Publication Board
Editorial Board
Editor-in-Chief José Berenguer (Madrid), Autonomous University of Madrid
Juan Aguirre, Prince Edward Island University, Canada Ricardo Amils, Autonomous University of Madrid, Madrid, Spain Miguel A. Asensio, University of Extremadura, Caceres, Spain Shimshon Belkin, The Hebrew University of Jerusalem, Jerusalem, Israel Albert Bordons, University Rovira i Virgili, Tarragona, Spain Albert Bosch, University of Barcelona, Barcelona, Spain Javier del Campo, University of British Columbia, Vancouver, Canada Victoriano Campos, Pontificial Catholic University of Valparaíso, Chile Josep Casadesús, University of Sevilla, Sevilla, Spain Rita R. Colwell, Univ. of Maryland & Johns Hopkins Univ., Baltimore, MD, USA Katerina Demnerova, Inst. of Chem. Technology, Prague, Czech Republic Esteban Domingo, CBM, CSIC-UAM, Cantoblanco, Spain Mariano Esteban, Natl. Center for Biotechnol., CSIC, Cantoblanco, Spain Mariano Gacto, University of Murcia, Murcia, Spain Juncal Garmendia, Institute of Agrobiotechnology, Pamplona, Spain Olga Genilloud, Medina Foundation, Granada, Spain Steven D. Goodwin, University of Massachusetts, Amherst, MA, USA Juan C. Gutiérrez, Complutense University of Madrid, Madrid, Spain Johannes F. Imhoff, University of Kiel, Kiel, Germany Juan Imperial, Technical University of Madrid, Madrid, Spain John L. Ingraham, University of California, Davis, CA, USA Juan Iriberri, University of the Basque Country, Bilbao, Spain Roberto Kolter, Harvard Medical School, Boston, MA, USA Germán Larriba, University of Extremadura, Badajoz, Spain Rubén López, Center for Biological Research, CSIC, Madrid, Spain Bernard M. MacKey, University of Reading, Reading, UK Michael T. Madigan, Southern Illinois University, Carbondale, IL, USA Beatriz S. Méndez, University of Buenos Aires, Buenos Aires, Argentina Diego A. Moreno, Technical University of Madrid, Madrid, Spain Ignacio Moriyón, University of Navarra, Pamplona, Spain Juan A. Ordóñez, Complutense University of Madrid, Madrid, Spain José M. Peinado, Complutense University of Madrid, Madrid, Spain Antonio G. Pisabarro, Public University of Navarra, Pamplona, Spain Carmina Rodríguez, Complutense University of Madrid, Madrid, Spain Fernando Rojo, Natl. Center for Biotechnology, CSIC, Cantoblanco, Spain Manuel de la Rosa, Virgen de las Nieves Hospital, Granada, Spain Carmen Ruiz Roldán, University of Murcia, Murcia, Spain Claudio Scazzocchio, Imperial College, London, UK James A. Shapiro, University of Chicago, Chicago, IL, USA John Stolz, Duquesne University, Pittsburgh, PA, USA James Strick, Franklin & Marshall College, Lancaster, PA, USA Gary A. Toranzos, University of Puerto Rico, San Juan, Puerto Rico Antonio Torres, University of Sevilla, Sevilla, Spain José A. Vázquez-Boland, University of Edinburgh, Edinburgh, UK Antonio Ventosa, University of Sevilla, Sevilla, Spain Tomás G. Villa, Univ. of Santiago de Compostela, Santiago de C., Spain Miquel Viñas, University of Barcelona, Barcelona, Spain Dolors Xairó, Biomat, S.A., Grifols Group, Parets del Vallès, Spain
Associate Editors Mercedes Berlanga, University of Barcelona Mercè Piqueras, Catalan Association for Science Communication Wendy Ran, International Microbiology Secretary General Jordi Mas-Castellà, International Microbiology Managing Coordinator Carmen Chica, International Microbiology Specialized Editors Josefa Antón, University of Alicante Susana Campoy, Autonomous University of Barcelona Ramón Díaz, CIB-CSIC, Madrid Josep Guarro, University Rovira i Virgili Enrique Herrero, University of Lleida Emili Montesinos, University of Girona José R. Penadés, Inst. of Mountain Livestock-CSIC, Castellon Jordi Vila, University of Barcelona Digital Media Coordinator Rubén Duro, International Microbiology Webmaster Jordi Urmeneta, University of Barcelona
Addresses Editorial Office International Microbiology C/ Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org www.im.microbios.org Spanish Society for Microbiology C/ Rodríguez San Pedro, 2 #210 28015 Madrid, Spain Tel. +34-915613381. Fax +34-915613299 E-mail: secretaria.sem@microbiologia.org www.semicrobiologia.org Institute for Catalan Studies C/ Carme, 47 08001 Barcelona, Spain Tel. +34-932701620. Fax +34-932701180 E-mail: int.microbiol@microbios.org © 2017 Spanish Society for Microbiology, Madrid, & Institute for Catalan Studies, Barcelona. Printed in Spain ISSN (print): 1139-6709 e-ISSN (electronic): 1618-1095 D.L.: B.23341-2004
The Spanish Society for Microbiology (SEM) is a scientific society founded in 1946 at the Jaime Ferrán Institute of the Spanish National Research Council (CSIC), in Madrid. Its main objectives are to foster basic and applied microbiology, promote international relations, bring together the many professionals working in this science, and contribute to the dissemination of science in general and microbiology in particular, among society. It is an interdisciplinary society, with about 1800 members working in different fields of microbiology.
