Ben J. Hatchwell, Univ. of Sheffield, UK
Dibuix de la coberta / Dibujo de la portada / Drawing of the cover: Pelagia noctiluca, medusa luminiscent, medusa luminiscente, mauve stinger (Jordi Domènech)
Secretaria de Redacció / Secretaría de Redacción / Editorial Office Museu de Ciències Naturals de Barcelona Passeig Picasso s/n. 08003 Barcelona, Spain Tel. +34–93–3196912 Fax +34–93–3104999 E–mail abc@bcn.cat Secretària de Redacció / Secretaria de Redacción / Managing Editor Montserrat Ferrer Assistència Tècnica / Asistencia Técnica / Technical Assistance Eulàlia Garcia Anna Omedes Francesc Uribe Assessorament lingüístic / Asesoramiento lingüístico / Linguistic advisers Carolyn Newey Pilar Nuñez
Animal Biodiversity and Conservation 43.2, 2020 Autoedició: Montserrat Ferrer Fotomecànica i impressió: CEVAGRAF SCCL ISSN: 1578–665 X eISSN: 2014–928 X Dipòsit legal: B. 5357–2013
Animal Biodiversity and Conservation es publica amb el suport de / Animal Biodiversity and Conservation se publica con el apoyo de / Animal Biodiversity and Conservation is published with the support of: Asociación Española de Ecología Terrestre – AEET Sociedad Española de Etología y Ecología Evolutiva – SEEEE Sociedad Española de Biología Evolutiva – SESBE Disponible gratuitament a internet / Disponible gratuitamente en internet / Freely available online at: www.abc.museucienciesjournals.cat
Animal Biodiversity and Conservation 43.2 (2020)
Editor en cap / Editor responsable / Editor in Chief Joan Carles Senar Museu de Ciències Naturals de Barcelona, Barcelona, Spain Editors temàtics / Editores temáticos / Thematic Editors Ecologia / Ecología / Ecology: Mario Díaz (Asociación Española de Ecología Terrestre – AEET) Comportament / Comportamiento / Behaviour: Adolfo Cordero (Sociedad Española de Etología y Ecología Evolutiva – SEEEE) Biologia Evolutiva / Biología Evolutiva / Evolutionary Biology: Santiago Merino (Sociedad Española de Biología Evolutiva – SESBE) Editors / Editores / Editors Pere Abelló Institut de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Pelayo Acevedo Instituto de Investigación en Recursos Cinegéticos IREC–UCLM–CSIC–JCCM, Ciudad Real, Spain Javier Alba–Tercedor Universidad de Granada, Granada, Spain Russell Alpizar–Jara University of Évora, Évora, Portugal Marco Apollonio Università degli Studi di Sassari, Sassari, Italy Pedro Aragón Universidad Complutense de Madrid, Madrid, Spain Miquel Arnedo Universitat de Barcelona, Barcelona, Spain Xavier Bellés Institut de Biología Evolutiva UPF–CSIC, Barcelona, Spain Agustín Camacho Instituto de Biociências–USP, São Paulo, Brasil David Canal MTA Centre for Ecological Research, Vácrátót, Hungary Salvador Carranza Institut de Biologia Evolutiva UPF–CSIC, Barcelona, Spain Luís Mª Carrascal Museo Nacional de Ciencias Naturales–CSIC, Madrid, Spain Pablo Castillo Institute for Sustainable Agriculture–CSIC, Córdoba, Spain Adolfo Cordero Universidad de Vigo, Vigo, Spain Mario Díaz Museo Nacional de Ciencias Naturales MNCN–CSIC, Madrid, Spain Darío Díaz Cosín Univ. Complutense de Madrid, Madrid, Spain José A. Donazar Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain Arnaud Faille Museum National histoire naturelle, Paris, France Jordi Figuerola Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain Gonzalo Giribet Museum of Comparative Zoology, Harvard University, Cambridge, USA Susana González Universidad de la República–UdelaR, Montivideo, Uruguay Jacob González-Solís Universitat de Barcelona, Barcelona, Spain Sidney F. Gouveia Universidad Federal de Sergipe, Sergipe, Brasil Gary D. Grossman University of Georgia, Athens, USA Ben J. Hatchwell University of Sheffield, Sheffield, UK Joaquín Hortal Museo Nacional de Ciencias Naturales MNCN–CSIC, Madrid, Spain Jacob Höglund Uppsala University, Uppsala, Sweden Damià Jaume IMEDEA–CSIC, Universitat de les Illes Balears, Esporles, Spain Miguel A. Jiménez–Clavero Centro de Investigación en Sanidad Animal–INIA, Madrid, Spain Jennifer A. Leonard Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain Jordi Lleonart Institut de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Josep Lloret Universitat de Girona, Girona, Spain Jorge M. Lobo Museo Nacional de Ciencias Naturales MNCN–CSIC, Madrid, Spain Pablo J. López–González Universidad de Sevilla, Sevilla, Spain Jose Martin Museo Nacional de Ciencias Naturales MNCN–CSIC, Madrid, Spain Santiago Merino Museo Nacional de Ciencias Naturales MNCN–CSIC, Madrid, Spain Manuel B. Morales CIBC–Universidad Autónoma de Madrid, Madrid Spain Juan J. Negro Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain Daniel Oro Centre d’Estudis Avançats de Blanes CEAB–CSIC, Girona, Spain Vicente M. Ortuño Universidad de Alcalá de Henares, Alcalá de Henares, Spain Miquel Palmer IMEDEA–CSIC, Universitaat de les Illes Balears, Esporles, Spain Per Jakob Palsbøll University of Groningen, Groningen, The Netherlands Reyes Peña Universidad de Jaén, Jaén, Spain Javier Perez–Barberia Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain Juan M. Pleguezuelos Universidad de Granada, Granada, Spain Oscar Ramírez Institut de Biologia Evolutiva UPF–CSIC, Barcelona, Spain Montserrat Ramón Institut de Ciències del Mar CMIMA–CSIC, Barcelona, Spain Alex Richter–Boix CREAF, Univ. Autònoma de Barcelona, Bellaterra, Spain Diego San Mauro Universidad Complutense de Madrid, Madrid, Spain Rafael Sardá Centre d’Estudis Avançats de Blanes CEAB–CSIC, Girona, Spain Ramón C. Soriguer Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain Constantí Stefanescu Museu de Ciències Naturals de Granollers, Granollers, Spain Diederik Strubbe University of Antwerp, Antwerp, Belgium Miguel Tejedo Madueño Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain José L. Tellería Universidad Complutense de Madrid, Madrid, Spain Simone Tenan MUSE–Museo delle Scienze, Trento, Italy Francesc Uribe Museu de Ciències Naturals de Barcelona, Barcelona, Spain José Ramón Verdú CIBIO, Universidad de Alicante, Alicante, Spain Carles Vilà Estación Biológica de Doñana EBD–CSIC, Sevilla, Spain Rafael Villafuerte Instituto de Estudios Sociales Avanzados IESA–CSIC, Cordoba, Spain Rafael Zardoya Museo Nacional de Ciencias Naturales MNCN–CSIC, Madrid, Spain
Animal Biodiversity and Conservation 43.2 (2020)
169
Prey availability influences the diet of Scinax fuscomarginatus in a Cerrado area, Central Brazil G. Michelin, K. Ceron, D. J. Santana
Michelin, G., Ceron, K., Santana, D. J., 2020. Prey availability influences the diet of Scinax fuscomarginatus in a Cerrado area, Central Brazil. Animal Biodiversity and Conservation, 43.2: 169–175, Doi: https://doi. org/10.32800/abc.2020.43.0169 Abstract Prey availability influences the diet of Scinax fuscomarginatus in a Cerrado area, Central Brazil. Prey availability in an environment may change seasonally and these changes should be considered as determinant factors for the diets of anurans. Scinax species are generalist predators that feed on arthropods, but data concerning their diet in relation to prey availability are lacking. In this study, we describe the diet of Scinax fuscomarginatus by evaluating its possibly generalist diet related to prey availability in its environment. We studied the diet of Scinax fuscomarginatus by analysing the stomach contents of 48 individuals captured in the Campo Grande municipality, Mato Grosso do Sul state, Brazil. We found eight prey categories, the most common and most representative being Hemiptera. The selectivity index of the two most important prey varied inversely between dry and wet seasons. Prey availability also varied between seasons. These results suggest a temporal pattern in prey composition and in the diet of Scinax fuscomarginatus. Key words: Amphibia, Cerrado, Natural history, Trophic ecology Resumen La disponibilidad de presas influye en la dieta de Scinax fuscomarginatus en una zona de Cerrado, en el centro de Brasil. La disponibilidad de presas en un entorno puede cambiar según la temporada y este cambio debe considerarse un factor determinante para las dietas de los anuros. Las especies de Scinax son depredadores generalistas que se alimentan de artrópodos; sin embargo, no hay datos sobre su dieta en relación con la disponibilidad de presas. En este estudio, describimos la dieta de Scinax fuscomarginatus mediante la evaluación de su posible dieta generalista con respectoa la disponibilidad de presas en su entorno. Estudiamos la dieta de Scinax fuscomarginatus mediante el análisis del contenido estomacal de 48 ejemplares capturados en el municipio de Campo Grande del estado de Mato Grosso do Sul, en Brasil. Encontramos ocho categorías de presas, de las cuales Hemiptera fue la más abundante y representativa. El índice de selectividad de las dos presas más importantes varió inversamente entre las estaciones seca y lluviosa. La disponibilidad de presas también varió entre las estaciones. Estos resultados sugieren la existencia de una pauta temporal en la composición de las presas y en la dieta de Scinax fuscomarginatus. Palabras clave: Amphibia, Cerrado, Historia natural, Ecología trófica Received: 17 VI 19; Conditional acceptance: 22 VIII 19; Final acceptance: 06 III 20 Giuseppe Michelin, Karoline Ceron, Diego José Santana, Mapinguari Lab, Instituto de Biociências, Universidade Federal de Mato Grosso do Sul, Cidade Universitária, CEP 79070–900, Campo Grande, Mato Grosso do Sul, Brazil. Corresponding author: K. Ceron. E–mail: adenomera@gmail.com ORCID ID: G. Michelin: 0000-0002-8032-1810; K. Ceron: 0000-0003-2354-3756; D. J. Santana: 0000-0002-8789-3061 ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
Michelin et al.
170
Introduction Understanding the diets of anurans is paramount to unveil their natural history and ecological impacts in both terrestrial and aquatic environments as amphibians help control the populations of many organisms and represent a link between terrestrial and aquatic environments (Toft, 1980, 1981; Duellman and Trueb, 1986; López et al., 2009). Despite great efforts to analyse the diets of anuran species, few approaches have considered prey availability in environments (Sabagh and Carvalho–e–Silva, 2008; Caldart et al., 2012; Araujo–Vieira et al., 2018). Some studies have already shown that prey availability can change seasonally, and these changes should be considered as a determinant factor for anuran diets (Cogălniceanu et al., 2001) as prey availability is intrinsically related to the trophic ecology of anurans (Kikuchi and Ueida, 1998; Ott and Carvalho, 2001; López et al., 2009). Amphibians are considered opportunistic and generalist predators (Vaz–Silva et al., 2005; Toledo et al., 2007; Neves et al., 2014), but some families (e.g., Microhylidae and Dendrobatidae) have specialized diets, feeding mostly on ants (Hymenoptera: Formicidae) and termites (Isoptera) (Attademo et al., 2007; Berazategui et al., 2007; Santana and Juncá, 2007; Forti et al., 2011). Tree frogs of the genus Scinax are considered generalist predators, commonly feeding on arthropods such as Araneae, Hemiptera, and Orthoptera, with the most commonly preyed order varying according to the species (Solé and Pelz, 2007; Teixeira and Rödder, 2007; Kittel and Solé, 2015; Blanco Torres et al., 2017). The snouted tree frog Scinax fuscomarginatus (A. Lutz, 1925) is characterized by its elongated body, small size (average snout–vent length: 23 mm), and yellowish back with wide dark brown sidebands (Brusquetti et al., 2014). It occurs in southern, central, and eastern Brazil (as far north as Piauí and Ceará, west to southern Amazonas), eastern Bolivia, Paraguay, and north–western Argentina (Leite Jr et al., 2008; Lima et al., 2017). Studies performed with the species have focused on taxonomy (Brusquetti et al., 2014), reproduction (Toledo and Haddad, 2005a, 2005b) and geographic distribution (Leite Jr et al., 2008; Lima et al., 2017), with no data about the diet of the species. Given the lack of information about this species’ natural history, and the importance of prey availability for anuran diets, the aim of this study was to describe the diet of Scinax fuscomarginatus, to verify whether the species has a generalist diet, as suggested for other species in the genus (Blanco Torres et al., 2017), and to evaluate whether this generalist diet is related to prey availability in its environment. We predicted that the diet of Scinax fuscomarginatus would be generalist without prey selection, as seen in most anurans. Material and methods Field survey We studied the diet of Scinax fuscomarginatus by analysing the stomach contents of 48 individuals (27 males and 21 females) captured at the Reserva
Particular do Patrimônio Natural (RPPN) Fazenda Santa Fé (–20.5131 ºS, –54.7277 ºW, 500 m a.s.l.) in the Campo Grande municipality, Mato Grosso do Sul state. We collected anurans and invertebrate specimens during the dry and wet season (July 2017 and December 2017, respectively). We sampled anurans by active search (Scott and Woodward, 1994) and visual and acoustic encounters (Zimmerman, 1994) along a swamp in the area. To estimate relative abundance of prey, we installed 20 pitfall traps (300 ml plastic cups) at the soil level in random locations around the swamp. The 70 % alcohol was used as a preservative in the traps, adding drops of detergent to break the surface tension of the solution. Pitfall traps were opened at sunset and removed at sunrise. These traps may underestimate some groups such as sedentary prey, flying insects, or Orthoptera. To avoid sampling bias, we used an entomological umbrella method for 30' to capture arboreal prey. Since invertebrates obtained in the diet are partially digested, we categorized the food items into operational taxonomic units (OTUs; Sneath and Sokal, 1962), usually to Order, except for the Formicidae family, which was separated from other Hymenoptera because of its unique morphological and ecological characteristics, and larvae, which are usually included in the same OTU (e.g., Lepidoptera larvae). The anuran specimens were killed using topical anaesthetic (Xylocaine 5 %) and then fixed with 10 % formaldehyde before analysing the stomach contents. We removed stomachs through a small abdominal incision and stored the contents in separate vials. To access the diet of frogs, the samples were killed as part of a large research project that studies anuran trophic networks (Fundect #71/700.146/2017). We preserved the frog individuals in 70 % alcohol. The captured specimens were housed at Coleção Zoológica de Referência da Universidade Federal de Mato Grosso do Sul (ZUFMS AMP 07800–07829). Diet composition We analysed the stomach content under a stereomicroscope and identified each item to order level. After measuring the length and width of each prey, we estimated their volumes using the formula of an ellipsoid: V = 4/3π * 2(W/2)2 * L/2 where, V is the volume, W the width, and L the length (Griffiths and Mylotte, 1987). For each item (prey category), we calculated the number, volume, and frequency of occurrence in both absolute and percentage values. We then calculated the Index of Relative Importance (IRI) to determine the relative importance of each prey item in the diet using the following formula, according to (Pinkas et al., 1971): IRI = (% N+% P) % FO where % N is equal to the relative number of each prey item per sample set, % P is equal to the mass percentage of each prey item in the sample set, and % FO represents the relative frequency of occurrence
Animal Biodiversity and Conservation 43.2 (2020)
171
Table 1. Diet of S. fuscomarginatus in both seasons (total), and in the dry and wet season: N, number of prey items found in total and as a percentage, where some individuals hold multiple items; F, number of individuals containing these prey items (frequency of prey items found) in total and as a percentage; V, volume in mm³ and in percentage; IRI, index of relative importance (important prey items are in bold). Tabla 1. Dieta de S. fuscomarginatus en ambas estaciones (total) y en la estación seca y la estación lluviosa: N, número de presas encontradas en total y en porcentaje, ya que algunos individuos contienen múltiples presas; F, número de individuos que contienen estas presas (frecuencia de presas encontradas) en total y en porcentaje; V, volumen en mm3 y en porcentaje; IRI, índice de importancia relativa (las presas importantes se señalan en negrita). Prey category
V (mm³)
V %
N
N %
F
3.00
33.57
F %
IRI
Total Araneae
17.43
58.67
Blattaria
9.36
21.14 1.00 5.00 1.00 6.67 112.36
Coleoptera
2.54
5.74
2.00 10.00 2.00 13.33 70.71
Formicidae
1.59
3.59
2.00 10.00 2.00 13.33 49.25
Hemiptera
26.04
61.67 15.00 102.86 8.00 66.67 3,623.57
Isoptera
15.54
45.90
3.00 24.29 3.00 33.33 628.18
3.29
1.00
Lepidoptera larvae 0.96
14.29
3.00 46.67 1,675.58
1.00
20.00
66.98
Dry season Araneae
0.89
2.01 1.00 5.00 1.00 6.67 16.72
Blataria
9.36
21.14 1.00 5.00 1.00 6.67 112.36
Coleoptera
2.54
5.74
2.00 10.00 2.00 13.33 70.71
Formicidae
1.59
3.59
2.00 10.00 2.00 13.33 49.25
Hemiptera
23.60
53.31 12.00 60.00 7.00 46.67 3,245.35
Isoptera
6.29
14.21
2.00 10.00 2.00 13.33 155.42
Wet season Araneae
16.54 56.66 2 28.57 2 40.00 1,658.85
Isoptera
9.25
31.69
1
14.29
1
20.00 472.76
Hemiptera
2.44
8.36
3
42.86
1
20.00 378.22
3.29
1
14.29
1
20.00
Lepidoptera larvae 0.96
on the entire samples (Krebs, 1999). Higher IRI values indicate greater importance of the prey category in the diet. We performed a PERMANOVA analysis to test whether diet composition varies between sexes, with euclidian distance, using the prey frequency. Statistical analyses were conducted in the R software v.3.4.2 (R Core Team, 2017) using the 'vegan' package (Oksanen et al., 2015) Prey selectivity With regard to prey selection in the environment, we compared the relative abundance of each prey category in the diet with the relative abundance of the same prey sampled in the environment. For this purpose, we used Vanderploeg and Scavia's Relativized Electivity Index (Vanderploeg and Scavia, 1979).
66.98
This index is calculated by first finding the selectivity coefficient for diet item i, Wi: Wi = (ri / pi) / S (ri / pi) where ri is the proportion of bites taken in each category i and pi is the proportional cover of each category i. The index Wi ranges from 0 (total avoidance) to 1 (total preference). The relativized index is: Ei = (Wi – 1/n) / (Wi + 1/n) where n represents the number of diet categories available. This index ranges from –1 to 1, with 0 indicating random selection, negative values indicating avoidance or inaccessibility of the prey item and positive values showing active selection.
Michelin et al.
172
Table 2. Seasonal variation in prey in the diet of Scinax fuscomarginatus and in the environment traps at the study site: n, number of items found; %, the number as a percentage; UI, unidentified invertebrate. Tabla 2. Variación estacional de presas en la dieta de Scinax fuscomarginatus y en las trampas colocadas en el sitio del estudio: n, número de presas encontradas; %, el número como porcentaje; UI, invertebrados sin identificar
Environment
Wet
Prey category
Diet Dry
Wet
Dry
n % n %
n % n %
Acari
1 0.38 0 0
0 0 0 0
Araneae
20 7.66 16 3.31
2 22.22 1 4.76
Blattaria
2
0.77 1 0.21
0
0
1 4.76
Coleoptera
22 8.43 12 2.48
0
0
2 9.52
Dermaptera
1 0.38 1 0.21
0
0 0 0
Diptera
23 8.81 39 8.06
0
0
0 0
Formicidae
154 59.00 226 46.69
0
0
2 9.52
Hemiptera
7
Hymenoptera
13 4.98 2 0.41
0
Isoptera
3
1
Lepidoptera
3 1.15 4 0.83
0
Lepidoptera larvae
1
0.38
0
0
1
11.11
0
0
Hymenoptera larvae
0
0.00
2
0.41
0
0
0
0
Orthoptera larvae
0
0.00
1
0.21
0
0
0
0
Mantodea
1 0.38 0 0
0 0 0 0
Myriapoda
2 0.77 0 0
0 0 0 0
Opiliones
1 0.38 0 0
0 0 0 0
Orthoptera
7 2.68 2 0.41
0
UI
0
2
2.68 174 35.95 1.15
0.00
4
0
Results Diet composition Diet composition did not differ between sexes (males = 27, females = 21, p = 0.1). We found eight prey categories, of which Hemiptera was the most representative group (N = 51.72 %), the most important prey category (IRI = 740.09) and the most volumetric prey (V = 61.67 %) (table 1). Blattaria and Lepidoptera larvae were the least frequent items, with a single occurrence. We found stomach contents in 48.93 % of all analysed stomachs. A total of 23 stomachs were empty. Prey selectivity Environmental sampling provided a total of 746 inver-
0.83
0
3
33.33 12 57.14 0 0 0 11.11
2
9.52
0 0 0
0 0 0 22.22
1
4.76
tebrates (484 in dry and 262 in wet seasons, respectively), representing 16 taxa in the dry season and 13 in the wet season (table 2). All prey categories found in Scinax fuscomarginatus stomach contents were also found in the sampled environment, suggesting that food resource estimations were represented by the use of pitfall traps and entomological umbrella. In contrast, 11 prey categories recorded in prey availability were not consumed by Scinax fuscomarginatus: Acari, Dermaptera, Diptera, Hymenoptera, Lepidoptera, Hymenoptera Larvae, Orthoptera Larvae, Mantodea, Myriapoda, Opiliones, and Orthoptera. In the dry season, Scinax fuscomarginatus positively selected only Hemiptera and negatively selected Araneae and Blattaria. However, in the wet season, Scinax fuscomarginatus showed a weakly positive selection for Isoptera and Araneae, but a weakly negative selection for Hemiptera (fig. 1).
Animal Biodiversity and Conservation 43.2 (2020)
–1 Lepidoptera larvae
–0.8
–0.6
173
Electivity index –0.4 –0.2 0 0.2 0.4
0.6
0.8
1
Dry season Wet season
Hemiptera
Prey category
Isoptera
Formicidae
Coleoptera
Blattaria
Araneae
Fig. 1. Vanderploeg and Scavia's (1979) electivity index E* for prey categories of Scinax fuscomarginatus diet. Fig. 1. Índice de selectividad de Vanderploeg y Scavia (1979), E*, para las categorías de presas de la dieta de Scinax fuscomarginatus.
Discussion The diet of Scinax fuscomarginatus was composed of eight prey categories, with Hemiptera being the most important category, followed by Araneae and Isoptera. The selectivity index of the two most important prey items varied inversely between the dry and rainy seasons, as did prey availability, suggesting a temporal pattern in prey composition and consumption. We found stomach contents in 48.93 % of all analysed stomachs, a higher percentage than that in the diet of some other previously studied Scinax: S. squalirostris (40 %; Kittel and Solé, 2015), S. rostratus (≅ 29 %) and S. ruber (40 %; Blanco Torres et al., 2017), S. granulatus (≅ 36 %) and S. perereca (≅ 34 %; Solé and Pelz, 2007), but lower than that in S. argyreornatus (≅ 83 %; Teixeira and Rödder, 2007). We did not find dietary differences between sexes, possibly due to the opportunistic and generalist habits of anurans (Toft, 1980). Hemiptera was the most important order for the diet of Scinax fuscomarginatus, in contrast with other Scinax species. Orthoptera was observed to be the most important order for Scinax rostratus and S. ruber (Solé and Pelz, 2007) and Arachnida have been found to be the most important prey for S. squalirostris (Kittel
and Solé, 2015). Most anurans are considered generalist predators of arthropods (Toledo et al., 2007). However, the diets of Scinax species studied thus far exhibit different categories of important prey, frequency and prey size (Blanco Torres et al., 2017). Scinax species are scansorial, like most hylids, perching on herbaceous plants or shrubs at swamp edges during the breeding season (Teixeira and Vrcibradic, 2004). Furthermore, they are considered active searchers (Teixeira and Rödder, 2007). We therefore consider microhabitat segregation is responsible for the differences among diets. These differences could be related to prey availability in the environment. The irregular conditions of the studied areas certainly influence the composition of invertebrates, changing prey availability in each habitat and leading to differences in anuran diets (López et al., 2009). However, none of the compared species showed prey availability in the environment, which made comparison among species difficult, since we could not draw conclusions about how species select these prey or whether they only feed on what is available in the environment. In our study, prey composition showed a seasonal pattern, reflected in prey selectivity varying during wet and dry seasons. The composition of invertebrates in an environment can change throughout a year in
174
relation to climatic variations, different requirements among species, and life history stages (Kikuchi and Ueida, 1998; Ott and Carvalho, 2001; Santana et al., 2015). During the dry season, S. fuscomarginatus showed no reproductive activity, which allowed it to hunt by the active search method and select prey items. In the dry season, S. fuscomarginatus positively selected Hemiptera, a common anuran prey. On the other hand, in the wet season, when individuals are focused on reproduction (males calling and females choosing males), predation was opportunistic. In the wet season, S. fuscomarginatus positively selected Isoptera (winged individuals), an easier prey as it lives in colonies and forms termite flocks (Rafael et al., 2012). In addition, Isoptera are a greater source of protein for anurans than other sclerotized prey such as Hemiptera and Coleoptera (Biavati et al., 2004). Proteins are essential in this season because anuran reproduction demands a greater amount of energy (Taigen and Wells, 1985). There is therefore a temporal pattern in prey availability and in anuran reproduction. As emphasized by Pough et al. (1992), besides the morphology and physiology of Scinax fuscomarginatus, prey availability and reproductive activity lead to the seasonal differences in hunting approaches and thus in diet. Acknowledgements This study was conducted with permission from the Brazilian wildlife regulatory service (SISBIO#56729–1) and with the approval of the Animal Ethics Committee of the Universidade Federal de Mato Grosso do Sul (CEUA#838/2017). The authors are grateful to Marina and João for giving their permission to study the area of RPPN Fazenda Santa Fé. GM thanks UFMS for his scholarship (PIBIC 095/2018). KC is grateful to Fundect (Fundação de Apoio ao Desenvolvimento de Ensino, Ciência e Tecnologia do Mato Grosso do Sul) for her scholarship (# 71/700.146/2017). DJS thanks CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico) for his research fellowship (311492/2017–7). References Araujo–Vieira, K., Gonçalves, U., Guedes dos Santos J., Gomes Ferreira, T., Skuk, G., 2018. Feeding habits of the bromeligenous treefrog Phyllodytes edelmoi Peixoto, Caramaschi & Freire, 2003 (Anura: Hylidae) from the State of Alagoas, Northeastern Brazil. Cuadernos de Herpetologia, 32: 5–13. Attademo, A. M., Peltzer, P. M., Lajmanovich, R. C., 2007. Feeding habits of Physalaemus biligonigerus (Anura, Leptodactylidae) from soybean field of Córdoba Province, Argentina. Russia Journal of Herpetology, 14: 1–6. Berazategui, M., Camargo, A., Maneyro, R., 2007. Environmental and seasonal variation in the diet of Elachistocleis bicolor (Guérin–Méneville 1838) (Anura: Microhylidae) from northern Uruguay.
Michelin et al.
Zoological Science, 24: 225–231. Biavati, G. M., Wiederhecker, H. C., Colli, G. R., 2004. Diet of Epipedobates flavopictus (Anura: Dendrobatidae) in a Neotropical savanna. Journal of Herpetology, 38: 510–518. Blanco Torres, A., Duré Pitteri, M. I., Bonilla, M. A., 2017. Trophic ecology of Scinax rostratus (Peters, 1863) and Scinax ruber (Laurenti, 1768) (Anura: Hylidae) in tropical dry forests of northern Colombia. Herpetology Notes, 10: 405–409. Brusquetti, F., Jansen, M., Barrio–Amorós, C., Segalla, M., Haddad, C. F. B., 2014. Taxonomic review of Scinax fuscomarginatus (Lutz, 1925) and related species (Anura; Hylidae). Zoological Journal of the Linnean Society, 171: 783–821. Caldart, V. M., Iop, S., Bertaso, T. R. N., Cechin, S. Z., 2012. Feeding ecology of Crossodactylus schmidti (Anura: Hylodidae) in southern Brazil. Zoological Studies, 51: 484–493. Cogălniceanu, D., Palmer, M. W., Ciubuc, C., 2001. Feeding in anuran communities on islands in the Danube floodplain. Amphibia–Reptilia, 22: 1–19. Duellman, W. E., Trueb. L., 1986. Biology of Amphibians. The Johns Hopkins University Press, Baltimore. Forti, L. R., Tissiani, A. S. O., Mott, T., Strüssmann, C., 2011. Diet of Ameerega braccata (Steindachner, 1864) (Anura: Dendrobatidae) from Chapada dos Guimarães and Cuiabá, Mato Grosso state, Brazil. Brazilian Journal of Biology, 71: 189–196. Griffiths, R., Mylotte, V., 1987. Microhabitat selection and feeding relations of smooth and warty newts, Triturus vulgaris and T. cristatus, at an upland pond in mid–Wales. Ecography, 10: 1–7. Kikuchi, R., Ueida, V. S., 1998. Composição da comunidade de invertebrados de um ambiente lótico tropical e sua variação espacial e temporal. Oecologia Brasiliensi, 5: 157–173. Kittel, R. N., Solé, M., 2015. Diet of the striped snouted treefrog Scinax squalirostris (Anura: Hylidae) in southern Brazil. Herpetology Notes, 8: 157–160. Krebs, C. J., 1999. Ecological methodology. Menlo Park, Addison Wesley Longman, New York. Leite Jr., J. M. A., Sampaio, J. M., Silva–Leite, R. R., Toledo, L. F., Loebmann, D., Leite, J. R. S., 2008. Amphibia, Anura, Hylidae, Scinax fuscomarginatus: Distribution extension. Check List, 4: 475–477. Lima, J. R. F., Lima, J. D., Lima, S. D., Silva, R. B. L., Andrade, G. V. de., 2017. Amphibians found in the Amazonian Savanna of the Rio Curiaú Environmental Protection Area in Amapá, Brazil. Biota Neotropica, 17: e20160252. López, J. A., Scarabotti, P. A., Medrano, M. C., Ghirardi, R., 2009. Is the red spotted green frog Hypsiboas punctatus (Anura: Hylidae) selecting its preys? The importance of prey availability. Revista de Biologia Tropical, 57: 847–857. Neves, M. de O., Morais, C. J. da S., Garda, A. A., 2014. Sexual dimorphism and diet of Pseudis tocantins (Anura, Hylidae, Pseudae). South American Journal of Herpetoly, 9: 177–182. Oksanen, J. F., Blanchet, G., Kindt, R., Legendre, P., Minchin, P. R., O'Hara, R. B., Wagner, H., 2015.
Animal Biodiversity and Conservation 43.2 (2020)
Vegan: community ecology, R package. Available online at: http://CRAN.R–project.org/package=vegan [Accessed on 16 June 2019]. Ott, A. P., Carvalho, G. S., 2001. The assembly of the Homopteran (Hemiptera: Auchenorrhyncha) of grasslands at Viamao County, Rio Grande do Sul State, Brazil. Neotropical Entomology, 30: 233–243. Pinkas, L., Oliphant, M. S., Iverson, I. L. K., 1971. Food habits of albacore, bluefin tuna, and bonito in California waters. California Department of Fish and Game's Fish Bulletin, 152: 1–105. Pough, F. H., Magnusson, W. E., Ryan, M. J., Wells, K. D., Taigen, T. L., 1992. Behavioral energetics. In: Environmental Physiology of the Amphibians: 395–436 (M. E. Feder, W. W. Burggren, Eds.). University of Chicago Press, Chicago. Rafael, J., Melo, G. A., Carvalho, C., Casari, S., Constantino, R., 2012. Insetos do Brasil: diversidade e taxonomia. Ribeirão Preto (SP), Holos. R Core Team, 2017. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Available online at: https:// www.R–project.org/ [Accessed on 16 June 2019]. Sabagh, L. T., Carvalho–e–Silva, A. M., 2008. Feeding overlap in two sympatric species of Rhinella (Anura: Bufonidae) of the Atlantic Rain Forest. Revista Brasileira de Zoologia, 25: 247–253. Santana, A., Juncá, F., 2007. Diet of Physalaemus cf. cicada (Leptodactylidae) and Bufo granulosus (Bufonidae) in a semideciduous forest. Brazilian Journal of Biology, 67: 125–131. Santana, H., Silva, L., Pereira, C., Simião–Ferreira, J., Angelini, R., 2015. The rainy season increases the abundance and richness of the aquatic insect community in a Neotropical reservoir. Brazilian Journal of Biology, 75: 144–151. Scott, N. J., Woodward, B. D., 1994. Surveys at breeding sites. Measuring and monitoring biological diversity: standard methods for amphibians. In: Measuring and Monitoring Biological Diversity: Standard methods for amphibians: 118–125 (R. Heyer, A. Maureen, M. Donnelly, F. Mercedes, R. Mcdiarmid, Eds.). Smithsonian Books, Washington. Sneath, P. H., Sokal, R. R., 1962. Numerical taxonomy. Nature, 193: 855–860. Solé, M., Pelz, B., 2007. Do male tree frogs feed during the breeding season? Stomach flushing of
175
five syntopic hylid species in Rio Grande do Sul, Brazil. Journal of Natural History, 41: 2757–2763. Taigen, T. L., Wells, K. D., 1985. Energetics of vocalization by an anuran amphibian (Hyla versicolor). Journal of Comparative Physiology B, 155: 163–170. Teixeira, R., Rödder, D., 2007. Diet, foraging strategy and reproduction of Scinax argyreornatus (Miranda–Ribeiro, 1926) from a mountainous region of the Atlantic rainforest in southeastern Brazil. Herpetozoa, 19: 161–173. Teixeira, R. L., Vrcibradic, D., 2004. Ecological aspects of Scinax argyreornatus (Anura, Hylidae) from a cacao plantation in Espírito Santo state, southeastern Brazil. Boletim do Museu de Biologia Mello Leitão, 17: 35–43. Toft, C. A., 1980. Feeding ecology of thirteen syntopic species of anurans in a seasonal tropical environment. Oecologia, 45: 131–141. – 1981. Feeding ecology of Panamanian litter anurans: patterns in diet and foraging mode. Journal of Herpetology, 15: 139–144. Toledo, L., Haddad, C., 2005a. Reproductive biology of Scinax fuscomarginatus (Anura, Hylidae) in south–eastern Brazil. Journal of Natural History, 39: 3029–3037. – 2005b. Acoustic repertoire and calling behavior of Scinax fuscomarginatus (Anura, Hylidae). Journal of Herpetology, 39: 455–464. Toledo, L. F., Ribeiro, R. S., Haddad, C. F. B., 2007. Anurans as prey: an exploratory analysis and size relationships between predators and their prey. Journal of Zoology, 271: 170–177. Vanderploeg, H., Scavia, D., 1979. Two electivity indices for feeding with special reference to zooplankton grazing. Journal of the Fisheries Research Board of Canada, 36: 362–365. Vaz–Silva, W., Frota, J., Prates–Júnior, P. H., Silva, J. S. B., 2005. Dieta de Lysapsus laevis Parker, 1935 (Anura: Hylidae) do médio rio Tapajós, Pará, Brasil. Comunicações do Museu de Ciências e Tecnologia da PUCRS Série Zoologia, 18: 3–12. Zimmerman, B. L., 1994. Audio strip transects. In: Measuring and monitoring biological diversity. Standard methods for amphibians: 92–97 (R. Heyer, A. Maureen, M. Donnelly, F. Mercedes, R. McDiarmid, Eds.). Smithsonian Books, Washington.
176
Michelin et al.
Animal Biodiversity and Conservation 43.2 (2020)
177
Temporal changes in the diet of two sympatric carnivorous mammals in a protected area of south–central Chile affected by a mixed–severity forest fire A. H. Zúñiga, J. R. Rau, V. Fuenzalida, A. Fuentes–Ramírez
Zúñiga, A. H., Rau, J. R., Fuenzalida, V., Fuentes–Ramírez, A., 2020. Temporal changes in the diet of two sympatric carnivorous mammals in a protected area of south–central Chile affected by a mixed–severity forest fire. Animal Biodiversity and Conservation, 43.2: 177–186, Doi: https://doi.org/10.32800/abc.2020.43.0177 Abstract Temporal changes in the diet of two sympatric carnivorous mammals in a protected area of south–central Chile affected by a mixed–severity forest fire. Fire is a significant disruptive agent in various ecosystems around the world. It can affect the availability of resources in a given area, modulating the interaction between competing species. We studied the diet of the culpeo fox (Lycalopex culpaeus) and cougar (Puma concolor) for two consecutive years in a protected area of southern–central Chile which was affected by a wildfire. Significant differences were observed in the dietary pattern between the two species, showing their trophic segregation. In the two years of the study, the predominant prey for cougar was an exotic species, the European hare (Lepus europaeus), implying a simplification of its trophic spectrum with respect to that reported in other latitudes. The ecological consequences related to this scenario are discussed. Key words: Dietary overlap, Predation, Post–fire dynamics, Microhabitat, Rodent cycles, Selectivity Resumen Cambios temporales en la dieta de dos mamíferos carnívoros simpátridas en una zona protegida del centro y el sur de Chile afectada por un incendio forestal de intensidad desigual. El fuego es un importante agente perturbador en varios ecosistemas de todo el mundo que puede afectar a la disponibilidad de recursos en una zona determinada, regulando la interacción entre especies competidoras. Estudiamos la dieta del zorro culpeo (Lycalopex culpaeus) y el puma (Puma concolor) por dos años consecutivos en un zona protegida del centro y el sur de Chile que se vio afectada por un incendio forestal. Se observaron diferencias significativas en el régimen alimentario de ambas especies, lo que pone de manifiesto su segregación trófica. En los dos años del estudio, la presa predominante del puma fue una especie exótica: la liebre europea (Lepus europaeus), lo que sugiere una simplificación de su espectro trófico respecto a lo reportado en otras latitudes. Se analizan las consecuencias ecológicas de este hecho. Palabras clave: Superposición alimentaria, Depredación, Dinámicas posteriores a un incendio, Microhábitat, Ciclos de roedores, Selectividad Received: 28 XI 19; Conditional acceptance: 04 II 20; Final acceptance: 26 III 20 Alfredo H. Zúñiga, Jaime R. Rau, Laboratorio de Ecología, Departamento de Ciencias Biológicas and Biodiversidad, Universidad de Los Lagos, Osorno, Chile.– Alfredo H. Zúñiga, Programa de Doctorado en ciencias mención conservación y manejo de Recursos Naturales, Universidad de Los Lagos, Puerto Montt, Chile.– Víctor Fuenzalida, Consultora Ambientes del Sur, Temuco, Chile.– Andrés Fuentes–Ramírez, Laboratorio de Biometría, Departamento de Ciencias Forestales, Universidad de La Frontera, Temuco, Chile and Instituto de Ecología y Biodiversidad, Santiago, Chile. Corresponding author: Alfredo H. Zúñiga. E–mail: zundusicyon@gmail.com ORCID ID: A. H. Zúñiga: 0000-0002-0504-7540; J. R. Rau: 0000-0003-0444-578X; V. Fuenzalida: 0000-0003-3044-9610; A. Fuentes–Ramírez: 0000-0003-1258-7462 ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
Zúñiga et al.
178
Introduction Physical disturbances caused by fire are one of the main modifying agents in natural ecosystems. Largely due to the combustion of plant mass (Bond and Keeley, 2005), such disturbances can alter microhabitats, with constraints for the wild fauna (Picket and White, 1985). The changes that forest fires cause in regard to the availability of resources can alter the dynamics of specie' interactions by dividing the use of resources (Schoener, 1974). In such severe disturbances, species must find alternative mechanisms of co–use of the resources to make their coexistence possible in this new ecological context (Wiens, 1977). Carnivores are a group of special relevance in the structuring of ecosystems due to the regulatory role they exert over the species at lower positions of the food web (Hairston et al., 1960). However, fires can cause significant changes in prey availability interactions, affecting the local species composition (Bouchert et al., 2014). Studies in the Northern Hemisphere (i.e., North America) concerning the response of predators to their prey in a context of disturbances caused by fire have found significant changes in predators’ response in terms of the availability of prey (Bouchert, 2013; Cunningham et al., 2006). In contrast, in the Southern Hemisphere, and particularly in South America, the effect of forest fires on the diet of syntopic predators is largely unknown. This is of special importance for their conservation considering the low adaptability of the vegetation in this biogeographical area to high– severity fires (Montenegro et al., 2004). Consequent changes to the composition of local fauna (Johnston and Odum, 1956) as an outcome of the recovering process in the burned areas are probable. The remaining native forest in southern Chile is characterized by its insularity compared to the rest of the Neotropic region, which is reflected in a high degree of endemism (Murúa, 1996). Among the predators present in the native forests of southern Chile, the most extended species are cougar (Puma concolor Linnaeus 1781) and culpeo fox (Lycalopex culpaeus Molina 1782) (Iriarte and Jaksic, 2012).The cougar is a big cat, with a wide distribution in the Neotropic region. It hunts a wide variety of prey, with sizes that vary between 1 and 60 kg (Iriarte et al., 1990; Iriarte and Jaksic, 2012). In some cases, the cougar preys on species linked to human settlement, like cattle and poultry, causing socio–ecological conflicts (Polisar et al., 2003). In the mountainous area of southern Chile, the cougar presents a context–dependent mixed pattern, in which it feeds on native fauna, as well as exotic and domestic animals, such as lagomorphs and cattle (Rau and Jiménez, 2002). On the other hand, the culpeo fox (Lycalopex culpaeus) is a medium–sized canid with a reported preference for small mammals (Zúñiga and Fuenzalida, 2016), but it could prey on larger herbivores (Novaro et al., 2009), possibly competing with the cougar for some prey. This could be particularly true in central–southern Chile, since according to national records the cougar is smaller here (Vidal, 2015), whereas the culpeo fox is larger at these higher latitudes in Chile (Fuentes and
Jaksic, 1979). Intense competitive dynamics can be expected where the differentiation of predator size is reduced (Gittleman, 1985). Additionally, forest fires not only affect the consumption of prey of both syntopic predators but also their dietary overlap (Pia, 2013). This can present relevant ecological consequences, as noted in reports of cougar attacks on canids of similar size to the culpeo fox, i.e., intraguild predation (Mazzolli, 2009), which would affect their persistence over time on a local scale. The aim of this study was to determine the diet of two syntopic predators, the culpeo fox and the cougar, in a protected area of central–southern Chile that was affected by a high–severity forest fire (Fuentes–Ramírez et al., 2018). Knowledge of the predation patterns of these species will help to determine their responsiveness in the event of a fire, helping to improve the design and implementation of recovery actions for this ecosystem. Materials and methods Study area and description of the forest fire The present study was conducted at the China Muerta National Reserve, in the foothills zone of the Region of La Araucanía, in central–southern Chile (38º 42' 00'' S–71º 26' 00'' W). The Reserve encompasses 1,1170 ha (CONAF, 2014), with an irregular and rugged topography and an altitude that ranges from 800 to 1,850 m a.s.l. The climate fluctuates between temperate to warm throughout the year, with fewer than 4 months of drought (in the summer season from December to March), and with ice and snow due to the effect of the altitude in winter and spring (Köeppen, 1948). The mean temperature is 19 ºC in summer and 5 ºC in winter. The mean precipitation is 2,500 mm. The study area belongs to the Andean–Patagonian deciduous forest included in the mountain range sub–region of La Araucanía (Gajardo, 1995). The native trees of most note are Araucaria araucana, Nothofagus pumilio and N. dombeyi. In the bush stratum, Chusquea culeou, Maytenus disticha and Gaultheria poepiggi are of note (Luebert and Pliscoff, 2006). The forest fire that affected the China Muerta National Reserve began on March 14, 2015 and was brought under control 23 days later, on April 6.The total surface affected by the fire, obtained through flyovers made during the monitoring operations and with field exams, was 3,765 ha, which excludes lands at high peaks with no vegetation and rocky terrains (CONAF, 2015). The levels of severity obtained were based on qualitative features, which varied between superficial damage of shrubs and canopy of trees, to carbonization of trees and disappearance of herbaceous and shrubby vegetation (CONAF, 2015). Feces collection and dietary analyses From December to May of 2017 and 2018 (summer–autumn in the Southern Hemisphere; second and third year post–fire, called hereafter the first and
Animal Biodiversity and Conservation 43.2 (2020)
second year), feces were collected from the culpeo fox and cougar along the route of the study area on the authorized trails. These trails included sites with no burning and sites affected by the fire. The sampling effort included an approximate surface of 1,000 ha, including burned and unburned sites. The feces of the species were recognized according to morphological criteria (Chame, 2003; Muñoz–Pedreros, 2010) and photographic records in the study area (Kays and Slauson, 2008). Later, feces were labeled and kept in paper bags for their analysis in the laboratory. There are no recordings of other carnivores in the area. In the laboratory, the samples were dried at 60 ºC and then separated manually to obtain the remains of the prey. The prey was identified by recognition of its cranial and dental morphological patterns in the case of rodents (Reise, 1973; Pearson, 1995), and of cuticular patterns of hairs and feathers for mammals and birds in general (Day, 1966). Reference collections were used for the rest of the taxa. To quantify the diet of the culpeo fox and cougar, we determined the relative frequency (RF) of the prey items based on the total observed (Rau, 2000). To estimate the dietary breadth of each predator, we used a trophic diversity index (β; Levins, 1968); establishes the use of the resources based on the total items observed. The standard deviation of this index was calculated using the jackknife method (Jaksic and Medel, 1987). To determine the interannual effect on diet, the standardized niche breadth index was used (Colwell and Futuyma, 1971) to compare the two years, due to differences in the availability of resources. The trophic niche overlap was evaluated using Pianka’s (1973) index, which considers the food items shared by the two species. Hutchenson's (1970) procedure was used to evaluate the diversity of the two predators, while pairwise comparisons were applied to assess the differences between species and the sampling periods. In order to evaluate the effect of the prey biomass on the dietary pattern of the two carnivores, we used the trophic isocline method (Kruuk and De Kock, 1980), using the total number of prey recorded in both years. This procedure is justified because it provides a more general picture of the importance of the prey biomass consumed by both predators. The estimation of prey biomass was based on the weight measurements reported by Amaya et al. (1979), Muñoz–Pedreros and Yáñez (2009) and Norambuena and Riquelme (2014). Due to their low contribution in terms of biomass, reptiles and arthropods were not included in this representation. We also calculated the geometrical mean of prey consumed for each species and study year (Jaksic and Braker, 1983). Rodent selectivity by the culpeo fox The frequency of rodent consumption by the culpeo fox was compared to the expected proportion of rodent species, which was obtained through live captures in Sherman traps (total sampling effort: 6,960 traps/night). These capture frequencies were seen as the availability of prey in the environment, and their respective comparisons were made by fit
179
testing (Sokal and Rohlf, 1995), which demonstrates the selectivity of this predator for a specific prey. We calculated Bonferroni confidence intervals when the comparison between the observed and expected frequencies was significant (Byers et al., 1984). This analysis was done using the HABUSE 4.0 program, which made it possible to determine this predator’s type of selectivity (i.e., refusal, neutral, or positive). The capture frequencies considered were obtained in the autumn months of each of the two sampling years, which is when the largest number of records of rodents and carnivores were obtained. Results A total of 52 feces were collected, 36 of which corresponded to culpeo fox (22 in 2017 and 14 in 2018) and 16 to cougar (10 in 2017 and six in 2018; table 1). In the case of the culpeo fox, 23 feces (19 in 2017 and four in 2018) were found at unburned sites, and 13 (four in 2017 and nine in 2018) at burned sites. Of these, eight (five in 2017 and three in 2018) were in low severity and four were in high severity fire sites. In the case of the cougar, six feces (four in 2017 and two in 2018) were at unburned sites, and 10 (six in 2017 and four in 2018) were at burned sites. Of these, three (two in 2017 and one in 2018) were at sites of medium fire severity, whereas seven (four in 2017 and three in 2018) were observed at high–severity sites. A total of eight trophic items were identified through feces, with five for culpeo fox and four for cougar, of which only one was shared by both species. The European hare, Lepus europaeus, was the only lagomorph seen and recorded by camera traps. From the relative consumption frequencies it can be seen that for the culpeo fox most of its dietary breadth in the first year consisted of rodents, followed by birds (order Passeriformes) (fig. 1). However, in the second year this pattern changed, with arthropods being the item of greatest frequency of consumption, reducing the proportion of rodents captured to almost half that of the previous year. Diversity of prey consumed showed significant differences between the years 1 and 2 (table 2). In the case of the cougar, lagomorph hares represented the core of its diet (fig. 1), with a proportion of consumption that increased in the second year. It is important to emphasize that in the second year the richness of prey decreased noticeably, with two types of prey consumed. Birds of the Order Anseriformes (Chloephaga sp.) had a similar representation in both years. No statistical differences in the diversity of prey were detected when both years were compared (table 2). Regarding the dietary overlap between the two species, Pianka's index was b = 0.069 for the first sampling year and b = 0.054 for the second year. This low overlap was reinforced when the dietary breadth of the two species was compared between the sampling years and showed to be significantly different (table 2). Regarding the effect of biomass on the consumption frequency of the two predators, in the
Zúñiga et al.
180
Table 1. Dietary composition, dietary breadth and overlap for Lycalopex culpaeus and Puma concolor in the China Muerta National Reserve, sampling years 1 and 2 (2 and 3 post–fire). Tabla 1. Composición, amplitud y superposición de la dieta de Lycalopex culpaeus y Puma concolor en la Reserva Nacional China Muerta, en los años de muestreo 1 y 2 (2 y 3 después del incendio).
Culpeo fox
Cougar
First year
Second year
First year
Second year
Abrothrix longipilis
10 (23.25)
7 (12.72)
–
–
Abrothrix olivaceus
7 (16.27)
1 (1.81)
–
–
Mammals Rodents, Cricetidae
Irenomys tarsalis
3 (6.97)
1 (1.81)
–
–
Oligoryzomys longicaudatus
7 (16.27)
10 (18.18)
–
–
–
–
1 (6.67)
–
3 (6.97)
3 (5.45)
9 (60)
8 (66.67)
–
–
1 (6..67)
–
Indeterminate Passeriformes
6 (13.95)
8 (14.54)
–
–
Indeterminate Anseriformes
–
–
4 (26.66)
4 (33.33)
3 (6.93)
–
–
–
4 (9.30)
5 (45.45)
–
–
22
16
10
6
6.67 + 0.58
3.56 + 3.82
2.27 + 4.52
1.12 + 0.64
0.70
0.36
0.31
0.06
Rodents, Echymidae Myocastor coypus Rodents, Lagomorpha Lepus europaeus Artiodactyla Sus scrofa Birds
Reptiles Liolaemus sp. Arthropods Indeterminate arthropods Number of feces Dietary breadth (β) Standardized niche (Bsta)
case of the cougar the consumption of hares this was over the isocline of 50 % (fig. 2), whereas the recently introduced wild boar Sus scrofa (Skewes et al., 2012) and birds were positioned in the intermediate isoclines (between 5 and 20 %), with the representation of the aquatic rodent coypu, Myocastor coypus, below 1 %. In contrast, the culpeo fox maintained the consumption of hares above the isocline of 20 %, the cricetid Abrothrix longipilis between 1 and 5 %, and the rest of the species was under the isocline of 1 %.The geometrical mean of the weight of the culpeo fox's prey was 40.71 and 10.38 g for the first and second year respectively, and for the cougar it was 7,079.95 g and 5,361.64 g for the same periods. A comparison of the frequencies of rodent trapping and rodent consumption by the culpeo fox revealed
differences in abundance terms between sampling year. In the first year, a non–significant relation was obtained between consumption and trapping frequencies of the three rodent species (x2 = 3.121, p = 0.20), suggesting that prey consumption occurred at random according to prey availability (table 3). However, in the second year this trend changed significantly (x2 = 173.274, p < 0.0001), resulting in a lower consumption than expected for Abrothrix olivaceus, but a higher consumption than expected for Oligoryzomys longicaudatus, a reservoir native rodent species and transmitter of the Hanta virus in Chile (Murúa, 1999). It should be noted that in the case of Irenomys tarsalis, this species of tree rodent was not detected in the Sherman traps, although it was in the feces, so it was not included in the analysis.
Animal Biodiversity and Conservation 43.2 (2020)
80
Culpeo first year
70
Culpeo second year Cougar first year
60 Percentage
181
Cougar second year
50 40 30 20 10 0
Crc.
Ech.
Lag.
Art.
Pas.
Ans.
Lz.
Arth.
Fig. 1. Percentage representation of the dietary items consumed by the culpeo fox and cougar in the study area for the two consecutive sampling years (2017–2018): Crc., Cricetidae; Ech., Echimyidae; Lag., Lagomorpha; Art., Artiodactyla; Pas., Paseriformes; Ans., Anseriformes; Lz., Lizards; Arth., Arthropods. Fig. 1. Porcentaje de la representación de los alimentos consumidos por el zorro culpeo y el puma en la zona de estudio durante los dos años de muestreo consecutivos (2017 y 2018): Crc., cricétidos; Ech., equimíidos; Lag., lagomorfos; Art., artiodáctilos; Pas., paseriformes; Ans., anseriformes; Lz., lacertilios; Arth., artrópodos.
Discussion Reports from the same biogeographical area show differences in the dietary range of the culpeo fox and the cougar the (Rau and Jiménez, 2002; Zúñiga and Fuenzalida, 2016), revealing a simplification in the local food supply. These differences could be attributed in the first term to the structural change in the prey assemblage in the study area due to the fire, which would reduce abundance and the incorporation of exotic species. The great capacity of canivores to move large generally exceeds the capture areas of their prey (Carbone and Gittleman, 2002), and it is therefore not possible to infer the place of capture of the prey through the feces detection site. However, both species would present differences in the use of space, a situation that has been detected in the coastal mountain range (Zúñiga et al., 2017 allowing them to use the mosaic produced by fire in a differentiated way. Disturbances by fire in native forest are regarded to promote the occurrence of exotic species, where the lagomorphs in particular benefit from the particularities of the microhabitats produced by the fire (Sokos et al., 2016), a situation that has been maintained systematically through different types of disturbances in the Chilean territory (Jaksic et al., 2002). The presence of lagomorphs in the study area would stimulate changes in the predators' feeding habits (Rubio et al., 2013), affecting the predation on native prey (Novaro et al., 2000), and therefore on the control the carnivores exert over this group. However, the effect of the fire on the hares could show variations in abundance over time (Sokos et al., 2016), which would vary the predation rate exerted on this group.
In the case of the cougar, the relative absence of medium to large native species in the study area has been compensated for by the consumption of hares, the largest species in the study area, with the exception of the introduced wild boar and sporadic groups of cattle wandering on the Reserve. Despite this, there are no records of cattle consumption by cougar. Consumption of coypu (Myocastor coypus),
Table 2. Comparison of the dietary diversity of the cougar and culpeo fox throughout the two sampling years. Tabla 2. Comparación de la diversidad de la dieta del puma y el zorro culpeo durante los dos años de muestreo. Comparisons
T–value
p–value
Culpeo fox first year vs. second year
2.63 0.0090
Cougar first year vs. second year
1.40
0.1849
Cougar vs. culpeo fox first year
9.58
< 0.0001
Cougar vs. culpeo fox second year
7.70
< 0.0001
Zúñiga et al.
182
Table 3. Consumption frequency of the culpeo fox Lycalopex culpaeus in relation to observations from Sherman traps, with the signs in the brackets (–), (+) or (=) establishes the type of selection by the corresponding prey (chance, positive or negative), according to Bonferroni intervals. Tabla 3. Frecuencia de consumo del zorro culpeo, Lycalopex culpaeus, en relación con las observaciones de las trampas Sherman; los signos entre paréntesis (–), (+) e (=) establecen el tipo de selección para la presa correspondiente (neutra, positiva o negativa), de acuerdo con los intervalos de Bonferroni.
Cricetid species
Consumption frequency (observed/expected)
Bonferroni's confidence intervals
First year Abrothrix longipilis
(0.370/0.530)
(0.138–0.602) (=)
Abrothrix olivaceus
(0.259/0.269)
(0.049–0.470) (=)
Oligoryzomys longicaudatus
(0.259/0.158)
(0.049–0.470) (=)
Irenomys tarsalis
(0.111/0.040)
(0.000–0.272) (=)
Abrothrix longipilis
(0.388/0.454)
(0.114–0.664) (=)
Abrothrix olivaceus
(0.055/0.515)
(0.000–0.185) (–)
Oligoryzomys longicaudatus
(0.555/0.030)
(0.275–0.836) (+)
Second year
which despite its size (10 kg; Muñoz–Pedreros and Gil, 2009) presents a lower occurrence, similar to that observed in the Central Valley (Zúñiga and Muñoz–Pedreros, 2014), showing casual consumption events. In the case of the birds of the Anatidae family, their systematic consumption in both study years suggests the importance of this prey in the study area. This observation is evidenced in trophic isoclins, where its frequency of consumption stands out. Also, its intermediate size (ca. 3 kg) could be a significant complement to the cougar’s energy requirements. Reports of consumption of this type of birds have been found in areas with presence of wetlands (Rau and Jiménez, 2002). It is therefore of interest to determine whether in the study area the cougar would positively select these habitats, given its feeding behaviour. On the other hand, the record of wild boar captured by this feline, the other exotic species observed as prey in the study area, has only recently been recorded from reports of predation by cougars (Skewes et al., 2012), suggesting that its consumption at present would be of very low frequency. This is supported by observations in the study area that reveal that wild boars are concentrated in areas of lower altitude, presenting only occasional migrations of isolated individuals to areas of higher altitude (Gastón León, pers. comm.). The dietary records obtained for the culpeo fox agree partially with observations made for this canid in this biogeographical area (Zúñiga and Fuenzalida, 2016), where rodents were the main trophic category of this species, which establishes a large differentiation with the cougar. The differences of capture between species would be explained by their use of the space,
which determines the likelihood of their capture (Simonetti, 1989; Vásquez, 1996).Thus, the greater representation of consumption by the two species of the genus Abrothrix seems to follow the generalist nature of both rodents in terms of microhabitat use, having been found at sites with low vegetation cover (Glantz, 1984), and to a lesser extent on O. longicaudatus, a scansorial species, since their preferential spatial habits are arboreal (Murúa et al., 1986). In the case of the tree mouse Irenomys tarsalis, its low consumption frequency could be a result of the smaller abundance due to the loss of trees and canopy as a result of the fire, which constitute its main microhabitat, given their predominantly arboreal habits (Kelt, 1993; Rau et al., 1995). Consequently, this rodent is one of the culpeo fox’s trophic items most affected by the fire. The consumption of lagomorphs by the culpeo fox is less than reported in other locations (Rubio et al., 2013; Zúñiga and Fuenzalida, 2016), which assumes an effect of interference by the cougar, spatially restricting the culpeo fox (Zúñiga et al., 2017). The dietary range of both species showed a divergence pattern based on the size of the captured prey. This trend is reinforced through the geometrical mean estimated for each predator. The trophic isoclines demonstrate that the cougar and the culpeo fox have a markedly different diet habit and the importance of their prey in a biomass/consumption frequency ratio. Thus, for the cougar, the hare was found above the 50 % isocline, which reveals the relevance of this item compared to larger prey, but of lower frequency in the scats, and therefore a lower capture rate. In contrast, for the culpeo fox, the hare was between the 20 % and 50 % isocline, which implied an intermediate impor-
Animal Biodiversity and Conservation 43.2 (2020)
183
Culpeo fox 100 90
Lag
Cougar
40
Sus
40 50 %
30 20 Bd
20 %
10 Myo
0
50
Lag
10
20 30 40 Frequency
50
5 % 1 % 60
Biomass (%)
Biomass (%)
50
50 %
30 20
20 %
10 Bd 0
Abrl Irn Abro Olg
10
20 30 40 Frequency
50
5 % 1 % 60
Fig. 2. Trophic isoclines for the cougar and the culpeo fox in the study area. The horizontal lines on the Y axis of the graph for culpeo fox indicate shortening for practical effects. Abrl, Abrothrix longipilis; Abro, Abrothrix olivaceus; Bd, birds; Irn, Irenomys tarsalis; Lag, lagomorphs; Myo, Myocastor coypus; Olg, Oligoryzomys longicaudatus; Sus, Sus scrofa. Fig. 2. Isoclinas tróficas del puma y el zorro culpeo en la zona de estudio. Las líneas horizontales del eje de las Y del gráfico correspondiente al zorro culpeo indican un acortamiento a efectos prácticos. Abrl, Abrothrix longipilis; Abro, Abrothrix olivaceus; Bd, aves; Irn, Irenomys tarsalis; Lag, lagomorfos; Myo, Myocastor coypus; Olg, Oligoryzomys longicaudatus; Sus, Sus scrofa.
tance, due to its lower capture frequency, if compared to rodents as a whole. This group, despite its low position in the isoclines, together would place them above the 5 % isocline, increasing their importance. Interannual variation of the carnivores' diet The interannual differences among carnivores are for each one of the two species studied due to changes in the availability of their prey. In the second year (2018), the steep drop in the Cricetidae rodent populations resulted in a lower capture frequency, which was a consistent decrease in the records of culpeo fox compared to the previous year. This suggests both a modification in the dietary range and a displacement of this canid. The sharp decrease in rodents is associated with interannual fluctuation processes in the availability of resources, as has been reported for rodents in the Northern Hemisphere (Hansson and Henttonen, 1988). Consequently, a reconfiguration of the culpeo fox’s dietary pattern was observed, which is demonstrated in particular by the disproportionate appearance of arthropods in the dietary range compared to the previous year, greater even than that reported for the same biogeographical area (Zúñiga and Fuenzalida, 2016).The absence of reptile con-
sumption compared to the previous year could be the result of a disincentive of its search due to its low energy reward, which would force this canid to prioritize the search for larger prey, as well as a physiological constraint to favor this type of consumption (Silva et al., 2005). This pattern, added to the smaller number of fecal records compared to the previous year, supposes the migration of individuals to habitat patches with a greater supply of resources, a fact facilitated by the wide habitat area of this species (Salvatori et al., 1999).The absence of selectivity in the predation of Cricetidae rodents in the first year is explained by the great availability of this resource, which was observed by the capture success in live traps, which was around 20 % (A. H. Zúñiga, unpublished data). In contrast, in the second sampling year, where there was a reduction in the number of captures compared to the previous year (1 %), there was a change in the prey search pattern (as was the case for arthropods and to a lesser extent lagomorphs), with a lower representation of cricetid rodents. In the case of the cougar, the absence of statistical significance observed when the diversity of prey was compared between the two years suggests a similar pattern in the use of resources during this period, partly by this felid being limited in the use of alternative
184
resources (Gelin et al., 2017). In a scenario of limited resources, however, the cougar could migrate to other places in search of prey of higher energy reward, which is part of a behavioral strategy in response to the seasonal decline of its prey (Pierce et al., 1999). This is supported by the large habitat area that the cougar can have (Grigione et al., 2002). Under this assumption, it is to be expected that the disturbance caused by fire was especially critical for the cougar due to the shortage of prey available and given its high energy requirements, which necessitate larger migrations in search of prey that complement their diet. This situation is in partial agreement with what was observed by Cunningham et al. (2006) in Mediterranean forests of the Northern Hemisphere, where the absence of fecal records of one of the predators made it possible to infer the limitation of the habitat in terms of dietary support. One aspect to consider is the low sample size of the feces analyzed for both species, which were determined largely by the migratory action of the individuals in the study area as a result of the low supply of prey, mainly in the second year. This made its recordings in the study area difficult, suggesting caution when interpreting the results presented here. In conclusion, culpeo fox and cougar showed trophic differentiation with regard to the diversity of their prey, as a consequence of their body size differences. Constraints of available resources as a consequence an interannual variation would lead both species to modify their dietary pattern towards prey with lower energy reward. Long–term studies in the study area could explain the variations in dietary response based on the evolution of the ecosystem. Acknowledgements This research was partially funded by Fondo Nacional de Desarrollo Científico y Tecnológico FONDECYT 11150487 and CONICYT–PIA Basal FB 002–2014. We thank the Dirección de Investigación, Universidad de La Frontera, for their support and Fabián Jaksic for his valuable comments and suggestions that greatly improved the manuscript. Thanks too to Gastón and Jorge León, park rangers at the National Reserve China Muerta, for their contribution to fieldwork and information about the study area. References Amaya, J. N. G., Alsina, M. G., Brandani, A. A., 1979. Ecología de la liebre europea (Lepus europeaus P.) II. Reproducción y peso corporal de una población del área de San Carlos de Bariloche. Technical Report No. 9, Bariloche, Argentina. Bond, W. J., Keeley, J. E., 2005. Fire as a global 'herbivore': the ecology and evolution of flammable ecosystems. Trends of Ecology and Evolution, 20: 387–394. Bouchert, M. I., 2013. Mammalian carnivore use of a high–severity burn in conifer forests in the San
Zúñiga et al.
