Course Introduction
General Biology
Textbook Exam Questions
General Biology is an introductory course that explores the fundamental principles of life and living organisms, focusing on the structure, function, growth, evolution, and diversity of biological systems. Topics include cellular biology, genetics, evolution, ecology, and the biological processes that sustain life. Through a combination of lectures, laboratory work, and practical exercises, students develop an understanding of the scientific method, the complexity of biological systems, and the relevance of biology to everyday life and global issues such as health, environment, and biotechnology.
Recommended Textbook
Campbell Essential Biology 6th Edition by Eric J. Simon
Available Study Resources on Quizplus
29 Chapters
1538 Verified Questions
1538 Flashcards
Source URL: https://quizplus.com/study-set/2280
Page 2
Chapter 1: Introduction: Biology Today
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/45281
Sample Questions
Q1) Members of the kingdom Plantae differ from members of the other kingdoms of Eukarya in that most members of the kingdom Plantae ________.
A)are decomposers
B)are unicellular
C)are consumers
D)produce their own food
Answer: D
Q2) What is the difference between discovery science and hypothesis-driven science?
A)Discovery science "discovers" new knowledge,whereas hypothesis-driven science does not.
B)Discovery science is based on deductive reasoning,whereas hypothesis-driven science is based on inductive reasoning.
C)Discovery science is mostly about describing nature,whereas hypothesis-driven science tries to explain nature.
D)Discovery science involves predictions about outcomes,whereas hypothesis-driven science involves tentative answers to specific questions.
Answer: C
To view all questions and flashcards with answers, click on the resource link above. Page 3
Chapter 2: Essential Chemistry for Biology
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/45282
Sample Questions
Q1) Which of the following is an acid?
A)NaOH
B)NaCl
C)HCl
D)CH
Answer: C
Q2) As water freezes,________.
A)its molecules move farther apart
B)it cools the surrounding environment
C)its hydrogen bonds break apart
D)it loses its polarity
Answer: A
Q3) Sweating cools your body by ________.
A)cohesion
B)radiation
C)evaporative cooling
D)hydrogen bonding
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
Page 4
Chapter 3: The Molecules of Life
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45283
Sample Questions
Q1) Sometimes when I have my morning coffee,which I drink black with no cream or sugar,I notice a thin film floating on top of the coffee.Since I have just read Chapter 3 of the text,I now realize the nature of this substance and so I run to my friend screaming,"Look at this ________ in my coffee!"
A)hydrophilic substance
B)hydrophobic substance
C)disaccharide
D)polysaccharide
Answer: B
Q2) Which cookies are less healthy?
A)The chocolate mint cookies because they contain more saturated fat.
B)The chocolate mint cookies because they contain more total grams of protein and carbohydrates.
C)The peanut butter cookies because they contain more trans fat.
D)The peanut butter cookies because they contain more grams of carbohydrates.
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
5
Chapter 4: A Tour of the Cell
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45284
Sample Questions
Q1) What structures move proteins from the ER to the Golgi apparatus?
A)transport proteins
B)central vacuole
C)transport vesicles
D)nucleolus
Q2) Information is transferred from the nucleus to ribosomes via ________.
A)mRNA
B)rough endoplasmic reticulum
C)DNA
D)smooth endoplasmic reticulum
Q3) Based on its function in detoxifying drugs,you would expect to find a large amount of smooth ER in ________ cells.
A)brain
B)liver
C)intestinal
D)muscle
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: The Working Cell
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45285
Sample Questions
Q1) Facilitated diffusion across a biological membrane requires ________ and moves a substance ________ its concentration gradient.
A)energy...down
B)transport proteins...down
C)energy and transport proteins...against
D)transport proteins...against
Q2) Certain cells that line the stomach synthesize a digestive enzyme and secrete it into the stomach.Which of the following processes could be responsible for its secretion?
