Skip to main content

REI 101 Review & Refresher Course

Page 1

StartART SM Annual REI Nursing Congress Scientific & Therapeutic Approaches To Assisted Reproductive Technology Advances in reproductive medicine & IVF nursing practice, and strategies to improve reproductive potential & outcomes REI 101: REVIEW & REFRESHER COURSE 2022 Educational Provider Supported by EMD Serono, Inc., a subsidiary of Merck KGaA, Darmstadt, Germany Ferring Pharmaceuticals, Inc. Organon

Table of Contents

Page

Purpose & Learning Objectives 1

Educational Grantors 2

Faculty Affiliations 3

Financial Disclosure Information 4

Disclosure of Unlabeled/Investigational Uses 6

Co-chair & Faculty Biographies 7

Abstracts and Presentations

A History of IVF & Mainstreaming of Reproductive Technology

Daniel B. Shapiro, MD 12

Menstrual Cycle Characteristics and Reproductive Strategies

Kaylen M. Silverberg, MD 33

The Infertility Work-up

Carol B. Lesser, MSN, NP-C 54

Optimizing Stimulation Protocols

Kaylen M. Silverberg, MD 75

Genetics and ART

Lauren J. Isley, MS, LCGC 108

Navigating Gamete Donation in Clinical Practice

Maria M. Jackson, RN, MA 120

Confronting Compassion Fatigue & Burnout

Carol B. Lesser, MSN, NP-C 145

© 2023 Letters & Sciences. All rights reserved. This audience guide is protected by copyright. No part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or utilizing any information storage or retrieval system, without permission from the copyright owner.

Copyright Notice

©2023 Letters & Sciences. All Rights Reserved.

All material appearing on this website (“content”) is protected by copyright under U.S. Copyright laws and is the property of Letters & Sciences or the presenter credited as the provider of the content. Participant may not copy, reproduce, distribute, publish, display, perform, modify, create derivative works, transmit, or in any way exploit any such content, nor may participant distribute any part of this content over any network, including a local area network, sell or offer it for sale, or use such content to construct any kind of database. Participant may not alter or remove any copyright or other notice from copies of the content on this website. Copying or storing any content except as provided above is expressly prohibited without prior written permission from Letters & Sciences and/or the copyright holder identified in the individual presenter’s content’s copyright notice. To request permission to use the content on the Fertility Updates website including the online REI 101: Review & Refresher Course, please contact jmiller@letsci.org

Disclaimer

The content contained on this website is provided only for educational and informational purposes. Letters & Sciences attempts to ensure that content is accurate and obtained from reliable sources, but does not represent it to be absolutely error-free. Letters & Sciences may add, amend or repeal any policy, procedure or regulation, and failure to timely post such changes to its website shall not be construed as a waiver of enforcement. Letters & Sciences does not warrant that any functions on this website will be uninterrupted, that defects will be corrected, or that the website will be free from viruses or other harmful components. Any links to third party information on the website are provided as a courtesy and do not constitute an endorsement of those materials or the third party providing them.

Purpose

The REI Nursing 101: A Review & Refresher Course provides nurses new to practice, as well as those experienced nurses who may require reinforcement, with an overview of key concepts in reproductive endocrinology and infertility. This overview helps develop and strengthen a foundation that will be critical to clinical practice, and especially to advancing the sophisticated educational concepts on which the StartART (Scientific & Therapeutic Approaches to Assisted Reproductive Technology) Congress presentations, including late-breaking information, cutting-edge techniques, and best practices to improve ART outcomes

Learning Objectives

After attending this activity, the attendee should be able to:

• Describe the history of IVF, identifying the milestones that are responsible for advances in the field

• Identify the complex of menstrual cycle characteristics, according to the menstruation, follicular, ovulation and the luteal phases

• Review considerations for optimizing stimulation protocols

• Evaluate the causes of female and male infertility

• Describe the infertility work-up

• Indicate available treatment options including OI, IVF/ET, and donor gametes

• Understand the side effects of infertility treatment

• Define the development and management of an early pregnancy

• Assess the psychological aspects of infertility

• Discuss basic genetic concepts

• Recognize common genetic tests in the ART setting

• Evaluate common genetics issues that may arise in the ART setting and when referrals are appropriate

• Define compassion fatigue and burnout in the field of fertility nursing and its signs and symptoms

1

Educational Grantors

This activity is supported by educational grants from:

EMD Serono, Inc., an affiliate of Merck KGaA, Darmstadt, Germany Organon

Ferring Pharmaceuticals, Inc.

2

Lauren J. Isley, MS, LCGC

Genetic Counselor Generate Life Sciences Los Angeles, CA

Maria M. Jackson, RN, MA

Third Party Nurse Coordinator Institute for Reproductive Medicine and Science Cooperman Barnabas Medical Center Livingston, NJ

Carol B. Lesser, MSN, NP-C

Nurse Practitioner Boston IVF Waltham, MA

Daniel B. Shapiro, MD Medical Director Reproductive Biology Associates Atlanta, GA

Kaylen M. Silverberg, MD Medical Director, Managing Partner Texas Fertility Center Austin, TX

REI 101 Faculty

3

Disclosure Information

It is the policy of Letters & Sciences to ensure balance, independence, and scientific rigor in all educational activities/programs. Those who may have the opportunity to influence content of this CNE program (e.g. planners, faculty, authors, reviewers, and others) must disclose all relevant, significant financial relationships with ineligible companies so that the providers may identify and resolve any conflicts of interest prior to the program. Any relevant financial relationships have been mitigated. No relevant financial relationships were identified for any other individuals with the ability to control content of the activity. Additionally, faculty members have been instructed to disclose any limitations of data and unlabeled or investigational uses of product(s), device(s) or clinical strategies to the participants during the presentations.

The faculty, discussants, and Executive, Curriculum, and CNE Committees have disclosed the following:

Lauren J. Isley, MS, LCGC

Full-time employee of Generate Life Sciences, a company providing donor gamete services

Maria M. Jackson, RN, MA Has no relationships to disclose

Carol B. Lesser, MSN, NP-C

Has no relationships to disclose

Daniel B. Shapiro, MD

Is a consultant to: Organon Owner/Founder of MyEggbank-NA Holds stock in Prelude Fertility

Kaylen M. Silverberg, MD

Has received research grants from Baxter

Has received consulting fees from Baxter, Seikagaku, Serono

Has served as a speaker for AbbVie, Myovant Is a co-founder and member of board of directors: Ovation Fertility

4

Disclosure Information (cont.)

Executive Committee, CNE Committee, Curriculum Committee Members

Letters & Sciences, the content managers/members of the executive and curriculum committees, reports no relationships with commercial interests

External Reviewers

In accordance with Letters & Sciences policy and ANCC standards to identify and resolve any potential conflicts of interest, to assure fair balance, independence and objectivity, and to instill scientific rigor in all CNE activities, all presentations, with any potential for conflict of interest, have been reviewed by two external reviewers. These independent external reviewers, who have no potential conflicts of interest, have determined that no bias exists in these presentations. These external reviewers are:

Shannon L. DeVita, MSN, RN, CNL, DNP University of San Diego San Diego, CA

Michele Nichols, PharmD Pharmacy Consultant Private Practice Raritan, NJ

5

Unlabeled Uses/Investigational Uses/Not Yet Approved Therapies

The learners are advised that some sections in this continuing nursing education activity may contain references to devices and/or protocols or clinical strategies that are unlabeled, investigational, or unapproved by the FDA. Healthcare professionals should note that the use of information presented that is outside of current approved labeling is considered experimental and are advised to consult current prescribing information. All faculty members have agreed to disclose any unlabeled/unapproved uses of drugs or products referenced in their presentation

Lauren J. Isley, MS, LCGC

Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies

Maria M. Jackson, RN, MA

Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies

Carol B. Lesser, MSN, NP-C

Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies

Daniel B. Shapiro, MD

Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies

Kaylen M. Silverberg, MD

Has agreed to disclose any unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies referenced in his presentation

6

Co-Chair Biography

Maria M. Jackson, RN, MA, is the Third Party Nurse Coordinator at the Institute for Reproductive Medicine and Science at Cooper Barnabas Medical Center in Livingston, New Jersey. Ms. Jackson received her nursing diploma from Bellevue School of Nursing in New York, and then completed a degree in psychology from Upsala College. Four years later, she matriculated a master’s degree in counselor education from Kean University, where her thesis was entitled ‘Gender Differences and the Perception of Infertility.’

Ms. Jackson began her nursing career in both education and research. She joined the American Cancer Society as a support group facilitator; however 4 years later, chose a shift in nursing focus, and initiated a fulfilling career in reproductive medicine. She segued from cancer support group facilitator to infertility support group facilitator as IVF/GIFT Egg Donation Nurse Coordinator at the Diamond Institute. She has served as a chair of the Nurses Professional Group (NPG) of the American Society for Reproductive Medicine and is an Emeritus Advisor to the NPG Board.

A recipient of several prestigious awards for academic achievement, lectures and abstracts, Ms. Jackson is perhaps most proud of the 2001 American Infertility Association Family Building Award. She is a sought-after presenter, and has authored papers, abstracts, book chapters and training manuals, all contributing to the education and inspiration of nurses in the fertility field.

7

Co-Chair Biography

Carol B. Lesser, MSN, NP-C, is a women's health nurse practitioner at Boston IVF in Brookline, Massachusetts. She earned her undergraduate degree in psychology from Cornell University in Ithaca, New York, and matriculated a nursing degree from the State University of New York at Stony Brook, followed by a Master’s of Science degree in Ob/Gyn Clinical Nursing from Boston College.

Ms. Lesser has been providing infertility services to couples in the Boston area for more than 3 decades. She began her nursing career as an Ob/Gyn Nurse Practitioner at Harvard Community Health Plan in Cambridge, Massachusetts. However, for more than 20 years, she has been a nurse practitioner at Boston IVF, one of New England's leading infertility treatment centers. Ms. Lesser is NAACOG certified as an Ob/Gyn Nurse Practitioner and is NCC certified in reproductive endocrinology and infertility.

A former board member of Resolve of the Bay State and a member of the American Society for Reproductive Medicine (ASRM) and the New England Fertility Society, Ms. Lesser was the 2006 recipient of the Jean Purdy Visionary Award for Excellence in Reproductive Nursing and a recipient of Resolve’s 2009 Hope Award for Service. She has delivered presentations on many topics in reproductive medicine, and speaks frequently to IVF nursing groups across the US. Ms. Lesser is the author of journal articles, ASRM abstracts, online newsletters, and content for continuing education activities. She is currently the editor for the ASRM nursing supplement to Sexuality, Reproduction and Menopause. Her areas of interest include ovarian decline in later reproductive years, patient friendly techniques for administering in vitro fertilization medications, polycystic ovarian syndrome, and ovarian hyperstimulation.

8

Faculty Biography

Lauren J. Isley, MS, CGC, is a Medical Science Liaison at Generate Life Sciences, the parent company of California Cryobank, Donor Egg Bank USA, and CBR. She received her Bachelor’s Degree from the University of Missouri in Columbia, Missouri and received her Master’s Degree in Genetic Counseling from Wayne State University in Detroit, Michigan

Following graduation, she was hired by Genesis Genetics (now Cooper Genomics) in Detroit, Michigan as a genetic counselor and established her reputation for excellence there in helping individuals and couples to understand and make informed decisions based on preimplantation genetic screening and diagnosis. In 2013, Ms. Isley transitioned from Genesis Genetics to a position at California Cryobank, where she counseled gamete donors and recipients. She joined Counsyl (now Myriad Genetics) in 2016 as a clinical laboratory genetic counselor. In 2019, Lauren then rejoined California Cryobank, now part of the parent company Generate Life Sciences, in a different role as a Medical Science Liaison. Ms. Isley works directly with reproductive healthcare providers to provide education and support regarding gamete donor screening and newborn stem cell banking.

She is an active member of the American Society of Reproductive Medicine, where she is the current Chair of the Genetic Counselor Professional Group. Ms. Isley also sits on the Executive Board of the Society for Assisted Reproductive Technology. Ms. Isley is also the former chair of the National Society of Genetic Counselor’s Special Interest Group on Assisted Reproductive Technologies/Infertility. Ms. Isley has authored several publications in Fertility and Sterility and other journals regarding genetic evaluation of gamete donors, management of inherited risks in donors and donor-conceived offspring, and genetic counseling scope of practice in ART She also has served as faculty at several national conferences and has presented abstracts at reproductive medicine and genetics meetings.

9

Faculty Biography

Daniel B. Shapiro, MD, is the Medical Director and a partner in Reproductive Biology Associates (RBA) in Atlanta. A graduate of Bowdoin College in Brunswick, Maine, Dr. Shapiro received his medical degree from Emory University School of Medicine in Atlanta, following which he served as a Chief Resident in Obstetrics and Gynecology at Pennsylvania Hospital in Philadelphia. He then completed a fellowship in Reproductive Endocrinology and Infertility at the University of Connecticut School of Medicine in Farmington, and was appointed as junior faculty of the University of Connecticut affiliated hospitals.

Dr. Shapiro co-founded the nation’s largest frozen egg bank, located at RBA. Since 2007, the egg bank completed ~7000 embryo transfers resulting in 3800 deliveries of 4200 babies.

He is board certified in Obstetrics and Gynecology, as well as Reproductive Endocrinology. He is a member of the American Society of Reproductive Medicine, the Society of Reproductive Endocrinologists, and the Thomas Bond Society.

Dr. Shapiro is well published in clinical reproductive endocrinology, including in estrogen bio-synthesis. He also is recognized for his research focus on GnRH antagonists and their applications in fertility medicine.

