Genomics Test Preparation
Course Introduction
Genomics is an advanced course that explores the structure, function, evolution, and mapping of genomes, with a particular focus on high-throughput sequencing technologies and bioinformatics tools. Students will examine the organization and annotation of genetic material, study comparative genomics across different species, and discuss applications such as personalized medicine, gene editing, and functional genomics. Emphasis is placed on the interpretation of large-scale genomic data sets, ethical considerations in genomics research, and the integration of genomics with other biological disciplines for addressing complex biological questions.
Recommended Textbook
Genetic Analysis An Integrative Approach 1st Edition by Mark F. Sanders
Available Study Resources on Quizplus
22 Chapters
1118 Verified Questions
1118 Flashcards
Source URL: https://quizplus.com/study-set/1991
Page 2
Chapter 1: The Molecular Basis of Heredity, Variation, and Evolution
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/39568
Sample Questions
Q1) The physical units of heredity composed of defined DNA sequences that collectively control gene transcription and contain the information to produce RNA molecules or proteins are better known as what?
Answer: genes
Q2) After replication,chromosomes consist of how many molecules of DNA (assuming one chromatid is equal to one molecule of DNA)?
Answer: two
Q3) What are the three principal components of a DNA nucleotide?
Answer: sugar (deoxyribose),phosphate,and nitrogenous base (nucleotide)
Q4) Peptidyl transferase and other proteins power the continuous progression of the ribosome along mRNA and catalyze what type of bond formation in the growing chain?
Answer: peptide bonds
Q5) The work of Walter Sutton and Theodor Boveri suggested that the hereditary units,or genes,described by Mendel are located on ________.
Answer: chromosomes
Q6) What feature distinguishes snakes and mammals from frogs and salamanders?
Answer: Snakes and mammals both have an amniotic egg,whereas amphibians do not.
Page 3
To view all questions and flashcards with answers, click on the resource link above.
Chapter 2: Transmission Genetics
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39569
Sample Questions
Q1) Why did Mendel cut off the nascent anthers during the process of artificial cross-fertilization?
Answer: to prevent self-fertilization or to prevent uncontrolled crosses
Q2) Assuming independent assortment,what phenotypic ratio would you expect to see if an individual with the genotype RrGg is self-crossed?
A)1:3
B)9:3:3:1
C)1:2:1
D)1:3:2:1
E)3:1
Answer: B
Q3) How many possible gametes can be produced by a short plant with yellow,round peas with a heterozygous genotype (YyRrSs)?
A)3
B)6
C)8
D)10
E)12
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
Page 4
Chapter 3: Cell Division and Chromosome Heredity
Available Study Resources on Quizplus for this Chatper
54 Verified Questions
54 Flashcards
Source URL: https://quizplus.com/quiz/39570
Sample Questions
Q1) Mutations that inhibit Rb gene expression will have what effect on cell proliferation?
A)Cells will proliferate less,even if excess growth factors are present.
B)Cells will proliferate less because growth factors are absent.
C)Cells will proliferate more because growth factors are produced in excess.
D)Cells will proliferate more,regardless of growth factor concentration.
E)There will be no effect on cell proliferation;only apoptosis occurs.
Answer: D
Q2) Mitosis is a process of cell division that results in
A)two unique daughter cells.
B)four unique daughter cells.
C)two identical daughter cells.
D)three identical daughter cells.
E)four identical daughter cells.
Answer: C
Q3) Why are chromosomes more easily visible under the microscope during metaphase as compared to prophase?
Answer: They condensed 10,000-fold.
Q4) What is the short segment of the cell cycle during which cells divide?
Answer: the M phase
To view all questions and flashcards with answers, click on the resource link above. Page 5
Chapter 4: Gene Interaction
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39571
Sample Questions
Q1) Which antigen,expressed on the surface of all red blood cells,is modified by A- or B-transferases?
Q2) Individuals with blood type AB have which blood antibody(ies)?
Q3) Explain how the c (Himalayan)allele and tyrosinase control the Siamese coat-color pattern.What is the underlying reason that certain parts of a Siamese cat (e.g.,tail and ears)are darker than the cat's trunk?
