Biotechnology Exam Review
Course Introduction
Biotechnology is an interdisciplinary field that harnesses biological processes, organisms, cells, and cellular components to develop new technologies, products, and applications in areas such as medicine, agriculture, environmental management, and industrial processes. This course explores the fundamental principles of biotechnology, including genetic engineering, molecular biology techniques, bioprocessing, and bioinformatics. Students will examine real-world applications and ethical considerations, gaining insights into how biotechnology impacts society and drives innovation in healthcare, food production, and sustainability.
Recommended Textbook
Concepts of Genetics 3rd Edition by Robert J. Brooker
Available Study Resources on Quizplus
24 Chapters
913 Verified Questions
913 Flashcards
Source URL: https://quizplus.com/study-set/2386
Page 2
Chapter 1: Overview of Genetics
Available Study Resources on Quizplus for this Chatper
28 Verified Questions
28 Flashcards
Source URL: https://quizplus.com/quiz/47400
Sample Questions
Q1) Performing a mating of two plants,one with a known genotype and the other with an unknown genotype,to determine the genotype of the individual with the unknown genotype would be an example what type of science?
A) discovery-based science
B) hypothesis testing
C) unethical experimentation
D) an impossible experiment
Answer: B
Q2) Genetic variation is ultimately based upon which of the following?
A) morphological differences
B) variations in nucleotide sequence of the DNA
C) carbohydrate content of the cell
D) translation
Answer: B
Q3) The basic unit of heredity is the ________.
A) individual
B) gene
C) macromolecule
D) trait
Answer: B
To view all questions and flashcards with answers, click on the resource link above. Page 3
Chapter 2: Reproduction and Chromosome Transmission
Available Study Resources on Quizplus for this Chatper
41 Verified Questions
41 Flashcards
Source URL: https://quizplus.com/quiz/47401
Sample Questions
Q1) The general purpose of the synaptonemal complex is to ________.
A) provide a link between homologous chromosomes in meiosis
B) enable the reformation of the cell wall during cytokinesis
C) separate the sister chromatids during anaphase
D) independently assort the chromosomes during metaphase of meiosis
Answer: A
Q2) Genes are physically located within ________.
A) chromosomes
B) centrosomes
C) kinetochores
D) microtubules
Answer: A
Q3) The process of binary fission is primarily used for asexual reproduction in ________.
A) prokaryotes
B) eukaryotes
Answer: A
To view all questions and flashcards with answers, click on the resource link above. Page 4
Chapter 3: Mendelian Inheritance
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/47402
Sample Questions
Q1) Mendel's data and the study of chromosomes and meiosis did not support the idea of ________,which is the belief that seeds are produced by all parts of the body and transmitted to the next generation.
A) the chromosome theory of inheritance
B) pangenesis
C) the blending theory of inheritance
D) the law of segregation
E) the law of independent assortment
Answer: B
Q2) What theory did Mendel's work with monohybrid crosses support?
A) blending theory of inheritance
B) particulate theory of inheritance
C) chromosomal theory of inheritance
D) pangenesis
Answer: B
Q3) The chi square test is used to prove that a hypothesis is correct.
A)True
B)False
Answer: False
To view all questions and flashcards with answers, click on the resource link above.
Page 5
Chapter 4: Sex Determination and Sex Chromosomes
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/47403
Sample Questions
Q1) A male that is produced from an unfertilized haploid egg is an example of what type of sex determination system?
A) X-Y
B) Z-W
C) X-O
D) haplo-diploid
Q2) With rare exceptions,a calico cat is likely to be female.
A)True
B)False
Q3) Dosage compensation offsets the problems associated with differences in the number of ________ chromosomes in many species.
A) sex
B) autosome
C) somatic
D) nuclear
Q4) Which of the following does not inactivate an X chromosome?
A) mammals
B) Drosophila
C) C. elegans
D) humans
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: Extensions of Mendelian Inheritance
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/47404
Sample Questions
Q1) In overdominance,the ________ genotype is beneficial over the ________ genotypes.
