Biology for Non-Majors Test Preparation
Course Introduction
Biology for Non-Majors introduces fundamental concepts of biological science with an emphasis on their relevance to everyday life and global issues. The course covers core topics such as cell structure and function, genetics, evolution, ecology, and human biology, presented in a way that is accessible to students with minimal science background. Through lectures, discussions, and hands-on activities, students develop an understanding of the diversity and interdependence of living organisms, the scientific method, and current topics in biology such as biotechnology, health, and environmental sustainability. This course is designed to foster scientific literacy and critical thinking skills for students pursuing degrees outside of the biological sciences.
Recommended Textbook
Campbell Essential Biology 6th Edition by Eric J. Simon
Available Study Resources on Quizplus
29 Chapters
1538 Verified Questions
1538 Flashcards
Source URL: https://quizplus.com/study-set/2280
Page 2
Chapter 1: Introduction: Biology Today
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/45281
Sample Questions
Q1) Humans are ________.
A)producers
B)producers and consumers
C)consumers
D)producers and decomposers
Answer: C
Q2) Which of the following structures can perform all the activities required for life?
A)DNA molecules
B)cells
C)organelles
D)nuclei
Answer: B
Q3) Taxonomy is the ________.
A)study of cells
B)naming and classifying of species
C)study of organisms and their interaction with the environment
D)study of genes
Answer: B
To view all questions and flashcards with answers, click on the resource link above.
3
Chapter 2: Essential Chemistry for Biology
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/45282
Sample Questions
Q1) Sweating cools your body by ________.
A)cohesion
B)radiation
C)evaporative cooling
D)hydrogen bonding
Answer: C
Q2) The tendency of molecules of the same kind to stick together is called ________.
A)bonding
B)cohesion
C)polarity
D)adhesion
Answer: B
Q3) A base ________.
A)removes H O molecules from a solution
B)decreases the pH of a solution
C)removes OH- ions from a solution
D)removes H ions from a solution
Answer: D
To view all questions and flashcards with answers, click on the resource link above.
4
Chapter 3: The Molecules of Life
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45283
Sample Questions
Q1) In the following reaction,galactose is a ________. galactose + glucose lactose + water
A)polysaccharide
B)monomer
C)polymer
D)protein
Answer: B
Q2) ________ is a hydroxyl group.
A)-NH
B)-OH
C)-COOH
D)-H
Answer: B
Q3) Which of the following is a health effect of a diet high in saturated fats?
A)increased risk of infectious disease
B)decreased risk of atherosclerosis
C)increased risk of heart attack
D)decreased risk of stroke
Answer: C
To view all questions and flashcards with answers, click on the resource link above.
Page 5
Chapter 4: A Tour of the Cell
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45284
Sample Questions
Q1) The nuclear envelope is composed of ________.
A)chromatin
B)DNA
C)a double membrane
D)carbohydrates
Q2) Which plant organelle is responsible for photosynthesis?
A)smooth endoplasmic reticulum
B)mitochondrion
C)ribosome
D)chloroplast
Q3) Which of the following is a function of the plasma membrane?
A)regulate the traffic of chemicals in and out of the cell
B)regulate the production of lipids in the cell
C)regulate the production of DNA in and out of the nucleus
D)regulate the production of proteins in the cell
Q4) In plant cells,________ may contain organic nutrients,pigments,and poisons.
A)mitochondria
B)chloroplasts
C)lysosomes
D)central vacuoles
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: The Working Cell
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45285
Sample Questions
Q1) A cell that neither gains nor loses a net amount of water at equilibrium when it is immersed in a solution is ________.
A)isotonic to its environment
B)hypertonic to its environment
C)hypotonic to its environment
D)metabolically inactive
Q2) The amount of dietary Calories in one hard-boiled egg could raise the temperature of ________.
A)75 grams of water by 1 degree Celsius
B)750 grams of water by 1 degree Celsius
C)1,000 grams of water by 75 degrees Celsius
D)7,500 grams of water by 50 degrees Celsius
Q3) Which of the following molecules spontaneously form membranes when mixed in water and most likely were one of the first organic compounds formed on Earth?
