Genetics
Pre-Test Questions
Course Introduction
Genetics is a foundational course that examines the principles of heredity and variation in living organisms. The course explores the molecular structure and function of genes, patterns of inheritance, genetic mapping, DNA replication, transcription, translation, and regulation of gene expression. Students are introduced to classic Mendelian genetics, molecular genetics, and modern concepts such as genomics and biotechnology. Through lectures, hands-on labs, and problem-based learning, students gain an understanding of how genetic information is transmitted, expressed, and altered, and its relevance to evolution, medicine, agriculture, and society.
Recommended Textbook
Molecular Biology of the Cell 6th Edition by Bruce Alberts
Available Study Resources on Quizplus
24 Chapters
1211 Verified Questions
1211 Flashcards
Source URL: https://quizplus.com/study-set/837 Page 2
Chapter 1: Cells and Genomes
Available Study Resources on Quizplus for this Chatper
34 Verified Questions
34 Flashcards
Source URL: https://quizplus.com/quiz/16622
Sample Questions
Q1) Laboratory strains of the model organism Escherichia coli that are resistant to antibiotics are very often used in research laboratories as well as in the biotechnology industry. If cultures of such bacteria were allowed to contaminate the environment uncontrollably, it is possible that at some point, pathogenic bacteria such as Neisseria meningitidis (which causes meningitis and can cause death, especially in children) could acquire the same antibiotic-resistance gene, causing a meningitis outbreak that is difficult to treat. In this scenario, which of the following mechanisms is a more likely source of the antibiotic-resistance gene in N. meningitidis?
A) Random new gene generation
B) Intragenic mutation
C) Gene duplication
D) DNA segment shuffling
E) Horizontal gene transfer
Answer: E
To view all questions and flashcards with answers, click on the resource link above.
Chapter 2: Cell Chemistry and Bioenergetics
Available Study Resources on Quizplus for this Chatper
54 Verified Questions
54 Flashcards
Source URL: https://quizplus.com/quiz/16623
Sample Questions
Q1) What are the molecules that normally supply carbon and oxygen atoms, respectively, for the citric acid cycle?
A) Oxaloacetate, oxaloacetate
B) Acetyl CoA, O
C) Oxaloacetate, O
D) Acetyl CoA, H O
E) Pyruvate, pyruvate
Answer: D
Q2) The free-energy change (?G) for a simple reaction, A ? B, is 0 kJ/mole at 37°C when the concentrations of A and B are 10 M and 0.1 M, respectively. What is the free-energy change for the reaction when the concentrations of A and B are instead 0.01 M and 1 M, respectively? Recall that ?G° = -5.9 × log(K?q). Write down your answer as a number with the appropriate sign (+ or -) and in kJ/mole, e.g. +11.8 kJ/mole.
Answer: +23.6 kJ/mole
To view all questions and flashcards with answers, click on the resource link above. Page 4
Chapter 3: Proteins
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/16624
Sample Questions
Q1) Switch proteins that bind and hydrolyze GTP are ubiquitous cell regulators in a wide variety of molecular processes. Which of the following statements is NOT true regarding these proteins?
A) EF-Tu is an example of such proteins.
B) GTP hydrolysis by the GTPase generally renders it inactive.
C) Activation of the GTPase involves addition of a phosphate group to its bound guanine nucleotide.
D) Guanine nucleotide exchange factors generally activate the GTPases.
E) Guanine nucleotide exchange factors accelerate the release of bound GDP from the GTPases.
Answer: C
Q2) Which of the following pairs of amino acid residues would you expect to form ionic bonds?
A) Glutamic acid and glutamine
B) Arginine and lysine
C) Lysine and glutamic acid
D) Tryptophan and tyrosine
E) Tyrosine and glutamine
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
Page 5
Chapter 4: DNA, Chromosomes, and Genomes
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/16625
Sample Questions
Q1) Most fish genomes are at least 1 billion nucleotide pairs long. However, the genome of the puffer fish Fugu rubripes is quite small at only about 0.4 billion nucleotide pairs, even though the number of Fugu genes is estimated to be comparable to that of its relatives which have larger genomes. What do you think mainly accounts for the Fugu genome being this small?
