REI 101: Introduction to Genetics and ART
Lauren Isley, MS, CGC Generate Life Sciences Los Angeles, CA
Disclosures • Full-time employee of Generate Life Sciences, a company providing donor gamete services • Will not be discussing or referring to unlabeled/unapproved uses of drugs, devices, products, protocols, or therapeutic strategies
Learning Objectives • Discuss basic genetic concepts • Recognize common genetic tests in the ART setting • Evaluate common genetics issues that may arise in the ART setting and when referrals are appropriate • Review current issues and topics in the field of clinical genetics
Genes and Chromosomes: Back to the Basics • Humans have 46 chromosomes – “Euploid” vs. “aneuploid”
• Each human chromosome is consisted of a continuous DNA double helix • Genes: Segments of DNA which code for protein or functional products • 2 chromosome copies = 2 gene copies (the majority of the time) • Mutations/copy number changes may cause genetic disease
Cytogenetic Disorders
Single Gene Disorders
vs.
•
Refers to an abnormal number of chromosomes
•
Trisomy 13, 18, 21
•
Sex chromosome abnormalities
•
Unbalanced translocations
• Refers to diseases caused by gene mutation(s) •
Mutation: genetic change that is generally disease-causing
• Mutation may be in one or both genes • Gene cannot produce functional product -> phenotype of disease • Examples: Cystic fibrosis, Sickle cell anemia, Huntington disease
Patterns of Inheritance • Autosomal recessive – Most recognized in ART setting
• Autosomal dominant • X-linked (dominant and recessive) • Multifactorial
Multifactorial Genetics • Complex interactions between a number of genetic and environmental factors • Risk figures are empirically derived – Familial aggregation, twin studies, degree of relationship
• Type 1 diabetes, Alzheimer’s disease (some rare exceptions) , mental illness, certain congenital malformations • “Can you test my embryos for…..?”
Uhlmann W., Schuette J., Yashar B. (2009). A Guide to Genetic Counseling, 2nd edition. Wiley-Blackwell.
Genetic Testing in ART: Infertility Evaluations •
Karyotype analysis – Infertility/recurrent SAB – Rule out chromosome rearrangement or sex chromosome disorder (i.e. Klinefelter syndrome)
•
Fragile X carrier screening – POF
•
Cystic fibrosis – CBAVD in men
•
Others – Thrombophilia panels, Y chromosome deletion, rare genetic syndromes, etc…
Shah, K. (2003). The genetic basis of infertility. Reproduction, 126(1), pp.13-25.
Genetic Testing in ART: Carrier Screening • May include autosomal recessive or X-linked conditions • Certain diseases recommended by ACOG/ACMG – Limited panels vs. expanded carrier screening panel
• Targeted mutation analysis vs. gene sequencing – Detection rate of test? Committee Opinion No. 690 Summary. (2017). Obstetrics & Gynecology, 129(3), pp.595-596. Committee Opinion No. 691 Summary. (2017). Obstetrics & Gynecology, 129(3), pp.597-599.
Detection Rates • If an individual is a carrier of a disorder, what is the chance that the test will detect a mutation? • Determining detection rate – Test methodology (genotyping vs. sequencing) – Patient’s ethnicity
Test Methodologies • •
Targeted mutation analysis (genotyping) ATGCGTAGTTCCAAATCTGTCGAGAAGTTT
• •
Full gene sequencing ATGCGTAGTTCCAAATCTGTCGAGAAGTTT
• • • •
Deletion/duplication analysis ATGCGTAGTTCC GAAGTTT OR ATGCGTAATGCGTAGTTCCAAATCTGTCGAGAAGTTT
Estimating Risks • Pre-test/prior risk – Carrier frequency in that ethnic group
• Post-test/residual risk: – Chance that an individual is actually a carrier for that condition, even with a negative screening result
• Reproductive risk: – Chance that an offspring of a couple will be affected with the disorder (for AR inheritance – always multiply by 1/4)
Genetics in ART: Preimplantation Genetic Testing Old nomenclature PGD (diagnosis): single gene disorders PGS (screening) or CCS: aneuploidy
New nomenclature PGT-M (monogenic): single gene disorders PGT-SR (structural rearrangements): translocations, inversions, etc. PGT-A (aneuploidy)
Overview of IVF/PGT Process 1 2
PGT-M custom test development (“probe”)
Controlled ovarian hyperstimulation & oocyte retrieval
Embryo culture to blastocyst stage
Trophectoderm biopsy & embryo cryopreservation
Genetic testing of biopsied cells
3
Fertilization (ICSI often recommended or required, especially for PGT-M)
Embryo warming & transfer into uterus
4 5 6 7
PGT-M: What is Required? • Known variant/mutation • Development of linkage-based test (“probe”) – Patient’s parents often need to pursue clinical genetic testing and provide additional DNA samples (cheek swabs) to the PGT laboratory – Typically takes ~2-3 months to complete once all necessary reports/samples are received by PGT lab
Evolution of PGT-A Technologies
Previous downfalls: •D3 biopsy effects on implantation & accuracy •Limitations of FISH
Polar body
Blastomere
Trophectoderm
Now: •More cells, more accurate •Reduced impact of TE biopsy •Improvements in freezing/thawing
Mosaicism in PGT-A • •
Increased detection of mosaicism with TE biopsy and NGS ICM/TE concordance is high for euploid & aneuploidy but significantly lower for mosaic results
aCGH
+7 “MOSAICISM” = INTERMEDIATE COPY NUMBER
Inner Cell Mass (fate: fetus) NGS
+7, +12 [mos]
Trophectoderm (fate: placenta) From Yang et al (2015) BMC Med Genomics
Mosaicism in PGT-A: Counseling Considerations •
Patients considering transfer of a mosaic embryo should consult with a clinical genetics specialist, such as a genetic counselor
•
Counseling should include a discussion of the various possible explanations for mosaic PGT-A results and potential outcomes
•
A decision regarding transfer of an embryo with mosaic results is optimally made with ample time for careful consideration of the risks, benefits, and alternatives
•
Limited outcomes reported after transfer of an embryo with mosaic results seem to be reassuring; however, current data are limited and should be interpreted with caution
•
Prenatal genetic counseling is strongly recommended
•
Postnatal evaluation should be considered, particularly if prenatal diagnostic testing is declined
Genetics in ART: Gamete Donation • ASRM recommendations for gamete and embryo donation – Includes exclusion criteria based on personal/family medical history and genetic testing results
• Standard donor evaluations – 3-generation personal/family medical history by trained genetics professional – Carrier screening – Other indicated genetic tests
• Evaluation of recipient
When is a Genetics Referral Appropriate? • Counseling about any of these genetics issues! • Especially…. – Positive carrier testing results – Abnormal karyotype (translocation; Klinefelter syndrome) – Personal/family/pregnancy history of birth defects, ID, significant medical issues, known genetic condition – Evaluation of a gamete donor and/or recipient – PGT patients • Especially PGT-A mosaicism cases
Hot Topics in ART Genetics • Direct-to-consumer testing (DTC) • PGT for polygenic (multifactorial) diseases • Non-invasive PGT • Mitochondrial transfer (“3-parent IVF”) • Germline genomic editing • In-vitro gametogenesis