10

Faculty Biography

Kaylen M. Silverberg, MD, is a Founding Partner, Managing Partner, and Medical Director of the Texas Fertility Center. He is also Medical Director and a Co-Founder of Ovation Fertility, and serves on the Ovation Board of Directors. He was educated at Vanderbilt University in Nashville, Tennessee, where he majored in finance and molecular biology. He pursued his medical studies at Baylor College of Medicine in Houston, followed by an internship and residency at Vanderbilt University Medical Center, where he served as Chief Resident. Dr. Silverberg then completed a fellowship in reproductive endocrinology/infertility at the University of Texas Health Science Center in San Antonio. He is certified by the American Board of Obstetrics and Gynecology, as well as the Subspecialty Board of Reproductive Endocrinology/Infertility.

Dr. Silverberg is actively involved in clinical research in infertility. In addition, he is a member of several corporate boards and medical advisory boards. He also serves as a consultant, including to members of Congress on issues relating to healthcare economics and policy.

Dr. Silverberg has been honored with numerous recognitions, including for papers presented at infertility meetings. He was also honored by the American Fertility Association with their national ‘Family Building Award’.

Active in several professional organizations and societies, Dr. Silverberg is a member of the American College of Obstetrics and Gynecology, the American Society for Reproductive Medicine, Society for Assisted Reproductive Technology, and the American Association of Gynecologic Laparoscopists. In addition to his extensive contributions to the peer-reviewed literature, Dr. Silverberg also serves as a reviewer for several respected clinical journals, including Obstetrics & Gynecology, Fertility & Sterility, and The Journal of Gynecologic Surgery

11

History of IVF

Human understanding of the link between sexual intercourse and reproduction dates back to the beginning of written human history. Though the ancients did not understand any scientific details, they knew that physical union between male and female were needed to conceive and that human semen either contained something needed to make a baby or the whole baby in miniature.

Classical views of reproduction persisted from the time of ancient Athens to the 17th century. The age of enlightenment brought new technologies, notably microscopy, which made it possible to see sperm and in the early part of the 19th century, eggs. The early 20th century brought advancements in biochemistry and identification of hormones of the hypothalamicpituitary-gonadal axis, which provided the road-map for ovarian stimulation.

All the advancements needed to make IVF possible were in place by the mid-1970s: adequate imaging, hormonal management, vaginal ultrasound, culture technique and a favorable public perception of fertility medicine. Once established as acceptable, the field of fertility medicine exploded in the 1980s and 1990s. IVF births now account for over 1% of American deliveries. IVF is also the gateway for application of genetic screening technologies now and will be the future access point for patients who require genetic therapies on their embryos to ensure healthy live births.

12
A History of IVF: The Mainstreaming of Reproductive Technology Daniel Shapiro, MD RBA and MyEggBank-NA Disclosure Information • Consultant to Organon • Owner/Founder-MyEggbank-NA • Stockholder in Prelude Fertility • Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies Shapiro - History of IVF 13

Concern About Fertility is OLD

Sarah presents Hagar to Abraham Van der Werff, 1699

Sarah, herself infertile, asks Hagar to be her surrogate to produce an heir for Abraham. Abraham accepts (Hagar hadn’t much choice) and Ishmael is born.

Outline the key developments in fertility medicine
Review reaction of western
to reproductive technologies
Anticipate where IVF
will take human
Learning Objectives •
•
society
•
medicine
reproduction
Shapiro - History of IVF 14

Sarah got pregnant anyway…

Abraham, Sarah and the Angel Jan Provost, 1590

An angel of G-D tells Sarah andAbraham that they will bear a son. He’s 100 and she’s 90. Did theAlmighty broker an egg donation?!

Isaac (Yitzchak in Hebrew) means ‘he will laugh’…becauseAbraham and Sarah thought it laughable that she could become pregnant!

Biblical Begetting

Shapiro - History of IVF 15
• Biological basis for reproduction was known to result from sexual intercourse…but what was actually happening was a bit of a mystery to the besot who begot

Early Concepts of Reproductive Science

•

Hippocrates-around 400 BC (Greek)

– Considered the possibility that both men and women contributed ‘seed’ and that it mixed in the uterus

– All female medical conditions were the result of either suppressed menstruation or excessive bleeding

– Diseases of the woman emanate from hysteron (uterus)…hence the word “hysterical”

Source: Hippocrates’Woman: Reading the Female Body in Ancient Greece; King H, Routledge, London 1998.

More Classical Medicine…

• Aristotle (Greek) about 300 BC

– Believed it was all about the male

– Woman was vessel to carry the seed planted by the male…which contained an entire tiny baby (homunculus)

– Women were imperfect men, who were ‘colder’ than men and were unable to provide enough heat to warm blood into semen

Source: Hippocrates’Woman: Reading the Female Body in Ancient Greece; King H, Routledge, London 1998.

Shapiro - History of IVF 16

Science Enters the Picture

• William Harvey

– English, ‘omne vivum ex ovo’ (everything from the egg)-1651

• Johannes van Horne/Jan Swammerdam

– Dutch anatomists in 1650s

– Recognized the importance of ovarian follicles in reproduction

• Regnier de Graaf

– Dutch-1650s first described the development of ovarian follicles (now called Graffian follicles in his honor)

– Postulated that the follicle contains the egg (still unseen though)

The classical view of reproductive physiology lasted about 2000 years…until enlightenment scientists (17th and 18th century) called the teachings of Hippocrates and Aristotle into question
Shapiro - History of IVF 17
Science • 1677 Antonii
– First to examine semen under a microscope – Confirmed the presence of sperm • 1827 Karl Ernst
Baer
– Observed mammalian eggs under the microscope – Described the principles of embryologic development • 1876 Oscar Hertwig (German) – Confirmed that sperm/egg union caused fertilization – Documented meiosis and role of nucleus as a genetic vector What Technologies Make In-vitro Fertilization Possible? • Microscopy • Incubation/Culture media • Anesthesia • Endocrine regulation/Assessment • Gray Scale Ultrasound 1600s 1973 Ancient/1880s 1840s 1920s to 1980s Shapiro - History of IVF 18
Important Dates in Early Reproductive
van Leeuwenhoek (Dutch)
von
(Estonian/Russian)

Reproductive Medicine Begins…

J. Marion Sims-1855; chief of staff at Woman’s Hospital in NYC (now St Luke’s-Roosevelt)

‘Father of modern GYN’ performed 55 IUIs over 2 year period; only one pregnancy which ended in miscarriage

Investigational methods were highly unethical-he worked on surgical technique by operating on enslaved African women without anesthesia

First Donor Insemination

Diagnosed azospermia in husband (from gonorrheal obstruction)

Asked best looking medical student in his charge to provide a sperm sample and then surreptitiously placed it in the wife while she was chloroformed and the other students watched

Husband was informed of the truth when the baby boy was born

Truth was published by a med student who was probably the donor…25 years later

Shapiro - History of IVF 19
Dr Pancoast…tsk…tsk…tsk

The guilt-ridden medical student’s name?

Addison Davis HARD, MD (I did not make this up…)

He wrote a letter to the journal MEDICALWORLD in 1909 detailing the event and defending it as a means of ‘race uplifting’whose net effect would be to improve human beings by using the best seed available.

The Dark Ages

• 1873-Harvard Medical School Professor Edward Clarke, MD publishes ‘Sex in Education’ arguing that higher education in women contributes to their infertility

• 1932-Aldous Huxley publishes ‘Brave New World’ with a dystopian future filled with ‘test tube babies’

• 1949-Pope Pius XII condemns attempts to fertilize human eggs in-vitro as sacrilege

• 1954-Illinois courts declare donor sperm babies to be legally illegitimate (later overturned)

PBS Documentary , ‘Test Tube Babies’, 2003.
Shapiro - History of IVF 20

More Resistance to Reproductive Science

• 1968 -Pope Paul VI issues HumanaeVitae which explicitly forbids Catholics from using the Pill and requires that procreation be the result of sexual intercourse

• 1971-Nobel Laureate James Watson (discoverer of DNA’s double helix), speaking at the American Bioethics Conference condemns IVF research as it ‘necessitates infanticide’. Robert Edwards gets a standing ovation when he argues against Watson’s position.

• 1972 -The AMA urges a moratorium on ALL IVF research

IVF Origins

• 1934 -Harvard researcher Gregory Pincus succeeds with IVF using rabbit eggs and suggests this would help infertile women. He is denied tenure at Harvard as a result.

• 1937 -John Rock, MD writes an anonymous editorial for NEJM suggesting IVF would be ‘a boon for the barren woman with closed tubes!’

Shapiro - History of IVF 21
PBS Documentary ‘Test Tube Babies’, 2003.

First Human IVF

• 1938-John Rock hires Pincus’ research assistant Miriam Menkin and begins collecting human ova with the intent to fertilize them in-vitro.

• 1944-Six years, 800 eggs and 138 attempts at insemination later, Rock and Menkin succeed in fertilizing 4 eggs in-vitro. No attempt was made to replace them into a patient.

• 1951-Landrum

British physiologist

Attempted fertilization in-vitro but was unsuccessful until partnering with Howard And Georgeanna Jones at Johns Hopkins in 1965

Returned to England and in 1968 collaborates with Dr. Patrick Steptoe, a British gynecologist interested in helping Edwards achieve a live birth from IVF

Shettles, MD duplicates Rock and Menkin’s work at ColumbiaPresbyterian in NYC Sir Robert G. Edwards
Shapiro - History of IVF 22
Shapiro - History of IVF 23
1973

1973 was a very busy year…

First Attempt with IVF in the US

Doris and John Del Zio; September 1973

Under the care of Drs Shettles and Sweeny at Columbia Presbyterian, eggs were collected by surgery after ovarian stimulation, mixed with sperm and placed in an incubator.

A colleague of Shettles notified superiors of the attempt at which point the petri dish was taken out of the incubator and brought to Hospital administration, effectively ending the Del Zio’s chance of success.

The Del Zios sued and went to trial the same week Louise Brown was born in 1978. They won but were awarded only 50,000.

Roe v Wade Nixon re-inaugurated Vietnam War ends Dolphins complete undefeatedseason Winter Spring Summer Fall Watergate scandal linked to Nixon First cell phone call Secretariat wins Triple Crown More Watergate DEA founded Billie Jean King beats Bobbie Riggs Yom Kippur War Oil Embargo Agnew Resigns OJ runs 2000 yards AND………………..
Shapiro - History of IVF 24

1975

• Steptoe and Edwards achieve an IVF pregnancy but it proves to be ectopic.

• US government task force concludes that all federal IVF and fetal tissue research grants must be approved by a National Ethics Advisory Board; but no board is formed until 1978.

1977

• Howard and Georgeanna Jones retire from Hopkins and resume their work in Norfolk at Eastern Virginia Medical School.

• Steptoe and Edwards meet Lesley Brown in England and suggest an attempt at IVF to bypass her blocked fallopian tubes.

• November 12, 1977-A single 8 cell embryo derived from a laparoscopic retrieval is implanted into Lesley Brown.

Shapiro - History of IVF 25

1978

Despite the world-wide fascination and delight with Louise Brown….

July 25, 1978 Louise Brown born in Oldham, England. A media circus ensues… Her parents receive several bags of hate mail
Shapiro - History of IVF 26
Louise Brown: My Life as the World’s First Test-Tube Baby Bristol Books , 2015, London.

1981

Howard and Georgeanna Jones Founders of the Jones Institute in Norfolk and responsible for the first IVF clinic in the US and the first IVF baby in the States (Elizabeth Carr) Elizabeth Carr
Shapiro - History of IVF 27
At Birth, 1981At ASRM Annual Meeting, Baltimore, 2015
1984 Orwellian IVF • Agonist down-regulation comes into use causing a decline in IVF cycle cancellations and a concomitant rise in pregnancy rates • First frozen embryo baby (Australia) • First donor egg babies (Australia and US) Turning Points in IVF Since 1984 • 1986-First Baby from Egg Freezing (Chen; Australia) • 1987-Vaginal Probe Ultrasound Egg retrievals • 1987-Partial Zona Dissection (precursor to ICSI) (Cohen et.al) • 1989/90-PGD; Embryo biopsy for X-linked diseases (Handyside et al.) • 1992-ICSI (Palermo et al.) • 1994-PGS Shapiro - History of IVF 28

More Turning Points

• 1997-first frozen donor egg baby (US)

• 1999-GnRH antagonists approved

• 2000-vitrification of blastocyst with delivery reported

• 2005-vitrification modification makes process easier

• 2007-First frozen donor egg bank based on vitrification

• 2010-clinical application of comparative genomic hybridization

• 2015-Marriage Equality in US

Shapiro - History of IVF 29
2010 Nobel Prize in Medicine Robert Edwards

Social Objections to IVF

• Arise from traditional social norms and religious teaching • Are more common in patriarchal societies • Emanate from debate over abortion and the concept of ’ensoulment’ • Include arguments based on access to care and social class >1% Of All US Babies are the Result of IVF • Social and political barriers to IVF remain but are less profound than they were prior to Roe v Wade – Embryos can be discarded, tested, used for stem cell research etc. – Hospital boards embrace REI now but kept it
the down
the
• Criticisms continue however – Multiple birth rates – Cost of care – Potential for abuse/objectification Shapiro - History of IVF 30
on
low in
past

The Threat to Reproductive Medicine

• Roe struck down 5-4 (6-3 on the question of the Mississippi Ban)

– First time in US history a constitutional right has been rescinded.

– Three Trump appointees, two of whom were approved under politically charged circumstances, created the new majority

• Abortion fully illegal in 3 States with 3 states making it illegal from conception

– IMPERILS FERTILITY MEDICINE!

WHAT TO DO WITH ALL THE EMBRYOS IN STATES WITH BANS?

• Many states with abortion restrictions about to be enacted

– Ghost laws, Trigger Laws, New restrictions coming in as many as 30 States

Food for Thought

•Study of human embryonic genetics requires access to an IVF lab

•The genetic revolution is underway and IVF medicine is at the forefront of genetic technology

•Gene splicing and gene therapy is already possible

•The overturning of ROE in June imperils all of the above?

Shapiro - History of IVF 31

Conclusions

• IVF is the result of – Intense human desire for children

– Hundreds of years of scientific advancement

– Ethical fluidity

• Social attitudes have lagged behind scientific advance but eventually catch up

• Organized religion has a hard time reconciling IVF with theology and is currently working to end REPRODUCTIVE FREEDOM.

