Skip to main content

Cellular Microbiology Midterm Exam - 1996 Verified Questions

Page 1


Cellular Microbiology

Midterm Exam

Course Introduction

Cellular Microbiology explores the intricate interactions between microbial pathogens and host cells at the molecular and cellular levels. This course examines the strategies employed by bacteria, viruses, and other microorganisms to invade, survive, and manipulate host cellular processes, including cytoskeletal dynamics, signaling pathways, and immune responses. Students will analyze key experimental techniques, study landmark discoveries, and gain a comprehensive understanding of microbial pathogenesis and the cellular defense mechanisms activated during infection. The course integrates concepts from both microbiology and cell biology, fostering a holistic perspective on host-pathogen interactions and their implications for disease and therapeutic development.

Recommended Textbook

Microbiology An Evolving Science 4th Edition by Joan Slonczewski

Available Study Resources on Quizplus

28 Chapters

1996 Verified Questions

1996 Flashcards

Source URL: https://quizplus.com/study-set/766

Page 2

Chapter 1: Microbial Life: Origin and Discovery

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14966

Sample Questions

Q1) Briefly describe how the ultracentrifuge is used to determine the sizes of cellular macromolecules.

Answer: The ultracentrifuge uses centrifugal forces to separate cell components. Theodor Svedberg calculated that the particle sizes could be determined based on the rate of sedimentation of the particles in an ultracentrifuge.

Q2) You have isolated a bacterium that you believe to be the causative agent of a new disease in frogs. How would you test the third of Koch's postulates?

A) Determine the shape of the bacterial cells.

B) Inject the bacteria into a healthy frog.

C) Isolate the bacterium from a sick frog.

D) Show that the bacterium is not present in healthy frogs.

E) Grow a pure culture of the bacterium outside the frog.

Answer: B

Q3) Define "attenuation" and describe some mechanisms used to attenuate pathogens.

Answer: Attenuation results in a weakened organism that will not produce full-blown disease but will generate immunity. Answers for mechanisms may vary, but heat treatment or aging for various periods or natural attenuation in the host are mentioned in the chapter.

To view all questions and flashcards with answers, click on the resource link above.

3

Chapter 2: Observing the Microbial Cell

Available Study Resources on Quizplus for this Chatper

69 Verified Questions

69 Flashcards

Source URL: https://quizplus.com/quiz/14967

Sample Questions

Q1) What is the best explanation for a Gram-negative bacterium appearing purple after performing a Gram stain?

A) The safranin was not applied.

B) The decolorizer was not applied.

C) The iodine was not applied.

D) The crystal violet was not applied.

E) The stain was properly performed.

Answer: B

Q2) What happens to an electron when excited by light at the excitation wavelength?

A) It remains in the same orbital.

B) It moves to a lower energy orbital.

C) It moves to a higher energy orbital.

D) It emits a photon.

E) It is filtered.

Answer: C

Q3) List and describe three common shapes of bacteria.

Answer: Bacilli (bacillus in the singular) are rod-shaped bacteria. Cocci (singular, coccus) are spherical-shaped bacteria. Spirochetes are tightly coiled spirals or corkscrew-shaped bacteria.

To view all questions and flashcards with answers, click on the resource link above.

Page 4

Chapter 3: Cell Structure and Function

Available Study Resources on Quizplus for this Chatper

72 Verified Questions

72 Flashcards

Source URL: https://quizplus.com/quiz/14968

Sample Questions

Q1) Which of the following materials is found in aquatic bacteria and used for positioning in the water column?

A) gas vesicle

B) sulfur

C) polyphosphate

D) glycogen

E) magnetosome

Answer: A

Q2) Explain what happens when a cell comes into contact with water or ethanol. Why is 70% ethanol commonly used to treat wounds and surfaces?

Answer: Water can cross cell membranes by osmosis, but ethanol can dissolve both polar and nonpolar substances, thus harming the integrity of the membrane. In the presence of water, ethanol can denature proteins. The 70% ethanol disrupts the membrane sufficiently that the cells lyse.

Q3) Explain how bacteria can produce proteins more quickly than eukaryotes do.

Answer: Bacteria have no membrane around the nucleoid. This transcription and translation can be coupled with no need to transport the mRNA out of a nucleus.

To view all questions and flashcards with answers, click on the resource link above.