P2
CONTENTS International Microbiology (2017) 20:55-104 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org
Volume 20, Number 2, June 2017
RESEARCH ARTICLES
Corbella C, Steidl RP, Puigagut J, Reguera G Electrochemical characterization of Geobacter lovleyi identifies limitations of microbial fuel cell performance in constructed wetlands
55
Seng R, Leungtongkam U, Thummeepak R, Chatdumrong W, Sitthisak S High prevalence of methicillin-resistant coagulase-negative staphylococci isolated from a university environment in Thailand
65
Huang J-Y, Kao C-Y, Liu W-S, Fang TJ Characterization of high exopolysaccharide-producing Lactobacillus strains isolated from mustard pickles for potential probiotic applications
75
Nghiem MN, Nguyen VT, Nguyen TTH, Nguyen TD, Vo TTB Antimicrobial resistance gene expression associated with multidrug resistant Salmonella spp. isolated from retail meat in Hanoi, Vietnam
85
Polonio Á, Vida C, de Vicente A, Cazorla FM Impact of motility and chemotaxis features of the rhizobacterium Pseudomonas chlororaphis PCL1606 on its biocontrol of avocado white root rot
95
PIONEERS IN MICROBIOLOGY: Paulina Beregoff (1902–1989), Colombia
A2
Journal Citations Reports 5-year Impact Factor of International Microbiology is 2,17. The journal is covered in several leading abstracting and indexing databases, including the following ones: Agricultural & Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents/Agriculture, Biology & Environmental Sciences; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science & Technology Abstracts; ICYT/CINDOC; IBECS/ BNCS; ISI Alerting Services; MEDLINE/Index Medicus; Latindex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; SciSearch.
A1
Front cover legends Upper left. Transmission electron micrograph of the marine phage H1 negatively stained. Phage was isolated from a strain of Pseudoalteromonas sp. from the Blanes Bay Microbial Observatory station (BBMO), a surface coastal site in the NW Mediterranean. Photo by Elena Lara, Marine Sciences Institute (ICM-CSIC) (Magnification, 330,000×)
Center. Experimental avocado plot number 16, allocated at the Experimenta Station “La Mayora”, The Institute for Mediterranean and Subtropical Horticulture “La Mayora” (IHSM-UMA-CSIC; Málaga, Spain). At the left, a 40 years-old healthy avocado tree. At the right, an avocado tree with typical symptoms of avocado white root rot caused by Rosellinia necatrix. Photograph by Francisco M. Cazorla. (See article by Polonio et al. pp. 95104, this issue.)
Lower right. Transmission electron micrograph of the plasmolized yeasts (“lias”) of Saccharomyces cerevisiae from the elaboration of sparkling wines according to the “cava” method after second fermentation in closed bottles. Photo by Montserrat Riu and Rebeca Tudela, Faculty of Pharmacy and Food Sciences, University of Barcelona. (Magnification, 10,000×)
Upper right. Transmission electron micrograph of Sphingobacterium detergens during the process of cellular division. The bacterium was isolated from a soil sample from the Azorean Islands and was selected for its ability to reduce the surface tension of the culture medium. Photo by Ana M. Marqués and César Burgos-Díaz, Faculty of Pharmacy and Food Sciences, University of Barcelona. (Magnification, 10,000×) Lower left. Dark field micrograph of several individuals of the ciliate Vorticella sp. detached from its peduncles. Note the big and active macronuleus with the shape of a long and bluish band. Photo by Rubén Duro, Center for Microbiological Research, Barcelona. (Magnification, 1000×)
Back cover: Pioneers in Microbiology Paulina Beregoff (1902–1989), Colombia Paulina Beregoff was the first woman to obtain a degree in medicine in Colombia. She was born in 1902 in Kiev—by then a city of the Russian Empire—, in an aristocratic family of Jewish descent. Due to the political situation in her country, she was educated in the United States, where, in 1921, she graduated in Bacteriology and Parasitology and Pharmacy and Chemistry at the University of Pennsylvania. She started working at the laboratory of Pathology of that university and became a member of the Rivas Bacteriological Society of the University of Pennsylvania. In 1922, the Dean of the School of Medicine of the University of Cartagena, Colombia, asked the University of Pennsylvania for an expert in tropical diseases, including yellow fever. This disease was a great concern in Cartagena due to the high mortality rates it caused and because of the implications on the image of the city, which was a major commercial and harbor center. The University needed a qualified advisor that could also train local physicians, and the University of Pennsylvania chose Beregoff for that task. Once in Cartagena, she had to identify an epidemic outbreak that had been causing many fatalities, mostly among indigenous peoples living in the Magdalena River shores. Colombian phys icians were not familiar with symptoms and causal agents of diseases such as yellow fever, typhoid fever and malaria, but thought that the epidemic outbreak could be due to one of them. Beregoff sent samples of cultures