Bernardino mountains of Southern California, USA. Hystrix, 23: 50–56. Bouchert, M. I., Farr, D. P., Rimbenieks–Negrete, M. A., Pawlowski, M. N., 2014. Responses of small mammals to wildfire in a Mixed Conifer Forest in the San Bernardino Mountains, California. Bulletin of the South California Academy of Sciences, 113: 81–95. Byers, C. R., Steinhorst, R. K., Krausman, P. R., 1984. Clarification of a technique of utilization– availability data. Journal of Wildlife Management, 48: 1050–1053. Carbone, C., Gittleman, J., 2002. A common rule for the scaling of carnivore density. Science, 295: 2273–2276. Chame, M., 2003. Terrestrial mammal feces: a morphometric summary and description. Memoriás do Instituto Oswaldo Cruz, 98: 71–94. Colwell, R., Futuyma, J., 1971. On the measuremente of the niche breadth and overlap. Ecology, 52: 567–572. CONAF, 2014. Plan de manejo forestal Reserva Nacional China Muerta. Documento operativo. Sistema Nacional de Áreas Silvestres protegidas del Estado. CONAF, Santiago de Chile. – 2015. Plan de restauración incendio Reserva Nacional China Muerta. CONAF, Temuco. Cunningham, S. C., Kirkendall, L., Ballard, W., 2006. Gray fox and coyote abundance and diet responses after a wildfire in Central Arizona. Western North American Naturalist, 66: 169–180. Day, M. G., 1966. Identification of hair and feather remains in the gut and feces of stoats and weasels. Journal of Zoology, 18: 315–326. Fuentes, E., Jaksic, F., 1979. Latitudinal size variation of Chilean foxes: tests of alternative hypotheses. Ecology, 60: 43–47. Fuentes–Ramírez, A., Barrientos, M., Almonacid, L., Aarriagada–Escamilla, C., Salas–Eljatib, C., 2018. Short–term response of soil microorganisms, nutrients and plant recovery in fire–affected Araucaria araucana forests. Applied Soil Ecology, 131: 99–106. Gajardo, R., 1995. La vegetación natural de Chile. Clasificación y distribución geográfica. Editorial Universitaria, Santiago de Chile. Gelin, M. L., Branch, L. C., Thornton, D. H., Novaro, A. J., Gould, M. J., Caragiulo, A., 2017. Response of pumas (Puma concolor) to migration of their primary prey in Patagonia. Plos One, 12: e0188877, https://doi.org/10.1371/journal.pone.0188877 Gittleman, J., 1985. Carnivore body size: ecological and taxonomical correlates. Oecologia, 67: 540–554. Glanz, W. E., 1984. Ecological relationships of two species of Akodon in Central Chile. Journal of Mammalogy, 65: 433–441. Grigione, M. M., Beier, P., Hopkins, R. A., Padley, W. D., Schonewald, C. M., Johnson, M. L., 2002. Ecological and allometric determinants of home–range size for mountain lions (Puma concolor). Animal Conservation, 5: 317–324. Hairston, N. G., Smith, F. E., Slobodkin, L. B., 1960. Community structure, population control, and competition. American Naturalist, 94: 421–425.
Animal Biodiversity and Conservation 43.2 (2020)
Hansson, L., Henttonen, H., 1988. Rodent dynamics as community process. Trends of Ecology and Evolution, 3: 195–200. Hutchenson, K., 1970. A test for comparing diversities based on Shanon formula. Joutnal of Theoretical Biology, 29: 151–154. Iriarte, J. A., Franklin, W. L., Johnson, W. E., 1990. Biogeographic variation of food habits and body size of the American puma. Oecologia, 85: 185–190. Iriarte, A., Jaksic, F., 2012. Los carnívoros de Chile. Flora and Fauna/CASEB Ediciones, Santiago de Chile. Jaksic, F., Braker, E., 1983. Food–niche relationships and guild structure of birds of prey: competition vs. opportunism. Canadian Journal of Zoology, 61: 2230–2241. Jaksic, F., Iriarte, J. A., Jiménez, J. E., Martínez, D. R., 2002. Invaders without frontiers: Cross–border invasions of exotic mammals. Biological Invasions, 57: 157–173. Jaksic, F., Medel, R., 1987. El acuchillamiento de datos como método de obtención de intervalos de confianza y prueba de hipótesis para índices ecológicos. Medio Ambiente, 8: 95–103. Johnston, D. W., Odum, E. P., 1956. Breeding bird populations in relation to plant succession on the piedmont of Georgia. Ecology, 78: 50–62. Kays, R., Slauson, K. M., 2008. Remote cameras. In: Non invasive survey methods for carnivores: 110–140 (R. Long, P. Mackay, W. Zielinski, J. Ray, Eds.). Island Press, Washington. Kelt, D., 1993. Irenomys tarsalis. Mammalian Species, 447: 1–3. Köeppen, W., 1948. Climatología. Con un estudio de los climas de la tierra. Fondo de Cultura Económica, México, D.F. Kruuk, H., De Kock, L., 1980. Food and habitat of badgers (Meles meles L.) of Monte Baldo, northern Italy. Zietschrift fur Saugetierkunde, 46: 295–301. Levins, R., 1968. Evolution in changing environments. Princeton University Press, New Jersey. Luebert, F., Pliscoff, P., 2006. Sinopsis bioclimática y vegetacional de Chile. Editorial Universitaria, Santiago de Chile. Mazzolli, M., 2009. Mountain lion Puma concolor attacks on a maned wolf Chrysocyon brachyurus and a domestic dog in a forestry system. Mastozoología Neotropical, 16: 465–470. Montenegro, G., Ginocchio, R., Segura, A., Keely, J. E., Gómez, M., 2004 Regímenes de incendios y respuestas de la vegetación en dos regiones de clima mediterráneo. Revista Chilena de Historia Natural, 77: 455–464. Muñoz–Pedreros, A., 2010. Huellas y signos de mamíferos de Chile. CEA Ediciones, Valdivia, Chile. Muñoz–Pedreros, A., Gil, C., 2009. Orden Rodentia. In: Mamíferos de Chile: 93–157 (A. Muñoz–Pedreros, J. Yáñez, Eds.). CEA Ediciones, Valdivia, Chile. Muñoz–Pedreros, A., Yáñez, J., 2009. Mamíferos de Chile. CEA Ediciones, Valdivia, Chile. Murúa, R., 1996. Comunidades de mamíferos del bosque nativo en Chile. In: Ecología de los bosques templados del sur de Chile: 113–133 (J. Armesto,
185
C. Villagrán, M. K. Arroyo, Eds.). Editorial Universitaria, Santiago de Chile. – 1999. Hantavirus en Chile: los mastozoólogos como un grupo ocupacional de riesgo epidemiológico. Revista Chilena de Historia Natural, 72: 7–12. Murúa, R., González, L. A., Meserve, P., 1986. Population ecology of Oryzomys longicaudatus philipii (Rodentia: Cricetidae) in Southern Chile. Journal of Animal Ecology, 55: 281–293. Norambuena, H., Riquelme, J., 2014. Profesor Dr. Francisco Behn Kuhn (1910–1976) biografía y catálogo de su colección de aves chilenas. CEA Ediciones, Valdivia, Chile. Novaro, A., Funes, M. C., Walker, R. S., 2000. Ecological extinction of native prey of a carnivore assemblage in Argentine Patagonia. Biological Conservation, 92: 25–33. Novaro, A., Moraga, C. A., Briceño, C., Funes, M. C., Marino, A., 2009. First records of culpeo (Lycalopex culpaeus) and cooperative defense by guanacos (Lama guanicoe). Mammalia, 73: 143–150. Pearson, O., 1995. Annotated keys for identifying small mammals living in or near Nahuel Huapi National Park or Lanín National Park, southern Argentina. Mastozoología Neotropical, 2: 99–148. Pia, M. V., 2013. Trophic interactions between puma and endemic culpeo fox after livestock removal in the high mountains of central Argentina. Mammalia, 77: 273–283. Pianka, E., 1973. The structure of lizard communties. Annual Review of Ecology and Systematics, 4: 53–74. Pickett, S. T. A., White, P. S., 1985. The ecology of natural disturbance and patch dynamics. Academic Press, Orlando. Pierce, B. M., Bleich, V. C., Vehausen, J., Bowyer, R. T., 1999. Migratory patterns of mountain lions: implications for social regulation and conservation. Journal of Mammalogy, 80: 986–992. Polisar, J., Maxit, I., Scognamillo, D., Farrell, L., Sunquist, M. E., Eisenberg, J. F., 2003. Jaguars, pumas, their prey base, and cattle ranching: ecological interpretations of a management problem. Biological Conservation, 109: 297–310. Rau, J., 2000. Métodos de ecología trófica. In: Mamíferos de Chile: 397–406 (A. Muñoz–Pedreros, J. Yáñez, Eds.). CEA Ediciones, Valdivia, Chile. Rau, J., Jiménez J., 2002. Diet of puma (Puma concolor, Carnivora: Felidae) in coastal and Andean ranges of southern Chile. Studies on Neotropical Fauna and Environment, 37: 201–205. Rau, J., Martínez, D. R., Low, J. R., Tillería, M. S., 1995. Depredación por zorros chilla (Pseudalopex griseus) sobre micromamíferos cursoriales, escansoriales y arborícolas en un área silvestre protegida del sur de Chile. Revista Chilena de Historia Natural, 68: 333–340. Reise, D., 1973. Clave para la determinación de los cráneos de marsupiales y roedores chilenos. Gayana, 27: 1–20. Rubio, A., Alvarado, R., Bonacic, C., 2013. Introduced European rabbit as a main prey of the native carni-
186
vore culpeo fox (Lycalopex culpaeus) in disturbed ecosystems of central Chile. Studies on Neotropical Fauna and Environment, 83: 89–94. Salvatori, V. G., Vaglio–Laurin, P., Meserve, P. L., Boitani, L., Campanella, A., 1999. Spatial organization, activity and social interactions of culpeo foxes (Pseudalopex culpaeus) in North–central Chile. Journal of Mammalogy, 31: 757–764. Schoener, T. W., 1974. Resource partitioning in ecological communities. Science, 185: 27–39. Silva, S. I., Jaksic, F. M., Bozinovic, F., 2005. Nutritional ecology and digestive response to dietary shift in the large South American fox, Pseudalopex culpaeus. Revista Chilena de Historia Natural, 78: 239–246. Simonetti, J.,1989. Microhabitat use by small mammals in Central Chile. Oikos, 56: 309–318. Skewes, O., Moraga, C., Arriagada, A., Rau, J. R., 2012. El jabalí europeo (Sus scrofa): un invasor biológico como presa reciente del puma (Puma concolor) en el sur de Chile. Revista Chilena de Historia Natural, 85: 227–232. Sokal, R. R., Rohlf, F. J., 1995. Biometry. W. H. Freeman and Company, New York. Sokos, C., Birstas, P., Papaspyropoulos, K. G.,
Zúñiga et al.
Tsachalidis, E., Giannakopoulos, A., Milis, C., Spyrou, V., Manolakou, K., Valiakos, G., Iakovakis, C., Athanasiou, L. V., Sfougaris, A., Billinis, C., 2016. Mammals and habitat disturbance: the case of brown hare and wildfire. Current Zoology, 62: 421–430. Vásquez, R. A., 1996. Patch utilization by three species of Chilean rodents differing in body size and mode of locomotion. Ecology, 77: 2343–2351. Vidal, F., 2015. El puma en la Araucanía. Ediciones Universidad Santo Tomás, Santiago de Chile. Wiens, J. A., 1977. On competition on variable environments. American Scientist, 65: 590–597. Zúñiga, A. H., Muñoz–Pedreros, A., 2014. Hábitos alimentarios de Puma concolor (Carnivora, Felidae) en bosques fragmentados del sur de Chile. Mastozoología Neotropical, 21: 157–161. Zúñiga, A. H., Fuenzalida, V., 2016. Dieta del zorro culpeo (Lycalopex culpaeus Molina 1782) en un área protegida del sur de Chile. Mastozoología Neotropical, 23: 201–205. Zúñiga, A. H., Jiménez, J. E., Ramírez De Arellano, P., 2017. Activity patterns in sympatric carnivores in the Nahuelbuta Mountain Range, southern–central Chile. Mammalia, 81: 445–453.
Animal Biodiversity and Conservation 43.2 (2020)
Brief communication 187
Use of visible implant elastomer and its effect on the survival of an endangered minute salamander M. T. Oropeza–Sánchez, A. Sandoval–Comte, P. García–Bañuelos, P. Hernández–López, E. Pineda
Oropeza–Sánchez, M. T., Sandoval–Comte, A., García–Bañuelos, P., Hernández–López, P., Pineda, E., 2020. Use of visible implant elastomer and its effect on the survival of an endangered minute salamander. Animal Biodiversity and Conservation, 43.2: 187–190, Doi: https://doi.org/10.32800/abc.2020.43.0187 Abstract Use of visible implant elastomer and its effect on the survival of an endangered minute salamander. The population study of threatened species requires marking techniques that do not affect the survival of individuals. In this study, we evaluated the effectiveness of visible implant elastomer (VIE) in the identification and survival of individuals of the salamander Parvimolge townsendi. We compared three salamander groups under different treatments: intervened, simulated intervention and control. No significant mortality differences were observed between groups (with two, none, and one individual, respectively), but implant migration was observed in four of 10 intervened individuals. Although VIE does not have a significant effect on survival, implant migration should be considered before use in population studies. Key words: Captivity, Marking techniques, Parvimolge townsendi, Survival, Threatened amphibians Resumen Utilización de implantes visibles de elastómero y sus efectos en la supervivencia de una salamandra enana en peligro de extinción. El estudio poblacional de especies amenazadas requiere técnicas de marcaje que no afecten a la supervivencia de los individuos. En este estudio, evaluamos la efectividad de los implantes visibles de elastómero (VIE, en sus siglas en inglés) en la identificación y supervivencia de individuos de la salamandra Parvimolge townsendi. Comparamos tres grupos de salamandras sometidos a diferentes tratamientos: Intervenido, Intervención Simulada y Testigo. No se observaron diferencias de mortalidad entre los grupos (con dos, ninguno y un individuo, respectivamente), pero se observó la migración del implante en cuatro de los 10 individuos intervenidos. Aunque los VIE no tienen un efecto significativo en la supervivencia, debería considerarse la migración de los implantes antes de emplearlos en estudios poblacionales. Palabras clave: Cautiverio, Técnicas de marcaje, Parvimolge townsendi, Supervivencia, Anfibios amenazados Received: 22 VIII 19; Conditional acceptance: 22 I 20; Final acceptance: 11 IV 20 Marco Tulio Oropeza–Sánchez, A. Sandoval–Comte, P. García–Bañuelos, E. Pineda, Red de Biología y Conservación de Vertebrados, Instituto de Ecología, A. C. Carretera antigua a Coatepec no. 351, 91703 El Haya, Xalapa, Veracruz, México.– Patricia Hernández–López, Parque Nacional Lagunas de Chacahua–CONANP, La Grúa Chacahua s/n., 71800 Oaxaca, Oaxaca, México. Corresponding author: Marco Tulio Oropeza–Sánchez. E–mail: mtos0290@gmail.com ORCID ID: M. T. Oropeza–Sánchez: 0000-0002-0619-3558; A. Sandoval–Comte: 0000-0002-2265-465X; P. García–Bañuelos 0000-0002-7527-1513; E. Pineda 0000-0002-1997-9576
ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
188
Globally, more than 40 % of amphibian species are considered threatened (IPBES, 2019). Population and community studies of these vertebrates are essential to define their current situation and help in decision– making in response to the global crisis. Alternatives for studying amphibians in the field include mark and recapture methods, the effectiveness of which depends on the natural history of the species of interest, the resources available (including time and funding), and even the expected number of individuals to mark (Heyer et al., 1994). In addition, the method used must comply with the assumptions of generating unique, easy–to–interpret and persistent marks with the minimal impact on survival or detection (Campbell–Grant, 2008). Numerous marking techniques in amphibians have been developed over the last century, such as surface markings, hypodermic staining using paints or labels, radio transmitters, passive microchips (PIT) and amputation of phalanges. Although this latter technique is one of the most commonly used marking approaches in this group, it is the most invasive approach (Heyer et al., 1994). Furthermore, it can significantly affect survival, growth, reproduction, locomotion and recapture probability (Perry et al., 2011). Its use is therefore controversial, especially in rare or threatened species (Phillips and Fries, 2009). One marking technique that has enabled population studies of amphibians, even in those with a different natural history, is the use of visible implant elastomer (VIE) tags, developed by Northwest Marine Technology Inc. This technique consists of a fluorescent biocompatible polymer that is externally visible after being injected into areas of transparent tissue. The success of VIE has been reported in the marking of small amphibians (< 50 mm of snout– vent length, SVL; Marold, 2001) and in threatened species (Bendik et al., 2013). Although only minor problems have been documented concerning the physical capacity (Kinkead et al., 2006; Hoffmann et al., 2008) and survival of individuals (Campbell– Grant, 2008), migration of marks to other regions of the body (Campbell–Grant, 2008; Phillips and Fries, 2009) and even partial or complete rejection of the implant (Hoffmann et al., 2008) have been reported. Defining the effectiveness of this technique is therefore a necessary step to achieve reliable population or community studies that do not significantly affect the survival of individuals. Parvimolge townsendi (Dunn, 1922) is a salamander of the family Plethodontidae. It measures a maximum of 60 mm in total length (TL) (fig. 1A). An endemic species to Mexico, it inhabits the Sierra Madre Oriental, between 800 and 1,800 m.a.s.l. and is mainly found in fragments of tropical montane cloud forest and oak forest (mostly species of genre Quercus) (Parra–Olea et al., 2008). Distribution of this minute salamander has recently been reduced (≈ 1,605 km2) due to habitat loss resulting from the expansion of livestock and agricultural activities (Sandoval–Comte et al., 2012). This species is listed as Critically Endangered by the IUCN (Parra–Olea et al., 2008), while the Mexican government considers
Oropeza–Sánchez et al.
it in the category of Threatened (Amenazada) in the NOM–059–SEMARNAT–2010 (SEMARNAT, 2015). It is therefore necessary to identify techniques that allow us to monitor this species, minimizing the risk of mortality of the individuals studied. For this reason, we aimed to evaluate the impact of the use of VIE tags on the survival of P. townsendi, and to determine its effectiveness as a marking method for identifying individuals. In October 2015 in the Área Natural Protegida Santuario del Bosque de Niebla Francisco Javier Clavijero (19.51014 ºN; 96.94332 ºW) in Xalapa, Veracruz, Mexico, we manually collected 30 adult individuals (18 females and 12 males) of P. townsendi through visual encounters (due to their threatened status). Total length of individuals ranged between 36 and 51 mm. In the first 60 minutes after capture, individuals were transported to the laboratory where they were randomly selected to receive one of three treatments (N = 10 individuals per treatment): a) intervened, consisting of the subcutaneous application of two red implants using insulin syringes of 30 units (0.25 x 8 mm); b) simulated intervention, the same treatment as for group a, but without applying the VIE; and c) controls, with handling only at the time of capture and no intervention. The punctures were performed without anesthesia, in the ventral area near the anterior and posterior members as well in the tail base; considering the bilaterality, six possible regions were considered according to MacNeil et al. (2011) (fig. 1B, 1C). Once the treatment was applied, the individuals were held captive for observation for 31 days. While in captivity, the salamanders were placed individually in 500 ml transparent plastic containers, with approximately 80 % of the space occupied by leaf litter.Temperature and air humidity averaged 20.7 ºC (SD = 1.0 ºC), and 76 % (SD = 4.0 %) respectively. Survival of individuals was confirmed every day. Leaf litter was humidified daily and replaced every week. The new leaf litter in the containers included diminutive invertebrates that could act as potential prey for salamanders. After 31 days, all the surviving individuals were released at the site where they were captured. During the experiment, no immediate effect of VIE was observed in individuals; all were active after the different treatments were applied. Three of the 30 individuals included in the experiment did not survive; two from the Intervened group and one from the control group. The first was a male (SVL = 22.5 mm) from the intervened group who died 14 days after capture and marking. The other two died at 25 days after capture, a female (SVL = 20.7 mm) from the Intervened group and a male (SVL = 22.3 mm) from the Control group. To assess survival differences between treatments, we developed a contingency table with the proportion of live and dead individuals at the end of the study. Between treatments, the survival of individuals did not differ significantly (x2 = 2.22, df = 2, P = 0.32). Low mortality with this marking technique has already been reported for other salamander species such as Desmognathus monticula (with size larger than 50 mm of SVL) and Desmognathus fuscus (SVL < 50 mm;
Animal Biodiversity and Conservation 43.2 (2020)
A
189
B
2 1 cm C
1 3 5
4
6
1 cm
Fig. 1. Palvimolge townsendi: A, without visible implant elastomer, VIE; B, representation of six possible regions for the visible implant elastomer placement in salamanders,white dots denote the location of VIE in regions one and five from ventral view; C, immediately after VIE application in regions one and three. Fig. 1. Palvimolge townsendi: A, sin implante visible de elastómero, VIE; B, representación de seis posibles regiones en las que se pueden colocar el VIE en salamandras, los puntos blancos representan la ubicación de los VIE en las regiones uno y cinco desde una vista ventral; C, inmediatamente después de aplicar los VIE en las regiones uno y tres.
Kinkead et al., 2006), for whom mortality events after two weeks of intervention were not reported. Likewise, the case of Eurycea nana, a tiny salamander (SVL < 40 mm), presented a mortality of marked individuals from 3 % at 30 days in captivity, to 17 % at the 244th day, while the mortality of the Control group ranged from 11 % by the 30th day to 22 % by the 244th day. The authors concluded that VIE does not have has not important effect on survival according to their studied animals (Phillips and Fries, 2009). The salamanders in this study did not expel implants, but four elastomers migrated in four individuals: this migration occurred in three implants in an anteroposterior direction, while one implant migrated sideways (left to right from ventral view). The change of implant position in the body of animals may lead to misidentification of individuals and generate unreliable estimates of populations (Yoshizaki et al., 2009). To minimize this error, the marking of limbs of larger species (> 50 mm SVL) is recommended because in minute species such as that used in this study, limbs are almost as thin as the syringe used (e.g. genus Thorius). We found that VIE did not significantly affec survival of P. townsendi compared to the simple handling of
specimens. However, because implants can migrate in the body of individuals of species such as that studied here, their use for individual identification should be conducted with caution. It is recommended to carry out pilot studies (before fieldwork) with the species of interest to evaluate the effectiveness of the marking technique used in this study. The use of complementary techniques such as marks with different color codes or the use of photomarking could avoid or reduce misidentification of individuals. Acknowledgements We would like to thank Flor Gabriela Vázquez Corzas and José Luis Aguilar López for their help in the collection of organisms, and Santiago Cortés Vázquez for his help with the maintenance of the specimens in captivity. Alfredo G. Nicieza and David Alvarez made useful suggestions that improved the manuscript. CONANP funded the PROCER/DGOR/02/2015 project. The experiment was carried out thanks to the permission granted by the Mexican Ministry of Environment and Natural Resources (SEMARNAT): SGPA/DGVS/03444/15.
190
References Bendik, N. F., Morrison, T. A., Gluesenkamp, A. G., Sanders, M. S., O'Donnell, L. J., 2013. Computer– assisted photo identification outperforms visible implant elastomers in an endangered salamander, Eurycea tonkawae. Plos One, 8: e59424, https:// doi.org/10.1371/journal.pone.0059424 Campbell–Grant, E. H., 2008. Visual implant elastomer mark retention through metamorphosis in amphibian larvae. The Journal of Wildlife Management, 72: 1247–1252. Dunn, E. R., 1922. A new salamander from Mexico. Proceedings of the National Academy of Sciences of the United States of America, 35: 5–6. Heyer, R., Donnelly, M. A., Foster, M., Mcdiarmid, R., 1994. Measuring and monitoring biological diversity: standard methods for amphibians. Smithsonian Institution Press, Washington, D.C. Hoffmann, K., McGarrity, M. E., Johnson, S. A., 2008. Technology meets tradition: a combined VIE–C technique for individually marking anurans. Applied Herpetology, 5: 265–280. IPBES, 2019. Media Release: Nature's Dangerous Decline 'Unprecedented'; Species Extinction Rates 'Accelerating', https://www.ipbes.net/news/Media– Release–Global–Assessment Kinkead, K. E., Lanham, J. D., Montanucci, R. R., 2006. Comparation of anesthesia and marking techniques on stress and behavioral responses in two Desmognathus Salamanders. Journal of Herpetology, 40: 323–328. MacNeil, J. E., Dharmarajan G. U. H. A., Williams R. N., 2011. Salamarker: A code generator and standardized marking system for use with visible implant elastomers. Herpetological Conservation and Biology, 6: 260–265.
Oropeza–Sánchez et al.
Marold, M. A. R., 2001. Evaluating visual implant elastomer polymer for marking small, stream–dwelling salamanders. Herpetological Review, 32: 91. Parra–Olea, G., Wake, D., Hanken, J., García–París, M., 2008. Parvimolge townsendi. The IUCN Red List of Threatened Species, 2008: e.T59328A11918563, http://dx.doi.org/10.2305/IUCN.UK.2008.RLTS. T59328A11918563.en Perry, G., Wallace, M. C., Perry, D., Curzer, H., Muhlberger, P., 2011. Toe Clipping of amphibians and reptiles: Science, ethics, and Law. Journal of Herpetology, 45: 547–555. Phillips, C. T., Fries, J. N., 2009. An evaluation of visible implant elastomer for marking the federally listed fountain darter and the San Marcos salamander. North American Journal of Fisheries Management, 29: 529–532. Sandoval–Comte, A., Pineda, E., Aguilar–López, J. L., 2012. In search of critically endangered species: the current situation of two tiny salamander species in the neotropical mountains of Mexico. Plos One, 7: e34023, https://doi.org/10.1371/journal. pone.0034023 SEMARNAT (Secretaría de Medio Ambiente y Recursos Naturales, México), 2015. Proyecto de modificación del Anexo Normativo III, Lista de especies en riesgo de la Norma Oficial Mexicana NOM–059–SEMARNAT–2010, Protección ambiental –Especies nativas de México de flora y fauna silvestres– Categorías de riesgo y especificaciones para su inclusión, exclusión o cambio–Lista de especies en riesgo, http://legismex.mty.itesm.mx/normas/ ecol/semarnat059–ProyModAnexo2015_12.pdf Yoshizaki, J., Pollock, K. H., Brownie, C., Webster, R. A., 2009. Modeling misidentification errors in capture–recapture studies using photographic identification of evolving marks. Ecology, 90: 3–9.
Brief communication 191
Animal Biodiversity and Conservation 43.2 (2020)
Marginal presence of plastic in nests of yellow–legged gulls (Larus michahellis) in the southeastern Bay of Biscay S. Delgado, N. Zorrozua, J. Arizaga
Delgado, S., Zorrozua, N., Arizaga, J., 2020. Marginal presence of plastic in nests of yellow–legged gulls (Larus michahellis) in the southeastern Bay of Biscay. Animal Biodiversity and Conservation, 43.2: 191–195, https://doi.org/10.32800/abc.2020.43.0191 Abstract Marginal presence of plastic in nests of yellow–legged gulls (Larus michahellis) in the southeastern Bay of Biscay. Nest entanglement and consumption of plastics can be a cause of mortality in chicks of various seabird species. As plastic debris may be chosen as a source of nesting material, evaluation of its presence and contribution to nest building in seabird colonies is important. Here, we determined the contribution of anthropogenic debris to nest construction by a yellow–legged gull Larus michahellis population that largely depends on refuse tips to forage. Two colonies within the southeastern Bay of Biscay, Spain, were sampled in 2019. One of the colonies was in Getaria, where no debris was found in nests, and the second was in Ulia, where 40 % of the nests had some kind of artificial material. In all cases, however, this debris comprised less than 5 % of the nests' area. Among the studied nests, we found one had a piece of fabric, five had pieces of rope, and 20 had pieces of flexible plastic packaging. These results contrast with other seabird species that face problems of conservation due to the increasing use of plastic for nesting. With the low prevalence of artificial debris (chiefly plastic) in nests found in this study, mortality due to debris entanglement or ingestion is unlikely. Key words: Anthropogenic debris, Conservation, Nest entanglement, Pollution, Seabirds Resumen Presencia marginal de plástico en nidos de gaviotas patiamarillas (Larus michahellis) en el sureste del golfo de Vizcaya. El enredo en nidos y el consumo de plástico pueden ser algunas de las causas de mortalidad en los pollos de varias especies de aves marinas. Los desechos de plástico se eligen como material para la construcción de los nidos y, según se ha podido evaluar, la presencia de plástico en los nidos de las colonias de aves marinas es abundante. En este estudio, determinamos la utilización de desechos antropogénicos en la construcción de los nidos de una población de gaviotas patiamarillas, Larus michahellis, que depende en gran medida de los vertederos para buscar alimento. En 2019, se tomaron muestras de dos colonias del sureste del golfo de Bizcaya, en España: Getaria, donde no se encontró ningún desecho, y Ulia, donde el 40 % de los nidos tenía algún tipo de material artificial, aunque en todos los casos estos desechos representaron menos del 5 % de la superficie del nido. De estos nidos, uno tenía un trozo de tela, cinco tenían cuerdas y 20 tenían plásticos de embalaje flexible. Estos resultados contrastan con otras especies de aves marinas que se enfrentan a problemas de conservación debido al uso creciente de plástico para construir los nidos. Habida cuenta de la reducida presencia de restos artificiales (principalmente plástico) en los nidos de este estudio, es poco probable que se produzca mortalidad por el enredo en material de desecho o su ingestión. Palabras clave: Desechos antropogénicos, Conservación, Enredo en nidos, Contaminación, Aves marinas Received: 28 X 19; Conditional acceptance: 27 I 20; Final acceptance: 22 IV 20 Sergio Delgado, Nere Zorrozua, Juan Arizaga, Department of Ornithology, Aranzadi Sciences Society, Zorroagagaina 11, 20014 Donostia, Spain. Corresponding author: S. Delgado. E–mail: sdelgado@aranzadi.eus ORCID ID: 0000–0001–5592–417X ISSN: 1578–665 X eISSN: 2014–928 X
© 2020 Museu de Ciències Naturals de Barcelona Papers are published under a Creative Commons Attribution 4.0 International License
Delgado et al.
192
Introduction Most birds collect several types of material to build their nests, including anthropogenic debris (Votier et al., 2011;Townsend and Barker, 2014; Jagiello et al., 2018). One of the main consequences of the use of this type of material is entanglement (primarily plastics) (Ryan, 2018). In some marine species, plastic debris can make a significant contribution to nesting material (Hartwig et al., 2007; Votier et al., 2011; Provencher et al., 2014; Grant et al., 2018), even in remote offshore colonies (de Souza Petersen et al., 2016). Evaluation of the contribution of anthropogenic debris to nesting material in seabird colonies is important due to its potential associated mortality, not only for chicks (Townsend and Barker, 2014) but also for adults (Votier et al., 2011). Compared to other seabirds which obtain material for their nests from the sea, many white–headed gulls (genus Larus) use a thin layer of grass that is obtained in the colony and its surroundings (Cramp and Simmons, 1983). It might therefore be expected that the amount of plastic or other types of anthropogenic debris would be lower if gulls use grass as their main nesting material. However, gulls may also use plastic and non–plastic debris that has been washed up on beaches or found on refuse tips, where they (Lindborg et al., 2012; Seif et al., 2018). Gulls have been shown to use large amounts of debris inn their nests (Witteveen et al., 2017). The contribution of anthropogenic debris found in kelp gull nests (L. dominicanus) differs greatly between colonies (ranging from 4 % to 67 %). It has been found to be higher in colonies where natural vegetation is scarce and where there is a higher dependence on urban waste as a food resource (Witteveen et al., 2017). Current knowledge on the presence of plastic in gull nests is scarce, and its possible impact on fitness or survival of chicks or adults remains largely unknown. The yellow–legged gull (L. michahellis) is the most abundant gull in the southwestern Palaearctic (Olsen and Larson, 2004). It breeds in Macaronesia, northern Africa, continental Europe –from Portugal to Poland– and the east of Turkey (Olsen and Larson, 2004). In recent decades, populations of the species have increased considerably, due to some extent to the exploitation of refuse tips and other types of subsidies of human origin (Duhem et al., 2008; Ramos et al., 2009; Arizaga et al., 2018). A high contribution of plastics to nests (Witteveen et al., 2017) would allow us to infer that some yellow– legged gull populations have a strong dependence on refuse tips (Arizaga et al., 2013). However, this is a question that remains unknown. Understanding the contribution of plastics to yellow–legged gull nests will help to evaluate the impact of this type of debris on a seabird species with high dependence on refuse tips. The aim of this study was to determine the contribution of anthropogenic debris (specifically, plastics) in nest construction in a yellow–legged gull
population in northern Spain, and to compare results between nearby colonies with variable dependence on refuse tips to forage.
Methods This study was carried out in two yellow–legged gull colonies from the Gipuzkoa province, north of Spain, in the southeastern part of the Bay of Biscay: Getaria (43º 18' N 02º 12' W, 165 adult breeding pairs) and Ulia (43º 20' N 01º 58' W, 824 pairs). The colony of Ulia shows a higher dependence on refuse tips to forage than the colony in Getaria, which is more marine–dependent. Getaria, however, also shows some degree of dependence on refuse tips (Zorrozua et al. 2019a; for details see also fig. 1). During the incubation period (April) of the 2019 breeding season, we examined the structure of 80 nests (Getaria, n = 15; Ulia, n = 65) to look for the presence of plastics or other types of anthropogenic debris. Although these two colonies have a high number of breeding pairs, and many nests could potentially be sampled, we should point out that many of the colonies are located on coastal cliffs and are thus inaccessible. Nests were chosen randomly across each colony in places we were able to access. To quantify debris contribution, we visually assessed the percentage and type of artificial debris in the area occupied by a nest. Types of debris were classified following Provencher et al. (2017): fabric (textiles), rope or string, and flexible packaging plastics. Though Provencher et al. (2017) also consider other categories, these are not reported here because they did not appear in our study nests. The colonies were visited for a second time in June. On this second occasion, we collected a sample of nests with debris to examine the material in more detail in the laboratory. We did not create any detrimental effect on chicks as removal was carried out once they had left the nest. Due to this methodological approach, some nests were deteriorated when we went to the colony for removal; for this reason the sample size was smaller than that on the first visit in April. We extracted and classified the items according to Provencher et al. (2017). They were then weighed (with a 0.01 g accuracy digital balance) and colour was visually determined and recorded (categories as proposed by Provencher et al. (2017); white– transparent, grey–silver, black, blue–purple, green, orange–brown, red–pink and yellow). Results No nests from the colony of Getaria contained any debris. In nests from the colony of Ulia, we found39 nests (60 %) did not contain any debris but 26 contained some kind of artificial material. In all cases, however, debris comprised less than 5 % of
Animal Biodiversity and Conservation 43.2 (2020)
Bay of Biscay
Marine
193
Terrestrial
w
Getaria
Landfill
France
w
Ulia
Navarre N
Gipuzkoa
0
2.5
w
5 km Landfill Harbour Colony
Fig. 1. Location of the two sampling colonies, refuse tips and main fishing ports from the Gipuzkoa province. Main trophic sources used at each colony during the breeding season, as obtained from stable isotopic analysis (modified from Zorrozua et al., 2019). Prey categories: marine (fish, marine invertebrates), terrestrial (mostly earthworms), landfill (mostly meat such as beef, pork or chicken; may include food remains obtained in urban areas). Fig. 1. Ubicación de las dos colonias analizadas, los vertederos y los principales puertos pesqueros de la provincia de Guipúzcoa. Principales fuentes de alimentación utilizadas en cada colonia durante la temporada de cría, obtenidas a partir de un análisis de isótopos estables (modificado a partir de Zorrozua et al., 2019). Categorías de presas: marina (peces e invertebrados marinos), terrestre (en su mayoría, lombrices) y de vertedero (en su mayoría, carne de vacuno, porcino y aves de corral; podría incluir restos de alimentos obtenidos en zonas urbanas).
the nest area (table 1). In the 26 nests, one nest had a piece of fabric, five nests had rope, and 20 had flexible packaging plastic (bags) (table 1). The proportion of nests with or without debris differed significantly between the two colonies (x2 = 8.88, df = 1, P = 0.005). The second, more detailed analysis of the items was carried out in a sample of 15 nests from Ulia that contained anthropogenic debris. We obtained a total of 19 items (11 nests were found to have a single item, while 4 nests had two items. For further details see annex 1). The mean (± SD) weight of the debris per nest was 0.4 ± 0.42 g (range: < 0.01 g to 1.44 g; n = 15). By material, such debris were flexible packaging plastics (n = 10 items; mean weight: 0.13 ± 0.17 g), rope (n = 8 items; mean weight: 0.43 ± 0.51 g) or textiles (n = 1 item; 0.85 g). By colour, 10 items were white, 3 were blue, 2 were grey, 2 red and 2 black. The majority of debris items were thus white flexible packaging plastics.
Table 1. Prevalence of artifical debris found at nests of two yellow-legged gull colonies in the Bay of Biscay. In all nests the area comprised by the debris was < 5 %. Tabla 1. Desechos artificiales encontrados en los nidos de dos colonias de gaviota patiamarilla en el golfo de Vizcaya. En todos los nidos, la superficie ocupada por desechos fue < 5 %. Type of debris
Ulia Getaria (n = 65) (n = 15)
Plastic
20 0
Fabric
1 0
Rope
5 0
Total
26 (40 %)
0
Delgado et al.
194
Discussion The presence of anthropogenic material in nests of a yellow–legged gull population in the Bay of Biscay was very low: 0 % of debris in one of two sampling colonies (the smaller one of Getaria), and 40 % of debris in the larger colony of Ulia. The amount of such debris, however, was marginal (< 5 % of nest's area). We should point out here, however, that the sample size in Getaria was comparatively low, so we cannot reject the possibility that a larger sample might have revealed the presence of debris in a proportion similar to that of the Getaria nests. Nevertheless, even in this case we consider this proportion would be small, as it is unlikely that a greater sample size would give rise to a change from 0 to 40 % as we obtained for the colony at Ulia. We therefore consider our results are sufficiently robust to conclude that artificial debris in Getaria is not as relevant as that in Ulia. Most debris items were white, but the reason for this remains unknown. Gulls may perhaps be attracted by brighter pieces or may just select them for their nests. Alternatively, white could be the most common colour in nature and the nests might simply reflect what gulls find available (washed/worn out plastic may become whiter independently of the original colour). Clearly, this is a question that deserves further research. Anthropogenic debris was detected in a colony with a higher dependence on refuse tips to forage, supporting the hypothesis that the contribution of (mostly) plastic to nesting is higher in gull colonies where waste shows a higher importance in diet (Witteveen et al., 2017). Though both colonies have landfill sites at their disposal, we should point out that (1) Ulia is close to the main landfill within the region (the Zaluaga one, in France), while (2) Getaria is very close to a major port in the region, making it a more accessible feeding resource. With the upcoming progressive closure of open–air refuse tips within the region (Zorrozua et al., 2019) the already low occurrence of anthropogenic debris in the nests of these yellow–legged gull colonies can be expected to decrease even further. Plastics, or other kinds of anthropogenic material, seem to pose a low mortality threat (e.g. due to entanglement) for the studied yellow–legged gull population, since they appear in small pieces, making entanglement highly unlikely. This contrasts with other seabird species which face problems of conservation due to the massive use of plastic for nesting (e.g. synthetic rope) (Hartwig et al., 2007; Votier et al., 2011; Provencher et al., 2014). Even though 40 % of the nests had some kind of artificial debris in one of the colonies, in all of these cases the total amount of debris in each nest was very low (less than 5 % of the nests' area). In view of the low incidence and small size of anthropogenic debris in gull nests in our study, mortality due to debris entanglement is unlikely in both sampling colonies. Visual observations of nests in other nearby colonies also suggest low amounts of debris. These areas were not examined
as in Getaria or Ulia, however (S. Delgado, pers. obs.). In summary, our findings to date suggest that this marginal contribution of artificial debris in the nests may be a common scenario for yellow–legged gull colonies in the Bay of Biscay. Acknowledgements The Gipuzkoa Administration authorized us to survey the colonies. S. Delgado benefited from a pre–doctoral fellowship from the Basque Government. Three anonymous referees provided valuable comments that contributed to improve an earlier version of this work. References Arizaga, J., Jover, L., Aldalur, A., Cuadrado, J. F., Herrero, A., Sanpera, C., 2013. Trophic ecology of a resident Yellow–legged Gull (Larus michahellis) population in the Bay of Biscay. Marine Environmental Research, 87–88: 19–25. Arizaga, J., Zorrozua, N., Egunez, A., 2018. Between the land and sea: how yellow–legged gulls have changed their dependence on marine food in relation to landfill management. In: Seabird: 67–78 (H. Mikkola, Ed.). InTech Open, London, England. Cramp, S., Simmons, K. E. L., 1983. Handbook of the Birds of Europe, the Middle East and North Africa, Vol. 3. Oxford University Press, Oxford. de Souza Petersen, E., Krüger, L., Dezevieski, A., Petry, M., Montone, R. C., 2016. Incidence of plastic debris in Sooty Tern nests: A preliminary study on Trindade Island, a remote area of Brazil. Marine Pollution Bulletin, 105: 373–376. Duhem, C., Roche, P., Vidal, E., Tatoni, T., 2008. Effects of anthropogenic food resources on yellow– legged gull colony size on Mediterranean islands. Population Ecology, 50: 91–100. Grant, M. L., Lavers, J. L., Stuckenbrock, S., Sharp, P. B., Bond, A. L., 2018. The use of anthropogenic marine debris as a nesting material by brown boobies (Sula leucogaster). Marine Pollution Bulletin, 137: 96–103. Hartwig, E., Clemens, T., Heckroth, M., 2007. Plastic debris as nesting material in a Kittiwake (Rissa tridactyla) colony at the Jammerbugt, Northwest Denmark. Marine Pollution Bulletin, 54: 595–597. Jagiello, Z. A., Dylewski, Ł., Winiarska, D., Zolnierowicz, K. M., Tobolka, M., 2018. Factors determining the occurrence of anthropogenic materials in nests of the white stork Ciconia ciconia. Environmental Science and Pollution Research International, 25: 14726–14733. Lindborg, V. A., Ledbetter, J. F., Walat, J. M., Moffett, C., 2012. Plastic consumption and diet of Glaucous–winged Gulls (Larus glaucescens). Marine Pollution Bulletin, 64: 2351–2356. Olsen, K. M., Larson, H., 2004. Gulls of Europe, Asia and North America. Christopher Helm, London. Provencher, J. F., Bond, A. L., Avery–Gomm, S., Borrelle, S. B., Bravo Rebolledo, E. L., Hammer,
Animal Biodiversity and Conservation 43.2 (2020)
S., Kühn, S., Lavers, J. L., 2017. Quantifying ingested debris in marine megafauna: a review and recommendations for standardization. Analytical Methods, 9: 1454–1469. Provencher, J. F., Bond, A. L., Mallory, M. L., 2014. Marine birds and plastic debris in Canada: a national synthesis and a way forward. Environmental Reviews, 23: 1–13. Ramos, R., Ramirez, F., Sanpera, C., Jover, L., Ruiz, X., 2009. Diet of Yellow–legged Gull (Larus michahellis) chicks along the Spanish Western Mediterranean coast: the relevance of refuse dumps. Journal of Ornithology, 150: 265–272. Ryan, P. G., 2018. Entanglement of birds in plastics and other synthetic materials. Marine Pollution Bulletin, 135: 159–164. Seif, S., Provencher, J. F., Avery–Gomm, S., Daoust, P. Y., Mallory, M. L., Smith, P. A., 2018. Plastic and non–plastic debris ingestion in three gull species
195
feeding in an urban landfill environment. Archives of Environmental Contamination and Toxicology, 74: 349–360. Townsend, A. K., Barker, C. M., 2014. Plastic and the nest entanglement of urban and agricultural crows. Plos One, 9: e88006, https://doi.org/10.1371/journal.pone.0088006 Votier, S. C., Archibald, K., Morgan, G., Morgan, L., 2011. The use of plastic debris as nesting material by a colonial seabird and associated entanglement mortality. Marine Pollution Bulletin, 62: 168–172. Witteveen, M., Brown, M., Ryan, P. G., 2017. Anthropogenic debris in the nests of kelp gulls in South Africa. Marine Pollution Bulletin, 114: 699–704. Zorrozua, N., Aldalur, A., Herrero, A., Diaz, B., Delgado, S., Sanpera, C., Jover, L., Arizaga, J., 2019. Breeding Yellow–legged Gulls increase consumption of terrestrial prey after landfill closure. Ibis, 162: 50–62, https://doi.org/10.1111/ibi.12701.
Annex 1. Raw data showing debris details of 15 nests from the Ulia colony. Anexo 1. Datos sin elaborar que aportan información detallada sobre los desechos encontrados en 15 nidos de la colonia de Ulia. Nest code
No. items
Material
Colour
Weight (g)
01
1 Rope
White
02
2
Plastic + Plastic
Black + White
0.10 + 0.07
03
2
Plastic + Plastic
White + Black
0.53 + 0.06
04
1 Rope
Red
0.02
05
1 Plastic
Grey
0.06
06
1 Rope
White
07
2
Red + Blue
08
1 Plastic
White
0.34
09
1 Plastic
Blue
0.04
10
2
Rope + Rope
White + White
11
1
Plastic
Blue
12
1 Fabric
White
0.85
13
1 Rope
White
0.11
14
1 Plastic
White
0.08
15
1 Rope
Grey
1.44
Rope + Plastic
0.15
0.85 0.63 + 0.03
0.17 + 0.06 < 0.01
196
Delgado et al.
Animal Biodiversity and Conservation 43.2 (2020)
197
Preferencias de los granívoros con respecto al tamaño y la calidad de las bellotas en un bosque de Quercus en la zona centroseptentrional de México A. Gamboa, F. Barragán
Gamboa, A., Barragán, F., 2020. Preferencias de los granívoros con respecto al tamaño y la calidad de las bellotas en un bosque de Quercus en la zona centroseptentrional de México. Animal Biodiversity and Conservation, 43.2: 197–208, https://doi.org/10.32800/abc.2020.43.0197 Abstract Preferences of granivores regarding rhe size and quality of acorns in a Quercus forest in central–northern Mexico. Acorns of the species of the genus Quercus are highly appreciated by a diverse group of animals. It remains unclear whether the choice to move an acorn is related to the intrinsic characteristics of the fruit. In this work, we aimed to determine whether the size and quality of acorns (healthy or damaged) influenced their removal. We found that Q. affinis was the species with the largest acorns but the lowest removal rate, and Q. eduardii was the species with the smallest acorns but highest removal rates. Two groups of vertebrates carried out this removal, and this activity occurred at two clearly separate times. Jays Aphelocoma spp. carried out their activity during the day, and rodents Peromyscus spp. removed acorns at night. Size and quality only had a significant influence on the removal of Q. affinis. Our results suggest that absence of large animals could put the establishment of species with large acorns (such as Q. affinis) at risk. Key words: Acorns, Dispersion, Oaks, Wildlife cameras, Zoochory Resumen Preferencias de los granívoros con respecto al tamaño y la calidad de las bellotas en un bosque de Quercus en la zona centroseptentrional de México. Las bellotas del género Quercus son muy apreciadas por diversos animales. Se ha cuestionado si la selección de una bellota puede depender de las características intrínsecas del fruto. En este trabajo determinamos si el tamaño y la calidad de las bellotas (sanas o dañadas) influyen en su selección. Los resultados muestran que Q. affinis fue la especie con las bellotas más grandes, pero con la tasa más baja de selección, y que Q. eduardii tenía bellotas más pequeñas, pero con la tasa más alta de selección. La selección la llevan a cabo dos grupos de vertebrados con periodos de actividad claramente separados. Los arrendajos Aphelocoma spp. realizaban su actividad de día y los roedores Peromyscus spp., de noche. El tamaño y la calidad solo representaron una influencia significativa en la selección de bellotas de Q. affinis. Nuestros resultados sugieren que la ausencia de animales grandes puede poner en riesgo el establecimiento de especies con bellotas grandes (como Q. affinis). Palabras clave: Bellotas, Dispersión, Encinas, Cámaras trampa, Zoocoria Received:19 VII 19; Conditional acceptance: 10 IX 19; Final acceptance: 04 V 20 Antonio Gamboa, Felipe Barragán, IPICYT/División de Ciencias Ambientales, Camino a la Presa San José 2055, Col. Lomas 4 sección, C. P. 78216, San Luis Potosí S. L. P., México. Corresponding author: F. Barragán. E–mail: felipe.barragan@ipicyt.edu.mx ORCID ID: A. Gamboa: 0000-0002-4907-6749; F. Barragán: 0000-0001-5658-6192
ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
Gamboa and Barragán
198
Introcucción Los bosques templados del hemisferio norte están dominados por especies de la familia Fagaceae, particularmente del género Quercus (Vander Wall, 2001; Valencia, 2004). En México, este conjunto de especies constituye uno de los recursos maderables más abundantes (después de los pinos, Pinus spp.) en los bosques de clima templado (Pérez Olvera et al., 2000). El buen establecimiento de las plántulas de este género depende de ciertas adversidades impuestas por un conjunto de factores (Pérez–Ramos, 2014). Las semillas de Quercus son muy apreciadas por diversos animales (Pérez–Ramos, 2014), lo que desde un punto de vista cuantitativo les confiere una gran desventaja, ya que la depredación es uno de los principales problemas para el buen establecimiento de las plántulas (Pérez–Ramos et al., 2012; González–Salvatierra et al., 2013). Desde el punto de vista cualitativo, esta interacción, particularmente con aves y mamíferos pequeños (McConkey et al., 2012; Ramos–Palacios et al., 2014; Perea et al., 2014), resulta beneficiosa para la dispersión efectiva de las semillas, ya que estos organismos tienen el hábito de transportar las semillas a otros lugares y frecuentemente no llegan a consumir la totalidad de lo almacenado. Por lo tanto, una parte de los frutos queda olvidada y ello conlleva que tenga más probabilidad de encontrar las condiciones óptimas para germinar y establecerse (Perea et al., 2011; Vander Wall, 2001; Pérez–Ramos et al., 2008). En este sentido y debido a que esta dualidad tiene consecuencias ecológicas y evolutivas cruciales, es difícil llegar a determinar los rasgos que definen los patrones de dispersión (Gómez et al., 2019). Sin embargo, se han identificado las características intrínsecas de las bellotas del género Quercus que podrían ser importantes para la dispersión, por ejemplo: a) el tamaño de la semilla de cada especie (Zhang et al., 2008; Perea et al., 2011; García–Hernández et al., 2016); b) la existencia de daños causados antes de la dispersión por organismos como insectos y hongos (Bonal et al., 2011; Kellner et al., 2014); c) la cantidad de nutrientes y taninos (Wang y Chen, 2008); d) el grosor del pericarpio (Chang et al., 2012; Lei et al., 2012); y e) el tiempo de germinación (Fox, 1982; Leiva y Díaz–Maqueda, 2016). La presencia o ausencia de estas características puede influir en la distribución espacial y la tasa de reclutamiento de las especies de Quercus (Chang et al., 2012; Yi et al., 2014), ya que se ha señalado que la persistencia de especies vegetales en un bosque se ve influenciada por las características de su fruto o semilla y por la manera en que estas características interactúan con los potenciales organismos dispersores (Moran et al., 2004; Xiao et al., 2010). Cabe mencionar que esta interacción también se rige por factores ambientales que configuran el equilibrio entre el coste y el beneficio de la dispersión de semillas desde el punto de vista de los organismos dispersores y que, en última instancia, determinarán la capacidad de las plantas de regenerarse y colonizar nuevos sitios (Smith–Ramírez et al., 2013; Morán–López et al., 2015a). Esto último es particularmente importante, sobre todo en bosques fragmentados con presencia
de claros en recuperación, donde los organismos dispersores de mayor tamaño son de vital importancia, ya que pueden desplazarse a mayores distancias y, por lo tanto, a más tipos de hábitats (Santos et al., 1999), a diferencia de organismos pequeños como los roedores que, por falta de refugios, se mueven en distancias cortas (Morán–López et al., 2015b). Matías et al. (2010) encontraron que tres especies de mamíferos frugívoros de tamaño corporal grande (zorros, garduñas y jabalíes) dispersaron semillas en diferentes tipos de hábitats de un paisaje agroforestal (integrado por bosques nativos, matorrales y repoblaciones forestales densas, aclaradas y valladas). En este sentido, tratar de entender si la degradación de los bosques limita la dispersión de semillas debido a la ausencia de frugívoros de gran tamaño representa un reto que también debe abordarse. Los bosques de Quercus son un modelo de estudio importante para este y otros tipos de trabajos de investigación. En México se encuentran 161 especies de las 500 descritas en todo el mundo (Valencia, 2004). A pesar de esta riqueza, los estudios en México que consideran estas interacciones entre plantas y animales son escasos (López–Barrera et al., 2007; Ramos–Palacios et al., 2014; García–Hernández et al., 2016). A su vez, estos bosques presentan una amplia variedad en el tamaño de sus bellotas, ya que se pueden encontrar bellotas muy pequeñas del tamaño de un cacahuate (5 gr) y otras muy grandes, cercanas a los 100 gr (Rubio–Licona et al., 2011; García–de la Cruz et al., 2014). Del mismo modo, se ha observado que las bellotas son muy vulnerables a daños bióticos como la depredación y la pudrición por hongos (Andersson, 1992; Lambert, 2002; Leiva y Fernández–Alés, 2005). Por lo tanto, en este trabajo analizamos las características intrínsecas de las bellotas (tamaño y calidad) de diferentes especies y cómo influyen en la interacción con sus consumidores y potenciales organismos dispersores. Material y métodos El área de estudio se encuentra en la Sierra de Álvarez, en el estado de San Luis Potosí, en México (fig. 1), entre las coordenadas 21º 58' 46,79'' N y 100º 34' 18,89'' O. La precipitación media anual es de 571 mm (Castillo–Lara, 2007). Presenta una vegetación de tipo templado, compuesta principalmente por encinares y, en segundo lugar, por bosques mixtos de pino y encino. El clima es templado subhúmedo con una temperatura media anual que oscila entre 12 ºC y 18 ºC (Arriaga et al., 2000). La vegetación original es el bosque de roble; sin embargo, en la actualidad presenta claros de diferentes tamaños (5–25 ha). Estos claros se utilizan para realizar diferentes actividades (por ejemplo, agricultura de subsistencia, pastoreo de ganado y prácticas de manejo mixto) y esto ha generado un paisaje extremadamente complejo. Especies y caracterización de sus bellotas Entre agosto y octubre del 2016, se recolectaron bellotas de todas las especies de Quercus que estuvieran
Animal Biodiversity and Conservation 43.2 (2020)
199
Nuevo León Tamaulipas Zacatecas
San Luis Potosí
Aguascalientes Jalisco
Veracruz de Ignaciode la Llave Guanajuato
101
Querétaro 100 N W
E
21
21
S
Coordiantes Sytem GCS WGS 1984 Datum: WGS 1984 Units: Degree –101
Zona de estudio Sierra de Álvarez Zaragoza
Author: Antonio Gamboa Mendoza –100
30
15
0
30
60 km
Fig. 1. Ubicación de la zona de estudio dentro en la Sierra de Álvarez en San Luis Potosí, México. Fig. 1. Location of the study area within the Sierra de Álvarez in San Luis Potosí, Mexico.
fructificando (Quercus affinis, Q. mexicana, Q. eduardii y Q. castanea), en diferentes zonas de la Sierra de Álvarez. Para determinar la calidad de las bellotas (sanas o dañadas), todas se sometieron a una prueba de flotabilidad (Zavala–Chávez y García, 1996). Se colocaron las bellotas en recipientes llenos de agua y tras 24 h, se consideró que las que flotaban estaban dañadas (infectadas por depredadores predispersivos que habían consumido los cotiledones y embriones); por el contrario, se consideró que las bellotas que se habían hundido estaban sanas (consideradas como potencialmente viables debido a que su contenido estaba intacto). Posteriormente, a las bellotas que quedaron completamente sumergidas en el agua se les realizó una revisión manual para detectar algún tipo de daño en su estructura; en caso de haberlo, también se consideraron dañadas. Para determinar el tamaño, se consideró a la bellota como un ovoide. Se midieron la longitud y el ancho de cada bellota (n = 9.216) y se aplicó la siguiente fórmula para obtener el volumen: V = 4/3 π r1* r2* r3 Diseño de campo En el sitio del estudio se trazó un cuadrante de 100 x 100 m, donde se ubicaron nueve unidades ex-
perimentales, separadas 50 m entre sí. Cada unidad experimental consistía en un recuadro de 20 x 20 cm dividido en cuatro compartimentos, a los que se asignaron de manera aleatoria bellotas de cada especie (Quercus affinis, Q. mexicana, Q. eduardii y Q. castanea). Cada compartimiento se marcó con una banderilla que indicaba la especie colocada (fig. 2A). Cada compartimento contenía una especie dispuesta en lotes de 16 bellotas seleccionadas al azar del total de bellotas disponibles de la especie (ocho sanas y ocho dañadas). Cabe señalar que todas las bellotas estaban registradas y que, por lo tanto, se podía saber el volumen de cada una de ellas. El recambio de los lotes se realizó cada seis horas a lo largo de cuatro días, lo cual quiere decir que cada seis horas había la misma cantidad de bellotas; esto representó 16 recambios para cada unidad experimental (en total se utilizaron 9.2016 bellotas, 2.304 por especie). La monitorización de las visitas de vertebrados silvestres se registró con tres cámaras Cuddeback C Model with Black Flash® por cada unidad experimental. Dos cámaras se colocaron a 20 cm del suelo y a una distancia de 20 cm y 40 cm de las semillas; la tercera se colocó a 80 cm del suelo y a una distancia de 70 cm a las semillas. La distribución de estas cámaras permitió tener una mejor cobertura de todos los ángulos y evitar alguna obstrucción que impidiera contabilizar las visitas y la selección de las bellotas (fig. 2B).