A)endocytosis
B)exocytosis
C)phagocytosis
D)passive transport
Q3) An object at rest has no ________ energy,but it may have ________ energy resulting from its location or structure.
A)kinetic...potential
B)kinetic...conserved
C)potential...kinetic
D)stored...potential
To view all questions and flashcards with answers, click on the resource link above.
7
Chapter 6: Cellular Respiration: Obtaining Energy From Food
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/45286
Sample Questions
Q1) In cellular respiration,most ATP is produced DIRECTLY as a result of ________.
A)the movement of hydrogen ions across the inner mitochondrial membrane
B)the citric acid cycle
C)fermentation
D)the electron transport chain
Q2) Photosynthetic organisms are ________.
A)producers that make all of their organic matter from organic molecules that they take in
B)consumers that obtain organic molecules from other living organisms
C)producers that make all their own organic matter from inorganic molecules
D)decomposers that obtain nutrients from the soil
Q3) Where in the cell does glycolysis occur?
A)cytoplasm
B)endoplasmic reticulum (ER)
C)within the fluid just inside the inner mitochondrial membrane
D)between the inner and outer mitochondrial membrane
To view all questions and flashcards with answers, click on the resource link above.
8
Chapter 7: Photosynthesis: Using Light to Make Food
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45287
Sample Questions
Q1) In the accompanying figure,the molecule that makes up the bulk of the mass of the plant comes in mostly ________.
A)through the veins,which bring materials from the roots
B)through the transparent covering of the leaf into the photosynthetic cells
C)through the stomata
D)from the roots where they are stored during the night
Q2) One of the compounds that is a direct output of the Calvin cycle is ________.
A)C H O
B)NADPH
C)G3P
D)ATP
Q3) What is one reason why plants have accessory pigment molecules,like chlorophyll b and carotenoids?
A)to reflect more energy
B)to absorb energy in parts of the electromagnetic spectrum that chlorophyll a cannot
C)to give them different colors
D)because plants cannot make enough chlorophyll a for all of their energy needs
To view all questions and flashcards with answers, click on the resource link above.
9
Chapter 8: Cellular Reproduction: Cells From Cells
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/45288
Sample Questions
Q1) Which of the following occurs during prophase?
A)Chromosomes line up on the midline of the cell.
B)The nuclear envelope forms.
C)Sister chromatids separate.
D)The mitotic spindle begins to form.
Q2) The CORRECT sequence of stages of mitosis is ________.
A)prophase,metaphase,anaphase,telophase
B)telophase,prophase,anaphase,metaphase
C)anaphase,interphase,prophase,metaphase,telophase
D)interphase,prophase,metaphase,anaphase,telophase
Q3) For a species with four pairs of chromosomes,________ chromosome combinations are possible.
A)4
B)8
C)16
D)20
To view all questions and flashcards with answers, click on the resource link above.
Chapter 9: Patterns of Inheritance
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45289
Sample Questions
Q1) The recombination frequency between gene B and gene C is 11%.The recombination frequency between gene B and gene D is 5%.The recombination frequency between gene C and gene D is 15%.What would be the arrangement of these genes on a linkage map?
A)CDB
B)DBC
C)BCD
D)More information is needed.
Q2) According to Mendel's law of segregation,________.
A)two alleles segregate into each gamete
B)more gametes carrying the dominant allele are produced than gametes carrying the recessive allele
C)gametes have one allele copy for each gene
D)gametes are diploid
Q3) Mary has the genotype ________.
A)WW
B)ww
C)Ww
D)More information is needed.
To view all questions and flashcards with answers, click on the resource link above.
Page 11
Chapter 10: The Structure and Function of Dna
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45290
Sample Questions
Q1) Where is translation accomplished?
A)lysosomes
B)smooth endoplasmic reticulum
C)ribosomes
D)nucleoli
Q2) After replication,________.
