Biotechnology Exam Review
Course Introduction
Biotechnology is an interdisciplinary field that harnesses biological processes, organisms, cells, and cellular components to develop innovative products and technologies for applications in medicine, agriculture, industry, and environmental management. This course explores the fundamental principles of genetic engineering, molecular biology, and bioprocessing, emphasizing techniques such as DNA manipulation, gene cloning, and recombinant protein production. Students will examine the ethical, legal, and social implications of biotechnological advancements, while gaining practical experience through laboratory exercises and case studies focused on real-world applications such as pharmaceuticals, crop improvement, biofuels, and environmental remediation.
Recommended Textbook
Human Genetics 10th Edition by Ricki Lewis
Available Study Resources on Quizplus 22 Chapters
1034 Verified Questions
1034 Flashcards
Source URL: https://quizplus.com/study-set/3104
Page 2
Chapter 1: What Is in a Human Genome
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61516
Sample Questions
Q1) A trait or disorder that is multifactorial is
A)present in more than one family member.
B)found only in one part of the world.
C)caused by one or more genes and environmental influences.
D)caused by a single gene,with no environmental input.
Answer: C
Q2) During DNA replication,to produce protein,a process called transcription copies the sequence of part of one strand of a DNA molecule into a related molecule,known as _____.
A)genes.
B)mRNAs.
C)proteins.
D)genomes.
Answer: B
Q3) Humans have _____ pairs of chromosomes.
A)23
B)38 C)46
D)32
Answer: A
To view all questions and flashcards with answers, click on the resource link above. Page 3
Chapter 2: Cells
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61515
Sample Questions
Q1) Organelles protect a cell by
A)sequestering biochemicals that could dismantle other cellular structures.
B)forming a thick outer barrier.
C)containing powerful enzymes that kill any bacteria that enter.
D)placing flag-like molecules on a cell's surface,which identify that cell as belonging to a particular person.
Answer: A
Q2) A type of vesicle that ferries molecules,such as cholesterol,to lysosomes is an A)endosome.
B)episome.
C)oprahsome.
D)ectosome.
Answer: A
Q3) The nuclear lamina is
A)the sac that holds the genetic material.
B)part of the nucleus that holds RNA.
C)a fibrous layer that lines the inner face of the nuclear membrane.
D)the site of protein synthesis.
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
Page 4
Chapter 3: Meiosis,Development and Aging
Available Study Resources on Quizplus for this Chatper
73 Verified Questions
73 Flashcards
Source URL: https://quizplus.com/quiz/61514
Sample Questions
Q1) Which of the following characteristics of the fetus distinguishes it from the embryo?
A)Blood cells form and fill primitive blood vessels.
B)The primitive streak appears.
C)Bone replaces the softer cartilage.
D)The specialization of one group of cells causes adjacent groups of cells to specialize.
Answer: C
Q2) A blastomere is a _____ and a blastocyst is _____.
A)fetal organ produced by cleavage;an embryonic organ produced by cleavage
B)fetal membrane;an embryonic membrane
C)cell produced by cleavage;a hollow ball of cells
D)solid ball of cells;three-layered embryo
Answer: C
Q3) Meiosis is necessary because otherwise
A)the fertilized ovum will have too much genetic material.
B)the fertilized ovum will have too little genetic material.
C)reproduction would have to be asexual.
D)too many mutations will occur.
Answer: A
To view all questions and flashcards with answers, click on the resource link above. Page 5
Chapter 4: Single-Gene Inheritance
Available Study Resources on Quizplus for this Chatper
43 Verified Questions
43 Flashcards
Source URL: https://quizplus.com/quiz/61513
Sample Questions
Q1) In a family that starts with you,your grandchildren would be the _____ generation.
A)P<sub>1</sub>
B)P<sub>2</sub>
C)F<sub>1</sub>
D)F<sub>2</sub>
Q2) In the Foofnagle family,the trait of being able to yodel affects members of both sexes in every generation.This trait could be
A)autosomal recessive or autosomal dominant.
