Animal Genetics
Final Exam Questions
Course Introduction
Animal Genetics explores the principles of heredity and variation in animals, focusing on the structure, function, and behavior of genes. The course covers fundamental topics such as Mendelian and non-Mendelian inheritance, chromosome structure and function, genetic mapping, population genetics, and the molecular basis of genetic traits. Students will examine genetic improvement through selective breeding, genetic disorders, and biotechnological advancements like genetic engineering and cloning in livestock and companion animals. Through theoretical concepts and practical applications, the course prepares students to understand and utilize genetic principles in animal breeding, conservation, and research.
Recommended Textbook
Concepts of Genetics 3rd Edition by Robert J. Brooker
Available Study Resources on Quizplus
24 Chapters
913 Verified Questions
913 Flashcards
Source URL: https://quizplus.com/study-set/2386 Page 2
Chapter 1: Overview of Genetics
Available Study Resources on Quizplus for this Chatper
28 Verified Questions
28 Flashcards
Source URL: https://quizplus.com/quiz/47400
Sample Questions
Q1) Which of the following could be used to study the effects of drugs on gene expression?
A) population genetics
B) transmission genetics
C) molecular genetics
D) quantitative genetics
Answer: C
Q2) The study of the processes of transcription and translation is at the ________ level of biological organization.
A) population
B) organismal
C) cellular
D) molecular
Answer: D
Q3) The basic unit of heredity is the ________.
A) individual
B) gene
C) macromolecule
D) trait
Answer: B
To view all questions and flashcards with answers, click on the resource link above. Page 3
Chapter 2: Reproduction and Chromosome Transmission
Available Study Resources on Quizplus for this Chatper
41 Verified Questions
41 Flashcards
Source URL: https://quizplus.com/quiz/47401
Sample Questions
Q1) Select the phase during which the centrosomes move to opposite poles of the cell.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: B
Q2) The location of a gene on a chromosome is called its ________.
A) karyotype
B) allele
C) locus
D) homolog
Answer: C
Q3) The end result of meiosis in animals is ________.
A) two diploid cells
B) two haploid cells
C) four diploid cells
D) four haploid cells
Answer: D
To view all questions and flashcards with answers, click on the resource link above.
Page 4
Chapter 3: Mendelian Inheritance
Available Study Resources on Quizplus for this Chatper
49 Verified Questions
49 Flashcards
Source URL: https://quizplus.com/quiz/47402
Sample Questions
Q1) Differences in plant characteristics such as flower color or height are called variants or traits.
A)True
B)False
Answer: True
Q2) An individual who has two identical alleles for a trait is said to be ________.
A) homozygous
B) heterozygous
C) isozygous
D) a variant
Answer: A
Q3) The anthers represent the ________ portion of the plant; the ovules represent the ________ portion of the plant.
A) female; male
B) male; female
C) female; female
D) male; male
Answer: B
To view all questions and flashcards with answers, click on the resource link above. Page 5
Chapter 4: Sex Determination and Sex Chromosomes
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/47403
Sample Questions
Q1) In humans,which sex is considered to be the heterogametic sex?
A) male
B) female
Q2) The coat color of calico cats is a result of ________.
A) maternal inheritance
B) X-inactivation
C) imprinting
D) extra nuclear inheritance
Q3) An example of a mechanism in which sex is determined by environmental factors is A) females are produced from fertilized eggs, whereas males are produced from unfertilized eggs.
B) when the male cares for the eggs, all of the offspring will be male, whereas if the female cares for the eggs, all of the offspring will be female.
C) fertilized eggs incubated at one temperature produce males, whereas eggs incubated at a different temperature produce females.
D) males will have a Y chromosome, whereas females will not have a Y chromosome.
Q4) With rare exceptions,a calico cat is likely to be female.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 6
Chapter 5: Extensions of Mendelian Inheritance
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/47404
Sample Questions
Q1) Because most lethal alleles are inherited in a recessive manner,a cross between two heterozygous individuals could result in a 2:1 genotypic ratio in their surviving offspring.
A)True
B)False
Q2) Because loss-of-function alleles typically do not make a functional gene product,they usually follow the recessive allele inheritance pattern.
A)True
B)False
Q3) Sickle-cell anemia in humans is an example of ________.