A)each new DNA double helix consists of two old strands
B)each new DNA double helix consists of one old strand and one new strand
C)each new DNA double helix consists of two new strands
D)one new DNA double helix consists of two old strands and the other new DNA double helix consists of two new strands
Q3) The first thing you notice is that there is no immediate increase in viruses following infection.This is because ________.
A)it takes the virus time to adapt to the host
B)although the virus has infected the host,it takes time to complete the lytic cycle
C)the host is immune to the virus
D)the virus is in a lysogenic cycle throughout the experiment
To view all questions and flashcards with answers, click on the resource link above.
Page 12
Chapter 11: How Genes Are Controlled
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45291
Sample Questions
Q1) In an operon,the ________ acts as an on/off switch.
A)operator
B)promoter
C)activator
D)repressor
Q2) What is a difference between embryonic and adult stem cells?
A)The use of embryonic stem cells raises fewer ethical issues than the use of adult stem cells.
B)Embryonic stem cells are undifferentiated; adult stem cells are partially differentiated.
C)It is easier to obtain embryonic stem cells.
D)Adult stem cells are easier to grow in culture.
Q3) Introns are ________.
A)noncoding DNA sequences
B)DNA sequences to which activators bind
C)expressed DNA sequences
D)the product of RNA splicing
To view all questions and flashcards with answers, click on the resource link above.
13
Chapter 12: DNA Technology
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/45292
Sample Questions
Q1) HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
A)0 times
B)1 time
C)2 times
D)3 times
Q2) Of the following,which is the last step in the production of a recombinant DNA plasmid?
A)cloning
B)using DNA ligase to join DNA fragments
C)cutting the gene of interest into fragments
D)allowing the reproduction of the bacterium bearing the recombinant plasmid
Q3) The scientific field that studies complete sets of genes is called ________.
A)genomics
B)metagenomics
C)proteomics
D)genetic engineering
To view all questions and flashcards with answers, click on the resource link above. Page 14
Chapter 13: How Populations Evolve
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/45293
Sample Questions
Q1) Natural selection can be defined as ________.
A)the evolution of a population of organisms
B)a process in which changes in gene frequencies result from evolution
C)the production of more offspring than can survive in a given environment
D)a process in which organisms with certain inherited traits are more likely to survive and reproduce than individuals with other traits
Q2) Which one of the following can create new alleles?
A)natural selection
B)sexual reproduction
C)mutation
D)genetic drift
Q3) The founder effect differs from a population bottleneck in that the founder effect
A)requires a small population
B)is a type of natural selection
C)can occur only on an oceanic island colony
D)involves the isolation of a small colony of individuals from a larger population
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: How Biological Diversity Evolves
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/45294
Sample Questions
Q1) Which of the following would be an example of paedomorphosis?
A)starfish regenerating severed limbs
B)rapid evolution in a small,isolated population
C)two species evolving a similar appearance
D)insects that can reproduce in larval stages without reaching mature development stages
Q2) An ancestral species and all its evolutionary descendants define a(n)________.
A)outgroup
B)clade
C)genus
D)ingroup
Q3) The production of sterile male ligers is an example of ________.
A)sympatric speciation
B)the founder effect
C)a postzygotic barrier
D)a prezygotic barrier
To view all questions and flashcards with answers, click on the resource link above. Page 16
Chapter 15: The Evolution of Microbial Life
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/45295
Sample Questions
Q1) RNAs that can act as enzymes are called ________.
A)ribozymes
B)ATPs
C)lysosomes
D)prokaryotes
Q2) Which of the following is a plausible reason for why it may be difficult to treat infections that arise from tooth decay?
A)Biofilm bacteria that cause tooth decay begin to produce endospores as a means to deter effects of antibiotics.
B)Binary fission in biofilm bacteria that cause tooth decay begins to decrease as the biofilm community becomes more complex,thereby producing fewer bacterial cells for antibiotics to penetrate.
C)As the biofilm that causes tooth decay becomes larger,its structure makes it difficult for antibiotics to break through bacterial cell walls.