A) Evolutionary advantage of extremely small exon sizes in the Fugu lineage
B) Unusual disappearance of all intronic sequences from the Fugu genome
C) Increased abundance of transposable elements in the Fugu genome
D) Increased occurrence of mitotic whole-chromosome loss in the Fugu lineage
E) Low relative rate of DNA addition compared to DNA loss in the Fugu lineage
Q2) The acetylation of lysines on the histone tails
A) loosens the chromatin structure because it adds positive charges to the histone.
B) recruits the heterochromatin protein HP1, resulting in the establishment of heterochromatin.
C) can be performed on methylated lysines only after they are first demethylated.
D) is sufficient for the formation of an open chromatin structure.
E) is a covalent modification and is thus irreversible.
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: DNA Replication, Repair, and Recombination
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/16626
Sample Questions
Q1) Which of the following repair pathways can accurately repair a double-strand break?
A) Base excision repair
B) Nucleotide excision repair
C) Direct chemical reversal
D) Homologous recombination
E) Nonhomologous end joining
Q2) At the replication fork, the template for the lagging strand is thought to loop around. This looping would allow the lagging-strand polymerase to move along with the rest of the replication fork instead of in the opposite direction. The single-strand part of the loop is bound by the single-strand DNA-binding (SSB) proteins. As each Okazaki fragment is synthesized toward completion, how does the size of the loop change? What about the size of the SSB-bound part of the loop?
A) Increases; increases.
B) Increases; decreases.
C) Decreases; increases.
D) Decreases; decreases.
E) Decreases; does not change.
To view all questions and flashcards with answers, click on the resource link above. Page 7
Chapter 6: How Cells Read the Genome: From DNA to Protein
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/16627
Sample Questions
Q1) How is tRNA splicing different from mRNA splicing in eukaryotic cells?
A) tRNA splicing does not proceed via transesterification reactions.
B) tRNA splicing is carried out by proteins only.
C) tRNA splicing does not create a lariat intermediate.
D) tRNA splicing involves RNA endonuclease and RNA ligase activities.
E) All of the above.
Q2) Which of the following nucleotides is hydrolyzed in both transcription and in translation elongation?
A) ATP
B) GTP
C) TTP
D) UTP
E) CTP
Q3) The sequence of a region of DNA around the 5? end of a gene in Escherichia coli is shown below. The -10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5? to 3?, e.g. CGGAUAAACT.
5? GCGCTTGGTATAATCGCTGGGGGTCAAAGAT 3?
To view all questions and flashcards with answers, click on the resource link above. Page 8
Chapter 7: Control of Gene Expression
Available Study Resources on Quizplus for this Chatper
62 Verified Questions
62 Flashcards
Source URL: https://quizplus.com/quiz/16628
Sample Questions
Q1) You have engineered the X chromosomes in female mice such that one X chromosome expresses green fluorescent protein when active, while the other expresses red fluorescent protein. You have used these mice to study cancer in females. You know that each tumor is a clonal cellular proliferation, meaning all of its proliferating cells are descendants of a single original cancer-causing cell. It follows that, unless X-chromosome inactivation is perturbed in tumors,
A) all tumor cells in one mouse should express the same fluorescent protein (either red or green), but tumor cells from different mice can show either red or green fluorescence. B) the cells in any tumor should all express the same fluorescent protein (either red or green), but independently derived tumors in the same mouse can show either green or red fluorescence.
C) different cells within each tumor can express different fluorescent proteins, and the tumors would therefore show yellow fluorescence, but each cell shows either red or green fluorescence.
D) each cell can express both fluorescent proteins and would therefore emit yellow fluorescence, and the tumors would glow in yellow as well.
E) different tumors would show red, yellow, or green fluorescence.
To view all questions and flashcards with answers, click on the resource link above.
Page 9
Chapter 8: Analyzing Cells, Molecules, and Systems
Available Study Resources on Quizplus for this Chatper
95 Verified Questions
95 Flashcards
Source URL: https://quizplus.com/quiz/16629
Sample Questions
Q1) In a bacterium that is normally cylindrical in shape, loss of either of two genes A and B results in round cells. Additionally, gain-of-function mutations in gene A can rescue the phenotype of gene B loss-of-function mutants. What phenomenon best describes this observation? The product of which gene is more likely to function upstream of the other one in determining cell shape in this bacterium?