A) codominance
B) incomplete penetrance
C) heterozygote advantage
D) multiple allele systems
Q4) Typically,a recessive allele increases the expression of a functional protein.
A)True
B)False
Q5) Incomplete dominance is an example of blending of phenotypes,not genotypes.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 7
Chapter 6: Extranuclear Inheritance, Imprinting, and Maternal Effect
Available Study Resources on Quizplus for this Chatper
36 Verified Questions
36 Flashcards
Source URL: https://quizplus.com/quiz/47405
Sample Questions
Q1) Which mating of four-o'clock plants would produce progeny that were either green,variegated,or white if the color variation is due to a mutation in a chloroplast gene?
A) green female x variegated male
B) variegated female x green male
C) white female x white male
D) white female x green male
Q2) Where is extranuclear DNA located in mammalian cells?
A) endoplasmic reticulum
B) mitochondria
C) ribosome
D) plasma membrane
Q3) Monoallelic expression is associated with which of the following?
A) X-inactivation
B) genomic imprinting
C) maternal inheritance
D) extranuclear inheritance
Q4) Both parents usually imprint the same gene.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 8
Chapter 7: Genetic Linkage and Mapping in Eukaryotes
Available Study Resources on Quizplus for this Chatper
32 Verified Questions
32 Flashcards
Source URL: https://quizplus.com/quiz/47406
Sample Questions
Q1) Twin spotting provides evidence of what genetic event?
A) meiotic recombination
B) mitotic recombination
C) linkage
D) mutation
Q2) Crossing over is more likely to occur between genes that are ________ on a chromosome.
A) close together
B) far apart
C) not
Q3) In humans,there are ________ autosomal linkage groups,plus an X and Y chromosome linkage group.
A) 23
B) 46
C) 22
D) 92
Q4) The locus is the physical place of a gene on a chromosome.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 9
Chapter 8: Variation in Chromosome Structure and Number
Available Study Resources on Quizplus for this Chatper
45 Verified Questions
45 Flashcards
Source URL: https://quizplus.com/quiz/47407
Sample Questions
Q1) The majority of autosomal aneuploid conditions are lethal,but sex chromosome aneuploids are usually not lethal.
A)True
B)False
Q2) Since no genetic material is lost or gained by an inversion,it will only influence phenotype if the breaks are within a gene or in important regulatory regions for a gene.
A)True
B)False
Q3) A ________ translocation occurs when a piece of one chromosome is attached to another chromosome.
A) simple
B) complex
C) reciprocal
D) balanced
Q4) Variations in a gene are called allelic variations.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 10
Chapter 9: Genetics in Bacteria
Available Study Resources on Quizplus for this Chatper
44 Verified Questions
44 Flashcards
Source URL: https://quizplus.com/quiz/47408
Sample Questions
Q1) After conjugation,the enzyme that rejoins the ends of the linear DNA into a circular plasmid is called ________.
A) relaxosome
B) relaxase
C) F factor
D) nucleoprotein
Q2) The site on a plasmid that is cut,producing a single strand of DNA,to allow conjugation to occur is called the ________.
A) origin of transfer
B) relaxase
C) nucleoprotein
D) T DNA
Q3) After two cells make contact via the conjugation bridge,the protein complex that initiates DNA transfer is called the
A) origin of transfer.
B) T DNA.
C) relaxosome.
D) nucleoprotein complex.
To view all questions and flashcards with answers, click on the resource link above.
11
Chapter 10: Genetics of Viruses
Available Study Resources on Quizplus for this Chatper
11 Verified Questions
11 Flashcards
Source URL: https://quizplus.com/quiz/47409
Sample Questions
Q1) Which virus uses reverse transcriptase in its reproductive cycle?
A) HIV
B) Phage lamda
C) Both of the viruses use reverse transcriptase
D) Neither of the viruses use reverse transcriptase
Q2) What was the outcome of the experiment that reconstituted two different strains of tobacco mosaic viruses that had different infection characteristics?
A) The differences in infection characteristics depended only on the RNA sequence of the virus strain.
B) The differences in infection characteristics depended only the the protein coat.
C) The differences in infection characteristics depended on an RNA and protein coat interaction.
Q3) A bacteriophage that is physically integrated into the host chromosome is called a ________.