B)autosomal dominant but not autosomal recessive.
C)conclusive or inconclusive.
D)caused by something in the environment and not inherited at all.
Q3) Alleles are
A)alternate forms of a gene.
B)genes near each other on a chromosome.
C)genes at opposite ends of a chromosome.
D)genes that are only in pea plants.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 5: Beyond Mendels Laws
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/61512
Sample Questions
Q1) The mitochondrial genome consists of _____ genes.
A)12
B)37
C)250
D)370
Q2) Zuzu is a white cat.She is genotype Ww for the "white masking gene" that reduces the number of melanocytes (pigment-containing cells).As a result,her body makes pigment,but it cannot get into the cells where it would color the fur.Zuzu's white masking gene is _____ to the melanin pigment gene because it prevents full expression of the pigment.
A)recessive
B)pleiotropic
C)epistatic
D)dominant
Q3) Mitochondrial disorders tend to cause great fatigue because
A)nerve cells are filled with mitochondriA.
B)muscle cells are normally filled with mitochondria.
C)affected cells do not use their mitochondrial DNA.
D)lysosomes dismantle the mitochondria in muscle cells.
To view all questions and flashcards with answers, click on the resource link above.
Page 7
Chapter 6: Matters of Sex
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61511
Sample Questions
Q1) Imprinting affects the phenotype when
A)both alleles of a gene are imprinted.
B)both alleles of a gene are inactivated or deleted.
C)one allele is imprinted and the other is inactivated or deleted.
D)an embryo arises from two female genomes or two male genomes.
Q2) The probability that a boy whose mother is heterozygous for an X-linked trait inherits the recessive allele is
A)1/16.
B)1/8.
C)1/4.
D)1/2.
Q3) A carrier of an X-linked recessive trait who expresses the phenotype is called a(n)
A)manifesting homozygote.
B)manifesting mutant.
C)manifesting heterozygote.
D)imprinting heterozygote.
To view all questions and flashcards with answers, click on the resource link above.
8
Chapter 7: Multifactorial Traits
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61510
Sample Questions
Q1) Empiric risk is based on _____,which is the _____.
A)prevalence;rate at which a certain event occurs
B)incidence;rate at which a certain event occurs
C)prevalence;proportion of individuals in a population with a particular disorder at a specific time
D)incidence;proportion of individuals in a population with a particular disorder at a specific time
Q2) Concordance refers to
A)percentage of monozygotic twin pairs in which neither express the trait.
B)percentage of monozygotic twin pairs in which both express the trait.
C)percentage of dizygotic twin pairs in which both express the trait.
D)percentage of twin pairs in which both express a trait among pairs in which at least one twin has the trait.
Q3) Skin color is not a good way to distinguish "races" of people because
A)it can be changed by environmental factors.
B)it is but one of many traits that vary within and between human populations.
C)it is not inherited.
D)it changes over a person's lifetime.
To view all questions and flashcards with answers, click on the resource link above. Page 9
Chapter 8: Genetics of Behavior
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61509
Sample Questions
Q1) The heritability of autism is _____ percent.
A)10
B)25
C)55
D)90
Q2) A person with narcolepsy may experience
A)cataplexy,in which he or she suddenly collapses.
B)dogaplexy,in which he or she suddenly collapses.
C)inability to sleep.
D)excessive REM sleep.
Q3) Early symptoms of schizophrenia affect A)thinking.
B)hearing.
C)vision.
D)aggression.
Q4) The part of the human brain that controls the sleep-wake cycle is called the A)nucleolus.
B)cerebral cortex.
C)suprachiasmatic nuclei.
D)substantia nigra.
Page 10
To view all questions and flashcards with answers, click on the resource link above.
Chapter 9: DNA Structure and Replication
Available Study Resources on Quizplus for this Chatper
54 Verified Questions
54 Flashcards
Source URL: https://quizplus.com/quiz/61508
Sample Questions
Q1) _____ incorrectly suggested that DNA has a triple helix structure.