Chapter 4: Bacterial Culture, Growth, and Development

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14969

Sample Questions

Q1) Compare and contrast the difference between electrogenic and electroneutral coupled transport and give an example of each.

Q2) Which forms are NOT made by Streptomyces?

A) hyphae

B) germinating spores

C) filaments

D) endospores

E) mycelia

Q3) When the population doubles during each given unit of time, the growth is A) linear.

B) semilogarithmic.

C) exponential.

D) geometric.

E) arithmetic.

Q4) Quorum sensing is triggered in biofilms when A) they form microcolonies.

B) they are dispersing.

C) antibiotics are applied to them.

D) the population reaches a certain number.

E) cells attach to a surface.

To view all questions and flashcards with answers, click on the resource link above. Page 6

Chapter 5: Environmental Influences and Control of

Microbial Growth

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14970

Sample Questions

Q1) At the bottom of the ocean, hydrostatic pressure averages a crushing 400 atm (atmospheres) and can go as high as ________ atm.

A) 700

B) 1,000

C) 1,500

D) 3,000

E) 3,500

Q2) How are some organisms able to survive temporary exposures to elevated temperatures?

Q3) If a disinfectant is added to a culture containing 1 ´ 10 CFU per milliliter and the D-value of the disinfectant is 2 minutes, how many viable cells are left after 4 minutes of exposure?

Q4) Describe the studies with Salmonella that showed that in vitro conditions do not always model what happens in vivo (in this case in the phagocytic vacuole).

Q5) Why is oxygen so dangerous for cells and how do cells deal with these problems?

Q6) Halophiles require high salt concentrations to survive. Describe a mechanism involving compatible solutes that has evolved to achieve low internal sodium ion concentrations.

Page 7

To view all questions and flashcards with answers, click on the resource link above.

Chapter 6: Viruses

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14971

Sample Questions

Q1) Filamentous viruses are classified in part by the pattern of capsid monomers, which form a ________ tube around the genome.

A) icosahedral

B) filamentous

C) asymmetrical

D) complex

E) helical

Q2) What are prions and how do they cause disease?

Q3) All of the following criteria are used to classify viruses according to the International Committee on Taxonomy of Viruses EXCEPT

A) genome composition.

B) size of the virus particle.

C) envelope.

D) capsid symmetry.

E) mutation rate.

Q4) During the eclipse period of a viral infection, why are the virions undetectable in the growth medium?

Q5) Discuss the role that marine viruses play in carbon balance.

Q6) What determines the host range and tropism of a virus?

Page 8

To view all questions and flashcards with answers, click on the resource link above.

Chapter 7: Genomes and Chromosomes

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14972

Sample Questions

Q1) Which of the following is NOT a mechanism by which plasmids increase the possibility of being present in the new generation of cells?

A) They can be present at a high number so that some copies will end up in each new cell after cell division.

B) They encode traits such as antibiotic resistance that are required for growth in some environments.

C) They have an exponential amount of genes needed for replication.

D) They participate in the physiological processes of the host cell.

E) They carry host survival genes and self-preservation genes.

Q2) During replication, the lagging strand is synthesized ________, while the leading strand can be synthesized ________.

A) continuously; discontinuously

B) discontinuously; continuously

C) 5'-to-3'; 3'-to-5'

D) 3'-to-5'; 5'-to-3'

E) quickly; slowly

Q3) Why is replication of the lagging DNA strand a problem, and how is this problem overcome?

Q4) Describe the functions of DNA Pol III.

To view all questions and flashcards with answers, click on the resource link above. Page 9

Chapter 8: Transcription, Translation, and Bioinformatics

Available Study Resources on Quizplus for this Chatper

76 Verified Questions

76 Flashcards

Source URL: https://quizplus.com/quiz/14973

Sample Questions

Q1) After tmRNA releases an mRNA and aberrant polypeptide from a stuck ribosome,

A) clpX tags the peptide for destruction.

B) sspB tags the peptide for destruction.

C) tmRNA then destroys the peptide.

D) tmRNA ubiquitinates the peptide.

E) sspB recognizes a proteolysis tag and delivers the peptide to clpX for degradation.

Q2) What does it mean to say that the genetic code is redundant?

A) There is more than one kind of amino acid in proteins.

B) More than one rRNA can bind to the ribosome at the same time.

C) A codon is composed of more than one nucleotide.

D) More than one codon can specify the same amino acid.