A) heteroduplex
B) envelope phage
C) prophage
D) plaque
To view all questions and flashcards with answers, click on the resource link above. Page 12
Chapter 11: Molecular Structure of DNA and RNA
Available Study Resources on Quizplus for this Chatper
38 Verified Questions
38 Flashcards
Source URL: https://quizplus.com/quiz/47410
Sample Questions
Q1) The purine bases are ________.
A) cytosine, thymine, and uracil
B) adenine and guanine
C) adenine and thymine
D) cytosine and guanine
Q2) Select the statements that are true about the Hershey-Chase experiments.
A) They radioactively labeled the protein coat of the bacteriophage with ³ S.
B) They radioactively labeled the DNA of the bacteriophage with ³²P.
C) The results of the experiment indicated only the presence of ³ S in the cell.
D) The results suggested that DNA was the genetic material.
Q3) The fact that the two DNA strands are arranged in opposite orientations gives DNA its ________ characteristics.
A) antiparallel
B) complementary
C) redundant
D) water-soluble
Q4) The term nucleic acids is used to describe RNA and DNA because
A) they are acidic molecules and have a net negative charge at neutral pH.
B) they are acidic molecules and have a net positive charge at neutral pH.
C) they are acidic molecules and have no charge at neutral pH.
Page 13
To view all questions and flashcards with answers, click on the resource link above.
Chapter 12: Molecular Structure of Chromosomes and Transposition
Available Study Resources on Quizplus for this Chatper
40 Verified Questions
40 Flashcards
Source URL: https://quizplus.com/quiz/47411
Sample Questions
Q1) Overwinding of the DNA decreases the number of turns in the double helix,and thus results in supercoils in the DNA.
A)True
B)False
Q2) How many origins of replication are there in bacteria?
A) 0
B) 1
C) 2
D) More than two
Q3) Unique sequences make up approximately what percent of the human genome?
A) 5%
B) 25%
C) 40%
D) 80%
Q4) Quinolones kill bacteria by what mechanism?
A) It inhibits DNA gyrase.
B) It inhibits DNA compaction.
C) It inhibits DNA replication.
D) All of these choices are correct.
To view all questions and flashcards with answers, click on the resource link above. Page 14
Chapter 13: Dna Replication and Recombination
Available Study Resources on Quizplus for this Chatper
50 Verified Questions
50 Flashcards
Source URL: https://quizplus.com/quiz/47412
Sample Questions
Q1) Which describes the mechanism of DNA replication in which the newly made double-stranded DNA contains one parental strand and one daughter strand?
A) dispersive
B) semiconservative
C) conservative
Q2) The problem of replicating the 3 ends of chromosomes is solved by using the enzyme telomerase.
A)True
B)False
Q3) In E.coli,which protein(s)are necessary for the cell to recognize double-stranded breaks and conduct recombination during meiosis?
A) RecG
B) RecA
C) RecBCD
D) RuvABC
Q4) The Meselson-Stahl experiments used ³ S radioisotopes to determine the mechanism of DNA replication.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 15
Chapter 14: Gene Transcription and RNA Modification
Available Study Resources on Quizplus for this Chatper
42 Verified Questions
42 Flashcards
Source URL: https://quizplus.com/quiz/47413
Sample Questions
Q1) RNA polymerase I in eukaryotes produces which type of RNA?
A) snRNA
B) tRNA
C) 5S rRNA
D) 18S rRNA
Q2) What structural motif is used by sigma factor to bind to DNA?
A) zinc-finger
B) helix-turn-helix
C) leucine zipper
D) homeodomain
Q3) The formation of open complex usually forms in GC-rich regions of DNA due to the decreased number of hydrogen bonds.
A)True
B)False
Q4) Select the stages of transcription.
A) initiation
B) elongation
C) termination
D) translation
E) replication
To view all questions and flashcards with answers, click on the resource link above. Page 16
Chapter 15: Translation of MRNA
Available Study Resources on Quizplus for this Chatper
51 Verified Questions
51 Flashcards
Source URL: https://quizplus.com/quiz/47414
Sample Questions
Q1) Which of the following are true regarding the experiments of Beadle and Tatum?
A) They were able to create loss-of-function mutations in any enzyme they chose.
B) They used the mold Neurospora as a model organism.
C) They isolated strains that could not grow on minimal media.
D) They established the link between a gene and an enzyme or protein.
Q2) The wobble base is the second base of a codon.