A)DNA
B)Enzymes
C)Phospholipids
D)RNA
To view all questions and flashcards with answers, click on the resource link above.
7
Chapter 6: Cellular Respiration: Obtaining Energy From Food
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/45286
Sample Questions
Q1) The final electron acceptor of aerobic respiration is ________.
A)ATP
B)oxygen
C)lactic acid
D)NAD
Q2) Which of the following is a result of glycolysis?
A)production of CO
B)conversion of glucose to pyruvic acid
C)a net loss of two ATPs per glucose molecule
D)conversion of NADH to NAD
Q3) Large amounts of oxygen gas first appeared in Earth's atmosphere about ________ years ago.
A)500,000
B)10 million
C)2)7 billion
D)3)5 billion
To view all questions and flashcards with answers, click on the resource link above. Page 8
Chapter 7: Photosynthesis: Using Light to Make Food
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45287
Sample Questions
Q1) Some plant species require shaded conditions while other plant species require bright sunlight.Shade tolerance is best related to which of these characteristics?
A)Different species of plants have different ratios of pigment molecules that utilize different wavelengths of light.
B)Plant leaves without a protective coating are subject to sunburn.
C)Some species of plants are able to produce sugar without ever having been exposed to sunlight.
D)Some species of plants are consumers and do not need sunlight.
Q2) The light reactions of photosynthesis take place ________.
A)in the stroma
B)in the mitochondria
C)in the thylakoid membrane
D)in the cytosol
Q3) In photosynthesis,redox reactions ultimately transfer electrons from ________ to
A)O ...CO
B)C H O ...O
C)H O...C H O
D)H O...CO
To view all questions and flashcards with answers, click on the resource link above.
Chapter 8: Cellular Reproduction: Cells From Cells
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/45288
Sample Questions
Q1) What percentage of Amanda's gametes would likely have the normal number of chromosomes?
A)zero
B)100 percent
C)50 percent
D)25 percent
Q2) Sexual reproduction appears to be absent in bdelloid rotifers.Which of these,if found in this group,would bring into question the idea that they reproduce ONLY asexually?
A)female rotifers with eggs
B)significant differences of two different alleles among different populations (one population having mostly allele A and one having mostly a).
C)cells in which meiosis occurs
D)related groups (not bdelloid rotifers)which reproduce both sexually and asexually.
To view all questions and flashcards with answers, click on the resource link above.
10
Chapter 9: Patterns of Inheritance
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45289
Sample Questions
Q1) Experience with dog breeding has taught geneticists ________.
A)that,given enough time,any desired trait can be bred into dogs
B)that purebred dogs have offspring with qualities identical to the parents,because all purebred dogs are alike genetically
C)that,while physical traits can be molded through artificial selection,behavioral traits cannot
D)that geographically isolated groups of dogs may be selected for quite different traits,resulting in a different dog breed
Q2) The ________ is most commonly found in nature.
A)recessive trait
B)wild-type trait
C)parental type
D)dominant trait
Q3) What is the best explanation for a BbCc × bbcc cross producing offspring in a 5:5:1:1 phenotypic ratio?
A)linked genes
B)polygenic inheritance
C)incomplete dominance
D)codominance
To view all questions and flashcards with answers, click on the resource link above.
Page 11
Chapter 10: The Structure and Function of Dna
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45290
Sample Questions
Q1) The mutation that resulted from the accident was probably ________.
A)an amino acid substitution
B)one that changed the triplet grouping of the genetic message
C)an error in translation
D)a loss in regulation of gene expression
Q2) Scientific research companies sell kits that allow researchers to produce proteins in test tubes via a process known as "in vitro translation." Which one of following components is NOT needed in these kits?
A)amino acids
B)transfer RNA
C)DNA
D)ribosomes
Q3) DNA replication ________.