• Genetic science will likely influence our thinking about ethics in reproduction over the next few decades

Shapiro - History of IVF 32

Menstrual Cycle Characteristics

The human menstrual cycle is the result of a very complex series of events that involve multiple organs, multiple hormones, and – above all else – appropriate, timely communication between them all. The cycle starts at a time when the endometrium is shedding due to a lack of hormonal support. In response to this dearth of (primarily) estradiol and progesterone, the hypothalamus sends a signal to the pituitary gland. The messenger for this signal is a small decapeptide called gonadotropin releasing hormone (GnRH). When released with the appropriate amplitude and the appropriate frequency, the pulses of GnRH stimulate cells in the anterior pituitary to secrete follicle stimulating hormone (FSH).

FSH travels through the circulatory system to the granulosa cells of the ovarian follicles, causing them to grow and secrete increasing amounts of estradiol (E2). As the serum E2 level rises, it exerts a negative feedback effect on the hypothalamus, causing it to diminish the amount of GnRH secretion. This decrease results in uni-follicular development, serving as a natural barrier to prevent multiple gestation. As the single (dominant) follicle continues to grow and develop in response to lower levels of GnRH, the follicle makes ever increasing amounts of E2. This E2 acts to increase endometrial development, causing a thickening of the uterine lining.

When the serum estradiol reaches a sustained, elevated level (that is different between women and even in different cycles within the same woman), the hypothalamus changes the way it secretes GnRH. Rather than the high frequency, low amplitude pulsations that lead to FSH secretion, the pulses change to high amplitude, low frequency – resulting in a surge of luteinizing hormone (LH). The LH surge causes 3 things to happen within the developing follicle: luteinization of the granulosa cells so that they begin to make progesterone (P4) in addition to estradiol, a decrease in oocyte maturation inhibitor so that the egg can resume meiosis, and eventually, ovulation.

Ovulation is the process by which the egg extrudes from the follicle. Once this happens, and in response to the LH surge, the follicle becomes the P4 secreting corpus luteum. P4 causes a specific sequence of events to occur within the endometrium, preparing the lining for implantation. If implantation fails to occur, the corpus luteum dies within 12-14 days, resulting in a huge decrease in both E2 and P4 production. This precipitous fall in both E2 and P4 causes sloughing of the endometrium. The hypothalamus detects this hormonal fall and again starts to secrete GnRH – and the next menstrual cycle begins.

Many different etiologies can cause derangements in the menstrual cycle. The primary cause is a disruption in the signaling between the hypothalamus and the pituitary – leading to abnormal follicular development and the irregular production of E2. Other common causes include:

• Polycystic ovarian syndrome

• Hypothyroidism

•

Hyperprolactinemia

• Hyperandrogenism (via either testosterone or DHEA-S)

• Alterations in body weight

33

The evaluation of menstrual cycle irregularities should include:

• A transvaginal sonogram

• Lab work

Day 3 FSH, E2, AMH TSH, Prolactin

If indicated: Testosterone, DHEA-S, 17 OH P4/17 OH Pregnenolone, 2-hour glucose tolerance test (GTT)

The treatment of menstrual cycle derangement depends on the individual patient’s needs and goals. For those not seeking pregnancy, hormonal therapy – usually with an oral contraceptive pill – will usually provide regular, predictable menses, as well as protection against endometrial hyperplasia and cancer. For those women desiring pregnancy, primary therapy usually includes treatment with either clomiphene citrate or letrozole. The drugs effectively induce ovulation and therefore a resumption of regular menstrual cycles.

34

Menstrual Cycle Characteristics

Kaylen M. Silverberg, MD Texas Fertility Center Ovation Fertility Austin, TX San Antonio, TX

Disclosure Information

• Has received research grants from Baxter

• Has received consulting fees from Baxter, Seikagaku, Serono

• Has served as a speaker for AbbVie, Myovant

• Is a co-founder and member of board of directors: Ovation Fertility

• I will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies

- Menstrual Cycle Characteristics 35
Silverberg

Learning Objectives

Female Anatomy Uterus

•

•

•

• Identify the parts of the female reproductive system and the role these organs play in human reproduction
• Explain the process of folliculogenesis and the hormonal feedback mechanism that drives this process
• Discuss factors that can influence the menstrual cycle and strategies to improve reproductive efficiency
• Contains and nourishes the fetus during pregnancy
Contracts during labor resulting in childbirth
The endometrium develops every month and sloughs if pregnancy does not occur Fallopian tubes
Transport the ovum from the ovary to the uterus and the sperm from the vagina
• Site of fertilization Ovaries
• Storage and development of ova (eggs)
- Menstrual Cycle Characteristics 36
• Production and secretion of estrogen & progesterone Silverberg
The Menstrual Cycle in 2 Minutes Hypothalamus Pituitary Gland Estrogen LH / FSH (+)(+) GnRH (+)(+) Ovary Hormones of Ovulation
- Menstrual Cycle Characteristics 37
Silverberg
Menstrual Cycle vs. Menstrual Cycles • There are actually 2 cycles occurring simultaneously: – Ovarian cycle • Follicular development, estradiol production, ovulation, progesterone production – Uterine cycle • Thickening in response to estradiol, stabilization and protein secretion in response to progesterone • Sloughing and regeneration if pregnancy fails to result • Maintenance of pregnancy – For successful pregnancy to result, these cycles must be SYNCHRONIZED Menstrual Cycle PhaseCycle Days Menstrual1-4 Follicular (ovary) Proliferative (uterine) 5-13 Ovulation~14 Luteal (ovary) Secretory (uterine) 15-28 Silverberg - Menstrual Cycle Characteristics 38
Cell Two Gonadotropin Theory FSH • Causes recruitment of the follicles • Stimulates granulosa cells (the estrogen-secreting cells within the Graafian follicle) • Responsible for selecting the dominant follicle LH • Stimulates theca cells to produce androgens which are then aromatized to estrogens by granulosa cells under the influence of FSH stimulation Folliculogenesis • Follicle: Small fluid-filled sac in the ovary 1. Primordial follicle 2. Primary follicle 3. Preantral follicle 4. Antral follicle Silverberg - Menstrual Cycle Characteristics 39
Two
Fertilization and Embryo Development Ovulatory Dysfunction • Incidence:40% of infertile women • Signs/Symptoms – Oligomenorrhea/polymenorrhea – Dysfunctional uterine bleeding – Short luteal phase • Causes: – PCOS – Thyroid disease – Pituitary tumor – Hyperandrogenism – Hyperprolactinemia – Extremes in wt loss/exercise – Obesity – Miscommunication between the hypothalamus and the pituitary Silverberg - Menstrual Cycle Characteristics 40
Documentation of Ovulation • Basal body temperature (BBT) • Luteal progesterone • Ovulation prediction kit/LH detection • Serial transvaginal sonography Ovulation Prediction Kit Silverberg - Menstrual Cycle Characteristics 41

Ovulation Prediction Kit

Day
FSH, E2,
PCOS)
hyperandrogenism,
–
DHEAS, 17-OHP
- Menstrual Cycle Characteristics 42
Hormonal Issues and Ovulatory Dysfunction • Ovulatory dysfunction: menstrual cycles are out of the normal range (25-35 days) • Initial work-up should include measurements of TSH, prolactin,
3
AMH, 2 hour GTT (if evidence of
• If evidence of
add:
Testosterone,
Silverberg
Miscommunication Between the Hypothalamus and the Pituitary • Responsible for most causes of ovulatory dysfunction • Disordered GnRH signals from hypothalamus to pituitary leads to irregular FSH and LH production causing irregular follicle growth, suboptimal LH surges and anovulation
Ovarian Syndrome • Affects 5-20% of women. Most common endocrine disorder of reproductive age women. • Diagnosis: – Chronic anovulation – Frequently accompanied by hyperandrogenism and/or hirsutism – Polycystic appearing ovaries on ultrasound – Presence of metabolic syndrome • Lack of ovulation results in continuous exposure of the endometrium to estrogen causing excessive thickening of the uterine lining • Metabolic syndrome is common in women with PCOS: – Abdominal obesity – Cholesterol abnormalities – Hypertension – Insulin resistance – Associated with an increased risk of insulin-dependent diabetes and heart disease Silverberg - Menstrual Cycle Characteristics 43
Polycystic
PCOS Diagnosis • Rotterdam criteria (2 of the following) – Anovulation – Hyperandrogenism – Polycystic ovarian morphology – Metabolic syndrome (2 hour GTT) Rotterdam ESHRE/ASRM Consensus workshop group. Fertil Steril.2004;81:19-25. Polycystic Ovarian Syndrome (PCOS)
Characteristics 44
Silverberg - Menstrual Cycle
of PCOS • Ovulation induction with clomiphene (CC) – If unsuccessful with CC, oral letrozole may be used • Medications that increase the body’s sensitivity to insulin, such as metformin if +metabolic syndrome • Gonadotropins can be used when CC and/or letrozole do not result in ovulation or pregnancy Hypothyroidism • Diagnosis: TSH level • Both hypo and hyperthyroidism can interfere with ovulation • Causes: Hashimoto’s (autoimmune) thyroiditis, iodine deficiency • Frequently hereditary • Cause of weight gain –but NOT all weight gain… • Treatment: Thyroxine
- Menstrual Cycle Characteristics 45
Treatment
Silverberg
Hyperprolactinemia • Prolactin: hormone secreted by anterior pituitary • Responsible for inducing lactation • Most common cause is pituitary adenoma – Micro – Macro – MRI to distinguish – Prolactin level/2x100% = likelihood of tumor – Other causes: Chest wall trauma, hypothyroidism, shingles, Cushing’s syndrome • Treatment is medical –dopamine agonists Transvaginal Ultrasound • Basic evaluation of ovaries, uterus, and maybe even the tubes • AFC, ovarian size/volume, masses/cysts • Fibroids/polyps/developmental abnormalities • Hydrosalpinges Silverberg - Menstrual Cycle Characteristics 46
• DHEAS-Adrenal • Testosterone –Ovary • Congenital Adrenal Hyperplasia – Due to defect in cortisol pathway leading to excessive androgen secretion Other Causes of Ovulatory Dysfunction: Age: Effect on Fertility • Women are most fertile in their 20s • Fertility gradually declines in the 30s, particularly after age 35 • Age related loss of fertility results from the gradual decline in quality and quantity of eggs Silverberg - Menstrual Cycle Characteristics 47
Hyperandrogenism

Pregnancy Rates by Patient Age

Miscarriage and Age

- Menstrual Cycle Characteristics 48
Silverberg

Egg Quality

Incidence

• Pregnancy rates decline/miscarriage rates increase with advancing maternal age • Frequency of genetic abnormalities (aneuploidy) increases with advancing maternal age • As quality declines, spindle apparatus is more prone to breakage, leading to aneuploid embryos • Most aneuploid embryos fail to implant or miscarry
Genesis Genetics –n=3518
tested
aCGH
of Aneuploidy Increases with Maternal Age Courtesy,
embryos
by
- Menstrual Cycle Characteristics 49
Silverberg
Egg Quantity • Diminished ovarian reserve (DOR): decreasing number of egg-containing follicles • DOR is usually age related – Natural loss of eggs (atresia) • High levels of FSH or estrogen/low levels of AMH indicate low ovarian reserve • Low antral follicle count (AFC) Oocyte Attrition Silverberg - Menstrual Cycle Characteristics 50
Reserve Tests CD 3 FSH, Estradiol, AMH • Normal – FSH <15, preferably <12 – Estradiol 20-50 – AMH >0.7, preferably >1.0 • FSH levels increase with decreasing reserve – The higher the level, the lower the reserve – Levels > 18 mIU/mL suggests a very low chance of pregnancy with IVF • AMH levels decrease with decreasing reserve – Difficult assay to perform so need to be familiar with the lab you use Basal FSH & E2 Variability 0 10 20 30 40 50 60 70 FSHEstradiol CD 2 CD 3 CD 4 CD 5 Hansen et al Hum Reprod 1996;11:486. Silverberg - Menstrual Cycle Characteristics 51
Ovarian

Antral Follicle Count

Smoking Decreases IVF Success

et al; Fertil Steril. 2012;98(6):1400-1406.
Characteristics 52
Pfeifer S, Fritz M, Goldberg J,
Silverberg - Menstrual Cycle
Body Weight: Outcome NormalOverweightObeseObeseMorbidly Obese BMI18.5-24.925-29.930-34.935-39.5>40 Clin Preg1.000.910.670.560.50 Spon Ab1.000.630.970.751.44 Live Birth1.001.060.230.660.51 1721 women, 1st cycle of IVF. Shah DK, et. al. Obstet Gynecol 118:63-70, 2011. Conclusions • Irregular menstrual bleeding is usually caused by ovulatory dysfunction • Cause is usually easy to determine • Workup: – Transvaginal sonogram (AFC, organ measurements) – Day 3 FSH, E2, AMH, TSH, Prl – IF indicated: • 2 hr GTT • DS, T, 17OH P4/pregnenolone • Pituitary MRI Silverberg - Menstrual Cycle Characteristics 53

The Infertility Work-up

Reproductive endocrinology infertility (REI) nurses working in centers and practices that provide assisted reproductive technology require an understanding of the infertility work-up for their female, male and transgender patients. The current REI nursing role focuses on patient education and patient preparation for testing and treatments, so understanding the foundations of the infertility work-up is imperative. Competency in this arena can serve to optimize patient support throughout the fertility journey.

The content of this presentation reviews the tests involved in the female, male, and transgender work-up with an emphasis on ovarian reserve, ovulatory dysfunction, uterine cavity and fallopian tube assessment, as well as the semen analysis. Adjunct tests that screen for genetic disease, infectious diseases, as well as other risk factors that could affect achieving a healthy pregnancy are reviewed.