A)Linus Pauling
B)James Watson and Francis Crick
C)Maclyn McCarty
D)Rosalind Franklin
Q2) Which of the following were part of the experiments of Hershey and Chase?
A)Mice were injected with type R bacteria and developed pneumoniA.
B)Mice were injected with type S bacteria and developed pneumonia.
C)DNA isolated from type S bacteria killed by heating transformed type R bacteria.
D)E.coli bacteria were infected with virus labeled with radioactive phosphorus.
Q3) Chargaff showed that DNA that has 20% guanine has _____ cytosine.
A)20%
B)30%
C)60%
D)40%
Q4) Next-generation sequencing reads millions of sequences at once,and so the general approach is also called "massively parallel DNA sequencing."
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 11
Chapter 10: Gene Action: From DNA to Protein
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/61507
Sample Questions
Q1) A signal sequence
A)directs RNA nucleotides to a particular gene.
B)attracts tRNAs to an mRNA.
C)is the first part of a protein's amino acid sequence that helps to direct it to a certain part of the cell.
D)is a coding codon that mutates into a stop codon.
Q2) Transcription factors function in the expression of genes by
A)initiating transcription.
B)associating to initiate translation.
C)turning transcription of specific genes on or off.
D)halting the activity of RNA polymerase at the end of transcription.
Q3) In transcription,the promoter is
A)an enzyme that binds DNA.
B)a series of proteins that collectively bind to DNA.
C)a recognition sequence in RNA that attracts ribosomes.
D)A DNA sequence that RNA polymerase binds.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 11: Gene Expression and Epigenetics
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61506
Sample Questions
Q1) Histone proteins
A)are male sex hormones.
B)are inert spool-like structural supports around which DNA winds.
C)control gene expression through chemical interactions that expose parts of the DNA to transcription factors,while shielding other parts.
D)bind to mRNAs,preventing their translation into protein.
Q2) "Epigenetic" means
A)"inside the gene."
B)"inside the protein."
C)"outside the gene."
D)"outside the protein."
Q3) Which metaphors correctly compare chromatin remodeling and microRNA function?
A)A hammer and a nail
B)An on/off switch and a dimmer switch
C)An elevator and a submarine
D)An activator and a repressor
Q4) The "methylome" is the collection of all the methylated sites in the genome.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 13
Chapter 12: Gene Mutation
Available Study Resources on Quizplus for this Chatper
56 Verified Questions
56 Flashcards
Source URL: https://quizplus.com/quiz/61505
Sample Questions
Q1) A mutation that changes the codon GAA to UAA is a _____ mutation.
A)missense
B)nonsense
C)frameshift
D)truncation
Q2) A mutation that changes the third position in a CUU codon to a C would
A)result in a frameshift mutation.
B)shorten the protein.
C)have no effect on the protein.
D)also change the first two positions.
Q3) A somatic mutation
A)occurs only in microbes.
B)affects a particular subset of cells.
C)affects all cells of an individual.
D)is expressed only in embryos.
Q4) A source of gamma radiation is
A)plutonium and cesium isotopes.
B)alpha and beta globin.
C)uranium and radium.
D)carbon-14 and strontium-70.
14
To view all questions and flashcards with answers, click on the resource link above.
Chapter 13: Chromosomes
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/61504
Sample Questions
Q1) A chromosome consists of
A)mostly protein and RNA with a small amount of DNA.
B)mostly DNA and proteins with a small amount of RNA.
C)about equal proportions of DNA,RNA,and protein.
D)DNA only.
Q2) Aneuploidy may occur in some cells of an individual if nondisjunction happens in
A)an early embryo.
B)a sperm cell.
C)an oocyte.
D)a polar body.
Q3) Spindle fibers (microtubules)attach to a chromosome's _____ during mitosis.