A)is a slow process that results in virtually no errors
B)requires DNA polymerase and RNA polymerase
C)is a very fast process that results in numerous errors
D)requires the cooperation of over a dozen enzymes and other proteins
To view all questions and flashcards with answers, click on the resource link above.
12
Chapter 11: How Genes Are Controlled
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45291
Sample Questions
Q1) What is a difference between embryonic and adult stem cells?
A)The use of embryonic stem cells raises fewer ethical issues than the use of adult stem cells.
B)Embryonic stem cells are undifferentiated; adult stem cells are partially differentiated.
C)It is easier to obtain embryonic stem cells.
D)Adult stem cells are easier to grow in culture.
Q2) The "master control genes" that regulate other genes and determine what body parts will develop in which locations are called ________.
A)enhancers
B)homeotic genes
C)oncogenes
D)operons
Q3) Repressors act by blocking the binding of ________ to the operator.
A)promoters
B)DNA polymerase
C)the operon
D)RNA polymerase
To view all questions and flashcards with answers, click on the resource link above. Page 13
Chapter 12: DNA Technology
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/45292
Sample Questions
Q1) Of the following,which is the last step in the production of a recombinant DNA plasmid?
A)cloning
B)using DNA ligase to join DNA fragments
C)cutting the gene of interest into fragments
D)allowing the reproduction of the bacterium bearing the recombinant plasmid
Q2) HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule?
GTAAGCTTCGACAAGCTTGCTGA
A)0 times
B)1 time
C)2 times
D)3 times
Q3) Ethical dilemmas raised by DNA technology and knowledge of the human genome include ________.
A)the potential for interfering in evolution,only
B)the safety of GM foods,only
C)the potential discrimination against people predisposed to certain diseases,only
D)all of the answer choices are correct
To view all questions and flashcards with answers, click on the resource link above.
Page 14
Chapter 13: How Populations Evolve
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/45293
Sample Questions
Q1) After 1 year of widely prescribed use,reports surface that bacterial infections disappear for up to 2 weeks after taking the prescribed antibiotic but then reappear,sometimes worse than the first time.Which of the following explanations might the FDA use to defend their choice of antibiotic to treat the infection?
A)Patients are not taking the antibiotic for the length of time prescribed and so selection for resistant bacteria that can survive a limited course of antibiotic is occurring.
B)Stabilizing selection over the year has allowed for the bacteria to remain at a high level in patients' bodies.
C)Patients' bodies are evolving over the year to create environments that are friendly to the growth of the bacteria.
D)Sexual dimorphism allowed for larger bacteria cells to outcompete smaller ones,therefore enabling larger bacteria cells to continue to multiply.
Q2) The first basic idea of evolutionary adaptation can be traced back to ________.
A)ancient Greeks about 2,500 years ago
B)Aristotle
C)Lamarck
D)Darwin
To view all questions and flashcards with answers, click on the resource link above.
Page 15
Chapter 14: How Biological Diversity Evolves
Available Study Resources on Quizplus for this Chatper
46 Verified Questions
46 Flashcards
Source URL: https://quizplus.com/quiz/45294
Sample Questions
Q1) When brought together in a zoo,two species are capable of mating and producing fertile offspring.Why may they still be considered two distinct species?
A)Wild populations of the two species have different geographic distributions.
B)In the wild,members of one species prey upon members of the other species.
C)Zoos are not natural environments.
D)The two species look very different.
Q2) The wing of a penguin is ________ the wing of a butterfly.
A)structurally identical to B)superior to C)homologous to D)analogous to
Q3) Biological species consist of groups of ________.
A)populations
B)domains
C)families
D)genera
To view all questions and flashcards with answers, click on the resource link above.
16
Chapter 15: The Evolution of Microbial Life
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/45295
Sample Questions
Q1) Spherical bacteria that occur in clusters are ________.