The intent of this presentation is to provide sufficient information to REI nurses so that they are able and confident to guide their patients through the process of initial testing, interpretation of the results, and implications of the findings. The content aims to help REI nurses better function in their roles while contributing to increased proficiency and the quality of care delivered.

54

The

Infertility Work-up
Disclosure Information • Has no relationships to disclose • Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies Lesser - Infertility Work-up 55
Carol Lesser, MSN, NP-C Boston IVF Waltham, MA
Learning Objectives • At the conclusion of this presentation participants should be able to: – Explain the key tests in the female and male infertility evaluation – Prepare patients for their initial testing – Gain competency in interpreting test results for patients Female Infertility Work-up and Testing Starts with a thorough history and exam Lesser - Infertility Work-up 56
Patient History • Age/length of time trying to conceive • Gynecologic – Menstrual history – Surgical history • Obstetrical history • Medical history including medications, BMI • Family history • Lifestyle: diet, smoking, ETOH Infertility Evaluation • Ovulation/ovarian reserve • Uterus • Fallopian tubes • Sperm • Preconception testing Lesser - Infertility Work-up 57
Hormone Evaluation • “Day 3” estradiol, FSH, AMH • TSH, PRL, LH • Antral follicle count (AFC, BAF) • Androgens when indicated • POF patient: Fragile X, karyotype Ovarian Reserve Testing • “Day 3” Estradiol, FSH • Anti-Müllerian hormone level (AMH) • Antral Follicle Count (AFC) Lesser - Infertility Work-up 58
Day 3 Levels February 2022 • E2 407 • FSH 6.0 March 2022 • E2 25 • FSH 35.9 Antral Follicle Count Lesser - Infertility Work-up 59
Ovulation Assessment • Menstrual history • LH, Progesterone • TVUS may be indicated Other Testing • Infectious disease screening • Blood type and RH • CBC, Rubella, VZV • Genetic carrier screening • Gyn and Pap up-to-date Lesser - Infertility Work-up 60
Patient Exam • BMI • Vital signs • Thyroid • Androgen excess • General exam • Pelvic exam Uterine Cavity Evaluation • Hysterosalpingogram (HSG) • HyCoSy (FemVue) • Saline infusion sonogram SIS or SHG • 3D ultrasound • Office hysteroscopy • Diagnostic or operative hysteroscopy • Pelvic MRI Lesser - Infertility Work-up 61
Hysterosalpingogram (HSG) • Assess uterine cavity for shape and filling defects • Check for tubal patency Hysterosalpingogram (HSG) • Performed in the follicular phase • Absolute contraindications: pregnancy, pelvic infection, allergy to iodine – Pregnancy test should be done prior to x-ray • Risk of infection following HSG in those patients with confirmed distally blocked tubes • Prophylactic antibiotics should be given to women with
tubal disease (doxycycline 100 mg
x 5 days or
prior
or
test. D/C if normal. Azithromycin 1
Lesser - Infertility Work-up 62
known
po BID
)
to
day of
gm ok.
Assessing Tubal
What is the Diagnosis? Lesser - Infertility Work-up 63
Patency Normal HSG Tubal Obstruction HSG:

HSG: Unicornuate Uterus

HSG: Septate Uterus

64
Lesser - Infertility Work-up
Tubal Patency Evaluation • HSG • HyCoSy • Laparoscopy with chromotubation HyCoSy • Hysterosalpingo Contrast Sonography • In-office sonography • Cavity check for filling defects • Tubal patency assessment • Same timing as SIS or HSG Lesser - Infertility Work-up 65
(SIS or SHG)
Filling Defect Lesser - Infertility Work-up 66
Sonohysterogram
Sonohysterogram
SIS Filling Defect Laparoscopy • Surgical procedure • Diagnose & treat endometriosis • Remove adhesions • Address tubal factor • Remove or reduce septums, fibroids • Not routine Lesser - Infertility Work-up 67
Pelvic Ultrasound (TVUS) • Uterus – Fibroids • Ovaries – Antral follicle count (AFC) (BAF) – Assess follicular development – Cysts • Pregnancy monitoring Endometrial Biopsy • Not a standard test for most patients • May be indicated in anovulatory patients to r/o hyperplasia/EIN (endometrial intraepithelial neoplasia) • Helpful to r/o chronic endometritis • Checks for presence of CD-138, plasma cells Lesser - Infertility Work-up 68

Polycystic Ovary Syndrome (PCOS)

Male Infertility Work-up and Testing • Starts with a thorough history and exam

Lesser - Infertility Work-up 69
Evaluation of the Male • Sexual history • Urologic history • Surgical history • Medical history including STDs, febrile illness • Family history • Medications including anabolic steroids • Toxic exposure Semen Analysis • Volume 2-5ml • Count >20 mil/ml • Motility >50% • Morphology: abstinence affect – WHO vs Strict Kruger/>4 • Progression >2 (scale 1-4) • Presence of RBC/WBC Lesser - Infertility Work-up 70
Male Infertility Work-Up • Blood work – Hormonal evaluation when indicated – Infectious disease screening – Genetic screening • Referral to reproductive urologist as needed – Scrotal ultrasound as indicated – Advanced sperm assessment as indicated Semen Analysis Morphology Lesser - Infertility Work-up 71
Semen Analysis Concerns Advanced Maternal Age (Additional Testing) • PCP medical clearance • MFM obstetrical clearance • Additional screening including EKG, GTT, mammogram Lesser - Infertility Work-up 72
Transgender Considerations • Inclusive care • Use of pronouns • Staff training, all departments • Customize patient forms • Humility Fertility Preservation Patients • Cancer patients: fast track to retrievaltesting optional • Non-cancer patients: emphasis on ovarian reserve testing and counseling Lesser - Infertility Work-up 73

REI Nurses

• Your role is vital to patient’s ability to navigate through testing and treatment
Lesser - Infertility Work-up 74
• You are the bridge that connects patients to the complex web of information vital to their fertility journey

Optimizing Stimulation Protocols

ART really is an art. Ovarian stimulation involves a thorough understanding of the inner workings of the hypothalamic-pituitary-ovarian (H-P-O) axis and then, figuring out ways to manipulate it using some of the gonadotropins at our disposal. Unfortunately, clinicians are unable to change the physiology of the ovary or create gametes yet.

Currently, we are limited by the fact that women are born with a finite egg supply, determined in utero and utilized over decades. These eggs are arrested in development whilst they await their turn to enter the pool of developing follicles and fulfill their destiny. Following puberty, and maturation of the H-P-O axis, developing follicles get a chance to complete their journey of maturation and enter the race for ovulation. As one can see, the efficiency of this whole process is abysmal with only a fraction of the 5 million eggs that populate the ovaries ever having a chance to ovulate as a mature egg and getting a chance to be fertilized. Understanding how to manipulate this process to our advantage and maximize the yield of mature oocytes in a woman desiring to preserve her future fertility or achieve a pregnancy is critical to improving ART outcomes. Using all of the key gonadotropins and hormones (or antagonists/blockers), this presentation will review the use of FSH, LH (hCG), HCG, GnRH agonists and antagonists, estrogen and OCP pre-treatment, oral agents like estrogen receptor modulators or aromatase inhibitors and different ways of tricking Mother Nature to improve the odds.

75

Optimizing Stimulation Protocols

Kaylen

Silverberg, MD Medical

Managing Partner Texas Fertility Center Austin & San Antonio, Texas

Disclosure Information

• Has received research grants from Baxter

• Has received consulting fees from Baxter, Seikagaku, Serono

• Has served as a speaker for AbbVie, Myovant

• Is a co-founder and member of board of directors: Ovation Fertility

• Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, or therapeutic strategies

- Optimizing Stimulation Protocols 76
Silverberg
Learning Objectives • Explore the rationale for ovarian stimulation • Discuss, compare and critically evaluate the different medical options for ovarian stimulation • Review the published effectiveness (of lack thereof) of popular supplements for male and female infertility • Examine the mechanism of action by which effective supplements may affect fertility Agenda • Purpose of ovarian stimulation • Medications – Clomiphene – Letrozole – Metformin – OCPs – GnRH agonists and antagonists – FSH vs. hMG – Growth Hormone – DHEA – Other Adjuncts
- Optimizing Stimulation Protocols 77
Silverberg
What are the Purposes of Stimulation? • To obtain a greater number of oocytes by: – Expand the number of embryos – Improve likelihood of at least 1 euploid – Increase chances for pregnancy – Enhance possibility of embryo banking Inherent Inefficiency of IVF • 12 oocytes (12) • 75% fertilization (9) • 40-60% blast utilization rate (3-5) • 30-50% euploid (1-3) – Therefore, it takes about 9-12 eggs (depending on patient age) to produce 1 euploid blastocyst Silverberg - Optimizing Stimulation Protocols 78
Clomiphene Citrate • Oral medication –50 mg • 2 isomers – Estrogen agonist – Estrogen antagonist • Basically works by fooling hypothalamus and pituitary • Results in increased FSH (and LH) secretion Clomiphene Citrate (cont.) • Give x 5 days (3-7 vs. 5-9…) • Monitor for ovulation – LH kit – Sonography – P4 levels • If no ovulation, progesterone withdrawal (+/-) and increase dose next cycle • Can go up to 250 mg/day x 5-10 days Silverberg - Optimizing Stimulation Protocols 79
Clomiphene Citrate (cont.) • Ovulation rates up to 80% • Pregnancy rates 8-12%/cycle; cumulative rates of 55-60% in 6 cycles • Life table analysis: 95% of those who will conceive on CC do so within 6 cycles • Multiple pregnancy risk: 5-8% • Adverse effects: hot flashes, vaginal dryness, headache, mood swings, scotomata Letrozole • 3rd generation aromatase inhibitor • Oral medication 2.5-10 mg/day x 5 days • Blocks peripheral conversion of androgen to estrogen • Releases the hypothalamus and pituitary from negative feedback induced by estrogen – FSH increases – Increase in follicular development Silverberg - Optimizing Stimulation Protocols 80
Letrozole (cont.) • Initially proposed as alternative to clomiphene1 • Optimal dosage not determined • Similar results to clomiphene2 – 75% ovulation – Similar pregnancy rates (8-15%/cycle) – Similar miscarriage rates 1 Mitwally, Casper. Fertil Steril 2001;75:305-9. 2 Badawy, et al. Fertil Steril 2007. Letrozole Toxicity • Question of fetal toxicity previously limited use – Skeletal & cardiac abnormalities1 • Biljan (n=150 study patient deliveries vs. 36,000 control deliveries) • Other studies suggest no problems – Tulandi (n=911)2 – Forman (n=94 letrozole conceptions vs. 242 clomid conceptions vs. 94 spontaneous conceptions)3 1Biljan et al. Fertil Steril 2005. 2Tulandi et al. Fertil Steril 2006. 3Forman et al. J Obstet Gynecol Canada 2007. Silverberg - Optimizing Stimulation Protocols 81
Metformin • Oral biguanide • Works by: – decreasing insulin levels, increasing insulin sensitivity – decreasing androgens (free and total) – decreasing LH – increasing SHBG • Effective vs. hyperglycemia; does NOT cause hypoglycemia in euglycemic patients Metformin in the PCO IVF Patient • Prospective randomized trial • n=101 • Metformin 850 BID vs. placebo • Higher ongoing pregnancy rates – 38.5% vs. 16.3% (p<0.05) • Significantly lower OHSS – 3.8% vs. 20.4% (p<0.05) Tang et al. Hum Reprod 2006;21:1416. Silverberg - Optimizing Stimulation Protocols 82
Metformin (cont.) • Dosage 1500-2000 mg/day • Restoration of ovulation in 78-96% of patients1 • Enhances effect of clomiphene2 • Although Metformin with or without clomiphene improves clinical pregnancy rates, NO evidence of increased live birth rate in Cochrane Collaboration (2010)3 1 Homburg, Insler. Hum Reprod Update. 2002;8(5):449-62. 2 Vandermolen D, et al. Fertil Steril. 2001;75:310-15. 3 Tang, et al. Cochrane Database Syst Rev. 2010 Jan 20;(1):CD003053. OCPs? How About Before IVF? • Decreased incidence of cysts • Greater number of oocytes • Higher E2 levels • Possibly faster stimulation with less gonadotropin • Higher fertilization rates • BUT –can suppress ovarian response, especially in poor responders… Silverberg - Optimizing Stimulation Protocols 83
GnRH: Agonists vs. Antagonists •Antagonist – Block receptors rapidly – Competitive inhibition – Immediate suppression – Rapidly reversible – “Turn off light switch” •Agonist – 4-6 day “flare” – Down regulation of receptor – Slow suppression due to desensitization of pituitary – Slowly reversible – Light bulb “burns out” GnRH Agonists • Significantly lower cancellation rates – Block spontaneous LH surges • Enhanced scheduling flexibility • Greater # oocytes • More embryos • Higher pregnancy rates (2x)1 1 Hughes et al. Fertil Steril 1992;58:888. Silverberg - Optimizing Stimulation Protocols 84