E) All products of translation contain a certain minimum number of mistakes, called mutations.

Q3) The average half-life for mRNA in a typical bacterium such as E. coli is

A) 1-3 seconds.

B) 10-30 seconds.

C) 1-3 minutes.

D) 1-3 hours.

E) 1-3 days.

To view all questions and flashcards with answers, click on the resource link above.

Page 10

Chapter 9: Gene Transfer, Mutations, and Genome

Evolution

Available Study Resources on Quizplus for this Chatper

72 Verified Questions

72 Flashcards

Source URL: https://quizplus.com/quiz/14974

Sample Questions

Q1) Approximately what percentage of the genome of E. coli O157:H7, which has been responsible for several outbreaks of food-borne disease, has been acquired from other species?

A) 5

B) 10

C) 25

D) 40

E) 50

Q2) Genomes are considered to be mosaic. Which of the following statements provides the LEAST support for this idea?

A) E. coli can receive plasmids from other strains of Gram-negative bacteria.

B) The archaeon Methanocaldococcus jannaschii has many proteins with sequence homology to proteins found in both bacteria and eukarya.

C) Agrobacterium can transfer plasmids to plants.

D) Genome sequencing and informatics has revealed a variety of homologous genes throughout the domains of life.

E) Genes from Mesorhizobium loti have been found in other new species of Mesorhizobium.

Q3) What is transcription-coupled repair and why is it important for the cell?

Page 11

To view all questions and flashcards with answers, click on the resource link above.

Chapter 10: Molecular Regulation

Available Study Resources on Quizplus for this Chatper

73 Verified Questions

73 Flashcards

Source URL: https://quizplus.com/quiz/14975

Sample Questions

Q1) Bacterial systems using an AraC/XylS-type regulator include ________ as regulated by ________.

A) a type III secretion system in Pseudomonas; NitR

B) a type III secretion system in Pseudomonas; ExsA

C) a type III secretion system in Pseudomonas; YbtA

D) virulence genes and cholera toxin in Vibrio; TxtR

E) virulence genes and cholera toxin in Vibrio; ExsA

Q2) The value of studying a transcriptome rather than a genome is that

A) RNA is much easier to work with than DNA.

B) using bacterial RNA eliminates the introns they all have.

C) one can get a snapshot of what genes are expressed under some conditions but not others.

D) a transcriptome is more related to the protein.

E) deep sequencing can only be performed on RNA.

Q3) During the process of endospore formation, different sigma factors are active in the mother cell and forespore. How is this possible, and why is it important?

Q4) Explain how riboswitches can be compared to activator and repressor proteins. State an example.

Q5) Describe the function of prokaryotic activator proteins.

To view all questions and flashcards with answers, click on the resource link above. Page 12

Chapter 11: Viral Molecular Biology

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14976

Sample Questions

Q1) Approximately 60%-80% of Americans acquire herpes simplex, usually HSV-1, in epithelial lesions commonly known as A) chancres.

B) pox.

C) cold sores.

D) shingles.

E) hives.

Q2) RNA synthesis of influenza virus is primed by 7-methylguanine fragments of host mRNA, obtained by A) telomerase activity.

B) the rolling-circle mechanism.

C) endocytosis.

D) exocytosis.

E) cap-snatching.

Q3) After Dr. Esther Lederberg crossed a standard stock of Escherichia coli K-12 with UV-mutagenized cells of the same strain, she observed the formation of plaques, but only among the mutagenized colonies. What was the explanation for this phenomenon?

Q4) Describe the several features of lentivectors. What are their molecular sources?

Q5) What is an oncolytic virus? Give an example.

To view all questions and flashcards with answers, click on the resource link above. Page 13

Chapter 12: Biotechniques and Synthetic Biology

Available Study Resources on Quizplus for this Chatper

72 Verified Questions

72 Flashcards

Source URL: https://quizplus.com/quiz/14977

Sample Questions

Q1) Gene fusions of a protein of interest and GFP, or its derivatives, can be used in all of the following EXCEPT

A) studying protein targeting to organelles in eukaryotic cells.

B) monitoring microbial protein movement inside infected eukaryotic cells.

C) tracking viral protein movement inside or between infected eukaryotic cells.

D) detecting interactions between microbial extracellular proteins and attachment surfaces.

E) CRISPR-Cas9.

Q2) Describe the difference between autoradiography and phosphor imaging.

