Biology of Human Disease Exam Questions
Course Introduction
Biology of Human Disease explores the molecular, cellular, and physiological mechanisms underlying major human diseases, including infectious, genetic, metabolic, and degenerative disorders. The course examines how disruptions in normal biological processes lead to the development and progression of disease, highlighting the roles of genetics, immune response, and environmental factors. Students will gain insights into the scientific basis of disease diagnosis, treatment strategies, and prevention, with a focus on current research and emerging therapies in human health.
Recommended Textbook
Human Genetics 10th Edition by Ricki Lewis
Available Study Resources on Quizplus
22 Chapters
1034 Verified Questions
1034 Flashcards
Source URL: https://quizplus.com/study-set/3104
2
Chapter 1: What Is in a Human Genome
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61516
Sample Questions
Q1) The number of copies of our genome in most of our cells is _____.
A)1
B)2
C)3
D)4
Answer: B
Q2) One way that single-gene diseases differ from other diseases is that
A)they affect consecutive generations.
B)they occur at the same frequency in every population.
C)they are not treatable.
D)it is possible to predict occurrence in specific relatives.
Answer: D
Q3) The difference between phenotype and genotype is that
A)phenotype refers to the genetic instructions and genotype to their expression.
B)genotype refers to the genetic instructions and phenotype to their expression.
C)the phenotype is RNA and the genotype is DNA.
D)the phenotype is DNA and the genotype is RNA.
Answer: B
To view all questions and flashcards with answers, click on the resource link above.
3
Chapter 2: Cells
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61515
Sample Questions
Q1) A molecule that binds a cell surface receptor is called a A)peroxisome.
B)nucleic acid.
C)ligand.
D)nuclear pore.
Answer: C
Q2) Factors that control how often a cell divides include
A)telomere lengths,hormonal signals,crowding,and growth factors.
B)which chromosomes are active and which are not.
C)the activity level of the person,diet,and environmental exposures.
D)where chromosomes are located within the nucleus.
Answer: A
Q3) Humans belong to domain _____,which is distinguished by cells that have _____.
A)Prokarya;organelles
B)Archaea;ancient organelles
C)Eukarya;organelles
D)Prokarya;proteins
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
4
Chapter 3: Meiosis,Development and Aging
Available Study Resources on Quizplus for this Chatper
73 Verified Questions
73 Flashcards
Source URL: https://quizplus.com/quiz/61514
Sample Questions
Q1) The partial twinning that led to the births of conjoined twins Abby and Brittany Hensel must have happened during the first two weeks of gestation,because the girls
A)share tissues that descend from ectoderm,endoderm,and mesoderm.
B)share only tissues derived from mesoderm.
C)were born on time.
D)have two separate nervous systems.
Answer: A
Q2) An embryo develops rudiments of all organs by week _____ of prenatal development.
A)8
B)4
C)6
D)3
Answer: A
To view all questions and flashcards with answers, click on the resource link above.
5
Chapter 4: Single-Gene Inheritance
Available Study Resources on Quizplus for this Chatper
43 Verified Questions
43 Flashcards
Source URL: https://quizplus.com/quiz/61513
Sample Questions
Q1) The difference in mode of inheritance between Huntington disease and cystic fibrosis is that
A)Huntington disease skips generations and only affects children,whereas cystic fibrosis can strike at any age and never skips generations.
B)Huntington disease does not skip generations but cystic fibrosis can.
C)A person with Huntington disease can have unaffected parents,but a person with cystic fibrosis must have an affected parent.
D)Huntington disease affects females and cystic fibrosis affects males.
Q2) Mode of inheritance reflects
A)whether a gene is on an autosome or sex chromosome and whether the allele is recessive or dominant.
B)whether the allele is transmitted from the male or the female.
C)the number of genes that determine a trait.
D)the size of the chromosome that includes the gene in question and the sex of the parent transmitting it.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 5: Beyond Mendels Laws
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/61512
Sample Questions
Q1) A popular research technique used to associate patterns of genetic variation with phenotypes that is based on the concept of linkage,but considering all of the chromosomes at once,is
A)gene expression profiling.
B)genome sequencing.
C)genome-wide association studies.
D)assisted reproductive technologies.
Q2) Types of genetic markers include
A)places in the genome where a base varies among individuals in a population.
B)places in the genome where all people have identical base sequences.
C)the types of mRNAs in a cell.
D)the proteins produced in a cell.
Q3) The alleles that control which A,B blood group antigens appear on the surfaces of red blood cells are
A)incompletely dominant.
B)variably expressed.
C)codominant.
D)semidominant.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 6: Matters of Sex
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61511
Sample Questions
Q1) X-linked dominant traits are typically expressed
A)much more severely in females because they have two X chromosomes.