A) Suppression; gene A
B) Suppression; gene B
C) Complementation; gene A
D) Complementation; gene B
Q2) You have devised genetic screens to identify gain- and loss-of-function mutations in the Escherichia coli DNA ligase gene. One of the screens (1) seeks mutant cells that are infected more readily with a ligase-deficient strain of T4 phage. The other screen (2) seeks mutant cells that have increased radiation sensitivity at high temperatures. Indicate whether each of the following descriptions better applies to screen 1 (1) or screen 2 (2). Your answer would be a three-digit number composed of digits 1 and 2 only, e.g. 122.
( ) It would identify gain-of-function DNA ligase mutants.
( ) It would identify loss-of-function DNA ligase mutants.
( ) It would identify conditional mutants.
To view all questions and flashcards with answers, click on the resource link above.
Page 10
Chapter 9: Visualizing Cells
Available Study Resources on Quizplus for this Chatper
29 Verified Questions
29 Flashcards
Source URL: https://quizplus.com/quiz/16630
Sample Questions
Q1) In which of the following microscopy techniques are oblique rays of light focused on the specimen?
A) Bright-field microscopy
B) Dark-field microscopy
C) Phase-contrast microscopy
D) Differential-interference-contrast microscopy
Q2) Which microscopy set-up uses a longer wavelength of light than usually excites a particular fluorophore? Which one allows researchers to peek deeper into biological samples?
A) Single-photon; single-photon
B) Single-photon; two-photon
C) Two photon; single photon
D) Two-photon; two-photon
Q3) The presence of which of the following provides the sample with the lowest electron density?
A) Osmium
B) Lead
C) Uranium
D) Carbon
E) Gold
To view all questions and flashcards with answers, click on the resource link above. Page 11
Chapter 10: Membrane Structure
Available Study Resources on Quizplus for this Chatper
26 Verified Questions
26 Flashcards
Source URL: https://quizplus.com/quiz/16631
Sample Questions
Q1) In intestinal epithelial cells, the different plasma membrane domains are separated from each other by special barriers. Indicate true (T) and false (F) statements below regarding this separation. Your answer would be a four-letter string composed of letters T and F only, e.g. FFFF.
( ) These barriers are set up by nanoscale lipid raft domains.
( ) Proteins normally cannot pass through these barriers, whereas any membrane lipid can do so freely.
( ) The asymmetric distribution of membrane proteins resulting from these barriers is functionally important.
( ) These barriers are a result of proteins of the apical surface forming a large aggregate together that excludes proteins of the other domains.
Q2) What is the typical thickness of a lipid bilayer such as the plasma membrane of our cells?
A) 0.5 nm
B) 5 nm
C) 50 nm
D) 100 nm
E) 500 nm
To view all questions and flashcards with answers, click on the resource link above. Page 12
Chapter 11: Membrane Transport of Small Molecules and the Electrical Properties of Membranes
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/16632
Sample Questions
Q1) Why do cells not have membrane transport proteins for O ?
A) Because they need to keep the oxygen concentration low inside the reducing environment of the cell.
B) Because oxygen can dissolve in water and leak in via water channels.
C) Because oxygen can dissolve in the lipid bilayer and diffuse in and out rapidly without the need for a transporter.
D) Because oxygen is transported in and out of the cell in special oxygen-carrying proteins such as hemoglobin.
E) Because oxygen transport across a membrane is energetically unfavorable.
Q2) Which of the following is the reason why an aquaporin does not pass ions (such as Na ) through?
A) The Na ions are too small to pass through the pore rapidly enough.
B) The Na ions are too large to pass through the narrow pore.
C) The Na ions do not favorably interact with the wall of the pore and therefore cannot be dehydrated.
D) Two Asn residues in the channel prevent the passage of Na ions.
E) A Na ion must become fully hydrated to pass through.
To view all questions and flashcards with answers, click on the resource link above.
Page 13
Chapter 12: Intracellular Compartments and Protein Sorting
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/16633
Sample Questions
Q1) Misfolded proteins in the ER may actively undergo any of the following EXCEPT ...
A) binding to chaperones such as BiP to allow unfolding and refolding.
B) binding to chaperones such as calnexin to prevent aggregation.
C) being transported back to the cytosol for degradation.
D) being expelled to the Golgi apparatus for disposal.
E) being glycosylated and binding to lectins.
Q2) Tom40 is a nuclear-encoded essential subunit of the TOM complex in the outer mitochondrial membrane. It is a ?-barrel protein that forms the pore through which precursor proteins enter the intermembrane space from the cytosol. Indicate true (T) and false (F) statements below regarding the Tom40 protein. Your answer would be a four-letter string composed of letters T and F only, e.g. TTTF.