GnRH Antagonists

•
advantages: – Shorter duration of treatment – Fewer injections, less discomfort – Lower dose of gonadotropins – Lower cycle cost – Lower incidence of OHSS – Rapid pituitary recovery
• Cochrane
1 – 5 studies – Lower delivery rates
antagonist
– 5% absolute treatment
every 20 couples treated,
one more pregnancy with agonist • Cochrane
2 – 27 studies – Significantly lower pregnancy/delivery rates with antagonist
1 Al-Inany et al, Hum Reprod. 2002;17:874. 2 Al-Inany et al, Cochrane Database Syst Rev. 2006;19:3. Silverberg - Optimizing Stimulation Protocols 85
Theoretic
Agonist vs. Antagonist: Data
review (2002)
with
0.79 (CI 0.63-0.99)
effect, so for
there will be
review (2006)
(p<0.05)
Antagonists
Donors • No differences in pregnancy rates in 2 trials – 1 prospective, randomized (n=148)1 – 1 retrospective (n=1036)2 1 Prapas et al. Hum Reprod 2005;20:1516. 2 Scott et al. 2008 UCLA IVF Course, unpublished data So, is There a Problem with GnRH Antagonists? • Agonists appear to be superior in fresh IVF cycles • Appears to be no difference in donor cycles • NO difference in FET cycles • Suggests a potential effect on the endometrium –never clearly demonstrated Silverberg - Optimizing Stimulation Protocols 86
GnRH
in
Why did Antagonist Cycles Become So Popular? • Fewer injections • Potentially less ovarian suppression • Shift to FET – Caused pregnancy rates to improve – Etiology? Recombinant FSH-only Protocols • Oocyte development can occur in absence of LH • Excessive LH may cause oocyte atresia • Estradiol production is limited • Endogenous LH appears to be adequate for oocyte development • The real ?: Do we make normal patients hypogonadal with GnRH-a or –ant?? – Probably NOT • Therefore, recombinant FSH alone works fine due to continued endogenous LH secretion
- Optimizing Stimulation Protocols 87
So,
Silverberg
Do We Need to Give LH in Addition to FSH? • Difficult question to answer as studies vary in design, protocol, dosing • May need if GnRH-a and OCPs suppress endogenous LH to hypothalamic levels • Since data suggest this doesn’t happen, probably no LH needed • So, why do >80% of cycles in US use LH? Meta-analysis #1: FSH vs. hMG • 5 RCT, > 2000 women, non-inferiority design • Clinical pregnancy rate higher with hMG (CI 1.03-1.44) • No difference in live birth rate • Non-inferiority demonstrated Van Wely et al Fertil Steril 2003;23:1086. Silverberg - Optimizing Stimulation Protocols 88
Meta-analysis #2: FSH vs. hMG • 7 RCT • 2159 women •Higher birth rates for hMG Coomarasamy et al Hum Reprod 2008;80:310. Meta-analysis #3: FSH vs. hMG • 42 RCT • 9606 women •No difference in: –Birth rates (rFSH vs. uFSH or hpFSH) –OHSS incidence •Small but statistically significant difference in : –Birth rates (rFSH vs. uhMG*) Van Wely M, et al Cochrane Summaries 2012:12;12. Silverberg - Optimizing Stimulation Protocols 89
Meta-analysis #4: FSH vs. hMG • 70 studies (all prospective, controlled) • Results: – FSH alone: higher # retrieved oocytes – No difference in # MII oocytes – Combo: greater number of embryos and higher implantation rate – Higher pregnancy rate with combo ONLY in GnRH agonist cycles Santi D et al Endocrine Abstracts 2017;49:1107. Supplements • FDA status – Approved – Exempt • Usually sold over the counter –or over the internet (no prescription required)
- Optimizing Stimulation Protocols 90
Silverberg
Male Fertility Supplements • 90 unique ingredients have been evaluated • 5 most commonly prescribed: – Vitamin E – Vitamin C – Zinc – Folic acid – Selenium Kuchakulla M, et al. Urology. Vol 136, Feb, 2020:133-41.
- Optimizing Stimulation Protocols 91
MaleInfertility
Silverberg
Male Fertility Supplements • 5 ingredients with the most supportive data: – Vitamin E – Vitamin C – Zinc – L carnitine – CoQ10 • Only 17% of ingredients had published data demonstrating positive effect • Evolution 60 and Conception XR had the highest scores Kuchakulla M, et al. Urology. Vol 136, Feb, 2020:133-41. Male Fertility Supplements –Critical Evaluation • 41 RCTs or meta-analyses • 18 ingredients had reported efficacy • 11 had at least 2 RCTs or 1 RCT and 1 meta analysis supporting efficacy: –Vitamin B1225 µg –Folic Acid400 µg –L arginine1.4 g –L carnitine1.0 g –N-Acetyl Cysteine600 mg –Vitamin C0.5 g –Zinc50 mg –Tribulus Terrestris250 mg –Alpha Tocopherol20 mg –EPA + DHA0.48 g –CoQ10200 mg Garolla A, et al. Nutrients. 2020 12:1472. Silverberg - Optimizing Stimulation Protocols 92
Popular Male Fertility Supplements with No Published Data Supporting Efficacy • Nettle DE • Glucosamine • Vitamin D • Niacin • Biotin • Manganese Garolla A, et al. Nutrients. 2020 12:1472. Meta-analysis Evaluating Medications and Supplements to Improve Spontaneous Pregnancy Rates in Idiopathic Male Infertility • Evaluated all RCTs from 1990-2021 – 65 studies, 7541 men • Drugs/supplements studied: – Medications • FSH, testosterone, clomiphene, letrozole – Supplements • Trace elements (selenium, zinc) • Vitamins (C,D,E, folic acid) • Energy supplements – Carnitine, CoQ10, fatty acids – Other • DHA, probiotics Li J, et al. Engineering. Accessed August, 2021 online. Silverberg - Optimizing Stimulation Protocols 93
of Action for Male Supplements • Act as antioxidants to protect sperm from damage from ROS – Zinc, selenium, carnitine, Vits C/E, CoQ10 • Regulation of mitochondrial bioenergetics – CoQ10 enhances energy production for sperm motility – Carnitine also enhances energy production Li J, et al. Engineering. Accessed August, 2021 online. Meta-analysis Evaluating Medications and Supplements to Improve Spontaneous Pregnancy Rates in Idiopathic Male Infertility • Findings: – Compared to placebo, carnitine plus vitamins increased SPR 3.7x – FSH and fatty acids significantly increased sperm concentration – SERMs (clomiphene) plus CoQ10 significantly increased sperm motility and normal morphology Li J, et al. Engineering. Accessed August, 2021 online. Silverberg - Optimizing Stimulation Protocols 94
Mechanisms

Female Infertility

Egg Quantity vs. Egg Quality • Many supplements have been demonstrated to increase egg quantity • None definitively improve egg quality (difficult to assess) • IMPORTANT that patients know the difference
- Optimizing Stimulation Protocols 95
Silverberg

Growth Hormone for

Folic Acid • 400 µg/day increases follicular fluid levels of folate and decreases homocysteine • Folic acid is critical for DNA synthesis, methylation, and protein synthesis • Proven to reduce the risk of neural tube defects • Not proven to enhance LBR
IVF-Early Metaanalyses
• Cochrane Review • 6 PR trials
• No effect on stimulation parameters
• Higher live birth rates (CI 1.06-18.01)1
• Women >40: PR study
2
• Higher E2, delivery rate 22% vs. 4% (p<0.05)
availability,
• Expensive,
safety?
Harper et al. Cochrane Database System Rev.2003, issue 3
Tesarik et al. Hum Reprod 2005;20:2536. Silverberg - Optimizing Stimulation Protocols 96
• Not effective for poor responders 1
2

Growth Hormone for IVF-Australian LIGHT Study

• <41 years of age

• Previous poor response (< 6 oocytes in previous IVF cycle)

• FSH <15

• Pros, randomized – A: 12 IU GH starting stim day* – B: Placebo

• GH treated patients:

– higher likelihood of TVOR (95.4% vs. 78.5%; 5 vs. 4 oocytes) – NO difference in embryonic development, likelihood of ET, pregnancy (14.5 vs. 13.7%)

1*Norman R, et al. Reprod Biomed Online. 38:908-15. 2019.

Growth Hormone for IVF-Latest Metaanalyses

• 12 RCTs, 1139 patients –20201

• Higher number of retrieved oocytes than placebo

• More embryos available for ET

• NO increase in LBR, no diff in SAb rate

• 15 RCTs, 1448 patients -20202

– Higher LBR (OR 1.74; CI 1.19-2.54), # oocytes, reduced cycle cxl, gonadotropin dose

– No difference in miscarriage rate

1 Cozzolino et al Fertil Steril 114;97-109. 2020.

2 Yang P , et al. Reprod Biol and Endocrin18;76. 2020.

- Optimizing Stimulation Protocols 97
Silverberg
• Adrenal androgen –precursor for estradiol production • Mechanism of action to improve fertility unknown • Possibilities: – Increases IGF-1 expression, sensitizing granulosa cells to exogenous FSH – Increases intrafollicular androgen causing an increase in AMH expression and Inhibin B production (related to DHEA duration)1 – Improves embryo ploidy – Promotes pre-antral follicle growth, suppresses apoptosis • 2010 survey reported that >25% of IVF specialists used DHEA for poor responders2 1 De Macedo et al.2018. 2 Nardo L, et al Upsala J Med Sci. 125. 2020. Vitamin D3 • Included in 30% of supplements • Involved in AMH secretion, so potentially relevant • NO effect on IVF outcome Cozzolino M, et al. Fertil Steril 2020.114:1014-25. Silverberg - Optimizing Stimulation Protocols 98
DHEA

DHEA

• P, R trial, n=33 (51 cycles) 1

• 75 mg/d DHEA

• Delivery 23% vs. 4% (controls, p<0.05)

• “We would like to present how insufficient the current evidence of acceptable quality is to warrant a conclusion that DHEA supplementation is an effective treatment for women with diminished ovarian reserve. More studies needed…”2

1 Wiser, et al. Hum Reprod.2010;25:2496.

b2Yakin and Urman Hum Reprod Online, May 18,2011.

DHEA –Review Articles and Meta-analysis

• Extensive review article by Malasevskaia, et al highlighted poor study design and conflicting data1

• Meta-analysis (6 RCTs, 745 patients)2 demonstrated:

– Significant increase in clinical pregnancy rate (OR =1.45, CI 1.04-2.03, p<0.05)

– Significant increase in LBR (OR=2.7, CI 1.24-5.85, p=0.01)

– No effect on miscarriage rate (OR=0.43, CI 0.03-6.7, p=0.55)

1 Malasevskaia I, et al. J Mid East and N Africa Sciences. 7(04); 6-18. 2018.

2 Liu Y, et al. Gynecol Endocrinology; 178-83.2018.

Silverberg - Optimizing Stimulation Protocols 99

Heparin

• Blocks formation of thrombi at implantation site by inhibiting Factor X

• Conflicting data from meta analyses due to poor statistical methodology, small sample sizes

• Some studies DO suggest improvement in LBR, but data remain inconclusive Akhtar M, et al. Fertil Steril. 103:33-4. 2015 .

Aspirin

• Inhibits platelet aggregation, improves blood flow to the ovaries and uterus • Meta-analysis did not show improved LBR in IVF1

• Cochrane review –13 RCTs2 – No improvement in pregnancy rates or LBR

As an aside…

• Latest Cochrane review for RPL patients showed no benefit of ASA with or without low molecular weight heparin (enoxaparin, LMWH) in patients with or without thrombophilia3 1 Gelbaya T, et al. Hum Reprod Update 13:357-64. 2007 2 Siristatidis C, et al. Cochrane DatabaseSyst Rev 2011;CD004832. 3 DeJong P, et al. Cochrane Database Syst Rev 2014;CD004734I.

Silverberg - Optimizing Stimulation Protocols 100

Sildenafil

• Vasodilator, improving blood flow to uterus

• Very poor quality data

• Small studies suggest occasional benefit but large, retrospective study demonstrated no improvement in endometrial thickness, endometrial blood flow, or LBR

Check J, et al. Clin Exp Obstet Gynecol 31:99-102. 2004.

Steroids

• Very difficult to assess due to multiple small studies using different drugs, different dosing regimens, different combinations, etc.

• Multiple proposed MOAs, all pointing to reduction in intrauterine inflammation

• Cochrane review of 14 RCTs:

– No benefit of glucocorticoids on LBR, and SAb rates when used in unselected IVF/ICSI patients1

• Some evidence that prednisolone (with LMWH) may improve LBR in patients with one or more failed IVF cycles2

1 Boomsma C, et al. Cochrane Database Syst Rev 2012;CD005996

2 Fawzy M, et al. Arch Gynecol Obstet289:677-80. 2014

Silverberg - Optimizing Stimulation Protocols 101

Intralipids

• Fatty emulsion of egg yolk, phospholipids, glycerine, soy bean oil, water

• Double blind, RCT of 296 RPL patients with elevated NK cells showed no difference in CPR

• Second study terminated early as control group did better than treatment group

• No substantive evidence demonstrating efficacy

Nardo L, et al. Upsala J Med Sci. 125;2:144-51. 2020.

IV Immunoglobulin (IVIG)

• Very poor data due to poor study design, multiple small uncontrolled trials

• Only 2 studies were RCT looking at RIF patients undergoing IVF

• No difference between study and control patients in terms of CPR or LBR

• No substantive data supporting its use

Li et al. Am J Reprod Immunol 70;434-47. 2013.

- Optimizing Stimulation Protocols 102
Silverberg
Myo-inositol • Most common ingredient in female supplements • Daily use of 4 mg reduces gonadotropin requirements; lower doses ineffective • Most supplements do not contain enough to be effective Lagana A, et al. Arch Gynecol Obstet 2018;298:675-84. CoQ-10 • Free radical scavenger • Meta-analysis, but only included 1 RCT of CoQ 10 • Significant improvement in CPR vs. control (poor responders) (OR 2.2, CI (1.08-4.58)* • Significant reduction in cycle cancellation rate (OR 0.33, CI 0.150.74) * Zhang et al. Hum Reprod Update 26 (2):247-63. 2020. Silverberg - Optimizing Stimulation Protocols 103

Embryo Glue

IVF Lab Supplements/Techniques
2014;CD007421
- Optimizing Stimulation Protocols 104
• It is hyaluronan -NOT glue • Glycoprotein that raises viscosity in uterine cavity • Cochrane review of 17 RCTs, 2898 patients*: – Moderate quality evidence for an improvement in LBR – Increased risk of twins *Bonetkoe S, et al. Cochrane Database
Silverberg

Assisted Hatching

• Used for over 20 years

• Mechanical or chemical disruption of zona

• Designed to facilitate embryo hatching as well as paracrine effects between embryo and endometrium

• Meta-analysis of 36 RCTs, 6459 patients

– No increase in LBR

Li D, et al. Sci Rep 6:31228, 2016.