B)much more severely in males because they have two Y chromosomes.
C)much more severely in males because they have only one X chromosome.
D)only if X-linked recessive conditions with similar symptoms are also inheriteD.
Q2) Human males are the _____ sex.
A)homozygous
B)homogametic
C)heterogametic
D)heterozygous
Q3) Prader-Willi and Angelman syndromes both arise from the same area of chromosome 15,illustrating
A)epistasis.
B)X inactivation.
C)genomic imprinting.
D)behavior modification.
To view all questions and flashcards with answers, click on the resource link above.
Page 8
Chapter 7: Multifactorial Traits
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61510
Sample Questions
Q1) A brother and sister share _____ percent of their genes.
A)10
B)25
C)50
D)100
Q2) The number of genes that affect skin,hair,and eye color is
A)less than 4.
B)less than 8.
C)more than 20,000.
D)more than 100.
Q3) Fingerprint pattern is inherited,but also affected by the environment.An example of how the environment naturally can alter fingerprint pattern is
A)a criminal taking off the fingertip skin with acid.
B)a fetus touching the developing toe and finger pads to the wall of the amniotic sac.
C)a person developing skin disorders.
D)the fingertips rubbing away from too much computer use.
To view all questions and flashcards with answers, click on the resource link above. Page 9
Chapter 8: Genetics of Behavior
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/61509
Sample Questions
Q1) A person with narcolepsy may experience
A)cataplexy,in which he or she suddenly collapses.
B)dogaplexy,in which he or she suddenly collapses.
C)inability to sleep.
D)excessive REM sleep.
Q2) In the 1980s,when researchers began seeking gene variants that caused or contributed to bipolar disorder,it seemed that each extended family had its own mutations.These findings,looking back,most likely mean that A)bipolar disorder results from imitating the behavior of an affected family member.
B)many gene variant combinations cause or contribute to bipolar disorder,but only a few such variants are seen in any one family.
C)many people fake the symptoms of bipolar disorder.
D)bipolar disorder reflects changes in gene expression,but not in mutations.
Q3) The first narcolepsy gene was discovered in A)bats.
B)cockroaches.
C)hippos.
D)dogs.
To view all questions and flashcards with answers, click on the resource link above. Page 10
Chapter 9: DNA Structure and Replication
Available Study Resources on Quizplus for this Chatper
54 Verified Questions
54 Flashcards
Source URL: https://quizplus.com/quiz/61508
Sample Questions
Q1) Polymerase chain reaction requires _____,a DNA polymerase from a bacterium that lives in hot springs.
A)Taql
B)telomerase
C)T7 DNA polymerase
D)Pol III
Q2) _____ incorrectly suggested that DNA has a triple helix structure.
A)Linus Pauling
B)James Watson and Francis Crick
C)Maclyn McCarty
D)Rosalind Franklin
Q3) The first and best-known DNA amplification technique is _____.
A)the polymerase chain reaction
B)Okazaki synthesis
C)Sanger sequencing
D)next-generation sequencing
To view all questions and flashcards with answers, click on the resource link above.
Chapter 10: Gene Action: From DNA to Protein
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/61507
Sample Questions
Q1) Ribosomal RNAs
A)are translated from DNA.
B)are synthesized by ribosomes.
C)connect codons to amino acids.
D)associates with proteins to form ribosomes.
Q2) In transcription,one DNA strand is transcribed into a(n)_____ RNA strand,which is translated into protein.
A)ribosomal
B)transfer
C)messenger
D)anticodon
Q3) After transcription and before translation,eukaryotic mRNA is modified by adding A)tRNAs and amino acids.
B)amino acids and a poly-A tail.
C)a cap of modified nucleotides and a poly-A tail.
D)an AUG at one end and a poly-U tail at the other.
To view all questions and flashcards with answers, click on the resource link above. Page 12
Chapter 11: Gene Expression and Epigenetics
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61506
Sample Questions
Q1) A treatment for some forms of anemia is to take a drug that turns on transcription of fetal hemoglobin.This would increase the proportion of _____ globin chains.
A)alpha
B)gamma
C)delta
D)epsilon
Q2) The most important chemical group that determines how tightly histones bind DNA is
A)acetyl.
B)methyl.
C)ethyl.
D)phosphate.
Q3) Histone proteins
A)are male sex hormones.
B)are inert spool-like structural supports around which DNA winds.
C)control gene expression through chemical interactions that expose parts of the DNA to transcription factors,while shielding other parts.
D)bind to mRNAs,preventing their translation into protein.
