Genomics for Health Professionals
Midterm Exam
Course Introduction
Genomics for Health Professionals is an interdisciplinary course designed to equip healthcare practitioners with foundational and applied knowledge in genomics and its significance in clinical practice. The course explores key concepts such as genome structure, gene regulation, and genetic variation, and examines the impact of genomics on disease risk, diagnosis, treatment, and prevention. Students will gain practical skills in interpreting genetic data, integrating genomic findings into patient care, and understanding ethical, legal, and social implications associated with genetic testing and personalized medicine. By bridging theory with hands-on case studies, the course prepares health professionals to effectively incorporate genomics into evidence-based healthcare delivery.
Recommended Textbook
Genetics and Genomics in Nursing and Health Care 2nd Edition by Theresa A. Beery
Available Study Resources on Quizplus
20 Chapters
432 Verified Questions
432 Flashcards
Source URL: https://quizplus.com/study-set/201
Page 2
Chapter 1: DNA Structure and Function
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/2914
Sample Questions
Q1) How does the DNA enzyme topoisomerase contribute to DNA replication?
A)Unwinds the double helix and separates the double-stranded DNA
B)Creates a "nick" in the DNA supercoils, allowing them to straighten before replication
C)Initiates DNA synthesis in multiple sites down the strand, making the process more efficient
D)Connects and links the individual pieces of newly synthesized DNA to form a single strand
Answer: B
Q2) Where is telomeric DNA located?
A)At the tips of the p and q arms of chromosomes.
B)In the mitochondria of all somatic cells
C)Only in the germ cells (ova and sperm)
D)Within the histones of the solenoid
Answer: A
To view all questions and flashcards with answers, click on the resource link above.
3
Chapter 2: Protein Synthesis
Available Study Resources on Quizplus for this Chatper
31 Verified Questions
31 Flashcards
Source URL: https://quizplus.com/quiz/2915
Sample Questions
Q1) Which factor has the greatest influence on protein tertiary structure?
A)The presence of a poly-A tail
B)The specific amino acids that are in close proximity to each other
C)Bond formation between amino acids that are distant from each other
D)The number and position of additional proteins needed to form the complex structure
Answer: C
Q2) Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA
A)AUGGUUAUUA
B)ACGCTCGATTATTT
C)CGCUCGAUUAUUU
D)AACGCUUGGUCUGAAUUUUAAUUU
Answer: A
To view all questions and flashcards with answers, click on the resource link above.
4
Chapter 3: Genetic Influence on Cell Division, Differentiation,
and
Gametogenesis
Available Study Resources on Quizplus for this Chatper
32 Verified Questions
32 Flashcards
Source URL: https://quizplus.com/quiz/2916
Sample Questions
Q1) How do transcription factors influence cell division?
A)They directly transmit external signals to the cell's nucleus.
B)Transcription factors regulate the expression of genes involved in cell division.
C)Loss or inactivation of transcription factors degrades suppressor gene protein products.
D)Transcription factors are enzymes that activate promitotic substances by adding a phosphate group to the chemical structure.
Answer: B
Q2) What is the usual outcome of "crossing over" during meiosis I for both spermatogenesis and oogenesis?
A)Unequal division of DNA between two new daughter cells during nucleokinesis
B)Mixing of maternal and paternal genes within one chromosome pair
C)Unequal distribution of cytoplasmic material
D)More rapid progression to meiosis II
Answer: B
To view all questions and flashcards with answers, click on the resource link above.
5
Chapter 4: Patterns of Inheritance
Available Study Resources on Quizplus for this Chatper
36 Verified Questions
36 Flashcards
Source URL: https://quizplus.com/quiz/2917
Sample Questions
Q1) Which statement or factor is a criterion for autosomal-recessive transmission of single-gene traits?
A)About 25% of the members of a large kindred with an autosomal-recessive trait will express the trait.
B)There is no carrier status; if the allele for the trait is present, it is expressed, although the degree of expression can be variable.
C)Individuals who are heterozygous for an autosomal-recessive trait have minimal risk for transmitting the allele to their offspring.
D)The degree of expression of an autosomal-recessive trait or disorder in a homozygous individual is directly related to the penetrance of the trait.
Q2) Which trait or disorder has both an autosomal-dominant form and an autosomal-recessive form?