D)Bacteria of the biofilm that cause tooth decay form a symbiotic relationship with the antibiotics and therefore diminish antibiotic effectiveness.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 16: The Evolution of Plants and Fungi
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45296
Sample Questions
Q1) ________ are seedless vascular plants.
A)Ferns
B)Angiosperms
C)Bryophytes
D)Gymnosperms
Q2) What global climatic change gave gymnosperms an advantage over ferns?
A)the climate becoming hotter and wetter
B)increased fluctuations in global climate temperatures
C)the climate becoming cooler and drier
D)the climate becoming hotter and drier
Q3) In angiosperms,what structures house female gametophytes?
A)stigmas
B)petals
C)ovules
D)sepals
Q4) Nearly all food plants are ________.
A)bryophytes
B)gymnosperms
C)ferns
D)angiosperms
Page 18
To view all questions and flashcards with answers, click on the resource link above.
Chapter 17: The Evolution of Animals
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/45297
Sample Questions
Q1) A characteristic of arthropods that has allowed for their great success is the presence of ________.
A)bilateral symmetry
B)an endoskeleton
C)a brain
D)specialized segments
Q2) While on an archaeology expedition,you unearth a skeleton with the following characteristics: four long,slender finger bones and a smaller opposable thumb bone,long arm bones,fingernails,and eye sockets close together on a skull.What type of organism do you suspect you may have found?
A)an anthropoid
B)a tarsier
C)a crustacean
D)a marsupial
Q3) Unique features of vertebrates include the presence of a(n)________.
A)endoskeleton
B)notochord
C)skull and a backbone
D)pharyngeal slit
To view all questions and flashcards with answers, click on the resource link above.
Page 19
Chapter 18: An Introduction to Ecology and the Biosphere
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45298
Sample Questions
Q1) Which of the following can moderate climate by absorbing heat when the air is warm and releasing heat when the air is cold?
A)clouds
B)glaciers
C)mountains
D)oceans
Q2) Which of these biomes are maintained by fire?
A)temperate broadleaf forests and chaparral
B)chaparral and savannas
C)deserts and chaparral
D)savanna and temperate grasslands
Q3) Which of these biomes is one of the most biologically productive of all biomes?
A)open oceans
B)estuaries
C)temperate grasslands
D)coniferous forests
To view all questions and flashcards with answers, click on the resource link above. Page 20
Chapter 19: Population Ecology
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/45299
Sample Questions
Q1) Examples of invasive species include ________.
A)kudzu and red-cockaded woodpeckers
B)cod and Chilean sea bass
C)snowshoe hares and kudzu
D)cheatgrass and Burmese pythons
Q2) If this trend continues,what do you predict that the populations will look like decades from 2014?
A)There will be more older individuals than working-age individuals.
B)There will be more children than older individuals.
C)There will be more older individuals than children.
D)There will be more working-age individuals than older ones.
Q3) The use of the Indian mongoose to control rat populations ________.
A)shows the effectiveness of biological control
B)shows why integrated pest management usually fails
C)became a disaster when the mongoose turned out to be as invasive as its target
D)is an example of how coevolution makes biological control difficult
To view all questions and flashcards with answers, click on the resource link above.
Chapter 20: Communities and Ecosystems
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45300
Sample Questions
Q1) Humans,mosquitoes,and Plasmodium together would be considered a(n)________.
A)population
B)community
C)ecosystem
D)population and community
Q2) Species found in only one place on Earth are called ________ species.
A)hot spot
B)exotic
C)keystone
D)endemic
Q3) Besides the atmosphere,abiotic reservoirs of carbon dioxide include ________.
A)fossil fuels and dissolved carbon compounds in the oceans
B)rocks and dissolved carbon compounds in the oceans
C)fossil fuels only
D)rocks only
Q4) Herbivory is an example of a ________ interaction.