( ) Incorporation of new Tom40 in the outer membrane requires preexisting Tom40 in that membrane.
( ) Formation of new TOM complexes is dependent on the SAM complex.
( ) Tom40 is partially translocated through the outer membrane and is then transferred in the plane of the membrane to fold into its native conformation.
( ) Tom40 is translocated through the inner membrane as a precursor.
To view all questions and flashcards with answers, click on the resource link above. Page 14
Chapter 13: Intracellular Membrane Traffic
Available Study Resources on Quizplus for this Chatper
54 Verified Questions
54 Flashcards
Source URL: https://quizplus.com/quiz/16634
Sample Questions
Q1) Aspartic acid residues resemble phosphorylated serine residues in proteins and also carry a similar negative charge. As a result, a protein in which serine residues are mutated to aspartic acid residues may mimic the function of the corresponding wild-type protein when those serines are phosphorylated. Given that phosphorylation on serine residues in a number of Golgi matrix proteins occurs during mitosis, would you expect that mutation of these serines to aspartic acids would prevent Golgi stack formation in interphase (1) or prevent Golgi dispersion in mitosis (2)? Write down 1 or 2 as your answer.
Q2) Lysosomes are the principal site of cellular digestion. They
A) normally maintain a pH of about 2.0 to 2.5.
B) contain F-type ATPases that pump protons into the organelles.
C) contain heavily glycosylated membrane proteins.
D) are homogeneous in size and shape.
E) All of the above.
Q3) Consider a perfectly assembled clathrin cage that is composed of 12 pentagons and 20 hexagons and therefore resembles a soccer ball. How many clathrin heavy chains are there in this cage? Write down the number as your answer, e.g. 24.
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: Energy Conversion: Mitochondria and Chloroplasts
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/16635
Sample Questions
Q1) A facultative anaerobic bacterium can survive both aerobic and anaerobic conditions. Under both conditions, the cell maintains a proton-motive force across the plasma membrane that drives many cellular processes including nutrient import. Under aerobic conditions, the proton-motive force is produced by a respiratory chain. What is the mode of action of the plasma membrane ATP synthase in this bacterium under aerobic conditions: ATP-hydrolysis mode (H) or ATP-synthesis mode (S)? Write down H or S as your answer.
Q2) Indicate whether each of the following statements better describes ATP production in chloroplasts (C) or in mitochondria (M). Your answer would be a four-letter string composed of letters C and M only, e.g. MCMM.
( ) The electrochemical gradient that drives ATP production is dominated by the electrical component.
( ) It involves a significant pH difference across the membrane.
( ) The ATP synthase molecules form dimers.
( ) The ATP synthase molecules are distributed randomly in flat membrane regions.
To view all questions and flashcards with answers, click on the resource link above.
Page 16
Chapter 15: Cell Signaling
Available Study Resources on Quizplus for this Chatper
63 Verified Questions
63 Flashcards
Source URL: https://quizplus.com/quiz/16636
Sample Questions
Q1) What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?
A) Both precision and amplification are improved.
B) Precision is improved, but amplification is limited.
C) Precision is compromised, but amplification is improved.
D) Both precision and amplification are limited.
Q2) What is the major way by which the monomeric G protein Ras is activated in receptor tyrosine kinase signaling?
A) Activation of Ras-GAP
B) Activation of Ras-GEF
C) Inactivation of Ras-GAP
D) Inactivation of Ras-GEF
E) Inactivation of Ras-GDI
Q3) Fill in the blank in the following paragraph.
"Cytosolic Ca<sup>2+</sup> can be sensed by ..., a small, conserved, dumbbell-shaped protein with four Ca<sup>2+</sup>-binding sites. Upon Ca<sup>2+</sup> binding, it binds and activates dozens of proteins by changing its conformation in different ways."
To view all questions and flashcards with answers, click on the resource link above.
Page 17
Chapter 16: The Cytoskeleton
Available Study Resources on Quizplus for this Chatper
75 Verified Questions
75 Flashcards
Source URL: https://quizplus.com/quiz/16637
Sample Questions
Q1) How is membrane protrusion by blebbing different from that by lamellipodia?
A) Blebbing usually occurs on a rigid substratum such as glass, whereas lamellipodia form on pliable substrata.