A)Widow's peak
B)Diabetes mellitus type 2
C)Polycystic kidney disease
D)Taste sensitivity to phenylthiocarbamate (PTC)
To view all questions and flashcards with answers, click on the resource link above.
Chapter 5: Epigenetic Influences on Gene Expression
Available Study Resources on Quizplus for this Chatper
11 Verified Questions
11 Flashcards
Source URL: https://quizplus.com/quiz/2918
Sample Questions
Q1) How does histone modification alter gene expression?
A)Modified histones result in increased DNA methylation, which increases the transcription of genes in that area.
B)In areas where histones are modified, the DNA is more tightly wound, and genes are not transcribed.
C)Histone modification results in an increase in microRNA production, which inhibits gene expression by preventing translation.
D)Histone modification results in an increase in microRNA production, which promotes gene expression by enhancing translation.
Q2) How is eating a diet high in broccoli thought to reduce cancer risk?
A)Increasing the excretion rate of foods known to be methyl donors
B)Increasing histone acetylation, turning on anticancer genes
C)Decreasing the rate of microDNA synthesis and activity
D)Decreasing the exposure of carcinogens to nuclear DNA
Q3) Which statement about the microbiome is true?
A)The microbiome does not undergo further changes after development is complete.
B)With aging, its influence on health is reduced.
C)The microbiome is necessary for good health.
D)Identical twins have identical microbiomes.
To view all questions and flashcards with answers, click on the resource link above.
Page 7
Chapter 6: Autosomal Inheritance and Disorders
Available Study Resources on Quizplus for this Chatper
20 Verified Questions
20 Flashcards
Source URL: https://quizplus.com/quiz/2919
Sample Questions
Q1) What is the best explanation of a child having the physical phenotype of Down syndrome but having a totally normal karyotype on chromosomal analysis of blood?
A)Mosaicism of trisomy 21 in various tissues
B)Inaccurate technique for chromosomal analysis
C)Uniparental disomy for somatic cells but not for germ cells
D)Selective chromosome loss during meiosis II of gametogenesis
Q2) Which factor has the greatest influence on the expression of a genetic disorder such as Prader-Willi syndrome or Angelman syndrome through the process of genomic imprinting?
A)Paternal age at time of conception
B)Maternal age at time of conception
C)The gender of the parent transmitting the deletion
D)The number of bases deleted from the chromosome
Q3) Which syndrome or condition represents monosomy?
A)Cri du chat
B)Patau syndrome
C)Turner syndrome
D)Robertsonian translocation
To view all questions and flashcards with answers, click on the resource link above.
Chapter 7: Sex Chromosome and Mitochondrial Inheritance and Disorders
Available Study Resources on Quizplus for this Chatper
20 Verified Questions
20 Flashcards
Source URL: https://quizplus.com/quiz/2920
Sample Questions
Q1) What is the function of the FMR1 gene?
A)Promoting brain development and maintaining neuronal synapses
B)Ensuring the expression of all other genes present on the X chromosome
C)Preventing amyloid plaque deposits and formation of neuronal tangles in the brain
D)Maintaining the structural integrity of the histone proteins surrounding the X chromosome
Q2) Which feature is common among people who have Klinefelter syndrome (47,XXY) or a karyotype with 47,XXX but not among people who have Down syndrome or Edward syndrome?
A)Severely reduced cognition
B)Cleft palate
C)Tall stature
D)Infertility
Q3) Why is the incidence of an extra Y chromosome in the general population unknown?
A)The phenotype is that of a normal male.
B)Most conceptions with 47,XYY are spontaneously aborted.
C)The life expectancy for males with 47,XYY is often short.
D)The majority of males with this sex chromosome abnormality are institutionalized.
To view all questions and flashcards with answers, click on the resource link above. Page 9
Chapter 8: Family History and Pedigree Construction
Available Study Resources on Quizplus for this Chatper
20 Verified Questions
20 Flashcards
Source URL: https://quizplus.com/quiz/2921
Sample Questions
Q1) Which activity would a general registered nurse be expected to perform as part of genomic care?