Gamboa and Barragán
200
A
B
Fig. 2. Vista en el campo de: A, unidades experimentales; B, montado de foto–trampas. Fig. 2. Field view of: A, experimental units; B, photo–traps.
Análisis de datos Se realizó una comparación estadística de los valores del volumen de las bellotas de las cuatro especies de Quercus incluidas en el estudio (2.304 bellotas por cada especie) mediante un análisis de la varianza de las medias (ANOVA) y una prueba post hoc de Fisher de la diferencia mínima significativa. Este análisis también se realizó para comparar el volumen entre las dos condiciones de la calidad de las bellotas (sanas y dañadas) dentro de cada especie. Con la información obtenida a través de las cámaras trampa, se cuantificó la selección de bellotas por hora, estableciendo cuatro periodos (periodo 1: de 18:00 a 24:00 h; periodo 2: de 24:00 a 6:00 h, periodo 3: de 6:00 a 12:00 h; y periodo 4: de 12:00 a 18:00 h). Con estos datos se realizaron cuatro análisis de tiempo de falla, a fin de comparar las tasas de selección de las especies de bellotas en cada periodo y así determinar las preferencias de los granívoros. En este análisis, la selección de una bellota en un determinado periodo se consideró una "falla" y se realizó mediante el método de Kaplan–Meier (Kaplan y Meier, 1958). A su vez, para averiguar si las diferencias obtenidas en las tasas de selección se pueden explicar o no por el azar, se recurrió a la prueba Mantel–Cox (Bland y Altman, 2004). Para llevar a cabo todos los análisis estadísticos, se utilizó la versión 10 del programa STATISTICA. Con objeto de evaluar si el periodo de actividad, el volumen o la calidad de la bellota influyen en la selección, se ajustó un modelo lineal generalizado (MLG) a la familia binomial y la función de enlace logit. La variable de respuesta fue binaria (selección sí o no) y las variables predictoras fueron: el periodo de actividad (variable categórica: diurno o nocturno), el estado de la semilla (variable categórica: sana o dañada) y el tamaño de las semillas (variable continua calculada por el volumen). Este primer modelo se realizó para cada especie de Quercus. Asimismo,
se utilizó otro MLG siguiendo los criterios antes mencionados, que permitió comprobar si el volumen o la calidad de la bellota influyen en la selección general de bellotas (sin considerar la especie de Quercus). Los análisis se realizaron con la versión 3.2 del programa R. Resultados Los análisis morfométricos (relativos al volumen de las bellotas) mostraron diferencias significativas entre todas las especies de Quercus (F3, 9212 = 37,87; p << 0,0001). En la prueba pareada de Fisher se observa que todas las especies difieren estadísticamente entre sí (fig. 3): Q. affinis resulta ser la especie con las bellotas más grandes y Q. eduardii la que las tiene más pequeñas; las otras dos especies quedan en una posición intermedia. En la comparación del volumen medio de las bellotas sanas y las dañadas de cada especie se encontró que, en casi todas las especies se presentaron diferencias significativas y se observó que las bellotas más grandes eran las más sanas. La excepción fue Q. eduardii, que no mostró diferencias significativas entre las dos condiciones (fig. 4). Los análisis de las tasas de selección de bellotas por especie mostraron que Q. eduardii, la especie con las bellotas más pequeñas, fue la que presentó tasas de selección más altas, seguida de Q. mexicana y Q. castanea (ambas especies con bellotas de tamaño intermedio) y, por último, de Q. affinis, la especie con las bellotas de mayor tamaño. Encontramos que la selección de bellotas (en todas las especies) fue mayor en el periodo nocturno (de 18:00 a 24:00 h y de 24:00 a 6:00 h), con porcentajes superiores al 60 %, mientras que durante el día (de 6:00 a 12:00 h y de 12:00 a 18:00 h), se mantuvieron por debajo del 50 % (fig. 5A). Esta tendencia se mantuvo a lo largo de los cuatro periodos en los que se realizaron los recambios de
Animal Biodiversity and Conservation 43.2 (2020)
201
Volumen (mm3)
3,000 a
b
2,000
d c
1,000 500 Q. affinis
Q. castanea Q. eduardii Species
Q. mexicana
Fig. 3. Comparación entre el volumen promedio de las bellotas (mm3 ± EE) de cada especie utilizadas en el estudio de extracción de bellotas. Las diferencias significativas obtenidas con la prueba pareada de Fisher se indican con letras diferentes. Fig. 3. Comparison between the average volume of each species of acorn (mm3 ± SE) used in the study of acorn removal. Significant differences are indicated by different letters according to Fisher' paired test.
b
3,000 a
Volumen (mm3)
a 2,000
b
b a a
1,000
a
500
Daño Sana Q. affinis
Daño Sana Daño Sana Q. castanea Q. eduardii Species
Daño Sana Q. mexicana
Fig. 4. Comparación entre el volumen promedio (mm3) de las bellotas sanas y las bellotas dañadas dentro de cada especie (Q. eduardi, Q. mexicana, Q. castanea y Q. affinis). En la gráfica se muestran la mediana con el 1er y el 3er cuartil (caja), los límites inferior y superior (línea punteada) y los valores de los datos (puntos). Las distintas letras indican diferencias significativas entre las comparaciones pareadas dentro de cada especie, obtenidas con la prueba pareada de Fisher. Fig. 4. Comparison between the average volume (mm3) of healthy and damaged acorns for each species (Q. eduardi, Q. mexicana, Q. castanea and Q. affinis). The graph shows the median with 1st and 3rd quartile (box), the lower and upper limits (dotted line), and the data values (points). The letters indicate specific differences between the paired comparisons within each species, from the Fisher's paired test.
Gamboa and Barragán
202
A
100
Extracción diurna Extracción nocturna
80 de bellotas (%)
Extracción total
90
Extracción total
70 60 50 40 30 20 10 0
B
Q. eduardii
Q. mexicana
Q. castanea
Q. affinis
80
Q. mexicana
40
Q. castanea Q. affinis
05:00–06:00
04:00–05:00
03:00–04:00
02:00–03:00
01:00–02:00
24:00–01:00
23:00–24:00
22:00–23:00
21:00–22:00
20:00–21:00
19:00–20:00
20 0
C
Q. eduardii
60
18:00–19:00
acumulada (%)
Extracción
100
80
Q. eduardii
60
Q. mexicana Q. castanea
40
Q. affinis
17:00–18:00
16:00–17:00
15:00–16:00
14:00–15:00
13:00–14:00
12:00–13:00
11:00–12:00
10:00–11:00
09:00–10:00
08:00–09:00
0
07:00–08:00
20 06:00–07:00
acumulada (%)
Extracción
100
Fig. 5. Porcentaje de bellotas extraídas por especie de Quercus: A, porcentaje total y por periodo del día. Así como las tasas de estracción de bellotas estimadas con el método de Kaplan–Meyer en los cuatro periodos de muestreo; B, periodos de muestreo durante la noche (de 18:00 a 24:00 h y de 24:00 a 6:00 h); C, periodos de muestreo durante el día (de 6:00 a 12:00 h y de 12:00 a 18:00 h). Fig. 5. Acorn removal percentage by species of Quercus: A, total percentage and by time of day. As well as removal rates estimated with the Kaplan–Meyer method in the four sampling periods; B, nocturnal sampling periods (18:00 a.m. to 12:00 p.m. and 24:00 a.m. to 6:00 p.m.); C, diurnal sampling periods (6:00 a.m. to 12:00 p.m. and 12:00 a.m. to 6:00 p.m.).
Animal Biodiversity and Conservation 43.2 (2020)
bellotas (figs. 5B y 5C). En particular, las tasas de selección más altas ocurrieron entre las 18:00 y las 24:00 h, con valores del 64 % en Q. affinis, del 76 % en Q. castanea y en Q. mexicana y del 82 % en Q. eduardii (fig. 5B). Por otro lado, las tasas más bajas se registraron en el periodo de 12:00 a 6:00 h, con valores del 16 % en Q. affinis, del 21 % en Q. castanea, del 24 % en Q. mexicana y del 31 % en Q. eduardii (fig. 5C). En los dos periodos nocturnos se encontraron diferencias significativas en la selección entre especies (de 18:00 a 24:00 h; p = 0,001 y de 24:00 a 6:00 h; p = 0,003), mientras que en los periodos diurnos, las diferencias no fueron significativas. Q. eduardii (con las tasas más altas de selección) presentó diferencias significativas con el resto de las especies en la mayoría de los periodos (con excepción de Q. mexicana en el periodo de 6:00 a 12:00 h; tabla 1). Por otro lado, a través de las cámaras trampa, se pudo observar que son básicamente dos grupos de especies los que se llevan las bellotas, separados claramente por dos periodos de actividad: durante el día (de 6:00 a 18:00 h) solamente se detectó a aves del género Aphelocoma (fig. 6A) y durante la noche (de 18:00 a 6:00 h) solo hubo actividad de roedores del género Peromyscus (fig. 6B). Además, el análisis de los MLG por cada especie de Quercus señalan que el periodo de actividad influye significativamente en la selección de bellotas de todas las especies: Q. eduardii (p < 0,001), Q. mexicana (p < 0,001), Q. castanea (p < 0,001) y Q. affinis (p < 0,001) (tabla 2). El volumen de la bellota solo representó una influencia significativa en la selección de las bellotas de Q. affinis (p < 0,05), que son las más grandes; asimismo, solo en esta especie se apreció una diferencia significativa en la selección determinada por la condición de la bellota (p < 0,05), ya que se observó una preferencia por llevarse las bellotas sanas, aunque solo durante la noche (tabla 2). Mediante el MLG se analizó la selección del total de bellotas en función del tamaño (volumen) y la condición (sana o dañada), sin considerar las especies, y se encontró que la variable de volumen influye significativamente (p < 0,001) en la selección de bellotas, mientras que la variable de la condición de la bellota por sí sola no ejerce una influencia significativa en la selección (p = 0,087). Sin embargo, la interacción de ambas variables resulta igualmente significativa (p < 0,001). Por lo tanto, si bien no hay un efecto por separado de la condición, la interacción de ambas variables determina una probabilidad de selección diferente entre las bellotas sanas y las dañadas en función de su volumen (tabla 3). Discusión Existió una clara diferencia en el tamaño (volumen) de las bellotas entre especies de Quercus de la región de estudio. Q. eduardii fue la especie con las bellotas más pequeñas y la que presentó las tasas más altas de selección, mientras que Q. affinis fue
203
Tabla 1. Resultados de las pruebas de Mantel– Cox para comparar las tasas de extracción de bellotas en los cuatro periodos de tiempo: Qed, Q. eduardii; Qme, Q. mexicana; Qca, Q. castanea; Qaf, Q. affinis; *** p < 0,001); * p < 0,05; NS, sin diferencias significativas. Table 1. Results of the Mantel–Cox tests to compare the rates of acorn removal in the four time periods: Qed, Q. eduardii; Qme, Q. mexicana; Qca, Q. castanea; Qaf, Q. affinis; *** p < 0.001; * p < 0.05; NS, no significant differences.
Qed Qme Qca Qaf
Primer periodo (18:00 a 24:00 h) Q. eduardii
Q. mexicana
***
Q. castanea
***
Q. affinis
*** *** *
NS
Segundo periodo (24:00 a 6:00 h)
Q. eduardii Q. mexicana
*
Q. castanea
***
Q. affinis
*** *** NS
*
Tercer periodo (6:00 a 12:00 h) Q. eduardii
Q. mexicana
NS
Q. castanea
*
Q. affinis
NS
*** *** *
Cuarto periodo (12:00 a 18:00 h)
Q. mexicana
*
Q. castanea
***
Q. affinis
*** *** NS
Q. eduardii
NS
la especie con el mayor volumen de bellotas y la menor tasa de selección. Este resultado contrasta con otros trabajos, que señalan que las semillas de tamaño grande son más atractivas para su selección, debido a que llegan a tener mayor valor nutricional (Zhang et al., 2008; Vander Wall, 2010). Por un lado, esta tendencia se puede explicar por el ahorro de costes energéticos y de tiempo que implica manipular y trasladar estas semillas, lo que se puede traducir en un menor tiempo de exposición a depredadores (Muñoz y Bonal, 2008; Lichiti et al., 2017). Por ejemplo, Hedj–Chikh et al. (1996) mencionan que el tiempo para que una ardilla (Sciurus carolinensis) pueda consumir una bellota
Gamboa and Barragán
204
A
B
Fig. 6. Vertebrados que participaron en la extracción de bellotas: A, extracción diurna: Aphelocoma spp.; B, extracción nocturna: Peromyscus spp. Fig. 6. Vertebrates that participated in the removal of acorns: A, daytime removal: Aphelocoma spp.; B, nocturnal removal: Peromyscus spp.
es de 5 minutos aproximadamente, en comparación con el tiempo que invierten (de 1 a 1,5 minutos) para llevarse la bellota a una corta distancia, guardarla y volver a buscar otra. Por otro lado, la baja selección de bellotas grandes observada en este estudio concuerda con lo constatado por Barragán et al. (2018), que sugieren que los claros artificiales reducen la riqueza y abundancia de los granívoros, y que las especies de bellotas grandes tienen más limitaciones de dispersión, debido a la falta de animales capaces de llevar las bellotas del bosque a los claros. Esta pérdida de fauna silvestre, debida a diferentes procesos de degradación del ecosistema (por ejemplo, la caza, el avance de la frontera agrícola, la extracción de leña, etc.), trae consigo la modificación de los patrones de dispersión (Ramos–Palacios et al., 2014). Esto se pudo constatar a través de las cámaras trampa, ya que fueron solo dos grupos de organismos pequeños, las aves del género Aphelocoma (durante el día) y los roedores del género Peromyscus (durante la noche), los que se llevaban las bellotas. Esta situación contrasta con lo observado en otros bosques de Quercus del mundo que cuentan con la presencia de otros organismos que se llevan bellotas de mayor tamaño (Gómez et al., 2003; Bonal y Muñoz, 2007; Kellner et al., 2016). Asimismo, cabe señalar que los roedores fueron los que tuvieron las mayores tasas de selección de bellotas, lo que ya se ha podido observar en otros bosques (por ejemplo, Gómez et al., 2008), por lo que la mayor dinámica en la selección se concentra por las noches. Si bien la preferencia por llevarse semillas de menor tamaño puede beneficiar a las especies con este tipo de semillas, se debe considerar que los organismos que se llevan las semillas pequeñas (roedores) desplazan una mayor cantidad de bellotas, pero su
área de actividad suele ser más local (raramente supera los 100 m²; Gómez et al. 2008). Por otro lado, a pesar de que los córvidos se desplazan a mayores distancias (Pesendorfer et al., 2016; Bartlow et al., 2011), nuestros resultados ponen de manifiesto que manipulan únicamente semillas pequeñas. Por lo tanto, en sitios con ausencia de granívoros de tamaño grande, el impacto puede ir en dos sentidos, por un lado, las especies de Quercus con bellotas grandes tienen dificultades importantes para su dispersión, ya que no hay animales que se interesen por ellas (Darley–Hill y Johnson, 1981; Scarlett y Smith, 1991). Por otro lado, se minimiza la posibilidad de que las bellotas (tanto de especies con semillas grandes como pequeñas) lleguen a sitios más distantes de su origen, lo cual puede representar una amenaza para la regeneración natural y la expansión del bosque de Quercus hacia zonas abiertas del dosel, especialmente en la región del estudio, ya que a través de observaciones personales se pudo constatar una baja densidad de plántulas en relación con los individuos adultos. En este sentido, cabe señalar que este estudio se llevó a cabo en un año de baja cosecha, lo cual podría haber limitado en cierta medida el conocimiento sobre la dinámica de la interacción entre la semilla y el organismo dispersor. Por ejemplo, se ha encontrado una relación positiva entre la producción muy elevada de bellotas y el crecimiento poblacional del organismo dispersor (Peromyscus leucopus) durante los años semilleros de dos especies de Quercus (Clotfelter et al., 2007), con lo cual es muy probable que el comportamiento de estos organismos sea diferente. Además, los resultados de los análisis intraespecíficos mostraron que, a excepción de Q. eduardii, en todas las especies, la calidad de las bellotas tuvo
Animal Biodiversity and Conservation 43.2 (2020)
205
Tabla 2. Resultados de los modelos lineares generalizados (MLG) para determinar el efecto del periodo, condición y el tamaño de las bellotas sobre la extracción en las cuatro especies de encino: EE, error estándar (p < 0,05; "Condición–sana" indica que el estado de referencia en el análisis es "sana"). Table 2. GLM results, to determine the effect of the period, condition and size of the acorns on removal of the four species of oak: EE, standard error (p < 0.05; "Condición–sana" indicates that healthy is the reference state in the analysis).
Estimador
EE
Valor z
p
Q. eduardii (Intercepto)
0,085 0,433 0,197 0,843
Periodo–noche
3,064
Volumen
–0,001 0,001 –0,952 0,341
0,722
4,244
< 0,001
Condición–sana
0,286 0,591 0,484 0,628
Periodo–noche:Volumen
–0,002 0,001 –1,639 0,101
Periodo–noche:Condición–sana
–1,831 1,010 –1,812 0,070
Volumen:Condición–sana
–0,001 0,001 –0,444 0,657
Periodo–noche:Volumen:Condición–sana 0,004 0,002 1,904 0,057 Q, mexicana (Intercepto)
–1,427
0,541
–2,636
< 0,05
Periodo–noche
2,962
0,886
3,344
< 0,001
Volumen
0,001 0,001 1,664 0,096
Condición–sana
0,662 0,798 0,829 0,407
Periodo–noche:Volumen
–0,002 0,001 –1,316 0,188
Periodo–noche:Condición–sana
–0,293 1,287 –0,227 0,820
Volumen:Condición–sana
–0,001 0,001 –0,732 0,464
Periodo–noche:Volumen:Condición–sana 0,000 0,002 0,236 0,813 Q, castanea (Intercepto)
–0,467 0,340 –1,372 0,170
Periodo–noche
2,386
0,548
Volumen
0,000
0,000 –0,565 0,572
4,352
< 0,001
Condición–sana
0,090 0,558 0,161 0,872
Periodo–noche:Volumen
–0,001 0,001 –1,258 0,208
Periodo–noche:Condición–sana
–0,336 0,924 –0,363 0,716
Volumen:Condición–sana
0,000
0,001 –0,014 0,989
Periodo–noche:Volumen:Condición–sana 0,001 0,001 0,696 0,486 Q, affinis (Intercepto)
–0,218 0,274 –0,794 0,427
Periodo–noche
1,478
0,406
3,637
< 0,001
Volumen
0,000
0,000
–2,251
< 0,05
Condición–sana
–0,366 0,458 –0,800 0,424
Periodo–noche:Volumen
0,000
0,000 –1,226 0,220
Periodo–noche:Condición–sana
1,990
0,746
Volumen:Condición–sana
0,000 0,000 1,053 0,292
Periodo–noche:Volumen:Condición–sana 0,000
2,668
< 0,05
0,000 –0,521 0,602
Gamboa and Barragán
206
Tabla 3. Resultado del MLG general en el que se muestra el efecto de la condición y el tamaño de las bellotas sobre su estracción: EE, error estándar (p < 0,05; "Condición–sana" indica que el estado de referencia en el análisis es "sana"). Table 3. General GML result showing the effect of the condition and size of the acorns on their removal. EE, standard error (p < 0.05; "Condición–sana" indicates that healthy is the reference state in the analysis).
Estimador
EE
Valor z
p
(intercepto)
1,320 1,1695 1,129 0,259
Volumen
–0,003
Condición–sana
–0,371 0,2169 –1,712 0,087
Volumen x Condición
0,002
una influencia en el tamaño, ya que las bellotas más grandes fueron las más sanas. Esto podría deberse a que normalmente los árboles abortan selectivamente las bellotas dañadas o pocos viables (Díaz et al., 2003). También se encontró que, solamente en Q. affinis, el tamaño y la condición de la bellota influyeron en su selección, ya que los organismos prefirieron las más pequeñas y de condición sana, lo cual puede deberse a que solo estuvieron presentes los organismos dispersores pequeños como los roedores (Hou et al., 2010; Perea et al., 2012). Esto, a su vez, podría tener implicaciones en la calidad de la dispersión de las especies de Quercus, debido a la proporción de bellotas probablemente inviables que se llevan igualmente (Pesendorfer et al., 2016). Aunque se ha documentado que en la interacción entre semillas e insectos, el daño ocasionado por estos no disminuye significativamente la tasa de germinación ni la supervivencia de las bellotas, esta interacción ha sido poco estudiada en los bosques de encinos y, por tanto, es una línea de investigación en la que se debería profundizar, particularmente en el área de este estudio. A pesar de que existen otros factores que pueden influir en la selección de bellotas, como la cantidad de nutrientes y de taninos o el grosor del pericarpio, podemos concluir que el periodo de actividad juega un papel importante en la selección de bellotas y que, por lo menos, hay una clara selección en favor de especies de bellotas pequeñas, tanto por roedores como por aves. Asimismo, los resultados sugieren que la ausencia de animales grandes que actúan como organismos dispersores de bellotas pone en riesgo el establecimiento de especies como Q. affinis, que mantuvo las tasas más bajas de selección por tener bellotas grandes. Para comprender mejor esta interacción, se sugiere que se realicen más estudios de campo, en los que se haga un seguimiento de esta relación a largo plazo. Además, se propone que estos estudios abarquen al menos dos periodos de fructificación, lo cual permitiría tener mejores resultados que podrían contribuir a generar estrategias para el manejo y conservación de los bosques templados del país.
0,0002 0,0002
–17,134 8,654
< 0,001 < 0,001
Agradecimientos Agradecemos a David Douterloungne y Ernesto Badano por sus comentarios sobre los análisis de los datos y a Joel Flores, Alfredo Hernández Ramírez y Elena Cortez Mendoza por la revisión del manuscrito. También agradecemos al CONACYT por la beca para realizar los estudios de maestría que concedió a Antonio Gamboa (N.º de beca 423342, N.º de registro 590500). Esta investigación de tesis fue financiada por el proyecto "Dinámicas de reclutamiento de encinos (Quercus spp.) en escenarios de cambio climático" del Fondo Sectorial de Investigación para la Educación SEP–CONACYT clave CB–2013/221623, a cargo del Dr. Ernesto I. Badano. Referencias Andersson, C., 1992. The effect of weevil and fungal attacks on the germination of Quercus robur acorns. Forest Ecology and Management, 50: 247–251. Arriaga, L., Espinoza, J., Aguilar, C., Martínez, E., Gómez, L., Loa, E., 2000. Regiones terrestres prioritarias de México. Comisión Nacional para el Conocimiento y uso de la Biodiversidad, México. Barragán, F., Badano, E., Douterlungne, D., Flores, J., 2018. Richness and abundance of granivorous vertebrates determine acorn removal patterns in a human modified oak forest. iForest, 11: 329–337, Doi: https://doi.org/10.3832/ifor2216-011 Bartlow, A. W., Kachmar, M., Lichti, N., Swihart, R. K., Stratford, J. A., Steele, M. A., 2011. Does multiple seed loading in Blue Jays result in selective dispersal of smaller acorns? Integrative Zoology, 6: 235–243, Doi: https://doi.org/10.1111/j.17494877.2011.00254.x Bland, J, Altman, D., 2004. The logrank test. BMJ, 328: 1073–1073, Doi: 10.1136/bmj.328.7447.1073. Bonal, R., Espelta, J. M., Vogler, A., 2011. Complex selection on life–history traits and the maintenance of variation in exaggerated rostrum length in acorn
Animal Biodiversity and Conservation 43.2 (2020)
weevils. Oecologia, 167: 1053–1061, Doi: https:// doi.org/10.1007/s00442-011-2036-7 Bonal, R., Muñoz, A., Díaz, M., 2007. Satiation of predispersal seed predators: the importance of considering both plant and seed levels. Evolutionary Ecology, 21: 367–380, Doi: https://doi.org/10.1007/ s10682-006-9107-y Castillo–Lara, P., 2007. Evolución reciente y estado actual de la vegetación del área natural protegida Sierra de Álvarez, S.L.P. San Luis Potosí. Universidad Autónoma de San Luis Potosí, México. Chang, G., Jin, T., Pei, J., Chen, X., Zhang, B., Shi, Z., 2012. Seed dispersal of three sympatric oak species by forest rodents in the Qinling Mountains, Central China. Plant Ecology, 213: 1633–1642, Doi: https://doi.org/10.1007/s11258-012-0118-1 Clotfelter, E. D., Pedersen, A. B., Cranford, J. A., Ram, N., Snajdr, E. A., Nolan, V., Ketterson, E. D., 2007. Acorn mast drives long–term dynamics of rodent and songbird populations. Oecologia, 154: 493–503, Doi: https://doi.org/10.1007/s00442-007-0859-z Darley–Hill, S.; Johnson, W. C., 1981. Acorn dispersal by the Blue Jay (Cyanocitta cristata). Oecologia, 50: 231–232. Díaz, M., Møller, A. P., Pulido, F. J., 2003. Fruit abortion, developmental selection and developmental stability in Quercus ilex. Oecologia, 135: 378–385, Doi: https://doi.org/10.1007/s00442-003-1202-y Fox, J., 1982. Adaptation of gray squirrel behavior to autumn germination by white oak acorns. Evolution, 36: 800–809, Doi: https://doi.org/10.2307/2407893 García–de la Cruz, Y., Becerra–Zalaveta, J., Quintanar–Isaías, P., Ramos–Prado, J., Hernández– Ramírez, A., 2014. La bellota de Quercus insignis Martens & Galeotti, 1843, la más grande del mundo. Cuadernos de Biodiversidad, 46: 1–8. García–Hernández, M. D., López–Barrera, F., Vásquez– Reyes, V., 2016. Microhabitat affects acorn removal in three sympatric and endangered Neotropical oak species. Ecological Research, 31: 343–351, Doi: https://doi.org/10.1007/s11284-016-1342-2 Gómez, J. M., García, D., Zamora, R., 2003. Impact of vertebrate acorn– and seedling–predators on a Mediterranean Quercus pyrenaica forest. Forest Ecology and Management, 180: 125–134, Doi: https://doi.org/10.1016/S0378-1127(02)00608-4 Gómez, J. M., Puerta–Piñero, C., Schupp, E. W., 2008. Evectiveness of rodents as local seed dispersers of Holm oaks. Oecologia,155: 529–537, Doi: https://doi.org/10.1007/s00442-007-0928-3 Gómez, J. M., Schupp, E. W., Jordano, P., 2019. Synzoochory: the ecological and evolutionary relevance of a dual interaction. Biological Review, 94: 874–902, Doi: https://doi.org/10.1111/brv.12481 González–Salvatierra, C., Badano, E. I., Flores, J., Rodas, J. P., 2013. Germinación, infestación y viabilidad en bellotas de Quercus polymorpha (Schltdl. & Cham.) tras un año de almacenamiento. Revista Chapingo serie ciencias forestales y del ambiente, 19: 1–12, Doi: https://doi.org/10.5154/r. rchscfa.2012.07.044 Hedj–Chikh, L. Z., Steele, M. A., Smallwood, P. D., 1996. Caching decisions by grey squirrels: a test
207
of the handling time and perishability hypotheses. Animal Behaviour, 52: 941–948, Doi: https://doi. org/10.1006/anbe.1996.0242 Hou, X., Yi, X., Yang, Y., Liu, W., 2010. Acorn germination and seedling survival of Q. variabilis: effects of cotyledon excision. Annals of Forest Science, 67: 711–711, Doi: https://doi.org/10.1051/ forest/2010036 Kaplan, E., Meier, P., 1958. Nonparametric estimation from incomplete observations. Journal of the American Statistical Association, 53: 457–481, Doi: https://doi.org/10.2307/2281868 Kellner, K., Lichti, N., Swihart, R., 2016. Midstory removal reduces effectiveness of oak (Quercus) acorn dispersal by small mammals in the Central Hardwood Forest region. Forest Ecology and Management, 375: 182–190, Doi: https://doi. org/10.1016/j.foreco.2016.05.042 Kellner, K., Riegel, J., Swihart, R., 2014. Effects of silvicultural disturbance on acorn infestation and removal. New Forests, 45: 265–28, Doi: https:// doi.org/10.1007/s11056-014-9409-9 Lambert, J. E., 2002. Exploring the link between animal frugivoryand plant strategies: the case of primate fruit–processing and post–dispersal seed fate. En: Seed Dispersal and Frugivory: Ecology, Evolution and Conservation: 365–379 (D. J. Levey, W. R. Silva, M. Galetti, Eds.). CAB International, Wallingford, UK. Lei, J., Shen, Z., Yi, X., 2012. Pericarp thickness and seed size determine acorn dispersal of five rodent–dis– persed oak species. Acta Theriologica Sinica, 32: 83–89. Leiva, J., Díaz–Maqueda, A., 2016. Fast–growing seeds and delayed rodent predatory activity in the seeding season: A combined mechanism to escape and survive rodent predation in Quercus ilex subsp. ballota L. acorns and seedlings. Forest Ecology and Management, 380, 23–30, Doi: https:// doi.org/10.1016/j.foreco.2016.08.038 Leiva, J., Fernández–Alés, R., 2005. Holm–oak (Quercus ilex subsp. Ballota) acorns infestation by insects in Mediterranean dehesas and shrublands Its effect on acorn germination and seedling emergence. Forest Ecology and Management, 212: 221–229, Doi: 10.1016/j.foreco.2005.03.036 Lichiti, N. I., Steele, M. A., Swihart, R. K., 2017. Seed fate and decision–making processes in scatter– hoarding rodents. Biological Reviews, 92: 474–504, Doi: https://doi.org/10.1111/brv.12240 López–Barrera, F., Manson, R., González–Espinosa, M., Newton, A., 2007. Effects of varying forest edge permeability on seed dispersal in a neotropical montane forest. Landscape Ecology, 22: 189–203, Doi: https://doi.org/10.1007/s10980-006-9020-3 Matías, L., Zamora, R., Mendoza, I., Hódar, J. A., 2010. Seed dispersal patterns by large frugivorous mammals in a degraded mosaic landscape. Restoration Ecology, 18: 619–627, Doi: https://doi. org/10.1111/j.1526-100X.2008.00475.x McConkey, K. R., Prasad, S., Corlett, R., Campos– Arceiz, A., Brodie, J., Rogers, H., Santamaria, L., 2012. Seed dispersal in changing landscapes.
208
Biological Conservation, 146: 1–13, Doi: https:// doi.org/10.1016/j.biocon.2011.09.018 Morán, C., Catterall, C., Green, R., Olsen, M., 2004. Functional variation among frugivorous birds: Implications for rainforest seed dispersal in a fragmented subtropical landscape. Oecologia, 141: 584–59, Doi: https://doi.org/10.1007/s00442-004-1685-1 Morán–López, T., Fernández, M., Alonso, C. L., Flores–Rentería, D., Valladares, F., Díaz, M., 2015a. Effects of forest fragmentation on the oak–rodent mutualism. Oikos, 124(11): 1482–1491, Doi: https:// doi.org/10.1111/oik.02061 Morán–López, T., Alonso, C. L., Díaz, M., 2015b. Landscape effects on jay foraging behavior decrease acorn dispersal services in dehesas. Acta Oecologica, 69: 52–64, Doi: https://doi. org/10.1016/j.actao.2015.07.006 Muñoz, A., Bonal, R., 2008. Seed choice by rodents: learning or inheritance? Behavioral Ecology and Sociobiology, 62: 913–922, Doi: https://doi. org/10.1007/s00265-007-0515-y Perea, R., López, D., San Miguel, A., Gil, L., 2012. Incorporating insect infestation into rodent seed dispersal: better if the larva is still inside. Oecologia, 170: 723–733, Doi: https://doi.org/10.1007/ s00442-012-2350-8 Perea, R., San Miguel, A., Gil, L., 2011. Leftovers in seed dispersal: ecological implications of partial seed consumption for oak regeneration. Journal of Ecology, 99: 194–201, Doi: https://doi. org/10.1111/j.1365-2745.2010.01749.x – 2014. Interacciones planta–animal en la regenaración de Quercus pyrenaica: ecología y gestión. Ecosistemas, 23: 18–26, Doi: https://doi. org/10.7818/ECOS.2014.23-2.04 Pérez Olvera, C. P., Dávalos, S. R., Guerrero, C. E., 2000. Aprovechamiento de la madera de encino en México. Madera y Bosques, 6: 3–13, Doi: https:// doi.org/10.21829/myb.2000.611338 Pérez–Ramos, I. M., 2014. El milagro de regenerar en especies mediterráneas de Quercus. ¿Cómo serán los bosques del futuro?. Ecosistemas, 23: 13–17, Doi: https://doi.org/10.7818/ECOS.2014.23-2.03. Pérez–Ramos, I. M., Urbieta, I. R., Marañón, T., Zavala, M. A., Kobe, R. K., 2008. Seed removal in two coexisting oak species: ecological consequences of seed size, plant cover and seed–drop timing. Oikos, 117: 1386–1396, Doi: https://doi. org/10.1111/j.2008.0030-1299.16370.x Pérez–Ramos, I. M., Urbieta, I. R., Zavala, M. A., Marañón, T., 2012. Ontogenetic demographic conflicts and rank reversals in two Mediterranean oak species: implications for coexistence. Journal of Ecology, 100: 267–277, Doi: https://doi. org/10.1111/j.1365-2745.2011.01912.x Pesendorfer, M., Sillett, S. T., Koenig, W., Morrison, S., 2016. Scatter–hoarding corvids as seed dispersers for oaks and pines: A review of a widely distributed mutualism and its utility to habitat restoration. The Condor: Ornithological Applications, 118: 215–237, Doi: https://doi.org/10.1650/CONDOR-15-125.1
Gamboa and Barragán
Ramos–Palacios, C. R., Badano, E., Flores, J., Flores–Cano, J., Flores–Flores, J., 2014. Distribution patterns of acorns after primary dispersion in a fragmented oak forest and their consequences on predators and dispersers. European Journal of Forest Research, 133: 391–404, Doi: https://doi. org/10.1007/s10342-013-0771-5 Rubio–Licona, L. E., Romero–Rangel, S., Rojas–Zenteno, E. C., Ángel, D. D., Gutiérrez–Guzmán, J. C., 2011. Variación del tamaño de frutos y semillas en siete especies de encino (Quercus, Fagaceae). Polibotánica, 32: 135–151. Santos, T., Tellería, J., Virgós, E., 1999. Dispersal of Spanish juniper Juniperus thurifera by birds and mammals in a fragmented landscape. Ecography, 22: 193–204, Doi: https://doi. org/10.1111/j.1600-0587.1999.tb00468.x Scarlett, T. L., Smith, K. G., 1991. Acorn Preference of Urban Blue Jays (Cyanocitta cristata) during Fall and Spring in Northwestern Arkansas. The Condor, 93: 438–442, Doi: https://doi.org/10.2307/1368961 Smith–Ramírez, C., Arellano, G., Hagen, E., Vargas, R., Castillo, J., Miranda, A., 2013. The role of Turdus falcklandii (Aves: Passeriforme) as disperser of invasive plants in the Juan Fernández Archipelago. Revista Chilena de Historia Natural, 86: 33–48. Valencia, A. S., 2004. Diversidad del género Quercus (Fagaceae) en México. Boletín de la Sociedad Botánica de México, 75: 33–53. Vander Wall, S., 2001. The evolutionary ecology of nut dispersal. Botanical Review, 67: 74–117, Doi: https://doi.org/10.1007/BF02857850 – 2010. How plants manipulate the scatter–hoarding behavior of seed–dispersing animals. Philosophical Transactions of the Royal Society B, 365: 989–997, Doi: https://doi.org/10.1098/rstb.2009.0205 Wang, B., Chen, J., 2008. Tannin concentration enhances seed caching by scatterhoarding rodents: An experiment using artificial 'seeds’. Acta Oecologica, 34: 379–385, Doi: https://doi.org/10.1016/j. actao.2008.07.001 Xiao, Z., Gao, X., Steele, M. A., Zhang, Z., 2010. Frequency–dependent selection by tree squirrels: adaptive escape of nondormant white oaks. Behavioral Ecology, 21: 169–175, Doi: https://doi. org/10.1093/beheco/arp169 Yi, X., Zhang, M., Bartlow, A., Dong, Z., 2014. Incorporating cache management behavior into seed dispersal: The effect of pericarp removal on acorn germination. Plos One, https://doi.org/10.1371/ journal.pone.0092544 Zavala–Chávez, F., García, E., 1996. Frutas y semillas de encinos. Universidad Autónoma Chapingo, México. Zhang, H., Chen, Y., Zhan, Z., 2008. Differences of dispersal fitness of large and small acorns of Liaodong oak (Quercus liaotungensis) before and after seed caching by small rodents in a warm temperate forest, China. Forest Ecology and Management, 255: 1243–1250, Doi: https://doi. org/10.1016/j.foreco.2007.10.028
Animal Biodiversity and Conservation 43.2 (2020)
209
How riparian forest integrity influences anuran species composition: a case study in the Southern Brazil Atlantic Forest P. C. de Almeida, M. T. Hartmann, P. A. Hartmann
Almeida, P. C. de, Hartmann, M. T., Hartmann, P. A., 2020, How riparian forest integrity influences anuran species composition: a case study in the Southern Brazil Atlantic Forest. Animal Biodiversity and Conservation, 43.2: 209–219, Doi: https://doi.org/10.32800/abc.2020.43.0209 Abstract How riparian forest integrity influences anuran species composition: a case study in the Southern Brazil Atlantic Forest. Riparian forests are under legal protection in Brazil and provide essential ecosystem services yet have been historically degraded and reduced by deforestation. Consequently, the fauna of these riparian forests and associated ecosystems can be strongly affected, as is the case with amphibians. In this study we identify how anuran species composition varies in riparian forests with various levels of environmental integrity. The study took place in the Fritz Plaumann State Park (FPSP), a protected area with forest formations typical of the Southern Atlantic Forest. Our results suggest that the environmental integrity of the sampling sites influenced where each species was found. The most preserved habitats, with large areas of riparian forest and fewer anthropic impacts, promoted greater species diversity and allowed for the maintenance of species with specific environmental requirements. Two species registered are on the list of endangered amphibians (Boana curupi and Vitreorana uranoscopa) and one is an exotic invasive species (Lithobates catesbeianus). Because it preys on native amphibians and may act as a pathogen vector, this species is a potential threat to the native amphibian populations inside the park. Even though large portions of the FPSP consist of forests in a secondary stage of succession, the connection with better–preserved areas of primary forest allows for the general occurrence of more demanding species that are usually associated with well–preserved habitats. On a regional level, these habitats occur only inside the park and in their absence, these species will most likely become locally or regionally extinct. Key words: Conservation, Protected area, Environmental integrity, Richness, Invasive species Resumen Cómo influye la integridad de los bosques ribereños en la composición de especies de anuros: un estudio práctico en el bosque Atlántico del sur del Brasil. Los bosques ribereños, que en Brasil están protegidos por la ley, proporcionan servicios ecosistémicos esenciales, a pesar de que, tradicionalmente, la deforestación ha conllevado su degradación y reducción. En consecuencia, la fauna de estos bosques ribereños y los ecosistemas asociados puede verse gravemente afectada, como en el caso de los anfibios. En este estudio, determinamos la composición de especies de anuros en bosques ribereños con varios grados de integridad ambiental. El estudio se llevó a cabo en el Parque Estatal Fritz Plaumann, un área protegida con formaciones forestales típicas del bosque atlántico meridional. Nuestros resultados sugieren que la integridad ambiental de los sitios de muestreo influyó en el lugar en que se encontró cada especie. Los hábitats más conservados, con grandes superficies de bosque ribereño y un impacto antrópico escaso, propiciaron la presencia de una mayor diversidad de especies y permitieron mantener especies con necesidades ambientales específicas. Dos de las especies registradas figuran en la lista de anfibios en peligro de extinción (Boana curupi y Vitreorana uranoscopa) y otra es una especie invasora exótica (Lithobates catesbeianus). Debido a que se alimenta de anfibios autóctonos y puede actuar como un vector de patógenos, esta especie representa una amenaza potencial para las poblaciones de anfibios autóctonos dentro del parque. Incluso aunque grandes extensiones del Parque Estatal Fritz Plaumann estén cubiertas por bosques en el segundo estadio de sucesión, la conexión
ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
210
Almeida et al.
con áreas mejor conservadas de bosque primario permite la presencia general de especies más exigentes, que se suelen asociar a hábitats bien conservados. A escala regional, estos hábitats solo se encuentran dentro del parque y, en su ausencia, lo más probable es que estas especies se extingan a escala local o regional. Palabras clave: Conservación, Área protegida, Integridad ambiental, Riqueza, Especie invasora Received: 04 X 19; Conditional acceptance: 9 IV 20; Final acceptance: 08 V 20 Priscila Cassiano de Almeida, Marilia T. Hartmann, Paulo A. Hartmann, Ecology and Conservation Laboratory, Federal University of Fronteira Sul, Erechim Campus, ERS 135 km 72 no. 200, Erechim, RS, Brazil. Corresponding author: P. A. Hartmann. E–mail: hartmann.paulo@gmail.com ORCID ID:
Animal Biodiversity and Conservation 43.2 (2020)
Introduction As a consequence of intense deforestation and fragmentation, over 70 % of its original area of the Atlantic Forest biome is degraded, and approximately 65 % was affected by anthropic activities (Almeida, 2016; Rezende et al., 2018). The intensity of this degradation, when considered along with the high biodiversity and endemism levels of the Atlantic Forest, make it a priority ecosystem for conservation (Myers et al., 2000). In the southern portion of the Atlantic Forest, and more specifically in western Santa Catarina and northern Rio Grande do Sul, habitat deforestation and fragmentation has increased because of logging, agricultural and livestock activities (Santa Catarina, 2014). Because of the historical conditions of soil use, there was a sharp reduction in forest cover including those forests associated with water bodies, the riparian forests (Durigan and Engel, 2012; Santa Catarina, 2014). Riparian forests provide ecological protection for lotic water bodies like streams and rivers, promoting the structuring of firm soil and decreasing erosion (Silva et al., 2017). The preservation of riparian forests is also related to increased water quality and environmental complexity of aquatic habitats (Cabette et al., 2017). In regions where the landscape is highly fragmented, riparian forests also function as faunal refuges or ecological corridors between forest fragments (Tanaka et al., 2016). In Brazil, riparian forests are protected by law. The width of the Permanent Preservation Areas (PPAs) around water bodies ranges from 30 to 600 m. However, the Native Vegetation Protection Law of Brazil (Brasil, 2012) includes exceptional cases that allow for riparian forests as small as 5 m around water bodies. Despite the fact that they are under legal protection and provide essential ecosystem services, riparian forests nevertheless have been historically degraded and reduced by deforestation (Ricci, 2013). Because of anthropic influences and reduction of the riparian forests, watercourses become prone to contamination and siltation (Parron et al., 2015). Consequently, the fauna of these riparian forests and associated ecosystems can be strongly affected, as is the case with amphibians (Toledo et al., 2010). The structure of the riparian forest influences the reproduction and conservation of many species of anurans that use these areas for reproduction and shelter (Ricci, 2013). In the context of degradation and contamination of water bodies, anuran dependence on water for reproduction may result in rapid declines of population sizes, or even in local species extinctions (Antonini and Martins, 2016). Furthermore, factors such as changes in forest size, presence of ponds and canopy cover may also influence the distribution of anurans in these riparian forests (Crema et al., 2014; Toledo, 2009). Anurans often exhibit fidelity to a reproductive site and have life cycles restricted to aquatic environments (Toledo et al., 2010). Because they respond to changes in the structure of water bodies and the landscape associated with them, anurans are considered good biological indicators of environmental quality (Toledo,
211
2009; Ribeiro et al., 2012; Gonçalves et al., 2015). It is therefore important to understand how species richness and composition vary in habitats with various degrees of environmental integrity, because this understanding allows for the identification of priority areas for conservation and restoration (Harper et al., 2005). The preservation of biodiversity in the Atlantic Forest is strongly dependent on the number and size of the remaining forest fragments (Colombo et al., 2008; Toledo et al., 2010) and on the anthropic activities in the areas surrounding these fragments. In southern Brazil, large forest areas with little anthropic activity are usually restricted to protected areas (PA). However, only 9 % of the remaining areas of Atlantic Forest are situated within fully–protected areas (Rezende et al., 2018), and most of these areas are strongly influenced by surrounding anthropic activities. Given this scenario, the goal of this study was to identify how anuran species composition, diversity and richness varies in areas of riparian forest with various levels of environmental integrity, in a region of subtropical forest in Southern Brazil. We addressed the following question: is there variation in species composition, diversity and richness among riparian forest with various levels of environmental integrity? We predicted that species composition and diversity would be different among levels of environmental integrity, with most disturbed habitats occupied by more generalist species and the least disturbed habitats having the most specific species. Based on predictions of the intermediate disturbance hypothesis, and considering the levels of environmental integrity, we also predicted that species richness would be greatest at an intermediate level of landscape complexity (Connell, 1978). Material and methods Study site The study was developed in the Fritz Plaumann State Park (27º 17' 26'' S, 52º 06' 51'' W) and its surrounding regions, comprising an area referred to as the Buffer Zone in the park’s management plan (Santa Catarina, 2014). The FPSP is a protected area located in western Santa Catarina state, at the border with the state of Rio Grande do Sul, from which it is separated by the Uruguay River (fig. 1). The park was created as a compensatory measure for the area flooded by the Itá Hydroelectric Plant reservoir and its main goal is to protect an important remnant of the Deciduous Seasonal Forest of the Atlantic Forest. The FPSP has a crucial role in connecting other protected areas of the Santa Catarina (the National Forest of Chapecó and the Araucarias National Park) and Rio Grande do Sul states (Teixeira Soares Municipal Park). The area surrounding the FPSP is mostly occupied by farmers, whose economic activities rely importantly on small–scale and/or subsistence agriculture, with various types of soil use (Santa Catarina, 2014). These characteristics make the FPSP a high–priority site for studies regarding regional
212
biodiversity, and the impacts of anthropic activities in species conservation. The park has an area of de 717.48 ha, including an insular environment of 260 ha. The vegetation is composed of subtropical Atlantic semi–deciduous forests (Oliveira–Filho et al., 2013). The mosaic of forest fragments in the FPSP comprises areas in the early, intermediate and advanced successional stages, as well as fragments of primary forest (Santa Catarina, 2014) The buffer zone surrounding the park has an area of 1,778 ha. It is considered a strategic area for sustainable rural development, where agricultural and livestock activities occupy approximately 58 % of its total area, including pastures, forestry, pig farming, temporary and/or permanent crops, and yerba mate plantations. As the result of agricultural activities and land use, the Permanent Preservation Areas (PPAs) of the streams in the buffer zone include riparian forests of various sizes and levels of environmental integrity (Santa Catarina, 2014). The region has a humid mesothermal climate, without a well–defined dry season. The average yearly rainfall is of approximately 1,800 mm (Wrege et al., 2012). Data sampling We established four sampling areas representing the structures of the riparian forests associated with regional streams, two inside the FPSP and two in the surrounding buffer zone area (fig. 1). We chose the following factors in the selection process: riparian forest width, recuperation efforts for the riparian forest and land use/occupation in the area surrounding the stream, according to the information available in the park management plan (Santa Catarina, 2014). Area 1 (A1) and Area 2 (A2) are located along the Lajeado Cruzeiro stream, in the buffer zone of the park. Area 3 (A3) and Area 4 (A4) are located inside the FPSP, A3 along the Lajeado Cruzeiro stream, and A4 along the Canafístula stream in the most well–preserved area of the park (fig. 1; Santa Catarina, 2014). The Lajeado Cruzeiro stream is a second order stream that runs through the park. It is approximately 5 km long, with a width ranging from 2 m near its source to 10 m near its mouth at the Queimados River, in the wetlands around the Itá HPP. The Canafístula stream is a first order stream that originates inside the FPSP and is an affluent of the Lajeado Cruzeiro stream. It is approximately 3 km long with a width ranging between 1 and 5 m (Santa Catarina, 2014). Regarding the sampling sites, A1 (27º 17' 21'' S, 52º 05' 28'' W) has a riparian forest of approximately 10 m on each side of the stream. It supports agricultural and livestock activities, with pig farming waste being dumped directly into the stream. The only recuperation effort in this area has been the presence of fences, installed in 2013 to protect the stream margins from trampling and grazing by cattle. The A2 site (27º 7' 24'' S, 52º 06' 09'' W) exhibits a riparian forest of approximately 20 m on each side of the stream, with a fence similar to that of A1 installed in 2015. In addition to fencing, other actions were undertaken to accelerate recuperation of the area, including the
Almeida et al.
planting of native trees. The A3 site (27º 17' 21'' S, 52º 06' 58'' W) is characterized by a riparian forest of approximately 50 m on each side of the stream. This forest is in an intermediate succession stage, because anthropic activities ceased after the park was created in 2003. Finally, the A4 site (27º 17' 38'' S, 52º 06' 40'' W) consists of more than 100 m of riparian forest, mostly comprised of forest in advanced succession stages, with patches of primary forest in between. This area has been subjected to very little exploration and alteration, and occasional low–intensity logging. All sampling sites are situated at least 700 m away from one another (Santa Catarina, 2014). Samplings were carried out from November 2017 to April 2018, including the reproductive season of most anuran species that occur in the region (Bastiani and Lucas, 2013). To quantify species richness and the number of anuran individuals, we established linear transects of 150 m in each sampling site along the streams. The transects were traversed from twilight (~20:00 h) until approximately 24:00 h. Each site was sampled at least eight times: A1, N = 10 (total of 22 h); A2, N = 9 (21 h); A3 (19 h) and A4, N = 8 (20 h). Whenever possible, we sampled two sites per night, always alternating the order in which they were sampled. We recorded all individuals sighted and heard, in a distance of up to five meters from the stream margins, and photographed them whenever possible. The limit of five meters was established to exclude the recording of species that are not ecologically associated with streams. For each individual, we recorded the species and the substrate used (Hartmann et al., 2010). Species were identified at the sampling site, whenever possible, or via the photographs taken (Research Authorization n° 60637–1–SISBIO and AUA n°14/2017 GERUC/DPEC–FATMA). The taxonomic nomenclature and classification followed the List of Brazilian Species, organized by the Brazilian Society of Herpetology (Segalla et al., 2019). To evaluate the level of environmental integrity of the streams at each sampling site (A1, A2, A3 and A4), we applied the rapid river assessment protocol (RAP). This protocol was modified from the RAP proposed by Callisto et al. (2002), combined with information from the protocols of Minatti–Ferreira and Beaumord (2006); Rodrigues and Castro (2008); and Rodrigues et al. (2012). The RAP uses categories of habitat alterations such as anthropic alterations, presence of aquatic plants, type of stream bank occupation, presence and size of riparian forest, water and sediment traits, erosion and siltation, plant cover, stream width, and number of riffle/pool areas in the stream. Higher scores reflect better levels of environmental integrity, whereas lower scores suggest degradation. The classification regarding environmental integrity of the streams evaluated used the following score values: 0–40 points = impacted; 41–60 = altered; 60 or more = natural (Callisto et al., 2002). The RAP results were used for analysis considering the various environmental integrities of the sampling sites. We classified the anuran species according to habitat use and conservation status. To determine the
Animal Biodiversity and Conservation 43.2 (2020)
N W
213
390000
E
Concórdia municipality
6982000
6982000
S
Area 3
Area 2
Area 1
6980000
6980000
Area 4
0
0.5
Sampling sites Hydrography Lajeado Cruzeiro River basin Fritz Plaumann State Park
1 km
Source IBGE, 2016; SDS 2012 Datum: SIRGAS 2000, UTM 22S 390000
South America
Brazil
Santa Catarina State
Fig. 1. Map of the study area showing the four sampling sites, two along the Lajeado Cruzeiro stream, into the buffer zone, and two inside the Fritz Plaumann State Park (FPSP), Southern Brazil Atlantic Forest. Fig. 1. Mapa de la zona del estudio en el que se muestran los cuatro sitios de muestreo: dos a lo largo del arroyo Lajeado Cruzeiro, en la zona de transición, y dos dentro del Parque Estatal Fritz Plaumann (FPSP), en el bosque atlántico del sur del Brasil.
Almeida et al.
214
habitat use categories, we used data from the literature (specifically: Haddad, 1998; Heyer et al., 1998; Hartmann et al., 2010; Bastiani and Lucas, 2013). Regarding habitat use, we considered the following categories: broad (Br, uses a variety of different habitats, including anthropic areas), forest (Fo, typical of inside the forest), forest edge (FE; uses primarily forest borders), permanent ponds (PP, uses water bodies that hold water all year round), and temporary ponds (TP, typical of annual water bodies with dry phase of variable timing and duration). For conservation status, we consulted the IUCN Red List of Threatened Species (IUCN, 2019), The Red Book of the Endangered Brazilian Fauna: Volume V: Amphibians (Brazilian list; ICMBIO, 2018), and the CONSEMA Resolution number 002, from December 6th 2011 (Santa Catarina State list; CONSEMA, 2011). Data analysis To estimate species richness and determine sample sufficiency, we used the Jack1 and Chao1 richness estimators (Chao et al., 2015), with the sampling days used as sampling units (Magurran, 2011). The comparisons between the sites with respect to richness (number of species recorded per site at each sampling), number of individuals (number of individuals recorder per site at each sampling) were made using one–way ANOVA, followed by a Tukey post–hoc test with a significance threshold of P < 0.05. We performed these analyses using Past 3.15 software (Hammer et al., 2001). We evaluated data normality and homogeneity using the Shapiro–Wilk and Bartllet tests, respectively. To assess similarity between sites, we use Jaccard’s similarity coefficient (SJij). Whenever appropriate, the analyses were performed either among the four sampling sites (A1, A2, A3 and A4), or between the areas in the buffer zone (A1 and A2) and those inside the park (A3 and A4). We compared the diversity among the sites using Shannon’s H' index. To test if the H' values differed between sites, we used a t–test with a significance threshold of P < 0.05, performed using Past 3.15 software (Hammer et al., 2001). Finally, to test for differences in the RAP core between areas in the buffer zone and those inside the FPSP, we used a Chi–squared (x2) test. Results We recorded a total of ten anuran species belonging to seven families (table 1). Two of these species are on the list of endangered amphibians. Boana curupi is considered Endangered (EN) on the list for the Santa Catarina State (CONSEMA, 2011), and Vulnerable (VU) is on the Brazilian list (ICMBIO, 2018). Vitreorana uranoscopa, is listed as Vulnerable (VU) for the Santa Catarina State (CONSEMA, 2011). One of the species found (Lithobates catesbeianus) is exotic (Segalla et al., 2019). The two richness estimators showed that over 80 % of the richness estimated for the sampling sites was registered (N(J1) = 12.38 ± 1.52 species; Chao1 =
10 ± 0.16 species). The total number of anuran species registered corresponds to 45 % of the anuran species known for the FPSP, considering all habitats (N = 22), and more than 90 % of the stream species recorded for the park (N = 11; Bastiani and Lucas, 2013; Santa Catarina, 2014). The RAP score was lowest in the buffer zone (A1 and A2) and highest inside the FPSP (A3 and A4; table 1). The two sites located in the buffer zone had scores that corresponded to altered habitats, while the two sites located inside the FPSP had scores corresponding to natural habitats. There was a significant difference between the RAP scores of areas in the buffer zone and those inside the FPSP (x2 = 9.04, g.l. = 1, p < 0.01) We registered seven species occurring inside the FPSP, and five in the buffer zone (fig. 2). There was a significant difference regarding the number of species found inside the FPSP and those found in the buffer zone (F1, 33 = 4.24; p = 0.04). When considering all four sampling sites separately, we found that A2 had the highest number of species, followed by A4 and A3, and A1 (table 1). The difference in the number of species registered was only significant between A1 and A4 (F3, 31 = 3.62; p = 0.02; Tukey test p < 0.05). We registered 31 individuals inside the FPSP, and 19 in the buffer zone. There was no significant difference between the number of individuals recorded in the buffer zone and those inside the FPSP (F1, 33 = 3.76; p = 0.06). The stream in A4 had the highest number of individuals reported, followed by A2, A3 and A1 (table 1). A significant difference for the number of individuals encountered was found only between sites A1 and A4 (F3, 31 = 2.83; p = 0.05; Tukey test p < 0.05). Species diversity was significantly higher inside the FPSP (H’ = 1.80) than in the buffer zone (H’ = 1.39; p = 0.01). The diversity index among the four sampling sites was highest for A4, followed by A2, A3 and A1 (table 1). All the comparisons between sites revealed significant differences (A1 x A3, p = 0.02; A1 x A4, p = 0.01; A2 x A3, p = 0.02; A2 x A4, p = 0.01), with the exception of the comparison between A1 and A2 (p = 0.05). Of the ten species encountered, four occurred primarily in forest habitats, three in both forests and open areas, and another three in open habitats (table 1). The exotic species, L. catesbeianus, occurred in both the buffer zone and the FPSP. Nevertheless, the number of L. catesbeianus individuals found was higher in the altered habitats (A1 and A2, N = 9) than inside the FPSP (A3, N = 1). Discussion The highest values of species richness, number of individuals and species diversity reported for the most well–preserved streams, as well as the differences in species composition, support the hypothesis that well–preserved riparian forests harbor more diverse anurans communities than do impacted areas with reduced forest cover (Moraes et al., 2007; Crema
Animal Biodiversity and Conservation 43.2 (2020)
215
Table 1. Anuran species recorded at each sampling site in the Fritz Plaumann State Park (FPSP, A1 and A2) and in the buffer zone (A3 and A4), from November 2017 to April 2018. Habitat use: Br, broad; Fo, forest; FE, forest edge; PP, permanent ponds; TP, temporary ponds; * exotic species. Tabla 1. Especies de anuros registradas por sitio de muestreo en el Parque Estatal Fritz Plaumann (A1 y A2) y en la zona de transición (A3 y A4), entre noviembre de 2017 y abril de 2018. Utilización del hábitat: Br, general; Fo, forestal; FE, márgenes de bosques; PP, embalses permanentes; TP, embalses temporales; * especie exótica. Family / species
A1
A2
A3
A4
Habitat use
4
Fo, FE
1
Br, Fo
F. Brachycephalidae Ischnocnema henselii (Peters,1872) F. Bufonidae Melanophryniscus sp. F. Centrolenidae Vitreorana uranoscopa (Müller, 1924)
5
Fo, FE
F. Hylidae Boana curupi (Garcia, Faivovichi, Haddad, 2007) 4
1
Boana faber (Wied, 1821)
1
1
Dendropsophus minutus (Peters, 1872)
6
5
Ololygon aromothyella (Faivovich, 2005)
Fo, FE Fo, FE, Br Fo, FE, PP, TP, Br
2
Fo, FE, TP
2
Br, FE, PP
F. Leiuperidae Physalaemus aff. gracilis F. Odontophyrynidae Proceratophrys bigibbosa (Peters,1872)
8
Fo, FE PP, Br
F. Ranidae Lithobates catesbeianus (Shaw, 1802)*
1
8
1
3
5
3
4
-
Number of individuals
6
13
11
20
-
RAP value
44
52
73
91
-
Diversity index (H’)
0.50
Number of site-specific species
0
Number of species
et al., 2014; Almeida–Gomes et al., 2014). Likewise, the difference regarding the number of species and number of individuals between the extremes (A1 and A4) appears to be related to the environmental integrity of each site. The extremes demonstrate a high level of structural differences, while the intermediate areas demonstrate transitional characteristics. Similarly to findings in other studies (Heyer et al., 1998; Moraes et al., 2007; Gonçalves et al., 2015), the species reported from the transition areas have the ability to occupy a wide range of habitats and are able to tolerate a moderate degree of environmental alterations. The RAP provided a measure of disturbance intensity and allowed us to test the influence of the intermediate–disturbance hypothesis (Connell, 1978;
1.25 0.93 1.27 2
2
3
-
Shea et al., 2004). As predicted by the hypothesis, we found the most disturbed habitats were occupied by more generalist species (no single exclusive species in A1) whereas the least disturbed habitats had the most specific species (N = 3 in A4). Even so, the highest absolute number of species among the four sampling sites was found in A2 where some transitional characteristics between altered and well– preserved habitats were observed. A similar situation was reported in other studies, demonstrating that transition habitats, between forest and open habitats, often exhibit high environmental complexity, offering a variety of resources and physical conditions that may favor increased species richness levels for anurans (Conte and Rossa–Feres, 2007; Babbitt et al., 2009; Gonçalves et al., 2015). The intermediate
216
successional stages of secondary forests represent a similar context to that described above because they combine landscape elements typical of habitats in both early and late successional stages (Fox, 2013). On the other hand, and not predicted by an intermediate–disturbance hypothesis, the number of species recorded showed a significant difference only between A1 and A4. That is, the sampling sites with intermediate values of disturbance intensity (A2 and A3) did not show a significant difference in number of species compared to the other sites. We found no clear gradient between the sampling sites regarding environmental integrity, thus reducing the effects of intermediate disturbance and increasing the characteristic of the extremes. The difference in species composition that can be perceived in the low similarity between the sampling sites and by the higher number of species occurring inside the FPSP (compared to the buffer zone) suggests that the environmental integrity of the sampling sites played a role in areas where each species was found. Most species encountered inside the FPSP prefer forest habitats and often require specific habitat characteristics (Haddad, 1998; Bastiani and Lucas, 2013). Of the seven species reported inside the FPSP, four (V. uranoscopa, B. curupi, Ischnocnema henselii and Proceratophrys bigibbosa) are considered typical of forest areas (Bastiani and Lucas, 2013). Two other species (Dendropsophus minutus and Ololygon aromothyella) were found in forest habitats, but they may also occur in other habitats such as temporary or permanent ponds (Bastiani and Lucas, 2013; Haddad, 1998). Of the five species found in the buffer zone, four may occur in forest edges and permanent or temporary ponds (L. catesbeianus, Melanophryniscus sp. and Physalaemus aff. gracilis and Boana faber). These findings suggest that anuran species typical of forests appear to depend on environmentally preserved areas. In contrast, most species found in the surrounding buffer zone exhibit greater environmental plasticity, or are typical of open areas, and are more tolerant to altered habitats (Oliveira et al., 2007). Interestingly, although B. curupi is usually associated with forest habitats (Bastiani and Lucas, 2013; Bastiani et al., 2016), it occurred in three of the four sampling sites, including A1, despite this being the most altered site. This demonstrates that although this species prefers forest areas it can potentially occur in locations with different environmental integrity (Bastiani and Lucas, 2013) as long as the vegetation cover is not completely altered. The A4 site exhibited the best habitat conditions for anurans, and was the place where B. curupi was most often found. Populations of B. curupi are currently in decline because of continuous reduction in habitat area, extension, and quality (CONSEMA, 2011; ICMBIO, 2018). The exotic invasive species, L. catesbeianus, was found in an area considered a natural habitat, despite being usually associated with lentic waters and open areas (Descamps and Vocht, 2016). Lithobates catesbeianus can be associated with A3 due to dispersion along the Lajeado Cruzeiro stream. It is not present in the A4 (Canafístula stream), probably
Almeida et al.