A)centromere
B)telomere
C)genomere
D)euchromatin
Q4) A man with trisomy 21 could pass Down syndrome to offspring if he
A)produces sperm that have two copies of chromosome 21.
B)produces sperm lacking chromosome 21.
C)also has Turner syndrome.
D)is a carrier of a deletion for chromosome 21.
Page 15
To view all questions and flashcards with answers, click on the resource link above.
Chapter 14: Constant Allele Frequencies
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61503
Sample Questions
Q1) The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q2) Familial DNA searches are controversial since innocent people may be accused based on sharing CODIS markers with convicted felons.
A)True
B)False
Q3) Which of the following would not alter a gene's frequency in a population?
A)mutation
B)migration
C)random mating
D)inbreeding
Q4) A series of markers have the following frequencies.Which would be the most useful for DNA profiling?
A)1/60
B)1/5200
C)1/500
D)1/40
Page 16
To view all questions and flashcards with answers, click on the resource link above.
Chapter 15: Changing Allele Frequencies
Available Study Resources on Quizplus for this Chatper
39 Verified Questions
39 Flashcards
Source URL: https://quizplus.com/quiz/61502
Sample Questions
Q1) The population of HIV variants in a person's body changes during the course of infection due to
A)natural selection.
B)mutation.
C)migration.
D)genetic drift.
Q2) A typhoon devastates a population on "island A" and only a few individuals survive.Several generations later,the replenished population suffers from several inherited disorders that are very rare in other groups.A genetic event that explains this is
A)a population bottleneck.
B)genetic load.
C)a founder effect.
D)natural selection.
Q3) In _____,people with a serious genetic disorder are not permitted to have children.
A)the United States
B)England
C)China
D)Russia
To view all questions and flashcards with answers, click on the resource link above.
17
Chapter 16: Human Ancestry and Evolution
Available Study Resources on Quizplus for this Chatper
44 Verified Questions
44 Flashcards
Source URL: https://quizplus.com/quiz/61501
Sample Questions
Q1) About 4 million years ago,_____ left the African forest to dwell in the grasslands.
A)Dryopithecus
B)Aegyptopithecus
C)Australopithecus
D)Propliopithecus
Q2) Haplogroups consist of
A)sets of species that share a recent ancestor.
B)the set of Y chromosomes in a population.
C)groups of SNPs that are linked on a chromosome.
D)preserved gametes,which are haploiD.
Q3) Comparison of common chromosomal banding patterns between humans and 5 other species are given below.Based on these data,humans are least related to A)gorillas: 99% common chromosome bands.
B)African green monkeys: 95% common chromosome bands.
C)domestic cats: 35% common chromosome bands.
D)mice: 7% common chromosome bands.
Q4) Nariokotome Boy was one of the first H.erectus individuals described.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 18
Chapter 17: Genetics of Immunity
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/61500
Sample Questions
Q1) The constant region of an antibody molecule is
A)the binding site for antigens.
B)part of the heavy chains only.
C)the same in all antibodies of a certain type.
D)the binding site for two antigens.
Q2) Identifying combinations of _____ alleles is useful in tissue typing,establishing identity,and estimating disease risk.
A)HIV
B)HLA
C)antibody
D)erythrocyte
Q3) In a less severe form of combined immune deficiency,the individual
A)has normal numbers of T and B cells.
B)has no white blood cells.
C)has some T cells but lacks B cells.
D)lacks both T and B cells.
Q4) Experimental gene therapy can be used to treat a form of severe combined immune deficiency,SCID-X1.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Cancer Genetics and Genomics
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/61499
Sample Questions
Q1) A _____ mutation is one that is present in every cell of an individual,including gametes.
A)somatic
B)sporadic
C)germline
D)benign
Q2) The connection between stem cells and cancer is that
A)all stem cells are also cancer cells.
B)cells may become cancerous by expressing "stemness" genes.
C)stem cells rescue cells that have become cancerous.