To view all questions and flashcards with answers, click on the resource link above. Page 13
Chapter 12: Gene Mutation
Available Study Resources on Quizplus for this Chatper
56 Verified Questions
56 Flashcards
Source URL: https://quizplus.com/quiz/61505
Sample Questions
Q1) Sanjay and Indira have thalassemia minor.Their young daughters are dizygotic (fraternal)twins.Malonie has thalassemia minor like her parents,but Jewel has the more severe thalassemia major.The more serious case most likely arose because
A)Jewel inherited two wild type alleles from her carrier parents.
B)Jewel inherited a dominant form of the condition.
C)Jewel inherited two recessive mutant alleles in the beta globin gene that cause thalassemia.
D)Jewel also has sickle cell disease.
Q2) Palindrome sequences are often found at mutation hotspots.Which of the following is a palindrome?
A)AAAATTTT
B)ATATGCGC
C)GATCCTAG
D)GATCGATC
Q3) Ionizing radiation alters DNA by A)deleting bases.
B)removing nitrogen from the bases.
C)breaking the sugar-phosphate backbone.
D)reversing replication forks.
To view all questions and flashcards with answers, click on the resource link above.
Page 14
Chapter 13: Chromosomes
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/61504
Sample Questions
Q1) A chromosome that results when the centromere splits in the wrong plane during meiosis,forming identical arms,is a(n)
A)ring chromosome.
B)metachromosome.
C)parachromosome.
D)isochromosome.
Q2) People with Turner syndrome have _____ chromosome constitution.
A)XX
B)XXY
C)XO
D)XXX
Q3) The type of chromosome abnormality that yields a long chromosome consisting of most of two acrocentric chromosomes is a(n)
A)Robertsonian translocation.
B)pericentric inversion.
C)paracentric inverson.
D)reciprocal translocation.
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: Constant Allele Frequencies
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61503
Sample Questions
Q1) Which of the following have the longest DNA sequences?
A)VNTRs
B)STRs
C)Thymine dimers
D)Base pairs
Q2) VNTRs and STRs differ in that
A)a VNTR repeat is shorter than an STR repeat.
B)a VNTR repeat is longer than an STR repeat.
C)a VNTR is a type of copy number variant and an STR is not.
D)an STR is a type of copy number variant and a VNTR is not.
Q3) The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q4) Familial DNA searches are controversial since innocent people may be accused based on sharing CODIS markers with convicted felons.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 16
Chapter 15: Changing Allele Frequencies
Available Study Resources on Quizplus for this Chatper
39 Verified Questions
39 Flashcards
Source URL: https://quizplus.com/quiz/61502
Sample Questions
Q1) In 1910,Charles Davenport opened the Eugenics Record Office at Cold Spring Harbor.He believed "feeblemindedness" was
A)not inherited.
B)autosomal dominant.
C)X-linked.
D)autosomal recessive.
Q2) Natural selection can alter gene frequencies in a population because A)carriers of inherited disease rarely survive to reproduce.
B)it maintains alleles that improve survival to sexual maturity.
C)it compensates for defects caused by deleterious alleles.
D)individuals with deleterious alleles selectively interbreeD.
Q3) _____ maintains deleterious alleles in a population.
A)Mutation
B)Migration
C)Random mating
D)Natural selection
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: Human Ancestry and Evolution
Available Study Resources on Quizplus for this Chatper
44 Verified Questions
44 Flashcards
Source URL: https://quizplus.com/quiz/61501
Sample Questions
Q1) A 3.6 million-year-old partial skeleton,named Lucy,represents an individual who was a member of
A)Australopithecus afarensis.
B)Homo erectus.
C)Homo habilis.
D)Australopithecus garhi.
Q2) A complication of molecular clock studies is that A)DNA and proteins appeared in life at about the same time. B)genes mutate at different rates.
C)DNA is not often preserved in fossils.
D)some species are more highly evolved than others.
Q3) The Denisova hominin co-existed with ancestors of modern humans and the Neanderthals.
A)True
B)False
Q4) Human chromosome banding patterns match most closely those of A)chimpanzees.
B)monkeys.
C)gorillas.
D)orangutans.
18
To view all questions and flashcards with answers, click on the resource link above.
Chapter 17: Genetics of Immunity
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/61500
Sample Questions
Q1) HIV destroys the immune system by primarily destroying A)cytotoxic T cells.
B)B cells.
C)helper T cells.
D)erythrocytes.
Q2) Heart valve replacement in humans using a pig valve is an example of a(n) A)autograft.
B)isograft.
C)allograft.
D)xenograft.
Q3) Monoclonal antibodies are produced by fusing a A)B cell and a cancer cell.
B)B cell and a T cell.
C)mast cell and a macrophage.