Q4) If an organism with a particular genotype fails to produce the corresponding phenotype,the organism is said to be ________ for the trait.
Q5) Numerous genes contribute to the wild-type red eye color in Drosophila.Two genes,brown and vermilion,produce eye pigments.What does the white gene do?
Q6) Proper cross-matching of blood type is essential for safe blood transfusion.What is the general rule for safe blood transfusion,and what are the consequences if a patient receives the incorrect blood type by accident? If a patient's blood type is unknown,what is the safest course of action?
Q7) What are the three categories of loss-of-function mutations?
Q8) Individuals with blood type A have which blood antigen(s)?
Q9) ________ mutations cause overexpression or result in new functions.
Page 6
To view all questions and flashcards with answers, click on the resource link above.
Chapter 5: Genetic Linkage and Mapping in Eukaryotes
Available Study Resources on Quizplus for this Chatper
56 Verified Questions
56 Flashcards
Source URL: https://quizplus.com/quiz/39572
Sample Questions
Q1) Morgan realized that Bateson and Punnett had detected genetic linkage but couldn't explain their results because they performed the wrong cross.What type of cross did Morgan use for the analysis of genetic linkage of autosomal genes in Drosophila?
Q2) Describe why allelic phase is a major obstacle in mapping human genes.
Q3) How is Newton Morton's statistical method helpful for calculating the overall probability of genetic linkage when allelic phase is unknown?
Q4) What type of test would you use to determine the relative order of more than two genes?
Q5) What unit of physical distance between genes on a chromosome provides a convenient way to link the recombination frequencies for linked genes with their positions and order along a chromosome?
Q6) Which type of crossover event produces two parental and two recombinant chromosomes in gametes?
A)single-strand crossover
B)two-strand double crossover
C)three-strand double crossover
D)four-strand double crossover
E)None of the above;all crossover events produce only recombinant chromosomes.
To view all questions and flashcards with answers, click on the resource link above. Page 7
Chapter 6: Genetic Analysis and Mapping in Bacteria and Bacteriophage
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/39573
Sample Questions
Q1) In five Hfr strains,each of which was used to build a time-of-entry map,the genes entered the recipient cells as follows: Strain 1: S L A C T F
Strain 2: N P F T C A
Strain 3: T F P N U Y
Strain 4: S H Y U N P
Strain 5: U N P F T C
Which of the following represents a correct compilation of these results?
A)S L A C T F P N H C U
B)N P F T S L A C H U T
C)T C A L S P N U Y H
D)U N P F T C A L S T F
E)S L A C T F P N U Y H
Q2) One kind of plasmid in bacteria is called an R plasmid.What kinds of genes are typical of such plasmids?
Q3) Name the two cycles in which bacteriophages act when they infect bacteria.
Q4) Explain when,why,and how recombination in bacteria is like crossing over in diploid cells.
Q5) In a transduction experiment,what would constitute evidence of linkage?
Q6) What is meant by a mutation that Benzer referred to as nonrevertible?
To view all questions and flashcards with answers, click on the resource link above. Page 8
Chapter 7: DNA Structure and Replication
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/39574
Sample Questions
Q1) DNA helicase inhibitors are well studied as potential drug targets.What would you expect to see if DNA helicase activity is inhibited?
A)The replisome complex would not assemble on the oriC region.
B)The DNA cannot bend,so hydrogen bonds in the 13-mer region of oriC remain intact.
C)Helicase catalyzes ATP hydrolysis and DNA strands separation,so the helix cannot be unwound and strands will not separate.
D)Helicase carries the SSB protein to the open region of DNA,so hydrolysis and strand separation will not occur.
E)Helicase prevents reannealing of the separated strands,so strands would quickly reanneal and DNA replication cannot proceed.
Q2) Eukaryotic polymerases interact with which protein that acts as the sliding clamp in eukaryotic DNA replication?
Q3) Based on Griffith's results,what would you expect if you injected both heat-killed type RII and living type SIII?
Q4) What characteristic of the polymerase isolated from Thermus aquaticus makes it unique and highly useful for maintaining the enzyme efficiency during PCR?
To view all questions and flashcards with answers, click on the resource link above.