A)streptococci
B)bacilli
C)spirochetes
D)staphylococci
Q2) Scientists hypothesize that disrupting our ________ communities may increase our susceptibility to infectious diseases,predispose us to certain cancers,and contribute to conditions such as asthma and other allergies,irritable bowel syndrome,Crohn's disease,and autism.
A)microbial
B)exotoxin
C)protist
D)pathogen
Q3) Animal life underwent its greatest diversification during the ________,which began about ________ million years ago.
A)Paleozoic era...290
B)Paleozoic era...540
C)Mesozoic era...363
D)Mesozoic era...245
To view all questions and flashcards with answers, click on the resource link above.
Page 17
Chapter 16: The Evolution of Plants and Fungi
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45296
Sample Questions
Q1) Gymnosperms and angiosperms share multiple similarities.Which of the following is NOT a shared feature of angiosperms and gymnosperms?
A)Both produce flowers.
B)Both have pollen grains that are male gametophytes.
C)Both have a dominant sporophyte generation.
D)Both have seeds.
Q2) Nearly all food plants are ________.
A)bryophytes
B)gymnosperms
C)ferns
D)angiosperms
Q3) Of the following,which is the earliest step in the formation of fossil fuels?
A)subjecting organic matter to extreme pressure
B)flooding swamps with seawater
C)incomplete decomposition of organic matter
D)subjecting organic matter to extreme heat
To view all questions and flashcards with answers, click on the resource link above.
18
Chapter 17: The Evolution of Animals
Available Study Resources on Quizplus for this Chatper
58 Verified Questions
58 Flashcards
Source URL: https://quizplus.com/quiz/45297
Sample Questions
Q1) Which of these exhibits radial symmetry?
A)butterfly
B)spoon
C)snowflake
D)shoe box
Q2) You are given the task of confirming the categorization of a newly discovered animal that has been tagged as a species of annelid.What evidence would convince you that it is indeed an annelid and not a roundworm or flatworm?
A)an incomplete digestive tract
B)a highly branched gastrovascular cavity
C)parasitic feeding habits
D)body segmentation
Q3) Which anthropoids are most closely related to humans?
A)orangutans
B)chimpanzees
C)gorillas
D)gibbons
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: An Introduction to Ecology and the Biosphere
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45298
Sample Questions
Q1) Which of these biomes is one of the most biologically productive of all biomes?
A)open oceans
B)estuaries
C)temperate grasslands
D)coniferous forests
Q2) Malaria is an infectious disease transmitted to humans from a parasite that infects mosquitoes that feed on humans.World health officials have concerns that climate change may impact the transmission of malaria into tropical highland areas in Africa.If these concerns turn out to be valid,they would be evidence for which of the following?
A)Global climate change affects the distribution of species.
B)Global climate change will negatively impact the transmission of malaria only in Africa.
C)Global climate change affects freshwater and marine biomes.
D)Global climate change will enable scientists to more easily control the spread of malaria.
To view all questions and flashcards with answers, click on the resource link above.
20
Chapter 19: Population Ecology
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/45299
Sample Questions
Q1) The virus introduced to the island in 1982 that reduced the wolf population is an example of ________.
A)a density-independent factor
B)a density-dependent factor
C)biological control
D)intraspecific competition
Q2) The Endangered Species Act aims to help protect species that ________.
A)are in danger of extinction
B)dominate suitable habitats
C)compete with invasive species
D)are economically valuable
Q3) If all populations occupy different areas that are approximately the same size,which population will have the lowest density after 3 years?
A)Population A
B)Population B
C)Population C
D)After 3 years,all three populations will have the same density.
To view all questions and flashcards with answers, click on the resource link above. Page 21
Chapter 20: Communities and Ecosystems
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45300
Sample Questions
Q1) When the mud volcano stops erupting,colonization of the disturbed area would be
A)primary succession if there is no biomass inside the area
B)primary succession if primary production relies on plants that survived the disturbance
C)secondary succession if there are no biotic components of the carbon cycle
D)secondary succession if there is no organic matter in the area
Q2) Why are most food chains limited to three to five trophic levels?