due to the lack of connection of this stream with the environments outside the park. Because it preys on native amphibians and may act as a pathogen vector, this species is a potential threat to the local amphibian fauna (Madalozzo et al., 2016). This amphibian currently occurs in approximately 136 municipalities in Brazil, mostly in the south and southeastern regions of the Atlantic Forest biome. The broad distribution of this species represents a conservation challenge, especially if we consider that invasive anurans might be related to the decline of the native anuran fauna (Both et al., 2011). Furthermore, L. catesbeianus may occupy permanent water bodies in the cropland–border–forest gradients that may increase the potential of this species to spread through the forest matrix, allowing it to invade protected areas (Madalozzo et al., 2016). It is estimated that 87.5 % of the protected Atlantic Forest areas might be subject to invasion by L. catesbeianus (Barbosa et al., 2017). The occurrence of this species inside the FPSP may represent a risk to the maintenance of native amphibian populations inside the park. According to the Native Vegetation Protection Law of Brazil (Brasil, 2012) all marginal bands of any natural watercourse from the channel edge of the regular bed are considered as Permanent Preservation Areas (PPAs). The mandatory width of natural marginal bands ranges from 30 to 600 m, depending of the width of the watercourse. However, in consolidated areas (i.e. with anthropic occupation pre–existing July 22nd, 2008) the same law permits marginal bands ranging 5 m, according to the size of the rural property in Fiscal Modules. As most properties in the buffer zone are smallholdings or rural family holdings, almost all riparian forest along the Lajeado Cruzeiro stream had widths of less than 30 m on each side of the stream. If the minimum width of natural marginal bands, such as riparian forests (30 m; Brasil, 2012), appears to be insufficient to maintain anuran diversity (Toledo et al., 2010; this study), this will clearly be a major concern in cases that allow for riparian forests as small as 5 m around water bodies. Furthermore, not only the width, but also too low levels of environmental integrity of the riparian forest, as we demonstrate here, can reduce the overall number of species and determine which species will occur in streams and surroundings. This study shows the importance of the preserving riparian forests for the maintenance of amphibian populations, both inside and outside the FPSP. The most preserved habitats, with large areas of riparian forest and less anthropic impact, promote higher species diversity and allow for the maintenance of species with specific environmental requirements. Smaller riparian forests with more anthropic impacts were occupied by species with fewer habitat requirements and broader ecological tolerances. Because FPSP is located in a region with intensive agricultural and livestock activities, it is an important remnant of the Deciduous Seasonal Forest, and is of paramount importance for its conservation. Even though large portions of the FPSP consist of forests in a secondary stage of succession, the connection with better–preserved areas of primary forest allows for the
Animal Biodiversity and Conservation 43.2 (2020)
Buffer zone A1 and A2
Boana faber Melanophryniscus sp. Physalaemus aff. gracilis
217
Inside the FPSP A3 and A4
Boana curupi Lithobates catesbeianus
Dendropsophus minutus Ischnocnema henselii Ololygon aromothyella Proceratophrys bigibbosa Vitreorana uranoscopa
Fig. 2. Species recorded in the buffer zone and inside the Fritz Plaumann State Park (FPSP), Southern Brazil Atlantic Forest. A1, Area 1; A2, Area 2; A3, Area 3; A4, Area 4. Fig. 2. Especies registradas en la zona de transición y dentro del Parque Estatal Fritz Plaumann, en el bosque atlántico del sur del Brasil. A1, Sitio de muestreo 1; A2, Sitio de muestreo 2; A3, Sitio de muestreo 3; A4, Sitio de muestreo 4.
general occurrence of more demanding species that are usually associated with well–preserved habitats. On a regional level, these habitats occur only inside the park and in their absence, these species would most likely become locally or regionally extinct. Acknowledgements We are grateful to the Federal University of Fronteira Sul (UFFS) for providing logistical support. Valuable help in fieldwork was provided by Taís Carla Gaspareto, Marília Cumaru Inhamuns and Fritz Plaumann State Park team (ECOPEF). This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior–Brasil (CAPES)–Finance Code 001. References Almeida–Gomes, M., Lorini, M. L., Rocha, C. F. D., Vieira, M. V., 2014. Underestimation of extinction threat to stream–dwelling amphibians due to lack of consideration of narrow area of occupancy. Conservation Biology, 28: 616–619. Almeida, D. S., 2016. Recuperação ambiental da Mata Atlântica. UESC, Ilhéus. Antonini, Y., Martins, J. P. V., 2016. Restauração e conservação de matas ciliares em reservatórios hidroelétricos: importância para a conservação da biodiversidade e processos ecológicos. Nitro,
Belo Horizonte. Babbitt, K. J., Baber, M. J., Childers, D. L., Hocking, D., 2009. Influence of agricultural upland habitat type on larval anuran assemblages in seasonally inundated wetlands. Wetlands, 9: 294–301. Barbosa, F. G., Both, C., Bastos, M., 2017. Invasive American bullfrogs ande African clawed frogs in South American: high suitability of occurrence in biodiversity hotspots. Zoological Studies, 58: 1–10. Bastiani, V. I. M., Cavasotto, E. I., Lucas, M. E., 2016. Ecology and natural history of Hypsiboas curupi (Anura, Hylidae): An endemic amphibian to the southern Atlantic Forest. Neotropical Biology and Conservation, 11: 122–131. Bastiani, V. I. M., Lucas, E. M., 2013. Anuran diversity (Amphibia, Anura) in a Seasonal Forest fragment in southern Brazil. Biota Neotropica, 13: 255–264. Both, C., Lingnau, R., Santos–Jr., A., Madalozzo, B., Lima, L. P., Grant, T., 2011. Widespread occurrence of the American bullfrog, Lithobates catesbeianus (Shaw, 1802) (Anura: Ranidae), in Brazil. South American Journal of Herpetology, 6: 127–134. Brasil, 2012. Lei n° 12.651 de 25 de maio de 2012. Código Florestal Brasileiro, http://www.planalto.gov. br/ccivil_03/_ato2011–2014/2012/lei/l12651.htm. Cabette, R. S. H., Souza, R. J., Shimano, Y., Juen, L., 2017. Effects of changes in the riparian forest on the butterfly community (Insecta: Lepidoptera) in Cerrado areas. Revista Brasileira de Entomologia, 61: 43–50. Callisto, M., Ferreirra, W. R., Moreno, P., Goulart, M., Petrucio, M., 2002. Aplicação de um protocolo de
218
avaliação rápida da diversidade de habitats em atividades de ensino e pesquisa. Acta Limnológica Brasiliencia, 14: 91–98. Chao, A., Ma, K. H., Hsieh, T. C., Chiu, C. H., 2015. Online Program SpadeR (Species–richness Prediction and Diversity Estimation in R). Program and User's Guide published at: http://chao.stat.nthu. edu.tw/wordpress/software_download/ Colombo, P., Kindel, A., Vinciprova, G., Krause, L., 2008.Composition and threats for conservation of anuran amphibians from Itapeva State Park, Municipality of Torres, Rio Grande do Sul, Brazil. Biota Neotropica, 8: 229–240. Connell, J. H., 1978. Diversity in tropical rain forest and coral reefs. Science, 199: 1302–131. CONSEMA, 2011. Lista de Espécies da Fauna Ameaçada no Estado de Santa Catarina, http:// www.fatma.sc.gov.br/upload/Fauna/resolucao_fauna__002_11_fauna.pdf Conte, C. E., Rossa–Feres, D. C., 2007. Riqueza e distribuição espaço–temporal de anuros em um remanescente de Floresta de Araucária no sudeste do Paraná. Revista Brasileira de Zoologia, 24: 1025–1037. Crema, A., Souza, F. A. C. F., Pastelli, L. F. P., Carvalho, R. M. V., Mesquita, D. O., 2014. Diversidade e distribuição de anfíbios anuros em matas de galeria do Distrito Federal, Brasil. Revista Nordestina de Biologia, 23: 3–27. Descamps, S., Vocht, A., 2016. Movements and habitat use of the invasive species Lithobates catesbeianus in the valley of the Grote Nete (Belgium). Belgian Jounal of Zoology, 146: 90–100. Durigan, G., Engel, V. L., 2012. Restauração de Ecossistemas no Brasil: onde estamos e para onde podemos ir? In: Restauração ecológica de ecossistemas degradados: 1–23 (S. V. Martins, Ed.). UFV, Viçosa. Fox, J. W., 2013. The intermediate disturbance hypothesis should be abandoned. Trends in Ecology and Evolution, 28: 86–92. Gonçalves, D. S., Crivellari, L. B., Conte, C. E., 2015. Linking environmental drivers with amphibian species diversity in ponds from subtropical grasslands. Anais da Academia Brasileira de Ciências, 87: 1751–1762. Haddad, C. F. B., 1998. Biodiversidade dos anfíbios no Estado de São Paulo. In: Biodiversidade do Estado de São Paulo, Brasil: síntese do conhecimento ao final do século XX: 17–26 (R. M. C. Castro, Ed.). FAPESP, São Paulo. Hammer, O., Haper, D. A. T., Ryan, P. D., 2001. Past: paleontological statistics software package for education and data analysis. Palaeontologia Electronica, 4: 1–9. Harper, K. A., Macdonald, E., Burton, J. P., Chein, J., Brosofske, D. K., Saunders, C. S., Euskirchen, S. E., Roberts, D., Jaith, S. M., Esseen, P., 2005. Edge Influence on Forest Structure and Composition in Fragmented Landscapes. Conservation Biology, 19: 768–782. Hartmann, M. T., Hartmann, P. A., Haddad, C. F. B., 2010. Reproductive modes and fecundity of an
Almeida et al.
assemblage of anuran amphibians in the Atlantic rainforest, Brazil. Iheringia, Série Zoologia, 100: 207–215. Heyer, W. R., Rand, A. S., Cruz, C. A. G., Peixoto, O. L., 1998. Decimations, extinctions, and colonizations of frog populations in southeast Brazil and their evolutionary implications. Biotropica, 20: 230–235. ICMBIO, 2018. Livro Vermelho da Fauna Brasileira Ameaçada de Extinção: Volume V: Anfíbios. In: Livro Vermelho da Fauna Brasileira Ameaçada de Extinção: 1–128. ICMBio, Brasilia. IUCN, 2019. The IUCN Red List of Threatened Species. Version 2019–2, https://www.iucnredlist.org Leite, P., Klein, R. M., 1990. Geografia do Brasil: região Sul. IBGE, Rio de Janeiro. Madalozzo, B., Both, C., Cechin, S., 2016. Can Protected Areas with Agricultural Edges Avoid Invasions? The Case of Bullfrogs in the Southern Atlantic Rainforest in Brazil. Zoological Studies, 55: 1–13. Magurran, A. E., 2011. Medindo a diversidade biológica. UFPR, Curitiba. Minatti–Ferreira, D. D., Beaumord, A. C., 2006. Adequação de um protocolo de avaliação rápida de integridade ambiental para ecossistemas de rios e riachos: aspectos físicos. Revista Saúde, 7: 39–47. Moraes, R. A., Sawaya, R. J., Barrela, W., 2007. Composição e diversidade de anfíbios anuros em dois ambientes de Mata Atlântica no Parque Estadual Carlos Botelho, São Paulo, sudeste do Brasil. Biota Neotropica, 7: 27–36. Myers, N., Mittermeier, R. A., Mittermeier, C. G., Fonseca, G. A. B., Kent, J., 2000. Biodiversity hotspots for conservation priorities. Nature, 403: 853–845. Oliveira, F. E., Feio, N. R., Matta, P. L. S., 2007. Aspectos reprodutivos de Dendropsophus minutus (PETERS, 1872) no município de Viçosa, Minas Gerais. CERES, 53: 230–238. Oliveira–Filho, A. T., Budke, J. C., Jarenkow, J. A., Eisenlohr, P. V., Neves, D. R. M., 2013. Delving into the variations in tree species composition and richness across South American subtropical Atlantic and Pampean forests. Journal of Plant Ecology, 8: 1–23. Parron, M. L., Garcia, R. J., Oliveira, B. E., Brown, G. G., Prado, B., 2015. Serviços Ambientais em Sistemas Agrícolas e Florestais do Bioma Mata Atlântica. Embrapa, Brasília. Rezende, C. L., Scarano F. R., Assad, E. D., Joly, C. A., Metzger, J. P., Strassburg, B. B. N., Tabarelli, M., Fonseca, G. A., Mittermeier, R. A., 2018. From hotspot to hopespot: An opportunity for the Brazilian Atlantic Forest. Perspectives in Ecology and Conservation, 16: 208–214. Ribeiro, J. W., Lima, A. P. L., Magnusson, W. E., 2012. The Effect of Riparian Zones on Species Diversity of Frogs in Amazonian Forests. Copeia, 2012: 375–381. Ricci, G. V., 2013. Área de Preservação Permanente de Cursos D´Água e Várzeas: Ante os Interesses de Ambientalistas e Empresários Rurais. UTFP, Londrina. Rodrigues, A. S. L., Castro, P. T. A., 2008. Protocolos
Animal Biodiversity and Conservation 43.2 (2020)
de avaliação rápida: instrumentos complementares no monitoramento dos recursos hídricos. Revista Brasileira de Recursos Hídricos, 13: 161–170. Rodrigues, A. S. L., Malafaia, G., Costa, A. T., Nalini–Júnior, H. A., 2012. Adequação e avaliação da aplicabilidade de um Protocolo de Avaliação Rápida na bacia do rio Gualaxo do Norte, Leste– Sudeste do Quadrilátero Ferrífero (MG, Brasil). Revista Ambiente & Água, 7: 231–244. Santa Catarina, 2014. Plano de Manejo Fase II do Parque Estadual Fritz Plaumann. Volume I: Plano Básico. FATMA, Florianópolis. Segalla, M. V., Caramaschi, U., Cruz, C. A. G., Garcia, P. C. A., Grant, T., Haddad, C. F. B., Santana, D. J., Toledo, L. F., Langone, J. A., 2019. Brazilian Amphibians: List of Species. Herpetologia Brasileira, 8: 65–96. Shea, K., Roxburgh, S. H., Rauschert, E. S. J., 2004. Moving from pattern to process coexistence mechanisms under intermediate disturbance regimes. Ecology Letters, 7: 491–508.
219
Silva, L. R., Leite, A. F. M., Muniz, H. F., Souza, G. A. L., Moraes, R. H., Gehring, C., 2017. Degradation impacts on riparian forests of the lower Mearim river, eastern periphery of Amazonia. Forest Ecology and Management, 402: 92–101. Tanaka, M. O., Souza, A. L. T., Moschini, L. E., Oliveira, A. K., 2016. Influence of watershed land use and riparian characteristics on biological indicators of stream water quality in southeastern Brazil. Agriculture, Ecosystems & Environment, 216: 333–339. Toledo, L. F., 2009. Anfíbios como Bioindicadores. In: Bioindicadores da Qualidade Ambiental: 196–208 (S. Neumann–Leitão, S. El–Dier, Orgs.). Instituto Brasileiro Pró–Cidadania, Recife. Toledo, L. F., Carvalho e Silva, S. P., Sánchez, C., Almeida, M. A., Haddad, C. F. B., 2010. The review of the Brazilian Forest Act: harmful effects on amphibian conservation. Biota Neotropica, 10: 35–38. Wrege, S. M., Steinmetz, S., Junior, R. C., Almeida, R. I., 2012. Atlas climático da região Sul do Brasil: Estados do Paraná, Santa Catarina e Rio Grande do Sul. Embrapa, Brasília.
220
Almeida et al.
Animal Biodiversity and Conservation 43.2 (2020)
221
A global review of animal translocation programs P. S. Resende, A. B. Viana–Junior, R. J. Young, C. S. de Azevedo
Resende, P. S., Viana–Junior, A. B., Young, R. J., de Azevedo, C. S., 2020. A global review of animal translocation programs. Animal Biodiversity and Conservation, 43.2: 221–232, Doi: https://doi.org/10.32800/abc.2020.43.0221 Abstract A global review of animal translocation programs. We performed a bibliometric analysis to investigate the efficiency of release techniques (soft and hard–release), to analyse the characteristics and outcomes of the translocation programs, to identify knowledge gaps, and to provide recommendations. Animal conservation studies involving animal release to the wild increased significantly over the 31 years studied and were more frequently performed with terrestrial mammals than with other taxonomic groups. Most of the studies were performed by researchers from developed countries. Translocations occurred mostly in temperate regions, with almost no translocations occurring in the tropics. Almost 60 % of the studies did not provide information regarding the success or failure of the translocation programs. The most commonly used technique was hard release. Wild–caught specimens were preferred for translocations. Translocation programs were less common for groups like amphibians, fishes, and invertebrates. If criteria for suitable translocation are met, this management tool should also be conducted for tropical threatened species, led by native researchers. Furthermore, criteria for successful translocation should be clearly identified in order to improve future conservation actions. Key words: Bibliometric analysis, Conservation, Hard release, Knowledge gap, Soft release Resumen Un examen general de los programas de translocación de animales. Realizamos un análisis bibliométrico para estudiar la eficiencia de las técnicas de liberación (liberación suave y dura), con objeto de analizar las características y los resultados de los programas de translocación, señalar vacíos de información y formular recomendaciones. Los estudios de conservación animal que implican la liberación de animales al medio natural han aumentado significativamente en los 31 años que abarca el presente estudio y se han realizado más frecuentemente con mamíferos terrestres que con otros grupos taxonómicos. La mayoría de los estudios fueron realizados por investigadores de países desarrollados. Las translocaciones se produjeron mayoritariamente en regiones templadas, mientras que en los trópicos prácticamente no hubo ninguna. Casi en el 60 % de los estudios, no se informó del éxito o el fracaso de los programas de translocación. La técnica más utilizada fue la liberación dura. Se prefería a los ejemplares capturados en el medio natural para las translocaciones. Los programas de translocación de grupos como anfibios, peces e invertebrados eran menos habituales. Si se cumplen los criterios para una translocación adecuada, esta herramienta de gestión también debería utilizarse con especies tropicales amenazadas, bajo la dirección de investigadores nativos. Asimismo, los criterios para que una translocación dé buenos resultados deberían estar claramente establecidos, a fin de mejorar las futuras medidas de conservación. Palabras clave: Análisis bibliométrico, Conservación, Liberación dura, Vacío de información, Liberación suave Received: 11 III 20; Conditional acceptance: 14 IV 20; Final acceptance: 10 V 20 Paloma Silva Resende, Universidade Federal de São João del–Rei, Pós–graduação em Ecologia, Praça Frei Orlando 170, Centro, CEP 36307–352 São João del–Rei, Minas Gerais, Brazil.– Arleu Barbosa Viana–Junior,
ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
222
Resende et al.
Laboratorio de Ecologia de Insetos, Programa de Pós–graduação em Biodiversidade e Evolução, Coordenação de Zoologia, Museu Paraense Emílio Goeldi, 66077–530 Belém, Pará, Brazil.– Robert John Young, University of Salford Manchester, Peel Building, Room G51, Salford, M5 4WT, United Kingdom.– Cristiano Schetini de Azevedo, Universidade Federal de Ouro Preto, Pós–graduação em Ecologia de Biomas Tropicais, Departamento de Biodiversidade, Evolução e Meio Ambiente, Campus Morro do Cruzeiro, Bauxita, CEP 35400–000 Ouro Preto, Minas Gerais, Brasil. Corresponding author: C. S. de Azevedo. E–mail: cristiano.azevedo@ufop.edu.br ORCID ID: P. S. Resende: 0000-0002-4750-8800; A. B. Viana–Junior: 0000-0002-9964-9875; R. J. Young: 0000-0002-8407-2348; C. S. de Azevedo: 0000-0003-0256-9017
Animal Biodiversity and Conservation 43.2 (2020)
Introduction More than 30,000 animal species are threatened with extinction in the world (IUCN, 2019). Animal populations are declining around the globe, mainly due to habitat destruction, hunting, urbanization, pollution, diseases, climate change, and competition with invasive species (Pimm et al., 2014; IUCN, 2019). To avoid local animal extinctions, conservationists are applying strategies that can be very useful in specific scenarios, such as animal translocations. Translocations are defined as the human–mediated movement of living organisms from one area with release in another (Griffith et al., 1989; Fischer and Lindenmayer, 2000; Seddon et al., 2007; IUCN, 2013). There are different types of translocations: (a) reintroductions (the intentional movement and release of an organism inside its indigenous range from which it has disappeared); (b) reinforcement or supplementation (intentional movement and release of an organism into an existing population of conspecifics); and (c) introductions (the intentional movement and release of an organism outside its indigenous range) (all definitions taken from IUCN, 2013). The efficiency of translocations as a conservation tool has been questioned. Some scientists argue that this strategy is unjustified or inadequate (Sarrazin and Barbault, 1996; Pons and Quintana, 2003; Pérez et al., 2012; Pressey et al., 2017). Others show that costs are high and success rates are low (Beauchamp et al., 2000; Ewen and Armstrong, 2007; Yott et al., 2011; Taggart et al., 2015; Stuparyk et al., 2018). Furthermore, the scientific literature shows that besides a bias towards publishing successful projects and towards popular organisms (Bonnet et al., 2002; Díaz et al., 2018), there is a geographical bias towards temperate regions (Lawler et al., 2006; Di Marco et al., 2017). To help direct future studies, a bibliometric analysis of the translocation literature is needed in order to develop better guidance for managers and conservationists and to identify knowledge gaps (Goulart et al., 2009). Determining the success of animal release programs is complicated and there is no single definition of how to measure whether a release has been successful (Gusset et al., 2008). Currently, the most commonly used measure of success of any animal release is the establishment of individuals at the release site and the formation of stable populations (Teixeira et al., 2007). Although there is no overruling definition of success, programs may have short–term and long–term objectives to evaluate. As an example, Seddon (1999) identified a sequence of three objectives to assess success of reintroduction programs: (1) survival of the release generation; (2) breeding by the release generation and their offspring; and (3) persistence of the re–established population as predicted through the use of population extinction probability modelling. The first two objectives could be used as short–term measures of success, while the third objective could be used as long–term measure of success, with time frames for evaluation depending on the focal species’ life history traits and the length of
223
time that the program has been in existence (Gusset, 2009; Martínez–Abrain and Oro, 2010). The main IUCN criterion for a successful translocation is the production of a viable population that reaches their regulation phase (IUCN, 2013). Translocation success may depend on characteristics of the released individuals (captive–raised or wild–caught: behaviour, stress level, age, genetics, life–history, etc.; Miller et al., 1999; Griffin et al., 2000; Seddon et al., 2007; IUCN, 2013; Neaves et al., 2015; Curik et al., 2017), type of release protocol (hard–release or soft–release: e.g. pre–release management and time with human contact; Hardman and Moro, 2006; Mitchell et al., 2011; IUCN, 2013; Moseby et al., 2014; Sasmal et al., 2015), release site (e.g. food and shelter availability, predation; Barbosa et al., 2008; Polo–Cavia and Gomez–Mestre, 2014; Szymkowiak et al., 2017), and funding (e.g. trained personnel, veterinary care, captive maintenance, monitoring; Ferraro and Pattanayak, 2006; Bunge–Vivier and Martínez–Ballesté, 2017; Green et al., 2018). Thus, the evaluation of such characteristics is important to establish best practice for translocation programs. The aim of the present study was to evaluate trends and assess the suitability of animal translocations by performing a bibliometric analysis (i.e. descriptive review of the literature; Xiau and Watson, 2019) from 1986 to 2017. Material and methods Data collection The bibliometric analysis involved an Internet search for articles published over a period of 31 years, from 1986 to 2017, using Scielo©, Web of Science© and Scopus© databases. The searches used the following keywords: hard release, soft release, wildlife reintroduction, wildlife translocation, wildlife introduction, release of wild animals, animal reintroduction, animal introduction, and animal translocation (terms singly and in combination). The analysis included articles published in scientific journals only; conference abstracts, book chapters, reports and grey literature were disregarded. After the initial search, references were exported to EndNote X7© software for reference management. Articles were initially filtered by reading the abstracts, so that only articles corresponding to the subject of interest were included. The following information was then obtained from each article: author, year, title, journal, language of the article, nationality of the researcher, country of the institution carrying out the study, co–authors, country where the study was conducted, region (temperate or tropical), degree of threat of the studied animals, origin of animals (captive or nature), pre–release management, management type, release coordinates, number of released individuals, sex, type of release (soft or hard), environment (aquatic or terrestrial), taxonomic group (mammals, birds, reptiles, amphibians, fishes, invertebrates), order, species, type of program
Resende et al.
224
Number of articles published
18 16
rPearson = 0.88
R2 = 0.87 Estimated break–point = 2006
14 12 10 8 6 4 2
2018
2016
2014
2012
2010
2008
2006
2004
2002
2000
1998
1996
1994
1992
0
Year of publication Fig. 1. Number of articles published between 1986 and 2017 related to animal introductions, reintroductions, and translocations. Articles were limited to conservation actions only. Black line represents the number of published papers over the years; red line represents the regression model showing the temporal breakpoint, where the number of published papers increased significantly. Fig. 1. Número de artículos publicados entre 1986 y 2017 en relación con introducciones, reintroducciones y translocaciones de animales. Los artículos se limitaron exclusivamente a actuaciones de conservación. La línea negra representa el número de artículos publicados a lo largo de los año y la línea roja representa el modelo de regresión que permite mostrar el punto de inflexión temporal, en el que el número de artículos publicados aumentó significativamente.
(conservation introduction, reintroduction or reinforcement), success, presence or absence of funding, funding value, and study time. Data analysis Descriptive statistics were calculated for bibliometric analysis. Pearson's correlation was used to test whether the number of articles was associated with year of publication. We ran a General Linear Model (GLM) with a Poisson distribution to evaluate whether the number of publications (response variable) was influenced by the year (explanatory variable). Finally, we ran a piecewise regression to evaluate the breakpoint, where the number of publications increased significantly. The geographical coordinates of the authors' and co–authors' institutions were used to create a global distribution map of collaborations and to evaluate geographical bias. A map was constructed to show locations where releases occurred. We determined the number of studies for each major animal group (fishes, amphibians, reptiles, birds, and mammals), the environment (terrestrial, aquatic or both), and conservation status (based on the IUCN Red List, 2018). We also recorded the release technique
employed, pre–release management, and success status, as well as the origin of the released specimens (nature or captivity). The number of individuals, the time frame, and the amount of money used for conservation programs were also acquired from the papers. The results are given in absolute and relative numbers whenever necessary and the percentages always refer to the number of records in the evaluated papers (not the number of individuals or species). If a study evaluated three different species, we computed this as three records. Chi–square tests and GLMs were run whenever possible to evaluate differences in the recorded parameters. For GLMs, response variables were the number of papers or species and explanatory variables were the type of release (soft or hard), the origin of the animal (captive or nature), and the success of the program (success or failure). The analyses were run using R 3.5.0 software (R Development Core Team, 2010). Results The initial search found 1119 articles (500 in Scielo, 201 in Web of Science© and 418 in Scopus©). Of the-
Animal Biodiversity and Conservation 43.2 (2020)
225
50
0
N W
E S
–50 0 500 1,000 km
–150
–100
–50
0
50
–100
150
Fig. 2. Number of articles published between 1986 and 2017 according to the 145 cities and 30 countries of the first authors' institutions. The bigger the circle, the greater the number of papers published by that institution. Green lines represent the collaboration net among the institutions. Number in X and Y axis represent the parallels and the meridians. Fig. 2. Número de artículos publicados entre 1986 y 2017, según las 145 ciudades y 30 países de las instituciones de los primeros autores. Cuanto mayor es el círculo, mayor es el número de artículos publicados por dicha institución. Las líneas verdes representan la colaboración neta entre las instituciones. Los números de los ejes X e Y indican los paralelos y meridianos.
se, we eliminated 209 because they were duplicates and 765 because they were not about the subject of interest. Thus, the final bibliometric analysis included 145 articles with a total of 275 records (each species studied was computed as a single record). The number of articles published on animal release for conservation purposes increased over the 31 years of the analysis period (fig. 1), with a statistically significant increase in the number of published articles (r = 0.88, R² = 0.87, F1, 19 = 67.58; p < 0.0001). The articles were associated with institutions from 30 different countries, with 33.1% from the United States of America (n = 48), 13.8 % from Australia (n = 20) and the remaining from 28 different countries (F = 0.98, d.f. = 29, p = 0.52; fig. 2). Most collaborations were between researchers of the United States, Europe, and Australia (fig. 2). Animals were released in 41 different countries; one article did not give a study site, and another reported the study was conducted on the African continent but did not specify which country. Most of the studies were conducted on releases in the United States 27.6 % (n = 40), Australia 11.0 % (n = 16) and New Zealand 9.7 % (n = 14) (F = 2.36, d.f. = 38, p < 0.001). Releases that provided geographical information occurred at 82
different locations, while 10 countries had records with no specified coordinates (fig. 3). Of the 275 records, 115 (41.8 %) occurred in the temperate region and 76 in the tropical region (27.6 %), while the region could not be determined for 84 (30.6 %) (x 2 = 9.26, d.f. = 2, p < 0.01). Among the taxonomic groups released, mammals were the most common, followed by birds, reptiles, amphibians, and insects (x 2 = 536.77, d.f. = 6, p < 0.001; fig. 4), with a total of 213 species from 32 different orders. The most highly represented order was Diprotodontia (number of records: Marsupialia: n = 43, 15.6 %), while the most representative species were Bettongia penicillata and Lagorchestes hirsutus (n = 5, 1.8 % each) (x 2 = 507.65, d.f. = 36, p < 0.001). One article did not mention the species or the order of the animal studied. Most species were terrestrial (number of records: n = 250, 90.9 %), followed by species living in both environments (n = 18, 6.6 %) and aquatic species (n = 6, 2.2 %); it was not possible to determine the environment for one article because the species was not given. Among the 213 species that were release targets for conservation purposes, 43.6 % (n = 120) were classified as Least Concern, 19.6 % (n = 54) as Vul-
Resende et al.
226
130º 0' 0'' W
80º 0' 0'' W
30º 0' 0'' W
20º 0' 0'' E
70º 0' 0'' E
120º 0' 0'' E
170º 0' 0'' E
40º 0' 0'' S
10º 0' 0'' N
60º 0' 0'' N
180º 0' 0'' W
Lat/Lon WGS84
Release sites
N
0
2,300
4,600
9,200 km
Countries with releases without specified locations
Fig. 3. Countries where the animal releases occurred between 1986 and 2017 (yellow circles). Some articles did not inform the coordinates of the releases; thus, the country was marked with a yellow triangle. Fig. 3. Países en los que se produjeron las liberaciones de animales entre 1986 y 2017 (círculos amarillos). Algunos artículos no aportaron información sobre las coordenadas de las liberaciones; por consiguiente, el país se marcó con un triángulo amarillo.
nerable, 12.4 % (n = 34) as Endangered (N = 6) and 8.0 % (n = 22) as Critically Endangered; 2.2 % (n = 6) were not on the IUCN's Red List, and 1.1% (n = 3) were listed as Data Deficient (values referred to the number of species and not the number of records). The species Anaxyrus baxteri was listed as Critically Endangered, but according to the IUCN (2018), it is already extinct in nature. According to the IUCN (2018), the captive population of A. baxteri is declining, so we assumed that this species is critically endangered. The most common type of release program was conservation translocation (n = 134, 48.7 %) (in this case the authors did not provide explicit information about the type of translocation). This was followed by conservation reintroduction (n = 116, 42.2 %), conservation introduction (n = 14, 5.1 %), and conservation supplementation (n = 8, 2.9 %). Three papers not mentioning the type of release program (1.1 %). More animals were translocated from the wild (57.1 %, n = 157) than from captivity (22.9 %, n = 63), while 14.9 % (n = 41) were translocated both from the wild and from captivity; 4.4 % (n = 12) did not state the origin of the released individuals and 0.7 % (n = 2) came from semi–captivity. Hard release was used in 28.0 % (n = 77) of the records, soft release in 22.6 % (n = 62), and both types simultaneously in the same conservation project in 20.7 % (n = 57); the type of release was not reported for 28.7 % (n = 79) of the records.
Among the studies that used soft release, 46.8 % (n = 29) used wild caught animals, while 41.9 % (n = 26) used animals from captivity. Among the studies that used hard release, 90.9 % (n = 70) used animals from the nature, while 7.8 % (n = 6) used animals from captivity. The remaining individuals either came from semi–captivity or from both nature and captivity. A total of 46.6 % (n = 128) of the records reported success in terms of their project goals, 9.9 % (n = 25) reported failure, 39.3 % (n = 108) did not report on their success, 1.8 % (n = 5) claimed an intermediate levels of success, and 3.3 % (n = 9) classified the situation as pending. In general, soft–release resulted in more success of the translocations than hard–release (F = 4.44, d.f. = 2, p = 0.03; table 1), but success for captive and wild individuals was similar (F = 0.27, d.f. = 2, p = 0.76; table 1). However, almost 60 % of the studies did not provide information about the success of the release (table 1). Table 2 shows the most representative taxonomic groups (more than 10 recorded releases) among the studies according to type of release. The studies lasted on average of (± SD) 76.6 ± 170.5 months. Studies involving the orders Carnivora (10.9 months), Rodentia (9.8 months), Passeriformes and Squamata (8.6 months), Testudines (8.1 months), Diprotodontia (5.8 months) and Cetartiodactyla (5.2 months) lasted longer than those
Animal Biodiversity and Conservation 43.2 (2020)
18
Number of species
16 14 12 10 8
Number of species
20
227
90 80 70 60 50 40 30 20 10 0
6 4
0
Carnivora Rodentia Squamata Testudine Passeriformes Primates Cetartiodactyla Galliformes Diprotodontia Artiodactyla Gruiformes Accipitiformes Anura Lagomorpha Anseriformes Orthoptera Perisodactyla Strigiformes Caudata Chiroptera Dasyuromorphia Dermoptera Falconiformes Pelecaniformes Peramelemorphia Pholidota Psittaciformes Rheiformes Rhynchocephalia Scandentia Scorpaeniformes Sirenia
2
Fig. 4. Taxonomic groups (classes and orders) most released in conservation programs across the globe. Colours represent the major animal classes (red, mammals; yellow, birds; purple, reptiles; green, amphibians; blue, arthropods; pink, fishes). Fig. 4. Los grupos taxonómicos (clases y órdenes) más liberados en programas de conservación en todo el planeta. Los colores representan las principales clases de animales (rojo, mamíferos; amarillo, aves; violeta, reptiles; verde, anfibios; azul, artrópodos; rosa, peces).
for all the other orders, but no statistical difference was observed (F = 1.23, d.f. = 35, p = 0.20). There were nine different types of pre–release management with the most representative being the use of an acclimatization enclosure with food supplementation, the use of acclimatization enclosure only, and food training, which accounted for 79.8 % of all the types of pre–release management (table 3). Of the 145 studies, 104 (71.7 %) reported some financial support, but only four (3.8 %) stated the amount spent on the project; the mean amount was US $ 145.757 (mean duration of the project: 66 months), with a range of US $ 35.983–US $ 5,000 (duration of the projects: 24 and 60 months, respectively). Discussion Our results show that studies on translocations have been performed more frequently with terrestrial mammals than with any other taxonomic group. Geographical bias was observed, with most studies and translocations being conducted by researchers
in temperate regions. A bias towards popular, charismatic animals was recorded, with mammals and birds being the most commonly relocated animals. Most of the releases occurred via hard release with animals originating from nature, and outcomes (success or failure) were not reported. The number of studies translocating animals increased significantly over the three decades with a sharp increase beginning in 2007. Changes to the public's perspective on conservation during this time stimulated both zoos and governments to increase conservation measures, including animal releases (Seddon et al., 2007). This increase in the number of publications may also reflect the publication of IUCN Reintroduction guidelines (IUCN, 1998, 2013). It could also reflect the pressure to publish that researchers all around the globe face from their institutions, funding agencies, and governments (De Rond and Miller, 2005; Fanelli, 2010). Animal releases are mostly performed in the temperate region, exhibiting a geographical bias that did not coincide with conservation hotspots. This geographical bias was also observed in other
Resende et al.
228
Table 1. Success of the studies involving hard and soft–release between 1986 and 2017: Ni, not informed; Mix, mix methods were used (hard and soft–release); Varied, cases that inform success and failure of releases at the same study; C, captivity, W, wild; M, individuals from captivity and wild. Tabla 1. Resultado de los estudios realizados entre 1986 y 2017 que implicaron liberaciones duras y suaves: NI, no se informó; MIX, se utilizaron métodos mixtos (liberación dura y suave); Varied, casos en los que se informó de los éxitos y los fracasos de las liberaciones en el mismo estudio; C, en cautividad; W, en el medio natural; M, individuos en cautividad y en el medio natural.
Success C
W
Failure M
C
W
Ni M
C
W
Varied M
C
W
Total M
Soft–release 9 9 6
1 0 2
10 18 2
0 0 0 57
Hard–release 2 4 0
1 2 0
5 10 1
1 0 0 26
Mix
0
1
0
7
9
6
0
0
0
33
0
0
1
3
12
3
1
0
0
29
4
5
1
Ni
1
5
3
Total
16 23 10
2 3 3
studies (Martin et al., 2012; Di Marco et al., 2017). Sixteen of the 36 biodiversity hotspots are located in the tropics, mostly in developing countries (Myers et al., 2000; Myers, 2003; Hrdina and Romportl, 2017; Weinzettel et al., 2018). In fact, the highest number of studies on animal release were conducted in developed countries (PNUD, 2015), especially the United States and Australia, and only 21 % of these were carried out in biodiversity hotspots. This is understandable given that these countries provide more financial resources for such studies. Furthermore, release projects in tropical countries also had collaborating researchers from North American and Australian. Therefore, participation by North American and Australian researchers in the conservation of species is not restricted to their home countries, and the collaboration map shows that these countries are contributing to conservation efforts worldwide, especially with European countries. Most of the studies we evaluated focused on mammals and birds, with mammals accounting for almost 60 % of the total. These data corroborate the similar review of Fischer and Lindenmayer (2000), who found that 50 % of the studies they considered were performed with mammals and 43 % with birds. Similar results were reported by Seddon et al. (2005) who investigated reintroduction projects and found that 41 % of the evaluated studies were performed with mammals and 33 % with birds. Historically, mammals and birds have been considered charismatic species, which attract more public attention and thus make it easier to find funding for conservation programs (Kleiman, 1989; Seddon et al., 2005; Colléony et al., 2017; Krause, 2017). Another aspect that has been considered is the value that humans attribute to species. As shown in the present study, taxonomic groups such as fish, reptiles, amphibians and invertebrates are still poorly represented in conservation programs
25 49 12
2 0 0 145
involving animal release. However, the conservation of charismatic, wide–ranging species can also help to conserve species of these less represented groups because such actions often result in greater habitat protection (Simberloff, 1998). Some studies have indicated that successful conservation projects are more likely to be published (Seddon et al., 2007; Bajonin et al., 2010; Fischer and Lindenmayer, 2000; Miller et al., 2014; Díaz et al., 2018), and that animal release programs, especially those with charismatic species, attract more attention from the public (Bajomi et al., 2010) and thus receive more financial support. In addition, successful actions can also have a more positive popular impact, while the lack of success may not be as attractive to funding sources, making researchers wary of publishing unsuccessful results (Seddon et al., 2007; Bajomi et al., 2010). This may explain the low number of unsuccessful releases found in the present study. Whether or not a release has been successful is difficult to establish (following the IUCN's criterion that success means establishing a viable population in the release area), because it usually requires a long time for released individuals to populate an area (Gusset et al., 2008; Tavecchia et al., 2009; Oro et al., 2011; IUCN, 2013). The mean time for the studies in the present research was 76.6 months, but in 39.3 % of the articles, authors did not explicitly declare whether release was successful or not. Some researchers may have been unable to determine success due to time constraints regarding study length. However, it is important to state that success in the present revision was defined using criteria such as dispersion/movement, survival in the initial months, and reproduction of the released animals, showing that success can be variable depending on the duration and criteria set by authors. No studies declared a success by evaluating the establishment of viable populations or the achievement of the regulation phase, as suggested
Animal Biodiversity and Conservation 43.2 (2020)
by IUCN (2013). Instead, they limited their outcomes to short–term measures of success. In fact, almost 60 % of the studies did not inform success or failure of the translocation programs. This is a very important result and a crucial information gap that needs to be filled in future studies. Most animals from the wild were subjected to hard release, while the origin of animals for soft release was equally from captivity or nature. Hard release may be more advantageous for animals from nature that were in captivity for only a short time, since there would be less time for their natural behaviours to change (Fritts et al., 2001; Rummel et al., 2016). Animals that were born in captivity or had spent most of their life in captivity may be released via soft release because it allows different types of training to be applied (e.g., anti–predation, feeding, flight, etc.) during the pre–release period to facilitate adaptation to the new wild environment (Sutherland et al., 2010). Captive–born individuals are more likely to be predated since they have had little if any contact with their predators (Mathews et al., 2006).Therefore, soft release with a period of acclimatization may increase their chance of establishing themselves (Reading et al., 2013). Through meta–analysis, Tetzlaff et al. (2019) showed the advantages of pre–release management. The present study found most studies failed to clearly state the costs involved in releasing animals for conservation purposes. Such information would
229
Table 2. Number of hard and soft releases for the most studied animal groups between 1986 and 2017. (Each species accounted as one register; studies that release individuals using hard and soft–release concomitantly were not accounted). Tabla 2. Número de liberaciones duras y suaves de los grupos de animales más estudiados entre 1986 y 2017. (Cada especie se cuenta como un único registro; los estudios en los que se produjeron liberaciones duras y suaves de forma simultánea no se tuvieron en cuenta).
Bird
Mammal
Reptile
Soft 19 28 11
(63.3%)
(40.0%)
(34.8%)
Hard 11 42 21
(36.7%)
(60.0%)
(65.6%)
Total 30 70 32
be useful for planning future releases. The need for economic analysis to guide decision–making in conservation is an important issue because a ba-
Table 3. Type of pre–release management used between 1986 and 2017. The types of pre–release management were not exclusive and could be used in combination: a individuals who were injured and remained in the enclosure until they were able to be released; b released during the hibernation period of the species, which prevents its dispersion from the release site; c individual who escaped from the acclimatization enclosure and was recaptured and released immediately. Tabla 3. Tipo de gestión utilizada antes de la liberación entre 1986 y 2017. Los tipos de gestión antes de la liberación no eran exclusivos y se podían utilizar de forma combinada: a individuos heridos que se mantuvieron en la jaula hasta que se les pudo liberar; b liberados durante el período de hibernación de la especie, a fin de evitar su dispersión desde el lugar de la liberación; c individuo que escapó de la jaula de aclimatación y fue capturado de nuevo y liberado inmediatamente. Type of management
N° of records
%
Acclimatization enclosure with food supplementation
39
32.8
Acclimatization enclosure without food supplementation
31
26.1
Pre–release food training
25
21.0
Acclimatization enclosure with food supplementation and anti–predator training
15
12.6
Rehabilitation in enclosure a
3 2.5
Acclimatization enclosure with food supplementation and food training
2
Forced to remain in hibernation site
2 1.7
Food Supplementation after release
1
b
1.7 0.8
Acclimatization enclosure for a few days until escape, followed by recapture and immediate release c
1 0.8
230
sic objective for setting conservation priorities is to maximize the biodiversity conserved within a usually finite budget. In a conservation project of the waterbird crested coot (Fulica cristata), for example, the costs varied between €166.000 and €270.000 for 55 individuals (Martínez–Abraín et al., 2011). In conclusion, the release of animals for conservation has increased over recent decades and can be important for restoring biodiversity. In general, soft release brings more success to conservation programs than hard release, especially for captive–born animals. More detailed information on matters such as techniques, type of translocation, costs, pre–release management, and success should be included in publications so that researchers can develop the most efficient management procedures. Acknowledgements The authors wish to thank CAPES and CNPq for research support and scholarships. Authors would like to thank Dr. Reuber Lana for the help in the construction of the interaction map. The authors also thank the reviewers for their invaluable suggestions. References Bajomi, B., Pullin, A. S., Stewart, G. B., Takacs–Santa, A., 2010. Bias and dispersal in the animal reintroduction literature. Oryx, 44: 358–365. Barbosa, R. R., Silva, I. P., Soto–Blanco, P., 2008. Development of conditioned taste aversion to Mascagnia rigida in goats. Pesquisa Veterinária Brasileira, 28: 571–574. Beauchamp, A. J., Staples, G. C., Staples, E. O., Graeme, A., Graeme, B., Fox, E., 2000. Failed establishment of North Island weka (Gallirallus australis greyi) at Karangahake Gorge, North Island, New Zealand. Notornis, 47: 90–96. Bonnet, X., Shine, R., Lourdais, O., 2002. Taxonomic chauvinism. Trends in Ecology and Evolution, 17: 1–3. Bunge–Vivier, V., Martínez–Ballesté, A., 2017. Factors that influence the success of conservation programs in common property resources in Mexico. International Journal of the Commons, 11: 487–507, Doi: http://doi.org/10.18352/ijc.718 Colléony, A., Clayton, S., Couvet, D., Saint Jalme, M., Prévot, A.–C., 2017. Human preferences for species conservation: animal charisma trumps endangered status. Biological Conservation, 206: 263–269. Curik, I., Ferencakovic, M., Sölkner, J., 2017. Genomic dissection of inbreeding depression: a gate to new opportunities. Revista Brasileira de Zootecnia, 46: 773–782. De Rond, M., Miller, A. N. 2005. Publish or perish? Bane or boon of academic life. Journal of Management Inquiry, 14: 321–329. Di Marco, M., Chapman, S., Althor, G., Kearney, S., Besancon, C., Butt, N., Maina, J. M., Possingham, H. P., von Bieberstein, K. R., Venter, O., Watson, J.
Resende et al.
E. M., 2017. Changing trends and persisting biases in three decades of conservation science. Global Ecology and Conservation, 10: 32–42. Díaz, M., Anadón, J. D., Tella, J. L., Giménez, A., Pérez, I., 2018. Independent contributions of threat and popularity to conservation translocations. Biodiversity Conservation, 27: 1419–1429. Ewen, J. G., Armstrong, D. P., 2007. Strategic monitoring of reintroductions in ecological restoration programmes. Ecoscience, 14: 401 – 409. Fanelli, D., 2010. Do pressure to publish increases scientist’s bias? An empirical support from US States Data. Plos One, 5: e10271. Ferraro, P. J., Pattanayak, S. K., 2006. Money for nothing? A call for empirical evaluation of biodiversity conservation investments. Plos Biology, 4: e105. Fischer, J., Lindenmayer, D. B., 2000. An assessment of the published results of animal relocations. Biological Conservation, 96: 1–11. Fritts, S. H., Mack, C. M., Smith, D. W., Murphy, K. M., Phillips, M. K., Jimenez, M. D., 2001. Outcomes of hard and soft–releases of reintroduced wolves in central Idaho and the Greater Yellowstone Area. In: Large Mammal Restoration: ecological and sociological challenges in the twenty–first century: 125–148. (M. David, F. N. Reed, L. L. Jeffery, Eds.). Island Press, Washington, D.C. Goulart, V. D., Azevedo, P. G., van de Schepop, J. A., Teixeira, C. P., Barçante, L., Azevedo, C. S., Young, R. J., 2009. Gaps in the study of zoo and wild animal welfare. Zoo Biology, 28: 561–573. Green, J. M. H., Fisher, B., Green, R. E., Makero, J., Platts, P. J., Robert, N., Schaafsma, M., Turner, R. K., Balmford, A., 2018. Local costs of conservation exceed those borne by the global majority. Global Ecology and Conservation, 14: e00385. Griffin, A. S., Blumstein, D. T., Evans, C., 2000. Training captive–bred or translocated animals to avoid predators. Conservation Biology, 14: 1317–1326. Griffith, B., Scott, J. M., Carpenter, J. W., Reed, C., 1989. Translocation as a species conservation tool: status and strategy. Science, 245: 477–480. Gusset, M., 2009. A framework for evaluating reintroduction success in carnivores: lessons from African wild dogs. In: Reintroduction of Top–order Predators: 307–320. (M. W. Hayward, M. J. Somers, Eds.). Blackwell Publishing, Oxford. Gusset, M., Ryan, S. J., Hofmeyr, M., Van Dyk, G., Davies‐Mostert, H. T., Graf, J. A., Wildt, D. E., 2008. Efforts going to the dogs? Evaluating attempts to re‐introduce endangered wild dogs in South Africa. Journal of Applied Ecology, 45: 100–108. Hardman, B., Moro, D., 2006. Optimizing reintroduction success by delayed dispersal: is the release protocol important for hare wallabies? Biological Conservation, 128: 403–411. Hrdina, A., Romportl, D., 2017. Evaluating global biodiversity hotspots: very rich and even more endangered. Journal of Landscape Ecology, 10: 108–115, https://doi.org/10.1515/jlecol-2017-0013 IUCN, 1998. IUCN Guidelines for Re–introductions. Gland: IUCN Species Survival Commission. – 2013. Guidelines for Reintroductions and Other
Animal Biodiversity and Conservation 43.2 (2020)
Conservation Translocations. Version 1.0. Gland: IUCN Species Survival Commission. – 2018. The IUCN Red List of Threatened Species 2018–1, http://www.iucnredlist.org [Accessed on 27 August 2018]. – 2019. The IUCN Red List of Threatened Species 2019–1, http://www.iucnredlist.org [Accessed on 06 January 2020]. Kleiman, D. G., 1989. Reintroduction of captive mammals for conservation. BioScience, 39: 152–161. Krause, M., 2017. Charismatic species and beyond: how cultural schemas and organizational routines shape conservation. Conservation and Society, 15: 313–321. Lawler, J. J., Aukema, J. E., Grant, J. B., Halpern, B. S., Kareiva, P., Nelson, C. R., Ohleth, K., Olden, J. D., Schlaepfer, M. A., Silliman, B. R., Zaradic, P., 2006. Conservation science: a 20–year report card. Frontiers in Ecology and the Environment. 4: 473–480. Martin, L. J., Blossey, B., Ellis, E., 2012. Mapping where ecologists work: biases in the global distribution of terrestrial ecological observations. Frontiers in Ecology and the Environment, 10: 195–201. Martínez–Abraín, A., Oro, D., 2010. Applied conservation services of the evolutionary theory. Evolutionary Ecology, 24: 1381–1392. Martínez–Abraín, A., Regan, H. M., Viedma, C., Villuendas, E., Bartolomé, M. A., Gómez, J. A., Oro, D., 2011. Cost–effectiveness of translocation options for a threatened waterbird. Conservation Biology, 25: 726–735. Mathews, F., Moro, D., Strachan, R., Gelling, M., Buller, N., 2006. Health surveillance in wildlife reintroductions. Biological Conservation, 131: 338–347. Miller, B., Ralls, K., Reading, R. P., Scott, J. M., Estes, J., 1999. Biological and technical considerations of carnivore translocation: a review. Animal Conservation, 2: 59–68. Miller, K. A., Bell, T.P., Germano, J. M., 2014. Understanding publication bias in reintroduction biology by assessing translocations of New Zealand’s herpetofauna. Conservation Biology, 28: 1045–1056. Mitchell, A. M., Wellicome, T. I., Brodie, D., Cheng, K. M., 2011. Captive–reared burrowing owls show higher site–affinity, survival and reproductive performance when reintroduced using a soft–release. Biological Conservation, 144: 1382–1391. Moseby, K. E., Hill, B. M., Lavery, T. H., 2014. Tailoring release protocols to individual species and sites: one size does not fit all. Plos One, 9: e99753. Myers, N. 2003. Biodiversity hotspots revisited. Bioscience, 53: 916–917. Myers, N., Mittermeier, R. A., Mittermeier, C. G., Da Fonseca, G. A., Kent, J., 2000. Biodiversity hotspots for conservation priorities. Nature, 403: 853–858 Neaves, L. E., Eales, J., Whitlock, R., Hollingsworth, P. M., Burke, T., Pullin, A. S., 2015. The fitness consequences of inbreeding in natural populations and their implications for species conservation: a systematic map. Environmental Evidence, 4: 5. Oro, D., Matínez–Abraín, A., Villuendas, E., Sarzo, B.,
231
Mínguez, E., Carda, J., Genovart, M., 2011. Lessons from a failed translocation program with a seabird species: determinants of success and conservation value. Biological Conservation, 144: 851–858. Pérez, I., Anadón, J. D., Díaz, M., Nicola, G. G., Tella, J. L., Giménez, A., 2012. What is wrong with current translocations? A review and a decision–making proposal. Frontiers in Ecology and Environment, 10: 494–501. Pimm, S. L., Jenkins, C. N., Abell, R., Brooks, T. M., Gittleman, J. L., Joppa, L. N., Raven, P. H., Roberts, C. M., Sexton, J. O., 2014. The biodiversity of species and their rates of extinction, distribution, and protection. Science, 344: 1246752. PNUD, 2015. Relatório de Desenvolvimento Humano. Casa das Nações Unidas do Brasil, Brasília, http://www.br.undp.org/content/brazil/pt/home/idh0/ rankings/idh-global.html [Accessed on January 2019]. Polo–Cavia, N., Gomez–Mestre, I., 2014. Learned recognition of introduced predators determines survival of tadpole prey. Functional Ecology, 28: 432–439. Pons, P., Quintana, X. D., 2003. Unsuitable reintroductions and conservation priorities. Oryx, 37: 285. Pressey, R. L., Weeks, R., Gurney, G. G., 2017. From displacement activities to evidence–informed decisions in conservation. Biological Conservation, 212: 337–348. R Development Core Team, 2010. R: a language and environment for statistical computing, http:// www.r-project.org [Accessed on March 2018]. Reading, R. P., Miller, B., Shepherdson, D., 2013. The value of enrichment to reintroduction success. Zoo Biology, 32: 332–341. Rummel, L., Martínez–Abraín, A., Mayol, J., Ruiz– Olmo, J., Mañas, F., Jiménez, J., Gómez, J. A., Oro, D., 2016. The use of wild individuals as a key factor for the success of vertebrate translocations. Animal Biodiversity and Conservation, 39: 207–219. Sarrazin, F., Barbault, R., 1996. Reintroduction: challenges and lessons for basic ecology. Trends in Ecology and Evolution, 11: 474–478. Sasmal, I., Honness, K., Bly, K., McCaffery, M., Kunkel, K., Jenks, J. A., Phillips, M., 2015. Release method evaluation for swift fox reintroduction at Bad River Ranches in South Dakota. Restoration Ecology, 23: 491–498. Seddon, P. J., 1999. Persistence without intervention: assessing success in wildlife reintroductions. Trends in Ecology and Evolution, 14(!2): 503. Seddon, P. J., Armstrong, D. P., Maloney, R. F., 2007. Developing the science of reintroduction biology. Conservation Biology, 21: 303–312. Seddon, P. J., Soorae, P. S., Launay, F., 2005. Taxonomic bias in reintroduction projects. Animal Conservation, 8: 51–58. Simberloff, D., 1998. Flagships, umbrellas, and keystones: is single–species management passé in the landscape era? Biological Conservation, 83: 247–257. Stuparyk, B., Horn, C.J., Karabatsos, S., Arteaga–Tor-
232
res, J., 2018. A meta–analysis of animal survival following translocations: comparisons between conflicts and conservation efforts. Canadian Wildlife Biology & Management, 7: 3–17. Sutherland, W. J., Armstrong, D., Butchart, S. H., Earnhardt, J. M., Ewen, J., Jamieson, I., Parker, K. A., 2010. Standards for documenting and monitoring bird reintroduction projects. Conservation Letters, 3: 229–235. Szymkowiak, J., Thomson, R. L., Kuczynski, L., 2017. Interspecific social information use in habitat selection decisions among migrant birds. Behavioural Ecology, 28: 767–775. Swaisgood, R. R., 2010. The conservation–welfare nexus in reintroduction programmes: a role for sensory ecology. Animal Welfare, 19: 125–137. Taggart, D. A., Schultz, D. J., Corrigan, T. C., Schultz, T. J., Stevens, M., Panther, D., White, C. R., 2015. Reintroduction methods and a review of mortality in the brush–tailed rock–wallaby, Grampians National Park, Australia. Australian Journal of Zoology, 63: 383–397. Tavecchia, G., Viedma, C., Martínez–Abraín, A, Bartolomé, M–A., Gómez, J. A., Oro, D., 2009. Max-
Resende et al.
imizing reintroduction success: assessing the immediate cost of release in a threatened waterfowl. Biological Conservation, 142: 3005–3012. Teixeira, C. P., Azevedo, C. S., Mendl, M., Cipreste, C. F., Young, R. J., 2007. Revisiting translocation and reintroduction programmes: the importance of considering stress. Animal Behaviour, 73: 1–13. Tetzlaff, S. J., Sperry, J. H., DeGregorio, B. A., 2019. Effects of antipredator training, environmental enrichment, and soft release on wildlife translocations: a review and meta–analysis. Biological Conservation, 236: 324–331. Weinzettel, J., Vackar, D., Medková, H., 2018. Human footprint in biodiversity hotspots. Frontiers in Ecology and the Environment, 16: 447–452, https:// doi.org/10.1002/fee.1825 Xiau, Y., Watson, M., 2019. Guidance on conducting a systematic literature review. Journal of Planning and Research, 39: 93–112, https://doi. org/10.1177/0739456X17723971 Yott, A., Rosatte, R., Schaefer, J. A., Hamr, J., Fryxell, J., 2011. Movement and spread of a founding population of reintroduced elk (Cervus elaphus) in Ontario, Canada. Restoration Ecology, 19: 70–77.
Animal Biodiversity and Conservation 43.2 (2020)
233
Growth rates in two natural populations of Gasterosteus aculeatus in northwestern Spain: relationships with other life history parameters E. San Miguel, R. Amaro, J. Castro, M. Hermida, C. Fernández
San Miguel, E., Amaro, R., Castro, J., Hermida, M., Fernández, C., 2020. Growth rates in two natural populations of Gasterosteus aculeatus in northwestern Spain: relationships with other life history parameters. Animal Biodiversity and Conservation, 43.2: 233–242, Doi: https://doi.org/10.32800/abc.2020.43.0233 Abstract Growth rates in two natural populations of Gasterosteus aculeatus in north–western Spain: relationships with other life history parameters. We analysed growth rates of two natural populations of the three–spined stickleback fish, Gasterosteus aculeatus, in Galicia (north–west of Spain) where it has a strictly annual life cycle. We used the von Bertalanffy growth model to estimate nonlinear function for length–at–age data sets. These European peripheral populations reach the highest growth rates (k of the von Bertalanffy model > 0.4 month–1) known for this species. Instantaneous mortality rates and fecundity were computed using von Bertalanffy model parameters for each population. Mortality rates found in Galician populations were 2.0–2.3 higher times than those observed in general for Gasterosteidae. Combining both mortality and fertility, different intermediate fitness optima in each population were obtained for mature females. Overall, these differences in life history compared to other studied populations of sticklebacks can be interpreted as local adaptations to a Mediterranean climate type with high degree–days. Consequently, these populations at the edges of the species’ range may have adapted to the unique environmental conditions and may be of interest in ecology and conservation. Key words: Ontogenetic growth, Peripheral populations, Semelparous, Fitness, Natural mortality, Half–life, Gasterosteus aculeatus Resumen Tasas de crecimiento en dos poblaciones naturales de Gasterosteus aculeatus en el noroeste de España: relación con otros parámetros vitales. Se analizaron las tasas de crecimiento de dos poblaciones naturales de Galicia (noroeste de España) del pez espinoso Gasterosteus aculeatus, cuyo ciclo biológico es estrictamente anual. Para ello, se utilizó una función no lineal para conjuntos de datos de longitud por edad: el modelo de crecimiento de von Bertalanffy. Estas poblaciones europeas periféricas tienen las tasas de crecimiento más altas (k en el modelo de von Bertalanffy > 0,4 mes–1, en promedio) conocidas para esta especie. A partir de los parámetros del modelo de von Bertalanffy, se calcularon las tasas de mortalidad instantánea y de fecundidad de cada población, y se observó que las tasas de mortalidad de las poblaciones gallegas son de 2 a 2,3 veces superiores a las observadas en general en Gasterosteidae. La combinación de la fertilidad y la mortalidad produjo diferentes valores óptimos intermedios de eficacia biológica para las hembras maduras de cada población. En términos generales, estas diferencias encontradas en rasgos vitales con respecto a otras poblaciones estudiadas de pez espinoso se pueden interpretar como adaptaciones locales a un clima de tipo mediterráneo con un valor alto de grados–día. Por tanto, estas poblaciones situadas en los límites de la zona de distribución de la especie pueden estar localmente adaptadas a condiciones ambientales muy específicas y pueden ser de interés en los ámbitos de la ecología y la conservación. Palabras clave: Crecimiento ontogenético, Poblaciones periféricas, Semélparas, Eficacia biológica, Mortalidad natural, Vida media, Gasterosteus aculeatus Received: 13 I 20; Conditional acceptance: 12 II 20; Final acceptance: 11 VI 20 E. San Miguel, R. Amaro, J. Castro, M. Hermida, C. Fernández, Departamento de Zoología, Genética y Antropología Física, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus de Lugo, Lugo, Spain. Corresponding author: Eduardo San Miguel. E–mail: eduardo.sanmiguel@usc.es ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
San Miguel et al.