A)+/+
B)-/-
C)0/+
D)+/-
To view all questions and flashcards with answers, click on the resource link above. Page 22
Chapter 21: Unifying Concepts of Animal Structure and Function
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45301
Sample Questions
Q1) Which of the following is NOT a true statement about organs?
A)An organ represents a higher level of structure than the tissues composing it.
B)An organ consists of several tissues.
C)An organ can carry out only the functions of its component tissues.
D)An organ consists of many cells.
Q2) A diuretic is a substance that ________.
A)promotes sweating
B)regulates the contraction of cardiac muscle
C)inhibits urinary water loss
D)promotes urinary water loss
Q3) Which of the following animals is generating (producing)body heat to warm itself?
A)a beetle that absorbs solar radiation
B)a moth that shivers its wings before flight
C)a lizard that lies on a warm rock
D)a turtle that moves to a warm,shallow part of a pond
To view all questions and flashcards with answers, click on the resource link above.
23
Chapter 22: Nutrition and Digestion
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/45302
Sample Questions
Q1) Which of the following people is shifting from an unhealthy category to a healthy category?
A)A 120 lb,5'5" male loses 15 lbs.
B)A 160 lb,5'10" female loses 5 lbs.
C)A 180 lb,5'10" male loses 20 lbs.
D)A 130 lb,5'0" female gains 10 lbs.
Q2) The four stages of food processing are,in order ________.
A)ingestion,absorption,elimination,digestion
B)ingestion,elimination,digestion,absorption
C)ingestion,digestion,absorption,elimination
D)digestion,absorption,ingestion,elimination
Q3) What is the main digestive function of the pancreas?
A)It produces digestive enzymes and bile.
B)It produces bile.
C)It produces digestive enzymes and neutralizes stomach acids.
D)It secretes mucus into the small intestine.
To view all questions and flashcards with answers, click on the resource link above. Page 24
Chapter 23: Circulation and Respiration
Available Study Resources on Quizplus for this Chatper
61 Verified Questions
61 Flashcards
Source URL: https://quizplus.com/quiz/45303
Sample Questions
Q1) Blood is propelled back to the heart by ________.
A)rhythmic contractions of muscles in the walls of veins and the action of one-way valves
B)skeletal muscle contractions around veins and the action of one-way valves
C)the negative pressure of the heart pulling blood into the empty chambers
D)the natural flow of blood into ever-larger blood vessels leading to the heart
Q2) Why is blood pressure higher during systole than during diastole?
A)The contraction of the heart during systole increases the blood pressure against arterial walls.
B)The relaxation of the heart during systole increases the blood pressure against arterial walls.
C)The contraction of the heart during diastole decreases the blood pressure against arterial walls.
D)More blood flows into the heart during systole than during diastole.
Q3) As a consequence of red blood cells' lack of nuclei and other organelles,they ________.
A)have more room to carry hemoglobin
B)have a small surface area
C)contain less hemoglobin than they might otherwise be able to carry
D)can carry more calcium
To view all questions and flashcards with answers, click on the resource link above. Page 25
Chapter 24: The Bodys Defenses
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/45304
Sample Questions
Q1) Defensive proteins can assist the immune response by ________.
A)helping viruses reproduce
B)directly destroying pathogens
C)reducing inflammation
D)increasing lymph production
Q2) Antibodies are ________.
A)composed of four fatty acid chains
B)a type of lymphocyte
C)proteins with short carbohydrates attached
D)proteins consisting of four polypeptide chains
Q3) When in its life cycle does a B cell first exhibit its particular surface antigen receptor?
A)after the memory cell giving rise to it divides
B)before it ever encounters an antigen
C)after it encounters several antigens
D)after it encounters a single antigen
To view all questions and flashcards with answers, click on the resource link above.
Chapter 25: Hormones
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45305
Sample Questions
Q1) Which of the following has both endocrine and nonendocrine functions?