D)T cell and a plasma cell.
Q4) Experimental gene therapy can be used to treat a form of severe combined immune deficiency,SCID-X1.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Cancer Genetics and Genomics
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/61499
Sample Questions
Q1) Dana Reeve,the wife of actor Christopher Reeve,died at a young age from lung cancer,although she had never smoked.Her cancer was likely caused by A)a germline mutation.
B)two somatic mutations in the same lung cell.
C)exposure to carcinogens.
D)stress from caring for her husband,who had a spinal cord injury.
Q2) The first mutation typically detected in FAP (familial adenomatous polyposis)colon cancer is A)APC.
B)TGF.
C)p53.
D)PRL-3.
Q3) A cancer cell is injected into a healthy mouse.The mouse develops tumors.This experiment indicates that cancer is A)contact inhibited.
B)transplantable.
C)benign.
D)invasive.
To view all questions and flashcards with answers, click on the resource link above.
20
Chapter
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/61498
Sample Questions
Q1) The first drug produced using recombinant DNA technology was A)insulin.
B)streptokinase.
C)tissue plasminogen activator.
D)erythropoietin.
Q2) In 1975,scientists convened in Asilomar,California and
A)determined that restriction enzymes could cut DNA.
B)created the first transgenic animals.
C)reviewed the use of drugs produced by recombinant DNA technology.
D)drew up guidelines to regulate recombinant DNA technology.
Q3) Recombinant DNA-based products are slow to reach the marketplace because of A)the adverse effects of gene cloning.
B)the lack of technological advances in gene cloning.
C)the lack of safety involved in such methods.
D)the cost and duration of research.
Q4) Genetic modification
A)alters genetic codes so that one species' code is like another's.
B)adds sugars and phosphates in a nucleus.
C)alters,deletes,or adds DNA to a cell.
D)substitutes entire nuclei to genetically engineer a cell.
To view all questions and flashcards with answers, click on the resource link above. Page 21
Chapter 20: Genetic Testing and Treatment
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61497
Sample Questions
Q1) "Patients-in-waiting" are false positives whose newborn screening reveals disease markers,but never develop the predicted symptoms.
A)True
B)False
Q2) A test offered on the Web by a direct-to-consumer genetic testing company genotypes a gene for ability to taste bitter substances.This test is not regulated by the Clinical Laboratory Improvement Amendments (CLIA)because
A)the test is not expensive.
B)the test provides information,not a diagnosis.
C)the test is offered in a state of the U.S.not covered by these regulations.
D)the Genetic Information Nondiscrimination Act outlawed CLIA.
E)it is not accurate.
Q3) Nondirective genetic counseling
A)does not accept health insurance.
B)does not deal with disorders carried on the sex chromosomes.
C)considers diseases caused by genes that are located throughout the genome.
D)offers options but not opinions.
To view all questions and flashcards with answers, click on the resource link above. Page 22
Chapter 21: Reproductive Technologies
Available Study Resources on Quizplus for this Chatper
41 Verified Questions
41 Flashcards
Source URL: https://quizplus.com/quiz/61496
Sample Questions
Q1) Which of the following contributes to subfertility?
A)regular menstrual cycles
B)high sperm counts
C)being under 30 years of age
D)oligospermia.
Q2) _____ places sperm into a woman's reproductive tract to fertilize an oocyte.
A)Sperm washing
B)Intrauterine insemination
C)GIFT
D)IVF
Q3) A man who is paralyzed from a spinal cord injury might become a father using A)IVF.
B)a surrogate mother.
C)intracytoplasmic sperm injection.
D)intrauterine insemination.
Q4) The logic behind polar body biopsy is based on
A)Darwin's theory of natural selection.
B)Mendel's law of segregation.
C)Mendel's law of independent assortment.
D)the rules of the genetic code.
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Genomics
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/61495
Sample Questions
Q1) Only about 6 percent of the human genome sequence is considered highly conserved.
A)True
B)False
Q2) The human genome project did not discover copy number variants because
A)people did not know they existed.
B)the sequenced and overlapped DNA pieces were unique.
C)there are too many to count,and they overlap among individuals.
D)no restriction enzymes are known that cut at these sequences.
Q3) The microbiome considers
A)DNA from microorganisms in the human body.
B)human DNA in microorganisms.
C)all DNA that is too small to be seen in a light microscope. D)genes that contribute to or control metabolism.
Q4) The original impetus to sequence the human genome was to investigate
A)how the four nitrogenous bases encode information.
B)how people vary.
C)how cancer arises.
D)the effects of exposure to low-level radiation on the genetics of populations.
To view all questions and flashcards with answers, click on the resource link above. Page 24