234
Introduction The Mediterranean region is a biodiversity hotspot for freshwater ecosystems, harbouring many species (many of them endemic) and genetically distinct lineages that are of conservation concern (Araguas et al., 2012; Sharda et al., 2018). One of these species is the three–spined stickleback Gasterosteus aculeatus, L. It is a small teleost fish and is a model organism in evolutionary biology and ethology (Bell and Foster, 1994; Mäkinen et al., 2006; Cresko et al., 2007; Mäkinen and Merilä, 2008). This fish is widely distributed throughout the northern hemisphere in latitudes ranging from 35º to 70 ºN (Crivelli and Britton, 1987). The Iberian Peninsula is the southern limit in the East Atlantic Ocean (FishBase, 2019). The species lives in a variety of habitats (marine, streams, rivers, lakes), leading to a high level of phenotypic variation (Bell and Foster, 1994). Iberian Peninsula populations are mainly located in freshwaters habitats in Portugal and Galicia (a region in northwest Spain). In the rest of Spain, they are limited to fragmented populations (Doadrio, 2002). The Galician populations of G. aculeatus have been evaluated on the basis of their morphometric and meristic characteristics by multivariate analysis (Fernández et al., 2000; Hermida et al., 2005a, 2005b). Heritabilities for some meristic characters have also been estimated in a natural population (Hermida et al., 2002). More recently, Pérez–Figueroa et al. (2015) obtained the first estimate of Ne / Nc (effective population size/population census) in Galician rivers using molecular markers. The genetic diversity (assessed by nuclear and mitochondrial markers) for local stickleback populations has also been discussed in relation to its phylogeography and conservation in the wider context of Ibero–Balearic populations (Vila et al., 2017). Galician sticklebacks constitute peripheral populations and are in greater peril than central populations, like various other animal and plant species (Lesica and Allendorf, 1995; Guo et al., 2005). Lying at the southern edge of the species´ European range, they appear to be close to their physiological and reproductive limits, and have undergone local extinction in the recent past (Vila et al., 2017). G. aculeatus is currently classified as endangered under IUCN criteria in both Spain and Portugal (the two Iberian countries). In particular, in Spain the species is classified as vulnerable (Doadrio, 2002) and the local government of Galicia (Xunta de Galicia) includes it in its catalogue of threatened species (CATGEA, 2007). Any conservation measures aimed at protecting this species require understanding of life history strategies, meaning the evaluation of their life history traits, under natural conditions, if possible. Life history traits are of great interest, especially in this species, G. aculeatus, whose populations have evolved by finding many different ways to combine these traits to affect fitness (Bell and Foster, 1994; Baker et al., 2015). Given the climatic differences between the Iberian Peninsula and northern Europe, the southern limit populations are probably subject to different selective forces and will show adaptations not found in northern populations. For example, G. aculeatus is a strictly annual species
in Galicia (Fernández et al., 2000; Pérez–Figueroa et al., 2015): fish breed once in the year following their birth and die shortly after breeding (a semelparous life history), as many dead adults can be found among thousands of young fish. This annual cycle, which is usual in southern populations (Crivelli and Britton, 1987; Clavero et al., 2009), is exceptionally found in some European northern populations (Wootton et al., 2005). Another topic of long interest in conservation and evolution of life history is the description of ontogenetic growth. Data on growth of G. aculeatus Iberian populations are scarce, but they are necessary to contribute to knowledge of their biology and to design effective conservation strategies in Galicia. One of the purposes of this study was to estimate growth parameters from length–at–age data obtained in natural conditions –in two Galician rivers– applying the von Bertalanffy growth function (VBGF) (Ricker, 1979). Empirical studies in teleost fishes have demonstrated a significant connection between growth parameters and life history attributes such as natural mortality and fecundity (Wootton, 1979; Roff, 1984; Gunderson, 1997; Mangel, 2006). Thus, we combined our study on individual growth with the survival exponential distribution and fecundity to obtain lifetime reproductive output. In this way we could describe the lifetime expected reproductive success (ERS) or fitness as the product of survival and fecundity at maturity (Roff, 1984; Mangel, 2006). From this last function, we deduce that fitness will reach a maximum at an intermediate age at maturity (Roff, 1992, 2002) and it is relevant for comparative purposes among populations. In general terms, this work aims to increase our knowledge of the biology of semelparous populations of this species in the Iberian Peninsula with a view to establishing appropriate conservation strategies. Material and methods Study area and sampling collection The samples used for this study come from two rivers (fig. 1): the Rato River (Rato 29T619547, 4761482; 2.8 km from Miño) and the Asma River (Asma; 29T601686, 4717706; 5.5 km from Miño). Both rivers are tributaries of the Miño River (the main Galician river), and are located, and isolated, upstream and downstream by the Belesar dam. Such isolation impedes movement of fishes and configures an important drainage area of Galicia (Pérez–Figueroa et al., 2015). The samples were collected monthly between May and November 1998 using hand nets with a mesh size of 2 mm, selecting specimens greater than 12 mm in length (from tip to tail). All samples were measured using a digital calliper to the nearest 0.01 mm, and then returned to the water. At all times, this work was carried out under the supervision of forest rangers from the autonomous government (Xunta de Galicia). The annual cycle is usual in southern populations of Gasterosteus aculeatus (Clavero et al., 2009; Fernández et al., 2000; Pérez–Figueroa et al., 2015). Analysis of otoliths (unpublished data 2005, Asma River) revealed
Animal Biodiversity and Conservation 43.2 (2020)
235
Rato River
Spain
Miño River 0
Asma River
20
40 km
Belesar dam
Fig. 1. Map of the Miño River basin and its location in Spain. Circles show the sampling points. The star represents the location of the Belesar dam that isolates the upstream basin. Fig. 1. Mapa de la cuenca del río Miño y su situación en España. Los círculos indican los puntos de muestreo. La estrella indica la situación del embalse de Belesar, que aísla la cuenca superior.
that more than 97 % of reproductive adults collected in May or June (with more than 46 mm of standard length) are born in the previous year (age 1+), while fishes between 21 and 25 mm are born in the current year (age 0+). Thus, most fishes captured for our analysis in the two rivers from May to November were cohorts born in 1998, i.e., they belonged to the same generation. Growth parameters, natural mortality, fecundity and expected reproductive success The length–at–age data were employed to fit the von Bertalanffy growth function nonlinear model, hereafter referred to as VBGF, which has the form: Lt = L∞ (1 – e–k(t – t0))
(1)
where Lt is length (in mm) at age t (in months); L∞ is the asymptotic length (theoretical final length); k is the growth rate (month–1); and t0 is a constant to improve the fit and it generally takes very small values. We also note that the rate constant k has units of reciprocal time and is difficult to interpret. It describes the speed at which the maximum size (asymptotic size) is reached; for example (assuming t0 = 0), when k = 0.5, an individual attains 90% of its asymptotic length in 4.6 months; while if k = 0.3, it takes 7.6 months to reach this percentage.
Natural mortality (m), which is closely related to the growth parameters, and especially to the parameter k of semelparous organisms, can be expressed as (Roff, 1984; Mangel, 2006): m = (3k) / (ekT – 1)
(2)
where T is the age at maturity (about 12 months for Galician stickleback populations). On the other hand, supposing that survival to age t is given by the exponential distribution l(t) = e–mt
(3)
where the natural mortality rate is fixed, and that the organism (female) matures at age t; and that fecundity is given by: f (t) = a (Lt)b
(4)
where a and b are allometric parameters. Combining both expressions (survival (3) and fecundity (4)), we can now define fitness or lifetime expected reproductive success as R(t) = l(t) f(t)
(5)
Due to legal regulations in Galicia, no more than
San Miguel et al.
236
Table1. Number (N) of sticklebacks (total length) measured monthly in the Asma and Rato rivers; mean values () and their standard errors (SE). Tabla 1. Número (N) de ejemplares de pez espinoso medidos (longitud total) cada mes en los ríos Asma y Rato; valores medios () y sus errores estándar. Population
May
June
July
August
September
October
November
21
45
21
50
50
50
50
Asma
N
17.64 23.71) 39.54 46.20 46.50 46.67 47.00
(0.40) (0.35) (1.13) (0.07) (0.05) (0.07) (0.07) Rato
N
20
27
39
22
27
50
37
16.3 21.76 34.69 38.58 40.98 46.32 46.54
(0.45) (0.46) (0.31) (1.01) (0.66) (0.08) (0.10)
Table 2. Parameter estimates for a von Bertalanffy growth function (VBGF) for each population. Values in parentheses are approximate lower and upper bounds for 95 % confidence intervals. Tabla 2. Estimaciones de los parámetros de la función de crecimiento de von Bertalanffy (VBGF) para cada población. Los valores entre paréntesis son los límites aproximados superior e inferior para intervalos de confianza del 95 %.
r2 (%)
t0
Asma
90.00
0.37 (0.25–0.48)
0.52 (0.46–0.57)
50.33 (49.16–51.49)
Rato
92.53
–0.03 (–0.21–0.15)
0.32 (0.27–0.36)
53.16 (50.74–55.58)
two or three females can be collected per river. We thus trapped 28 females throughout the breeding season (May to early August) from ten tributaries of the Miño basin (including Asma and Rato rivers). The ovaries were dissected and all oocytes were counted. Fecundity ranged from 39 to 148 eggs, depending on the size (total length) of the female. All model parameters and their standard errors (SE) were estimated using non–linear regression analysis by means of the GraphPad Prism version 4.0 for Windows (GraphPad Software, La Jolla California USA, www.graphpad.com). Results Table 1 shows the growth data in length of the cohorts born in 1998 by seven monthly sampling. Table 2 shows the growth parameters and confidence intervals estimated using the von Bertalanffy model. By averaging r2 values, we obtained 91 %, which indicates good performance of the model, i.e. VBGF accounted for 91 % of the variance in total length exhibited by these populations. The estimates of t0 were very small, ranging from –0.03 to 0.37 months.
k L∞
This parameter can therefore be confidently set to zero with very little effect on the model’s performance. The estimates of k showed a marked difference when their confidence intervals were compared, and the Asma population showed the highest k value (0.52 month–1). However, a similar comparison for L∞ values did not show a significant difference between the studied rivers. Figure 2 shows the representative VBGF curves resulting from all these parameters. As age increases the relative differences in size also decrease for populations with different growth functions. The instantaneous rate of mortality for each population, obtained by the expression (2), were 0.19 and 0.21 for Asma and Rato rivers, respectively. We applied these values to compute the probability of survival (e–mt) in both populations as described by predicted survival curves in figure 3 (red lines), assuming constant m values throughout the life of mature females. Both curves showed a similar appearance: survivorship dropped precipitously in early sexual maturity until a certain age was reached, at which moment the rate of decline was substantially reduced. The allometric parameters (a and b) related to fecundity (fig. 4) took the values 2.7 x 10–4 (SE = 5.4 x 10–4) and 3.2 (SE = 0.5), respectively (with
Animal Biodiversity and Conservation 43.2 (2020)
237
55 50 45 Length mm
40
Rato Lt = 53.16 (1 – e(–0.32t))
35 30
Asma Lt = 50.33 (1 – e(–0.52t))
25 20 15 10 5 0 0.0
2.5
5.0
7.5 Months
10.0
12.5
15.0
Fig. 2. Estimates of von Bertalanffy growth curves for natural populations of Gasterosteus aculeatus from the Asma and Rato rivers.
1.05 1.00 0.95 0.90 0.85 0.80 0.75 0.70 0.65 0.60 0.55 0.50 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 0.0
45 40 35 30 25
Eggs
Survival
Fig. 2. Curvas de crecimiento de von Betalanffy estimadas para poblaciones naturales de Gasterosteus aculeatus de los ríos Asma y Rato.
20 15 10 5 2.5
0 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 Time (arbitrary units)
Fig. 3. Probability of mature females surviving (e–mt, red lines) to reproduce (assuming a constant mortality rate), expected fecundity (a(Lt)b, blue lines) and expected reproductive success (green lines) defined by e–mta(Lt)b, as a function of age at maturity, in two (Galician) semelparous populations of Gasterosteus aculeatus. (Asma River, continuous line; Rato River, dashed line). Fig. 3. Probabilidad de supervivencia (e–mt, líneas rojas) hasta la reproducción en hembras maduras (suponiendo una tasa de mortalidad constante), fecundidad esperada (a(Lt)b, líneas azules), y eficacia biológica esperada (líneas verdes) definida por e–mta(Lt)b en función de la edad de madurez de dos poblaciones semélparas de Gasterosteus aculeatus en Galicia (río Asma, línea contínua; río Rato, línea discontinua).
San Miguel et al.
238
Eggs
160 150 140 130 120 110 100 90 Eggs 80 70 60 50 40 30 20 10 0 40.0 42.5 45.0 47.5 50.0 52.5 55.0 57.5 60.0 62.5 Total lenght (mm)
Fig. 4. Scatter diagram showing a typical (allometric) relationship between fecundity and total fish length from Gasterosteus aculeatus in the Miño basin. Fig. 4. Diagrama de dispersión en el que se muestra una relación típica (alométrica) entre la fecundidad y la longitud total de hembras de Gasterosteus aculeatus de la cuenca del Miño.
r2 = 0.62). As many empirical studies in fish species have shown that value of allometric b parameter is about 3 (Gunderson, 1997; Mangel, 2006; Roff, 1984), this value was used in the subsequent analysis. After applying the expressions (3) and (4), we obtained expected fecundities and reproductive success (expression (5)) as functions of age at maturity for females (see fig. 3). At first, fecundities increased with age and then remained stable. With respect to fitness, both populations showed a maximum at an intermediate age but at different moments. This value was slightly higher for the Asma population (green lines in fig. 3). Discussion In a wide sense, the reproductive lifespan in a semelparous species is restricted to a single breeding season, even if age at maturity does not occur until after several years of development, such as in Pacific salmon species (Wootton and Smith, 2015). Life spans (and age at maturity) of G. aculeatus have been reported in many studies using otoliths, spines annuli, annual rings on the operculum and length– frequency plots (Bell and Foster, 1994; Yershov and Sukhotin, 2015). These studies comprise natural populations with different lifestyles (marine, stream dwelling, anadromous, lacustrine; revisions by Jones and Hynes, 1950; Wootton, 1984; Bell and Foster, 1994; Yershov and Sukhotin, 2015; FishBase, 2019). In general terms, their findings have concluded that this fish lives for a maximum of 1 to 5 years. Labo-
ratory populations can reach 5 years, and Reimchen (1992) reported an exceptional large–bodied natural population that attained eight years. Wootton (1984) suggested a gradual change (a north–south cline) as populations at higher latitudes are more long–lived, but his hypothesis did not reach statistical significance because some high–latitude populations are also short–lived (Giles, 1987). The Galician populations fit this geographical trend, so that a strictly annual cycle can be established as in other populations of sticklebacks at similar latitudes in Spain and France (Crivelli and Britton, 1987; Clavero et al., 2009). The length of time that an organism lives can have a relevant effect on other life history traits such as fecundity and survival. Values on mortality rates and growth rates on G. aculeatus and nearby species (Gasterosteidae such as Apeltes quadracus, Pungitius pungitius, and Spinachia spinachia) reported to date are expressed in years–1 (table 3). For comparative with our results, we divided these values by 12. Estimates of mortality (the exponential coefficient of mortality) and growth rates (and therefore L∞) in natural conditions are usually hard to obtain. We found only 12 estimates for k and 3 for m (most of them for unsexed populations), considering G. aculeatus and other related closely species (FishBase, 2019; Yershov and Sukhotin, 2015; Roff, 1984; Pauly, 1980: Beverton and Holt, 1959). These estimates (table 3) varied from 0.048 to 0.280 and between 0.075 and 0.120 for k and m, respectively. Therefore, our estimates for Galician populations of sticklebacks are the largest reported so far. However, asymptotic values for Asma and Rato populations
Animal Biodiversity and Conservation 43.2 (2020)
239
Table 3. Estimates of growth rate (k) and instantaneous mortality (m) taken across a number of studies on Gasterosteids (FishBase, 2019). Tabla 3. Estimaciones de la tasa de crecimiento (k) y de la mortalidad instantánea (m) según varios estudios sobre gasterosteidos (FishBase, 2019). Species
k (1/y)
m (1/y) Sex Location
Latitude
G. aculeatus
0.57
M
Kandalaksha (RUS)
67º 09'
G. aculeatus
0.67
F
Kandalaksha (RUS)
67º 09'
G. aculeatus
1.79
Kiel Bay (GER)
54º 31'
G. aculeatus
0.64
Chesire (UK)
53º 14'
G. aculeatus
2.32
Ooster Schelde (NED)
52º 30'
G. aculeatus
2.4
F
Roscoff (FR)
48º 44'
G. aculeatus
4.2
M
Roscoff (FR)
48º 44'
G. aculeatus
1.78
Navarro River (USA)
39º 09
G. aculeatus
1.77
Navarro River (USA)
39º 02'
0.9
G. aculeatus
2.09
Navarro River (USA)
39º 11'
Apeltes quadracus
0.84
F
Chesapeake Bay (USA)
38º 19'
Apeltes quadracus
1.5
M
Chesapeake Bay (USA)
38º 19'
Pungitius pungitius
1.6
Chesire (UK)
53º 14'
Spinachia spinachia
1.78
Kiel Bay (GER)
54º 31'
1.4
1.1
are intermediate among those found in FishBase for Gasterosteidae after applying VBGF. Estimates of m here presented were obtained by the expression (1), that is, m is k dependent [more theoretical evidence for this can be found in Charnov (1993), Mangel (2006), Roff et al. (2006), and Hamel (2015)]. Furthermore, based on independent estimates of k and m in natural populations of hundreds of fish species, Pauly (1980) found a significant correlation between the two parameters, suggesting that k is a good predictor of m [for example, high k values correspond to high m values (Hamel, 2015)]. Thus, our k values may be sufficient to obtain a rough (approximate) estimate of m, and confirming that high mortality rates will in general be associated with low ages at first reproduction (Roff, 1984; Mangel, 2006). Values m and k are also related to mean environmental temperature (Pauly, 1980). Ziuganov et al. (2010) recorded water temperatures in the Arctic region (1,750– 1,850 degree–days) and Galicia (4,750–5,000 degree– days). The growth rate of Galician populations of G. aculeatus was at least 6–10 higher times than those of Artic populations (Yershov and Sukhotin, 2015), and mortality constants found in Galician populations were 2.0–2.3 times higher than those observed in general for Gasterosteidae (Roff, 1984). With higher mean annual temperatures in the south, the increment in metabolic rate would tend to increase growth rate. Natural mortality, as defined in the literature, is made up by all possible causes of death except for
fishing. These can include, for example, mortality caused solely by disease, by old age, or by both, or mortality proportional only to the number of potential predators. Causal (direct) and non–causal relationships between mortality and temperature in fish have been proposed. For example: temperature determines m via k increasing physiological mortality by aging; fishes living at higher temperatures have more chances to have encounters with predators (Charnov, 1993). We cannot specifically assign mortality to any of the aforementioned causes, and several of them may be acting at the same time on Asma and Rato stickleback populations. Therefore, our Iberian (Galician) populations may have adapted to local conditions within the European population context of G. aculeatus. These local populations are also peripheral populations of G. aculeatus. In ecology, central (core) and peripheral populations are key components to be considered. Peripheral populations are essential in terms of species biogeography, evolution and conservation (Lesica and Allendorf, 1995). Peripheral populations in natural conditions exist under different environmental conditions and are distinct from core populations. Thus, marginalized populations at the edge of the species distribution range must be integral parts of the conservation efforts for global biodiversity (Johannesson and André, 2006). Asma and Rato populations may represent particular genetic (Hermida et al., 2002; Vila et al., 2017) and phenotypic (Fernández et al., 2000;
San Miguel et al.
240
Hermida et al., 2005b) adjustments to their environments, and variations in growth and mortality rates here reported with respect to northern populations can enhance their conservation value. Expression (4) predicts fitness in adult females of a semelparous organism (most species of fish are iteroparous) using two pieces of information: probability of survival to reproduce decrease with a constant mortality rate (e–mt) and the assumption that fecundity is a power function of length. Mathematical models making these assumptions accounted for more than 80 % of the variation in natural populations of lizards, salamanders, and fish (Stearns and Koella, 1986; Stearns and Hoekstra, 2005). Thus, age at maturity appears to be adjusted to different intermediate fitness optima in each population (fig. 3), that is, the peaks of the curves are linked to specific age at maturity. The age at maturity in this mathematical model is the age at which the survival fecundity curve has a turning point or peak, that is, up until this age the product survival fecundity increases while after this age it decreases. Age at maturity and fitness are plastic traits that can respond to natural selection because they can vary among close related species, among populations within species, and among individuals within populations. It is widely accepted that global climate change (warming or cooling) is impacting on marine and freshwater fish and will continue to do so (Moss, 2010). Most data on climate–induced effects have been obtained for commercially relevant species, while those that are not targeted by fisheries have received less attention. Non–commercial short–lived species are of special interest because climate–induced effects on their populations could be more clearly recognized than in exploited species (Yershov and Sukhotin, 2015). Data trends show climate change effects ranging from fish growth, digestion physiology and performance in marine and freshwater ecosystems: the literature is replete with studies on increased growth rates at elevated temperatures between and within fish species (Mazumder et al., 2015). As ectotherms fish cannot thermoregulate physiologically, but only behaviourally by moving to areas with appropriate temperatures, even a small increase in temperature may thus put them at high risk of extinction (Tewksbury et al., 2008). Cross–comparisons of fish populations in similar systems in South America and Europe and within Europe have shown that lower–latitude fish species are often not only individually smaller but also grow faster, mature earlier, have shorter life spans and allocate less energy to reproduction than species at higher latitudes (Jeppesen et al., 2012). As we have indicated there is a relationship between m and environmental temperature, but m is also connected to the half–life of our female cohorts. Half–life is a statistic used by demographers to measure the time it takes for half of a cohort of organisms to die: the equation used to calculate the time taken by the population to decrease to half its initial size is t = ln 0.5/m (Gotelli, 2008), and applying our estimates of instantaneous mortality rates the half–lives are about 3.6 and 3.3 months (Asma and Rato populations respectively). Climate–induced variation (elevated or low temperatures) in life history
traits (such as mortality) will have consequences in expected reproductive success, and therefore there will be a relevant probability of local extinctions. In Gasterosteids it is difficult to find experiments on a link between climate and populations dynamics, but it has been shown that modestly rising temperatures result in fewer males (G. aculeatus) making nests, and less time spent tending the nests (by fanning oxygenated water through them) by those that make them. As a result, fewer young are produced with more than a 2 ºC rise in temperature over current values (Moss, 2010). Studies are needed to predict future effects, and highly resilient species, such as the three–spined stickleback, provide indications of what might happen to less robust species. Acknowledgements We thank all the forest guards who accompanied us on the sampling trips. We also thank an anonymous reviewer for helpful suggestions. This study was supported financially by the local Government (Xunta de Galicia), projects XUGA 26109A95 and XUGA 26101A97. References Araguas, R., Vidal, O., Pla, C., Sanz, N., 2012. High genetic diversity of the endangered Iberian three– spined stickleback (Gasterosteus aculeatus) at the Mediterranean edge of its range. Freshwater Biology 57: 143–154. Baker, J., Wund, M., Heins, D., King, R., Reyes, M., Foster, S., 2015. Life–history plasticity in female threespine stickleback. Heredity, 115: 322–334. Bell, M., Foster, S., 1994. The Evolutionary Biology of the Threespine Stickleback. Oxford University Press, New York. Beverton, R. J. H., Holt, S. J., 1959. A review of the lifespans and mortality rates of fish in nature, and their relation to growth and other physiological characteristics. In: CIBA Foundation colloquia on ageing: the lifespan of animals, vol 5: 142–180 (G. E. W. Wolstenholme, M. O'Connor, Eds.). J & A Churchill Ltd., London. CATGEA, 2007. Catálogo galego de especies ameazadas. Xunta de Galicia (Decreto 88/2007 de abril). DOG 89, 7409. Charnov, E., 1993. Life History Invariants: Some Explorations of Symmetry in Evolutionary Ecology. Oxford University Press, Oxford. Clavero, M., Pou–Rovira, Q., Zamora, L., 2009. Biology and habitat use of three–spined stickleback (Gasterosteus aculeatus) in intermittent Mediterranean streams. Ecology of Freshwater Fish, 18: 550–559. Cresko, W., McGuigan, K., Phillips, P., Postlethwait, J., 2007. Studies on threespine stickleback developmental evolution: progress and promise. Genetica, 129: 105–126. Crivelli, A., Britton, R., 1987. Life history adaptations of
Animal Biodiversity and Conservation 43.2 (2020)
Gasterosteus aculeatus in a Mediterranean wetland. Environmental Biology of Fishes, 18(2): 109–125. Doadrio, I., 2002. Atlas y Libro Rojo de los Peces Continentales de España. CSIC. Ministerio de Medio Ambiente, Madrid. Fernández, C., Hermida, M., Amaro, R., San Miguel, E., 2000. Lateral plate variation in Galician stickleback populations in the rivers Mino and Limia, NW Spain. Behaviour, 137: 965–979. FishBase, 2019. Growth parameters for Gasterosteidae. Available from http://www.fishbase.se/popdyn/ PopGrowthList_family.php?id=2420&genusname=Gasterosteus&speciesname=aculeatus&fc [accessed on 29 May 2019]. Giles, N., 1987. Population Biology of the three–spined sticklebacks, Gasterosteus aculeatus, in Scotland. Journal of Zoology, 212: 255–265. Gotelli, N. J., 2008. A Primer of Ecology. Sinauer Associates, Massachusetts. Gunderson, D., 1997. Trade–off between reproductive effort and adult survival in oviparous and viviparous fishes. Canadian Journal of Fisheries and Aquatic Sciences, 54: 990–998. Guo, Q., Taper, M., Schoenberger, M., Brandle, J., 2005. Spatial temporal population dynamics across species range: from center to margin. Oikos, 108:47–57. Hamel, O., 2015. A method for calculating a meta– analytical prior for the natural mortality rate using multiple life history correlates. ICES Journal of Marine Science, 72(1): 62–69. Hermida, M., Fernández, C., Amaro, R., San Miguel, E., 2002. Heritability and ’evolvability’ of meristic characters in a natural population of Gasterosteus aculeatus. Canadian Journal of Zoology, 80: 532–541. – 2005a. Geographical and temporal FA variation in threespine stickleback populations from Galicia (NW Spain). Evolutionary Ecology, 19: 517–532. – 2005b. Morphometric and meristic variation in Galician threespine stickleback populations, northwest Spain. Environmental Biology of Fishes, 73: 189–200. Jeppesen, E. Mehner, T., Winfield. I., Kangur, K., Sarvala, J., Gerdeaux, D., Rask, M., Malmkist, H., Holmgren, K., Volta, P., Romo, S., Eckmann, R., Sandström, A., Blanco. S., Kangur, A., Ragnarsson, H., Tarvainen, M., Ventelä, A., Søndergaard, M., Lauridsen, T., Meerhoff, M., 2012. Impacts of climate warming on the long–term dynamics of key fish species in 24 European lakes. Hydrobiologia, 694: 1–39. Johannesson, K., André, C., 2006. Life on the margin: genetic isolation and diversity loss in a peripheral marine ecosystem, the Baltic Sea. Molecular Ecology, 15(8): 2013–2029. Jones, J., Hynes, H., 1950. The age and growth of Gasterosteus aculeatus, Pigosteus pungitius and Spinachia vulgaris, as shown by their otoliths. Journal of Animal Ecology, 19(1): 59–73. Lesica, P., Allendorf, F., 1995. When are peripheral populations valuable for conservation? Conservation Biology, 9: 753–760.
241
Mäkinen, H., Cano, J. M., Merilä, J., 2006. Genetic relationships among marine and freshwater populations of the European three–spined stickleback (Gasterosteus aculeatus) revealed by microsatellites. Molecular Ecology, 15: 1519–1534. Mäkinen, H., Merilä, J., 2008. Mitochondrial DNA phylogeography of the three–spined stickleback (Gasterosteus aculeatus) in Europe–Evidence for multiple glacial refugia. Molecular Phylogenetics and Evolution, 46(1): 167–182. Mangel, M., 2006. The Theoretical Biologist’s Toolbox: Quantitative Methods for Ecology and Evolutionary Biology. Cambridge University Press, Cambridge. Mazunder, S. K., De, M., Mazlan, A. G., Zaidi, C. C., Rahim, S. M., Simon, K. D., 2015. Impact of global climate change on fish growth, digestion and physiological status: developing a hypothesis for cause and effect relationships. Journal of Water and Climate Change, 6(2): 200–226. Moss, B., 2010. Ecology of Freshwaters: A View for the Twenty–First Century. John Wiley & Sons Ltd., Chichester. Pauly, D., 1980. On the interrelationships between natural mortality, growth parameters, and mean environmental temperature in 175 fish stocks. Journal du Conseil international pour l’Exploration de la Mer, 39(3): 175–192. Pérez–Figueroa, A., Fernández, C., Amaro, R., Hermida, M., San Miguel, E., 2015. Population structure and effective/census population size ratio in threatened three–spined stickleback populations from an isolated river basin in northwest Spain. Genetica, 143(4): 403–411. Reimchen, T., 1992. Extended longevity in a large– bodied Gasterosteus population. Canadian Field– Naturalist, 106: 122–125. Ricker, W. E., 1979. Growth rates and models. In: Fish physiology, VIII: Bioenergetics and growth: 677–743 (W. S. Hoar, D. J. Randall, J. R. Brett, Eds). Academic Press, New York. Roff, D., 1984. The evolution of life history parameters in teleosts. Canadian Journal of Fisheries and Aquatic Sciences, 41: 989–1000. – 1992. The Evolution of Life History: Theory and Analysis. Chapman and Hall, New York. – 2002. Life History Evolution. Sinauer Associates, Sunderland, MA. Roff, D., Heibo, E., Vollestad, L., 2006. The importance of growth and mortality costs in the evolution of the optimal life history. Journal of Evolutionary Biology, 19(6): 1920–1930. Sharda, S., Argenti, E., Lucek, K., 2018. On the status of threespine stickleback (Gasterosteus aculeatus, Linnaeus 1758) in Lake Bracciano, Italy. Fishes, 3(17): 1–6. Stearns, S., Hoekstra, R., 2005. Life history and sex allocations. In: Evolution, an Introduction. Oxford University Press, Hampshire. Stearns, S., Koella, J., 1986. The evolution of phenotypic plasticity in life history traits: predictions of reaction norms for age and size at maturity. Evolution, 40(5): 893–913. Tewksbury, J., Huey, R., Deutsch, C., 2008. Putting the
242
heat on tropical animals. Science, 320: 1296–1297. Vila, M., Hermida, M., Fernández, C., Perea, S., Doadrio, I., Amaro, R., San Miguel, E., 2017. Phylogeography and Conservation Genetics of the Ibero–Balearic Three–Spined Stickleback (Gasterosteus aculeatus) (online). Plos One, 12(1): e0170685, Doi:10.1371/journal.pone.0170685. Wootton, R. J., 1979. Energy costs of production and environmental determinants of fecundity in teleost fishes. Symposia of the Zoological Society of London, 44: 133–159. – 1984. A Functional Biology of Sticklebacks. Croom Helm, London and Sidney. Wootton, R., Adams, C., Attrill, M., 2005. Empirical Modelling of the Population Dynamics of a Small
San Miguel et al.
Population of the Threespine Stickleback, Gasterosteus aculeatus. Environmental Biology of Fishes, 74:151–161. Wootton, R. J., Smith, C., 2015. Reproductive Biology of Teleost Fishes. John Wiley & Sons, Chichester. Yershov, P., Sukhotin, A., 2015. Age and growth of marine three–spined stickleback in the White Sea 50 years after a population collapse. Polar Biology, 38(11): 1813–1823. Ziuganov, V., San Miguel, E., Neves, R., Longa, A., Fernández, C., Amaro, R., Beletsky, V., Popkovitz, E., Kaliuzhin, S., Johnson, T., 2000. Life span variation of the freshwater pearl shell: A model species for testing longevity mechanisms in animals. Ambio, 29(2): 102–105.
Animal Biodiversity and Conservation 43.2 (2020)
243
Leisure activities as a main threat for the conservation of waterbirds in an estuary in northern Iberia J. Arizaga, R. Garaita, A. Galarza
Arizaga, J., Garaita, R., Galarza, A., 2020. Leisure activities as a main threat for the conservation of waterbirds in an estuary in northern Iberia. Animal Biodiversity and Conservation, 43.2: 243–253, Doi: https://doi. org/10.32800/abc.2020.43.0243 Abstract Leisure activities as a main threat for the conservation of waterbirds in an estuary in northern Iberia. Human disturbances can have a severe impact on avian conservation, decreasing diversity and carrying capacity of ecosystems. Coastal wetlands are hotspots for the conservation of biodiversity but they commonly suffer the impact of human activity because they are usually priority areas for socio–economic development. The aim of this study was to determine the role of several factors on the potential and real disturbances of human origin on waterbirds over an annual cycle, and to evaluate their impact on the waterbird community. The study was carried out at the Urdaibai estuary (Spain). Although Urdaibai is a main coastal refuge for aquatic birds in Northern Spain (a Ramsar site, Natura 2000 site, Reserve of Biosphere), it faces high levels of human–induced disturbances. We found disturbances varied across the day, week and year, with peak disturbance coinciding with hours, days and months with highest activity, mostly associated with leisure options. The impact on waterbirds varied between species and the response to such impacts was also species–specific. Disturbances were highest near the river mouth and decreased towards the upper parts of the estuary. Efforts to increase protection of waterbirds should consider reducing the disturbance in areas with the highest impact in order to increase the functional carrying capacity of the estuary for waterbirds and to create quiet feeding and resting areas, maybe by establishing reserves with restricted access. Key words: Biodiversity conservation, Coastal wetland, Disturbance, Waterfowl Resumen Las actividades recreativas como principal amenaza para la conservación de las aves acuáticas en un estuario del norte de Iberia. Las perturbaciones antropogénicas pueden tener graves repercusiones en la conservación de especies avícolas, lo que contribuye a reducir la diversidad y la capacidad de carga de los ecosistemas. Aunque los humedales costeros son zonas de gran interés para la conservación de la biodiversidad, suelen estar sometidos a importantes presiones humanas, ya que, con frecuencia, son zonas prioritarias para el desarrollo socioeconómico. La finalidad del presente artículo es determinar el papel de varios factores en las perturbaciones antropogénicas que afectan y pueden afectar a las aves acuáticas durante todo el ciclo anual, y evaluar los efectos de dichas perturbaciones en el conjunto de la comunidad de aves acuáticas. El estudio se llevó a cabo en el estuario de Urdaibai (España). Incluso aunque Urdaibai sea uno de los principales refugios costeros de aves acuáticas en el norte de España (es un lugar protegido por la Convención de Ramsar, forma parte de la Red Natura 2000 y es una reserva de la biosfera), es objeto de una elevada frecuencia de perturbaciones inducidas por humanos. La cantidad de perturbaciones varió en el tiempo, de forma diaria, semanal y anual; el máximo coincidía con las horas, días o meses de mayor actividad en la zona, en su mayoría asociada a actividades recreativas. Los efectos en las aves acuáticas también variaron entre especies y la respuesta a tales efectos también fue distinta según la especie. Las perturbaciones fueron máximas cerca de la desembocadura del río y disminuyeron en dirección a las zonas altas del estuario. Las iniciativas dirigidas a aumentar la protección de las aves acuáticas deberían sopesar la posibilidad de reducir la cantidad de perturbaciones en las zonas más conflictivas, a fin de aumentar la capacidad de carga funcional del estuario para las aves acuáticas y crear zonas tranquilas de alimentación y descanso, tal vez estableciendo reservas con acceso restringido. ISSN: 1578–665X eISSN: 2014–928X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
244
Arizaga et al.
Palabras clave: Conservación de la biodiversidad, Humedal costero, Perturbación, Ave acuática Received: 20 X 19; Conditional acceptance: 27 I 20; Final acceptance: 12 VI 20 Juan Arizaga, Aitor Galarza, Department of Ornithology, Aranzadi Sciences Society, Zorroagagaina 11, 20014 Donostia, Spain.– Rafael Garaita, Fernández del Campo 6, 48010 Bilbao, Spain.– Aitor Galarz, Departament of Sustainability and Environment, Biscay County Council, 40014 Bilbao, Spain. Corresponding author: J. Arizaga. E–mail: jarizaga@aranzadi.eus
Animal Biodiversity and Conservation 43.2 (2020)
Introduction Human–induced disturbances can have a severe impact on avian conservation (Platteeuw and Henkens, 1997; Frid and Dill, 2002; McLeod et al., 2013; Collop et al., 2016), becoming a major threat to conservation even in protected areas (e.g., Sutherland, 2007). Response to such disturbances can be multiple, from null (such as no impact, e.g. causing flush but no effect on fitness) to physiological alterations (causing changes in feeding and resting patterns) and abandonment of the disturbed zone (Triplet et al., 2003). During the breeding season, disturbance can increase the risk of predation (Mikola et al., 1994), leading to loss of eggs or offspring (Gillett et al., 1975) and nest abandonment (Miller et al., 1998). Disturbances can also lead to changes in the spatial distribution pattern of birds, forcing them to use sub–optimal and less safe areas, which can have negative long–term carryover effects on reproduction and survival (Riddington et al., 1996; Lepage et al., 2000). Disturbances can also generate a decrease in the diversity and carrying capacity of ecosystems (Davenport and Davenport, 2006; Platteeuw and Henkens, 1997). Coastal wetlands are hotspots for the conservation of biodiversity but they commonly support multiple human pressures because they are usually priority areas for socio–economic development (Beazley, 1993; Weller, 1999). The conflict between biodiversity conservation and the use of coastal marshes by human societies remains unsolved in many regions of the world (e.g. Glover et al., 2011; McFadden et al., 2017). The impact of a disturbance can differ between species. While some species can be particularly sensitive (Garaita and Arizaga, 2015) others are highly tolerant (Beja, 1996). The impact can also vary temporally, from hourly (Fernández–Juricic and Tellería, 2000) or daily (Lafferty, 2001) to seasonally (Stillman and Goss–Custard, 2002). In this context, identifying the type and patterns of disturbances and evaluating their impact on populations is a basic first step towards the development of efficient conservation management policies. Many aquatic bird populations around the world use coastal marshes as breeding sites, as stopovers during migration, or as wintering quarters (Boere et al., 2006). Waterbird conservation thus depends largely on preservation of coastal marshes that are of high ecological value, and all levels of disturbance should be considered (Davenport and Davenport, 2006). Depending on the type of disturbance, the impact on waterbirds can differ substantially between species and sites. A species–dependent or site–dependent approach is therefore commonly needed to solve problems from a small–scale, local perspective (Glover et al., 2011; Samia et al., 2015). Long–term monitoring programs can help plan appropriate conservation measures and evaluate their effectiveness in mitigating disturbances. Such programs can also help prompt interventions when needed. Data collected can be used to assess whether a given value at a particular time unit is exceptional or whether it falls
245
within a range that can be considered normal (Peach et al., 1999; Jiguet et al., 2012; Dubos et al., 2018). The aim of this study was to evaluate the impact of human disturbances on waterbirds at the Urdaibai estuary (Spain) over the day and year. Hypotheses to be tested were: (1) temporally, disturbances would be higher during peaks of human activity, e.g. in summer as compared to winter, in holidays as compared to working days, or around midday as compared to the early and later hours of the day; (2) spatially, zones closest to the river mouth may be more influenced by human disturbances since people tend to accumulate on sandy beaches (Martín et al., 2014) rather than on mudflats or upper marsh zones with dense vegetation; and (3) taxonomically, some taxa would be more tolerant to disturbances than others. For example, spoonbills or ducks are likely more sensitive and would show a stronger response than gulls. Material and methods Sampling area This study was carried out at the Urdaibai estuary, one of the main tidal marshes along the coast of northern Iberia. With a surface area of 918 ha, it is a focal site for the conservation of waterbirds in Spain (Galarza and Domínguez, 1989). The estuary is included in the Urdaibai Biosphere Reserve, established in 1984, and the area was declared a Ramsar site in 1993. The estuary is also designated as a Special Area of Conservation (SAC ES2130007) and included in a Special Bird Protected Area (SPAB ES0000144). However, waterbirds at Urdaibai are impacted by human disturbance arising from several activities, such as fishing, angling, recreational walking, and sailing. These disturbances are the main reason why some migrant bird species of conservation interest, such as the Eurasian spoonbill (Platalea leucorodia), have shortened their stopover in the area (Garaita and Arizaga, 2015). Specifically, our study area covered the main places used by waterbirds in the estuary and ranged from the river mouth (Laida Beach) to the upper part of the estuary (Orueta Lagoon) (Arizaga et al., 2014). Between these two sites, the estuary was divided into five sectors to facilitate bird counts (fig. 1): (1) Zone 1, that comprises mostly sandy areas (214.8 ha); (2) Zone 2, chiefly mudflats (258.2 ha); (3) Zone 3, upper marsh, consisting of mudflats with halophytic vegetation (103.6 ha); (4) Zone 4, upper marsh (151.5 ha); and (5) Zone 5, a brackish water lagoon which is connected with the marsh during high spring tides (12.4 ha) (Arizaga et al., 2014). We excluded the areas situated still further away from the mouth, which were mostly occupied by reed beds. Human access to these areas is difficult and they are little used by most waterbirds. Sampling protocol Sub–lethal effects of a disturbance are not easy to record since many of them could generate physiological
Arizaga et al.
246
disorders that are very difficult (or impossible) to detect unless individual birds are captured and/or monitored long–term. Therefore, and for practical purposes, here we considered an impact as a disturbance that forced a bird to stop its activity and change to either a position of alert, to move to another part within the wetland, or to leave Urdaibai. We assigned the category ‘leaving’ to flocks or individual birds which took off and followed a straight–flight trajectory, disappearing from the area. This behavior was not very common, but was recorded for several large species, like Eurasian spoonbills. In this case, it was not rare that disturbed flocks took off, gained height, and followed their straight flight course in a W/SW direction (autumn) or E/NE direction (spring), hence resuming their migration. The censuses were carried out from May 2017 to April 2018. Potential disturbances and real disturbances (hereafter, PD and RD, respectively) were identified by direct observation from a number of strategically located sampling points along the shore, covering the five zones described above. A PD was considered to be all disturbances with the potential to disturb a bird or flock of birds. The presence of a person, boat, dog or any other human–related item included within any of the 12 categories shown below, therefore, constituted a PD. For instance, a boat passing through the estuary channel in one of the zones was counted as a PD, whether or not there were birds in the zone (as the boat could potentially have caused a disturbance if there were birds present). A PD became an RD when it generated one of the following real reactions in a bird or flock of birds: abandonment of Urdaibai, movement to another site within the zone, or activity and change to a position of alert. For given individual birds, we always considered the higher–scored reaction (e.g., if a bird was alerted and then flew to another site, we considered the second reaction for that bird). We considered a bimester as the time unit for the analyses. Smaller time units were not considered due to logistic constraints. Within each two–month period, we conducted 10 sampling days, from dawn to dusk, five coinciding with weekends or holidays, and five coinciding with working days. We therefore conducted 60 sampling days over study period. On each sampling day, we carried out a 30–minute census in each zone, starting on the hour. To guarantee surveillance in each zone within each two–monthly analysis, the observer surveyed all the sampling points once within each possible hourly interval on a working day and also on a weekend day or holiday. Double counts within each zone were excluded because censuses were done from elevated survey points, allowing us to follow individual flocks/birds. Conducting the survey from an elevated position also ruled out the observer as a source of RD . Within each census, the number of PD and RD was recorded for all the waterbirds within the zone. Disturbances were grouped into 12 categories: slow boat (slow–motor boats; BOAT); fast boat (fast–motor boats, including Zodiac boats, and aquatic scooters; FAST); canoes (boats without motor; KANO); dogs (DOGS); shellfish gathering (SHELL); angling (FISH); tourists (anyone walking through the estuary; TOUR); naturalists (birdwatchers and nature lovers, normally
ornithologists; NATU); guided visits (with personnel from local tourist sites; VISI); surf (kite–surf, wind– surf; SURF); paddle boards (PADD); and others (OTHERS). Within each RD, we recorded the species and the number of affected individual birds. This allowed us to identify which species were most affected, the type of reaction, and where and when the disturbance was generated. Moreover, the PD–RD difference allowed us to quantify the impact of the PD and to evaluate the role of human activities within the study area as a source of conflict for the conservation of waterbirds. Statistical approach The original sample of PD had many zeros (true zero values) so we modelled the PD and the factors affecting it with zero–altered (ZA) or hurdle models, i.e. models that consider two modeling approaches: a negative binomial model to estimate the probability of having a zero, and a zero–truncated model to estimate effects on data which are not zero. Using the 'pscl' package (Jackman, 2017) for R (R Core Team, 2014), we conducted a saturated global model using the hurdle function to test for the fit of the data to the Poisson and the negative binomial approach. Between these two model approaches, that with a lower Akaike value was considered to better fit the data (Akaike, 2011). A model would fit the data better if the Akaike value was lower than 2, as compared to a second model (Burnham and Anderson, 1998). In our model the number of PD was used as an object variable, with the following explanatory variables: hour (seven categories: hours 1 to 3, corresponding to the first three after dawn; hours 5 to 7, corresponding to the last three hours before dusk; 'hour' 4, pooled hours around midday, before hours 3 and 5); zone (zone 1 to 5, as shown above), period (bimester), tide (4 categories: high, decreasing, low, increasing); day of the week (working day –Monday to Friday–, and weekend) (Perona et al., 2019; Sastre et al., 2009); and type of disturbance (12 categories, as shown above). The area of each sampling zone could also have an effect. Preliminary comparisons considering this area (log–transformed) as an offset variable showed area had an effect on the intercept and the beta–parameter estimates associated with factor 'zone', but not on the other factors in either the Poisson or negative binomial models. However, it should be kept in mind that as most waterbirds tend to concentrate along the banks of the chief channel, each sampling zone has only relative importance, and its inclusion in the models may mask the true weight of PD within each zone. This is relevant if we consider that, as shown in Results, negative binomial models fitted the data better than Poisson models (i.e., our data were more adequate to assess occurrence probabilities rather than to quantify PD per unit of area and time). Thus, we conducted hurdle models twice: first, with all the fixed factors shown above and, second, including area as an offset variable. To determine which variables caused a real disturbance (RD) we used a generalized linear model (GLM) using a logit–link function with negative binomial
Animal Biodiversity and Conservation 43.2 (2020)
2.70 ºO
247
2.68 ºO
2.65 ºO
43.40 ºN Z1
43.38 ºN
Z2
Z3 Spain Z4
Z5
43.35 ºN
ZEC Urdaibai N
0
43.33 ºN
500 1,000 m
Fig. 1. Sectorization of waterbird surveys and disturbances at Urdaibai. The solid line shows the limits of Natura 2000 (Special Area of Conservation, ZEC Urdaibai). Dashed polygons indicate survey zones. Fig. 1. Sectorización de los estudios sobre aves acuáticas y perturbaciones en Urdaibai. La línea continua muestra los límites de la Red Natura 2000 (Zona Especial de Conservación, ZEC, de Urdaibai). Los polígonos sombreados indican las zonas del estudio.
errors distribution. As compared to PD, in this case the hurdle function to test for the fit of the data to the Poisson and the negative binomial approach may not be used due to problems of convergence (see Results for details). Factors/covariates considered in this model were those taken into account for the models on PD, except the type of disturbance, which was omitted in this case due to sample size constraints. We also conducted a GLM on the proportion of waterbirds affected by a real disturbance as an object variable, with a linear link function with Gaussian error distribution. Factors/covariates considered in this model were those taken into account for the models on PD, except the type of disturbance, omitted in this case due to sample size constraints. In this situation we did not consider the area of each zone as an offset as we used here a percentage, rather than counts as an object variable.
Results Potential disturbances Overall, over 495.5 sampling hours we identified 30,602 PD, with a global mean of 2.38 PD/0.5 h/zone (95 % CI = 0.90 PD/0.5 h/zone; controlled for the area of each zone: 1.16 ± 0.4 PD/0.5 h/100 ha). The ZA models provided a better result for the approach assuming a negative binomial effect, i.e. that PD were better modelled when we tested for the effect of factors driving the occurrence of a PD than for the amount of a PD (AICc values: negative binomial models, 11,703.26; Poisson, 48140.86). According to the negative binomial approach (annex 1), the occurrence of a PD tended to (1) increase progressively from dawn to midday, and then decrease until the end of the day, though the chance of a PD occurring
Arizaga et al.
248
during the last hour of the day was still higher than during the first hour; (2) increase during summer, from May to October, with no significant difference between the winter/spring period (from November to April); (3) decrease on working days as compared to weekends or holidays; (4) be higher in case of slow–motor boats, canoeing or dogs, without significant difference between these three types of disturbances; (5) increase with decreasing tide; and (6) progressively decrease from Zone 1 to Zone 5, i.e. with increasing distance from the Laida Beach (river mouth) (annex 1). After controlling for the area of each zone, we obtained fairly similar parameter estimates for the zone effect (Zone 2: –0.79 ± 0.08, P < 0.001; Zone 3: –1.00 ± 0.10, P < 0.001; Zone 4: –3.51 ± 0.19, P < 0.001; Zone 5: –2.47 ± 0.36, P < 0.001). Real disturbances Overall, 10,633 individual birds were found to be disturbed during the study period. These corresponded to 122 disturbances detected in 64 sampling zones/hours out of 991 zones/hours sampled overall (i.e., 6.5 %). According to our negative binomial approach, RD were less likely to happen (1) in Zones 3 and 5 than in Zone 1 (Zones 2 and 4 showed no significant differences compared to Zone 1), and (2) on working days as compared to weekends/ holidays (annex 2). Period and hour did not have a significant effect on the chance of having an RD (annex 2). This model was shown to better fit the data than a null (constant) model (Akaike values: 379.64 and 449.31, respectively). Disturbances were highest at weekends (n = 92, 75.4 %), and in Zones 1 and 2 (n = 53 and 49, respectively, 83.6 %). After controlling for the area of each zone, however, the 'Zone' effect became non–significant (Zone 2: –0.55 ± 0.33, P = 0.090; Zone 3: –0.57 ± 0.41, P = 0.166; Zone 4: NA; Zone 5: –0.78 ± 1.03, P = 0.447), i.e., the occurrence of a disturbance per area unit did not vary between zones. Tourists (people walking across the wetland and getting too close to birds) were the cause of almost 32 % of the disturbances and 40 % of disturbed birds (fig. 2). Altogether, an additional 40 % of disturbances were due to some kind of boat (categories BOAT, KANO, PADD) moving across Urdaibai, though these were shown to affect just 18 % of total disturbed birds. In contrast, almost 25 % of the disturbed birds were affected by a disturbance categorized as 'others', but these last did not comprise more than a 6.5 % of disturbances. Overall, therefore, recreational activities (excluding here motor boats, shell–fishing and fishing) caused 73 % of the disturbances and affected 80.2 % of the total number of disturbed birds. Bird counts conducted in parallel to the survey period of real disturbances revealed that 8.4 % of the waterbirds were affected by a disturbance. On average, however, the percentage of waterbirds affected by a disturbance was 3.2 % (95 % confidence interval = 1.2 %, n = 928). By taxa, not all groups of waterbirds showed the same proportion of disturbances (chi–square test: 5,636.5, df = 8, P < 0.001). Thus,
the osprey, divers/grebes and waterbirds classified as 'others' did not suffer any disturbance coinciding with the census period. In contrast, 14.2 % of gulls/ terns (mainly gulls) were affected by a disturbance. The proportions for the other taxa were: ducks/geese, storks/herons, cormorants, 1.0 %; spoonbills, 4.4 %; and waders, 4.4 %. Annex 3 summarizes the beta–parameter estimates from a model which tests for the effect of factors on the proportion of disturbed birds in relation to those occurring in a zone and time interval (hour) when the census was done. Overall, this proportion tended to decrease from Zone 1 to 5 (annex 3). More than 85 % of real disturbances were detected in Zone 1 (fig. 3). This proportion also tended to increase during mid– summer as compared to the rest of year and during the weekends/holidays (annex 3; fig. 4, 5). Among disturbed birds, 62 % and 30 % showed a type B or C reaction (i.e., escape movement within Urdaibai). Six per cent of the birds did not move from their site but showed just a type A reaction (alarming position), and the remaining 2 % showed a type D reaction (take off and abandonment of Urdaibai). By taxa, 90 % of RD involved gulls, since these are the most abundant waterbirds in Urdaibai, followed by waders (6.2 %), ducks/geese (3.0 %), herons (0.8 %), Eurasian spoonbill (0.6 %), cormorants (0.2 %), and the Northern gannet (< 0.1 %). Not all the taxa had the same reaction (chi–square test: 4504.5, df = 15, P < 0.001, gannets removed due to low sample size for this taxon; fig. 6). Thus, type D reaction only involved ducks/geese and spoonbills, but not gulls, which were found to habituate to a non–lethal disturbance source better than others (proportionally, they had more type A and B reactions; fig. 6). Discussion Coastal wetlands constitute particular habitats because they often occupy relatively small areas but have high rates of human–induced disturbances. In the present study in the Urdaibai marshlands in northern Iberia, we found waterbirds were subjected to disturbances all year round. In absolute values, 8.4 % of birds were affected by a disturbance, comprising more than 10,000 individual birds per year. Although some individual birds could have been disturbed more than once (pseudo–replications cannot be controlled since most birds are not individually marked), we consider our results reflect only a fraction of the birds that may have been disturbed during the study period. This is because the surveys were carried out in such a way that for any given moment they covered only a fraction of the wetland, and samples were taken only on 60 days. A rough estimate based on these results would thus result in more than 60,000 birds being disturbed over one year in this wetland. Potential disturbances on waterbirds across the annual cycle peaked around mid–day, at weekends and holidays, during summer months, and in the areas closest to the river mouth (i.e. sandy areas where people concentrate). The real chances of disturbance
Animal Biodiversity and Conservation 43.2 (2020)
249
40
No. disturbance No. birds
35
Frequency /%)
30 25 20 15 10
NATU
FISH
DOGS
OTHERS
SHELL
KANO
PADD
BOAT
0
TOUR
5
Fig. 2. Distribution of frequency of number of disturbances and birds affected by a disturbance at Urdaibai over one year. Sample sizes: disturbances, n = 122; birds, n = 10,633. (Abbreviations for the type of disturbance are shown in Methods). Fig. 2. Distribución de frecuencias del número de perturbaciones y de aves que se vieron afectadas por una perturbación en Urdaibai, durante un año completo. Tamaños de muestra: perturbaciones, n = 122; aves, n = 10.633. Las abreviaciones de los tipos de perturbación se muestran en el apartado Methods.
agreed with this schedule regarding zone and weekends vs. workdays, and regarding the proportion of disturbed birds in relation to those occurring at Urdaibai for zone, period and day within a week). Thus, it can be concluded that disturbances varied temporally, over the day, week and year, and also spatially, with a higher absolute impact closer to river mouth (Zone 1). Overall, the findings show that leisure activities are the main source of human–induced disturbances throughout the year and may be the main threat for the conservation of waterbirds within this wetland site. Such spatio–temporal patterns would allow managers to plan greater protection in those zones. Reducing current potential disturbances by increasing protection levels would also allow managers/stakeholders to evaluate the carrying capacity of this wetland with a higher degree of accuracy. Information about the types and magnitude of potential disturbances is, in this context, an elementary tool in conservation management of any protected area. A question that remains unanswered is whether or not a disturbance rate of less than 10 % is admissible. It is difficult to establish an optimal (or desired) value that represents a 'tolerable' amount of disturbances at Urdaibai (i.e. to find whether a value below or above of 8.4 % is acceptable or should be achieved). Further-
more, it is probable that such a value would also differ between species (Samia et al., 2015). For example, in the case of gulls, which are abundant and seem to be more habituated to disturbances, the proportion of 'sustainable' disturbances could be higher than that for species with a stronger reaction (including a definite abandonment of Urdaibai), or those that are under higher levels of protection (e.g., Triplet et al., 2008), such as ducks, geese, and particularly, the Eurasian spoonbill (Garaita and Arizaga, 2015) and the osprey (Monti et al., 2018). Osprey behavior can be modified significantly by touristic activities, leading to breeding failure even in a well–enforced marine protected area (Monti et al., 2018). Therefore, even very low levels of disturbance could have a high impact on some species. From a European perspective, the proportion of waterbirds affected by real disturbances at Urdaibai was very low and negligible (mean percentage of waterbirds affected by a RD equalled 0.01 % of European waterbirds populations; BirdLife International, 2015). However, these calculations are conservative as they only took into account the number of adult breeding birds in Europe, but not the juvenile and immature population that was also included among the birds disturbed at Urdaibai. In this context, distur-
Arizaga et al.
250
14
RD (% on total birds)
12 10 8 6 4 2 0
Zone 1
Zone 2
Zone 3
Zone 4
Zone 5
Fig. 3. Percentage of waterbirds affected by a real disturbance, RD (mean ± 95 % confidence interval) in relation to the zone; Zone 1, river mouth; Zone 5, upper marsh. Fig. 3. Porcentaje de aves acuáticas afectadas por una perturbación real (RD) (media ± intervalo de confianza del 95 %) en Urdaibai, en relación con la zona; Zona 1, desembocadura del río; Zona 5, marisma aguas arriba.
bances at Urdaibai did not have the impact observed in nearby wetlands like the Santoña Marshes, where disturbances might cause the flush of up to 1.5 % of the Eurasian curlew population (Navedo and Herrera, 2012), for example. The type of reaction to disturbance varied substantially between species. Even though gulls were
the most abundant bird taxon, the most severe reaction, consisting of a long flight within the wetland or definite abandonment was mostly performed by other taxa, some of which are endangered waterbirds, such as waders and the Eurasian spoonbill (BirdLife, 2015). A very specific local problem would be that concerning the Eurasian spoonbill. Spoonbills
10 RD (% on total birds)
9 8 7 6 5 4 3 2 1 0
Jan–Feb Mar–Apr May–Jun Jul–Aug Sep–Oct Nov–Dec
Fig. 4. Percentage of waterbirds affected by a real disturbance, RD (mean ± 95 % confidence interval) in relation to time of year. Fig. 4. Porcentaje de aves acuáticas afectadas por una perturbación real (RD) (media ± intervalo de confianza del 95 %) en Urdaibai, en relación con el período del año.
Animal Biodiversity and Conservation 43.2 (2020)
251
6
RD (% on total birds)
5 4 3 2 1 0
Weekends
Work days
Fig. 5. Percentage of waterbirds affected by a real disturbance, RD (mean ± 95 % confidence interval) in relation to day of the week. Fig. 5. Porcentaje de aves acuáticas afectadas por una perturbación real (RD) (media ± intervalo de confianza del 95 %) en Urdaibai, en relación con el día de la semana.
90 80 70 60
Type A Type B Type C Type D
50 40 30 20
Gulls
Herons
Spoonbills
Cormorants
Ducks/Geese
0
Gannet
10 Waders
Waterbirds affected by RD (%)
100
Fig. 6. Number of individuals (in percentage) affected by real disturbances at Urdaibai in relation to their taxonomic group and the type of reaction. Reactions: tipe A, alarm position, n = 735; type B, short displacements within Urdaibai, n = 6,648; type C, long displacements within Urdaibai, n = 3,116; D, take off and abandonment of Urdaibai, n = 134. Fig. 6. Número de individuos (en porcentaje) afectados por perturbaciones reales en Urdaibai en relación con su grupo taxonómico y el tipo de reacción producida. Reacciones: A, posición de alarma, n = 735; B, desplazamientos a corta distancia dentro de los límites de Urdaibai, n = 6.648; C, desplazamientos a larga distancia dentro de los límites de Urdaibai, n = 3.116; D, levantar el vuelo y abandonar Urdaibai, n = 134.
Arizaga et al.