Q3) The colorless molecule o-nitrophenyl galactoside (ONPG) can be used as an artificial substrate to assay b-galactosidase in cell extracts of Escherichia coli in which lacZ is used as a reporter gene. Which of the following statements is NOT true with respect to the use of ONPG?

A) Hydrolysis of ONPG by b-galactosidase produces yellow o-nitrophenol.

B) o-nitrophenol can be measured with a spectrophotometer.

C) Hydrolysis of ONPG by b-galactosidase also releases colorless galactose.

D) The o-nitrophenol moiety is blue and more suitable for use in solid media.

E) The o-nitrophenol moiety is green and less suitable for use in solid media.

Q4) What is synthetic biology? Provide an example of its potential applications.

Q5) How do operon fusions reveal transcriptional control of a target gene?

To view all questions and flashcards with answers, click on the resource link above. Page 14

Chapter 13: Energetics and Catabolism

Available Study Resources on Quizplus for this Chatper

77 Verified Questions

77 Flashcards

Source URL: https://quizplus.com/quiz/14978

Sample Questions

Q1) Disparate animal groups, such as ruminants and humans, can digest a variety of plant fibers because they harbor cellulase-producing bacteria such as

A) Staphylococcus aureus and Bacillus subtilis.

B) Salmonella and Shigella.

C) Escherichia coli and Enterococcus faecalis.

D) Bacteroides and Ruminococcus.

E) Escherichia chrysanthemi and Erwinia uredovora.

Q2) Although ATP is the main energy carrier in living organisms, other molecules may also serve as energy carriers in metabolic reactions. Which of the following molecules does NOT carry energy?

A) nucleotides such as GTP

B) phosphoenolpyruvate

C) creatine phosphate

D) glucose

E) nucleotides such as CTP and UDP

Q3) What are the differences among DG, DG°, and DG°'?

Q4) Define "organotroph" and "heterotroph." Are these terms equivalent?

Q5) Treponema pallidum, the causative agent of syphilis, was shown to be lacking a TCA cycle. Explain the significance of this finding.

To view all questions and flashcards with answers, click on the resource link above. Page 15

Chapter 14: Electron Flow in Organotrophy, Lithotrophy, and Phototrophy

Available Study Resources on Quizplus for this Chatper

73 Verified Questions

73 Flashcards

Source URL: https://quizplus.com/quiz/14979

Sample Questions

Q1) The reduction of U to U by Geobacter metallireducens is an example of A) assimilatory metal reduction.

B) fermentation.

C) dissimilatory metal reduction.

D) organotrophy.

E) lithotrophy.

Q2) Ferroplasma acidarmanus produces large amounts of sulfuric acid through

A) oxidation of Cu<sup>+</sup> with Cu(NO<sub>3</sub>)<sub>2</sub>.

B) oxidation of FeS<sub>2</sub> with Fe3+ and H<sub>2</sub>O.

C) oxidation of Fe<sub>3</sub>O<sub>2</sub> with Fe<sup>2+</sup>.

D) oxidation of H<sub>2</sub>S with H<sub>2</sub>O.

E) reduction of SO with H<sub>2</sub>.

Q3) In anaerobic soils, some yeasts and filamentous fungi can reduce nitrate to nitrite and nitrite to

A) ammonia (NH<sub>3</sub>).

B) nitric oxide (NO).

C) urea.

D) nitrogen gas (N<sub>2</sub>).

E) ammonium hydroxide (NH<sub>4</sub>OH).

Q4) What is photoheterotrophy? Give examples of photoheterotrophic organisms.

To view all questions and flashcards with answers, click on the resource link above. Page 16

Chapter 15: Biosynthesis

Available Study Resources on Quizplus for this Chatper

73 Verified Questions

73 Flashcards

Source URL: https://quizplus.com/quiz/14980

Sample Questions

Q1) In anaplerotic reactions

A) intermediates in a pathway are regenerated.

B) nutrients are imported from the environment.

C) molecules targeted for breakdown are salvaged for anabolism.

D) the reactions are thermodynamically impossible.

E) large amounts of ATP are generated.

Q2) What technique was used to demonstrate that gene expression of the CO -concentrating mechanism (CCM) transporters is induced by low levels of CO ? Briefly explain the basis of the technique.

Q3) Chorismate is used in a branched pathway to synthesize

A) fatty acids.

