) the physical and energetic properties of the DNA influence protein folding.

D) knowing what specific codons are used for each amino acid in the protein can help predict its structure.

Q2) What is a reason that the proteome is larger than the genome?

A)Alternative splicing

B)Proteins are constantly being synthesized and degraded.

C)Each protein has a specific function which are quite varied while the genes in the genome are only transcribed

D)Each protein has multiple functional domains whille each gene consists of three basic parts.

Q3) A functional protein microarray can be used to establish the function or substrates for a given group of proteins.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 25

Chapter 24: Medical Genetics and Cancer

Available Study Resources on Quizplus for this Chatper

35 Verified Questions

35 Flashcards

Source URL: https://quizplus.com/quiz/48930

Sample Questions

Q1) Cancer is considered clonal because daughter cells from a cancer cell have the same genetic makeup as the parent cell.

A)True

B)False

Q2) Haplotypes between homologs in the same individual _________; haplotypes for the same chromosome in different individuals ________.

A)are always the same; are always different

B)can be the same or different; can be the same or different C)are always the same; can be the same or different D)can be the same or different; are always different

Q3) What is p53?

A)A caspase

B)A proto-oncogene

C)A transcription factor

D)A tumor suppressing gene

E)None of the answers are correct

Q4) Prions can contain either DNA or RNA as their genetic material.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 26

Chapter 25: Developmental Genetics

Available Study Resources on Quizplus for this Chatper

35 Verified Questions

35 Flashcards

Source URL: https://quizplus.com/quiz/48929

Sample Questions

Q1) A mutation in which the fate of cell lineages is not synchronized in an organism is called a ____.

A)heterochronic mutation

B)apoptotic mutation

C)homeotic mutation

D)homeobox mutation

Q2) Pole cells are responsible for forming what structures in an adult organism?

A)liver cells

B)gametes

C)nerve cells

D)hematopoietic stem cells

Q3) Which segment gene is activated first in the Drosophila embryo?

A)pair-rule genes

B)segment-polarity genes

C)gap genes

D)myogenic bHLH genes

Q4) Studies of invertebrate and vertebrate development suggest that there is a universal body plan for animal development.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 27

Chapter 26: Population Genetics

Available Study Resources on Quizplus for this Chatper

48 Verified Questions

48 Flashcards

Source URL: https://quizplus.com/quiz/48928

Sample Questions

Q1) Which of the following will alter the frequency of alleles in the population the least?

A)Mutation

B)Natural selection

C)Genetic drift

D)Migration

E)All of the answers are equal

Q2) The formula p<sup>2</sup> + 2pq + q<sup>2</sup> = 1 is associated with which of the following?

A)Calculations of heterozygosity

B)Hardy-Weinberg equilibrium

C)Calculations of recombination frequencies

D)Degrees of freedom

Q3) Migration of a random few individuals from one population to a new area to establish a new population is an example of ____

A)Bottleneck effect

B)Mutation

C)Founder effect

D)Selection

To view all questions and flashcards with answers, click on the resource link above. Page 28

Chapter 27: Quantitative Genetics

Available Study Resources on Quizplus for this Chatper

42 Verified Questions

42 Flashcards

Source URL: https://quizplus.com/quiz/48927

Sample Questions

Q1) When analyzing two variables, the strength of the association between the variables is called the ____.

A)Covariance

B)Standard deviation

C)Correlation coefficient

D)Variance

Q2) In QTL mapping, the parental strains are crossed and the F<sub>1</sub> generation backcrossed to which of the following?

A)The F<sub>2</sub> generation

B)The parental generation

C)A strain that is homozygous recessive for all markers

D)A wild-type organism

Q3) What is a typical characteristic of a quantitative trait?

A) No environmental influence on the trait

B) Polygenic basis

C) Discontinuous distribution of phenotypic trait.

D) Usually the graph of trait versus frequency has two distinct peaks.

Q4) Traits that fall into discrete categories are called continuous traits.

A)True

B)False

29

To view all questions and flashcards with answers, click on the resource link above.

Chapter 28: Evolutionary Genetics

Available Study Resources on Quizplus for this Chatper

32 Verified Questions

32 Flashcards

Source URL: https://quizplus.com/quiz/48926

Sample Questions

Q1) Researchers who study molecular evolution often analyze DNA sequences using computer programs which identify homologous sequences.

A)True

B)False

Q2) Orthologous genes may form gene families in a species.

A)True

B)False

Q3) Proteins that are functionally less important for the survival of an organism generally evolve _____ more important proteins.

A)more slowly than B)more quickly than C)at the same rate as

Q4) What is the most common form of cladogenesis?

A)Parapatric speciation

B)Allopatric speciation

C)Sympatric speciation

Q5) Homologous genes are derived from the same ancestral gene.

A)True

B)False

To view all questions and flashcards with answers, click on the resource link above. Page 30

Turn static files into dynamic content formats.

Create a flipbook
Genomics Test Preparation - 1164 Verified Questions by Quizplus - Issuu