Page 9
Chapter 8: Molecular Biology and Transcription and Rna Processing
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39575
Sample Questions
Q1) If bacteria are infected with a bacteriophage and briefly exposed to radioactive uracil,what results would you expect to see immediately after exposure?
A)radioactive mRNA in the cytoplasm
B)radioactive mRNA in the nucleus
C)radioactive DNA in the cytoplasm
D)radioactive DNA in the nucleus
E)radioactive proteins in the nuclear membrane
Q2) What are the mechanisms for transcription termination in bacteria?
Q3) Which three types of RNAs are found in both prokaryotes and eukaryotes?
Q4) Processing of the 30S pre-RNA transcript in humans produces what three rRNAs after enzymatic cleavage?
Q5) Which type of RNA interacts with nuclear proteins to form a ribonucleoprotein complex responsible for intron removal?
Q6) Eukaryotic promoters are diverse,which means that eukaryotes have how many different RNA polymerases?
Q7) The rat -tropomyosin ( -Tm)gene produces nine different mature mRNAs proteins from a single gene using which three "alternative" mechanisms?
Q8) Name three functional RNAs unique to eukaryotes.
To view all questions and flashcards with answers, click on the resource link above. Page 10
Chapter 9: The Molecular Biology of Translation
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/39576
Sample Questions
Q1) What result would you expect if you mutate one of the four arms of a tRNA?
A)The tRNA will fit into the A site but will not release the peptide at the P site.
B)The tRNA will not be recognized by tRNA synthetase and cannot be charged.
C)The tRNA will be charged with the wrong amino acid.
D)The tRNA will not be able to undergo traditional complementary base pairing.
E)There will be no effect on function,so long as the anticodon region is intact.
Q2) Using mathematical reasoning,a triplet genetic code gives a possible ________ different codons,while a doublet genetic code would yield ________ different codons.Thus,the triplet code accounts for 20 known amino acids and indicates redundancy in the genetic code.
Q3) Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template?
5 - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3
A)5 - ATG CGA TTT GGG TGC TAG - 3
B)5 - AUG CGA UUU GGG UGC UAG - 3
C)5 - AUG CGA UUU GGG UGC - 3
D)5 - CTA GCA CCC AAA TCG CAT TAG - 3'
E)3 - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5
Q4) How many different aminoacyl-tRNA synthetases can be found in a given cell?
To view all questions and flashcards with answers, click on the resource link above. Page 11
Chapter 10: The Integration of Genetic Approaches: Understanding Sickle Cell Disease
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/39577
Sample Questions
Q1) The bone marrow must continuously generate new red blood cells because the life span of a typical red blood cell is only ________.The life span is even shorter in individuals with sickle-cell trait,which accounts for the protective effects against malaria.
Q2) As part of the maturation process,red blood cells lose their nucleus.What is the consequence for cell division in these cells?
Q3) Which of the following techniques quantifies the amount of protein present in a gel lane by measuring how much light is blocked from passing through the gel by the presence of a band of protein?
A)hybridization
B)electrophoretic mobility
C)densitometry
D)restriction fragment analysis
E)peptide fingerprint analysis
Q4) Hemoglobin is made up of four proteins from two different gene clusters,the -globin gene cluster and the -globin gene cluster.The two clusters are related,having evolved from a common ancestral gene through gene duplication,based on strong similarities in which three gene characteristics?
To view all questions and flashcards with answers, click on the resource link above. Page 12
Chapter 11: Chromosome Structure
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/39578
Sample Questions
Q1) Each nucleus in a human somatic cell contains ________ chromosomes.
Q2) Eukaryotic chromosomes are a combination of proteins and DNA,which allows the cell to perform which four essential functions?
Q3) Which proteins would you target if you wanted to disrupt the chromosome superstructure for chromatin condensation that ultimately produces the characteristic shape of the metaphase chromosome?
Q4) What is the purpose of DNA supercoiling?
Q5) What is the name of the structure formed when the 10-nm fibers of chromatin form a cylindrical filament of coiled nucleosomes?
Q6) If heterochromatic spreading encompasses the new location of the w gene,what is the phenotype of the cells?
Q7) Nonhistone proteins make up the protein framework that gives the chromosomes their shape.What is this structure called?
Q8) What gene is critical for establishment of X-inactivation in mammals?