A) heterozygous; homozygous
B) homozygous; heterozygous
C) homozygous dominant; homozygous recessive
D) homozygous recessive; homozygous dominant
E) incomplete dominant; codominant
Q2) Polydactyly in humans is an example of ________.
A) simple Mendelian inheritance
B) incomplete dominance
C) incomplete penetrance
D) codominance
E) gene dosage
Q3) Genes that are not required for survival,but are likely to be beneficial to the organism,are called ________.
A) essential genes
B) lethal alleles
C) semilethal alleles
D) nonessential genes
E) conditional lethal alleles
To view all questions and flashcards with answers, click on the resource link above. Page 7
Chapter 6: Extranuclear Inheritance, Imprinting, and Maternal Effect
Available Study Resources on Quizplus for this Chatper
36 Verified Questions
36 Flashcards
Source URL: https://quizplus.com/quiz/47405
Sample Questions
Q1) What type of inheritance is observed with extranuclear DNA?
A) mendelian inheritance
B) sex-linked inheritance
C) paternal inheritance
D) Inheritance patterns are based on cytoplasmic inheritance.
Q2) G and g are dominant and recessive alleles,respectively,for a gene. If a mating of a gg female with a Gg male resulted in offspring that all have the recessive phenotype,this would most likely be an example of
A) a recessive lethal gene.
B) a maternal effect gene.
C) environmental influence on phenotype.
D) imprinting which results in silencing of the maternal alleles.
Q3) In maternal effect,the ________ of the mother determines the ________ of the offspring.
A) chloroplast; mitochondria
B) phenotype; genotype
C) genotype; phenotype
D) phenotype; sex
E) methylation; inheritance
Page 8
To view all questions and flashcards with answers, click on the resource link above.
Chapter 7: Genetic Linkage and Mapping in Eukaryotes
Available Study Resources on Quizplus for this Chatper
32 Verified Questions
32 Flashcards
Source URL: https://quizplus.com/quiz/47406
Sample Questions
Q1) In humans,there are ________ autosomal linkage groups,plus an X and Y chromosome linkage group.
A) 23
B) 46
C) 22
D) 92
Q2) A genetic linkage map indicates the precise distance between two genes of interest.
A)True
B)False
Q3) The individual who is credited with discovering genetic linkage in Drosophila is
A) Thomas Hunt Morgan
B) Gregor Mendel
C) Alfred Sturtevant
D) Barbara McClintock
Q4) A map unit or centiMorgan is equal to a 10% recombination frequency.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 9
Chapter 8: Variation in Chromosome Structure and
Number
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/47407
Sample Questions
Q1) The polytene chromosomes of Drosophila are an example of ________.
A) aneuploidy
B) polyploidy
C) translocations
D) inversion loops
E) None of these choices are correct.
Q2) Inversions represent a change in the total genetic material of a chromosome.
A)True
B)False
Q3) Chromosomes may be identified based on which of the following characteristics?
A) location of the centromere
B) banding patterns
C) size of the chromosome
D) All of these choices are correct.
Q4) Which human cells exhibit endopolyploidy?
A) sex cells
B) nerve cells
C) all somatic cells
D) liver cells
E) red blood cells
To view all questions and flashcards with answers, click on the resource link above. Page 10
Chapter 9: Genetics in Bacteria
Available Study Resources on Quizplus for this Chatper
44 Verified Questions
44 Flashcards
Source URL: https://quizplus.com/quiz/47408
Sample Questions
Q1) P1 phage can carry a piece of the chromosome that is 2 minutes in length.In a P1 phage transduction experiment,two genes have a cotransduction frequency of 0.68.Determine the distance between these two genes,assuming that pieces of chromosome are packaged randomly.
A) 0.68 = (1 - d/2)³
B) d = .68³ - 1
C) d = (1 - .68)²
Q2) A minute is the basic unit of map distance in bacteria.
A)True
B)False
Q3) The use of bacteriophages to map bacterial genes is called ________.
A) generalized transduction
B) cotransduction
C) transformation
D) conjugation
Q4) This form of DNA transfer uses a sex pilus to transfer the genetic material.