A)Calculating recurrence risk for parents who have just had a child with nondisjunction Down syndrome
B)Informing a patient that his test results are positive for a genetic disorder
C)Obtaining an accurate family history and physical assessment data
D)Requesting a consultation visit from a clinical geneticist
Q2) Why is a legend necessary when constructing a pedigree that includes a health history?
A)Gender-altering surgeries require either the drawing of both male and female symbols for the same person or the use of a diamond instead of a circle or square.
B)When a pedigree includes more than three generations, the relationships of members in older (more remote) generations are less clear and must be explained.
C)The gender of individuals lost in the first trimester of pregnancy cannot be established. D)Health problems do not have standard symbols.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 9: Congenital Anomalies, Basic Dysmorphology, and
Genetic Assessment
Available Study Resources on Quizplus for this Chatper
17 Verified Questions
17 Flashcards
Source URL: https://quizplus.com/quiz/2922
Sample Questions
Q1) What is the most important action to take when assessing an infant for possible dysmorphic features?
A)Assess the phenotypes of first-degree relatives.
B)Count the number of minor anomalies present.
C)Use an atlas that includes globally diverse populations.
D)Determine whether an identified dysmorphic feature is a malformation or a deformation.
Q2) How is a congenital anomaly that requires intervention or management categorized?
A)A dysmorphology
B)A major anomaly
C)A minor anomaly
D)A disruption
Q3) What is the best description of a drug prescribed to control acne that also causes severe birth defects when it is taken during pregnancy?
A)Pleiotropic
B)Teratogenic
C)Carcinogenic
D)Geneticomimetic
11
To view all questions and flashcards with answers, click on the resource link above.
Chapter 10: Enzyme and Collagen Disorders
Available Study Resources on Quizplus for this Chatper
30 Verified Questions
30 Flashcards
Source URL: https://quizplus.com/quiz/2923
Sample Questions
Q1) A woman who is a carrier for Fabry disease has children with a man who does not have the disorder. Their son has the disease, and their daughter also has somesymptomsof Fabry disease even though she could only have inherited one affected allele. What is the explanation for the daughter having some symptoms of Fabry disease?
A)The girl must have a different father than her brother.
B)The daughter is seeking the same attention that is given to her brother.
C)The inactivation of one X chromosome in female cells is a totally random event.
D)In addition to inheriting one affected allele, the daughter has developed a somatic mutation.
Q2) For which disorder is the drug idursulfase (Elaprase) appropriate for enzyme-replacement therapy?
A)Hurler syndrome
B)Hunter syndrome
C)Gaucher type 2
D)Tay-Sachs disease
To view all questions and flashcards with answers, click on the resource link above.
Chapter 11: Common Childhood-Onset Genetic Disorders
Available Study Resources on Quizplus for this Chatper
34 Verified Questions
34 Flashcards
Source URL: https://quizplus.com/quiz/2924
Sample Questions
Q1) What is the most likely explanation for the variability in expression of disease severity for cystic fibrosis?
A)The ethnicity of the patient
B)The specific CFTR gene mutation inherited
C)The presence of other nongenetic lung or pancreatic problems
D)The length of trinucleotide repeat sequences in the first exon of the CFTR gene
Q2) Which statement regarding type 1 von Willebrand disease (VWD) is true?
A)Incomplete penetrance is common.
B)It represents the female form of hemophilia.
C)Carriers can transmit the disease to their children.
D)Males are affected twice as frequently as females.
Q3) Which additional health problem commonly develops in boys with Duchenne muscular dystrophy?
A)Arthritis
B)Hypertension
C)Diabetes mellitus
D)Chronic heart failure
To view all questions and flashcards with answers, click on the resource link above.
13
Chapter 12: Common Adult-Onset Disorders
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/2925
Sample Questions
Q1) Which type of maturity-onset diabetes of the young (MODY) is the most common?
A)MODY-1
B)MODY-2
C)MODY-3
D)MODY-4
Q2) An obese patient (body mass index of 35) states, "There is no point in changing how I eat because it is all genetics anyway." What is the best response?
A)"Even with a large genetic component, obesity can be reduced through a sensible diet and exercise."
B)"Let's gather some more family history about body height, weight, and eating patterns."
C)"You are right; you can't change your genes. There is no point in dieting."
D)"With your genetics, your best bet would be a low-carb Atkins-type diet."