A)True
B)False
Q3) What site does the initiator tRNA bind to on the ribosome?
A) A
B) E
C) P
Q4) A tRNA that has an amino acid attached is called ________.
A) rRNA
B) degenerate tRNA
C) coding tRNA
D) charged tRNA
E) None of the answers are correct.
To view all questions and flashcards with answers, click on the resource link above. Page 17
Chapter 16: Gene Regulation in Bacteria
Available Study Resources on Quizplus for this Chatper
37 Verified Questions
37 Flashcards
Source URL: https://quizplus.com/quiz/47415
Sample Questions
Q1) In Jacob,Monod,and Pardee's experiment,how many functional copies of lacI were there in the merozygote?
A) 0
B) 1
C) 2
D) 3
Q2) Which of the following is not an example of translational regulation in prokaryotes?
A) sterically blocking the ribosome
B) phosphorylation of an enzyme
C) incorporation of antisense RNA
D) altering the structure of the mRNA
Q3) How many promoters are in an operon?
A) 1
B) 2
C) 3
D) It depends on how many genes there are in the operon.
Q4) Repressor proteins are responsible for negative transcriptional regulation.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 18
Chapter 17: Gene Regulation in Eukaryotes
Available Study Resources on Quizplus for this Chatper
55 Verified Questions
55 Flashcards
Source URL: https://quizplus.com/quiz/181990
Sample Questions
Q1) Expression of ________ would inhibit X-chromosome inactivation.
A) Xic
B) Xist
C) Tsix
D) All of the answers are correct
E) None of the answers are correct
Q2) What genes appear to be controlled by the Xic?
A) Xist and Tsix
B) Xist
C) TsiX
D) Xic
Q3) Regulatory transcription factors may be regulated by
A) phosphorylation.
B) binding of carbohydrates.
C) lipid modifications.
D) sulfation.
Q4) The CpG islands upstream of housekeeping genes are unmethylated.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 19
Chapter 18: Non-Coding Rnas
Available Study Resources on Quizplus for this Chatper
24 Verified Questions
24 Flashcards
Source URL: https://quizplus.com/quiz/181991
Sample Questions
Q1) Select possible outcomes after RISC binds to an mRNA during RNA interference.Choose all that apply.
A) Inhibition of translation without mRNA degradation
B) mRNA degradation
C) Movement of the RISC-mRNA complex to a P-body
D) Expulsion of the RISC-mRNA complex from the cell
E) Cell death
Q2) Consider the two key roles that have been identified for SRP RNA.You have isolated a mutant SRP RNA.This RNA is able to perform its role as a scaffold for SRP proteins,but has lost its other function.How will this affect translation of SRP-containing proteins?
A) Partially translated proteins will be stuck in the cytosol.
B) Partially translated proteins will be stuck in the ER lumen.
C) Partially translated proteins will be stuck in the nucleus.
D) Translation will proceed normally.
Q3) An RNA molecule with catalytic activity is called a(n)
A) ribozyme.
B) ncRNA.
C) snRNA
D) miRNA.
To view all questions and flashcards with answers, click on the resource link above.
Page 20
Chapter 19: Gene Mutation and DNA Repair
Available Study Resources on Quizplus for this Chatper
43 Verified Questions
43 Flashcards
Source URL: https://quizplus.com/quiz/47418
Sample Questions
Q1) Homologous recombination repair requires the presence of a sister chromatid.
A)True
B)False
Q2) Which of the following are examples of spontaneous mutations?
A) depurination
B) deamination
C) tautomeric shifts
D) nitrogenous base oxidation
Q3) Which DNA repair process identifies daughter strands by methylation?
A) homologous recombination repair
B) direct repair
C) base excision repair
D) mismatch repair
E) nucleotide excision repair
Q4) When guanine is oxidized into 8-oxoguanine,it will base pair with adenine during DNA replication,causing a transversion mutation.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above.
21
Chapter 20: Molecular Technologies
Available Study Resources on Quizplus for this Chatper
47 Verified Questions
47 Flashcards
Source URL: https://quizplus.com/quiz/47419
Sample Questions
Q1) A vector is a small segment of DNA that a gene of interest is inserted into for cloning.
A)True
B)False
Q2) In the DNA sequence 5 GCGCAAATTTCCCTATACCC 3 ,you wish to use site-directed mutagenesis to change the T at position 8 to a C.Select the primer that is likely to give you the best results.