B) polyketide antibiotics

C) purines and pyrimidines

D) aromatic amino acids

E) tetrapyrroles

Q4) What techniques and technical advances allowed Melvin Calvin to study carbon fixation? Why did he choose the unicellular alga Chlorella?

Q5) How is fatty acid biosynthesis regulated in bacteria?

Q6) What are nonribosomal peptide antibiotics? How are they synthesized?

Page 17

To view all questions and flashcards with answers, click on the resource link above.

Chapter 16: Food and Industrial Microbiology

Available Study Resources on Quizplus for this Chatper

73 Verified Questions

73 Flashcards

Source URL: https://quizplus.com/quiz/14981

Sample Questions

Q1) Which of the following aids microbial growth?

A) drying

B) radiation

C) addition of spices

D) refrigeration

E) warming the food to body temperature

Q2) Alcohol dehydrogenase in the ________ detoxifies alcohol produced in the intestines.

A) lungs

B) liver

C) mouth

D) pancreas

E) spleen

Q3) How is injera produced and why is it nutritionally better than quick-rising wheat breads?

Q4) Why is Agrobacterium used in genetic engineering of plants? Briefly explain the Agrobacterium expression system.

Q5) Describe some of the characteristics that industrial strains of microbes must possess.

Page 18

Q6) What makes a company dealing with industrial microbiology a success?

To view all questions and flashcards with answers, click on the resource link above.

Chapter 17: Origins and Evolution

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14982

Sample Questions

Q1) In the domains of life, archaea and bacteria differ from each other in that

A) archaea contain membrane-bound organelles, bacteria do not.

B) bacteria can be extreme thermophiles, archaea cannot.

C) archaea contain ester-linked membrane fatty acids, bacteria do not.

D) bacteria start protein production with formylmethionine, archaea do not.

E) bacteria have introns, archaea do not.

Q2) How do membrane compartments spontaneously arise from the properties of fatty acid glycerol esters?

Q3) Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?

(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG

(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG

(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG

(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

Q4) Describe the intracellular endosymbiosis between algae of the genus Chlorella and Paramecium. Why is this symbiosis considered reversible?

To view all questions and flashcards with answers, click on the resource link above. Page 19

Chapter 18: Bacterial Diversity

Available Study Resources on Quizplus for this Chatper

71 Verified Questions

71 Flashcards

Source URL: https://quizplus.com/quiz/14983

Sample Questions

Q1) What bacterial groups use actin as a means to leave their host cells? What advantage does this type of cellular invasion provide to intracellular pathogens?

Q2) Corynebacterium species have a particular type of cell division that can be described as

A) "half-snapping."

B) the formation of reticulate bodies.

C) the formation of a forespore and a mother cell.

D) stalking.

E) "live birth."

Q3) Which of the following is NOT a common cyanobacterial morphology?

A) single-celled

B) endospore

C) colonial

D) filamentous

E) akinete

Q4) Compare and contrast the double membrane found in Planctomycetes versus that found in the eukaryotic nucleus.

Q5) Describe the metabolic characteristics of Chlorobium species.

Q6) Describe the photosynthetic machinery of cyanobacteria.

Page 20

To view all questions and flashcards with answers, click on the resource link above.

Chapter 19: Archaeal Diversity

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14984

Sample Questions

Q1) The Sulfolobus species maintains an internal pH ________ that of its habitat. A) equivalent to B) higher than C) lower than D) variable enough that it cannot be measured against E) not determined to be different to

Q2) Archaeoglobus fulgidus conserves energy by sulfate respiration, which drives a unique acetyl-CoA degradation pathway involving the reversal of A) methanogenesis.

B) glycolysis.

C) flagella rotation.

D) the TCA cycle.

E) electron transport.

Q3) Which of the following uses light to generate a proton gradient in the haloarchaeotes?

A) bacteriorhodopsin

B) bacterioruberin

C) halorhodopsin

D) methanofuran

E) ferredoxin

To view all questions and flashcards with answers, click on the resource link above. Page 21

Chapter 20: Eukaryotic Diversity

Available Study Resources on Quizplus for this Chatper

69 Verified Questions

69 Flashcards

Source URL: https://quizplus.com/quiz/14985

Sample Questions

Q1) Dinoflagellates are marine phototrophs responsible for the toxic red tide blooms. What pigments confer the red color to these organisms?

