Genetics
Mock Exam
Course Introduction
Genetics explores the principles and mechanisms of heredity, focusing on how genetic information is transmitted, expressed, and regulated in living organisms. The course covers foundational topics such as Mendelian and non-Mendelian inheritance, DNA structure and replication, gene expression and regulation, molecular genetics, genetic mutations, and population genetics. Emphasis is placed on understanding genetic technologies, variation, and their implications for evolution, medicine, and biotechnology, providing students with both theoretical knowledge and practical applications in the field.
Recommended Textbook
Human Genetics Concepts and Applications 9th Edition by Ricki Lewis
Available Study Resources on Quizplus
22 Chapters
998 Verified Questions
998 Flashcards
Source URL: https://quizplus.com/study-set/3119
Page 2
Chapter 1: Overview of Genetics
Available Study Resources on Quizplus for this Chatper
39 Verified Questions
39 Flashcards
Source URL: https://quizplus.com/quiz/61839
Sample Questions
Q1) One way that single-gene diseases differ from other diseases is that
A) they most often affect people late in life.
B) they affect consecutive generations.
C) they occur at the same frequency in every population.
D) they are not treatable.
E) it is possible to predict occurrence in specific relatives.
Answer: E
Q2) A human body has about _________ cells.
A) 3.2 billion
B) 20,600
C) 50 to 100 trillion
D) 10 to 100 million
E) a quadrillion
Answer: C
To view all questions and flashcards with answers, click on the resource link above. Page 3
Chapter 2: Cells
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61838
Sample Questions
Q1) Organelles protect a cell by
A) sequestering biochemicals that could dismantle other cellular structures.
B) forming a thick outer barrier.
C) containing powerful enzymes that kill any bacteria that enter.
D) placing flag-like molecules on a cell's surface identifying that cell as belonging to a particular person.
E) producing new DNA if the genetic material is damaged.
Answer: A
Q2) In mitochondria,
A) energy from nutrients is converted into a form that a cell can use.
B) all of a cell's DNA is replicated.
C) fats and carbohydrates are degraded.
D) sugars are added to proteins.
E) proteins are folded.
Answer: A
To view all questions and flashcards with answers, click on the resource link above.
4
Chapter 3: Meiosis and Development
Available Study Resources on Quizplus for this Chatper
69 Verified Questions
69 Flashcards
Source URL: https://quizplus.com/quiz/61837
Sample Questions
Q1) Latika and Jeremiah are thrilled at the ultrasound scan that shows that their fetus appears to be a boy.It is the first time this has shown up on a scan.Latika is likely in her ___ week of pregnancy.
A) third
B) sixth
C) twelfth
D) twentieth
E) thirtieth
Answer: C
Q2) The correct sequence for the steps of meiosis I is
A) interphase-mitosis-meiosis
B) telophase-anaphase-metaphase-prophase
C) 46 chromosomes, 23 chromosomes, then 46 chromosomes
D) prophase-metaphase-anaphase-telophase
E) anaphase-metaphase-prophase-telophase
Answer: D
To view all questions and flashcards with answers, click on the resource link above.
5
Chapter 4: Single-Gene Inheritance
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61836
Sample Questions
Q1) Using the product rule,the probability that parents heterozygous for two traits (AaBb)produce an offspring homozygous recessive for the same two traits (aabb)is
A) 1/4.
B) 1/8.
C) 1/16.
D) 1/24.
E) 1/32.
Q2) The inheritance of eye color indicates that
A) a single gene is the only factor that determines eye color.
B) many different genes determine eye color, each contributing to different degrees.
C) eye color is sensitive to what the mother ate while pregnant.
D) other characteristics, such as the texture at the back of the eye, can affect the phenotype.
E) a person's sex influences inheritance of eye color.
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: Beyond Mendels Law
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61835
Sample Questions
Q1) Multiple alleles are common because
A) RNA is an informational molecule, and many sequences are possible for a particular gene.
B) proteins are informational molecules, and many amino acid sequences are possible.
C) a gene sequence can vary in different ways and still encode a functional protein.
D) there are many humans on the planet.
E) people have many children.
Q2) Can a woman with blood type A have a child with blood type O with a man who is AB?
A) Yes, because of codominance between the I<sup>A</sup> and I<sup>B</sup> alleles.
B) No, because a man with type AB blood could not contribute an i allele.
C) Yes, because of epistasis between the I and the H genes.
D) No, because the child's genotype must be ii.
E) Cannot tell from the phenotypes.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 6: Matters of Sex
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61834
Sample Questions
Q1) Indifferent gonads develop
A) during the first two weeks of prenatal development.