A) 5 GCGCAAACTTCCCTATACCC 3
B) 5 CGCGTTTGAAGGATATGGG 3
C) 5 GCGCAGGCCTCCCTATACCC 3
Q3) Which of the following is an example of a pluripotent cell?
A) embryonic stem cells
B) red blood cells
C) fetal heart cells
D) umbilical cord blood
E) nerve cells
Q4) The primary interest of genetic research into stem cells is the desire to clone a human being.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 22
Chapter 21: Genomics
Available Study Resources on Quizplus for this Chatper
34 Verified Questions
34 Flashcards
Source URL: https://quizplus.com/quiz/47420
Sample Questions
Q1) RFLP stands for restriction fragment linked position.
A)True
B)False
Q2) In the screening of a DNA microarray,detection of a fluorescent signal from one of the genes indicates which of the following?
A) The labeled cDNA hybridized to that particular gene.
B) The labeled cDNA did not hybridize to that particular gene.
C) The experiment was not conducted correctly.
D) None of these choices are correct.
Q3) In shotgun sequencing,how is a complete sequence of a genome reconstructed?
A) The entire genome is directly sequenced chromosome by chromosome.
B) The genome is fragmented and sequences of each fragment are arranged so that overlapping regions are identified.
C) The sequences of a large number of individuals is obtained and "averaged" to obtain the complete sequence.
D) The position of each marker and gene are first mapped relative to regions for which the genomic sequence is not known.
To view all questions and flashcards with answers, click on the resource link above. Page 23
Chapter 22: Medical Genetics and Cancer
Available Study Resources on Quizplus for this Chatper
25 Verified Questions
25 Flashcards
Source URL: https://quizplus.com/quiz/47421
Sample Questions
Q1) The term that refers to the linkage of alleles or molecular markers along a single chromosome is
A) loss of variation.
B) association group.
C) recombination group.
D) haplotype.
Q2) What can cause epigenetic changes? (Select all that apply.)
A) DNA methylation
B) Histone acetylation
C) Histone methylation
D) Histone phosphorylation
Q3) Haplotypes can be useful in the identification of disease genes since
A) the least concordant marker(s) is typically the one that is closest to the disease gene.
B) the most concordant marker(s) is typically the one that is closest to the disease gene.
C) the most concordant marker(s) is the disease gene.
D) no pedigree information needs to be known.
To view all questions and flashcards with answers, click on the resource link above.
24
Chapter 23: Population Genetics
Available Study Resources on Quizplus for this Chatper
39 Verified Questions
39 Flashcards
Source URL: https://quizplus.com/quiz/47422
Sample Questions
Q1) Mutations represent
A) a minor part of microevolution.
B) an essential part of microevolution.
C) deleterious changes to the fitness of an individual.
D) advantageous changes to genes.
Q2) Microevolution is defined as
A) changes in the gene pool from one generation to the next.
B) changes in gene flow from one generation to the next.
C) the ability of different genotypes to succeed in a particular environment.
D) morphological changes that occur from one generation to the next.
Q3) Migration of a random few individuals from one population to a new area to establish a new population is an example of
A) bottleneck effect.
B) mutation.
C) founder effect.
D) selection.
Q4) At equilibrium the allelic and genotypic frequencies of a population change over time.
A)True
B)False
To view all questions and flashcards with answers, click on the resource link above. Page 25
Chapter 24: Quantitative Genetics
Available Study Resources on Quizplus for this Chatper
33 Verified Questions
33 Flashcards
Source URL: https://quizplus.com/quiz/47423
Sample Questions
Q1) QTL mapping determines the relationship between genes for quantitative traits and which of the following?
A) the centromere
B) transposon sites
C) structural genes
D) molecular markers such as RFLPs
Q2) In calculations of the degrees of freedom for a correlation coefficient,what value does the degrees of freedom take?
A) (n - 1)
B) (n - 2)
C) (n - 1)/2
D) 2(n - 1)
Q3) What must be true for a correlation coefficient to be calculated between two traits?
A) The values for the traits must have been obtained from unbiased sampling.
B) The relationship between the two traits must be linear.
C) The traits must follow a normal distribution.
D) All of these choices are correct.
To view all questions and flashcards with answers, click on the resource link above.