A) rhodopsin

B) tannins

C) anthocyanins

D) chlorophylls

E) carotenoids

Q2) Which of the following is a mismatched pair?

A) Trypanosoma brucei-sleeping sickness

B) Trypanosoma cruzi-Chagas disease

C) Balantidium coli-gastric ulcers

D) Entameba histolytica-amebiasis

E) Plasmodium falciparum-malaria

Q3) Which group has the widest range of form but the least diversity in terms of metabolism?

A) archaea

B) eukaryotes

C) bacteria

D) viruses

E) prokaryotes

To view all questions and flashcards with answers, click on the resource link above. Page 22

Chapter 21: Microbial Ecology

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14986

Sample Questions

Q1) Eutrophic lakes typically support ten times the microbial concentrations of an oligotrophic lake. Which of the following statements is NOT true of eutrophic lakes?

A) Biochemical oxygen demand is high.

B) Population of aquatic animals is high.

C) Nitrogen and phosphorous levels are usually high.

D) Photosynthetic activities are altered.

E) Algal blooms are common.

Q2) Metatranscriptomics is the study of ________ obtained from an environmental community.

A) lipids

B) proteins

C) organisms

D) DNA

E) RNA

Q3) Explain at least three ways in which metagenomes may overlook organisms in the environment.

Q4) What are the benefits and limitations of different environmental sequencing methods? Explain why ribosomal gene sequencing can be used as an initial screen.

To view all questions and flashcards with answers, click on the resource link above.

Page 23

Chapter 22: Microbes in Global Elemental Cycles

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14987

Sample Questions

Q1) In polluted ocean waters, what type of organisms may contribute significantly to global warming?

A) photosynthetic algae

B) methanogens

C) vent bacteria

D) marine mammals

E) denitrifying bacteria

Q2) Which of these is involved in commercial chemical fertilizer production?

A) lightning strikes

B) the Haber process

C) cellular nitrogen fixation

D) nitrification

E) denitrification

Q3) What evidence suggests that the biochemistry of life elsewhere would resemble that on Earth?

Q4) How did Jill Mikucki test her hypothesis that a subsurface river of brine flows deep beneath the glaciers and permafrost of Taylor Valley, feeding Blood Falls?

Q5) What are two mechanisms used by marine organisms to adapt to the scarcity of phosphorous?

To view all questions and flashcards with answers, click on the resource link above. Page 24

Chapter 23: Human Microbiota and Innate Immunity

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14988

Sample Questions

Q1) In cystic fibrosis, a mutation has rendered the receptor for binding and inactivating Pseudomonas defective. The affected gene is the CFTR. The CFTR gene product is located in the

A) cytosol.

B) nucleus.

C) plasma membrane.

D) mitochondria.

E) phagosome.

Q2) Is it correct to state that bacteria introduced through a skin cut will most likely be engulfed by Langerhans cells?

Q3) Natural killer cells target ________ cells that ________.

A) infected; have lost MHC class I

B) bacterial; have lost MHC class I

C) bacterial; are coated with complement

D) infected; have lost C-reactive protein

E) infected; secrete cytokines

Q4) How does Propionibacterium acnes-an anaerobic Gram-positive normal flora of the skin-cause acne, especially in teenagers?

Q5) Why can acne be treated with antibiotics?

To view all questions and flashcards with answers, click on the resource link above. Page 25

Chapter 24: The Adaptive Immune Response

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14989

Sample Questions

Q1) The antigen-binding receptor expressing hepatitis antigen in an infected liver cell would be

A) TCR.

B) MHC II.

C) MHC I.

D) CD4.

E) CD8.

Q2) The difference between antibody allotypes and isotypes is that isotypes are ________ and allotypes are ________.

A) the differences in constant regions; differences within isotypes

B) differences within allotypes; the differences in constant regions

C) the differences in constant regions; alternations in the hypervariable regions

D) alternations in the hypervariable regions; differences within isotypes

E) alternations in the hypervariable regions of one person; alternations in the hypervariable regions among a species

Q3) Would treating a person infected with human immunodeficiency virus (HIV) who has recently developed acquired immunodeficiency syndrome (AIDS) using a helper T-cell transfusion work? Why or why not?

To view all questions and flashcards with answers, click on the resource link above.

Chapter 25: Microbial Pathogenesis

Available Study Resources on Quizplus for this Chatper

70 Verified Questions

70 Flashcards

Source URL: https://quizplus.com/quiz/14990

Sample Questions

Q1) Which of the following types of information CANNOT be derived from the full genome of a noncultured bacterial pathogen?