B) during the fifth week of prenatal development.
C) during the ninth week of prenatal development.
D) when the embryo becomes a fetus.
E) at puberty.
Q2) Imprinting disorders illustrate A) epistasis.
B) epigenetics.
C) epidermics.
D) apogenetics.
E) Mendelian genetics.
Q3) X inactivation is controlled by A) the SRY gene.
B) the XIST gene.
C) the XTASY gene.
D) whether or not a woman takes birth control pills.
E) the location of the spindle in mitosis.
To view all questions and flashcards with answers, click on the resource link above.
8
Chapter 7: Multifactorial Traits
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/61833
Sample Questions
Q1) The degree to which genes contribute to Krabbe disease compared to osteoporosis is that
A)Krabbe disease is caused by small contributions from many genes,with no environmental component.
B)Krabbe disease and osteoporosis are caused by mutations in different single genes.
C)Krabbe disease and osteoporosis are caused by a mutation in the same single gene,but it acts early in life in Krabbe disease and later in life in osteoporosis.
D)Krabbe disease is genetic and osteoporosis is caused entirely by environmental factors,such as lack of weight-bearing exercise and a diet poor in calcium and vitamin D.
E)Krabbe disease is very rare and caused by a mutation in a single gene,whereas osteoporosis is caused by several genes and environmental factors
To view all questions and flashcards with answers, click on the resource link above.
9
Chapter 8: Genetics of Behavior
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61832
Sample Questions
Q1) Causes of mental retardation include
A) single-gene and chromosomal disorders, infection, malnutrition, poisoning, and problems before or during birth.
B) eating too much chocolate, not exercising, and not drinking enough.
C) watching too much television, exposure to secondhand smoke, and drinking cow's milk before the age of six months.
D) inheriting a very low IQ, not having mobiles in the crib or being read to, and being ignored.
E) being exposed to certain bacteria, fungal spores, or mouse excrement.
Q2) Some drugs are plant products that can bind neural receptors in a human body because the body makes a similar chemical.Endorphins are the human equivalent of A) opiates.
B) cocaine.
C) THC (tetrahydrocannabinol).
D) ethanol.
E) chocolate.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 9: DNA Structure and Replication
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61831
Sample Questions
Q1) Rosalind Franklin did not share in the Nobel Prize for determining the structure of DNA,although her work was critical to it,because
A) she was a she.
B) the prize can only be awarded to three people.
C) she had died, and it is only awarded to living people.
D) she turned it down.
E) she was not a full professor.
Q2) Erwin Chargaff showed that DNA that has 30% adenine has ___ thymine.
A) 20%
B) 30%
C) 60%
D) 40%
E) a percentage that cannot be determined of
Q3) In 1909,Archibald Garrod linked inheritance to proteins when he noted that
A) inherited metabolic disorders in humans are associated with missing enzymes.
B) substances in cells could transform bacteria from nonvirulence to virulence.
C) proteins are made up of amino acids.
D) the substance that transmits traits is in the cell nucleus.
E) X-ray diffraction reveals that DNA is a highly symmetrical molecule.
To view all questions and flashcards with answers, click on the resource link above.
Page 11
Chapter 10: Gene Action: From Dna to Protein
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/61830
Sample Questions
Q1) In transcription,the promoter is
A) an enzyme that binds DNA.
B) a series of proteins that collectively bind to DNA.
C) a recognition sequence in RNA that attracts ribosomes.
D) A DNA sequence that RNA polymerase binds.
E) a type of mutation.
Q2) An mRNA molecule is also called a(n)
A) intron.
B) transcript.
C) gene.
D) proscript.
E) linguist.
Q3) To express a gene,DNA is first transcribed into a corresponding strand of A) mtDNA.
B) rRNA.
C) mRNA.
D) tRNA.
E) siRNA.
To view all questions and flashcards with answers, click on the resource link above.
12
Chapter 11: Gene Expression and Epigenetics
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61829
Sample Questions
Q1) A microRNA is ____ bases long.
A) 2-4
B) 12-13
C) 21-22
D) 100-110
E) 400-440
Q2) A treatment for some forms of anemia is to take a drug that turns on transcription of fetal hemoglobin.This would increase the proportion of _____ globin chains.
A) alpha
B) beta
C) gamma
D) delta
E) epsilon
Q3) The most abundant type of DNA repeat sequence is called a A) genome.
B) lipidome.
C) proteome.
D) transposon.
E) transcriptome.
To view all questions and flashcards with answers, click on the resource link above.