Q9) If you block histone deacetylase,what effect would you expect to see on transcriptional activity?
Q10) Nucleosome displacement during transcription initiation is referred to as what?
Q11) What molecular interaction allows histones to interact with DNA?
To view all questions and flashcards with answers, click on the resource link above. Page 13
Chapter 12: Gene Mutation, DNA Repair, and Homologous
Recombination
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/39579
Sample Questions
Q1) Which bases would you mutate to create a nonsense transition mutation?
5 -ATG GGA TGG CAC CTG-3
Q2) You have developed a new drug and have been asked to test the drug's mutagenicity before putting it on the market.Which test could you use to determine your compound's mutagenic potential?
Q3) Given the DNA sequence 5 -TAC AAA ATA CAG CGG-3 ,which of these sequences represents a nonsense mutation?
A)5 -TAG AAA ATA CAG CGG-3
B)5 -TAC AAA TAC AGC GGG-3
C)5 -TAC AAG ATA CAG CGG-3
D)5 -TAC AAA ATA CAC CGG-3
E)5 -TAC AAA ATA CAG AGG-3
Q4) Agents generating mutation-inducing DNA damage are collectively referred to as ________.
Q5) What process,which is responsible for many trinucleotide repeat disorders,alters the number of DNA repeats?
Q6) A second-site mutation that compensates for the mutation in one gene by mutating a second gene and restoring the wild-type phenotype is also known as a ________ mutation.
To view all questions and flashcards with answers, click on the resource link above. Page 14
Chapter 13: Chromosome Aberrations and Transposition
Available Study Resources on Quizplus for this Chatper
54 Verified Questions
54 Flashcards
Source URL: https://quizplus.com/quiz/39580
Sample Questions
Q1) "Seedless" fruits and vegetables have how many chromosomes and what type of chromosomal distribution?
Q2) How are retroviruses and retrotransposons similar? Describe the genes encodes by the DNA of the retrovirus and the two DNA elements consistently found in retrotransposons.
Q3) Pseudodominance is used to map genes by using what method?
Q4) Provide a description of the cellular mechanisms by which one reciprocal cross leads to hybrid dysgenesis while the other does not.
Q5) What sequences or structures within the DNA can be used to identify sites of transposition?
A)target site duplication and direct repeats
B)target site duplication and short tandem repeats
C)inverted loops
D)target site inversion and direct repeats
E)chromosome translocation and insertion of transposase gene
Q6) What are the two common patterns of chromosome segregation seen in the tetravalent structures found in translocation heterozygotes?
Q7) Cri-du-chat syndrome is a human disorder caused by which type of chromosomal defect?
Page 15
To view all questions and flashcards with answers, click on the resource link above.
Chapter 14: Regulation of Gene Expression in Bacteria and Bacteriophage
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39581
Sample Questions
Q1) Regulation of transcription of bacterial genes takes place at which two levels?
Q2) In the absence of tryptophan,
A)the inactive repressor cannot bind trpO,so operon gene transcription occurs.
B)the active repressor binds trpP,so operon gene transcription is repressed.
C)the inducer cannot bind trpO,so operon gene transcription occurs.
D)the active repressor cannot bind trpO,so operon gene transcription is attenuated.
E)the repressor binds the corepressor,and operon gene transcription occurs.
Q3) The presence of which combination of molecules would lead to active transcription of an operon?
A)activator + corepressor
B)activator + repressor
C)inducer + corepressor
D)repressor + corepressor
E)activator + inducer
Q4) What are the three possible alternative stem loops that can form in mRNA?
Q5) Which enzyme is the product of the lacZ gene?
Q6) Most of the regulation of gene expression in bacteria occurs at the ________ level.
Q7) Which molecule functions as the corepressor in the trp operon?
To view all questions and flashcards with answers, click on the resource link above. Page 16
Chapter 15: Regulation of Gene Expression in Eukaryotes
Available Study Resources on Quizplus for this Chatper
48 Verified Questions
48 Flashcards
Source URL: https://quizplus.com/quiz/39582
Sample Questions
Q1) If you want to affect chromatin packaging,which amino acid could you mutate to affect both histone acetylation and methylation patterns?