Intentional Endometrial Injury (“Scratch”)

• Theory is that injury promotes production or secretion of growth factors and other cytokines

• Obvious problem is that injury doesn’t occur in same cycle as transfer; “injured” endometrium shed in preceding cycle…

• RCT demonstrated no benefit or improvement in LBR

Lensen S, et al. N Engl J Med 380:325-34.2019.

-
Protocols 105
Silverberg
Optimizing Stimulation
Conclusions • Never ending search for anything to improve LBR with IVF • Some medications for male fertility are beneficial: – FSH, clomiphene citrate Conclusions: Male Fertility Supplements • Over 90 supplements scientifically evaluated • Good data support the use of up to 11 supplements • Vitamins: B12, C, E? • Others: – Folic acid, L-carnitine, L-arginine, N-acetyl cysteine, CoQ10, zinc, EPA+DHA, tocopherol • Many popular supplements lack any supporting data – Glucosamine, Vit D, biotin, niacin Silverberg - Optimizing Stimulation Protocols 106
Conclusions: Female Fertility Supplements • Proven Benefit: None at this time • Unclear but potential benefit: – DHEA, CoQ10, growth hormone, LMWH, Prednisolone, myo-inositol • Unlikely benefit: – Aspirin, sildenafil, glucocorticoids, intralipids, IVIg Conclusions: Laboratory Techniques • Proven benefit: – Embryo glue • Unlikely benefit: – Assisted hatching – Intentional endometrial injury/“scratch” Silverberg - Optimizing Stimulation Protocols 107

Genetics and ART

Clinical genetics is an integral component of reproductive medicine. Carrier screening and preimplantation genetic testing (PGT) are commonly offered genetic tests in the assisted reproduction setting. Carrier screening can help determine if a couple may be at an increased risk for a genetic disorder in their future offspring, and provide them with the opportunity to explore alternative reproductive options as needed. PGT-M may be available to test the couple’s embryos for a specific genetic disorder. In addition, PGT-A is an option to determine the chromosomal status of embryos prior to transfer. For intended parents using a gamete donor, consideration of that donor’s carrier screening results and family medical history is an important component of donor selection. Clinicians should consider referring patients to a genetics specialist, such as a genetic counselor, to discuss family medical history and genetic test results in the reproductive medicine setting.

108
Genetics and ART
Disclosures • Full-time employee of Generate Life Sciences, a company providing donor gamete services • Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies Isley - Genetics & ART 109
Lauren J. Isley, MS, CGC Genetic Counselor Medical Science Liaison, Generate Life Sciences Los Angeles, CA
Objectives • Discuss basic genetic concepts • Recognize common genetic tests in the ART setting • Evaluate common genetics issues that may arise in the ART setting and when referrals are appropriate • Review current issues and topics in the field of clinical genetics Genes and Chromosomes: Back to the Basics • Humans have 46 chromosomes – “Euploid”vs. “aneuploid” • Each human chromosome is consisted of a continuous DNA double helix • Genes: Segments of DNA which code for protein or functional products • 2 chromosome copies = 2 gene copies (the majority of the time) • Mutations/copy number changes may cause genetic disease Isley - Genetics & ART 110
Learning
Cytogenetic Disorders • Refers to an abnormal number of chromosomes • Trisomy 13, 18, 21 • Sex chromosome abnormalities • Unbalanced translocations •Refers to diseases caused by gene mutation(s) •Mutation:genetic change that is generally disease-causing •Mutation may be in one or both genes •Gene cannot produce functional product -> phenotype of disease •Examples: Cystic fibrosis, Sickle cell anemia, Huntington disease Single Gene Disorders vs. Patterns of Inheritance • Autosomal recessive – Most recognized in ART setting • Autosomal dominant • X-linked (dominant and recessive) • Multifactorial Isley - Genetics & ART 111
Multifactorial Genetics • Complex interactions between a number of genetic and environmental factors • Risk figures are empirically derived – Familial aggregation, twin studies, degree of relationship • Type 1 diabetes, Alzheimer’s disease (some rare exceptions) , mental illness, certain congenital malformations • “Can you test my embryos for…..?” Uhlmann W., Schuette J., Yashar B. (2009). A Guide to Genetic Counseling, 2nd edition. Wiley-Blackwell. Genetic Testing in ART: Infertility Evaluations • Karyotype analysis – Infertility/recurrent SAB – Rule out chromosome rearrangement or sex chromosome disorder (i.e. Klinefelter syndrome) • Fragile X carrier screening – POF • Cystic fibrosis – CBAVD in men • Others – Thrombophilia panels, Y chromosome deletion, rare genetic syndromes, etc. Shah, K. (2003). The genetic basis of infertility. Reproduction, 126(1), pp.13-25. Isley - Genetics & ART 112
Genetic Testing in ART: Carrier Screening • May include autosomal recessive or X-linked conditions • Certain diseases recommended by ACOG/ACMG – Limited panels vs. expanded carrier screening panel • Targeted mutation analysis vs. gene sequencing – Detection rate of test? Committee Opinion No. 690 Summary. (2017). Obstetrics & Gynecology, 129(3), pp.595-596. Committee Opinion No. 691 Summary. (2017). Obstetrics & Gynecology, 129(3), pp.597-599. Detection Rates • If an individual is a carrier of a disorder, what is the chance that the test will detect a mutation? • Determining detection rate – Test methodology (genotyping vs. sequencing) – Patient’s ethnicity Isley - Genetics & ART 113
Test Methodologies • Targeted mutation analysis (genotyping) • ATGCGTAGTTCCAAATCTGTCGAGAAGTTT • Full gene sequencing • ATGCGTAGTTCCAAATCTGTCGAGAAGTTT • Deletion/duplication analysis • ATGCGTAGTTCC GAAGTTT • OR • ATGCGTAATGCGTAGTTCCAAATCTGTCGAGAAGTTT PGD (diagnosis): single gene disorders PGS (screening) or CCS: aneuploidy Old nomenclature PGT-M (monogenic): single gene disorders PGT-SR (structural rearrangements): translocations, inversions, etc. PGT-A (aneuploidy) New nomenclature Genetics in ART: Preimplantation Genetic Testing Isley - Genetics & ART 114
Trophectoderm biopsy & embryo cryopreservation Genetic testing of biopsied cells PGT-M custom test development (“probe”) Controlled ovarian hyperstimulation & oocyte retrieval Fertilization (ICSI often recommended or required, especially for PGT-M) 1 2 3 Embryo culture to blastocyst stage Embryo warming & transfer into uterus 4 5 6 7 Overview of IVF/PGT Process PGT-M: What is Required? • Known variant/mutation • Development of linkage-based test (“probe”) – Patient’s parents often need to pursue clinical genetic testing and provide additional DNA samples (cheek swabs) to the PGT laboratory – Typically takes ~2-3 months to complete once all necessary reports/samples are received by PGT lab Isley - Genetics & ART 115
Complex Issues in PGT-M • PGT-M for adult-onset conditions • PGT-M for variants of uncertain significance • PGT-M for diseases with reduced penetrance or mild presentation Evolution of PGT-A Technologies Previous downfalls: •D3 biopsy effects on implantation & accuracy •Limitations of FISH Currently: •More cells, more accurate •Reduced impact of TE biopsy •Improvements in freezing/thawing Polar bodyBlastomere Trophectoderm Isley - Genetics & ART 116
Mosaicism in PGT-A • Increased detection of mosaicism with TE biopsy and NGS • ICM/TE concordance is high for euploid & aneuploidy but significantly lower for mosaic results From Yang et al (2015) BMC Med Genomics NGS aCGH +7 +7, +12 [mos] “MOSAICISM” = INTERMEDIATE COPY NUMBER Inner Cell Mass (fate: fetus) Trophectoderm (fate: placenta) Mosaicism in PGT-A: Counseling Considerations • PGDIS Position Statement on Transfer of Mosaic Embryos (2021) – Embryos with higher-level mosaicism may be associated with less favorable outcomes compared to lower-level mosaicism – A decision to transfer a mosaic embryo can be prioritized either on the level of mosaicism or type of mosaicism (whole chromosome vs. segmental changes) • Current ASRM counseling recommendations state: – Patients considering transfer of a mosaic embryo should consult with a clinical genetics specialist, such as a genetic counselor – Counseling should include a discussion of the various possible explanations for mosaic PGT-A results and potential outcomes – A decision regarding transfer of an embryo with mosaic results is optimally made with ample time for careful consideration of the risks, benefits, and alternatives – Prenatal genetic counseling is strongly recommended – Postnatal evaluation should be considered PGDIS POSITION STATEMENT ON THE TRANSFER OF MOSAIC EMBRYOS 2021 Isley - Genetics & ART 117
Genetics in ART: Gamete Donation • ASRM recommendations for gamete and embryo donation (updated 2021) – Includes exclusion criteria based on personal/family medical history and genetic testing results • Standard donor evaluations – 3-generation personal/family medical history by trained genetics professional – Carrier screening – Other indicated genetic tests • Evaluation of recipient When is a Genetics Referral Appropriate? • Counseling about any of these genetics issues! • Especially…. – Positive carrier testing results – Abnormal karyotype (translocation; Klinefelter syndrome) – Personal/family/pregnancy history of birth defects, ID, significant medical issues, known genetic condition – Evaluation of a gamete donor and/or recipient – PGT patients Isley - Genetics & ART 118
ART Genetics • Direct-to-consumer testing (DTC) • PGT for polygenic (multifactorial) diseases • Non-invasive PGT • Mitochondrial transfer (“3-parent IVF”) • Germline genomic editing • In-vitro gametogenesis Isley - Genetics & ART 119
Hot Topics in

Navigating Gamete Donation in Clinical Practice

Gamete donation in clinical practice in the US dates back to the 1800s when an anonymous sperm donor was used to inseminate a woman whose husband was azoospermic. Since then, the number of people using both egg and sperm donors has increased significantly. Statistics tracking donor inseminations are difficult to determine and the numbers are estimated to be considerably higher than what is reported in the literature.

There are 4 distinct stakeholders involved in the practice of gamete donation and the implications for each are quite different. Donor conceived offspring are often referred to as the “forgotten stakeholders” because their long-term needs for information about their means of conception and their donor histories were often not considered. Moreover, scientific advances in the realm of genetics have changed the landscape and instances of inadvertent disclosure are becoming commonplace. The industry as a whole is largely unregulated therefore; responsibility for the ethical practice falls on clinics to educate donors and recipients regarding the numerous complex issues involved. Donor conceived offspring are asking for changes in the way gamete donation is practiced, forcing all the stakeholders to examine their rights and responsibilities within the framework of third party reproduction.

120

Gamete

Donation in Clinical Practice
Disclosures • No financial relationships to disclose • Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies Jackson - Gamete Donation 121

Learning Objectives

• Review the history of donor insemination and oocyte donation

• List the indications for donor insemination and oocyte donation

• Describe the parties involved in gamete donation and the implications for each

• Evaluate the impact of at home DNA kits on the practice of gamete donation

• Explore outside influences that impact patient use and acceptance

122
Jackson - Gamete Donation

Historical Perspectives: Donor

Insemination

• Unofficial history claims that the first attempts to artificially inseminate a woman, were done by Henry IV (1425-1474), King of Castile, nicknamed The Impotent

• The first documented application of artificial insemination in a human was done in London in the 1770s byJohn Hunter, which has been called in medical history the “the founder of scientific surgery

• 1953 Dr. Jerome K.Sherman, an American pioneer in sperm freezing, introduced a simple method of preserving human sperm using glycerol

– Resulted in the first successful human pregnancy with frozen spermatozoa

Historical Perspectives: US Donor Insemination

• In 1909, a letter was published in Medical World claiming the first human donor insemination had been performed at the Jefferson Medical College in Philadelphia in 1884 by Dr. William Pancoast.

• The woman had no abnormalities her husband was azoospermic due to a case of gonorrhea from “sowing his wild oats in his younger days.”

• Dr. Pancoast discussed the case with his medical students (including Addison Hard who wrote the letter) and it was suggested that semen should be collected from the "best looking" member of the class, and used to inseminate the woman.

• Dr. Pancoast agreed to the experiment, and did not inform either the woman or her husband.

• The woman was anesthetized, the procedure carried out and it wasn't until it became evident that the woman had actually conceived that her husband was informed; he was pleased. At his request, his wife was never told how she became pregnant.

• Hard's letter went on to say that, as a result of this medical school experiment, the wife gave birth to a son, who became the first known child by donor insemination (DI).

Ombelet w & Van Robays J. Facts Views Vis Obgyn 2015; 7(2): 137–143.
Jackson - Gamete Donation 123
Gregoire AT & Mayer R. Fertil Steril 1965;16 (1): 130-134.

Historical Perspectives: Egg Donation

• The first birth using a donor egg was reported in 1984 from an egg fertilized in vivo

• An anonymous egg donor was inseminated, and then uterine lavage was performed at precisely the right time to recover the resulting embryo, which was transferred into the intended mother’s uterus

• Until the late 1980s laparoscopy was used to to retrieve donor eggs not the transvaginal approach currently used

Donor Insemination Statistics

• The US government does not track DI therefore the actual number of donor conceived offspring is not known

– Practice is shrouded in secrecy (still) so accurate estimates impossible to determine

– 30,000 to 60,000 annual births from donated sperm has been the figure used in the literature

• National Survey of Family Growth include women of childbearing age (15–44)

– In 2015–2017, 440,986 [95% CI: 108,458 –773,513] were estimated to have used donor insemination

– DI users were mostly White, urban, older, college-educated, and had high family incomes

Arocho R. et al. Fertil Steril. 2019 October ; 112(4): 718–723.