252
passing through the Atlantic flyway from northern Europe to Iberia and Africa make long stopovers in coastal marshes of the southeastern part of the Bay of Biscay, with Urdaibai being a major (potential) stopover site (Arizaga et al., 2016). However, the occurrence of continuous disturbances commonly shortens such stopovers dramatically, often to less than 24 h (Overdijk and Navedo, 2012, Garaita and Arizaga, 2015). Clearly, the establishment of reserves with restricted access within the marsh may be set as a conservation priority in Urdaibai. According to our results, efforts should focus on zones 2 and 3, which host large numbers of waterbirds (especially Zone 2), including target species of concern, such as the Eurasian spoonbill, with herons and waders also having a good representation in these areas (annex 4). Effective conservation measures should consider strategies oriented to reduce/minimize disturbances in Zone 2, and to a lesser extent Zone 3, where most of the conflicts between waterbirds and humans occur. Creating integral reserves or places with restricted access for pedestrians are two of the possible management measures that should be studied in detail. Zone 1, in contrast, was the most frequented area by people, and here only gulls were found in large numbers. Human activities might therefore be concentrated in this part of Urdaibai, in a strategy aiming to reduce dispersion of the people across the estuary. Zone 5, comprising the Orueta Lagoon, hosted high numbers of waterbirds, confirming previous analyses demonstrating the importance of this artificial lagoon for the conservation of waterbirds at Urdaibai (Arizaga et al., 2014). Given the comparatively low number of disturbances in this zone and the high number of birds present there, the Lagoon may be a good candidate area for planning a zone of integral protection in Urdaibai. Zones 3 and 4 host a relatively low number of waterbirds (with the exception of Zone 3 for the osprey) and have few absolute disturbances. Additional protection measures in these zones are not therefore a priority unless ospreys or other priority species are found to be breeding therein. Collaboration with the local tourism industry is also strongly recommended in order to increase the efficacy of conservation measures. In conclusion, even though Urdaibai is one of the chief coastal refuges for aquatic birds in Northern Spain (it is a Ramsar site, Natura 2000 site, Reserve of Biosphere), it is subject to high rates of human–induced disturbances. The disturbances vary temporally, across the day, week and year, with peaks coinciding with those times of highest activity, particularly that related to leisure options. The impact on waterbirds varied between species, and the response to such impact was also species–specific. Disturbances were maximal near the river mouth and decreased towards the upper parts of the estuary. Efforts to increase protection of waterbirds should consider reducing the disturbances in areas where the conflict is highest in order to increase the functional carrying capacity of the estuary for waterbirds and to create quiet feeding and resting areas, maybe by establishing reserves with restricted access.
Acknowledgements This research was funded by the Basque Government–Patronato de Urdaibai. The Urdaibai Bird Center facilitated the access to its facilities for the census at the Orueta Lagoon. Two referees provided very valuable comments that helped us to improve an earlier version of this work. References Akaike, H., 2011. Akaike’s Information Criterion. In: International Encyclopedia of Statistical Science: 25–25 (M. Lovric, Ed.). Springer Berlin Heidelberg, Berlin, Heidelberg. Arizaga, J., Cepeda, X., Maguregi, J., Unamuno, E., Ajuriagogeaskoa, A., Borregón, L., Azkona, A., Unamuno, J. M., 2014. The influence of the creation of a lagoon on waterbird diversity in Urdaibai, Spain. Waterbirds, 37: 111–118. Arizaga, J., Garaita, M., González, H., Laso, M., 2016. Stopover use by the Eurasian Spoonbill Platalea leucorodia of wetlands on the Basque coast (northern Iberia). Revista Catalana d’Ornitología, 32: 1–10. Beazley, M., 1993. Wetlands in danger. IUCN, London. Beja, P. R., 1996. Temporal and spatial patterns of rest–site use by four female otters Lutra lutra along the south–west coast of Portugal. Journal of Zoology, 239: 741–753. BirdLife, 2015. European Red List of Birds. Office for Official Publications of the European Communities, Luxembourg. BirdLife International, 2015. European Red List of Birds. Office for Official Publications of the European Communities, Luxembourg. Boere, G., Galbraith, C., Stroud, D., 2006. Waterbirds around the world. The Stationery Offic, Edinburgh. Burnham, K. P., Anderson, D. R., 1998. Model Selection and Inference. A Practical Information Theoretic Approach. Springer–Verlag, New York. Collop, C., Stillman, R. A., Garbutt, A., Yates, M. G., Rispin, E., Yates, T., 2016. Variability in the area, energy and time costs of wintering waders responding to disturbance. Ibis, 158: 711–725. Davenport, J., Davenport, J. L., 2006. The impact of tourism and personal leisure transport on coastal environments: A review. Estuarine, Coastal and Shelf Science, 67: 280–292. Dubos, N., Le Viol, I., Robert, A., Teplitsky, C., Ghislain, M., Dehorter, O., Julliard, R., Henry, P. Y., 2018. Disentangling the effects of spring anomalies in climate and net primary production on body size of temperate songbirds. Ecography, 41: 1319–1330. Fernández–Juricic, E., Tellería, J. L., 2000. Effects of human disturbance on spatial and temporal feeding patterns of Blackbird Turdus merula in urban parks in Madrid, Spain. Bird Study, 47: 13–21. Frid, A., Dill, L. M., 2002. Human–caused disturbance stimuli as a form of predation risk. Ecology and Society, 6: 1–11. Galarza, A., Domínguez, A., 1989. Urdaibai: Avifauna
Animal Biodiversity and Conservation 43.2 (2020)
de la ría de Guernica. Diputación Foral de Bizkai, Bilbao. Garaita, R., Arizaga, J., 2015. The benefits of a constructed lagoon for the conservation of Eurasian Spoonbills (Platalea leucorodia) in a tidal marsh. Journal for Nature Conservation, 25: 35–41. Gillett, W. H., Hayward, J. L., Stout, J. F., 1975. Effects of human activity on egg and chick mortality in a Glaucous–winged gull colony. The Condor, 77: 492–495. Glover, H. K., Weston, M. A., Maguire, G. S., Miller, K. K., Christie, B. A., 2011. Towards ecologically meaningful and socially acceptable buffers: Response distances of shorebirds in Victoria, Australia, to human disturbance. Landscape and Urban Planning, 103: 326–334. Jackman, S., 2017. pscl: Classes and Methods for R Developed in the Political Science Computational Laboratory. United States Studies Centre, University of Sydney, Sydney. Jiguet, F., Devictor, V., Julliard, R., Couvet, D., 2012. French citizens monitoring ordinary birds provide tools for conservation and ecological sciences. Acta Oecologica, 44: 58–66. Lafferty, K. D., 2001. Birds at a Southern California beach: seasonality, habitat use and disturbance by human activity. Biodiversity & Conservation, 10: 1949–1962. Lepage, D., Gauthier, G., Menu, S., 2000. Reproductive consequences of egg–laying decisions in snow geese. Journal of Animal Ecology, 69: 414–427. Martín, B., Delgado, S., de la Cruz, A., Tirado, S., Ferrer, M., 2014. Effects of human presence on the long–term trends of migrant and resident shorebirds: evidence of local population declines. Animal Conservation, 18: 73–81. McFadden, T. N., Herrera, A. G., Navedo, J. G., 2017. Waterbird responses to regular passage of a birdwatching tour boat: Implications for wetland management. Journal for Nature Conservation, 40: 42–48. McLeod, E. M., Guay, P.–J., Taysom, A. J., Robinson, R. W., Weston, M. A., 2013. Buses, cars, bicycles and walkers: the Influence of the type of human transport on the flight responses of waterbirds. Plos One, 8: e82008. Mikola, J., Miettinen, M., Lehikoinen, E., Lehtilä, K., 1994. The effects of disturbance caused by boating on survival and behaviour of velvet scoter Melanitta fusca ducklings. Biological Conservation, 67: 119–124. Miller, S. G., Knight, R. L., Miller, C. K., 1998. Influence of recreational trails on breeding bird communities. Ecological Applications, 8: 162–169. Monti, F., Duriez, O., Dominici, J. M., Sforzi, A., Robert, A., Fusani, L., Grémillet, D., 2018. The price of success: integrative long–term study reveals ecotourism impacts on a flagship species at a
253
UNESCO site. Animal Conservation, 21: 448–458. Navedo, J. G., Herrera, A. G., 2012. Effect of recreational disturbance on tidal wetlands: supporting the importance of undisturbed roosting sites for waterbird conservation. Journal of Coastal Conservation, 16: 373–381. Overdijk, O., Navedo, J. G., 2012. A massive spoonbill stopover episode: identifying emergency sites for the conservation of migratory waterbird populations. Aquatic Conservation: Marine and Freshwater Ecosystems, 22: 695–703. Peach, W. J., Siriwardena, G. M., Gregory, R. D., 1999. Long–term changes in over–winter survival rates explain the decline of reed buntings Emberiza schoeniclus in Britain. Journal of Applied Ecology, 36: 798–811. Perona, A. M., Urios, V., López–López, P., 2019. Holidays? Not for all. Eagles have larger home ranges on holidays as a consequence of human disturbance. Biological Conservation, 231: 59–66. Platteeuw, M., Henkens, R. J. H. G., 1997. Possible impacts of disturbance to waterbirds: individuals, carrying capacity and populations. Wildfowl, 48: 225–236. R Core Team, 2014. R: A language and environment for statistical computing. Vienna, Austria. Riddington, R., Hassall, M., Lane, S. J., Turner, P. A., Walters, R., 1996. The impact of disturbance on the behaviour and energy budgets of Brent Geese Branta b. bernicla. Bird Study, 43: 269–279. Samia, D. S. M., Nakagawa, S., Nomura, F., Rangel, T. F., Blumstein, D. T., 2015. Increased tolerance to humans among disturbed wildlife. Nature Communications, 6: 8877. Sastre, P., Ponce, C., Palacín, C., Martín, C. A., Alonso, J. C., 2009. Disturbances to great bustards (Otis tarda) in central Spain: human activities, bird responses and management implications. European Journal of Wildlife Research, 55: 425–432. Stillman, R. A., Goss–Custard, J. D., 2002. Seasonal changes in the response of oystercatchers Haematopus ostralegus to human disturbance. Journal of Avian Biology, 33: 358–365. Sutherland, W. J., 2007. Future directions in disturbance research. Ibis, 149: 120–124. Triplet, P., Overdijk, O., Smart, M., Nagy, S., Schneider–Jacoby, M., Karauz, E. S., Pigniczki, C., Baha El Din, S., Kralj, J., Sandor, A., Navedo, J. G., 2008. International single species action plan for the conservation of the Eurasian spoonbill Platalea leucorodia. AEWA Technical Series 35, Bonn. Triplet, P., Sournia, A., Joyeux, E., Le Dréan– Quénec'Hdu, S., 2003. Activités humaines et dérangement: l’exemple des oiseaux d’eau. Alauda, 71: 305–316. Weller, M. W., 1999. Wetland Birds. Cambridge University Press, Cambridge.
254
Arizaga et al.
Animal Biodiversity and Conservation 43.2 (2020)
i
Supplementary material
Annex 1. Beta–parameter estimates of a zero–altered model with logit link function and negative binomial distribution errors used to test for the effect of several factors on the occurrence of a potential disturbance on waterbirds at Urdaibai. Abbreviations for the type of disturbance are shown in Methods. Reference values (Beta = 0): Hour = 1; Zone = 1; Period = Jan–Feb; Tide = high; Week = weekend/holiday; Type = BOAT. Anexo 1. Estimaciones del parámetro beta de un modelo de cero alterado con función de enlace logit y distribución binomial negativa del error utilizado para determinar el efecto de varios factores en la manifestación de una posible perturbación que afectara a las aves acuáticas de Urdaibai. Las abreviaciones de los tipos de perturbación se muestran en el apartado Methods. (Para los valores de referencia, véase arriba). Factor
Beta SE(Beta) P
Factor
Beta
SE(Beta)
P
Intercept
–7.43
0.25
< 0.001
Hour: 2
+0.62
0.26
0.018
Tide: low
–0.02
0.10
0.860
Tide: decreasing
–0.27
0.10
0.008
Hour: 3
+1.18
0.25
< 0.001
Tide: increasing
–0.05
0.11
0.664
Hour: 4
+1.94
Hour: 5
+1.61
0.21
< 0.001
Week: workdays
–0.45
0.07
< 0.001
0.24
< 0.001
Hour: 6
Type: DOGS
–0.17
0.14
0.200
+1.70
0.24
< 0.001
Type: FAST
–2.66
0.23
< 0.001
Hour: 7
+1.09
0.25
< 0.001
Type: FISH
–1.10
0.15
< 0.001
Zone: 2
–0.61
0.08
< 0.001
Type: KANO
–0.12
0.13
0.383
Zone: 3
–1.72
0.10
< 0.001
Type: NATU
–2.58
0.22
< 0.001
Zone: 4
–3.85
0.19
< 0.001
Type: OTHERS
–2.39
0.16
< 0.001
Zone: 5
–5.32
0.36
< 0.001
Type: PADD
–1.39
0.16
< 0.001
Period: Mar–Apr
–1.28
0.16
< 0.001
+0.13
0.15
0.402
Type: SHEL
Period: May–Jun +1.04
0.14
< 0.001
Type: SURF
–2.96
0.26
< 0.001
Period: Jul–Aug
+1.26
0.14
< 0.001
Type: TOUR
+1.19
0.13
< 0.001
Period: Sep–Oct
+0.87
0.15
< 0.001
Type: VISI
–3.53
0.32
< 0.001
Period: Nov–Dec +0.23
0.16
0.151
Arizaga et al.
ii
Annex 2. Beta–parameter estimates of a generalized linear model using a logit link function with negative binomial distribution errors used to test for the effect of several factors on the occurrence of a real disturbance on waterbirds at Urdaibai. Abbreviations for the type of disturbance as shown in Methods: NA, non–estimable parameter. Reference values (Beta = 0): Hour = 1; Zone = 1; Period = Jan–Feb; Week = weekend/holiday; Tide: high. Anexo 2. Estimaciones del parámetro beta de un modelo lineal generalizado utilizando una función de enlace logit con una distribución binomial negativa para los errores utilizados para determinar el efecto de varios factores en la manifestación de una perturbación real que afectara a las aves acuáticas de Urdaibai. Las abreviaciones de los tipos de perturbación tal como se muestran en el apartado Methods: NA, parámetro no estimable. (Para los valores de referencia, véase arriba). Factor
Beta SE(Beta) P
Factor
Beta
SE(Beta)
P
Intercept
–8.02 0.81 0.001
Period: Mar–Apr
–1.02
0.65
0.117
Hour: 2
–0.07
0.88
0.932
Period: May–Jun
–0.07
0.53
0.896
Hour: 3
+0.70
0.80
0.376
Period: Jul–Aug
+0.70
0.46
0.128
Hour: 4
+0.47
0.65
0.469
Period: Sep–Oct
+0.19
0.52
0.719
Hour: 5
+0.32
0.83
0.704
Period: Nov–Dec
–0.24
0.58
0.682
Hour: 6
+0.91
0.76
0.230
Week: workdays
–0.95
0.31
0.002
Hour: 7
NA
NA
NA
Tide: low
+1.08
0.47
0.021
Zone: 2
–0.41
0.32
0.201
Tide: decreasing
+0.72
0.49
0.142
Zone: 3
–1.32
0.41
0.001
Tide: increasing
+1.29
0.49
0.009
Zone: 4
NA
NA
NA
Zone: 5
–3.60
1.03
< 0.001
Annex 3. Beta–parameter estimates of a linear model using linear link function and normal distribution errors to test for the effect of several factors on the proportion of waterbirds affected by a real disturbance at Urdaibai. Reference values (Beta = 0): Hour = 1; Zone = 1; Period = Jan–Feb; Week = weekend/holiday; Tide = high. Anexo 3. Estimaciones del parámetro beta de un modelo lineal utilizando una función lineal de enlace logit con una distribución binomial negativa para los errores utilizados para determinar el efecto de varios factores en la proporción de aves acuáticas afectadas por una perturbación real en Urdaibai. (Para los valores de referencia, véase arriba). Factor
Beta
SE(Beta)
P
Factor
Beta
SE(Beta)
P
Intercept
+8.31 3.29 0.012
Period: Mar–Apr –0.22 2.25 0.920
Hour: 2
+0.01
3.25
0.999
Period: May–Jun
+1.54
2.25
0.490
Hour: 3
+4.96
3.21
0.120
Period: Jul–Aug
+5.04
2.17
0.020
Hour: 4
+1.17
2.49
0.640
Period: Sep–Oct
+0.91
2.28
0.690
Hour: 5
+5.50
3.18
0.080
Period: Nov–Dec –1.31 2.41 0.590
Hour: 6
+3.20
3.22
0.320
Week: workdays –2.44 1.23 0.050
Hour: 7
–1.70 3.34 0.610
Tide: low
+2.25
1.67
0.180
Zone: 2
–7.62
1.94
< 0.001
Tide: decreasing
+0.84
1.76
0.640
Zone: 3
–9.22
1.95
< 0.001
Tide: increasing
+1.26
1.87
0.500
Zone: 4
–11.24
2.02
< 0.001
Zone: 5
–11.18
1.94
< 0.001
Animal Biodiversity and Conservation 43.2 (2020)
Abundance (indiv./zone/hour)
700
Gulls/terns
600 500 400 300 200 100 0
Z1
Z2
Abundance (indiv./zone/hour)
50
Z4
Z5
Storcks/herons
600
Ducks/geese
500
100
400
80
300
60
200
40
100
20
0
Z1
Z2
Z3
25
Z4
Z5
Spoonbill
0
20
30
15
15
20
10
10
10
5
5
18 16 14 12 10 8 6 4 2 0
Z2
Z3
Z4
Z5
Divers/grebes
Z1
Z2
Z3
Z4
Z5
0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0
Z1
Z2
Z3
Z4
Z5
Osprey
Z1
Z2
0
Z3
Z4
Z5
Cormorants
25
20
Z1
Waders
120
40
0
Abundance (indiv./zone/hour)
Z3
iii
Z1
Z2
Z3
3.5
Z4
Z5
Others
3.0 2.5 2.0 1.5 1.0 0.5 Z1
Z2
Z3
Z4
Z5
0
Z1
Z2
Z3
Z4
Z5
Annex 4. Mean (± 95 % confidence interval) spatial abundance pattern by taxa of waterbirds in the Urdaibai estuary over an annual cycle. The common coot (Fulica atra) has been included in the ducks/ geese group. 'Others' included: rallids other than common coot and northern gannet (Morus bassanus). Anexo 4. Media (± intervalo de confianza del 95 %) de la pauta de abundancia espacial por taxón de aves acuáticas en el estuario de Urdaibai durante todo el ciclo anual. La focha común (Fulica atra) se ha incluido en el grupo de los patos y las ocas (ducks/geese). El grupo "otros" incluye: rálidos (excepto la focha común) y alcatraz atlántico.
iv
Arizaga et al.
Animal Biodiversity and Conservation 43.2 (2020)
255
Ultrasound speed in red deer antlers: a non–invasive correlate of density and a potential index of relative quality L. Castillo, M. Del Río, J. Carranza, C. Mateos, J. J. Tejado, F. López
Castillo, L., Del Río, M., Carranza, J., Mateos, C., Tejado, J. J., López, F., 2020. Ultrasound speed in red deer antlers: a non–invasive correlate of density and a potential index of relative quality. Animal Biodiversity and Conservation, 43.2: 255–269, Doi: https://doi.org/10.32800/abc.2020.43.0255 Abstract Ultrasound speed in red deer antlers: a non–invasive correlate of density and a potential index of relative quality. Deer antlers can be used as an index of individual performance both in ecological and productive contexts. Their quality is often measured only by their biometrical features, such as size, asymmetry or weight. Mechanic characteristics cannot normally be measured without destroying the antler and hence losing the commercial value of the trophies. Here, we studied ultrasonic velocities, density, and tensile strength across various sections of cast antlers of Iberian red deer (Cervus elaphus hispanicus). We found that the speed value depended on the section of the antler and the propagation direction. For antler sections, velocities were lowest for mid–beam and highest for brow tine. Results were similar for density and indirect tensile strength, probably related to differences in functionality among antler sections. Density explained most of the variability of ultrasound–speed. The time elapsed from antler shed affected density more than ultrasound speed. The indirect tensile strength showed a non–linear, decelerating relationship with ultrasound speed. We discuss the applications of ultrasound speed as a non–invasive tool to measure density and physical properties of antlers and antler sections, and their potential use as an index of quality. Key words: Cervus elaphus hispanicus, Deer antlers, Deer population management, Hunting trophies, Iberian red deer, Ultrasound Resumen Velocidad de ultrasonidos en las cuernas del ciervo ibérico: una medición no invasiva de la densidad y un posible índice de la calidad relativa. Las cuernas de ciervo pueden usarse como un índice de calidad individual, tanto en contextos ecológicos como productivos. Por lo general, la calidad de las cuernas se mide solo por sus características biométricas, como la longitud, la asimetría o el peso, mientras que las características mecánicas normalmente no pueden medirse sin destruir la cuerna y, por lo tanto, sin perder el valor comercial de los trofeos. En este trabajo medimos la velocidad de transmisión de ultrasonidos en distintas secciones de cuernas de desmogue de ciervo ibérico (Cervus elaphus hispanicus), junto con la densidad y la resistencia a la tracción. Encontramos que el valor de la velocidad depende de la sección de la cuerna y de la dirección de propagación. En relación con las secciones de las cuernas, las velocidades más bajas se obtuvieron en el tronco medio y las más altas, en las luchaderas. Los resultados fueron similares con respecto a la densidad y la resistencia a la tracción indirecta, probablemente debido a la diferencia de funcionalidad de las distintas secciones de cuerna. La densidad fue la principal causa de la variabilidad en la velocidad de los ultrasonidos. El tiempo transcurrido entre el desmogue y la medición afectó a la densidad más que a la velocidad de los ultrasonidos. La resistencia a la tracción indirecta mostró una relación curvilínea de desaceleración con la velocidad de los ultrasonidos. Analizamos las aplicaciones de la velocidad de los ultrasonidos como herramienta no invasiva para medir la densidad y las características físicas de las cuernas y de sus secciones, así como su posible utilidad como índice de la calidad. Palabras clave: Cervus elaphus hispanicus, Cuernas de ciervo, Gestión de la población de ciervos, Trofeos de caza, Ciervo ibérico, Ultrasonidos ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
256
Castillo et al.
Received: 5 XI 19: Conditional acceptance: 16 III 20; Final acceptance: 15 VI 20 L. Castillo, C. Mateos, Biología Evolutiva, Etología y Gestión Cinegética, Universidad de Extremadura, Avda. Universidad s/n., 10071 Cáceres, Spain.– M. Del Río, F. López, Física Aplicada, Escuela Politécnica, Universidad de Extremadura, Avda. Universidad s/n., 10071 Cáceres, Spain.– J. Carranza, Wildlife Research Unit (UIRCP), Universidad de Córdoba, Campus de Rabanales, Colonia de San José, Ctra. Nacional IV km 396, 14014 Córdoba, Spain. Corresponding author: Mariano del Río. E–mail: labmdr@gmail.com ORCID ID: 0000–0003–4587–8194
Animal Biodiversity and Conservation 43.2 (2020)
Introduction Deer antlers are deciduous bony structures that males shed and re–grow each year (Gross, 1983). They are used as weapons in conspecific fights for female access (Clutton–Brock, 1982) and probably also as visual signals of dominance (Lincoln, 1972; Geist, 1966). This sexual character is particularly costly to grow and maintain (Andersson, 1994; Gaspar–López et al., 2008; Foley et al., 2012) and its development relates to tooth wear and potential lifespan (Carranza et al., 2004, 2008; Pérez–Barbería et al., 2015). Antler growth demands a great amount of calcium and phosphorus within a short period of time (Chapman, 1975), and therefore usually involves demineralization of the skeleton since the animal's daily intake cannot supply these minerals at the required rate (Chapman, 1975; Meister, 1956). Due to their high cost of growth, antlers may be used as an honest signal of individual quality (Weladji et al., 2005; Pérez–González et al., 2010), as an indicator of genes related to immune response (Ditchkoff et al., 2001), and as an example of sexual selection, particularly relating to competition between males (Lincoln, 1972; Gesist, 1966; Clutton–Brock et al., 1982). In addition, females may use these traits as reliable signals when choosing mates (Wong and Candolin, 2005). Deer antlers may encode information of the quality of the male based on their size and asymmetry (Mateos et al., 2008; Parsons, 1992), their body condition and body size (Kruuk et al., 2002), or the density of antler bone (Landete–Castillejos et al., 2007). In the last decades, the impact of human activities on the environment has increased. Management of red deer populations in Europe, and particularly in Spain, has intensified and better procedures are needed to assess their consequences. The study of antler characteristics may provide important information not only on the bearer but also concerning environmental variations (Weladji et al., 2005; Carranza and Vargas, 2007; Foley et al., 2012). Climate change, for instance, may affect the size of antlers (Torres–Porras et al., 2009) and likely other antler features. Until recently, length, asymmetry and weight or density have been studied external measurements (Swaddle, 2003; Mateos et al., 2008). To study mechanical properties, destructive techniques (Landete–Castillejos et al., 2007) have been studied but they present limitations. Antlers are trophies in hunting management, valuable for managers and hunters, and cannot be destructively analyzed without losing their commercial value. A new technique is thus needed to determine the physical/ mechanical properties without decreasing their value. Ultrasound velocity measures could be an interesting tool for this purpose. Ultrasound is a travelling mechanical vibration whose speed depends on the mechanical properties of the medium (Njeh et al., 1997). It is an alternative to conventional absorptiometry to obtain information on structure and density (Gluer et al., 1993; Tavakoli and Evan, 1991). The speed of ultrasonic waves has been extensively used to measure both the elastic properties of bone and its proportion of compact and
257
porous tissue (e.g. Bonfield and Tully, 1982; Hartman et al., 2004; Drozdzowska and Pluskiewicz, 2005). Some of the advantages of ultrasound diagnostic techniques are that they are straightforward, non–invasive, and non–destructive (Bowling and Frank, 1981; Laugier, 2012). For these reasons, they have been extensively used for bone diagnosis (Lakes et al., 1986; Lasaygues and Pithioux, 2002; Laugier, 2006; Tonni et al., 2012) but to our knowledge, ultrasound has been used to describe the characteristics of antler tissues in only one study (Lees, 1982). Here we studied the relationships between the speed of ultrasound through antler bone and the physical/ mechanical properties of antlers. Our objective was to investigate the relationship between ultrasound speed and antler density and mechanical properties, as well as the possibility to use ultrasound as a non–invasive procedure to assess the quality of red deer antlers. This work led to the design of equipment for measuring ultrasound speed in antlers. It has been registered as a utility model (Del Río et al., 2012). Methods Study area Antlers were obtained from free–ranging red deer from four estates in Extremadura, a region in south–western Spain. The study area was divided into two zones, with two states located in the Sierra de San Pedro and the other two in the Monfragüe National Park. The vegetation cover in these estates is open–managed forest 'dehesa' (main tree species Quercus rotundifolia and Q. suber) and Mediterranean scrub (genus Cistus, Erica, Arbutus, Mirtus, Pistacia, Phyllyrea). Procedure Antlers were collected in the field after being shed at the end of March and beginning of April over three consecutive years. We used 29 antlers from different individual males. Because we only had access to the shed antlers from the field, not to the males, we could not register the age of the stag (a rough estimation from antler size and shape ranged 2–4 years; see e.g. Clutton–Brock et al., 1982; Gross, 1983). Most antlers were measured within one year after they were cast. For some, however, between one and four years elapsed between casting and measurement. This allowed us to see the effect of time from casting by including in models a dichotomous variable 'recently shed' with level 1 = less than or equal to 1 year elapsed between casting and measurements, and level 0 = more than 1 year between casting and measurements. To study properties at different antler sections, antlers were cut in 4–7 (depending on the size and morphology of the antler) fragments (~15 cm length, 3–4 cm diameter) at the positions shown in fig. 1. Thus, we obtained a total of 150 antler specimens or fragments belonging to 29 antlers from different individual stags. However, a variable number of antler fragments were used for measurements, and for statistical models we used only
Castillo et al.
258
5 6
7
1
3
4
2
Fig. 1. Position of antlers sections: 1, brow tine; 2, low beam, or section between bez tine and trez tine; 3, mid beam, or section between trez tine and crown; 4, palm beam; 5, bez tine; 6, trez tine; 7, crown tine. Fig. 1. Posición de cada sección de las cuernas: 1, luchadera; 2, zona media baja o sección entre las luchaderas y la punta central; 3, zona media alta o zona entre la punta central y la corona; 4, palma; 5, contraluchadera; 6, punta central; 7, punta de corona.
those four sections (numbers 1 to 4 in fig. 1) present in all the antlers as repeated measures (see below). We established a measurement protocol to allow all the following tests to be performed on each fragment. First we determined the thickness of the antler bone tissue by means of various measurements on both surfaces of the cut with an electronic caliper. The time of flight of ultrasonic wave was then measured and the ultrasound velocity was determined. We determined the density, porosity, and strength. Ultrasound measurements In order to apply this method for quality assessment of antlers in different situations, it is essential to use the through transmission (T–T) technique with a portable, compact, robust, and easy to use device (Steinkamp BP–V with transducers of 50 kHz nominal frequency). The low frequency of transducers (50 kHz), together with the high voltage pulse applied to the emitting transducer (600 Vpp), ensures that the wave will be transmitted through the material despite the high attenuation in the porous material in the interior of antlers. We used plasticine as coupling material to ensure the correct transmission of the wave between the transducers and the rough antler surface, checking the received waveform on an oscilloscope, subtracting in each measure the propagation time of the wave in the coupling medium. This attenuation, below 0.1 MHz, particularly in porous material such as
bone or antlers, is relatively insensitive to frequency and above 1 MHz signal–to–noise becomes a significantly limiting factor (Langton and Njeh, 2008). It also is important to consider the length (~ 15 cm) and thickness (~ 3 cm) of the samples to choose the transducers. For these two reasons, porosity and sizes of samples, we selected transducers of 50 kHz to detect the signal into the received transducer. When using transducers 50 kHz and with measurements made on samples sized an order of magnitude of the wavelength of the ultrasonic signal, overlapping of waves might occur. However, using an oscilloscope we verified that the start of the first cycle allowed the device to determine (with accuracy of 0.1 μs) the time taken for the ultrasonic signal to reach the receiver from the transmitter. The value of the flight time of the signal between the transmitter and the receiver was obtained through measurements made in each fragment, over the central part where the thickness was previously measured with an electronic caliper. For each test, the measurements were repeatedthree times, withdrawing and returning the transducers to the fragment every time. Therefore, we obtained a total of nine measurements obtained in three different tests. From these we obtained the corresponding mean and associated error. The standard errors obtained for each measurement ranged between 5–10 %. However, to further ensure the reproducibility of the measurements obtained following the method described above we carried
Animal Biodiversity and Conservation 43.2 (2020)
out a specific analysis with three different sets of measures with 50 kHz transducers. In all cases we obtained ratios between the speeds of each series next to the unit (0.98–1.10). These results allow us to ensure the reproducibility of measurements within the range that provides the associated error. To obtain the maximum information on the speed of propagation of ultrasound in the antler samples, for each fragment we made measurements in the three principal axes: the longitudinal axis (VL, in the direction of the antler beam) and the two transverse axes of the oval transversal shape of the antler (the mayor axis: VT1, and the minor one: VT2), taken at the center of the fragment. Non–ultrasound measurements For each sample we measured the density, porosity, and strength. For density and porosity we applied an adaptation of the European standard test used for calculating these properties in natural stone (EN1936, 2006). The bulk density (c) is determined by the equation:
c = [Wd / (Wsat – Wsum)] · cH2O
(Eq. 1)
where, Wd is the dry weight (after removing ambient moisture using an oven at 40º for 24–48h until weight stabilized), Wsat is the weight saturated with methanol, Wsum is the weight of the saturated sample submerged in the hydrostatic balance and cH2O is the water density. We defined the bulk porosity (q%) as the ratio between the volume of accessible pores and the total sample volume, with the former parameter being determined by the weight gain of the sample saturated with methanol divided by the density of methanol. The formula used is thus:
q% =
[(Wsat – Wd) / cmet] [(Wsat – Wsum) / cH2O]
x 100
(Eq. 2)
The proportion of cancellous and compact areas (Aca/co) was determined by measurements made in both areas, for a selected group of specimens from all sections of each antler. These measurements were made in four different directions of the outer and the inner diameters of the two sections of each sample, obtaining the average value and the area assuming circular sections for the samples. Although there is a transition zone between compact and cancellous areas, the most contrasting line of separation occurred between cancellous and the rest (see fig. 2), and hence for practical purposes we decided to include the transition zone in the compact measure. To determine the tensile strength we elaborated an indirect tensile strength (ITS) test (the Brazilian test) as the method to use for the basic mechanical characterization of the material. The strength trials had to be designed bearing in mind the need to relate this mechanical property with the speed of ultrasound. We therefore needed to know the strength of the entire
259
fragment of antler (both the compact and the porous parts) because the speed is measured through these two concentric layers. Initially, we attempted to use the bending or flexural test (EN12372, 2006) as most representative of the stresses to which antlers are subjected in conspecific combat. This test was found to be unusable because it was impossible to obtain fragments with sufficiently flat and smooth support surfaces for forces to be applied to them without causing movement of the fragment. A further problem was the plasticity of the material, which in some cases the test equipment could not be used without fragment breaking, a limitation acknowledged in other studies (Landete–Castillejos et al., 2007). We then tried compression (EN1926, 2006) and point load stress tests, but both presented major difficulties in implementation, in the former because the fragment had a curved geometry, and in the latter because the steel cones that are used to press on a point in the material dig into the antler bone without breaking the sample. This variable is an adaptation of testing procedures used to determine the quality of materials such as rocks, concrete and bituminous mixtures (Balbo, 2013; Sivakugan et al., 2014). The indirect tensile strength test (ITS) or Brazilian test is used to determine the tensile properties of the samples. This test allows a relatively wide range of values for specimen geometry, defined in terms of length to diameter ratio, and loading rates, defined as either time to failure or stress rate It is hence a useful procedure when specimens are approximately cylindrical, as is the case for antler sections. The indirect tensile strength of cylindrical specimens was calculated by subjecting them to a compressive force applied in a narrow band along their entire length. The result of the force resulted from the orthogonal traction making the sample break under tension. The trials were kept as close as possible to the requirements of the published norms (EN12390–6, 2009), transmitting the stress to the antler sample through metal plates about twice the diameter of the antler fragment. Thus, in our case, the stress was applied diametrically across the circular cross section, in the direction of the axis, corresponding to that of the measurement of the VT2 speed of ultrasound (fig. 2). The indirect tensile strength (ITS) was determined by the equation: ITS = (2 Pmax) / (o e v)
(Eq. 3)
where Pmax is the maximum load applied and e and v are respectively the height and the base diameter of the cylindrical sample. Statistical analysis Statistical analyses were performed with the computer software packages SPSS. Relationships between variables were explored using Spearman correlation coefficients, since not all correlations were lineal. Descriptive statistics were carried out for all the fragments of the antler but the models were conducted with only the main four antler fragments or
Castillo et al.
260
Fig. 2. Experimental setup for indirect tensile strength test (left). Result of its application to a cylindrical fragment from the antler of one of the deer (right). Fig. 2. Dispositivo experimental para la medición de la resistencia a la tracción indirecta (izquierda). Resultado de aplicar esta técnica a una de las secciones de cuerna con forma cilíndrica (derecha).
sections (brow tine, low beam, mid beam and palm beam; see fig. 1). However, as the four fragment measurements in the same antler are not independent cases, to obtain predictive models on the real relationship between the VT2 and the antler characteristics, we conducted a General Linear Mixed Model (GLMM) with VT2 as the dependent variable and antler fragments as repeated measures. The chosen type of the covariance structure for the repeated effect was Toeplitz: Heterogeneous, which assumes heterogeneous variances and heterogeneous correlation between sections. Estate identity was introduced as a random factor. Explanatory variables were the bulk density, the indirect tensile strength (ITS) and the categorical variable 'recently shed' that controlled for the time elapsed since antler shedding until the ultrasound measurement was carried out, in two levels: recent, i.e. less than one year since casting (level = 1), and not recent, i.e. between 1 and 4 years since casting (level = 0). We used this variable in two levels instead of all the years after exploring its relationships with VT2, bulk density and ITS, as well as the sample size for each year and the adequacy of models. Tensile strength (ITS) was fitted as an orthogonal quadratic relationship, as suggested in the explorative stage of analyses. The percentage of porosity was so highly correlated with density that it cannot be considered a different measure. Similarly, we avoided introducing the cancellous–to–compact area ratio in the analysis because it was also highly correlated with density and it was measured in fewer cases (rs=–0.84, see table 2; quadratic regression: R2 = 0.652, F2,41 = 38.46, P < 0.001), which greatly reduced the sample size and produced a serious collinearity problem (mainly increasing the standard error for the estimate, so that any effect of the problematic variable on VT2 cannot be detected).
In the model, we first introduced the main effects and their meaningful double interactions. We then removed the non–significant interactions step–by–step using the p–values. The coefficients of the model were estimated using REML (restricted maximum likelihood), and the degrees of freedom were calculated following Satterthwaite’s approximation. Normality and homoscedasticity were verified by using bivariate plots. The dataset was checked for outliers using plots of fitted values against residuals and one odd record was removed. Results Descriptive analysis of the variables Table 1 shows descriptive information on the ultrasonic velocities under each of the three axes measured in the fragments of antlers and the rest of antler measurements included in this study. The mean value of the velocity in the longitudinal axis (VL) appeared higher than the velocities in the transversal axes (VT1, VT2), both transversal velocities being very similar to each other. This anisotropy is due to various factors such as the structure of concentric cylindrical layers of the antler bone, as occurs in other materials with similar geometry and structure (tree trunks, bones, etc.), and other structural characteristics such as orientation of mechanically efficient microstructures (collagen and mineral particles). The physical and mechanical variables measured ITS, bulk density (c), porosity (q) and cancellous vs compact area ratio (Aca/co) showed considerable variability, indicating the large differences between antler fragments, mainly in their relative composition of cancellous and compact tissue and other related properties: indirect tensile strength, density, bulk porosity, and cancellous–to–compact area ratio.
Animal Biodiversity and Conservation 43.2 (2020)
261
Correlations between variables The ultrasound velocities were highly correlated, obtaining the following values of Pearson's correlation coefficient: r(VL,VT1) = 0.709, r(VL,VT2) = 0.825 and r(VT2,VT1) = 0.905. For subsequent analyses we chose the VT2 measurement because: (1) using VL implies sectioning the antler, which is not possible in a non–destructive procedure to measure deer antler quality; (2) VT1 provides a smaller plain surface of measure which may make transducer coupling with the sample difficult. Table 2 shows the Spearman correlations between ultrasound and non–ultrasound variables. The ultrasound speed (VT2) was positively correlated with indirect tensile strength (ITS) and bulk density (c) and negatively with porosity and cancellous to compact area ratio (Aca/co). Similarly, the physical variables were correlated with each other. Porosity was so highly correlated with bulk density (rs= –0.94, table 2) that the two could be considered the same variable, so we only included bulk density in the regression analyses below.
Table 1. Summary description of the statistical data obtained for ultrasonic velocities and other physical and mechanical variables studied in the antlers. Tabla 1. Descripción resumida de los datos estadísticos obtenidos para las velocidades de los ultrasonidos y otras variables físicas y mecánicas estudiadas en las cuernas.
N Min Max Mean SD VL (m/s)
25
3,076 3,877 3,482 224
VT1 (m/s)
25
1,781 2,899 2,394 296
VT2 (m/s) 108 1,700 3,121 2,389 278 ITS (MPa) 120
0.86
19.23 5.53 3.83
c (g/cm ) 130 0.79 1.64 1.19 0.21 q (%) 130 13.73 57.10 32.73 9.86 3
ACa/Co
79 0.06 2.52 0.75 0.56
Differences between antler sections Table 3 and Figure 3 show the differences between antler sections in ultrasound speed and other physical characteristics. Ultrasound speed, VT2 (m/s) was higher in the brow tine and palm beam, whereas the mid beam presented lower values (fig. 3A). Post–hoc multiple comparisons (using Sidak correction after applying a repeated measured model) showed significant differences between brow tine and low beam (233 ± 55,
df = 28, P = 0.001) and between brow tine and mid beam (356 ± 65, df = 34, P < 0.001). Bulk density (g/cm3) followed the same pattern: with the brow tine being the denser antler section, decreasing towards the distal sections and increasing again just in the palm beam (fig. 3B). There were significant differences between brow tine and the other sections (with low beam: 0.23 ± 0.03, df = 42, P < 0.001; with
Table 2. Spearman’s correlation coefficient (rs) between variables studied in antler fragments: N, sample size in each correlation. (All correlations are significant at 0.01 level, 2–tailed). Tabla 2. Coeficiente de correlación de Spearman (rs) entre las variables estudiadas en los fragmentos de cuernas: N, tamaño de la muestra en cada correlación (todas las correlaciones son significativas P < 0.01, 2 colas. VT2 (m/s)
c (g/cm3)
q (%)
ACa/Co
ITS (MPa)
VT2 (m/s)
rs 1.00
0.68 –0.62 –0.51 0.58
N 108
105 105
46
95
c (g/cm ) rs 0.68
1.00 –0.94 –0.84 0.70
130 130
3
N 105
q (%)
rs –0.62 –0.94 1.00
N 105
130 130
ACa/Co rs –0.51 –0.84 0.78
N 46
71
71
71 117 0.78 –0.58 71 117 1.00 –0.83 79 71
ITS (MPa)
rs 0.58
0.70 –0.58 –0.83 1.00
N
117
95
117
71
120
Castillo et al.
262
Table 3. Values (Mean ± SD) and simple size (N) obtained in each section of the antlers for the speed of ultrasound and the other physical–mechanical variables. Tabla 3. Valores (media ± DE) y tamaño de muestra (N) obtenidos en cada una de las secciones de las cuernas para la velocidad de los ultrasonidos y del resto de variables físicas y mecánicas.
VT2 (m/s) Brow tine Low beam Mid beam Palm beam
2,520 ± 260
c (g/cm3) ACa/Co 1.33 ± 0.16
0.58 ± 0.49
ITS (MPa) 7.69 ± 4.03
(23) (25) (12) (23) 2,330 ± 230
1.11 ± 0.16
1.06 ± 0.45
3.04 ± 1.64
(25) (26) (12) (24) 2,210 ± 190
0.98 ± 0.11
1.45 ± 0.62
2.64 ± 1.56
(25) (26) (12) (24) 2,360 ± 260
1.18 ± 0.15
0.56 ± 0.37
5.65 ± 3.05
(18) (20) (11) (19)
mid beam: 0.36 ± 0.03, df = 42, P < 0.001; with palm beam: 0.18 ± 0.04, df = 48; P = 0.01); and between low and mid beam (0.13 ± 0.3; df = 40, P < 0.001). In accordance with the decrease in density, the proportion of cancellous to compact tissue area increased toward distant sections, decreasing just in the palm beam (fig. 3C). The differences between brow tine and mid beam (–0.87 ± 0.23, df = 19, P = 0.007) and between palm beam and the two central sections (low beam: –0.50 ± 0.17, df = 22, P = 0.04; mid beam: 0.88 ± 0.20; df =16, P = 0.003) were significant. Similarly, brow tine and palm beam were the sections with highest ITS (MPa), whereas the central sections such as low beam and mid beam were more fragile (fig. 3D). The differences between brow tine and low beam (5.05 ± 0.76, df = 21, P < –0.001) and between brow tine and mid beam (5.37 ± 0.85, df = 26; P < 0.001) were significant, and so were the differences between palm beam and the central sections of the antler (low beam: 2.52 ± 0.70, df = 23, P = 0.008; mid beam: 2.84 ± 0.62, df = 19, P = 0.001). Relationship between ultrasound speed and antler mechanical properties We used mixed model analysis with the different fragments of each antler as repeated measures to study the relationship between mechanical properties of antler fragments and ultrasound speed (table 4). Density had the highest effect to explain ultrasound speed (VT2), but tensile strength (ITS) and its quadratic term were also significantly related to VT2. Time elapsed since antler shedding (recently shed) showed a significant interaction with bulk density to explain VT2, so that for a given density, antlers shed more than one year ago showed higher ultrasound speed (table 4; fig. 4). Indirect tensile strength (ITS) showed a non–linear, decelerating relationship with ultrasound speed (VT2)
(table 4). As tensile strength of antler samples increased, the ultrasound speed did not increase with the same slope (fig. 5). We did not find a significant variation between estates (i.e. areas or deer populations) in the relationships between antler features and ultrasound speed (table 4). Discussion Our results showed that the speed of ultrasound in antlers correlated significantly with the physical properties studied. We found the highest effect for bulk density, meaning that VT2 may be a good indicator of density. Therefore, the differences in ultrasound speed can inform about conditions during antler development, such as mineralization (Currey, 1987, 1990), likely related to diet (Landete–Castillejos et al., 2012; Gómez et al., 2013), and leading to variations in density. Measuring ultrasound speed may be more feasible in practice than measuring density, particularly because of its non–destructive procedure. Our results also indicate however, that ultrasound speed may be a less sensitive than density due to variations caused by drying up or any degradation of organic matter remaining in the antler, when they are collected from the field and stored in indoor conditions. For recently shed antlers, high weight (and hence the estimated density) may be due to water (Currey et al., 2009) or any non–mineral tissue content within the bone matrix that might degrade with time. As ultrasound speed is lower in water or soft tissue than in solid material (e.g. in wood, Oliveira et al., 2005) it may be a better indicator of quality (i. e. mineralization) than density. Further experimental studies should focus on the variations of the relationships between ultrasound speed, mineral content and other variables throughout the desiccating/degradation process of individual antlers.
Animal Biodiversity and Conservation 43.2 (2020)
A B 1.40 Bulk density (g/cm3)
2,600
263
VT2 (m/s)
2,500 2,400 2,300 2,200 2,100
Bt
0.50 Bt
1.00 Bt
Lb Mb Sections
Pb
8.00 ITS (MPa)
ACa/Co
0.75
1.10
C D
1.50
1.00
1.20
0.90 Lb Mb Pb Sections
1.75
1.25
1.30
6.00 4.00
2.00 Lb Mb Pb Sections
Bt
Lb
Mb Sections
Pb
Fig.3. Differences in the speed of ultrasound VT2, density, tensile strength and cancellous to compact area ratio, between sections at different parts of the antler: Bt, brow tine; Lb, low beam; Mb, mid beam; and Pb, palm beam. (The figure shows mean ± SD for each section). Fig. 3. Diferencias en la velocidad de los ultrasonidos VT2, la densidad, la resistencia a la tracción y la proporción entre el área esponjosa y el área compacta, entre diferentes secciones de la cuerna: Bt, la luchadera; Lb, la zona media baja; Mb, la zona media alta; Pb, la palma. (La figura muestra la media ± DE de cada sección).
We expected that ultrasound speed would be related to the resistance of antlers, in our case to tensile strength. Our results showed that this relationship is not linear and little predictive for values of tensile strength (fig. 5). We do not have a clear explanation for this nonlinear behavior. It may be related to the mechanical behavior of cylindrical structures such as the antler samples, for which the increase in section diameter may cause the total density to decrease (and therefore VT2 to decrease as well), keeping the value of ITS stable, because less strong material (cortical) is needed to maintain the same mechanical properties of the whole structure (Gere and Goodno, 2011). It is also worth considering that the equation for indirect tensile strength was designed to correct for the size of the specimen, assuming homogeneous features in the material. In the case of biological structures, the composition and density are not likely to be independent of the size of the specimen, so it may be that the ITS equation developed for materials does not capture these peculiarities. But tensile strength may also be related to the composition of antler bone, rather than simply density or mineralization.
The mineral composition of antler bone may affect its mechanical properties without changing density and hence ultrasound speed. For instance, Landete– Castillejos et al. (2010) reported that some minerals, notably manganese (Mn), highly influenced the mechanical properties of antler bone (see also review in Picavet and Balligand, 2016). Therefore, ultrasound speed may not be a useful indicator of antler bone composition besides its effects on variations in density. Values reported in the literature for physical and mechanical properties of deer antlers are variable and depend on the species (Chen et al., 2009). For the flexural strength of antlers, Landete–Castillejos et al. (2007) reported values between 81.9 and 103.7 MPa for cortical antler bone of free ranging and captive raised populations Iberian red deer, respectively. For hog deer (Axis porcinus) the reported value was 246 MPa (Kitchener in Chen et al., 2009). Chen et al. (2009) measured bending strength in cortical bone antlers of North American elk (Cervus canadensis) and found values of 197.3 ± 24.0 MPa, and 66.7 ± 10.7 MPa, for longitudinal and transversal axis, respectively. These authors also reported tensile strength va-
Castillo et al.
264
Table 4. Results of the general linear mixed model (GLMM) with bulk density (c in g/cm3) and indirect tensile strength (ITS in MPa) as the explanatory variables for ultrasound speed (VT2 in m/s). Time elapsed from antler cast to measurement was introduced as the categorical variable 'Recently shed' (reference level = 1, see Statistical analysis in Methods). Tabla 4. Resultados del modelo lineal general mixto (MLGM) con la densidad aparente (c en g/cm3) y la fuerza de tracción indirecta (ITS, en MPa) como variables explicativas de la velocidad de los ultrasonidos en las cuernas (VT2 en m/s). El tiempo transcurrido entre el desmogue de la cuerna y la medición se introdujo como variable categórica, "Recently shed" (nivel de referencia = 1, véase el subapartado "Statistical analysis" en "Methods"). Fixed Factors
Estimate
Intercept
1,061.379 175.046 41.464 6.063 0.000
Recently shed Bulk_density
381.886
S.E. 215.732
df
t Sig.
49.706
1.770
0.083
1,137.478 176.301 31.783 6.452 0.000
ITS
54.988 22.476 53.988 2.446 0.018
Square_ITS
–3.803
[Recently shed] * Bulk_density
–453.115
1.572 193.162
50.125 –2.419 0.019 44.104
–2.346
0.024
Random Factors
Estimate
S. E.
Wald Z
Sig.
Variance between estimates
1,922.185
3,795.980
0.506
0.613
lues (direct) of 115.4 ± 16.6 MPa (longitudinal) and 20.3 ± 6.0 MPa (transversal) for antlers of the same species, and values from Currey (1990) of 158 MPa from red deer antlers. We did not find any studies using the ITS–Brazilian test for deer antlers. For small pieces (2 x 4 x 30 mm) of archaeological bones, this technique yielded values ranging between 60 MPa and 4 MPa for bone bulk densities between 2.0 g/cm3 and 0.8 g/cm3, respectively (Turner–Walker, 1995). Values reported here for tensile strength of antlers, ranging from 0.86 to 19.23 MPa and with an average value of (5.5±3.8) MPa (table 1), are lower than those reported in the literature. Because we used a different technique to determine strength (indirect tensile) our results are little comparable with those of other authors who used flexural or direct tensile strength. Moreover, the fragments of specimens used in our case have different geometry and dimensions to those used by these authors (fig. 2). In fact, we performed the tests on antler specimens that included the complete structure with a compact outer layer and a highly porous inner layer, with cylindrical geometry of approximately 0.15 m length and 0.03–0.04 m in diameter at the base, while other studies only tested the compact part on different geometries and smaller fragments: Chen et al. (2009) on rectangles (25–30 x 3 x 2 mm) and Landete–Castillejos et al. (2007) on antler bars (50 x 2; 5 x 4 mm) both extracted samples only from the external compact tissue, thus leading to possible differences between axes and excluding any differences in cancellous vs compact composition of antlers.
Chen et al. (2009) reported a complete set of values for the static elastic modulus (destructive) obtained by different authors, ranging from 2.2 GPa for roe deer (Capreolus capreolus) (Currey, 1987) to 17.1 GPa for chital deer (Axis axis) (Rajaram and Ramanathan 1982). For Iberian red deer, mean values reported for the static elastic modulus are (Landete–Castillejos et al., 2007) 5.27 ± 0.33 GPa (free ranging population) and 6.87 ± 0.28 GPa (captive raised). For a medium with infinite dimensions the wavelength of ultrasound can be established when its velocity (v) depends on the properties of the medium through which it is propagating and its mode of propagation, according to the following formula (Czichos et al., 2006): v = (E/c)1/2
(Eq. 4)
where E is the dynamic Young's modulus and c is the density of the medium. Generally, this formula is used to estimate the value of Young's modulus of different materials using an indirect and non–destructive technique, (Del Río et al., 2007). Therefore, the values that we obtain through this equation are only indicative of the possible mechanical behavior of antlers respect to this elastic modulus. The average value of the young modules calculated with the Eq. 4 in our study for dynamic elastic modulus for Iberian red deer was: 5.9 ± 2.8 GPa, consistent with those obtained by the aforementioned authors. The differences in the speed of ultrasound according to the direction of measurement and the
Animal Biodiversity and Conservation 43.2 (2020)
265
3,000
VT2 (m/s)
2,800 2,600 2,400 2,200 2,000 1,800 0.60
0.80 1,00 1,20 Bulk density (g/cm3)
1,40
1.60
Fig. 4. Relationship between antler density and ultrasound speed (VT2) for two groups of antlers according to time elapsed from shed to measurement: recently shed, open circles and discontinuous line; older antlers, black dots and continuous line. The figure shows raw data and prediction lines from the mixed model in table 4, with other variables fixed at their mean values. Fig. 4. Relación entre la densidad de la cuerna y la velocidad de transmisión de los ultrasonidos (VT2) en dos grupos de cuernas según el tiempo transcurrido entre el desmogue y la medición: cuernas recientes, puntos blancos y línea discontinua; cuernas más antiguas, puntos negros y línea continua. En el gráfico se muestran los datos sin tratar y las líneas de predicción del modelo mixto de la tabla 4 con las demás variables fijadas en sus valores medios.
3,000
VT2 (m/s)
2,750 2,500 2,250 2,000 0.00
2.50
5,00 7,50 ITS (MPa)
10,00
12.50
Fig. 5. Relationship between the indirect tensile strength (ITS in MPa) and the speed of ultrasound (VT2). The figure shows raw data and the prediction line from the mixed model in table 4 with other variables fixed at their mean values. Fig. 5. Relación entre la resistencia a la tracción indirecta (en MPa) y la velocidad de los ultrasonidos (VT2). En el gráfico se muestran los datos sin tratar y la línea de predicción del modelo mixto de la tabla 4 con las demás variables fijadas en sus valores medios.
266
correlation between these values have been studied in cancellous bone (Hans et al., 1999). As with our results, Hans et al found a positive correlation between density and the speed of ultrasound, and differences according to the direction of measurement that they attributed to the trabecular structure of bone tissue. Similar results were reported for bovine cortical bone (Lasaygues and Pithioux, 2002), with greater longitudinal speeds (in the direction of the collagen fibers) than radial speeds, and both were significantly correlated. Regarding the correlations between the physical properties of bone, several studies have shown that the density of bone is the most important property determining its flexibility (Keller, 1994; Carter and Hayes, 1977). But density alone does not fully explain the variability in flexibility (Rice et al., 1988). Instead, structural information is also needed to improve estimates of bone flexure and fracture risk (Ulrich et al., 1999). Not surprisingly, we found that the ration of cancellous to compact bone was strongly negatively related to density and, to a lesser extent, to the indirect tensile strength and velocity of ultrasound (see table 2). The density values we obtained varied widely (between 0.79 and 1.64 g/cm3) due to the different values of the cancellous to compact area ratio of the fragments analyzed, this ratio varying between 2.2 and 0.06. The average value of the bulk density we obtained (1.19 ± 0.21 g/cm3) for fragments containing both porous and compact parts is consistent with the value provided by Chen et al. (2009) for full antler (1.3 ± 0.10 g/cm3), and for cortical (1.72 ± 0.04 g/cm3) and porous parts (0.50 ± 0.05 g/cm3). The mineral content is considered an important factor to determine density, and consequently the tensile strength, of bone tissue (Currey, 1987, 1990). The mineral content of antlers is incorporated via two routes during antler formation: from the diet and from re–absorption of minerals from the skeleton. Changes in diet affect the formation of the antler (Landete–Castillejos et al., 2012), so that the habitat where deer live could be an important factor in explaining variability in ultrasound speed. Differences in ultrasound speed for different sections within an antler can indicate differences in mechanical properties that could be related to functionality. The differences in VT2 and other physical properties between the distinct parts of the antler, with a range of mean values from 2,209 ± 37 m/s for the mid beam to 2,565 ± 68 m/s for the brow tine reflect differences in their resistance to breakage. Antler formation is differentially influenced by selection so that some parts are more susceptible than others to harsh conditions during development, affecting asymmetry for instance (Mateos et al., 2008). According to Gómez et al. (2016), in their study with PIXE and PIGE techniques they observed that mineralization decreases upwards from the base of the antler, being higher in low beam than in mid beam. This different mineralization would explain in part the porosities (and the ITS) of the different sections of the antlers, that is the main cause of
Castillo et al.
the differences obtained between the speeds of propagation by ultrasound. Our results indicate that antler resistance to breakage is not uniform throughout antler morphology, probably related to the costs for male deer of antler breakage at different sections. Antler base, main beam and proximal tines are stronger than more distal parts of the antler. Moreover, our results reveal a weak zone of the antler at mid beam section that might serve to facilitate breakage at this point rather than in more proximal parts of the antler. Antlers are subjected to directional selection because of their role in male–male competition (Kruuk et al., 2002). Antler tines and beam break in fights during the rutting season (Johnson et al., 2005; Karns and Ditchkoff, 2012) and male mating success is affected by antler breakage (Johnson et al., 2007). In white–tailed deer (Odocoileous virginianus) antler tines were found to break more easily than beam (Karns and Ditchkoff, 2012), probably because they are more exposed to impact, but it may also be that a broken beam has more serious consequences for the bearer than broken tines. Further studies on the differences in fighting behaviour between deer species may also contribute to our understanding of differences between antler parts. As our results show, antler structure and density explain much of the variability of the speed of ultrasound, and they in turn relate to the tensile strength. This relationship, however, is not linear as we have shown. We are aware that we did not measure the actual resistance of antler sections in the way they are used by stags in real fighting. However, the differences in ultrasound speed for different sections within an antler can indicate differences in mechanical properties that could be related to its functionality. Thus, as in the diagnosis of osteoporosis, the use of ultrasound in antlers may be an interesting non–invasive tool to study their mechanical properties as well as the functionality and susceptibility to stress conditions of different antler parts. On the other hand, since antler properties are related to the conditions of animals during antlerogenesis, ultrasound speed appears to be a useful non–invasive tool with a potentially wide range of applications in the management of deer populations. In conclusion, ultrasound speed is an interesting tool to estimate the density of antler bone. It is less influenced by moisture or soft tissue remains than total antler density, and hence may be used (along with other measurements) as an indicator of quality. The main advantages of this method, registered as a utility model (Del Río et al., 2012), are that it is non–destructive and rapid, it does not require any complicated training, and it can be used in outdoor conditions with portable equipment. Consequently, compared to currently used methods to estimate antler mechanical properties or density on the basis of antler weight, we suggest that this procedure can be implemented as a rapid, straightforward, and reliable method to assess antler quality for research, population management, and trophy measurement.
Animal Biodiversity and Conservation 43.2 (2020)
Acknowledgements We thank Antonio Flores and Beatriz Calleja for their collaboration in sample collection and management. Financial support came partly from the Spanish Ministry of Science, projects CGL2010–17163 and GLC2016–77052–P to Juan Carranza. Leticia Castillo was supported by an FPU grant from the Ministerio de Ciencia e Innovación. References Andersson, M., 1994. Sexual selection. Princeton University Press, Princeton. Balbo, J. T., 2013. Relations between indirect tensile and flexural strengths for dry and plastic concretes. Revista IBRACON de Estruturas e Materiais, 6(6): 854–874, Doi: 10.1590/S198341952013000600003 Bonfield, W., Tully, A. E., 1982. Ultrasonic analysis of the Young's modulus of cortical bone. J. Biomed. Eng., 4: 23–27. Bowling, B., 1981. Diagnostic ultrasound. Squire LF, Philadelphia. Carranza, J., Alarcos, S., Sanchez–Prieto, C. B., Valencia, J., 2004. Disposable–soma senescence mediated by sexual selection in an ungulate. Nature, 432: 215–218. Carranza, J., Mateos, C., Alarcos, S., Sanchez–Prieto, C. B., Valencia, J., 2008. Sex–specific strategies of dentine depletion in red deer. Biological Journal of the Linnean Society, 93: 487–497. Carranza, J., Vargas, J. M., 2007. Criterios para la Certificación de la Calidad Cinegética en España. Publicaciones Universidad de Extremadura, Spain. Carter, D. R., Hayes, W. C., 1977. The compressive behavior of bone as a two–phase porous structure. The Journal of Bone and Joint Surgery, 59: 954–962. Chapman, D. I., 1975. Antlers–bones of contention. Mammal Review, 5: 121–172. Chen, P. Y., Stokes, A. G., McKittrick, J., 2009. Comparison of the structure and mechanical properties of bovine femur bone and antler of the North American elk (Cervus elaphus canadensis). Acta Biomaterialia, 5: 693–706. Clutton–Brock, T. H., Guinness, F. E., Albon, S. D., 1982. Red deer: behavior and ecology of two sexes. Edimburg University Press, Edimburg, U.K. Currey, J. D., 1987. The evolution of the mechanical properties of amniote bone. Journal of Biomechanics, 20: 1035–1044. – 1990. Physical characteristics affecting the tensile failure properties of compact bone. Journal of Biomechanics, 23: 837–844. Currey, J. D., Landete–Castillejos, T., Estevez, J., Ceacero, F., Olguin, A., Garcia, A., Gallego, L., 2009. The mechanical properties of red deer antler bone when used in fighting. Journal of Experimental Biology, 212: 3985–3993. Czichos, H., Saito, T., Smith, L. (Eds.), 2006. Springer Handbook of Materials Measurement Methods. Springer Science + Business Media, Würzburg.