A)The higher the trophic level,the larger the organism; the larger the organism,the less likely it will be prey.
B)The nutritional quality of existing biomass decreases with increasing trophic level.
C)Most ecosystems have insufficient space to support the increased number of organisms that more trophic levels would require.
D)There is insufficient energy to support more trophic levels.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 21: Unifying Concepts of Animal Structure and Function
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/45301
Sample Questions
Q1) Which of the following is a physiological response that takes place in many animals when they get too hot?
A)slowing of the heart rate
B)constriction of blood vessels in the skin
C)contraction of muscles
D)increased blood flow to the skin
Q2) What kind of connective tissue has a matrix that is strong and flexible?
A)bone
B)adipose tissue
C)loose connective tissue
D)cartilage
Q3) The vertebrate kidney helps to keep the acidity of the body fluids constant by varying the amount of hydrogen ions (H )it secretes into the urine.You can confidently predict that this aspect of kidney function,like other mechanisms of homeostasis,will be controlled by ________.
A)a negative feedback mechanism
B)nerve impulses from the brain
C)a hormone produced in the brain
D)a hormone produced in the kidney itself
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Nutrition and Digestion
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/45302
Sample Questions
Q1) Digestion is ________.
A)the absorption of nutrients
B)the breakdown of food into small nutrient molecules that the body can absorb
C)the churning of food in the stomach and intestine
D)eating
Q2) Anorexia and bulimia ________.
A)occur when the body does not receive enough vitamin C
B)occur when there is a protein-deficient diet
C)occur mainly in affluent countries where thinness is idealized
D)occur when a person does not obtain all the essential amino acids
Q3) What do the vitamins biotin and Vitamin K have in common?
A)They are both water-soluble vitamins.
B)They are both obtained from meat.
C)They are both produced by intestinal bacteria.
D)They are both common deficiencies in the human diet.
Q4) What is the main digestive function of the pancreas?
A)It produces digestive enzymes and bile.
B)It produces bile.
C)It produces digestive enzymes and neutralizes stomach acids.
D)It secretes mucus into the small intestine.
Page 24
To view all questions and flashcards with answers, click on the resource link above.
Chapter 23: Circulation and Respiration
Available Study Resources on Quizplus for this Chatper
61 Verified Questions
61 Flashcards
Source URL: https://quizplus.com/quiz/45303
Sample Questions
Q1) If yawning has a regulatory mechanism similar to breathing,then which of the following is TRUE?
A)Athletes should yawn more when exercising compared to when they are not exercising.
B)Tibetan mountaineers yawn more when they are walking compared to when they are standing still.
C)People adapted to lower altitudes should yawn the same amount when they are at high altitudes.
D)Athletes who have trained at high altitudes should inhale a greater volume of air when yawning compared to those who have trained only at low altitudes.
Q2) Earthworms use ________ as their respiratory surface.
A)lungs
B)gills
C)their skin
D)tracheae
To view all questions and flashcards with answers, click on the resource link above.
25
Chapter 24: The Bodys Defenses
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/45304
Sample Questions
Q1) Humans who are infected with avian influenza are likely to have elevated levels of
A)defensive proteins
B)histamine
C)antihistamines
D)bacterial cells
Q2) Suppose that you encounter an antigen for the first time.What types of cells stored in your lymph nodes can be activated in case you encounter the antigen again?
A)memory cells
B)effector cells
C)phagocytic cells
D)helper T cells
Q3) Which of the following is a response of our innate defense system?
A)adaptive immunity
B)inflammation
C)cytotoxic T cell response
D)helper T cell response
To view all questions and flashcards with answers, click on the resource link above.
26
Chapter 25: Hormones
Available Study Resources on Quizplus for this Chatper
52 Verified Questions
52 Flashcards
Source URL: https://quizplus.com/quiz/45305
Sample Questions
Q1) Hormones regulate ________.
A)growth,only
B)reproduction,only
C)metabolism,only
D)Growth,reproduction,and metabolism are regulated by hormones.