A) transformation
B) transduction
C) conjugation
D) fission
Page 11
To view all questions and flashcards with answers, click on the resource link above.
Chapter 10: Genetics of Viruses
Available Study Resources on Quizplus for this Chatper
11 Verified Questions
11 Flashcards
Source URL: https://quizplus.com/quiz/47409
Sample Questions
Q1) What is the genetic material in the parvovirus?
A) single-stranded DNA
B) double-stranded DNA
C) single-stranded RNA
D) double-stranded RNA
Q2) A bacteriophage that is physically integrated into the host chromosome is called a ________.
A) heteroduplex
B) envelope phage
C) prophage
D) plaque
Q3) A ________ frequently integrates into the host genome,forming prophages and utilizing a lysogenic cycle to manufacture new phages.
A) virulent phage
B) temperate phage
C) bacteria
D) eukaryotic cell
Q4) The genetic material of HIV is single-stranded RNA.
A)True
B)False
Page 12
To view all questions and flashcards with answers, click on the resource link above.
Chapter 11: Molecular Structure of DNA and RNA
Available Study Resources on Quizplus for this Chatper
38 Verified Questions
38 Flashcards
Source URL: https://quizplus.com/quiz/47410
Sample Questions
Q1) All nucleotides contain (check all that apply)
A) a phosphate group.
B) a five carbon sugar.
C) one of five nitrogenous bases.
D) a six-carbon sugar.
Q2) The idea that the adenine and thymine bases of the DNA interact in some manner was first proposed by ________.
A) Watson and Crick
B) Franklin
C) Pauling
D) Chargaff
Q3) The purine bases are ________.
A) cytosine, thymine, and uracil
B) adenine and guanine
C) adenine and thymine
D) cytosine and guanine
Q4) In the Hershey-Chase experiments,the protein coat of the bacteriophage was labeled with the ³²P radioisotope.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 13
Chapter 12: Molecular Structure of Chromosomes and Transposition
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/47411
Sample Questions
Q1) To date,there are no indications that transposable elements offer a selective advantage to a species.
A)True
B)False
Q2) Which of the following would introduce more twists into the DNA molecule of a bacterial cell?
A) negative supercoiling
B) positive supercoiling
C) chromatin remodeling
D) All of these choices are correct.
Q3) Where is the bacterial chromosome located?
A) nucleus
B) nucleolus
C) nucleoid
D) nuclear envelope
Q4) LINEs and SINEs together constitute over 30% of the human genome.
A)True
B)False
Page 14
To view all questions and flashcards with answers, click on the resource link above.
Chapter 13: Dna Replication and Recombination
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/47412
Sample Questions
Q1) DNA polymerase III has an error in replication once every 100 million nucleotides.
A)True
B)False
Q2) A primosome consists of a polymerase and a single-stranded binding protein.
A)True
B)False
Q3) How many origins of replication does a bacterial chromosome contain?
A) 0
B) 1
C) 10
D) Depends on the size of the DNA
Q4) Homologous recombination that leads to genetic diversity occurs during meiosis II.
A)True
B)False
Q5) The proofreading of the DNA occurs in the ________.
A) 5 to 3 direction
B) 3 to 5 direction
C) both directions
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: Gene Transcription and RNA Modification
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/47413
Sample Questions
Q1) In trying to distinguish between the two models of eukaryotic transcriptional termination,you identify a drug that specifically blocks exonuclease activity.When you add it at the appropriate time to an in vitro system that carries out all the stages of eukaryotic transcription,you find that transcription proceeds normally,but transcription doesn't terminate. This experiment provides support for which model of eukaryotic transcriptional termination?
A) Allosteric model
B) Torpedo model
C) Rho-dependent termination
D) Rho-independent termination
Q2) What process is important for the initiation of translation?
A) alternative splicing
B) RNA editing
C) 5' capping
D) base modification
Q3) Alternative splicing allows an organism to ________.
A) produce several different proteins from a single gene.
B) produce only one protein from a gene.
C) produce nonfunctional variants of proteins from a gene
To view all questions and flashcards with answers, click on the resource link above.
Page 16
Chapter 15: Translation of MRNA
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/47414
Sample Questions
Q1) The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.