Bustillo M, Buster JE, Cohen SW, et al. JAMA 1984;251:889; Sauer MV. Fertil Steril 2018;110:981-987; Leeton J, Chan LK, Trounson A, Harman J. PJ. In Vitro Fert Embryo Transf 1986;3:379-382.
Jackson -
Donation 124
Gamete
Estimated Number of Women Reporting Having Used Donated Sperm or Mixed Husband/Partner with Donor Arocho R. et al. Fertil Steril. 2019 October ; 112(4): 718–723. SART Data 2020: Donor Eggs • Fresh – N: 1277 – LBR: 44.6% • Frozen – N: 2541 – LBR: 41.1% • Thawed Frozen Embryos – N: 13,649 – LBR: 47.2% https://www.sartcorsonline.com/rptCSR_PublicMultYear.aspx?reportingYear=2020#donor-fresh-egg Jackson - Gamete Donation 125

Indications for Donor Insemination

• Azoospermia, severe oligospermia, or other significant sperm or seminal fluid abnormalities

• Ejaculatory dysfunction

• IVF with ICSI is not elected or feasible

• Male partner has a significant genetic defect and the recipient also is known either to be affected or to be a carrier of it

• The recipient has previously produced an offspring affected by a condition and carrier status cannot be determined

• Male partner has an ineradicable sexually transmissible infection

• The female partner is Rh-negative and severely Rh-isoimmunized, and the male partner is Rh-positive

• Females without male partners

Fertil Steril. 2002(77):S5: 2-5.

Indications for Egg Donation

• Hypergonadotropic hypogonadism (Primary gonadal failure/Turners)

• Advanced reproductive age

• Diminished ovarian reserve

• Women who are known to be affected by or be the carrier of a significant genetic defect or who have a family history of a condition and whose carrier status cannot be determined

• Poor oocyte, and/or embryo quality

• Multiple failures in prior attempts to conceive by ART

• Single men/ same sex male couples

Practice Committee Volume 82, Supplement 1, 13-15 September 01, 2004.

-
Donation 126
Jackson
Gamete
Gamete Sources: Sperm • Commercial sperm banks – Approximately 2 dozen in the US – Options • Non-identified (anonymous) – Open – ID disclosure » Anonymous contact through the sperm bank – Approximately 1/3 of US sperm banks offer an open identity option • 2016 CA Cryo required all new donors to be either Open or ID disclosure • Directed/Identified (known) donors lamag.com/citythinkblog/sperm-bank-california-cryobank/ Gamete Sources: Eggs • Clinic recruited – Costly, labor intensive, <10% of candidates are accepted – Covid has had a significant impact on recruitment • Egg banks – Efficient, diverse inventories, multiple pricing options/guarantees, cycle synchronization unnecessary reducing the time to complete a cycle • Agencies – Costly but useful when patients are looking for specific characteristics/ethnicities – Clinic is responsible for screening • Identified/directed (known) Gorrill M, Johnson L, Patton P, Burry K. Fertil Steril 2001; 75: 400-04. Jackson - Gamete Donation 127

Donor Sperm Screening

Guidance regarding gamete and embryo donation Fertil Steril 2021; 115 (6):1395-1410.

Donor Egg Screening

Guidance regarding gamete and embryo donation Fertil Steril 2021; 115 (6):1395-1410.

Jackson - Gamete Donation 128

Parties Involved in Gamete Donation

Involved in Gamete Donation • Multiple players are involved in the process and each has its own perspective – Clinic – Donor – Recipient – Offspring ASRM Ethics Committee Opinion. Interests, obligations, and rights in gamete donation. Fertil Steril2019;111:664–70
Parties
• Affected parties have,
at times, competing interests” – These interests may give
to rights and corresponding obligations • Little
interests
rights
responsibilities
donors, recipients, and programs –
Jackson - Gamete Donation 129
“distinct but,
rise
consensus about how to balance conflicting
or define the
and
of
For this reason, it is especially important that programs are explicit about expectations regarding future information sharing and contact between donors and individuals born as a result of donation

Clinic Perspective

• Clinicians have an obligation to all the parties involved – Safety and well-being of the donor – Protecting the health of recipients

• Ethically obligated to screen donors for infectious diseases and genetic risk factors – Protecting the health of the unborn child

• Obligation to do this in the most ethical way possible – Definition of “ethical” may be interpreted differently

• Psychological screening over the phone once frowned upon now commonplace

• Establish an age limit for recipient

• Must be done in a cost efficient manner

• Managing patient expectations in light of information available to them from social media and Dr. Google

Recipient’s Perspective

• I can’t believe I’m considering this option • Who are the donors? – What’s their motivation? – How are they screened? – Do you validate the information they provide? – Do you do background checks? • What do my partner and I need to do? • What are my chances of taking home a baby?

Jackson - Gamete Donation 130

Recipient’s Perspective: Managing Their Expectations

• The ideal donor would be – Pretty/handsome – Smart – Athletic – Musically talented

https://www.cbsnews.com/pictures/ivy-leaguesperm-do-you-have-it/4/

To become a sperm donor, a guy must have lots of fast-swimming, well-formed sperm. But that's not all he needs. Potential donors are also judged on their personality and intelligence. It helps if you're an Ivy Leaguer. The ideal sperm donor stands six feet tall and has blond or brown hair, blue or green eyes and a "medium" complexion. Dimples? They're a plus!

Recipient’s

Perspective: Managing Their Expectations Majority would love twins… • Aware of increased maternal risks – Feel technology is good so the risks are low • Aware of increased risk of premature delivery • Avoid having to do another cycle • Avoid waiting lists • Like the idea of twins
Jackson - Gamete Donation 131
Ryan GL et al. Fertil Steril 2004;81(3):500–4. Mendoza R et al. J Reprod Infertil 2018; 19(3):167–173.

Recipients Perspective: Age cutoffs

New technologies and cultural shifts have created a booming cohort of wrinkled moms and dads with newborn babies. So why do older parents make so many people uneasy? By Lisa Miller

• “Old parents face a version of the judgment implicit here: They have no idea what they’re in for. More than that: This is just not right

• A new child may be a blessed event, but when a 50-year-old decides to strap on the Baby Björn, that choice is seen as selfish and overwhelmingly prompts something like a moral gag reflex. “

Is this the new normal?

ART: Advanced Reproductive Age

DISADVANTAGES

ADVANTAGES

• Better prepared

• Less stressed

• Better positioned economically

• Higher levels of education

• Happier parents

Myrskyla M et al. Gynakologe 2017: 50(10):767-772.

• Goes beyond the “natural” age limits to reproduce

• Unable to meet the emotional, financial, and physical demands of raising a child

• Greater likelihood that the children will suffer the loss of one or both parents before reaching adulthood

• Medical/obstetrical risks

• Increased germline DNA mutations (older fathers)

Zweitel JE. Fertil Steril 2015:104:513-9. Carslake et al. Nature Research 2019; 9:1-14.

Jackson - Gamete Donation 132

Recipient’s

•

•

•

•

•

Perspective: Age Cutoffs Why they’re needed:
Concerns
– Careful screening required – Adequate counseling
risks of complications
for the mother’s health
re:
Additional screening and clearances necessary
SET
strongly recommended
Discouraged/denied
underlying
in women 50 and over with
medical conditions & >55 regardless of health
Each
ASRM Ethics Committee Report: Oocyte or embryo donation to women of advanced age. Fertil Steril 2016; 106 (5): e3-7.
my Parents Too Old? https://www.bbc.com/news/57174993g
clinic determines what that age is
Are
Jackson - Gamete Donation 133
"Actually in many ways I think it's easier," she said. "I don't have such big expectations. I'm not concerned about external judgments and factors. It's just us and Jack and our day-to-day life. So far, so good."

Recipient Psychoeducational Counseling

• Psychoeducational consultation with a qualified licensed mental health professional who has training and education in third-party reproduction is strongly recommended for all parties involved in gamete donation

• Covering potential emotional, moral, ethical, and social implications of using a gamete donor

• If a directed donor is used there should be separate consultations done.

• Long-term impact on the family

• Needs of donor-conceived persons

• Grief and loss

• Limitations of donor screening

• Transition to parenthood

• Disclosure

Planned

Inadvertent • Challenges of anonymity and the implications for donor-conceived families because of:

Direct-to-consumer DNA testing

Technological advances

Social media, and the implications for donorconceived families

Donor Perspective

• Donation is not a one time event

Anonymity not guaranteed

Implications are far reaching

Ongoing communication is essential

Benefits recipient and offspring

May benefit the donor • There may be frozen embryos resulting from their donation

Issues of consanguinity • Possible donation of unused embryos to another recipient

–
–
–
–
–
•
•
–
–
-
Donation 134
•
–
Jackson
Gamete
Perspective • They may want contact with the recipient(s)/offspring • They may have an interest in knowing the cycle outcome but are usually not told • Have to be counseled about advances in genetics that may impact them • Advised that laws and circumstances may change • Promises of anonymity or future contact by offspring cannot be assured Donor Psychoeducational Counseling • Protects both the donor and recipient • Issues are complex and changing • Donors derive no benefit from medical treatment only financial • Different risk/benefit decision • Different ethical considerations Jackson - Gamete Donation 135
Donor

Offspring: Forgotten Part of the Equation?

Tough Questions

• What do we as a society owe donor-conceived children?

• Do recipient-parents have a duty to tell their donor-conceived child about his/her genetic origins?

• Should the identity of the donor be disclosed or remain anonymous?

• Does the child have a right to know their conception story and to receive information, including identifying information, about the donor?

• If a donor-conceived child has a right to know, who has the duty/responsibility to tell them about it?

Jackson - Gamete Donation 136

Rights of the Offspring

Rights

Offspring:

–
–
–
–
• Focus for clinics is to “overcome” fertility issues of the recipient
Recipients get to experience pregnancy
Child genetically related to one of them • Didn’t anticipate the effects on offspring
Need to know where they come from
Knowledge is essential to forming their identity • Clinics are complicit in the veil of secrecy that exists
https://www.donorkinderen.com/united-nations-2019 http://assembly.coe.int/nw/xml/XRef/Xref-XML2HTML-EN.asp?fileid=27680 Jackson - Gamete Donation 137
of the
International laws • United Nations Convention on the Rights of the Child (2019) – Donor-conceived people requested international and national frameworks and laws that ensure their right to access information about their origins and to preserve relations with their genetic and social families • Parliamentary Assembly of the Council of Europe (2019) – Approved Recommendation 2156 asking the Committee of Ministers to deliberate on the waiving of anonymity for all future human gamete donations in order to allow all children born through assisted reproductive technologies (ART) to know their origins

Why Disclose the Use of Donor Gametes?

• Avoid secrets that can strain the family relationships

• Avoid inadvertent disclosure that can be far more damaging than planned disclosure – Especially true in light of advances in genetic testing

Expanded carrier panels – At-home DNA kits

• Every child’s birth story is important to them – They don’t necessarily care what it is – They’ll want to hear it over and over again

• Knowing about the donor at an early age makes it a non-issue for the child – May be a much bigger issue for the parent

What Donor Conceived Offspring are Saying

Uprooted authorPeter Boni, who learned he was donor-conceived at age 49, lays out a “Donor-Conceived Bill of Rights” that demands, first and foremost, the end of anonymous donations and includes access to a donor’s medical records, limits on the number of offspring per donor, and consequences for outright fertility fraud.

“Can you point to any federal law that protects the rights of the donor-conceived child?” https://www.theatlantic.com/science/archive/2021/10/do-we-have-right-know-our-biological-parents/620405/

–
Hahn S, Craft-Rosenberg M. JOGGN 2002; 31: 283-93. Golombok S. Hum Reprod 1999; 13: 2342-47. Turner A, Coyle A. Hum Reprod 2000; 15: 2041-51.
Jackson - Gamete Donation 138

Donor Sibling Registry

DNA Testing Kits: Changed the Landscape Irrevocably for all Parties Involved

• DNA testing is readily available for anyone who can afford it thanks to 23andMe and Ancestry.com

– By the end of 2018 it was estimated that ~ 26 million individuals had taken an in-home DNA test

• Inadvertent disclosure of donor origins is becoming commonplace

• Donor anonymity is uncertain

Regalado,Antonio. "2017 was the year consumer DNA testing blew up." MIT TechnologyReview (Cambridge, MA)

February 12, 2018. https://www.technologyreview.com/s/610233/2017-was-the-year-consumer-dna-testing-blew-up/

Jackson - Gamete Donation 139

Factors that Influence the Use of Donor Gametes

Religious Attitudes

• About a third of American adults say in vitro fertilization is morally acceptable, according to aPew Research Study

• The conditions around IVF, mainly if donor sperm or eggs are used, can ignite debates, especiallyin faith circles

– ”Children become products instead of gifts”

• Catholics, Evangelicalsand Mormons are among those against using a sperm or egg donor

• Sunni Islam, the most dominant branch of the faith, is against using donors

• Increasing number of Muslims practicing ShiiteIslam usedonors, especially egg donors

• Chinese culture is strongly influenced by Confucianism, which accepts all forms of assisted reproduction that do not involve third parties

Pew Research Center, April 2, 2015. “The Future of World Religions: Population Growth Projections, 20102050”. http://www.pewforum.org/2015/04/02/religiousprojections20102050.

Salam HN & Salam NH. FactS ViewS ViS ObgyN, 2016, 8 (1): 33-48

Jackson - Gamete Donation 140

Media Influences

• The Center for Bioethics and Culture Network createdtwo documentaries about egg donation:

– Maggie’s Story & Eggsploitation

• Women talk about serious medical problems they developed after egg donationand how they felt used and abused by the process

• They maintain that egg donationviolates a woman’s rights in four ways:

– Coercing donors through ads "manipulative of young college-aged women”

– Focusing only on women with certain racial, physical and intellectual characteristics

– Not disclosing health risks neededfor “informed consent”

– Asking donors to remain anonymous

Q: Are we exploiting donors?

https://www.youtube.com/watch?v=jAMrwAGR3GA

Media Influences

• Our Father theNetflix documentary exposing Dr. Donald Cline, “the best infertility doctor in Indianapolis,"who secretly fathered dozens of his patients' children —and was only caught when one of those children attempted to connect with her half-siblings

• Number of offspring was at 94 and counting when the film aired

• Our Father’s main focus is on highlighting the lack of legal recourse afforded to the siblings and their parents

Jackson - Gamete Donation 141

Media Influences

“The sperm kings of America are exhausted. People are fed up with sperm banks,” said Kyle Gordy, 29. He invests in real estate but spends most of his time donating his sperm, free (except for the cost of travel), to women. He also runs a nearly 11,000-member private Facebook group, Sperm Donation USA, which helps women connect with a roster of hundreds of approved donors. His donor sperm has sired 35 children, with five more on the way.