Q2) Which of the following glands is located nearest the kidneys?
A)ovaries
B)pineal gland
C)thyroid gland
D)adrenal glands
Q3) Estrogens stimulate the development of ________.
A)breasts
B)a low-pitched voice
C)sperm production
D)facial hair
Q4) Which of the following hormones affects the greatest variety of cell types?
A)prolactin
B)insulin
C)growth hormone
D)calcitonin
To view all questions and flashcards with answers, click on the resource link above. Page 27
Chapter 26: Reproduction and Development
Available Study Resources on Quizplus for this Chatper
53 Verified Questions
53 Flashcards
Source URL: https://quizplus.com/quiz/45306
Sample Questions
Q1) In human females,the ovarian cycle begins when the ________.
A)levels of estrogen reach their maximum
B)hypothalamus stimulates the anterior pituitary to increase its output of FSH and LH
C)level of progesterone drops precipitously
D)levels of FSH and LH drop precipitously
Q2) Mesoderm gives rise to the ________.
A)heart and kidneys
B)brain and skin
C)nervous system and thyroid
D)liver and pancreas
Q3) Which one of the following statements is TRUE?
A)Meiosis in oogenesis produces four mature eggs from one primary oocyte.
B)Oogenesis begins during puberty.
C)Spermatogenesis in an individual begins before that individual is born.
D)Oogenesis in humans is completed after stimulation by sperm.
To view all questions and flashcards with answers, click on the resource link above.
Chapter 27: Nervous,Sensory,and Locomotor Systems
Available Study Resources on Quizplus for this Chatper
62 Verified Questions
62 Flashcards
Source URL: https://quizplus.com/quiz/45307
Sample Questions
Q1) The minimum change in a membrane's voltage that must occur to trigger an action potential is called the ________.
A)threshold
B)synaptic terminal
C)membrane potential
D)resting potential
Q2) A person who has blurred vision caused by a misshapen lens or cornea has ________.
A)farsightedness
B)nearsightedness
C)astigmatism
D)cataracts
Q3) Eyes can become bloodshot when irritants in the eye trigger an increased blood flow to the connective tissue covering the eye.These swollen blood vessels are located on the
A)cornea
B)sclera
C)iris
D)lens
To view all questions and flashcards with answers, click on the resource link above. Page 29
Chapter 28: The Life of a Flowering Plant
Available Study Resources on Quizplus for this Chatper
68 Verified Questions
68 Flashcards
Source URL: https://quizplus.com/quiz/45308
Sample Questions
Q1) In which structure do pollen grains develop?
A)stamen
B)sepal
C)filament
D)anther
Q2) What evidence best supports the pineapple's classification as a monocot?
A)It does not produce woody tissue.
B)It produces a fruit.
C)Its flowers have three petals each.
D)It has double fertilization.
Q3) The ________ enclose and protect the flower bud,while the ________ advertise the flower to insects and other pollinators.
A)anthers...petals
B)carpels...stigmata
C)sepals...stamens
D)sepals...petals
To view all questions and flashcards with answers, click on the resource link above. Page 30
Chapter 29: The Working Plant
Available Study Resources on Quizplus for this Chatper
57 Verified Questions
57 Flashcards
Source URL: https://quizplus.com/quiz/45309
Sample Questions
Q1) Which of the following hormones promotes cell elongation in stems?
A)auxin
B)cytokinin
C)ethylene
D)gibberellin
Q2) Which of the following BEST describes the essential difference between plant and animal nutrition?
A)Plants use inorganic substances and energy from the sun to produce their own food.
B)Plants use organic substances to produce their own food.
C)Plants absorb food through their roots.
D)Plant and animal nutrition are essentially the same.
Q3) Which of the following mechanisms best explains how xylem sap moves up against the downward pull of gravity?
A)cohesion-tension hypothesis
B)gravitropism
C)phototropism
D)expenditure of ATP
To view all questions and flashcards with answers, click on the resource link above. Page 31