A)True
B)False
Q2) How many amino acids are encoded by the following mRNA?
5 GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3
A) 8
B) 9
C) 10
D) 11
Q3) The scientist(s)________ studied Neurospora mutants that were altered in their nutritional requirements and hypothesized that one gene encodes one enzyme.
A) Garrod
B) Nirenberg and Matthaei
C) Khorana and colleagues
D) Nirenberg and Leder
E) Beadle and Tatum
Q4) The wobble base is the second base of a codon.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: Gene Regulation in Bacteria
Available Study Resources on Quizplus for this Chatper
37 Verified Questions
37 Flashcards
Source URL: https://quizplus.com/quiz/47415
Sample Questions
Q1) How many promoters are in an operon?
A) 1
B) 2
C) 3
D) It depends on how many genes there are in the operon.
Q2) cAMP is a small effector molecule.
A)True
B)False
Q3) Operons that code for anabolic enzyme systems are typically regulated by inducers.
A)True
B)False
Q4) A riboswitch is an RNA molecule that can exist in two different conformations.Conversion from one to another is due to the binding of a small molecule to the riboswitch.
A)True B)False
Q5) In the trp operon,tryptophan is a corepressor.
A)True B)False
To view all questions and flashcards with answers, click on the resource link above. Page 18
Chapter 17: Gene Regulation in Eukaryotes
Available Study Resources on Quizplus for this Chatper
55 Verified Questions
55 Flashcards
Source URL: https://quizplus.com/quiz/181990
Sample Questions
Q1) The differentially methylated region (DMR)is associated with which of the following?
A) X-chromosome inactivation
B) Genomic imprinting
C) Polycomb group (PcG) proteins
D) mRNA stability
E) All of the answers are correct.
Q2) Activator proteins bind to silencer sequences and repressor proteins bind to enhancer sequences.
A)True
B)False
Q3) Where is the IRE located in the ferritin gene?
A) 5 end of DNA
B) 5 end of mRNA
C) 3 end of DNA
D) 3 end of mRNA
Q4) Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Non-Coding Rnas
Available Study Resources on Quizplus for this Chatper
24 Verified Questions
24 Flashcards
Source URL: https://quizplus.com/quiz/181991
Sample Questions
Q1) What is the make up of the bacterial and eukaryotic SRP,respectively?
A) Bacterial: 1 ncRNA, 1 protein; Eukaryotic: 1 ncRNA, 6 proteins
B) Bacterial: 1 ncRNA, 1 protein; Eukaryotic: 6 ncRNAs, 1 protein
C) Bacterial: 1 ncRNA, 6 proteins; Eukaryotic: 1 ncRNA, 6 proteins
D) Bacterial: 6 ncRNAs, 1 protein; Eukaryotic: 1 ncRNA, 1 protein
Q2) Ribozymes are RNA molecules with what type of activity?
A) Catalytic
B) Binding
C) Protease
D) Decoy
Q3) You are working in a lab that studies ncRNAs.You develop an assay to isolate ncRNAs and any associated molecules.You must then identify the molecules you have isolated.You find a molecule that is associated with an ncRNA that is not changed by protease,RNase,or DNase.The associated molecule is most likely
A) a small molecule.
B) a protein.
C) an mRNA.
D) DNA.
To view all questions and flashcards with answers, click on the resource link above.
Page 20
Chapter 19: Gene Mutation and DNA Repair
Available Study Resources on Quizplus for this Chatper
43 Verified Questions
43 Flashcards
Source URL: https://quizplus.com/quiz/47418
Sample Questions
Q1) Which environmental agent shown can induce mutations?
A) UV radiation
B) x-rays
C) gamma rays
D) All of the answers are correct.
Q2) How does position effect influence gene expression?
A) The movement of the genetic material on the chromosome by inversions or translocations may place a coding sequence near a new regulatory region, thus activating the expression of the gene.
B) The movement of the gene may place it into a region that is highly condensed.
C) The movement of a gene may remove it from its normal promoter, thus silencing the gene.
D) All of the answers are correct.