B) Blebbing is mostly observed in vitro, whereas lamellipodia are observed both in vitro and in vivo.
C) Blebbing does not involve myosin II activity, but formation of lamellipodia does.
D) Blebbing requires loss of membrane interaction with actin filaments, whereas lamellipodia require a close interaction between the two.
E) All of the above.
Q2) Indicate if each of the following changes occurring during mitosis in a fibroblast is the result of the reorganization of actin filaments (A), microtubules (M), or intermediate filaments (I). Your answer would be a five-letter string composed of letters A, M, and I only; e.g. AIAAM.
( ) The cell rounds up.
( ) The endoplasmic reticulum collapses.
( ) The Golgi apparatus fragments.
( ) The primary cilium is resorbed (disappears).
( ) The contractile ring forms and constricts.
To view all questions and flashcards with answers, click on the resource link above. Page 18
Chapter 17: The Cell Cycle
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/16638
Sample Questions
Q1) Indicate whether each of the following descriptions better applies to mitogens (M), growth factors (G), or survival factors (S). Your answer would be a four-letter string composed of letters M, G, or S only, e.g. GMSG.
( ) They unblock cell-cycle progression
( ) They suppress apoptosis
( ) They trigger a wave of G<sub>1</sub>/S-Cdk activity
( ) They inhibit the degradation of cellular macromolecules
Q2) In the early embryos of Caenorhabditis elegans, defects in the formation of astral microtubules increase myosin activity throughout the cell cortex. If the spindle is forced to one side of the cell, the cortical myosin activity is observed mostly at the opposite side of the cell. Which model (1, 2, or 3) better predicts these observations? Write down 1, 2, or 3 as your answer.
Q3) Which of the following events contributes to driving the mammalian cell past the restriction point of the cell cycle?
A) Phosphorylation of Cdh1-APC/C by G /S-Cdk
B) Destruction of CKIs that target S-Cdks
C) Phosphorylation of Rb by G -Cdk, G /S-Cdk, and S-Cdk
D) Activation of E2F gene expression by active E2F protein
E) All of the above
To view all questions and flashcards with answers, click on the resource link above.
Page 19
Chapter 18: Cell Death
Available Study Resources on Quizplus for this Chatper
12 Verified Questions
12 Flashcards
Source URL: https://quizplus.com/quiz/16639
Sample Questions
Q1) For each of the following proteins that are proteolytically cleaved in apoptosis, indicate whether the cleavage is first carried out by an initiator (I) or executioner (E) caspase. Your answer would be a five-letter string composed of letters I and E only, e.g. EEEII.
( ) The initiator caspase-2
( ) The executioner caspase-3
( ) The BH3-only protein Bid
( ) The endonuclease inhibitor iCAD
( ) The nuclear protein Lamin A
Q2) Which of the following morphological changes is NOT typically seen in a cell that is undergoing apoptosis?
A) The cell rounds up.
B) The nuclear envelope disassembles.
C) The cell swells.
D) Large cells break up into membrane-enclosed fragments.
E) The nuclear chromatin breaks into fragments.
To view all questions and flashcards with answers, click on the resource link above. Page 20
Chapter 19: Cell Junctions and the Extracellular Matrix
Available Study Resources on Quizplus for this Chatper
56 Verified Questions
56 Flashcards
Source URL: https://quizplus.com/quiz/16640
Sample Questions
Q1) This large glycoprotein of the extracellular matrix is associated with elastin fibers and is essential for their integrity. Its deposition in the developing connective tissues often precedes the appearance of elastin. It is part of microfibrils that cover the elastic fibers. This protein is
A) collagen.
B) fibronectin.
C) fibrillin.
D) filamin.
E) laminin.
Q2) What is the most common additional polymer present in the plant secondary, but not primary, cell wall?
A) Cellulose
B) Pectin
C) Lignin
D) Starch
To view all questions and flashcards with answers, click on the resource link above.
21
Chapter 20: Cancer
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/16641
Sample Questions
Q1) A benign neoplasia of cartilage is called a
A) Chondrocarcinoma
B) Chondroma
C) Chondrosarcoma
D) Adenochondroma
E) Chondromelanoma
Q2) Indicate whether each of the following descriptions better applies to proto-oncogenes (P) or tumor suppressor genes (T). Your answer would be a four-letter string composed of letters P and T only, e.g. PPPT.
( ) Cancer mutations in these genes are usually recessive.