A) nutritional requirements

B) toxin production

C) infectious and lethal doses

D) pathogenic islands

E) cell receptor binding and tissue tropism

Q2) Type I and Type IV pili both

A) are similar in mode of secretion.

B) are mannose resistant.

C) have an assembly that does not involve the secA general secretory pathway.

D) are encoded by a pathogenicity island.

E) are exclusively used for pathogenesis.

Q3) Toxins with ADP ribosyltransferase activity cause

A) membrane pore formation.

B) immune system activation.

C) proteolytic degradation of host proteins.

D) adenylate cyclase inhibition.

E) inhibition of elongation factor 2.

Q4) Diphtheria toxin is a classic AB exotoxin. How does it cause host cell damage?

Page 27

To view all questions and flashcards with answers, click on the resource link above.

Chapter 26: Microbial Diseases

Available Study Resources on Quizplus for this Chatper

69 Verified Questions

69 Flashcards

Source URL: https://quizplus.com/quiz/14991

Sample Questions

Q1) Giardia causes more diarrhea than any other protozoan globally. Interpret the reasons for its success in causing disease.

Q2) Why is antibiotic treatment NOT typically prescribed for staphylococcal food poisoning?

A) The bacterium is a multidrug-resistant pathogen.

B) No antibiotic is useful because it's a mixed infection.

C) No living cells are involved in the disease.

D) The causative agent is MRSA.

E) Some antibiotics will trigger gastrointestinal disease.

Q3) Which of the following STDs is most likely to lead to sterility?

A) gonorrhea

B) syphilis

C) trichomoniasis

D) chancroid

E) genital herpes

Q4) How can prescribing an antibiotic for a sick patient actually lead to triggering gastrointestinal illness? Explain and give an example.

Q5) People who come down with STDs and do not get treated, frequently end up with co-STD infections. Why is this? Explain.

To view all questions and flashcards with answers, click on the resource link above. Page 28

Chapter 27: Antimicrobial Therapy

Available Study Resources on Quizplus for this Chatper

72 Verified Questions

72 Flashcards

Source URL: https://quizplus.com/quiz/14992

Sample Questions

Q1) Which of the following would NOT be considered a way to fight bacterial resistance?

A) creating molecules without antibiotic activity that can compete and bind antibiotic-resistance enzymes

B) increase the amount of antibiotics in our foods to prevent food-borne infection

C) alter the structure of antibiotics to sterically hinder the binding of antibiotic-resistance enzymes

D) link different antibiotics together, forming hybrid antibiotics with dual action and targets

E) administer antibiotics more prudently when possible

Q2) A bacterium may be penicillin resistant due to all of the following EXCEPT

A) a Gram-negative cell wall.

B) beta-lactase production.

C) a Gram-positive cell wall.

D) modified transpeptidases.

E) modified transglycosylases.

Q3) Why is metronidazole uneffective against an aerobic bacteria like Staphylococcus aureas?

Q4) Why are drug-resistant bacteria less viable in comparison with wild type?

To view all questions and flashcards with answers, click on the resource link above.

Page 29

Chapter 28: Clinical Microbiology and Epidemiology

Available Study Resources on Quizplus for this Chatper

75 Verified Questions

75 Flashcards

Source URL: https://quizplus.com/quiz/14993

Sample Questions

Q1) The cause of the infection from which a patient suffers is best known as the

A) clinical agent.

B) etiological agent.

C) pathogenic culprit.

D) epidemiological agent.

E) antibiotic menace.

Q2) Direct fluorescent staining of infected tissue samples taken from a patient allows for rapid identification under what circumstances?

A) hard-to-culture organisms

B) protist infections

C) Gram-negative organisms

D) intracellular infections

E) metabolically active organisms

Q3) Haemophilius influenzae requires ________ and ________ for confirmatory growth of an organism in vitro.

A) catalase; oxidase (N disk)

B) Eosin-Methylene Blue (EMB) agar; MacConkey agar

C) citrate; bile salts

D) hemin (X factor); NAD (V factor)

E) phenylalanine; ortho-Nitrophenyl-b-galactoside (ONPG)

To view all questions and flashcards with answers, click on the resource link above. Page 30

Turn static files into dynamic content formats.

Create a flipbook