Q3) In the nucleotide excision repair system,which of the following proteins is responsible for recognizing a thymine dimer to be repaired?
A) UvrA/UvrB
B) UvrC
C) UvrD
D) None of the answers are correct.
To view all questions and flashcards with answers, click on the resource link above. Page 21
Chapter 20: Molecular Technologies
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/47419
Sample Questions
Q1) What is the origin of restriction endonucleases?
A) They are part of DNA repair mechanisms in eukaryotic cells.
B) They are a defense mechanism against viruses in bacteria.
C) They are replication enzymes of yeast.
D) They are transposable elements of Drosophila.
Q2) An organism that can be regenerated from somatic cells is called multipotent.
A)True
B)False
Q3) What is a property of stem cells?
A) They can differentiate into one or more specialized cell types.
B) They can form any tissue in the body.
C) They are only capable of one to two cell divisions.
D) They will only form hematopoietic cells.
Q4) Site-directed mutagenesis allows researchers to produce a mutation at a ________ within a cloned DNA segment.
A) specific site
B) random site
C) semilocalized site that can later be identified by sequencing
To view all questions and flashcards with answers, click on the resource link above. Page 22
Chapter 21: Genomics
Available Study Resources on Quizplus for this Chatper
34 Verified Questions
34 Flashcards
Source URL: https://quizplus.com/quiz/47420
Sample Questions
Q1) To identify novel DNA binding sites for a protein,it would be best to use ________.
A) pyrosequencing
B) microsatellites
C) chromatin immunoprecipitation
D) ChIP-chip
Q2) The human genome consists of approximately ________ base pairs of DNA.
A) 100,000
B) 1 million
C) 1 billion
D) 3 billion
E) 2 trillion
Q3) Which of the following procedures best determines the relative order,but not precise location,of a series of genes on a chromosome?
A) physical mapping
B) cytogenetic mapping
C) linkage mapping
D) shotgun sequencing
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Medical Genetics and Cancer
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/47421
Sample Questions
Q1) The term that indicates that cancer has begun to migrate to other parts of the body is ________.
A) malignant
B) benign
C) metastatic
D) invasive
E) clonal
Q2) In a disease that has a single gene,the concordance among monozygotic twins should be
A) 0%.
B) 25%.
C) 50%.
D) 75%.
E) 100%.
Q3) The term for the use of information about a person's genotype and other clinical data in order to select a medication is referred to as
A) best medical practices.
B) molecular profiling.
C) personalized medicine.
D) minimalized drug therapy.
To view all questions and flashcards with answers, click on the resource link above. Page 24
Chapter 23: Population Genetics
Available Study Resources on Quizplus for this Chatper
39 Verified Questions
39 Flashcards
Source URL: https://quizplus.com/quiz/47422
Sample Questions
Q1) The term for the mating for two genetically unrelated individuals is A) outbreeding.
B) inbreeding.
C) disassortative mating.
D) assertive mating.
Q2) Which of the following types of selection creates two phenotypic classes from a single original distribution?
A) disruptive selection
B) stabilizing selection
C) directional selection
D) balancing selection
Q3) Migration of a random few individuals from one population to a new area to establish a new population is an example of
A) bottleneck effect.
B) mutation.
C) founder effect.
D) selection.
Q4) Most natural populations are in Hardy-Weinberg equilibrium.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 25
Chapter 24: Quantitative Genetics
Available Study Resources on Quizplus for this Chatper
33 Verified Questions
33 Flashcards
Source URL: https://quizplus.com/quiz/47423
Sample Questions
Q1) Heritability values can be compared between populations if there is variation in the environmental conditions.
A)True
B)False
Q2) Which of the following is incorrect concerning quantitative traits?
A) Individuals fall into distinct classes for comparison.
B) The phenotypic variation for the trait is continuous.
C) The frequency distribution follows a bell-shaped curve.
D) All of these choices are correct.
Q3) When analyzing two variables,the strength of the association between the variables is called the ________.
A) covariance
B) standard deviation
C) correlation coefficient
D) variance
Q4) The variance is the sum of the standard deviation from the mean divided by the degrees of freedom.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 26