Donors are going direct to customers. They meet with prospective mothers-to-be in Airbnbs for an afternoon handoff; Facebook groups with tens of thousands of members have sprung up.

https://www.nytimes.com/2021/01/08/business/sperm-donors-facebook-groups.html

Third Party Regulation: Do we Need it?

“The USA has often been characterized as the ‘wild west’ of the reproductive industry given its relatively lax and sparse regulation of third-party and assistedconception transactions. Unlike other nations which ban or strictly control practices such as surrogacy or gamete donation, the USA has no such federal legislation that regulates the rights and responsibilities of various players—from physicians and clinics to intended parents, donors and surrogates, and donorconceived children — involved in third-party assisted reproduction in the USA.”

“The permissive approach to assisted reproductive practices found in the USA fits within the dominant American cultural ideology of wariness about government interference in the ‘private’ sphere of the family.”

Markens S. J Law Biosci. 2016 Dec; 3(3): 666–672.

Jackson - Gamete Donation 142

ASRM Guidelines

•

•

• A task force of topic experts with varying levels of experience develop the guidelines

•

Follow rigorous developmental process based on documented, verifiable systematic reviews of the scientific literature
Summary statements include evidence-based recommendations intended to optimize patient care and guide medical practice
practice-documents/ Are ASRM Guidelines Necessary? YES! • We’re confronted on a daily basis with challenging situations • They provide a framework in a largely unregulated industry – Some posit this is an attempt by ASRM to prevent further involvement by the Federal government in a largely unregulated industry • Potential for abuse is great and ultimately the patient is the biggest loser • Have no teeth but they provide a framework Jackson - Gamete Donation 143
Reviewed every 5 years for currency or sooner if meaningful new data emerge http://www.asrm.org/news-and-publications/practice-committee-documents/additional-documents/asrm-

In Summary: Family 2022

• There are multiple parties involved in gamete donation

• Interests of these parties may have competing agendas

• Clinicians are facilitators and educators

• The interests of the offspring must be considered

IRMS Reproductive Medicine

Jackson - Gamete Donation 144

Confronting Compassion Fatigue & Burnout

Fertility nurses are in the profession of creating life and helping patients navigate a deeply personal and emotional journey. While this career path can be deeply rewarding it is also inherently challenging and difficult, both intellectually and emotionally. The world of assisted reproductive technology (ART) is increasingly complex and calls upon the IVF nurse to understand many complex disciplines entwined in the IVF experience. This is even more challenging given that we learn our craft on the job, implying a steep learning curve to understand all of the components of IVF nursing.

The patient’s experience, exacerbated by our current and protracted pandemic is intrinsically stressful and can place excess demands on the IVF nurse who has the majority of daily patient contact. The nurse is often overworked, can feel underappreciated, underprepared and overwhelmed with the demands and responsibilities of the job. Unfortunately, this can lead to compassion fatigue, burn out and staff turnover. This in turn leads to understaffing and higher than previously seen resignations and turnover. The COVID inspired “Great Resignation” means fewer nurses are willing to work in less than ideal work environments. While increasingly, individuals are looking for “ more meaningful’ work and certainly infertility nursing fits that bill, they are also interested in more flexible hours, virtual work when feasible, better wages and benefits that demonstrate appreciation for their service.

Our profession lends itself to a roller coaster of emotions, from moments of elation to times of disappointment and other times to grief, potentially placing us at risk of developing compassion fatigue. Compassion is intrinsic to nursing practice; therefore, none of us is immune to compassion fatigue. Fortunately understanding what puts us at risk for compassion fatigue can help prevent burnout and possibly worse, leaving our profession.

Recognizing the signs of compassion fatigue and understanding the universal nature of the mental health challenges of our particular filed can be useful. Sharing suggestions for how to navigate this common experience can offer nurses a foothold to incorporate the changes needed to improve the experience for both nurse and patient.

Strategies to mitigate compassion fatigue include creating open communication with coworkers and administrators to improve the work experience. This in turn should translate into better patient care and support. This includes valuing and promoting educational programs aimed at offering the nurse a deeper understanding of the foundational knowledge and principles of reproductive medicine and their role and responsibilities.

Our patients depend on our support and empathetic guidance. Before we can begin to take care of them, we must take care of ourselves However, it also requires systemic changes that concretely and materially show appreciation for the challenging work IVF nurses with better staffing, compensation and recognition of the vital role IVF nurses play in the patient experience and success with ART, realizing that happy nurses make happy patients. patients depend on your support and empathetic guidance. Before you

145
Disclosure Information • Has no relationships to disclose • Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies
Confronting Compassion Fatigue & Burnout Carol B. Lesser, MSN, NP-C Boston IVF Waltham, MA
146
Lesser - Compassion Fatigue & Burnout

Learning Objectives

• Define compassion fatigue and burnout in the field of fertility nursing and its signs and symptoms

• Discuss ways COVID-19 has worsened this issue

• Assess strategies to manage compassion fatigue in your work environment

• Recognize the unique contribution and critical role played by the IVF nurse and why this issue matters

Daily Awareness

“Every day, think as you wake up: Today I am fortunate to be alive. I have a precious human life. I am not going to waste it. I am going to use all my energies to develop myself, to expand my heart out to others, to achieve enlightenment for the benefit of all beings. I am going to have kind thoughts towards others; I am not going to get angry or think badly about others. I am going to benefit others as much as I can.”

Tenzin Gyatso, the 14th Dalai Lama

- Compassion Fatigue & Burnout 147
Lesser

Navigating Work with Compassion

“This is the real secret of life: to be completely engaged with what you are doing in the here and now. Instead of calling it work, realize it is play.”

Why We Choose This Work

Common reply: TO HELP OTHERS

• To help people through one of the hardest chapters in their lives

• I can think of no higher honor than helping people who place their trust in us to help them achieve the miracle of life

•

To be of service to those who are determined to become parents

• Because I went through this and I understand

Epicquotes, accessed 10/7/21.
- Compassion Fatigue & Burnout 148
Lesser
• The increasing complexity of what the IVF nurse must learn • The lack of formal training for this subspecialty • The global pandemic and “the great resignation’s” effect on how we practice
Challenges • Increasingly, IVF is a team sport with the IVF nurse on the front line – Volume of phone calls/emails – EMR demands – Financial stressors – COVID has made direct contact less frequent with patients and other staff
- Compassion Fatigue & Burnout 149
Challenges
Newer
Lesser

Challenges We Face

Newer Challenges

We often have to deliver bad news, sometimes repeatedly
Patients ask us to explain why the cycle was not successful
Our patients’ stress can become our stress
•
•
•
• Patient turnover • Staff turnover • Both are affected by nursing job satisfaction • Both can be impacted by improving the work environment for the nurse
nurses
happy patients”
& Burnout 150
“Happy
make
Lesser - Compassion Fatigue

The Patient Experience

•

•

•

A Patient’s Perspective

What I wish IVF nurses understood about their patients:

• “A simple kindness makes all the difference. The nurse who looked at me with a smile put me at ease. The nurse who gave an extra minute of patience to answer my questions calmed my racing mind.”

Increasing levels of anxiety and depression
COVID has heightened these concerns
Requires increased empathy
Lesser - Compassion Fatigue & Burnout 151

A Patient’s Perspective

•

“Infertility challenges our beliefs, faith and hope in the normal workings of our body and can leave us feeling broken and defective. It forces us to ask why do bad things happen to good people.”

• “It is empathy amidst the unknown. It’s feeling the nurse is genuinely rooting for me. It’s compassion amidst the chaos which makes the journey tolerable.”

The Compassion Dilemma

•

“Compassionate people are geniuses in the art of living, more necessary to the dignity, security, and joy of humanity than the discoverers of knowledge.”1

• Compassion fatigue may be the result of being so preoccupied with helping those in distress, that it causes extreme tension resulting in secondary traumatic stress for the helper.2

Albert Einstein Quote. AZ Quotes website. http://www.azquotes.com/quote/606131. Compassion FatigueAwareness Project website. http://www.compassionfatigue.org/ Lesser - Compassion Fatigue & Burnout 152

•

Key Triggers

Stressful situations in which nurses:

•

•

•

•

•

•Compassion
is
satisfaction
job
job-related distress that exceeds job satisfaction. •
1992
describe the
experience • Now applied to broad settings Compassion Fatigue: An Introduction. Gifts From Within website. http://www.giftfromwithin.org/html/What-is-Compassion-Fatigue-Dr-Charles-Figley.html Sheppard K. Am Nurs Today. 2016;11(1). https://www.americannursetoday.com/compassion-fatigue.
Compassion Fatigue Is Not New
fatigue
defined as a loss of
related to doing one’s
well or
Coined in
to
in-hospital
Signs and Symptoms of Compassion Fatigue Signs and Symptoms
Sadness and grief
Nightmares
Avoidance
Somatic complaints
Increased psychological
Changes
beliefs, expectations, assumptions
Detachment
Decreased intimacy
•
•
•
•
arousal •
in
•
•
Believe their actions would make no difference or never seemed to be enough
Experience workplace issues such as high patient census, heavy patient load, high acuity, overtime, and additional work days
Personally identify with the patients
Miss serious patient symptoms
Lesser - Compassion Fatigue & Burnout 153
Blame themselves for all problems

Beyond Compassion Fatigue

•Secondary traumatic stress describes the emotional distress that can occur when exposed to another person’s traumatic experience

•Burnout is a negative emotional reaction related to workplace stressors

“Mental stress associated with compassion fatigue is a leading determinant of intent to leave the profession.”

Theoretical framework: Structural Empowerment Theory (Kanter)

• The theory of structural empowerment suggest that empowering conditions give employees the ability to accomplish their work in a meaningful ways

• The absence of this structure creates a toxic work environment ripe for burn out

- Compassion Fatigue & Burnout 154
Lesser
The Great Resignation • While burnout manifests in individuals it originates in systems • Burnout leads to resignation. Costly on many levels. • Up to 47% of US health care workers plan to leave their positions by 2025 https://www.aamc.org/news-insights/medical-burnout-breaking-bad How Do You Feel? • Underappreciated • Selfless • Overworked • Valued • Stressed out • Motivated Lesser - Compassion Fatigue & Burnout 155
Solutions • Must go beyond yoga, meditation and mindfulness • Needs institutional solutions that truly support nurses • Requires engaged and compassionate leaders Biden-Harris Administration Awards $103 Million American Rescue Plan Funds to Reduce Burnout and Promote Mental Health and Wellness Among Health Care Workforce • January 2022 • National recognition of a worsening problem https://www.hhs.gov/about/news/2022/01/20/accessed June 20, 2022 Lesser - Compassion Fatigue & Burnout 156

Compassion Fatigue

• Fertility nurses are in the business of trying to create life and help patients navigate a deeply personal and emotional road

• What we do is inherently complex, challenging, and difficult, both intellectually and emotionally

• Patients depend on our support and empathetic guidance

• Before you take care of them, you must take care of yourself

Lesson from Air Travel Protocol

• As caring professionals, we need to adopt the same life saving approach as on airplanes

• Put your oxygen mask on first before caring for others

- Compassion Fatigue & Burnout 157
Lesser
Is Not Selfish • Create healthy boundaries – By using self-reflection and slowing your response when others invade personal boundaries, you can address the issues with professional and courteous responses • Seek help from a mentor, supervisor, or charge nurse – Consider reducing overtime or changing job assignment • Adopt replenishing strategies to promote physical, emotional, and spiritual well-being while making improvements to how the practice is organized Workplace Support • Increased staffing and pay • Tangible displays of appreciation: a little goes a long way but more than ice cream breaks • Intensive orientation tailored to your practice • Initial emphasis on the basics and eventually training in IVF cycle co-management
- Compassion Fatigue & Burnout 158
Self-Care
Lesser
It Takes a Village • Develop and execute a formalized on-the-job training/mentorship programs from day one • Refer complex cases to those more experienced • Experienced nurses nearing retirement need to pass the baton of their knowledge and experience on to the newer fertility nurses Don’t Take It Personally • Never blame the victim • Non-reactivity • Don’t make assumptions • Offer suggestions and solutions when possible • Seek the support of a colleague or ask a colleague to intervene
- Compassion Fatigue & Burnout 159
Lesser

Workplace

•

•

•

•

•

Kindness

“Our prime purpose in this life is to help others. And if you can’t help them, at least don’t hurt them.… This is my simple religion. There is no need for temples; no need for complicated philosophy. Our own brain, our own heart is our temple; the philosophy is kindness. Be kind whenever possible. It is always possible.”

Tenzin Gyatso, the 14th Dalai Lama

Wellness programs
into fertility centers
and
Support •
embedded
promote physical
psychological health
Weekly
programs
mind/body
Nutrition, yoga, acupuncture, and counseling services
Team
to
meetings
improve the collective experience
Employee
cream
recognition programs, gift cards NOT ice
Providing
a relaxation refuge
-
Fatigue & Burnout 160
Lesser
Compassion

Kindness to Self

• Be kind to yourself

• Remember why you chose this profession

• Understand and clarify your personal boundaries

• Verbally express your needs

• Take positive action to make changes in your environment and work together

Summary

• Importance of networking and sharing our best experiences in the service of providing the best care possible to our patients

• Our work is intrinsically stressful. The challenge is how to work together to improve the experience for both nurse and patient.

• “Choose a job you love and you will never have to work a day in your life.”

Confucius Thank you for all that you do!

Lesser - Compassion Fatigue & Burnout 161

Turn static files into dynamic content formats.

Create a flipbook