267
Del Río, L. M., López, F., Calleja, B., Mota, M. I., Tejado, J. J., González, I., Emeterio, J. L., Ramos, A., 2007. Determination of dynamic elastic constants in granites using through–transmission A–scan and resonance–based ultrasonic techniques. Proceedings of the International Congress on Ultrasonics, Vienna, April 9–13. 2007: Paper ID 1181. Del Río, L. M., López, F., Castillo, L., Carranza, J., Tejado, J. J., Calleja, B., 2012. Equipo portátil para la determinación de velocidad de ultrasonidos con medida automática de distancia entre transductores. Modelo de Utilidad de número P201131306. Concesión publicada en el Boletín Oficial de la Propiedad Industrial (BOPI) 07/09/2012 Ditchkoff, S. S., Lochmiller, R. L., Masters, R. E., Hoofer, S. R., Van Den Bussche, R. A., 2001. Major–histocompatibility–complex–associated variation in secondary sexual traits of white–tailed deer (Odocoileus virginianus): evidence for good–genes advertisement. Evolution, 55: 616–625. Drozdzowska, B., Pluskiewicz, W., 2005. Quantitative ultrasound in diagnosis of metabolic bone diseases. Curr. Med. Imaging Rev., 1: 67–73. EN12372, 2006. Natural stone test methods – Determination of flexural strength under concentrated load. European Committee for Standardization (CEN), Brussels. EN12390–6, 2009. Testing hardened concrete – Part 6: Tensile splitting strength of test specimens. European Committee for Standardization (CEN), Brussels. EN1926, 2006. Natural stone test methods – Determination of uniaxial compressive strength. European Committee for Standardization (CEN), Brussels. EN1936, 2006. Natural stone test methods – Determination of real density and apparent density, and of total and open porosity. European Committee for Standardization (CEN), Brussels. Foley, A. M., DeYoung, R. W., Lukefahr, S. D., Lewis, S. J., Hewitt, D. G., Hellickson, V. M., Draeger, D. A., DeYoung, A. C., 2012. Repeatability of antler characteristics in mature white–tailed deer in South Texas: consequences of environmental effects. Journal of Mammalogy, 93: 1149–1157. Gaspar–López, E., García, A. J., Landete–Castillejos, T., Carrión, D., Estévez, J. A., Gallego, L., 2008. Growth of the first antler in Iberian red deer (Cervus elaphus hispanicus). European Journal of Wildlife Research, 54: 1–5, Doi: 10.1007/s10344007-0096-0 Geist, V., 1966. The evolution of horn–like organs. Behavior, 27: 175–214. Gere, J. M., Goodno, B. J., 2011. Mechanics of Materials, brief edition. Cengage Learning Ed. Stamford. Gluer, C. C., Wu, C. Y., Genant, H. K., 1993. Broadband attenuation signals depend on trabecular orientation: an in–vitro study. Osteoporosis International, 3: 185–191. Gómez, S., Garcia, A., Landete–Castillejos, T., Gallego, L., Pantelica, D., Pantelica, A., Preoteasa, E. A., Scafes, A., Straticiuc, M., 2016. Potential of the Bucharest 3MV Tandetron™ for IBA studies of deer antler mineralization. Nuclear Instrument and
268
Methods in Physics Research B, 371: 413–418, Doi: 10.1016/j.nimb.2015.10.012 Gomez, S., Garcia, A. J., Luna, S., Kierdorf, U., Kierdorf, H., Gallego, L., Landete–Castillejos, T., 2013. Labeling studies on cortical bone formation in the antlers of red deer (Cervus elaphus). Bone, 52: 506–515. Gross, R. J., 1983. Deer antlers. Regerenation, Function and Evolution. Academic Press, New York. Hans, D., Wu, C., Njeh, C. F., Zhao, S., Augat, P., Newitt, D., 1999. Ultrasound velocity of trabecular cubes reflects mainly bone density and elasticity. Calcified Tissue International, 64: 18–23. Hartman, C., Shamir, R., Eshach–Adiv, O., Iosilevsky, G., Brik, R., 2004. Assessment of osteoporosis by quantitative ultrasound versus dual energy X–ray absorptiometry in children with chronic rheumatic diseases. The Journal of Rheumatology, 3: 981–985. Johnson, H. E., Bleich, V. C., Krausman, P. R., 2005. Antler breakage in tule elk, Owens Valley, California. The Journal of Wildlife Management, 69: 1747–1752. Johnson, H. E., Bleich, V. C., Krausman, P. R., Koprowski, J. L., 2007. Effects of antler break– age on mating behavior in male tule elk (Cervus elaphus nannodes). European Journal of Wildlife Research, 53: 9–15. Karns, G. R., Ditchkoff, S. S., 2012. Antler Breakage Patterns in White–tailed Deer. Proceedings of the Southeastern Association of Fish and Wildlife Agencies, 66: 114–119. Keller, T. S., 1994. Predicting the compressive mechanical behavior of bone. Journal of Biomechanics, 27: 1159–1168. Kitchener, A., 2000. Fighting and the mechanical design of horns and antlers. In: Biomechanics in Animal Behaviour (P. Domenici, R. W. Blake, Eds.). BIOS Scientific Publishers, Oxford. Kruuk, L. E. B., Slate, J., Pemberton, J. M., Brotherstone, S., Guinness, F., Clutton–Brock, T., 2002. Antler size in red deer: heritability and selection but no evolution. Evolution, 56: 1683–1695. Lakes, R., Yoon, H. S., Katz, J. L., 1986. Ultrasonic Wave Propagation and Attenuation in Wet Bone. Journal of Biomedical Engineering, 8: 143–148. Landete–Castillejos, T., Currey, J. D., Ceacero, F., García, A. J., Gallego, L., Gomez, S., 2012. Does nutrition affect bone porosity and mineral tissue distribution in deer antlers? The relationship between histology, mechanical properties and mineral composition. Bone, 50: 245–54, Doi: 10.1016/j. bone.2011.10.026 Landete–Castillejos, T., Currey, J. D., Estevez, J. A., Fierro, Y., Calatayud, A., Ceacero, F., Garcia, A. J., Gallego, L., 2010. Do drastic weather effects on diet influence changes in chemical composition, mechanical properties and structure in deer antlers? Bone, 47: 815–825. Landete–Castillejos, T., Currey, J. D., Estevez, J. A., Gaspar–López, E., Garcia, A., Gallego, L., 2007. Influence of physiological effort of growth and chemical composition on antler bone mechanical properties. Bone, 41: 794–803.
Castillo et al.
Langton, C. M., Njeh, C. F., 2008. The measurement of broadband ultrasonic attenuation in cancellous bone – A review of the science and technology. IEEE Transactions on Ultrasonics, Ferroelectrics, and Frequency Control, 55: 1546–1554. Lasaygues, P., Pithioux, M., 2002. Ultrasonic Characterization of Orthotropic Elastic Bovine Bones. Ultrasonics, 39: 567–573. Laugier, P., 2006. What Can Ultrasound Teach Us About Bone Quality? Journal of Biomechanics, 39(1): S7. – 2012. Ultrasound assessment of bone with ultrasound: Present and future. Journal of the Acoustical Society of America, 132: 1928. Lees, S., 1982. Ultrasonic measurements of deer antler, bovine tibia and tympanic bulla. Journal of Biomedical Engineering, 15: 867–874. Lincoln, G. A., 1972. The role of antlers in the behavior of red deer. Journal of Experimental Zoology, 182: 233–249. Mateos, C., Alarcos, S., Carranza, J., Sánchez–Prieto, C. B., Valencia, J., 2008. Fluctuating asymmetry of red deer antlers negatively relates to individual condition and proximity to prime age. Animal Behaviour, 75: 1629–1640. Meister, W., 1956. Changes in biological structure of the long bones of white–tailed deer during the growth of antlers. The Anatomical Record, 124: 709–721. Njeh, C. F., Boivin, C. M., Langton, C. M., 1997. The role of ultrasound in the assessment of osteoporosis: a review. Osteoporosis International., 7: 7–22. Oliveira, F. G. R., Candian, M., Luchette, F. F., Salgon, J. L., Sales, A., 2005. Moisture content effect on ultrasonic velocity in Goupia Glabra. Materials Research, 8(1): 11–14. Parsons, P. A., 1992. Fluctuating asymmetry: a biological monitor of environmental and genomic stress. Heredity, 68: 361–364. Pérez–Barbería, J., Carranza, J., Sánchez–Prieto, C., 2015. Wear fast, die young: more worn teeth and shorter lives in Iberian compared to Scottish red deer. Plos One, 10(8): e01134788, Doi:10.1371/ journal.pone.0134788 Pérez–González, J., Carranza, J., Torres–Porras, J., Fernandez–Garcia, J. L., 2010. Low heterozygosity at microsatellite markers in Iberian red deer with small antlers. Journal of Heredity, 101: 553–561. Picavet, P. P., Balligand, M., 2016. Organic and Mechanical Properties of Cervidae Antlers: a review. Veterinary Research Communication, 40: 141–147, Doi: 10.1007/s11259-016-9663-8 Rajaram, A., Ramanathan, N., 1982. Tensile properties of antler bone. Calcified Tissue International, 34: 301–305. Rice, J. C., Cowin, S. C., Bowman, J. A., 1988. On the dependence of the elasticity and strength of cancellous bone on apparent density. Journal of Biomechanics, 21: 155–168. Swaddle, J. P., 2003. Fluctuating Asymmetry, Animal Behaviour, and Evolution. Advances in the Study of Behavior, 32: 169–207. Sivakugan, N., Das, B., Lovisa, J., Patra, C., 2014.
Animal Biodiversity and Conservation 43.2 (2020)
Determination of c and Φ of rocks from indirect tensile strength and uniaxial compression tests. International Journal of Geotechnical Engineering, 8: 59–65, Doi: 10.1179/1938636213Z.00000000053 Tavakoli, M. D., Evans, J. A., 1991. Dependence of the velocity and attenuation in bone on the mineral content. Physics in Medicine & Biology, 36: 1529–1537. Tonni, G., Lituania, M., Rosignoli, L., 2012. Craniosynostosis with wormian bone, bowing of the long bones, unilateral short femur, and focal fibula deficiency: A prenatal diagnostic dilemma. Journal of Clinical Ultrasound, 41: 448–452. Torres–Porras, J., Carranza, J., Pérez–González, J., 2009. Selective culling of Iberian red deer stags (Cervus elaphus hispanicus) by selective montería in Spain. European Journal of Wildlife Research,
269
55: 117–123. Turner–Walker, G., 1995. The Tensile Strength of Archaeological Bone. Journal of Archaeological Science, 22: 185–191. Ulrich, D., Van Rietbergen, B., Laib, A., Ruegsegger, P., 1999. The ability of three–dimensional structural indices to reflect mechanical aspects of trabecular bone. Bone, 25: 55–60. Weladji, R. B., Holand, O., Steinheim, G., Colman, J. E., Gjostein, H., Kosmo, A., 2005. Sexual dimorphism and intercohort variation in reindeer calf antler length is associated with density and weather. Oecologia, 145: 549–555. Wong, B. B. M., Candolin, U., 2005. How is female mate choice affected by male competition? Biological Reviews, 80: 559–571.
270
Castillo et al.
Animal Biodiversity and Conservation 43.2 (2020)
271
Towards high–throughput analyses of fecal samples from wildlife C. Sarabia, I. Salado, A. Cornellas, A. Fernández–Gil, C. Vilà, J. A. Leonard
Sarabia, C., Salado, I., Cornellas, A., Fernández-Gil, A., Vilà, C., Leonard, J. A., 2020. Towards high–throughput analyses of fecal samples from wildlife. Animal Biodiversity and Conservation, 43.2: 271–283, Doi: https://doi. org/10.32800/abc.2020.43.0271 Abstract Towards high–throughput analyses of fecal samples from wildlife. High–throughput sequencing offers new possibilities in molecular ecology and conservation studies. However, its potential has not yet become fully exploited for noninvasive studies of free–ranging animals, such as those based on feces. High–throughput sequencing allows sequencing of short DNA fragments and could allow simultaneous genotyping of a very large number of samples and markers at a low cost. The application of high throughput genotyping to fecal samples from wildlife has been hindered by several labor–intensive steps. We evaluate alternative protocols which could allow higher throughput for two of these steps: sample collection and DNA extraction. Two different field sampling and seven different DNA extraction methods are tested here on grey wolf (Canis lupus) feces. There was high variation in genotyping success rates. The field sampling method based on surface swabbing performed much worse than the extraction from a fecal fragment. In addition, there is a lot of room for improvement in the DNA extraction step. Optimization of protocols can lead to very much more efficient, cheaper and higher throughput noninvasive monitoring. Selection of appropriate markers is still of paramount importance to increase genotyping success. Key words: Noninvasive genetic samples, Fecal DNA, Microsatellite genotyping, NGS, Field sampling, Carnivore feces Resumen Hacia análisis genéticos de alto rendimiento de muestras fecales de fauna silvestre. La secuenciación de alto rendimiento ofrece nuevas posibilidades en ecología molecular y biología de la conservación. Sin embargo, el potencial de esta técnica no ha sido totalmente explotado para estudios no invasivos, a partir de muestras fecales, de fauna en libertad. La secuenciación de alto rendimiento permite la secuenciación de fragmentos de ADN cortos y podría permitir el genotipado simultáneo de un gran número de muestras y marcadores a un bajo coste. La aplicación de estas técnicas a muestras fecales de fauna silvestre ha sido obstaculizada por la gran cantidad de trabajo requerido en varios pasos, desde la recolección de muestras hasta la secuenciación. Aquí evaluamos protocolos alternativos que podrían permitir un mayor rendimiento en dos de estos pasos: muestreo de campo y extracción de ADN. En este trabajo comparamos dos métodos distintos de conservación de las muestras obtenidas en el campo y siete métodos de extracción de ADN para heces de lobos (Canis lupus). Observamos una gran variación en el éxito de genotipado según los protocolos que se sigan. El método de muestreo de campo basado en frotado superficial de los excrementos dio resultados peores que la recolección de un fragmento del excremento. Por otro lado, los protocolos para la extracción de ADN mostraban resultados muy variables y ofrecen mucho margen de optimización y mejora. La optimización de protocolos puede llevar a un monitoreo no invasivo mucho más eficiente, económico y con mayor rendimiento. La selección de marcadores apropiados sigue siendo de importancia vital para incrementar el éxito de genotipado. Palabras clave: Muestras genéticas no invasivas, ADN fecal, Genotipado de microsatélites, Secuenciación de nueva generación (NGS), Muestreos de campo, Heces de carnívoros Received: 12 III 20; Conditional acceptance: 12 VI 20; Final acceptance: 09 VII 20 Carlos Sarabia, Isabel Salado, Anna Cornellas, Alberto Fernández–Gil, Carles Vilà, Jennifer A. Leonard, Estación Biológica de Doñana (EBD–CSIC), Avda. Americo Vespucio 26, 41092 Seville, Spain. Corresponding author: J. A. Leonard. E–mail: jleonard@ebd.csic.es ORCID ID: Jennifer A. Leonard: 0000-0003-0291-7819; Carlos Sarabia: 0000-0002-6980-3480; Isabel Salado: 0000-0002-8861-2436; Carles Vila: 0000-0002-4206-5246 ISSN: 1578–665 X eISSN: 2014–928 X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
Sarabia et al.
272
Introduction Feces are a very useful source of information to study free–ranging animals. They can be used to study many aspects of their ecology such as dietary habits, scent marks, parasite loads, hormonal levels, hunting ranges and distribution, and importantly, yield DNA. Fecal DNA offers a special insight into rare or endangered species and is noninvasive, so it has become increasingly used for ecological studies. Fecal DNA has proved to be an effective method to track animals in the wild (Harrison et al., 2006; Janečka et al., 2011), and it has helped understand complex patterns of population structure (Paetkau et al., 1995; Muñoz–Fuentes et al., 2009; Ruiz–Gonzalez et al., 2015; Norman et al., 2017), estimate population sizes (Taberlet, 1996; Kohn et al., 1999; Harrison et al., 2006; Pérez et al., 2014), detect criptic, endangered or elusive species in the wild (Harrison et al., 2006; Karmacharya et al., 2011; Pérez et al., 2014; Laguardia et al., 2015; Gil–Sánchez et al., 2017), and even has helped to describe complex behavioral patterns (Bischof et al., 2016; Forcina et al., 2019). The results of fecal DNA studies can also help assess and evaluate conservation or management policies (Echegaray and Vilà, 2010; Åkesson et al., 2016). However, feces are a sub–optimal source of DNA for molecular analyses as they are not widely suitable for genomic studies, with few reports of success (Perry et al., 2010). There are three main challenges for the use of feces as a source of genetic material: presence of polymerase chain reaction (PCR) inhibitors, low amount of endogenous DNA, and DNA degradation and fragmentation. PCR inhibitors can be chemical compounds originating in the food, the digestive track, or the environment after deposition (Wilson, 1997; Monteiro et al., 1997; Rådström et al., 2004; Broquet et al., 2007; Panasci et al., 2011). As a result, the inhibitors vary between species and habitats. There is a low amount of endogenous DNA that comes from the cells swept away by the outer layer of the feces on their transit through the digestive track (Taberlet, 1996), which is normally less than the amount of micro–organismal DNA. Finally, environmental conditions, chemical compounds, and microorganisms can fragment and degrade DNA decreasing the likelihood of amplification through PCR (Deagle et al., 2006; Brinkman et al., 2010; Panasci et al., 2011; Demay et al., 2013; Roques et al., 2014; Agetsuma–Yanagihara et al., 2017). Such processes can lead to PCR failure, allelic dropout (failure to amplify one of two alleles), and/or false alleles (Taberlet, 1996; Miller et al., 2002; Broquet & Petit, 2004; Panasci et al., 2011). To overcome these problems, a number of studies have optimized protocols to sample, extract and amplify DNA from feces (Paetkau et al., 1995; Taberlet, 1996; Frantz et al., 2003; Miquel et al., 2006; Ramón–Laca et al., 2015). However, these methods tend to be labor intensive and are not conducive to high throughput projects. Today the field of molecular ecology has extensively incorporated high throughput technologies to address a wide variety of research questions. One notable exception is the analysis of microsatellites. Despite
the increasing popularity of SNP studies in natural populations, the high polymorphism of microsatellite markers imply that many fewer markers are needed for individual and population assessment, which is of great importance when working with fecal samples of low quality and with small amounts of DNA. However, high throughput technologies have not been fully implemented in microsatellite studies of noninvasive samples, which continues to be very labor–intensive. The potential to simultaneously analyze large numbers of markers from fecal samples could have a dramatic impact on noninvasive studies. There are multiple protocols in field sampling and laboratory analyses that could potentially be optimized to make them more compatible with high throughput analyses. An early step has been taken to optimize field collection of fecal samples for DNA analyses by Ramón–Laca et al. (2015), and their suggestion to field sample feces with swabs could streamline lab analyses by reducing the labor of preparing the samples for digestion. DNA extraction is also a key step to optimize for high throughput, for example by robotization. We tested field and lab (DNA extraction) methods that could be scaled up to make the analyses of fecal samples for molecular ecology studies more feasible for high throughput studies. We used carnivore feces (from gray wolves, Canis lupus) to evaluate the field sampling method proposed by Ramón–Laca et al. (2015) against the more traditional approach of conserving fecal fragments in 70 % ethanol (EtOH). Once established which field sampling method(s) yielded acceptable results, we also compared seven methods for DNA extraction and purification. We evaluated these methods of extraction by assessing the PCR and genotyping success with a multiplex amplification of eight autosomal plus two Y–chromosome microsatellite loci typed using Next Generation Sequencing (NGS) approaches. We report the cost, in time and money, of each method, estimate the number of replicates necessary to overcome uncertainties due to dropout and false alleles, and discuss their potential for high–throughput projects including adaptation for robotization. Methods Evaluation of field sampling methods We first evaluated the relative performance of two field sampling protocols. Eight Iberian gray wolf feces were collected in Asturias, Northern Spain. In the field, we cut each scat in half and preserved one half in a 50–ml Falcon tube with 70 % ethanol, while we swabbed the surface of the other half in situ following Ramón–Laca et al. (2015) and preserved the swabs in ca. 400 μl of Longmire's lysis buffer (Longmire et al., 1997). Samples were kept at –20 ºC until DNA extraction. DNA from both swabs and ethanol–conserved fecal fragments was extracted using two different extraction methods: 1) using a QIAamp DNA Stool Kit (Qiagen, Hilden, Germany; 'extraction method 1' or EM1), which performs a silica membrane–based DNA purification of samples with high concentrations of PCR inhibitors;
Animal Biodiversity and Conservation 43.2 (2020)
and 2) an adapted solid phase–reversible immobilization (SPRI) beads–based purification method as in Rohland and Reich (2012), following digestion with proteinase K ('extraction method 2' or EM2). For each scat, we carried out two DNA extractions from the fecal fragment with each method and one from the fecal swab due to low amount of material, resulting in six DNA extractions for each scat. For the DNA extraction using the QIAamp DNA Stool Kit (EM1) we followed the manufacturer's protocol 'Isolation of DNA from Stool for Human DNA Analysis' for the fecal fragments. Fecal swabs were drained and 150 μl of the lysis buffer was used for DNA extraction. The SPRI–based DNA extraction method (EM2) was carried out as follows. For the ethanol–preserved fecal fragments, 120 mg of dry fecal sample was added to 1200 μl Longmire's lysis buffer in a 1.5 ml Eppendorf tube. These digests were homogeneized by vortex, incubated at room temperature for 10', and centrifuged for 1' at full speed. Supernatant (about 850 μl) was transferred to a new tube. In the case of fecal swabs, 700 μl of Longmire's lysis buffer were added to 150 μl of buffer from the tube with the swab. Proteinase K (500 μg) was added to each digest, and tubes were briefly vortexed and then incubated for 10' at 70 ºC. Digests were purified with MagBeads ® as in Rohland and Reich (2012). Beads were washed twice with EtOH at 80 % and DNA was eluted as in Meyer and Kircher (2010, see 'Reaction Clean–Up Using Solid Phase Reversible Immobilization, SPRI'). All DNA extractions were performed in an isolated lab dedicated to low quality DNA. Before starting lab work, all surfaces were UV–treated for 20' and cleaned with a bleach solution. Filter–tips and isolation suits were also used. All batches of DNA extractions included negative controls. Four PCRs were done for each DNA extract and negative. Each multiplex PCR reaction contained tailed primers for eight autosomal and two Y–chromosome microsatellites (table 1). Tails on the 5' end were 5'–TCTTTCCCTACACGACGCTCTTCCGATCT for forward and 5'–GAGTTCAGACGTGTGCTCTTCCGATCT for reverse primers. We used Phusion® High– Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA) following manufacturer's specifications: 1X Multiplex Phusion® MasterMix, 10–plex primer mix (0.05 μM per primer), bovine serum albumin (BSA) (200 μM), 2 μl of DNA extract to a final volume of 25 μl. We used the following touchdown PCR program for all multiplex reactions: initial denaturation at 98 ºC for 30''; 10 cycles of 98ºC for 10', 58 ºC for 30'' (decreasing 0.5 ºC per cycle), and 72 ºC for 30''; 20 cycles of 98 ºC for 10'', 53 ºC for 30'' and 72 ºC for 30''; final extension of 10' at 72 ºC and a final heating up step of 95 ºC for 3' to avoid the formation of dimers. Products were checked on a 2 % agarose gel and visualized on a Gel Doc™ EZ Gel transiluminator (Bio Rad, Hercules, CA, USA). PCR products that showed amplification were used for subsequent steps. PCR products were purified using Sera Mag SPRI beads as in Meyer and Kircher (2010). Purified PCR products were dual indexed by PCR using a Kapa HiFi HotStart ReadyMix (2X) PCR kit for High Throughput Sequencing (Kapa Biosystems,
273
Haufmann–La Roche, Basel, Switzerland). PCR conditions were: 95 ºC for 30''; 25 cycles of 98 ºC for 20'', 60 ºC for 15'', and 72 ºC for 15''; a final extension time of 1' and a heating up step of 95 ºC for 3' before leaving it slowly cool down. PCR products were checked by agarose gel electrophoresis and concentration was estimated against a standard using ImageLab v5.2.1 of BioRad. Products from different reactions were pooled equimolar, cleaned and then sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA, USA). We defined PCR success as the proportion of those multiplex PCRs that provided suitable amplification bands in agarose for subsequent high–throughput sequencing. Multilocus genotypes were constructed for each PCR product in Geneious v11.0.5 (Kearse et al., 2012). However, not all PCRs with bands could be successfully genotyped for all loci. We estimated the proportion of locus dropout as the proportion of loci that in successful PCR amplifications (with clear band) either failed to be sequenced or provided sequences that did not correspond to the targeted microsatellite (fig. 1, 2). The genotypes obtained were compared to the consensus genotypes obtained for all amplifications (consensus genotypes generated as in the multi–tube approach; Taberlet, 1996). These comparisons allowed the identification of false alleles and allelic dropout. False allele rate was defined as the proportion of genotypes with false alleles and allelic dropout rate was defined as the proportion of genotypes that failed to amplify one of the alleles in heterozygous loci (Taberlet, 1996; Creel et al., 2003; Broquet and Petit, 2004). False allele and allelic dropout rates were calculated using equations 2 and 4 from Broquet and Petit (2004). Finally, we defined genotyping success as the proportion of autosomal genotypes that coincided with the consensus per total number of PCR attempts. We also calculated sexing success just for the Y–chromosome loci as the proportion of successful amplification and correct genotyping of Y–chromosome markers in samples deriving from males. Evaluating different extraction methods A high yield of DNA extracted from noninvasive samples has been reported based on chaotropic salts (such as sodium dodecyl sulfate, SDS; Goldenberger et al., 1995; Yu and Morrison 2004), cetyl trimethyl ammonium bromide (CTAB; Zhang et al., 2006), a mixture of phenol–chloroform–isoamyl alcohol (PCI; Sambrook et al., 1989; Goldenberger et al., 1995; Muñoz–Fuentes et al., 2009), and SPRI–beads (DeAngelis et al., 1995; Meyer and Kircher, 2010). We aimed to find a cost–effective DNA extraction method by combining these procedures that could be automated for implementation in DNA extraction robots. In addition to the two methods described above (EM1 and EM2), we evaluated five additional extraction methods using the feces sampled in ethanol (see table 2 for a summary of extraction methods). Two extractions per method per sample were done, until the sample was exhausted.
Sarabia et al.
274
Table 1. Microsatellite loci and primers: name (Locus), Repeat motif, and Chromosome according to the original publication (reference, Ref: 1, Bannasch et al., 2005; 2, Francisco et al., 1996; 3, Jouquand et al., 2000; 4, Ostrander et al., 1993). For each microsatellite typed, sequences of forward (Fwd_primer) and reverse (Rev_primer) primers are indicated (5'–3'): PIC, polymorphic information content from the original publication. Tabla 1. Loci y cebadores de los microsatélites: nombre ("Locus"), secuencia repetida ("Repeat motif") y cromosoma, según la publicación original (referencia, Ref: 1, Bannasch et al., 2005; 2, Francisco et al., 1996; 3, Jouquand et al., 2000; 4, Ostrander et al., 1993). Para cada microsatélite genotipado, se indican las secuencias de los cebadores ("Fwd_primer", "Rev_primer") (5'–3'): PIC, contenido de información del polimorfismo según la publicación original.
Fwd_primer
Locus
Rev_primer
Repeat motif
650–79.3
(CA)n
Chromosome
Y–chromosome AGTTTCTGCCCAGGAAGGAC
990–35
(GT)n
PIC
Ref 1
AGCTGAGCGGTTTGAAACTT
Y–chromosome CCATCCGCAGAACAGGTATT 1
GGGCCGCTATTTTAGGTGAT c2096
(GAAT)n
Autosomal
CCGTCTAAGAGCCTCCCAG 0.37 2
GACAAGGTTTCCTGGTTCCA Ren37H09
(GT)n
Autosomal
ATTCCCTTGTATTGCTCAC
0.67 3
CCCAAAAAATCCAACCA Ren49F22
(CA)n
Autosomal
GGGGCTCTGTTATTAGGTG 0.66 3
TCATAAGGCAAAGAAAACC u109
(A)7(T)7(CA)n Autosomal AACTTTAAGCCACACTTCTGCA 0.42 4
ACTTGCCTCTGGCTTTTAAGC u173
(TG)n
Autosomal
ATCCAGGTCTGGAATACCCC 0.78 4
TCCTTTGAATTAGCACTTGGC u225
(GT)n
Autosomal AGCGACTATTATATGCCAGCG 0.46 4
CTCATTGGTGTAAAGTGGCG u250
(AC)nA2(TC)m Autosomal TTAGTTAACCCAGCTCCCCCA 0.75 4
TCACCCTGTTAGCTGCTCAA u253
(AC)nAT(AC)m Autosomal AATGGCAGGATTTTCTTTTGC 0.52 4
ATCTTTGGACGAATGGATAAGG
Extraction method 3 (EM3) Small samples (100 mg) of feces were sampled from the EtOH–conserved fecal fragments, dried, and digested in 900 μl of CTAB buffer as in Vallet et al. (2008), but adding 750 mg of proteinase K to the original CTAB buffer. Digestions were vortexed briefly and incubated in a shaker at 60 ºC for 1 hour in 2 ml tubes. Supernatant of the digestion was extracted with 1 ml phenol–chloroform–isoamyl alcohol (25:24:1) (Sambrook et al., 1989) and further purified with SPRI beads following DeAngelis et al. (1995), but using the same bead buffer as in EM2. For each volume of supernatant, twice the volume of SPRI bead buffer was used. Particles were washed twice with 1.8 ml of 80 % EtOH and air dried for 4' before elution in 50 μl TLE buffer.
Extraction method 4 (EM4) This protocol was identical to EM3, but instead of using a CTAB digestion buffer, a SDS digestion buffer was used as in Goldenberger et al. (1995), with the following composition: SDS 1 %, Tris–HCl 100 mM, Ethylenediaminetetraacetic acid (EDTA) 20 mM, NaCl 10 mM, Proteinase K 0.8 mg/μl. Extraction method 5 (EM5) This protocol was identical to EM3, but instead of using a CTAB digestion buffer, a CTAB+SDS digestion buffer was used with the following composition: CTAB 10 g/l (1 % w/w), SDS 1 %, Tris–HCl 100 mM, EDTA 20 mM, NaCl 1.4 M, Proteinase K 0.8 mg/μl. These proportions were optimized to ensure homogenization and solubilization of all reactants, avoiding the formation of too much foam.
Animal Biodiversity and Conservation 43.2 (2020)
Sequence lengths for 8 nucleotide sequences
5 Number of sequences
275
4 3 2 1 0
0
20
40
60
80 100 120 140 160 180 200 210 Sequences length
Fig. 1. Example of a locus from a successful multiplex PCR that did not yield an identifiable genotype due to insufficient number of reads, as identified in Geneious v11.0.5 (locus dropout).
Number of sequences
Fig. 1. Ejemplo de un locus obtenido a partir de una PCR múltiple exitosa que no produjo ningún genotipo identificable debido al número insuficiente de lecturas, determinado mediante Geneious v11.0.5 (locus nulo).
3,800 3,600 3,400 3,200 3,000 2,800 2,600 2,400 2,200 2,000 1,800 1,600 1,400 1,200 1,000 800 600 400 200 0
Sequence lengths for 7,392 nucleotide sequences
0
20
40
60
80 100 120 140 160 180 200 220 240 260 280 Sequences length
Fig. 2. Example of a locus from a successful multiplex PCR that did not yield an identifiable genotype due to unspecific amplification of spurious fragments and background noise, as identified in Geneious v11.0.5 (locus dropout). Fig. 2. Ejemplo de un locus obtenido a partir de una PCR múltiple exitosa que no produjo ningún genotipo identificable debido a la amplificación inespecífica de fragmentos mal purificados y ruido de fondo, determinado mediante Geneious v11.0.5 (locus nulo).
Extraction method 6 (EM6) This protocol was identical to EM3, but after the 60' at 60 ºC in the thermoshaker, an additional centrifugation of 30' at maximum speed (14,000 rpm) was done. The supernatant, ap-
proximately 600 μl, was carefully transferred to a new tube, leaving behind the pellet of tissue debris. DNA was subsequently extracted with SPRI beads as in protocol EM3, except DNA was eluted in double–distilled water.
Sarabia et al.
276
Table 2. Summary of extraction methods: extractions of DNA were performed from fragments of wolf feces preserved in ethanol and air dried. Seven approaches were tested varying digestion buffer, DNA separation and purification. (For abbreviations and protocol details, see text). Tabla 2. Resumen de los métodos de extracción: la extracción de ADN se realizó a partir de fragmentos de heces de lobo conservadas en etanol y secadas al aire. Se probaron siete métodos cambiando la solución de digestión y los protocolos para la separación y purificación del ADN. (Véase el texto para las abreviaciones y los detalles de los protocolos).
Extraction methods
Sample amount Digestion
DNA isolation DNA purification
EM1
QIAmp
180 mg
QIAmp Kit
EM2
SPRI beads
120 mg
Longmire buffer +
SPRI beads +
+ proteinase K
+ double EtOH 80 % wash
EM3
CTAB + PCI +
CTAB buffer
+ beads
EM4
SDS+PCI+
Beads
+ double EtOH 80 % wash
EM5
CTAB + SDS +
SPRI beads +
+ PCI + beads
buffer
EM6
CTAB + beads
CTAB buffer
100–120 mg 100–120 mg 100–120 mg 100–120 mg
PCI
PCI PCI
CTAB + SDS +
PCI
+ double EtOH 80 % wash
EM7
CTAB + beads + 100–120 mg
+ reactivation
Extraction method 7 (EM7) This protocol was identical to EM6, but with an additional step of bead reactivation with the same buffer as in protocol EM3 at the beginning of the DNA purification with SPRI beads. For EM1–EM5, each extraction method was performed twice on each scat. Four PCRs were made for each extract, yielding eight PCR replicates per extraction method and scat. Due to lack of sample at the end of the experiment, methods EM6 and EM7 were only carried out once. EM6 and EM7 did not include a step of phase separation using phenol:chloroform:isoamyl alcohol and therefore had a higher chance to be ineffective at separating DNA from polysaccharides (Zhang et al., 2006), which are likely to act as PCR inhibitors (Monteiro et al., 1997; Schrader et al., 2012). A moderate level of dilution is often recommended to diminish the effect and concentration of PCR inhibitors from environmental samples (Wang et al., 2017), so we hypothesized that a second elution could improve genotyping success. Consequently, for EM6 and EM7 we tested two elutions. We carried out six PCR replicates on each elution. We estimated amplification success, locus dropout, false alleles, allelic dropout, and sexing success. We assessed the effect of extraction method on the genotyping success through generalized linear mixed model (GLMM) with a binomial distribution and using the function glmer from the lme4 package (Bates et al., 2015) in R (R version 3.5.2). The extraction method,
SPRI beads +
Centrifugation SPRI beads +
CTAB buffer
SPRI beads + + double EtOH 80 % wash
+ double EtOH 80 % wash
Centrifugation SPRI beads + reactivation + + double EtOH 80 % wash
locus and extract were included as fixed effects while feces were considered as random effect. Assumptions for normality and homocedasticity of residuals were checked graphically. We evaluated the model’s goodness of fit and the explained variance by fixed and random effects in the model through pseudo–R2 statistics using the function r.squaredGLMM from the MuMIn package in R (Barton, 2019). The significance of each variable was tested using a Chi–squared test with drop1 function from lme4, comparing the likelihood of the full model without the variable of interest. The model with the highest likelihood value was selected as the most parsimonious model. We also performed pairwise comparisons with Tukey's post hoc test among extraction methods using emmeans package (Lenth, 2018). We estimated the number of amplifications needed to ensure a correct genotype with a probability of 0.99 as in Le Gouar et al. (2009) and Forcina et al. (2019; calculations based on Navidi et al., 1992; Taberlet, 1996; Taberlet and Luikart, 1999), using an Excel spreadsheet kindly provided by Giovanni Forcina and Pascaline Le Gouar. Results Evaluation of field sampling methods The performance of the two field sampling methods was evaluated by PCR amplification success using
Animal Biodiversity and Conservation 43.2 (2020)
277
Table 3. Evaluation of field sampling techniques: extraction methods (EM) are described in the text; PCR success refers to the proportion of multiplex PCR reactions that produced an amplification band visible in agarose gel from eight different samples; locus dropout (LD), proportion of loci that did not amplify in otherwise successful multiplex amplifications; false alleles (FA), proportion of alleles called that were not true alleles; allelic dropout (AD), proportion of heterozygote alleles that did not amplify; sexing success (SS), rate of successful genotyping of Y–chromosome markers in males; genotyping success (GS), proportion of PCR amplifications that provide the correct genotype. Tabla 3. Evaluación de las técnicas de muestreo de campo: los métodos de extracción (EM) se describen en el texto; "PCR success" se refiere a la proporción de reacciones de PCR múltiple que produjeron una banda de amplificación visible en gel de agarosa a partir de ocho muestras diferentes; "locus dropout" (LD) es la proporción de loci que no se amplificaron en reacciones de PCR multi–locus exitosas; "false alleles" (FA) es la proporción de alelos identificados que no son reales; "allelic dropout" (AD), proporción de alelos en heterocigosis que no se amplificaron; "sexing success" (SS), tasa de eficacia del genotipado de marcadores del cromosoma Y en machos; "genotyping success" (GS), proporción de reacciones de PCR que generaron el genotipo correcto. Field sampling techniques
EM
PCR success
LD
FA
AD
SS
GS
Fragment in 70 % EtOH
EM1
80 % (51/64)
0.11
0.06
0.11
0.58
0.61
Fragment in 70 % EtOH
EM2
10 % (6/60)
0.25
0.08
0.07
0.10
0.06
Swab + Longmire's buffer
EM1
31 % (10/32)
0.13
0.06
0.08
0.26
0.24
Swab + Longmire's buffer
EM2
28 % (9/32)
0.14
0.16
0.15
0.23
0.18
two extraction methods. Sampling fragments of feces followed by DNA extraction using the Qiagen kit (EM1) yielded the highest rate of PCR success (80 %, table 3), but the same field sampling method had the lowest rate of PCR success (10 %) when DNA was extracted with beads (EM2). For those reactions that resulted in multilocus PCR amplification, frequently not all of the loci amplified. For each method, locus dropout ranged from 11–25 % per reaction, and was lowest for the fecal fragment extracted with EM1, and highest when the same sample type was extracted with EM2. Interestingly, false alleles were also lowest when extracting with EM1 for both field sampling methods (6 %). Allelic dropout was highest with swabs extracted with EM2. The overall genotyping success rate, measured as the proportion of loci per PCR replicate that matched the consensus genotype, was highest for fecal fragments extracted with EM1 (61 % for autosomal loci, 58 % for Y–chromosome loci in males). However, the same sampling method had the lowest success rate if extracted with EM2 (6 %). Overall the best performance was obtained for fecal fragments preserved in ethanol and extracted with EM1. Given the potentially higher performance of sampling fecal fragments instead of swabs, all tests of extraction protocols were carried out on DNA extracts generated from fragments from feces preserved in ethanol. Evaluation of extraction protocols To test for replicability, we carried out a glmm with the model 'Genotyping success ~ Extraction method + Locus + Extract + Feces (random effect)' to assess
the contribution of the extraction replicate to the total variance in genotyping success, where 'Locus' refers to the identity of the microsatellite loci, 'Feces' refers to the identity of the fecal sample and Extract refers to the extraction replicate. 'Extraction method' (likelihood ratio test LRT = 287.34, p < 0.001, N = 536) and 'Locus' (LRT = 391.22, p < 0.001) had significant effects whereas 'Extract' did not (LRT = 0.05, p = 0.831). In addition, pseudo–R2 of the different models showed that the extract replicate ('Extract') did not contribute to the total variance of the model (table 4). Thus, the results of the two extraction replicates were pooled for comparisons. The simplest model was 'Genotyping success ~ Extraction method + Locus + Feces (random effect)'. This implies that although all feces were collected at the same time, their individual conditions had an important impact on the final genotyping success and that DNA extraction replicates produced very similar results. Thus, replicates to reduce allelic dropout and false alleles (see below) do not need to be carried out on different DNA extracts but should focus on replicating PCRs. Similarly, different markers showed very large differences in genotyping success, and the genotyping success was clearly different between extraction methods. Post–hoc comparisons showed pairwise differences among extraction methods. EM2, EM6 and EM7 were the worst extraction methods in comparison to EM1, EM3, EM4, EM5. Although the QIAmp kit (EM1) is widely used (Creel et al., 2003; Panasci et al., 2011; Pérez et al., 2014; Ramón–Laca et al., 2015), it led to slightly worse amplification success rate than some other methods (77 % PCR amplification success for EM1 vs. 100 %
Sarabia et al.
278
Table 4. Variance explained by the models using pseudo–R2 statistics of generalized mixed models: R2 GLMM(m), marginal component of R2 value show variability explained by fixed effects ('Method', 'Locus', 'Extract'); R2GLMM(c), conditional R2 value show variability explained by fixed effects plus the random effects ('Feces'); GS, genotyping success. (N = 536, number of observations for all models). Tabla 4. Varianza explicada por los modelos según estadísticos pseudo–R2 de modelos mixtos generalizados: R2 GLMM(m), componente marginal de R2 que muestra la variabilidad explicada por los efectos fijos ("Method", "Locus", "Extract"); R2GLMM(c), componente condicional de R2 que muestra la variabilidad explicada por los efectos fijos más los efectos aleatorios ("Feces"); GS, eficacia del genotipado. (N = 536, número de observaciones de todos los modelos).
Models R2GLMM(m) R2GLMM(c)
GS ~ Feces
0.00
0.07
GS ~ Method + Feces
0.12
0.20
GS ~ Method+Locus + Feces
0.32
0.40
GS ~ Method + Locus + Extract + Feces
0.32
0.40
PCR amplification success for EM3, EM4, EM5, EM6 and EM7, table 4). However, the lowest locus dropout rate was observed in EM1. Genotyping success was highest for EM4 and EM5 (65 % and 63 %, respectively) although it was not very much higher than for EM1 (60 %). EM4 and EM5 involved the use of SDS in the digestion buffer and a one hour digestion at 60 ºC followed by a phenol–chloroform–isoamyl DNA isolation. EM6 and EM7 had in general lower performance than all other methods (table 5). The performance was clearly worse for the second elutions of EM6 and EM7, but diluting the extract resulted in a reduction of false alleles, although the proportion of allelic dropout became higher. Replication requirements We estimated the number of replicates needed to generate reliable consensus in homozygotes with a probability of 0.99. While heterozygote genotypes are usually confirmed with at least two independent replicates of the genotype, homozygotes required several replicates depending on the rate of false alleles and allelic dropout (table 5). A minimum of three replicates were sufficient for EM3, EM4 and EM5. EM2 performed much worse than all other methods, due to the low PCR success rate and low genotyping success rate (table 5). However, these numbers do not take into account the rate of PCR success and locus dropout. If amplifications fail frequently, the number of replicates needs to be increased accordingly. Thus, dividing the number of replicates estimated for homozygous loci by the PCR success rate and by the proportion of amplification (1–locus dropout) for the locus with the 6th lowest locus dropout rate, we estimated the number of replicates needed to obtain reliable genotypes with a probability of 0.99 for 6 of the loci. The results showed a huge variation in the genotyping effort needed with the different methods
(table 6), ranging from four (for EM1, EM3, EM4 and EM5) to 40 PCR reactions needed. When a positive amplification of 7 out of 8 loci is required, the number of PCRs required increases in EM6 (to 100 replicates needed), while it remains constant for EM1, EM4 and EM5. Economic and time–consumption evaluation of extraction protocols Methods EM3, EM4 and EM5 were more time consuming due to the additional 1 hour digestion step and the phenol–chloroform extraction. Although slightly less time consuming, EM1 was the most expensive method, with all other methods considered being at least three times cheaper (table 6). Methods EM6 and EM7 were reasonably cheap and are more amenable to robotization, although a much higher number of PCR replicates was needed to obtain reliable results. Discussion In order to simplify field sampling methods and establish a reasonable protocol for high throughput DNA studies of noninvasive samples from carnivores, we tested both swabbing and feces fragment sampling. The field sampling method of taking a swab instead of a fragment, which could have made lab work much easier, was not successful because the swabs yielded much lower PCR success. The low performance obtained when genotyping swabs contrasts with the general results in Ramón–Laca et al. (2015). These authors observed a big difference in performance between the two approaches when analyzing herbivore feces. The high amount of polysaccharides in herbivore feces from the wall of plant cells acts as a well–characterized PCR inhibitor (Monteiro et al., 1997; Rådström et al., 2004, Ramón–Laca et al., 2015), a less prevalent
Animal Biodiversity and Conservation 43.2 (2020)
279
Table 5. Evaluation of performance of seven DNA extraction methods: extraction methods (EM) as in the text and summarized in table 2 from seven different samples; second elution indicates DNA extracts that were subject to an additional elution to decrease the concentration of potential inhibitors. PCR success, locus dropout (LD), false alleles (FA), allelic dropout (AD), sexing success (SS) and genotyping success (GS) as described in table 3. Tabla 5. Evaluación del rendimiento de siete métodos de extracción de ADN: los métodos de extracción (EM) de siete muestras diferentes son los descritos en el texto y resumidos en la tabla 2. La segunda elución indica los extractos de ADN que se sometieron a una elución adicional para reducir la concentración de posibles inhibidores. Eficacia de la PCR ("PCR success"), loci nulos (LD), falsos alelos (FA), alelos nulos (AD), eficacia del sexado (SS) y eficacia del genotipado (GS), descritos en la tabla 3.
Extraction method
Elution
PCR success
LD
FA
AD
SS
GS
EM1
QIAmp
1st
77 % (43/56)
0.08
0.06
0.12
0.58
0.60
EM2
SPRI beads
1st
11 % (6/56)
0.25
0.08
0.07
0.11
0.07
EM3
CTAB + PCI + beads
1st
100 % (52/52)
0.30
0.10
0.12
0.61
0.58
EM4
SDS + PCI + beads
1st
100 % (52/52)
0.25
0.09
0.06
0.67
0.65
EM5
CTAB/SDS + PCI +
1st
100 % (52/52)
0.25
0.09
0.10
0.64
0.63
+ beads
EM6
CTAB + beads
1st
100 % (42/42)
0.67
0.20
0.18
0.48
0.24
2nd
71 % (30/42)
0.70
0.14
0.29
0.22
0.14
EM7
CTAB + beads +
1st
100 % (42/42)
0.58
0.16
0.13
0.46
0.30
+ reactivation
2nd
71 % (30/42)
0.70
0.13
0.24
0.24
0.15
problem in carnivore feces, and this may explain the difference in success between carnivore and herbivore feces. Previous studies have already addressed how dietary habits influence the quality and quantity of DNA extracted with the same method, thereby showing how important it is to define an appropriate field sampling strategy and DNA extraction method for each particular project (Miquel et al., 2006; Ramón–Laca et al., 2015). For carnivores, we recommend to continue using the more traditional field sampling strategy of taking feces fragments. Running a preliminary test on different field sampling methods for fecal DNA extraction in a target species might be advisable before starting a noninvasive monitoring study. Apart from sampling strategies, different DNA extraction protocols produce very variable results. We saw a higher performance in PCR success, sexing success and genotyping success in SDS–based methods than in all other methods. PCI was generally a good strategy for DNA separation, and although in the literature CTAB –PCI is often referred to as a good method to remove polysaccharides that could inhibit PCR amplification (Zhang et al., 2006; Vallet et al., 2008), we observed a better performance when SDS was present in the digestion buffer. SDS is a key component of the Longmire's 'lysis buffer' (Longmire et al., 1997), works very well for cell lysis (Zhang et al., 2006; Chandra De et al., 2015), and is the basis of a very well–established method for protein purification and molecular weight estimation (Shapiro and Vinuela, 1967; Weber and Osborn, 1969). It seems likely that
the higher performance of method EM5 arose from a combination of the polysaccharide elimination activity of CTAB coupled from the cell lysis activity of SDS. However, EM4 performed slightly better than EM5, resulting in a lower allelic dropout. We also observed that SPRI beads–based methods (EM2, EM6, EM7) could not compete with matrix–based or PCI–based DNA methods for locus dropout, false alleles, allelic dropout or genotyping success. This suggests that a high number of PCR inhibitors cannot be separated from the DNA easily by centrifugation, even after using a well–established digestion buffer such as CTAB. An additional step of DNA isolation or separation remains necessary to ensure that enough inhibitors are removed in carnivore feces. The main reason why a second elution was attempted with EM6 and EM7 was the high probability of finding PCR inhibitors that could not easily be separated from the DNA, inhibitors that could be extracted if a matrix–based or PCI–based method were used. However, using a second elution also dilutes DNA extracts. Although diluting can have a positive effect by reducing the concentration of inhibitors (Monteiro et al., 1997) it also reduces the concentration of available DNA for analysis, increasing allelic dropout (Taberlet, 1996). This effect can be seen in table 3: allelic dropout rates were double for second elutes of EM6 and EM7 than for first elutes, but false alleles were reduced by half. False alleles are normally produced by incomplete addition of extra adenine residues at the 3' end of amplified fragments or slippage in the first steps of PCR (Pompanon et al.,
Sarabia et al.
280
Table 6. Evaluation of time and economic costs and number of replicates required by the different DNA extraction protocols, extraction methods are described in the text and summarized in table 2: Time, time needed to process one batch of eight samples; Cost, the price per sample in Euros in spring 2019; Replicates (4/8), number of PCR replicates required to establish a correct genotype at four out of eight loci; Replicates (6/8), number of PCR replicates required to obtain a correct genotype at six out of eight loci; and Replicates (7/8), number of PCR replicates required to ensure a correct genotype at seven out of eight loci. Number of replicates needed to achieve a correct consensus genotype with a 99 % probability was calculated for homozygous loci following Le Gouar et al. (2009), taking into account the PCR success rate from table 5: a 1 h for reagents of the digestion buffer to dissolve included; b 1 h of digestion at 60 ºC included; c 1 h of digestion and 30' centrifugation at maximum speed included. Tabla 6. Evaluación del tiempo, costos económicos y número de repeticiones necesarias para los diferentes protocolos de extracción de ADN descritos en el texto y resumidos en la tabla 2: "Time", tiempo necesario para procesar un lote de ocho muestras; "Cost", precio en euros por muestra, en la primavera de 2019; "Replicates (4/8)", número de repeticiones de la PCR necesarias para obtener un genotipo correcto en cuatro de ocho loci; "Replicates (6/8)", número de repeticiones de la PCR necesarias para obtener un genotipo correcto en seis de ocho loci; y "Replicates (7/8)", número de repeticiones de la PCR necesarias para obtener un genotipo correcto en siete de ocho loci. El número de repeticiones necesarias para obtener un genotipo correcto consensuado con una probabilidad del 99 % se calculó en loci en homocigosis según Le Gouar et al. (2009) y teniendo en cuenta el grado de eficacia de la PCR indicado en la tabla 5: a se incluye 1 h para que los reactivos de la solución de digestión se disuelvan; b se incluye 1 h de digestión a 60 ºC; c se incluye 1 h de digestión y 30 min. de centrifugación a velocidad máxima.
EM Time Cost
Replicate Replicate Replicate (4/8) (6/8) (7/8)
EM1
3 h
5.78
4
4
4
EM2
3 h
EM3
5 h 30'
EM4
6 h
1.39
23
46
46
EM5
5 h 50'
1.82
EM6 EM7
4
5
4
4
3
4
4
3 h 30' 1.64
5
40
100
3 h 45' 1.64
4
20
20
a,b
a,b
1.82
3
1.8 3
a,b c c
2005), factors that can be increased by the presence of PCR inhibitors in the extract. The observation that bead based extraction methods EM2, EM6 and EM7 yielded a much lower genotyping success makes automatized DNA extraction much more difficult. The potential for robotization of DNA extraction has already been described and equipment such as QIAcube (Qiagen, Hilden, Germany) has been suggested for these tasks (Ramón–Laca et al., 2015). Our work shows that for fecal extractions a step of matrix– or PCI–based DNA isolation is still needed, a process that remains time consuming. Both of these methods (PCI and silica) require centrifugation, which is not compatible with standard lab robots. However, protocols that do not require a delicate phase separation (as in PCI) do have the potential to be adapted to lower volumes and done in 96 well plates, which could dramatically increase throughput. In the recent past this would not yield sufficient material to genotype
a reasonable number of loci, but if loci are genotyped by NGS, many loci can be multiplexed in few reactions reducing the amount of extract necessary for a study. Finally, while DNA extraction with the QIAmp kit (EM1) is widely used in literature, methods EM3, EM4 and EM5 require a similar effort in terms of PCR replicates that need to be attempted (table 6) and are three times cheaper. Thus, they are suitable substitutes for the QIAmp kit for labs and projects handling a large number of fecal samples and/or limited budgets. In terms of ecological impact all three methods produce hazardous waste. QIAmp kit includes guanidinium thiocyanate, while EM4 and EM5 (and EM3 although with a slightly lower performance) involve the use of phenol:chloroform:isoamyl alcohol. All these chemicals need to be handed in fume hoods and disposed of carefully. Cleaner and safer extraction methods still need to be developed to ensure low impact on health and environment.
Animal Biodiversity and Conservation 43.2 (2020)
Acknowledgements We are grateful to A. Pires, P. Le Gouar, G. Forcina, P. Johnson and C. Miquel for their assistance in the analyses. Logistical support was provided by Laboratorio de Ecología Molecular (LEM–EBD) and by the infrastructure provided by Doñana’s Singular Scientific–Technical Infrastructure (ICTS–EBD). This project was funded by a Frontera grant P18–FR–5099 from the Junta de Andalucia. C. Sarabia was supported by a PhD fellowship from the Programa Internacional de Becas 'La Caixa–Severo Ochoa' of the Spanish Ministerio de Economía y Competitividad and La Caixa bank (BES–2015–074331). References Åkesson, M., Liberg, O., Sand, H., Wabakken, P., Bensch, S., Flagstad, Ø., 2016. Genetic rescue in a severely inbred wolf population. Molecular Ecology, 25(19): 4745–4756, https://doi.org/10.1111/ mec.13797 Agetsuma–Yanagihara, Y., Inoue, E., Agetsuma, N., 2017. Effects of time and environmental conditions on the quality of DNA extracted from fecal samples for genotyping of wild deer in a warm temperate broad–leaved forest. Mammal Research, 62(2): 201–207, https://doi.org/10.1007/s13364-0160305-x Bannasch, D. L., Bannasch, M. J., Ryun, J. R., Famula, T. R., Pedersen, N. C., 2005. Y chromosome analysis in purebred dogs. Mammal Genome 16: 273–280. Barton, K., 2019. MuMIn: Multi–Model Inference. R package version 1.43.6. https://cran.r-project.org/ web/packages/MuMIn/index.html Bates, D., Maechler, M., Bolker, B., Walker, S., 2015. Fitting linear mixed–effects models using lme4. Journal of Statistical Software, 67(1): 1–48, https:// doi:10.18637/jss.v067.i01. Bischof, R., Gregersen, E. R., Brøseth, H., Ellegren, H., Flagstad, Ø., 2016. Noninvasive genetic sampling reveals intrasex territoriality in wolverines. Ecology and Evolution, 6(5): 1527–1536, https:// doi.org/10.1002/ece3.1983 Brinkman, T. J., Schwartz, M. K., Person, D. K., Pilgrim, K. L., Hundertmark, K. J., 2010. Effects of time and rainfall on PCR success using DNA extracted from deer fecal pellets. Conservation Genetics, 11(4): 1547–1552, https://doi.org/10.1007/ s10592-009-9928-7 Broquet, T., Petit, E., 2004. Quantifying genotyping errors in noninvasive population genetics. Molecular Ecology, 13(11): 3601–3608, https://doi. org/10.1111/j.1365-294X.2004.02352.x Broquet, T., Ménard, N., Petit, E., 2007. Noninvasive population genetics: A review of sample source, diet, fragment length and microsatellite motif effects on amplification success and genotyping error rates. Conservation Genetics, 8(1): 249–260, https:// doi.org/10.1007/s10592-006-9146-5 Chandra De, B., Patra, M. C., Kumar, S., Brahma, B., Goutam, D., Jaiswal, L., Sharma, A., De, S.,
281
2015. Noninvasive method of DNA isolation from fecal epithelial tissue of dairy animals. Animal Biotechnology, 26(3): 211–216, https://doi.org/10. 1080/10495398.2014.989325 Creel, S., Spong, G., Sands, J. L., Rotella, J., Zeigle, J., Joe, L., Murphy, K. M., Smith, D., 2003. Population size estimation in Yellowstone wolves with error–prone noninvasive microsatellite genotypes. Molecular Ecology, 12(7): 2003–2009, https://doi. org/10.1046/j.1365-294X.2003.01868.x Deagle, B. E., Eveson, J. P., Jarman, S. N., 2006. Quantification of damage in DNA recovered from highly degraded samples –a case study on DNA in faeces. Frontiers in Zoology, 3: 11, https://doi. org/10.1186/1742-9994-3-11 DeAngelis, M. M., Wang, D. G., Hawkins, T. L., 1995. Solid–phase reversible immobilization for the isolation of PCR products. Nucleic Acids Research, 23(22): 4742–4743, https://doi.org/10.1093/ nar/23.22.4742 Demay, S. M., Becker, P. A., Eidson, C. A., Rachlow, J. L., Johnson, T. R., Waits, L. P., 2013. Evaluating DNA degradation rates in faecal pellets of the endangered pygmy rabbit. Molecular Ecology Resources, 13(4): 654–662, https://doi. org/10.1111/1755-0998.12104 Echegaray, J., Vilà, C., 2010. Noninvasive monitoring of wolves at the edge of their distribution and the cost of their conservation. Animal Conservation, 13(2): 157–161, https://doi.org/10.1111/j.14691795.2009.00315.x Francisco, L. V., Langston, A. A., Mellersh, C. S., Neal, C. L., Ostrander, E. A., 1996. A class of highly polymorphic tetranucleotide repeats for canine genetic mapping. Mammal Genome, 7: 359–362. Frantz, A. C., Pope, L. C., Carpenter, P. J., Roper, T. J., Wilson, G. J., Delahay, R. J., Burke, T., 2003. Reliable microsatellite genotyping of the Eurasian badger (Meles meles) using faecal DNA. Molecular Ecology, 12(6): 1649–1661, https://doi. org/10.1046/j.1365-294X.2003.01848.x Forcina, G., Vallet, D., Le Gouar, P. J., Bernardo–Madrid, R., Illera, G., Molina–Vacas, G., Dréano,S., Revilla, E., Rodríguez–Teijeiro, J. D., Ménard, N., Bermejo, M., Vilà, C., 2019. From groups to communities in western lowland gorillas. Proceedings of the Royal Society B: Biological Sciences, 286(1896): 20182019, https://doi.org/10.1098/ rspb.2018.2019 Gil–Sánchez, J. M., Herrera–Sánchez, F. J., Álvarez, B., Arredondo, Á., Bautista, J., Cancio, I., Castillo, S., Díaz–Portero, M. A., de Lucas, J., McCain, E., Pérez, J., Rodríguez–Siles, J., Sáez, J. M., Martínez–Valderrama, J., Valenzuela, G., Qninba, A., Virgós, E., 2017. Evaluating methods for surveying the Endangered Cuvier’s gazelle Gazella cuvieri in arid landscapes. Oryx, 51(4): 648–655, https:// doi.org/10.1017/S0030605316000430 Goldenberger, D., Perschil, I., Ritzler, M., Altwegg, M., 1995. A simple 'universal' DNA extraction procedure using SDS and proteinase K is compatible with direct PCR amplification. Genome Research, 4(6): 368–370, https://doi.org/10.1101/gr.4.6.368
282
Harrison, R. L., Barr, D. J., Dragoo, J. W., 2006. A comparison of population survey techniques for swift foxes (Vulpes velox) in New Mexico. American Midland Naturalist, 148(2): 320, https://doi. org/10.1674/0003-0031(2002)148[0320:ACOPST ]2.0.CO;2 Janečka, J. E., Munkhtsog, B., Jackson, R. M., Naranbaatar, G., Mallon, D. P., Murphy, W. J., 2011. Comparison of noninvasive genetic and camera– trapping techniques for surveying snow leopards. Journal of Mammalogy, 92(4): 771–783, https:// doi.org/10.1644/10-mamm-a-036.1 Jouquand, S., Priat, C., Hitte, C., Lachaume, P., André, C., Galibert, F., 2000. Identification and characterization of a set of 100 tri– and dinucleotide microsatellites in the canine genome. Animal Genetics 31: 266–272. Karmacharya, D. B., Thapa, K., Shrestha, R., Dhakal, M., Janečka, J. E., 2011. Noninvasive genetic population survey of snow leopards (Panthera uncia) in Kangchenjunga conservation area, Shey Phoksundo National Park and surrounding buffer zones of Nepal. BMC Research Notes, 4(1): 516, https://doi.org/10.1186/1756-0500-4-516 Kearse, M., Moir, R., Wilson, A., Stones–Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Drummond, A., 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12): 1647–1649, https://doi.org/10.1093/bioinformatics/bts199 Kohn, M. H., York, E. C., Kamradt, D. A., Haught, G., Sauvajot, R. M., Wayne, R. K., 1999. Estimating population size by genotyping faeces. Proceedings of the Royal Society of London B: Biological Sciences, 266: 657–663, https://doi.org/10.1098/ rspb.1999.0686 Laguardia, A., Wang, J., Shi, F. L., Shi, K., Riordan, P., 2015. Species identification refined by molecular scatology in a community of sympatric carnivores in Xinjiang, China. Zoological Research, 36(2): 72–78, https://doi.org/10.13918/j.issn.2095-8137.2015.2.72 Le Gouar, P. J., Vallet, D., David, L., Bermejo, M., Gatti, S., Levréro, F., Petit, E. J., Ménard, N., 2009. How Ebola impacts genetics of western lowland gorilla populations. Plos One, 4: 12, https://doi. org/10.1371/journal.pone.0008375 Lenth, R., 2018. emmeans: Estimated Marginal Means, aka Least Squares Means. R package version 1.1. Available at: https://CRAN.R-project.org/ package=emmeans [Accessed on 10 July 2019] Longmire, J., Maltbie, M., Baker, R., 1997. Use of lysis buffer in DNA isolation and its implications for museum collections. Museum of Texas Tech University, 163: 1–3. Meyer, M., Kircher, M., 2010. Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harbor Protocols, 5: 6, https://doi.org/10.1101/pdb.prot5448 Miller, C. R., Joyce, P., Waits, L. P., 2002. Assessing allelic dropout and genotype reliability using maximum likelihood. Genetics, 160: 357–366.