Q3) Why are women usually older than men before symptoms of hereditary hemochromatosis manifest?
A)Women have a counterbalancing normal gene on their second X chromosome.
B)Women lose some iron with normal menstruation during childbearing years.
C)Men have a larger muscle mass and more iron-storing capability than women.
D)Men have greater expression of the gene for hemoglobin than do women.
To view all questions and flashcards with answers, click on the resource link above. Page 14
Chapter 13: Cardiovascular Disorders
Available Study Resources on Quizplus for this Chatper
23 Verified Questions
23 Flashcards
Source URL: https://quizplus.com/quiz/2926
Sample Questions
Q1) What do the known monogenic disorders that result in the expression of hypertension have in common?
A)An error in the ability of vascular smooth muscle to contract
B)An error in the ability of vascular smooth muscle to relax
C)Excessive kidney reabsorption of sodium
D)Excessive kidney excretion of potassium
Q2) Which condition or factor for coronary artery disease (CAD) suggests a greater genetic contribution than environmental contribution to its development?
A)When a person develops CAD 5 years after quitting smoking
B)When CAD occurs in a person who has normal blood pressure
C)When CAD is diagnosed in a person who is younger than 50 years
D)When low-density lipoprotein levels can be reduced by dietary changes alone
Q3) How does factor V Leiden increase the likelihood of stroke?
A)Factor V Leiden activates protein C.
B)Factor V Leiden increases thrombin formation.
C)People affected with factor V Leiden have increased blood viscosity.
D)Affected people have a type of factor V that is resistant to activated protein C.
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: The Genetics of Cancer
Available Study Resources on Quizplus for this Chatper
30 Verified Questions
30 Flashcards
Source URL: https://quizplus.com/quiz/2927
Sample Questions
Q1) How are malignant tumors different from benign tumors?
A)Malignant tumors grow by expansion, and benign tumors grow by invasion.
B)Malignant tumors lose plasma membranes, and benign tumors continue to produce them.
C)Benign tumors retain parental cell functions, and malignant tumors lose parental cell functions.
D)Benign tumors have totally normal features, and malignant tumors have totally abnormal features.
Q2) By which process does "initiation" assist in cancer development?
A)Enhancing the cell division of cells damaged by a carcinogen
B)Inflicting mutations at specific sites on the exposed cell's DNA
C)Increasing the transformed cell's capacity for error-free DNA repair
D)Making cancer cells appear more normal and escaping immunosurveillance
Q3) What percentage of common cancers appears to be hereditary?
A)1% to 3%
B)5% to 15%
C)20% to 25%
D)About 35%
To view all questions and flashcards with answers, click on the resource link above.
16
Chapter 15: Genetic Contributions to Psychiatric and Behavioral Disorders
Available Study Resources on Quizplus for this Chatper
15 Verified Questions
15 Flashcards
Source URL: https://quizplus.com/quiz/2928
Sample Questions
Q1) Which assessment finding in a 3-year-old child increases the suspicion for a possible diagnosis of autism spectrum disorder?
A)Language skills are delayed.
B)The child is very near-sighted.
C)Height is below the 5th percentile.
D)The child does not sit still during the assessment interview.
Q2) What is the best description of the genetic contribution to the onset of autism?
A)Autism spectrum is caused by a single-gene mutation in most, but not all, cases.
B)Exposure to a teratogen can be a cause of autism spectrum in many cases.
C)Known causes of autism spectrum include copy-number variants and chromosomal problems.
D)Autism spectrum disorders have a much stronger environmental input than genetic input to expression of the phenotype.
To view all questions and flashcards with answers, click on the resource link above.
17
Chapter 16: Genetic and Genomic Testing
Available Study Resources on Quizplus for this Chatper
14 Verified Questions
14 Flashcards
Source URL: https://quizplus.com/quiz/2929
Sample Questions
Q1) A patient is 34 years old and concerned about possibly being a carrier for HNPCC because his father died of colon cancer at 39, his father's sister died of colon cancer at age 41, and his brother (aged 37) now has colon cancer. The brother's testing is negative for all the known mutations associated with inherited forms of colon cancer. How should this patient be counseled about his risk for colon cancer?
A)Explain that because the brother with cancer is negative for these gene mutations, this cancer is most likely sporadic, and his risk is the same as that for the general population.