A)arginine
B)methionine
C)histidine
D)lysine
E)asparagine
Q2) During RNAi,what do miRNAs target for destruction?
A)heterochromatic regions of DNA
B)CpG islands
C)mRNAs
D)histones
E)ribosomes
Q3) In the GAL gene system,which protein binds to the activation domain of the activator protein,ultimately blocking transcription in the absence of galactose?
Q4) In yeast,which gene would you expect to be activated during phosphate starvation?
Q5) What effect does methylation of CpG islands have on human promoters?
Q6) What are the two mechanisms by which chromatin remodelers can move nucleosomes?
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: Forward Genetics and Recombinant DNA Technology
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39583
Sample Questions
Q1) You have a DNA sequence of 1600 bp.To characterize it,you decide to make a restriction map.Cutting with the first enzyme,you show by electrophoresis that the fragments produced are 400 and 1200 bp respectively.After using the second enzyme,you recover 700-bp and 900-bp fragments.After treatment with both enzymes,fragments were 300,400,and 900 bp.Which is the correct map?
A)-900 ------/400--/3---
B)-400/--900-----/300 ---
C)-300-/--400--/--900----
D)-400-/300-/---900-----
E)-400-/-100/--300--/900
Q2) In selecting recombinant bacteria,cells are chosen that are resistant to a specific antibiotic.How are the bacteria made resistant?
A)They are pre-selected for the experiment on this basis.
B)The antibiotic resistance is encoded in the vector.
C)The antibiotic resistance gene is encoded on the donor insert.
D)Resistance is activated by the recombination event.
E)Resistance is activated when the cells are provided with the antibiotic
Q3) Which approach for sequencing large DNA molecules uses fragmentation that produces random but overlapping pieces?
Page 18
To view all questions and flashcards with answers, click on the resource link above.
Chapter 17: Applications of Recombinant DNA Technology and
Reverse Genetics
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39584
Sample Questions
Q1) Transgenic fusions between a gene and a reporter are used to determine whether a gene is expressed.Which of these components allows the researcher to work with living specimens,and why?
Q2) Besides the obvious fact that chemical mutagens are dangerous to handle,another major disadvantage to their use is that
A)most of these mutations are immediately lethal.
B)most chemically induced changes are detectable only by sequencing.
C)chemical mutagens activate transposons.
D)two or more generations of further matings are required to isolate them.
E)they alter all A-T and C-G base pairing.
Q3) If a researcher is cloning a sequence by using pUC and uses the plasmid to transform bacteria,which are then plated on X-gal medium,would the recombinant plasmids be found in blue or white colonies or both?
Q4) Agrobacterium tumefaciens is often used in the production of transgenic plants because of its Ti plasmid.This plasmid is usually "disarmed" by deleting its tumor genes along with the genes for producing what products that would have been advantageous to the bacterium?
Q5) Suppose a gene from a cow is introduced into a frog.This results in a ________ transgene.
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Genomics: Genetics From a Whole-Genome Perspective
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39585
Sample Questions
Q1) A significant polymorphic inversion on chromosome 17,the MAPT inversion,is identified by marker SNPs that can now be used to screen large numbers in a population.The inverted region is large and extends for approximately 900 kb.The two haplotypes (one inverted and one not)are each associated with increased risk of a number of neurological conditions.How can the inverted region be used to find the most recent common ancestor of the inversion?
A)by typing SNPs from humans and from other primates
B)by assessing SNPs from a large number of human populations
C)by looking for heterozygotes for the two kinds of chromosome 17
D)by fertility studies on populations with each of the haplotypes
E)by using a BAC clone library to identify the ends of the inversion
Q2) In humans,a large number of genes associated with immune function share sequence similarity and are evolutionarily related.These would be known as what kind of group?
Q3) Very many related genes can be recognized by conserved protein domains.To what gene structures do these domains correlate?
Q4) If an entire genome is fragmented and then a large number of pieces are sequenced,the approach is known as the ________ approach.
Page 20
To view all questions and flashcards with answers, click on the resource link above.