Sarabia et al.
Miquel, C., Bellemain, E., Poillot, C., Bessière, J., Durand, A., Taberlet, P., 2006. Quality indexes to assess the reliability of genotypes in studies using noninvasive sampling and multiple–tube approach. Molecular Ecology Notes, 6(4): 985–988, https:// doi.org/10.1111/j.1471-8286.2006.01413.x Monteiro, L., Bonnemaison, D., Vekris, A., Petry, K. G., Me, F., Bonnet, J., Vidal, R. U. I., 1997. Complex polysaccharides as PCR inhibitors in feces. Journal of Clinical Microbiology 35(4): 995–998. Muñoz–Fuentes, V., Darimont, C. T., Wayne, R. K., Paquet, P. C., Leonard, J. A., 2009. Ecological factors drive differentiation in wolves from British Columbia. Journal of Biogeography, 36(8): 1516–1531, https://doi.org/10.1111/j.13652699.2008.02067.x Navidi, W., Arnheim, N., Waterman, M. S., 1992. A multiple–tubes approach for accurate genotyping of very small DNA samples by using PCR: statistical considerations. American Journal of Human Genetics, 50(2): 347–359. Norman, A. J., Stronen, A. V., Fuglstad, G. A., Ruiz– Gonzalez, A., Kindberg, J., Street, N. R., Spong, G., 2017. Landscape relatedness: detecting contemporary fine–scale spatial structure in wild populations. Landscape Ecology, 32(1): 181–194, https://doi.org/10.1007/s10980-016-0434-2 Ostrander, E. A., Sprague, G. F. Jr., Rine, J., 1993. Identification and characterization of dinucleotide repeat (CA)n markers for genetic mapping in dog. Genetics, 16: 207–213. Paetkau, D., Calvert, W., Stirling, I., Strobeck, C., 1995. Microsatellite analysis of population structure in Canadian polars bears. Molecular Ecology, 4: 347–354. Panasci, M., Ballard, W. B., Breck, S., Rodriguez, D., Densmore, L. D., Wester, D. B., Baker, R. J., 2011. Evaluation of fecal DNA preservation techniques and effects of sample age and diet on genotyping success. Journal of Wildlife Management, 75(7): 1616–1624, https://doi.org/10.1002/jwmg.221 Pérez, T., Naves, J., Vázquez, J. F., Fernández–Gil, A., Seijas, J., Albornoz, J., Revilla, E., Delibes, M., Domínguez, A., 2014. Estimating the population size of the endangered Cantabrian brown bear through genetic sampling. Wildlife Biology, 20(5): 300–309, https://doi.org/10.2981/wlb.00069 Perry, G. H., Marioni, J. C., Melsted, P., Gilad, Y., 2010. Genomic–scale capture and sequencing of endogenous DNA from feces. Molecular Ecology, 19(24): 5332–5344, https://doi.org/10.1111/j.1365294X.2010.04888.x Pompanon, F., Bonin, A., Bellemain, E., Taberlet, P., 2005. Genotyping errors: causes, consequences and solutions. Nature Review Genetics, 6(11): 847–859, https://doi.org/10.1038/nrg1707 Rådström, P., Knutsson, R., Wolffs, P., Lövenklev, M., Löfström, C., 2004. Pre–PCR Processing strategies to generate PCR–compatible samples. Molecular Biotechnology, 26: 133–146, https://doi. org/10.1385/MB:26:2:133 Ramón–Laca, A., Soriano, L., Gleeson, D., Godoy, J. A., 2015. A simple and effective method for obtai-
Animal Biodiversity and Conservation 43.2 (2020)
ning mammal DNA from faeces. Wildlife Biology, 21(4): 195–203, https://doi.org/10.2981/wlb.00096 Rohland, N., Reich, D., 2012. Cost–effective, high– throughput DNA sequencing libraries for multiplexed target capture. Genome Research, 22: 939–946, https://doi.org/10.1101/gr.128124.111 Roques, S., Furtado, M., Jácomo, A. T. A., Silveira, L., Sollmann, R., Tôrres, N. M., Godoy, J. A., Palomares, F., 2014. Monitoring jaguar populations Panthera onca with non–invasive genetics: A pilot study in Brazilian ecosystems. Oryx, 48(3): 361– 369, https://doi.org/10.1017/S0030605312001640 Ruiz–Gonzalez, A., Cushman, S. A., Madeira, M. J., Randi, E., Gómez–Moliner, B. J., 2015. Isolation by distance, resistance and/or clusters? Lessons learned from a forest–dwelling carnivore inhabiting a heterogeneous landscape. Molecular Ecology, 24(20): 5110–5129, https://doi.org/10.1111/mec.13392 Sambrook, J., Fritsch, E. F., Maniatis, T., 1989. Molecular cloning: a laboratory manual (2nd Edition). Cold Spring Harbor Laboratory Press. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R., 2012. PCR inhibitors–occurrence, properties and removal. Journal of Applied Microbiology, 113(5): 1014–1026, https://doi.org/10.1111/j.13652672.2012.05384.x Shapiro, A., Vinuela, E., 1967. Molecular weight estimation of polypeptide chains by eletrophoresis in SDS–Polyacrylamide gels. Biochemical Biophysical Research Communications, 28(5): 815–820. Taberlet, P., 1996. Reliable genotyping of samples with very low DNA quantities using PCR. Nucleic
283
Acids Research, 24(16): 3189–3194, https://doi. org/10.1093/nar/24.16.3189 Taberlet, P., Luikart, G., 1999. Non–invasive genetic sampling and individual identification. Biological Journal of the Linnean Society, 68(1–2): 41–55, https://doi.org/10.1006/bijl.1999.0329 Vallet, D., Petit, E.J., Gatti, S., Levréro, F., Ménard, N., 2008 A new 2CTAB/PCI method improves DNA amplification success from faeces of Mediterranean (Barbary macaques) and tropical (lowland gorillas) primates. Conservation Genetics, 9(3): 677–680, https://doi.org/10.1007/s10592-007-9361-8 Wang, H., Qi, J., Xiao, D., Wang, Z., Tian, K., 2017. A re–evaluation of dilution for eliminating PCR inhibition in soil DNA samples. Soil Biology and Biochemistry, 106: 109–118, https://doi.org/10.1016/j. soilbio.2016.12.011 Weber, K., Osborn, M., 1969. The reliability of molecular gel weight determinations by dodecyl electrophoresis. Journal of Biological Chemistry, 244(16): 4406–4412. Wilson, I. G., 1997. Inhibition and facilitation of nucleic acid amplification. Applied and Environmental Microbiology, 63(10): 3741–3751, https://doi. org/0099-2240/97/$04.00+0 Yu, Z., Morrison, M., 2004. Improved extraction of PCR–quality community DNA from digesta and fecal samples. BioTechniques, 36(5): 808–812. Zhang, B. W., Li, M., Ma, L. C., Wei, F. W., 2006. A widely applicable protocol for DNA isolation from fecal samples. Biochemical Genetics, 44(11–12): 494–503, https://doi.org/10.1007/s10528-006-9050-1
42
Muñoz and Farfán
Animal Biodiversity and Conservation 43.2 (2020)
Animal Biodiversity and Conservation Animal Biodiversity and Conservation és (abans Miscel·lània Zoològica) és una revista interdisciplinària publicada, des de 1958, pel Museu de Ciències Naturals de Barcelona. Inclou articles d'investigació empírica i teòrica en totes les àrees de la zoologia (sistemàtica, taxonomia, morfologia, biogeografia, ecologia, etologia, fisiologia i genètica) procedents de totes les regions del món. La revista presta una atenció especial als estudis que plantegen un problema nou o que introdueixen un nou tema, amb unes hipòtesis i prediccions clares i als treballs que d'una manera o altre tinguin rellevància en la biologia de la conservació. No es publicaran articles purament descriptius o articles faunístics o corològics que descriguin la distribució en l'espai o en el temps dels organismes zoològics. Aquests treballs s'han de redirigir a la nostra revista germana Arxius de Miscel·lània Zoològica (www.amz. museucienciesjournals.cat). Els estudis realitzats amb espècies rares o protegides poden no ser acceptats tret que els autors disposin dels permisos corresponents. Cada volum anual consta de dos fascicles. Animal Biodiversity and Conservation es troba registrada en la majoria de les bases de dades més importants i està disponible gratuitament a internet a www.abc.museucienciesjournals.cat, de manera que permet una difusió mundial dels seus articles. Tots els manuscrits són revisats per l'editor executiu, un editor i dos revisors independents, triats d'una llista internacional, a fi de garantir–ne la qualitat. El procés de revisió és ràpid i constructiu. La publicació dels treballs acceptats es fa normalment dintre dels 12 mesos posteriors a la recepció. Una vegada hagin estat acceptats passaran a ser propietat de la revista. Aquesta es reserva els drets d’autor, i cap part dels treballs no podrà ser reproduïda sense citar–ne la procedència. Els drets d’autor queden reservats als autors, els qui autoritzen la revista a publicar l’article. Els articles es publiques amb una Llicència de Reconeixement 4.0 Internacional de Creative Commons: no es podrà reproduir ni reutilitzar cap part dels treballs publicats sense citar-ne la procedència.
I
Les proves d'impremta enviades a l'autor per a la correcció, seran retornades al Consell Editor en el termini de 10 dies. Publicar a Animal Biodiversity and Conservation es gratuït per als autors, tot i que les despeses degudes a modificacions substancials introduïdes per ells en el text original acceptat aniran a càrrec dels autors. El primer autor rebrà una còpia electrònica del treball en format PDF. Manuscrits Els treballs seran presentats en format DIN A–4 (30 línies de 70 espais cada una) a doble espai i amb totes les pàgines numerades. Els manuscrits han de ser complets, amb taules i figures. No s'han d'enviar les figures originals fins que l'article no hagi estat acceptat. El text es podrà redactar en anglès, castellà o català. Se suggereix als autors que enviïn els seus treballs en anglès. La revista els ofereix, sense cap càrrec, un servei de correcció per part d'una persona especialitzada en revistes científiques. En tots els casos, els textos hauran de ser redactats correctament i amb un llenguatge clar i concís. Els caràcters cursius s’empraran per als noms científics de gèneres i d’espècies i per als neologismes intraduïbles; les cites textuals, independentment de la llengua, seran consignades en lletra rodona i entre cometes i els noms d’autor que segueixin un tàxon aniran en rodona. S'evitarà l'ús de termes extrangers (p. ex.: llatí, alemany,...). Quan se citi una espècie per primera vegada en el text, es ressenyarà, sempre que sigui possible, el seu nom comú. Els topònims s’escriuran o bé en la forma original o bé en la llengua en què estigui escrit el treball, seguint sempre el mateix criteri. Els nombres de l’u al nou, sempre que estiguin en el text, s’escriuran amb lletres, excepte quan precedeixin una unitat de mesura. Els nombres més grans s'escriuran amb xifres excepte quan comencin una frase. Les dates s’indicaran de la forma següent: 28 VI 99 (un únic dia); 28, 30 VI 99 (dies 28 i 30); 28–30 VI 99 (dies 28 a 30). S’evitaran sempre les notes a peu de pàgina.
Normes de publicació
Format dels articles
Els treballs s'enviaran preferentment de forma electrònica (abc@bcn.cat). El format preferit és un document Rich Text Format (RTF) o DOC que inclogui les figures i les taules. Les figures s'hauran d'enviar també en arxius apart en format TIFF, EPS o JPEG. Cal incloure, juntament amb l'article, una carta on es faci constar que el treball està basat en investigacions originals no publicades anterior ment i que està sotmès a Animal Biodiversity and Conservation en exclusiva. A la carta també ha de constar, per a aquells treballs en que calgui manipular animals, que els autors disposen dels permisos necessaris i que compleixen la normativa de protecció animal vigent. També es poden suggerir possibles assessors.
Títol. Serà concís, però suficientment indicador del contingut. Els títols amb desig nacions de sèries numèriques (I, II, III, etc.) seran acceptats previ acord amb l'editor. Nom de l’autor o els autors Abstract en anglès que no ultrapassi les 12 línies mecanografiades (860 espais) i que mostri l’essència del manuscrit (introducció, material, mètodes, resultats i discussió). S'evitaran les especulacions i les cites bibliogràfiques. Estarà encapçalat pel títol del treball en cursiva. Key words en anglès (sis com a màxim), que orientin sobre el contingut del treball en ordre d’importància. Resumen en castellà, traducció de l'Abstract. De la traducció se'n farà càrrec la revista per a aquells
ISSN: 1578–665X eISSN: 2014–928X
© 2020 Museu de Ciències Naturals de Barcelona Papers are published under a Creative Commons Attribution 4.0 International License
II
autors que no siguin castellanoparlants. Palabras clave en castellà. Adreça postal de l’autor o autors, es publicaran tal i com s’indiqui en el manuscrit rebut. Identificadors d’investigador (ORCID, ResearchID,…), al menys de l’investigador principal i de qui assumeixi la correspondència posterior. (Títol, Nom dels autors, Abstract, Key words, Resumen, Palabras clave, Adreça postal e Identificadors d’investigador conformaran la primera pàgina.) Introducción. S'hi donarà una idea dels antecedents del tema tractat, així com dels objectius del treball. Material y métodos. Inclourà la informació pertinent de les espècies estudiades, aparells emprats, mètodes d’estudi i d’anàlisi de les dades i zona d’estudi. Resultados. En aquesta secció es presentaran únicament les dades obtingudes que no hagin estat publicades prèviament. Discusión. Es discutiran els resultats i es compararan amb treballs relacionats. Els suggeriments de recerques futures es podran incloure al final d’aquest apartat. Agradecimientos (optatiu). Referencias. Cada treball haurà d’anar acompanyat de les referències bibliogràfiques citades en el text. Les referències han de presentar–se segons els models següents (mètode Harvard): * Articles de revista: Conroy, M. J., Noon, B. R., 1996. Mapping of species richness for conservation of biological diversity: conceptual and methodological issues. Ecological Applications, 6: 763–773. * Llibres o altres publicacions no periòdiques: Seber, G. A. F., 1982. The estimation of animal abundance. C. Griffin & Company, London. * Treballs de contribució en llibres: Macdonald, D. W., Johnson, D. P., 2001. Dispersal in theory and practice: consequences for conservation biology. In: Dispersal: 358–372 (T. J. Clober, E. Danchin, A. A. Dhondt, J. D. Nichols, Eds.). Oxford University Press, Oxford. * Tesis doctorals: Merilä, J., 1996. Genetic and quantitative trait variation in natural bird populations. Tesis doctoral, Uppsala University. * Els treballs en premsa només han d’ésser citats si han estat acceptats per a la publicació: Ripoll, M. (in press). The relevance of population studies to conservation biology: a review. Animal Biodiversity and Conservation.
La relació de referències bibliogràfiques d’un treball serà establerta i s’ordenarà alfabèticament per autors i cronològicament per a un mateix autor, afegint les lletres a, b, c,... als treballs del mateix any. En el text, s’indicaran en la forma usual: "... segons Wemmer (1998)...", "...ha estat definit per Robinson i Redford (1991)...", "...les prospeccions realitzades (Begon et al., 1999)...". Taules. Es numeraran 1, 2, 3, etc. i han de ser sempre ressenyades en el text. Les taules grans seran més estretes i llargues que amples i curtes ja que s'han d'encaixar en l'amplada de la caixa de la revista. Figures. Tota classe d’il·lustracions (gràfics, figures o fotografies) entraran amb el nom de figura i es numeraran 1, 2, 3, etc. i han de ser sempre ressenyades en el text. Es podran incloure fotografies si són imprescindibles. Si les fotografies són en color, el cost de la seva publicació anirà a càrrec dels autors. La mida màxima de les figures és de 15,5 cm d'amplada per 24 cm d'alçada. S'evitaran les figures tridimensionals. Tant els mapes com els dibuixos han d'incloure l'escala. Els ombreigs preferibles són blanc, negre o trama. S'evitaran els punteigs ja que no es reprodueixen bé. Peus de figura i capçaleres de taula. Seran clars, concisos i bilingües en la llengua de l’article i en anglès. Els títols dels apartats generals de l’article (Introducción, Material y métodos, Resultados, Discusión, Conclusiones, Agradecimientos y Referencias) no aniran numerats. No es poden utilitzar més de tres nivells de títols. Els autors procuraran que els seus treballs originals no passin de 20 pàgines (incloent–hi figures i taules). Si a l'article es descriuen nous tàxons, caldrà que els tipus estiguin dipositats en una institució pública. Es recomana als autors la consulta de fascicles recents de la revista per tenir en compte les seves normes. Comunicacions breus Les comunicacions breus seguiran el mateix procediment que els articles y tindran el mateix procés de revisió. No excediran de 2.300 paraules incloent–hi títol, resum, capçaleres de taula, peus de figura, agraïments i referències. El resum no ha de passar de 100 paraules i el nombre de referències ha de ser de 15 com a màxim. Que el text tingui apartats és opcional i el nombre de taules i/o figures admeses serà de dos de cada com a màxim. En qualsevol cas, el treball maquetat no podrà excedir de quatre pàgines.
Animal Biodiversity and Conservation 43.2 (2020)
Animal Biodiversity and Conservation Animal Biodiversity and Conservation (antes Miscel·lània Zoològica) es una revista interdisciplinar, publicada desde 1958 por el Museu de Ciències Naturals de Barcelona. Incluye artículos de investigación empírica y teórica en todas las áreas de la zoología (sistemática, taxonomía, morfología, biogeografía, ecología, etología, fisiología y genética) procedentes de todas las regiones del mundo. La revista presta especial interés a los estudios que planteen un problema nuevo o introduzcan un tema nuevo, con hipòtesis y prediccions claras, y a los trabajos que de una manera u otra tengan relevancia en la biología de la conservación. No se publicaran artículos puramente descriptivos, o artículos faunísticos o corológicos en los que se describa la distribución en el espacio o en el tiempo de los organismes zoológicos. Esos trabajos deben redirigirse a nuestra revista hemana Arxius de Miscel·lània Zoològica (www.amz. museucienciesjournals.cat). Los estudios realizados con especies raras o protegidas pueden no ser aceptados a no ser que los autores dispongan de los permisos correspondientes. Cada volumen anual consta de dos fascículos. Animal Biodiversity and Conservation está registrada en todas las bases de datos importantes y además está disponible gratuitamente en internet en www.abc.museucienciesjournals.cat, lo que permite una difusión mundial de sus artículos. Todos los manuscritos son revisados por el editor ejecutivo, un editor y dos revisores independientes, elegidos de una lista internacional, a fin de garantizar su calidad. El proceso de revisión es rápido y constructivo, y se realiza vía correo electrónico siempre que es posible. La publicación de los trabajos aceptados se realiza con la mayor rapidez posible, normalmente dentro de los 12 meses siguientes a la recepción del trabajo. Una vez aceptado, el trabajo pasará a ser propiedad de la revista. Ésta se reserva los derechos de autor, y ninguna parte del trabajo podrá ser reproducida sin citar su procedencia. Los derechos de autor quedan reservados a los autores, quienes autorizan a la revista a publicar el artículo. Los artículos se publican con una Licencia Creative Commons Atribución 4.0 Internacional: no se podrá reproducir ni reutilizar ninguna de sus partes sin citar la procedencia.
Normas de publicación Los trabajos se enviarán preferentemente de forma electrónica (abc@bcn.cat). El formato preferido es un documento Rich Text Format (RTF) o DOC, que incluya las figuras y las tablas. Las figuras deberán enviarse también en archivos separados en formato TIFF, EPS o JPEG. Debe incluirse, con el artículo, una carta donde conste que el trabajo versa sobre inves tigaciones originales no publicadas anteriormente y que se somete en exclusiva a Animal Biodiversity and Conservation. En dicha carta también debe constar, para trabajos donde sea necesaria la manipulación ISSN: 1578–665X eISSN: 2014–928X
III
de animales, que los autores disponen de los permisos necesarios y que han cumplido la normativa de protección animal vigente. Los autores pueden enviar también sugerencias para asesores. Las pruebas de imprenta enviadas a los autores deberán remitirse corregidas al Consejo Editor en el plazo máximo de 10 días. Publicar en Animal Biodiversity and Conservation es gratuito para los autores, sin embargo los gastos debidos a modificaciones sustanciales en las pruebas de imprenta, introducidas por los autores, irán a cargo de los mismos. El primer autor recibirá una copia electrónica del trabajo en formato PDF. Manuscritos Los trabajos se presentarán en formato DIN A–4 (30 líneas de 70 espacios cada una) a doble espacio y con las páginas numeradas. Los manuscritos deben estar completos, con tablas y figuras. No enviar las figuras originales hasta que el artículo haya sido aceptado. El texto podrá redactarse en inglés, castellano o catalán. Se sugiere a los autores que envíen sus trabajos en inglés. La revista ofrece, sin cargo ninguno, un servicio de corrección por parte de una persona especializada en revistas científicas. En cualquier caso debe presentarse siempre de forma correcta y con un lenguaje claro y conciso. Los caracteres en cursiva se utilizarán para los nombres científicos de géneros y especies y para los neologismos que no tengan traducción; las citas textuales, independientemente de la lengua en que estén, irán en letra redonda y entre comillas; el nombre del autor que sigue a un taxón se escribirá también en redonda. Se evitará el uso de términos extranjeros (p. ej.: latín, aleman,...). Al citar por primera vez una especie en el trabajo, deberá especificarse siempre que sea posible su nombre común. Los topónimos se escribirán bien en su forma original o bien en la lengua en que esté redactado el trabajo, siguiendo el mismo criterio a lo largo de todo el artículo. Los números del uno al nueve se escribirán con letras, a excepción de cuando precedan una unidad de medida. Los números mayores de nueve se escribirán con cifras excepto al empezar una frase. Las fechas se indicarán de la siguiente forma: 28 VI 99 (un único día); 28, 30 VI 99 (días 28 y 30); 28–30 VI 99 (días 28 al 30). Se evitarán siempre las notas a pie de página. Formato de los artículos Título. Será conciso pero suficientemente explicativo del contenido del trabajo. Los títulos con designaciones de series numéricas (I, II, III, etc.) serán aceptados excepcionalmente previo consentimiento del editor. Nombre del autor o autores Abstract en inglés de 12 líneas mecanografiadas (860 espacios como máximo) y que exprese la esencia del manuscrito (introducción, material, métodos, resultados y discusión). Se evitarán las especulaciones y las citas bibliográficas. Irá enca© 2020 Museu de Ciències Naturals de Barcelona Papers are published under a Creative Commons Attribution 4.0 International License
IV
bezado por el título del trabajo en cursiva. Key words en inglés (un máximo de seis) que especifiquen el contenido del trabajo por orden de importancia. Resumen en castellano, traducción del abstract. Su traducción puede ser solicitada a la revista en el caso de autores que no sean castellano hablantes. Palabras clave en castellano. Direccion postal del autor o autores, se publicarán tal como se indique en el manuscrito recibido. Identificadores de investigador (ORCID, ResearchID,…), al menos del investigador principal y de quien asuma la correspondencia posterior. (Título, Nombre de los autores, Abstract, Key words, Resumen, Palabras clave, Direcciones postalo e Identificadores de investigador conformarán la primera página.) Introducción. En ella se dará una idea de los antecedentes del tema tratado, así como de los objetivos del trabajo. Material y métodos. Incluirá la información referente a las especies estudiadas, aparatos utilizados, metodología de estudio y análisis de los datos y zona de estudio. Resultados. En esta sección se presentarán únicamente los datos obtenidos que no hayan sido publicados previamente. Discusión. Se discutirán los resultados y se compararán con otros trabajos relacionados. Las sugerencias sobre investigaciones futuras se podrán incluir al final de este apartado. Agradecimientos (optativo). Referencias. Cada trabajo irá acompañado de una bibliografía que incluirá únicamente las publicaciones citadas en el texto. Las referencias deben presentarse según los modelos siguientes (método Harvard): * Artículos de revista: Conroy, M. J., Noon, B. R., 1996. Mapping of species richness for conservation of biological diversity: conceptual and methodological issues. Ecological Applications, 6: 763–773. * Libros y otras publicaciones no periódicas: Seber, G. A. F., 1982. The estimation of animal abundance. C. Griffin & Company, London. * Trabajos de contribución en libros: Macdonald, D. W., Johnson, D. P., 2001. Dispersal in theory and practice: consequences for conservation biology. In: Dispersal: 358–372 (T. J. Clober, E. Danchin, A. A. Dhondt, J. D. Nichols, Eds.). Oxford University Press, Oxford. * Tesis doctorales: Merilä, J., 1996. Genetic and quantitative trait variation in natural bird populations. Tesis doctoral, Uppsala University.
* Los trabajos en prensa sólo se citarán si han sido aceptados para su publicación: Ripoll, M. (in press). The relevance of population studies to conservation biology: a review. Animal Biodiversity and Conservation. Las referencias se ordenarán alfabéticamente por autores, cronológicamente para un mismo autor y con las letras a, b, c,... para los trabajos de un mismo autor y año. En el texto las referencias bibliográficas se indicarán en la forma usual: "...según Wemmer (1998)...", "...ha sido definido por Robinson y Redford (1991)...", "...las prospecciones realizadas (Begon et al., 1999)...". Tablas. Se numerarán 1, 2, 3, etc. y se reseñarán todas en el texto. Las tablas grandes deben ser más estrechas y largas que anchas y cortas ya que deben ajustarse a la caja de la revista. Figuras. Toda clase de ilustraciones (gráficas, figuras o fotografías) se considerarán figuras, se numerarán 1, 2, 3, etc. y se citarán todas en el texto. Pueden incluirse fotografías si son imprescindibles. Si las fotografías son en color, el coste de su publicación irá a cargo de los autores. El tamaño máximo de las figuras es de 15,5 cm de ancho y 24 cm de alto. Deben evitarse las figuras tridimensionales. Tanto los mapas como los dibujos deben incluir la escala. Los sombreados preferibles son blanco, negro o trama. Deben evitarse los punteados ya que no se reproducen bien. Pies de figura y cabeceras de tabla. Serán claros, concisos y bilingües en castellano e inglés. Los títulos de los apartados generales del artículo (Introducción, Material y métodos, Resultados, Discusión, Agradecimientos y Referencias) no se numerarán. No utilizar más de tres niveles de títulos. Los autores procurarán que sus trabajos originales no excedan las 20 páginas incluidas figuras y tablas. Si en el artículo se describen nuevos taxones, es imprescindible que los tipos estén depositados en alguna institución pública. Se recomienda a los autores la consulta de fascículos recientes de la revista para seguir sus directrices. Comunicaciones breves Las comunicaciones breves seguirán el mismo procedimiento que los artículos y serán sometidas al mismo proceso de revisión. No excederán las 2.300 palabras, incluidos título, resumen, cabeceras de tabla, pies de figura, agradecimientos y referencias. El resumen no debe sobrepasar las 100 palabras y el número de referencias será de 15 como máximo. Que el texto tenga apartados es opcional y el número de tablas y/o figuras admitidas será de dos de cada como máximo. En cualquier caso, el trabajo maquetado no podrá exceder las cuatro páginas.
Animal Biodiversity and Conservation 43.2 (2020)
Animal Biodiversity and Conservation Animal Biodiversity and Conservation (formerly Miscel·lània Zoològica) is an interdisciplinary journal published by the Museu de Ciències Naturals de Barcelona since 1958. It includes empirical and theoretical research from around the world that examines any aspect of Zoology (Systematics, Taxonomy, Morphology, Biogeography, Ecology, Ethology, Physiology and Genetics). It gives special emphasis to studies that expose a new problem or introduces a new topic, presenting clear hypotheses and predictions, and to studies related to Cconservation Biology. Papers purely descriptive or faunal or chorological describing the distribution in space or time of zoological organisms will not be published. These works should be redirected to our sister magazine Arxius de Miscel·lània Zoològica (www.amz.museucienciesjournals.cat). Studies concerning rare or protected species will not be accepted unless the authors have been granted the relevant permits or authorisation. Each annual volume consists of two issues. Animal Biodiversity and Conservation is registered in all principal data bases and is freely available online at www.abc.museucienciesjournals.cat assuring world–wide access to articles published therein. All manuscripts are screened by the Executive Editor, an Editor and two independent reviewers so as to guarantee the quality of the papers. The review process aims to be rapid and constructive. Once accepted, papers are published as soon as is practicable. This is usually within 12 months of initial submission. Upon acceptance, manuscripts become the property of the journal, which reserves copyright, and no published material may be reproduced or cited without acknowledging the source of information. All rights are reserved by the authors, who authorise the journal to publish the article. Papers are published under a Creative Commons Attribution 4.0 International License: no part of the published paper may be reproduced or reused unless the source is cited.
Information for authors Electronic submission of papers is encouraged (abc@ bcn.cat). The preferred format is DOC or RTF. All figures must be readable by Word, embedded at the end of the manuscript and submitted together in a separate attachment in a TIFF, EPS or JPEG file. Tables should be placed at the end of the document. A cover letter stating that the article reports original research that has not been published elsewhere and has been submitted exclusively for consideration in Animal Biodiversity and Conservation is also necessary. When animal manipulation has been necessary, the cover letter should also specify that the authors follow current norms on the protection of animal species and that they have obtained all relevant permits and authorisations. Authors may suggest referees for their papers. Proofs sent to the authors for correction should be returned to the Editorial Board within 10 days. Publishing in Animal Biodiversity and Conservation is free of charge, but expenses due to any substantial ISSN: 1578–665X eISSN: 2014–928X
V
alterations of the proofs will be charged to the authors. The first author will receive electronic version of the article in PDF format. Manuscripts Manuscripts must be presented in DIN A–4 format, 30 lines, 70 keystrokes per page. Maintain double spacing throughout. Number all pages. Manuscripts should be complete with figures and tables. Do not send original figures until the paper has been accepted. The text may be written in English, Spanish or Catalan, though English is preferred. The journal provides linguistic revision by an author’s editor. Care must be taken to use correct wording and the text should be written concisely and clearly. Scientific names of genera and species as well as untranslatable neologisms must be in italics. Quotations in whatever language used must be typed in ordinary print between quotation marks. The name of the author following a taxon should also be written in lower case letters. Foreing terms (e.g. Latin, German,...) should not be used. When referring to a species for the first time in the text, both common and scientific names should be given when possible. Do not capitalize common names of species unless they are proper nouns (e.g. Iberian rock lizard). Place names may appear either in their original form or in the language of the manuscript, but care should be taken to use the same criteria throughout the text. Numbers one to nine should be written in full within the text except when preceding a measure. Higher numbers should be written in numerals except at the beginning of a sentence. Specify dates as follows: 28 VI 99 (for a single day); 28, 30 VI 99 (referring to two days, e.g. 28th and 30th), 28–30 VI 99 (for more than two consecutive days, e.g. 28th to 30th). Footnotes should not be used. Formatting of articles Title. Must be concise but as informative as possible. Numbering of parts (I, II, III, etc.) should be avoided and will be subject to the Editor’s consent. Name of author or authors Abstract in English, no longer than 12 typewritten lines (840 spaces), covering the contents of the article (introduction, material, methods, results and discussion). Speculation and literature citation should be avoided. The abstract should begin with the title in italics. Key words in English (no more than six) should express the precise contents of the manuscript in order of relevance. Resumen in Spanish, translation of the Abstract. Summaries of articles by non–Spanish speaking authors will be translated by the journal on request. Palabras clave in Spanish. © 2020 Museu de Ciències Naturals de Barcelona Papers are published under a Creative Commons Attribution 4.0 International License
VI
Author’s address will be published as they appear in the manuscript file. Researcher’s identifiers (ORCID, ResearchID,…), at least from the first and the corresponding authors. (Title, Name, Abstract, Key words, Resumen, Palabras clave and Author’s address and Researcher’s identifiers must constitute the first page) Introduction. Should include the historical background of the subject as well as the aims of the paper. Material and methods. This section should provide relevant information on the species studied, materials, methods for collecting and analysing data, and the study area. Results. Report only previously unpublished results from the present study. Discussion. The results and their comparison with related studies should be discussed. Suggestions for future research may be given at the end of this section. Acknowledgements (optional). References. All manuscripts must include a bibliography of the publications cited in the text. References should be presented as in the following examples (Harvard method): * Journal articles: Conroy, M. J., Noon, B. R., 1996. Mapping of species richness for conservation of biological diversity: conceptual and methodological issues. Ecological Applications, 6: 763–773. * Books or other non–periodical publications: Seber, G. A. F., 1982. The estimation of animal abundance. C. Griffin & Company, London. * Contributions or chapters of books: Macdonald, D. W., Johnson, D. P., 2001. Dispersal in theory and practice: consequences for conservation biology. In: Dispersal: 358–372 (T. J. Clober, E. Danchin, A. A. Dhondt, J. D. Nichols, Eds.). Oxford University Press, Oxford. * PhD thesis: Merilä, J., 1996. Genetic and quantitative trait variation in natural bird populations. PhD thesis, Uppsala University. * Works in press should only be cited if they have been accepted for publication: Ripoll, M. (in press). The relevance of population studies to conservation biology: a review. Animal Biodiversity and Conservation. References must be set out in alphabetical and chronological order for each author, adding the letters a, b, c,...
to papers of the same year. Bibliographic citations in the text must appear in the usual way: "...according to Wemmer (1998)...", "...has been defined by Robinson and Redford (1991)...", "...the prospections that have been carried out (Begon et al., 1999)..." Tables. Must be numbered in Arabic numerals with reference in the text. Large tables should be narrow (across the page) and long (down the page) rather than wide and short, so that they can be fitted into the column width of the journal. Figures. All illustrations (graphs, drawings, photographs) should be termed as figures, and numbered consecutively in Arabic numerals (1, 2, 3, etc.) with reference in the text. Glossy print photographs, if essential, may be included. The Journal will publish colour photographs but the author will be charged for the cost. Figures have a maximum size of 15.5 cm wide by 24 cm long. Figures should not be tridimensional. Any maps or drawings should include a scale. Shadings should be kept to a minimum and preferably with black, white or bold hatching. Stippling should be avoided as it may be lost in reproduction. Legends of tables and figures. Legends of tables and figures should be clear, concise, and written both in English and Spanish. Main headings (Introduction, Material and methods, Results, Discussion, Acknowledgements and References) should not be numbered. Do not use more than three levels of headings. Manuscripts should not exceed 20 pages including figures and tables. If the article describes new taxa, type material must be deposited in a public institution. Authors are advised to consult recent issues of the journal and follow its conventions. Brief communications Brief communications should follow the same procedure as other articles and they will undergo the same review process. They should not exceed 2,300 words including title, abstract, figure and table legends, acknowledgements and references. The abstract should not exceed 100 words, and the number of references should be limited to 15. Section headings within the text are optional. Brief communications may have up to two figures and/or two tables but the whole paper should not exceed four published pages.
Animal Biodiversity and Conservation 43.2 (2020)
VII
Welcome to the electronic version of Animal Biodiversity and Conservation
Rec ele omme ctr nd o to you nic a c r li bra cess r y!
this
https://abc.museucienciesjournals.cat
Animal Biodiversity and Conservation joins the worldwide Open Access Initiative of providing a permanent online version free of charge and access barriers This is the result of the growing consensus that open access to research is essential for efficient and rapid scientific communication ABC alert, a free alerting service, provides e–mail information on the latest issue To sign on for this service, please send an e–mail to: abc@bcn.cat
VIII
Animal Biodiversity and Conservation 43.2 (2020)
Animal Biodiversity and Conservation 43.2 (2020)
IX
Arxius de Miscel·lània Zoològica vol. 17 (2019) Museu de Ciències Naturals de Barcelona ISSN: 1698–0476 www.amz.museucienciesjournals.cat
Índex / Índice / Contents García–Luis, M., Briones–Salas, M., Lavariega, M. C., 2019. Bat species richness in the region of the Central Valleys of Oaxaca, Mexico. Arxius de Miscel·lània Zoològica, 17: 1–11, Doi: https://doi.org/10.32800/ amz.2019.17.0001 Abstract Bat species richness in the region of the Central Valleys of Oaxaca, Mexico. We present a revised checklist of bat species occurring in the semi–urbanized region of the Central Valleys of Oaxaca, Mexico. The checklist is based on surveys using mist nets, recordings of echolocation calls, data from literature, and museum databases. Results show that the Central Valleys of Oaxaca have a species richness of 33 bat species belonging to 22 genera and five families. Species like the Mustached bat Pteronotus parnellii, the Western Red bat Lasiurus blossevillii and the Free–tailed bat Promops centralis were recorded after 32, 30 and 19 years respectively according to the records of the literature. We also recorded four species classified in some risk category according to either the Mexican government’s red list (NOM–059) or the IUCN red list. The recordings of the echolocation calls are the first from the region of Central Valleys of Oaxaca. Bat diversity in the Central Valleys of Oaxaca was underestimated and emphasizes the need for further research. Data published through GBIF (doi: 10.15470/qp5ccr) Key words: Urban biodiversity, Acoustic monitoring, Anabat SD 1, Promops centralis, Pteronotus parnellii, Lasiurus blosevillii
Mesa–S., L. M., DoNascimiento, C., Lasso, C. A., 2019. Peces de la subcuenca del río Tomo, Orinoquia colombiana: actualización de la lista de especies. Arxius de Miscel·lània Zoològica, 17: 12–33, Doi: https://doi. org/10.32800/amz.2019.17.0012 Abstract Fishes of the Tomo River sub–basin, Colombian Orinoquia: updating the checklist of species. The Tomo River runs west to east through the high savannah, known as the 'Altillanura' in eastern Colombia, to flow directly into the Orinoco River. This updated ichthyological checklist was developed by revising and deleting five bibliographic references in combination with the results of an expedition carried out in April 2017 in the lower part of the sub–basin. Here we report 305 species of fish belonging to 183 genera, 45 families and 14 orders. The consolidated checklist includes 69 additional species for Tomo River, of which three species are new records for the Orinoco River basin and eight are new species for Colombia. In addition, we add 578 catalog numbers (10,423 specimens) to the fish collection of the Humboldt Institute (IAvH–P). Data published through GBIF (Doi:10.15472/44yqz9) Key words: Freshwater fishes, Eastern Colombian plains, Orinoco Basin, Species richness, Vichada State
ISSN: 1578–665X eISSN: 2014–928X
© [2020] Copyright belongs to the authors, who license the journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License.
X
Nouidjem, Y., Mimeche, F., Bensaci, E., Merouani, S., Arar, A., Saheb, M., 2019. Check list of waterbirds at Wadi Djedi in Ziban Oasis–Algeria. Arxius de Miscel·lània Zoològica, 17: 34–43, Doi: https://doi.org/10.32800/ amz.2019.17.0034 Abstract Check list of waterbirds at Wadi Djedi in Ziban Oasis–Algeria. This pioneering work is the first to document the aquatic avifauna community of the Wadi Djedi in the Ziban region in southeast of Algeria. We present results obtained through the monthly counts of waterbirds conducted from September 2013 to September 2016. On this wetland we recorded 36 species of water birds representing 11 families. The Anatidae family was the most numerous, with 11 species. From among all the species, 18 were wintering species, nine were visitors, eight were sedentary breeding species (including the ruddy shelduck Tadorna furruginea and Kentish plover Charadrius alexandrines) and one species was migratory nesting (the white stork Ciconia ciconia). Two species (the teal marbled Marmaronetta angustirostris and ferruginous duck Aythya nyroca) are listed as Vulnerable on the IUCN Red List of endangered species. Data published through GBIF (Doi:10.15470/6m0dyq) Key words: Waterbirds, Ziban region, Status, Algeria
Oussalah, N., Marniche, F., Espadaler, X., Biche M., 2019. Exotic ants from the Maghreb (Hymenoptera, Formicidae) with first report of the Hairy Alien Ant Nylanderia jaegerskioeldi (Mayr) in Algeria. Arxius de Miscel·lània Zoològica, 17: 45–58, Doi: https://doi.org/10.32800/amz.2019.17.0045 Abstract Exotic ants from the Maghreb (Hymenoptera, Formicidae) with first report of the Hairy Alien Ant Nylanderia jaegerskioeldi (Mayr) in Algeria.– We compiled 16 exotic ant species found in the Maghreb in wild ecosystems, gardens and urban areas. Five of these introduced species are considered major ecological and agricultural household pest species that have become established above all in Morocco. During our investigation in a citrus orchard of ITMAS Heuraoua, Algiers, we detected two exotic ants, Nylanderia jaegerskioeldi (Mayr, 1904) and Strumigenys membranifera Emery, 1869, plus nine native ant species. The Formicinae ant N. jaegerskioeldi is recorded for the first time in Algeria, taking the number of exotic ants in the country to 11. This is the fourth known record in North Africa. A brief comparison between the exotic ant fauna of Algeria, Morocco, Tunisia and neighboring countries highlights the need to improve the limited knowledge of ants in North Africa. Data published through GBIF (Doi:10.15470/dgay4r) Key words: Tramp ants, Maghreb, Nylanderia jaegerskioeldi, Queen
Ziouani, Kh., Benzehra, A., Saharaoui, L., 2019. Population fluctuations of Gynaikothrips ficorum (Marchal, 1908) (Thysanoptera, Tubulifera) and natural enemies on leaf gall of Ficus retusa in Algeria. Arxius de Miscel·lània Zoològica, 17: 59–71, Doi: https://doi.org/10.32800/amz.2019.17.0059 Abstract Population fluctuations of Gynaikothrips ficorum (Marchal, 1908) (Thysanoptera, Tubulifera) and natural enemies on leaf gall of Ficus retusa in Algeria. Monthly fluctuations of thrip populations on Ficus retusa were monitored and parasites and predators in Boudouaou, Algeria, were identified. Twenty leaves were collected fortnightly from 30 trees from January to December 2015. The number of eggs increased significantly in August with 11,163 eggs and was slightly higher in October with 11,471 eggs. Presence was rare in spring and winter. The 1st and 2nd larval stages (L1 and L2) overlapped: L1 were present from August to October with 27 and 51 individuals respectively, and L2 were present from August to December with 65 to 186 individuals respectively. Prepupae were active in April and June, reaching 46 and 50 individuals respectively, before increasing to 266 in November. Highest numbers of pupae were observed in June (171) and July (135). The number of adults gradually increased, reaching a maximum of 642 in early December. Two predators were identified: Montandoniola confusa (Hemiptera, Anthocoridae) and Nephus peyerimhoffi (Coleoptera, Coccinellidae). A parasite, Tetrastichus gentilei (Hymenoptera, Eulophidae), was also later identified. Key words: Gynaikothrips ficorum, Ficus retusa, Predators, Parasite, Algeria
Animal Biodiversity and Conservation 43.2 (2020)
XI
Kherroubi, M., Mouhouche, F., Zerrouk Izzeddine, Z., Chahbar, M., 2019. Biocontrol of the pine processionary moth Thaumetopoea pityocampa (Denis and Schiffermuller, 1775) with plant extracts. Arxius de Miscel·lània Zoològica, 17: 73–84, Doi: https://doi.org/10.32800/amz.2019.17.0073 Abstract Biocontrol of the pine processionary moth Thaumetopoea pityocampa (Denis and Schiffermuller, 1775) with plant extracts. The purpose of this study was to propose alternative solutions based on the use of natural, bio–insecticidal products to fight against the processionary moth, Thaumetopoea pityocampa (T. pityocampa), considered a defoliator because of the damage it causes to silvicultural. This insect also causes health problems in forests or wooded areas open to the public. To meet this objective, we evaluated the toxicity of six extracts from two plants: Taxus baccata and Populus nigra, collected from the regions of Blida, against first instar larvae of T. pityocampa. The results from these biological tests showed a significant difference between the six extracts. The LD50 (lethal dose) values were calculated by probit analysis using Finney's table. The LD50 was also low for the two extracts Populus Methanol and Populus Methanol Chloroform (1.4 mg/ml and 3.3 mg/ml, respectively). However, the LD50 was relatively high for the rest of the extracts. In conclusion, the Bio–insecticides of Populus Methanol (PMP) and Populus Methanol Chloroform (PMC) showed to be active and could be integrated into the biological control of the egg parasitoids of T. pityocampa. Key words: Thaumetopoea pityocampa, LD50, Populus nigra, Taxus baccata.
Taybi, A. F., Mabrouki, Y., Berrahou, A., Sbaa, M., Brochard, C., 2019. New data on the dragonfly fauna (Odonata) of the Moulouya River Basin and the Oriental Region, Morocco. Arxius de Miscel·lània Zoològica, 17: 85–108, Doi: https://doi.org/10.32800/amz.2019.17.0085 Abstract New data on the dragonfly fauna (Odonata) of the Moulouya River Basin and the Oriental Region, Morocco. We present new faunistic and distributional data on dragonflies (Odonata) from the east of Morocco, comprising the administrative Oriental Region and the Moulouya River Basin and covering an area of 119,268 km2. A checklist of 47 species belonging to 19 genera and seven families is provided. Pseudagrion s. sublacteum (Coenagrionidae), Aeshna mixta (Aeshnidae), Sympetrum sinaiticum and S. meridionale (Libellulidae) are new for Eastern Morocco, while Paragomphus genei (Gomphidae) is new for the Moulouya watershed. Our surveys yield evidence of breeding of Zygonyx torridus in the Moulouya River, of Sympetrum sinaiticum in the Oriental province, and also of Boyeria Irene, which remained unrecorded for more than three decades. We confirm the occurrence of Brachythemis impartita in the study area, by providing new sightings. Our results also revealed the range expansion of several other species whereas some previously known species in the region were not found. We found a clear dominance of the Palearctic elements, mainly Mediterranean, with a high proportion of Ibero–Maghrebian endemic species. This chorotype pattern is similar to patterns observed for other macroinvertebrate groups in the same study area. Data published in GBIF (Doi: 10.15470/dikubb) Key words: Dragonflies, inventory, Eastern Morocco, Ramsar site, Nador lagoon, Monitoring, New records
K. Ramdani, K., Kouidri, M. , Ouakid, M. L., Houhamdi, M., 2019. Breeding biology of the chaffinch Fringilla coelebs africana in the El Kala National Park (North East Algeria). Arxius de Miscel·lània Zoològica, 17: 109–121, Doi: https://doi.org/10.32800/amz.2019.17.0109 Abstract Breeding biology of the chaffinch Fringilla coelebs africana in the El Kala National Park (North East Algeria). This work focused on monitoring the reproductive phenology of the Chaffinch Fringilla coelebs africana for two successive seasons (2016 and 2017) in the mountains of the El Kala National Park (North East Algeria). We searched for nests in the tree stratum or by direct observation of breeding pairs carrying building materials from mid–March to the end of June and found a total of 34 nests that were measured without affecting the breeding process. The results show that nests were built at an average height of 6.3 m from the ground. The laying period was 46 days (Early April to mid–May) and the average laying date was May 2. The mean of clutch size is 3.2 eggs per brood. All the previous traits are similar to those recorded in Europe. The mean hatching success rate was 43.1 % and the average breeding success rate was 36.3 %. These two values are relatively low compared to those found in European populations. Key words: Fringilla coelebs africana, El Kala National Park, North–east Algeria, Reproductive phenology, Reproductive success
XII
Musthafa, M. M., Abdullah, F., 2019. Coleoptera of Genting Highland, Malaysia: species richness and diversity changes along the elevations. Arxius de Miscel·lània Zoològica, 17: 123–144, Doi: https://doi.org/10.32800/ amz.2019.17.0123 Abstract Coleoptera of Genting Highland, Malaysia: species richness and diversity changes along the elevations. The objective of this study was to measure beetle richness and diversity in Genting Highland at four major elevations (500 m, 1,000 m, 1,500 m and 1,800 m). Beetles were collected using light traps, malaise traps and pitfall traps. Altogether, 1,499 beetle samples representing 156 morphospecies were collected. Light trap and pitfall traps were more effective than Malaise trap. The 500 m elevation band displayed high species richness, abundance and diversity with all indices showing a decreasing pattern. The species accumulation curve displayed a progressive asymptote for all the altitudinal transects, showing the sampling effort was sufficient for this study. A long–term monitoring program of beetle diversity and distribution is useful to test abiotic factors that might influence biodiversity. This study also serves as a benchmark for further studies on this highly disturbed montane cloud forest in Peninsular Malaysia and will be useful to implement effective conservation management, particularly under the threat of climate change. Data published through GBIF (Doi: https://doi.org/10.15470/i0uuis). Key words: Abundance, Beetle, Biodiversity, Ecosystem, Forest
Kissayi, K., Benhalima, S., Bentata, F., Bhilili, M., Benhoussa, A., 2019. New records for a catalogue of Chalcididae (Hymenoptera, Chalcidoidea) from Morocco. Arxius de Miscel·lània Zoològica, 17: 145–159, Doi: https:// doi.org/10.32800/amz.2019.17.0145 Abstract New records for a catalogue of Chalcididae (Hymenoptera, Chalcidoidea) from Morocco. Three species of Chalcididae (Hymenoptera, Chalcidoidea) were newly recorded from Morocco during a study carried out in the Maâmora forest between 2012 and 2014: Hockeria bifasciata (Walker, 1834), H. mengenillarum (Silvestri, 1943) and Proconura decipiens (Masi, 1929). P. decipiens (Masi, 1929) stat. rev. will be removed from synonymy with P. nigripes (Fonscolombe, 1832). This study includes bibliographical research and revision of specimens deposited in the National Museum of Natural History, Scientific Institute of Rabat (Morocco). Twenty–six species and fourteen genera belonging to the family Chalcididae (Hymenoptera, Chalcidoidea) are now catalogued from Morocco. Data published through GBIF (Doi: 10.15470/nochzr) Key words: Hymenoptera, Chalcididae, New data, Maâmora, Morocc
Kissayi, K., Benhalima, S., Benhoussa, A., 2019. New contributions to the Eulophidae fauna from Morocco (Hymenoptera, Chalcidoidea) with comparison in the North African region. Arxius de Miscel·lània Zoològica, 17: 161–177, Doi: https://doi.org/10.32800/amz.2019.17.0161 Abstract New contributions to the Eulophidae fauna from Morocco (Hymenoptera, Chalcidoidea) with comparison in the North African region. We present an update of the Moroccan Eulophidae following samples collected in the Maâmora forest between 2012 and 2014, and completed with a thorough bibliographic study. We report seven genera for the first time in Morocco: Allocerastichus Masi, 1924; Euderomphale Girault, 1916; Eulophus Geoffroy, 1762; Euplectrus Westwood, 1832; Microlycus Thomson, 1878; Tamarixia Masi, 1924 and Trjapitzinichus Kostjukov & Kosheleva, 2006 and six species: Baryscapus impeditus (Nees, 1864); Ceranisus menes (Walker, 1839); Elachertus lateralis (Spinola, 1808); Elasmus atratus Howard, 1897; Microlycus biroi (Erdös, 1951) and Trjapitzinichus politus (Graham, 1991). A possible new species (Baryscapus n. sp.) and two unidentified species (Allocerastichus sp. and Euderomphale sp.) are included in the list of Moroccan Eulophidae. Data published through GBIF (Doi: 10.15470/wpyzuh) Keys word: Hymenoptera, Chalcidoidea, Eulophidae, Additions, Morocco
Animal Biodiversity and Conservation 43.2 (2020)
XIII
Kopij, G., 2019. Diversity and population densities of coraciiform birds in Zambezi riparian forest. Arxius de Miscel·lània Zoològica, 17: 179–186, Doi: https://doi.org/10.32800/amz.2019.17.0179 Abstract Diversity and population densities of coraciiform birds in Zambezi riparian forest. A territory mapping method was used in 2015 to assess the population density of coraciiform species breeding in a riparian forest on the Zambezi River near Katima Mulilo, NE Namibia. The forest, c. 280 ha in surface area, was partly transformed by human settlement and arable grounds. A total of 13 species and 42 breeding pairs were recorded. Population densities were (pairs/100 ha) as follows: grey–headed kingfisher 4.3; giant, pied and woodland kingfisher, each one with 1.1; malachite kingfisher 0.7; striped kingfisher 0.4; white–fronted bee–eater 1.4; little bee–eater 1.1; lilac–breasted roller 0.7; broad–billed roller 1.1; African hoopoe 0.7; red–billed wood–hoopoe 1.1; and scimitar–billed wood–hoopoe 0.4. Data published through GBIF (Doi: 10.15470/s9rlud) Key words: Coraciiformes, Census, Riparian forest, Population density
Doménech, C., Doménech, R. P., Belda, A., 2019. Primera cita de corzo, Capreolus capreolus (Linnaeus, 1758) (Artyodactila, Cervidae) para la provincia de Alicante. Arxius de Miscel·lània Zoològica, 17: 187–192, Doi: https://doi.org/10.32800/amz.2019.17.0187 Abstract First record of the roe deer, Capreolus capreolus (Linnaeus, 1758) (Artyodactila, Cervidae) from the province of Alicante. The first record of the roe deer, Capreolus capreolus (Linnaeus, 1758), from the Alicante province is reported. This species was identified by phototrapping in one of the mountainous regions in the north of this area. The various hypotheses of recolonization of the species in the area are considered, the most plausible being natural reintroduction due to expansion of the populations from neighbouring provinces. Key words: Roe deer, Geographical distribution, Alicante, Hunting, Ungulates Record published in Zenodo (Doi: 10.5281/zenodo.3479531) Key words: Roe deer, Geographical distribution, Alicante, Hunting, Ungulates
Borredà, V., Martínez–Ortí, A., 2019. Las babosas (Mollusca Gastropoda, Pulmonata) de Teruel (Aragón, España) y el Rincón de Ademuz (Valencia, España). Arxius de Miscel·lània Zoològica, 17: 193–208, Doi: https:// doi.org/10.32800/amz.2019.17.0193 Abstract The slugs (Mollusca Gastropoda, Pulmonata) of Teruel (Aragón, Spain) and Rincón de Ademuz (Valencia, Spain). This paper presents the results of a study of slugs that was carried out over the last three decades in the province of Teruel and Rincón de Ademuz (Valencia, Spain). Previous studies in the area were practically non–existent. We provide a list of species and localities and comment on the most relevant species from the anatomical, taxonomic, or geographic point of view. Dataset of the inedit species published in Zenodo (Doi:10.5281/zenodo.3523295) Key words: Molluscs, Slugs, Teruel, Rincón de Ademuz, Aragón, Valencia
XIV
Shrestha, B. B., Khatiwada, J. R., Thanet, D. R., 2019. mtDNA confirms the presence of Moschus leucogaster (Ruminantia, Moschidae) in Gaurishankar Conservation Area, Nepal. Arxius de Miscel·lània Zoològica, 17: 209–218, Doi: https://doi.org/10.32800/amz.2019.17.0209 Abstract mtDNA confirms the presence of Moschus leucogaster (Ruminantia, Moschidae) in Gaurishankar Conservation Area, Nepal. Musk deer (genus Moschus), an endangered mammal, is not only of great concern for its conservation, but it is also of great interest to understand its taxonomic and phylogenetic associations in Nepal. The aim of this study was to identify the taxonomic status of musk deer in Gaurishankar Conservation Area (GCA) using mitochondrial genomic data of cytochrome b (370 bps) through phylogenetic analysis of all the species of musk deer. The results showed that the species found in GCA is confirmed as Himalayan musk deer Moschus leucogaster, further expanding its distributional range in Nepal. Key words: Moschus leucogaster, Phylogenetic analysis, Gaurishankar Conservation Area, Nepal
Labbaci, A., Marniche, F., Daoudi–Hacini, S., Boulay, R., Milla, A., 2019. Species diversity of myrmecofauna (Hymenoptera, Formicidae) on the southern slope of Djurdjura National Park (Northern Algeria). Arxius de Miscel·lània Zoològica, 17: 219–229, Doi: https://doi.org/10.32800/amz.2019.17.0219 Abstract Species diversity of myrmecofauna (Hymenoptera, Formicidae) on the southern slope of Djurdjura National Park (Northern Algeria). This study was carried out at three study sites in the forests of the southern part of Djurdjura National Park. We found a high variety of ants, with 2,651 individuals belonging to 25 species and three subfamilies, Dolichoderinae, Myrmicinae and Formicinae. Sampling methods used were pitfall traps and hand collection. The dominant subfamily was Formicinae, representing 48 % of individuals collected. Seven species belonged to this subfamily, 31 % of which were Camponotus cruentatus. The second most common species found (18 %) was Tapinoma magnum, an invasive species in many countries. Relative abundance, frequency of occurrence, and diversity varied across the three study sites. Site 1, a black pine forest, had higher species richness (20 species) than site 2, a cedar strip (15 species), and site 3, a mixed holm oak forest (16 species). Our study area has a diverse fauna of ants and distribution of their populations is wide. Data published in GBIF (Doi: 10.15470/htbs0q) Key words: Formicidae, Algeria, Djurdjura National Park
42
Muñoz and Farfán
-
Les cites o els abstracts dels articles d'Animal Biodiversity and Conservation es resenyen a / Las citas o los abstracts de los artículos de Animal Biodiversity and Conservation se mencionan en / Animal Biodiversity and Conservation is cited or abstracted in: Abstracts of Entomology, Agrindex, Animal Behaviour Abstracts, Anthropos, Aquatic Sciences and Fisheries Abstracts, Behavioural Biology Abstracts, Biological Abstracts, Biological Abstracts, BIOSIS Previews, CiteFactor, Current Primate References, Current Contents/Agriculture, Biology & Environmental Sciences, Essential Science Indicators, Dialnet, DOAJ, DULCINEA, Ecological Abstracts, Ecology Abstracts, Entomology Abstracts, Environmental Abstracts, Environmental Periodical Bibliography, FECYT, Genetic Abstracts, Geographical Abstracts, Índice Español de Ciencia y Tecnología–ICYT, International Abstracts of Biological Sciences, International Bibliography of Periodical Literature, International Developmental Abstracts, Latindex, Marine Sciences Contents Tables, MIAR, Oceanic Abstracts, RACO, Recent Ornithological Literature, REBIUN, REDIB, Referatirnyi Zhurnal, ResearchGate, Responsible Journals, Science Abstracts, Science Citation Index Expanded, Scientific Commons, SCImago, SCOPUS, Serials Directory, SHERPA/RoMEO, Transpose, Ulrich's International Periodical Directory, WoS, Zoological Records
Consorci format per / Consorcio formado por / Consortium formed by:
Índex / Índice / Contents Animal Biodiversity and Conservation 43.2 (2020) ISSN 1578–665 X eISSN 2014–928 X 169–175 Michelin, G., Ceron, K., Santana, D. J. Prey availability influences the diet of Scinax fuscomarginatus in a Cerrado area, Central Brazil
209–219 Almeida, P. C. de, Hartmann, M. T., Hartmann, P. A. How riparian forest integrity influences anuran species composition: a case study in the Southern Brazil Atlantic Forest
177–186 Zúñiga, A. H., Rau, J. R., Fuenzalida, V., Fuentes– Ramírez, A. Temporal changes in the diet of two sympatric carnivorous mammals in a protected area of south–central Chile affected by a mixed–severity forest fire
221–232 Resende, P. S., Viana–Junior, A. B., Young, R. J., Azevedo, C. S. de A global review of animal translocation programs
187–190 Brief communication Oropeza–Sánchez, M. T., Sandoval–Comte, A., García–Bañuelos, P., Hernández–López, P., Pineda, E. Use of visible implant elastomer and its effect on the survival of an endangered minute salamander 191–195 Brief communication Delgado, S., Zorrozua, N., Arizaga, J. Marginal presence of plastic in nests of yellow–legged gulls (Larus michahellis) in the southeastern Bay of Biscay 197–208 Gamboa, A., Barragán, F. Preferencias de los granívoros con respecto al tamaño y la calidad de las bellotas en un bosque de Quercus en la zona centroseptentrional de México
233–242 San Miguel, E., Amaro, R., Castro, J., Hermida, M., Fernández, C. Growth rates in two natural populations of Gasterosteus aculeatus in northwestern Spain: relationships with other life history parameters 243–253 Arizaga, J., Garaita, R., Galarza, A. Leisure activities as a main threat for the conservation of waterbirds in an estuary in northern Iberia 255–269 Castillo, L., Del Río, M., Carranza, J., Mateos, C., Tejado, J. J., López, F. Ultrasound speed in red deer antlers: a non–invasive correlate of density and a potential index of relative quality 271–283 Sarabia, C., Salado, I., Cornellas, A., Fernández-Gil, A., Vilà, C., Leonard, J. A. Towards high–throughput analyses of fecal samples from wildlife
FUNDACIÓN ESPAÑOLA
Amb el suport de / Con el apoyo de / With the support of: FUNDACIÓN ESPAÑOLA PARA LA CIENCIA Y LA TECNOLOGÍA
Nº DE CERTIFICADO: FECYT-113/2020 FECHA DE CERTIFICACIÓN: 6 de octubre 2014 (4ª convocatoria) ESTA CERTIFICACIÓN ES VÁLIDA HASTA EL: 13 de julio de 2021