Page 13
Chapter 12: Gene Mutation
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/61828
Sample Questions
Q1) Homozygotes for hemoglobin C have
A) sickle cell disease.
B) a normal phenotype.
C) a bluish complexion.
D) a black mouth.
E) black ear tips.
Q2) A mutation expressed only under certain conditions is
A) germinal.
B) somatic
C) de novo.
D) conditional.
E) deleterious
Q3) Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?
A) GTCCCA
B) GTCCTGATTATTCA
C) GTCCACTTATT
D) GTCCTTATATTCA
E) GTCCTTATTCAACTTATTCCTG
To view all questions and flashcards with answers, click on the resource link above.
Page 14
Chapter 13: Chromosomes
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/61827
Sample Questions
Q1) To observe chromosomes,they must be
A) actively transcribing all of their genes.
B) actively transcribing some of their genes.
C) condensed.
D) in interphase.
E) contained in the nucleus.
Q2) A karyotype that uses FISH that shows two chromosomes,each with two colors,but in the opposite patterns,most likely indicates a
A) Robertsonian translocation.
B) pericentric inversion.
C) paracentric inverson.
D) reciprocal translocation.
E) isochromosome.
Q3) Amniocentesis cannot be used to detect fetal
A) gender.
B) intelligence.
C) chromosomal abnormalities.
D) biochemicals that indicate an inborn error of metabolism.
E) total chromosome number.
To view all questions and flashcards with answers, click on the resource link above.
Page 15
Chapter 14: Constant Allele Frequencies
Available Study Resources on Quizplus for this Chatper
37 Verified Questions
37 Flashcards
Source URL: https://quizplus.com/quiz/61826
Sample Questions
Q1) In a population in Hardy-Weinberg equilibrium,75 percent of the individuals have a dominant allele for a particular gene (p=0.75)and 25 percent have a recessive allele (q=0.25).The proportion of homozygous recessive individuals in the F<sub>1</sub> generation will be
A) 2.5%.
B) 6.25%.
C) 18.75%.
D) 25%.
E) 0%.
Q2) Hardy-Weinberg calculations are based on
A) the binomial expansion.
B) the quadratic equation.
C) the Pythagorean theorem.
D) comparing DNA sequences.
E) monitoring phenotypes.
To view all questions and flashcards with answers, click on the resource link above. Page 16
Chapter 15: Changing Allele Frequencies
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61825
Sample Questions
Q1) Many alleles cause PKU.A unique mutation found only in Yemenite Jews is probably
A) more ancient than other PKU mutations.
B) a result of genetic drift.
C) due to a strong heterozygote advantage.
D) identical to the original allele.
E) Present in 100% of the individuals.
Q2) A small group of islanders leave "island A" and travel to "island B." After several generations on island B,a researcher finds that a large percentage of the population is left-handed.Left-handedness is a relatively rare trait on island A.A genetic event that explains this is
A)a population bottleneck.
B)genetic load.
C)a founder effect.
D)natural selection.
E)Hardy-Weinberg equilibrium.
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: Human Ancestry
Available Study Resources on Quizplus for this Chatper
43 Verified Questions
43 Flashcards
Source URL: https://quizplus.com/quiz/61824
Sample Questions
Q1) The most recent known habitat of Neanderthals was
A) New Jersey.
B) South Africa.
C) Gibraltar.
D) Vancouver.
E) Sardinia.
Q2) Comparison of common chromosomal banding patterns between humans and 5 other species are given below.Based on these data,humans are least related to A) gorillas: 99% common chromosome bands.
B) orangutans: 99% common chromosome bands.
C) African green monkeys: 95% common chromosome bands.
D) domestic cats: 35% common chromosome bands.
E) mice: 7% common chromosome bands.
Q3) A complication of molecular clock studies is that
A) DNA and proteins appeared in life at about the same time.
B) genes mutate at different rates.
C) DNA is not often preserved in fossils.
D) some species are more highly evolved than others.
E) some primate species do not have a Y chromosome.
To view all questions and flashcards with answers, click on the resource link above.
Page 18
Chapter 17: Genetics of Immunity
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/61823
Sample Questions
Q1) Helper T cells secrete
A) cytokines.
B) antibodies.
C) antigens.
D) immunoglobulins.
E) autoantibodies.
Q2) Heart valve replacement in humans using a pig valve is an example of a(n)
A) autograft.
B) isograft.
C) allograft.
D) xenograft.
E) unmatched recipient.
Q3) Antibody production begins
A) in a fetus as its bone marrow develops.
B) in a fetus in response to maternal antigens.
C) immediately after birth.
D) after birth, a few months after exposure to foreign antigens.
E) at the embryo stage.