B)Explain that he could benefit from testing even though his brother is negative for these mutations because reduced penetrance might account for his negative status.
C)Explain that testing for him would be of no benefit because of the current test limitations but that his family history does place him at high risk.
D)Explain that his risk is not related to his brother's diagnosis because he did not inherit any genes from him, but because his father is a first-degree relative, testing should be considered.
To view all questions and flashcards with answers, click on the resource link above.
Page 18
Chapter 17: Assessing Genomic Variation in Drug Response
Available Study Resources on Quizplus for this Chatper
17 Verified Questions
17 Flashcards
Source URL: https://quizplus.com/quiz/2930
Sample Questions
Q1) Which of the following is a goal of pharmacogenetics?
A)Producing "blockbuster drugs" that will work equally well for everyone
B)Bringing down the cost of pharmaceutical manufacturing
C)Developing drugs that will treat very rare diseases
D)Reducing adverse reactions
Q2) What is the most likely outcome for a patient with glucose-6-phosphate dehydrogenase (G6PD) deficiency when he or she takes aspirin or an antimalarial drug?
A)Rapid elimination of the drug with no benefit
B)Liver damage or failure
C)Hemolytic anemia
D)Fluid retention
Q3) What is the expected heart-rate response when a patient is taking a drug that is an adrenaline antagonist?
A)Heart rate is unchanged.
B)Heart rate decreases.
C)Heart rate increases.
D)Heart rate is irregular.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 18: Health Professionals and Genomic Care
Available Study Resources on Quizplus for this Chatper
11 Verified Questions
11 Flashcards
Source URL: https://quizplus.com/quiz/2931
Sample Questions
Q1) The patient who has been found to have a mutation in a gene allele that greatly increases her risk for a serious health problem has asked a generalist nurse tobe present when she discloses this information to her family. What is the nurse's role in this situation?
A)Primary health-care provider
B)Genetic counselor
C)Patient advocate
D)Patient support
Q2) Which genetics professional has the defined responsibility for overseeing the work in a cytogenetic laboratory?
A)Clinical laboratory geneticist
B)Genetic laboratory technician
C)Cytogenetics technician
D)Medical geneticist
To view all questions and flashcards with answers, click on the resource link above. Page 20
Chapter
Available
9 Verified Questions
9 Flashcards
Source URL: https://quizplus.com/quiz/2932
Sample Questions
Q1) Apatient asks you whether the Genetic Information and Nondiscrimination Act (GINA) means that his insurance company is required to pay for his genetic testingif heelects to have it done. What is your best response?
A)"Yes, if you agree to share the test results with your family, your health-care provider, and your insurance company."
B)"Yes, if other family members have already been found positive for a disease-causing mutation."
C)"No, unless testing finds a specific disorder for which a current medical intervention has been proven effective."
D)"No, it only protects against discrimination and does not require insurance companies to pay for testing."
Q2) Ascientist is working to develop a genetic test that will screen embryos so that only those producing tall children with beautiful features will be implanted.Whatarea of genetic work or studies does this example represent?
A)Eugenics
B)Cybernetics
C)Cytogenetics
D)Genetic imprinting
To view all questions and flashcards with answers, click on the resource link above. Page 21
Chapter 20: Genetic and Genomic Variation
Available Study Resources on Quizplus for this Chatper
12 Verified Questions
12 Flashcards
Source URL: https://quizplus.com/quiz/2933
Sample Questions
Q1) What criteria must a population meet in order to stay in Hardy-Weinberg equilibrium?
A)Random mating, no migration, and no mutation
B)Founding commonalities and no haplotype differences
C)Assortative mating, migration, and frequent mutation
D)Limited procreation, no diet change
Q2) Why is it important to consider population genetics?
A)Natural selection can increase genetic diversity.
B)Accurate assessment of a person's ethnicity can be identified from DNA.
C)Disease risk can vary as a result of the geographic origin of one's ancestors.
D)Knowing ethnicity allows accurate prediction of Huntington disease risk.
Q3) Which term refers to a random change in allele frequencies, not based on natural selection?
A)Population bottleneck
B)Genetic drift
C)Founder effect
D)Migration effect
To view all questions and flashcards with answers, click on the resource link above.
22