A)pancreas
B)salivary gland
C)anterior pituitary gland
D)skeletal muscle
Q2) Which of these hormones acts in opposition to diuretics such as alcohol?
A)ADH
B)glucagon
C)HGH
D)FSH
Q3) The hormone being released from the organs shown in the figure is likely to be
A)adrenalin
B)growth
C)testosterone
D)calcitonin
To view all questions and flashcards with answers, click on the resource link above. Page 27
Chapter 26: Reproduction and Development
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45306
Sample Questions
Q1) Researchers have found a general relationship between testicular cancer and exercise.Increased exercise is associated with a decrease in incidence of testicular cancer.However,a positive relationship (increased incidence of testicular cancer)was found between testicular cancer and riding bikes or horses.Several factors might be hypothesized to bring about this result.Which of these hypotheses is properly related to a prediction that arises from it?
A)Hypothesis: Riding bikes or horses causes trauma to the testes.Prediction: Bike or horse riding will cause testes to shrink.
B)Hypothesis: The seat on bikes and the saddle on horses are made of material containing chemicals that damage testicular cells.Prediction: Chemicals found in bike seats or horse saddles damage testicular cells.
C)Hypothesis: Riding bikes or horses increases scrotal temperature,which damages testicular cells.Prediction: Bike riders are more likely to wear briefs than boxers as their underwear of choice.
D)Hypothesis: Mutations that lead to testicular cancer make men more likely to ride bikes or horses.Prediction: Men who ride bikes or horses have a higher rate of mutations than nonriders.
To view all questions and flashcards with answers, click on the resource link above.
28
Chapter 27: Nervous,Sensory,and Locomotor Systems
Available Study Resources on Quizplus for this Chatper
62 Verified Questions
62 Flashcards
Source URL: https://quizplus.com/quiz/45307
Sample Questions
Q1) Which of the following effects could result from activation of the sympathetic nervous system?
A)decreased heart rate
B)stimulated digestive organs
C)secretion of epinephrine
D)narrowing of the bronchi
Q2) In contrast to action potentials,receptor potentials ________.
A)are all-or-none phenomena
B)vary in intensity
C)do not require a stimulus
D)do not rely on changes in the membrane potential
Q3) Muscles are connected to bones by ________.
A)thick filaments
B)ligaments
C)tendons
D)myofibrils
To view all questions and flashcards with answers, click on the resource link above.
Chapter 28: The Life of a Flowering Plant
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/45308
Sample Questions
Q1) Most domesticated food crops come from which of the following plant groups?
A)mosses
B)gymnosperms
C)ferns
D)angiosperms
Q2) Which of the following are the tiny projections found on roots that increase the surface area?
A)root hairs
B)cotyledons
C)nodes
D)mesophyll
Q3) Water lily shoots and roots have very little structural support because this support is not needed in aquatic habitats.What structures would you be LEAST likely to see in a water lily stem?
A)epidermis
B)parenchyma
C)sclerenchyma
D)tracheids
To view all questions and flashcards with answers, click on the resource link above.
Chapter 29: The Working Plant
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/45309
Sample Questions
Q1) Which of the following best describe(s)the dependencies of most flowering plants?
I)Many depend on insects or other animals for pollination.
II)Many depend on insects or other animals for seed dispersal.
III)Many depend on fungi to help them acquire nutrients.
A)I
B)II
C)I and III
D)I,II,and III
Q2) Which of the following best describes the mechanism that causes stomata to open?
A)Water accumulates below the opening and eventually causes the stoma to open.
B)A large bubble of oxygen accumulates below the stoma and eventually causes it to open.
C)Two guard cells flanking each stoma control its opening by changing shape.
D)The internal pressure of xylem sap expands the leaf,stretching the stoma open.
Q3) For plants,mycorrhizae are______.
A)parasitic
B)mutualistic
C)an adaptation for photosynthesis
D)agricultural pests
To view all questions and flashcards with answers, click on the resource link above.
Page 31