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Genetics of Cancer
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61822
Sample Questions
Q1) Mutations in microRNAs can explain families who have different cancers but do not have mutation for known family cancer syndrome genes because
A) microRNAs are specific to families.
B) a single type of microRNA can have many targets.
C) microRNAs also serve as oncogenes.
D) exposure to different environmental toxins triggers transcription of particular microRNAs.
E) they caused reversion of the family cancer syndrome mutations.
Q2) In 1971,cancer was thought to be caused by A) too little exercise.
B) too much chocolate and other sweets.
C) radiation, viruses, and chemical exposures.
D) oncogenes and tumor suppressor gene mutations.
E) a bacterial infection.
Q3) A breast cancer test for HER2 considers A) genotype.
B) phenotype.
C) gene expression.
D) mutation rate.
E) receptor diversity.
To view all questions and flashcards with answers, click on the resource link above. Page 20
Chapter 19: Genetic Technologies: Amplifying, Modifying, and Monitoring DNA
Available Study Resources on Quizplus for this Chatper
37 Verified Questions
37 Flashcards
Source URL: https://quizplus.com/quiz/61821
Sample Questions
Q1) Bacteriophages can be used as vectors in recombinant DNA experiments because they
A) are small and made of double-stranded DNA.
B) are circular and easily imported into bacteria or yeast.
C) insert their genetic material into bacteria.
D) are resistant to protective restriction systems.
E) infect human and other animal cells.
Q2) Automated PCR machines use a heat stable
A) DNA ligase.
B) helicase.
C) primase.
D) DNA polymerase.
E) amino acid synthetase.
Q3) The polymerase chain reaction is used to
A) create millions of copies of an interesting piece of DNA.
B) speed the rate of DNA replication in cells.
C) make more copies of DNA polymerase.
D) copy protein into RNA.
E) make RNA in the cell nucleus.
To view all questions and flashcards with answers, click on the resource link above. Page 21
Chapter 20: Genetic Testing and Treatment
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61820
Sample Questions
Q1) Germline gene therapy would correct a genetic defect in
A) an unaffected individual only.
B) an unaffected individual and his or her offspring.
C) an affected individual and all of his or her descendants.
D) the parents of an affected individual.
E) the unaffected sibling of an affected individual.
Q2) Muscle is a good target for gene therapy because
A) it is an abundant tissue with a rich blood supply.
B) muscular dystrophy is an autosomal dominant trait.
C) genes that function in muscles tend to be small.
D) muscle cells can be stimulated to divide with exercise.
E) the musculature is similar in males and females.
Q3) Which of the following is a vector used to deliver genes in human gene therapy?
A) parvovirus
B) rabies virus
C) adeno-associated virus
D) Ebola virus
E)E. coli
To view all questions and flashcards with answers, click on the resource link above.
22
Chapter 21: Reproductive Technologies
Available Study Resources on Quizplus for this Chatper
38 Verified Questions
38 Flashcards
Source URL: https://quizplus.com/quiz/61819
Sample Questions
Q1) Freezing oocytes has not been very successful because A) they undergo an extra meiosis.
B) the woman can become dangerously cold.
C) ice crystals can form in the abundant, watery cytoplasm.
D) the nuclei shatter.
E) the oocyte turns into a polar body.
Q2) The fertility drug clomiphene causes a woman to A) produce more oocytes.
B) ovulate more than one oocyte a month.
C) ovulate more than one time a month.
D) have only one menstrual period a year.
E) conceive.
Q3) A woman has a child using intrauterine insemination.The woman is the child's A) gestational mother only.
B) genetic mother only.
C) gestational and genetic mother.
D) gestational and surrogate mother.
E) clone.
To view all questions and flashcards with answers, click on the resource link above.
23
Chapter 22: Genomics
Available Study Resources on Quizplus for this Chatper
36 Verified Questions
36 Flashcards
Source URL: https://quizplus.com/quiz/61818
Sample Questions
Q1) _______ was the first organism to have its entire genome sequenced.
A)The fruit fly
B)E.coli
C)Homo sapiens
D)Haemophilus influenzae
E)Mycoplasma genitalium
Q2) Which genetic map is derived from overlapping short pieces of DNA and is used to distinguish genes tens of kilobases apart?
A) Cytogenetic map
B) Linkage map
C) Physical map
D) Sequence map
E) Genotype map
Q3) Research has been identifying the genes that cause inherited disease for A) a century.
B) half a century.
C) a decade.
D) since completion of the human genome project in 2000.
E) only the past two years.
To view all questions and flashcards with answers, click on the resource link above.
Page 24