Chapter 19: Cytoplasmic Inheritance and the Evolution of Organelle Genomes
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39586
Sample Questions
Q1) In 1918,the tsar and tsarina of Russia and their five children were presumably assassinated and buried in an unmarked grave.Later,several women came forward and claimed that they were in fact Anastasia,one of the daughters whose bones had not been found.More recently,forensic scientists have extracted DNA,including mtDNA,from the skeletal remains.Which of the following samples of mtDNA had to be analyzed to discern which,if any,of the claimants was Anastasia?
A)the tsar,tsarina,and the other assassinated children
B)each of the claimants or their living children
C)the tsarina and the claimants
D)the tsar and tsarina only
E)the tsar and tsarina and living relatives of each of them
Q2) Variation in numbers of mutated chloroplast genomes can give rise to green,white,or variegated leaves.What color leaves do you expect in offspring of pollen from a white-leafed plant and ovules from a green-leafed plant?
Q3) If a cell includes a mixture of variable numbers of wild-type and mutant organelles,this condition is known as ________.
Q4) The protein-coding genes of chloroplasts are involved in what part of photosynthesis?
Page 21
To view all questions and flashcards with answers, click on the resource link above.
Chapter 20: Developmental Genetics
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39587
Sample Questions
Q1) Which structure in plants acts most like embryonic stem cells in animals?
Q2) The establishment of the axes of the body plan occurs during which stage of Drosophila development?
Q3) Since mice embryos with loss-of-function Hox mutations result in homeotic alterations,then introduction of such a mutation might cause A)ribs on normally rib-less vertebrae.
B)pointed rather than rounded ears.
C)a change in fur coloration along the dorsal midline.
D)behavioral alterations causing limb shaking.
E)paralysis of hindlimbs but not forelimbs.
Q4) Drosophila mutations such as bcd,if homozygous in the mother,produce offspring with lethal defects,no matter what the genotype of the offspring.For some other genes,the mutant phenotype can be "rescued" by introducing a wild-type allele.Why the difference?
A)Non-rescuable mutations are of paternal origin.
B)Rescuable mutations act as dominants.
C)bcd is a maternal effect mutation.
D)Rescue requires recombination between the maternal and introduced alleles.
E)bcd is a Hox gene.
To view all questions and flashcards with answers, click on the resource link above. Page 22
Chapter 21: Genetic Analysis of Quantitative Traits
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/39588
Sample Questions
Q1) QTLs are most often mapped relative to DNA markers by using what scores as measurement?
Q2) An increased number of patients have recently been diagnosed with celiac disease,which you may know of as gluten sensitivity (OMIM 212750).It is a multifactorial disorder of the small intestine influenced by genes and environment,and it is characterized by malabsorption due to inflammation of the mucosa after eating wheat gluten or related proteins.It is now thought to occur in 1 out of 120 to 300 people.Genes found to be associated with it are in the HLA region of chromosome 6,namely DR3 and DQw2.Which of the following is more probable?
A)It is an autoimmune disorder.
B)It is caused by exposure to gluten in infancy.
C)It has high broad-sense heritability.
D)Its frequency varies greatly by population.
E)It is found primarily in inbred populations.
Q3) If we suppose that a specific QTL is genetically linked to a DNA marker at a recombination frequency of 10%,then the parental type combinations in gametes would be expected at what frequency?
Q4) What is the statistically acceptable Lod score that provides evidence of genetic linkage?
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Population Genetics and Evolution
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/39589
Sample Questions
Q1) What are the three key elements for determining F,a measure that a particular allele is IBD,using pedigree analysis?
Q2) If the genotype frequency in an admixed population is f(A )= 0.75,what is the genotypic frequency of heterozygotes in the admixed population?
Q3) If the frequency of PKU,an autosomal recessive disease,is 1% in males,what is the frequency of females with PKU?
Q4) ________ is an evolutionary mechanism that favors the reproductive success of certain members of a population over others as a result of differences in anatomical,physiological,or behavioral traits they possess.
Q5) In a group of 500 people,the frequency of genotype NN is 40%.How many individuals would you expect to have the MN genotype?
A)68
B)232
C)300
D)200
E)258
Q6) What are the two most common types of nonrandom mating?
Q7) A relative fitness value of w = 1 means an organism exhibits what trait?
Page 24
To view all questions and flashcards with answers, click on the resource link above.