D)both stem cells and cancer cells have inactivated telomerase.
Q3) Which of these are thought to have anti-cancer benefits?
A)Heterocyclic aromatic amines (HAs)
B)Cruciferous vegetables such as broccoli
C)Red meats
D)Baked potatoes
Q4) Invasive malignant tumors typically contain mutations that affect the cytoskeleton and allow the cell to move from where it is anchored.
A)True
B)False
20
To view all questions and flashcards with answers, click on the resource link above.
Chapter
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61498
Sample Questions
Q1) One of the science-related concerns associated with the use of genetically modified (GM)foods is that
A)overreliance on GM crops may lead to genetic uniformity.
B)GM foods are not natural.
C)genetic modification degrades the nutritional value of food crops.
D)buffer zones of GM crops halt the pollination of non-GM crops.
Q2) Restriction enzymes are useful in creating recombinant DNA molecules because they
A)generate "sticky ends" by cutting at the same sequence in any DNA source.
B)are found only in human cells,where they naturally mend broken DNA strands.
C)are used to encapsulate and transport foreign DNA into cells of the target organism.
D)stimulate DNA amplification so that the desired cells or their products can be scaled up.
Q3) In 2010,a federal judge in the U.S.ruled seven patents on the BRCA1 and BRCA2 genes had been improperly granted.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
Page 21
Chapter 20: Genetic Testing and Treatment
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61497
Sample Questions
Q1) Unlike cholesterol checks and chest x-rays,the results of genetic tests may have repercussions to family members who share genotypes that can affect health
A)True
B)False
Q2) Newborn screening using mass spectrometry identifies certain single-gene disorders by detecting
A)the causative mutation.
B)the wild type gene sequence.
C)an unusual metabolite or metabolic imbalance.
D)abnormal proteins in urine.
Q3) Nondirective genetic counseling
A)does not accept health insurance.
B)does not deal with disorders carried on the sex chromosomes.
C)considers diseases caused by genes that are located throughout the genome.
D)offers options but not opinions.
Q4) "Patients-in-waiting" are false positives whose newborn screening reveals disease markers,but never develop the predicted symptoms.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 22
Chapter 21: Reproductive Technologies
Available Study Resources on Quizplus for this Chatper
41 Verified Questions
41 Flashcards
Source URL: https://quizplus.com/quiz/61496
Sample Questions
Q1) A lesbian couple may use intrauterine insemination (IUI)to have a child.
A)True
B)False
Q2) A procedure that places an oocyte and sperm in a culture dish,allows a few cell divisions,and then places the resulting very early embryo in the oocyte donor's uterus is A)IVF.
B)intrauterine insemination.
C)surrogate insemination.
D)GIFT.
Q3) Antibodies from the male that coat the sperm may impair fertility by
A)preventing sperm binding to oocytes.
B)stretching out the acrosome until the sperm cell bursts.
C)causing point mutations in the male genome.
D)inducing an autoimmune reaction in the female.
Q4) Infertility and spontaneous abortion increase with age primarily due to A)uterine fibroids.
B)endometriosis.
C)highly acidic or basic vaginal secretions.
D)higher production of oocytes with abnormal chromosome numbers.
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Genomics
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61495
Sample Questions
Q1) Whole-genome shotgunning is faster,but it misses some sections that the clone-by-clone method detects.
A)True
B)False
Q2) Sequencing of the first three human genomes revealed that the percent of our SNPs likely to influence our phenotypes is
A)0 percent.
B)<1 percent.
C)about 2 percent.
D)about 10 percent.
Q3) The term genome was first used by
A)H.Winkler in 1920.
B)Francis Crick in 1962.
C)Francis Collins in 1992.
D)J.Craig Venter in 1990.
Q4) _____ was the first organism to have its entire genome sequenced.
A)The fruit fly
B)E.coli
C)Haemophilus influenzae
D)Mycoplasma genitalium
Page 24
To view all questions and flashcards with answers, click on the resource link above.