( ) Cancer mutations in these genes include gene duplications.
( ) Cancer mutations in these genes are responsible for most hereditary cancers.
( ) Cancer mutations in these genes are commonly in the form of nonsense (truncating) mutations that abort protein synthesis.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 21: Development of Multicellular Organisms
Available Study Resources on Quizplus for this Chatper
61 Verified Questions
61 Flashcards
Source URL: https://quizplus.com/quiz/16642
Sample Questions
Q1) Cortical rotation following fertilization in X. laevis places the (1) pole at the point of sperm entry, while Wnt11 mRNA is transported to the (2) pole.
A) 1: anterior; 2: posterior
B) 1: posterior; 2: anterior
C) 1: animal; 2: vegetal
D) 1: dorsal; 2: ventral
E) 1: ventral; 2: dorsal
Q2) Indicate true (T) and false (F) statements below regarding Hox genes. Your answer would be a four-letter string composed of letters T and F only, e.g. TTTF.
( ) The order of expression of Hox genes along the body corresponds to their order in the Hox complex.
( ) Generally, the more anterior of the Hox genes dominate (or suppress) posterior Hox genes.
( ) When a posterior Hox gene is artificially expressed in an anterior region of the embryo, the tissue maintains its anterior character.
( ) Hox genes control the A-P axis in both vertebrates and invertebrates.
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Stem Cells and Tissue Renewal
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/16643
Sample Questions
Q1) All blood cells in our body
A) have exceptionally short life-spans-at most a month or so.
B) are produced only before adulthood.
C) are ultimately generated from multipotent hematopoietic stem cells.
D) are made from progenitors that themselves circulate in the blood.
E) All of the above.
Q2) In addition to fibroblasts themselves, the fibroblast family of connective-tissue cells includes all of the following EXCEPT
A) Smooth muscle cells
B) Chondrocytes
C) Osteoblasts
D) Adipocytes
E) Macrophages
Q3) Blood platelets in an adult human
A) are made in lymphoid organs.
B) are NOT derived from hematopoietic stem cells.
C) lack nuclei.
D) All of the above.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 23: Pathogens and Infection
Available Study Resources on Quizplus for this Chatper
32 Verified Questions
32 Flashcards
Source URL: https://quizplus.com/quiz/16644
Sample Questions
Q1) Indicate true (T) and false (F) statements below regarding bacterial and viral evolution. Your answer would be a four-letter string composed of letters T and F only, e.g. FFFT.
( ) Bacteria that reside in natural soil that has not been deliberately exposed to antibiotics are normally sensitive to any antibiotic.
( ) Whereas bacterial and eukaryotic pathogens evade the immune response mainly by genetic recombination, antigenic variation in most viruses occurs by error-prone replication mechanisms.
( ) If an antibiotic targets a vital bacterial protein that cannot be altered in any way to become antibiotic-resistant and functional at the same time, the bacteria would never develop resistance to the antibiotic.
( ) It is impossible to develop effective vaccines against viral infections, since viruses evolve very rapidly.
Q2) How has pathogenicity in pandemic strains of Vibrio cholerae been acquired?
A) By transformation
B) By transduction
C) By conjugation
D) By vertical gene transfer
To view all questions and flashcards with answers, click on the resource link above. Page 25
Chapter 24: The Innate and Adaptive Immune Systems
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/16645
Sample Questions
Q1) Indicate true (T) and false (F) statements below regarding lymphocytes in the adaptive immune system. Your answer would be a four-letter string composed of letters T and F only, e.g. TTFF.
( ) To induce an adaptive immune response, an invading pathogen must invade a peripheral lymphoid organ.
( ) Lymphocytes continuously circulate between central and peripheral lymphoid organs.
( ) Upon encountering its specific antigen in a peripheral lymphoid organ, a lymphocyte remains there to proliferate and differentiate into effector and memory cells.
( ) Memory B and T cells do not recirculate, but rather remain in the peripheral lymphoid organ in which they develop.
Q2) Mice whose immune systems had previously rejected a tissue transplant from a certain strain of donor mouse received another transplant shortly afterward, either from the same donor strain or a new one. All of the recipient mice eventually rejected the transplant. However, one group did so more quickly than the other group. Do you think this group received the graft from the original mouse strain (O) or the new strain (N)?
Write down O or N as your answer.
To view all questions and flashcards with answers, click on the resource link above.