from corpses of people killed by the disease to be analyzed at the University of Pennsylvania. The disease turned out to be fiebre tifomalárica and not simply malaria, as they first had considered. Beregoff thought that the infection depended mostly on the deficiencies or resistance of the immune system and proposed that physicians should work to prevent the disease. Once she had achieved her task, she intended to go back to Philadelphia to study medicine at Temple University, but she was asked to remain in Cartagena, where she could also study medicine. In 1922 she enrolled at the University of Cartagena under special conditions. Due to her previous studies and qualification, she could be waived the first two years of the studies of medicine. She set up the first laboratories of bacteriology and parasitology in Cartagena, with microscopes and other equipment donated by the University of Pennsylvania. Her thesis director recognized her great contribution, she having been able to differentiate the various species of Laveran’s haematozoa, to observe the treponema causing yaws, to find the Piroplasma Donovani, the parasite of KalaAzar (visceral leishmaniasis) in the blood, and having been the first to isolate the “typhoid bacillus”, confirming thus the presence of typhoid fever in town. She could also to properly perform the Wassermann technique on syphilis. The fact that she was a foreign woman and the she had had some privileges in her medicine studies was criticized by some people. In 1933 she married bacteriologist Arthur Stanley Gillow and they moved to Canada. Since then she signed her publications as Pauline Beregoff-Gillow. After her husband’s death, in 1964, she returned to Colombia and dedicated his husband’s legacy to set up a foundation under his name that should work on preventive medicine. She died on September 20, 1989 and left her fortune to the foundation.
Front cover and back cover design by MBerlanga & RGuerrero
A2
RESEARCH ARTICLE International Microbiology 20(2):55-64 (2017) doi:10.2436/20.1501.01.285. ISSN (print): 1139-6709. e-ISSN: 1618-1095
www.im.microbios.org
Electrochemical characterization of Geobacter lovleyi identifies limitations of microbial fuel cell performance in constructed wetlands Clara Corbella,1,2 Rebecca P. Steidl,1 Jaume Puigagut,2 Gemma Reguera1* Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI, USA. Department of Civil and Environmental Engineering, Technical University of Catalunya, Barcelona-Tech, Spain 1
2
Received 22 March 2017 · Accepted 15 April 2017
Summary. Power generation in microbial fuel cells implemented in constructed wetlands (CW-MFCs) is low despite the enrichment of anode electricigens most closely related to Geobacter lovleyi. Using the model representative G. lovleyi strain SZ, we show that acetate, but not formate or lactate, can be oxidized efficiently but growth is limited by the high sensitivity of the bacterium to oxygen. Acetate and highly reducing conditions also supported the growth of anode biofilms but only at optimal anode potentials (450 mV vs. standard hydrogen electrode). Still, electrode coverage was poor and current densities, low, consistent with the lack of key c-type cytochromes. The results suggest that the low oxygen tolerance of G. lovleyi and inability to efficiently colonize and form electroactive biofilms on the electrodes while oxidizing the range of electron donors available in constructed wetlands limits MFC performance. The implications of these findings for the optimization of CW-MFCs are discussed. [Int Microbiol 20(2):55-64 (2017)] Keywords: microbial fuel cells · bioelectrochemical systems · constructed wetlands · extracellular electron transfer · electricigens
Introduction Horizontal subsurface flow constructed wetlands (HSSF CW) are natural wastewater treatment systems where organic matter is oxidized by means of physical, chemical and biological Abbreviations: CW Constructed Wetlands MEC Microbial Electrolysis Cell MFC Microbial Fuel Cell CW-MFC Microbial Fuel Cells implemented in Constructed Wetlands HSSF CW Horizontal subsurface flow constructed wetlands *
Corresponding author: Gemma Reguera E-mail: reguera@msu.edu
processes under mainly anaerobic conditions [3]. During treatment, a redox gradient is naturally established between the top layer exposed to air and the deeper anaerobic areas of the treatment bed that can be exploited to harvest an electrical current with a sediment microbial fuel cell (MFC) [7]. Although MFCs operating in HSSF CW (CW-MFCs) increase organic matter removal efficiency, power density and coulombic efficiencies are generally low (below 50 mW/m2 and 4%, respectively) [10]. As with other MFCs that process domestic wastewater, system performance is ultimately dependent on the syntrophic interactions among the organisms in the anode biofilm, which first hydrolyze the complex substrates and then ferment them to generate electron donors (e.g., acetate, formate, and lactate) for the electricigenic population [5,9].
56
Int. Microbiol. Vol. 20, 2017
Efficiency is also dependent on the ability of the electricigens to couple the oxidation of the available organic substrates to the electron transfer to the anode electrode [23]. Indeed, changes in the chemical composition of the wastewater in CW influence substrate availability, the type and relative abundance of bacteria that grow in the anode biofilms, and CWMFC performance [8]. The fluctuating chemical and physical conditions that dominate HSSF CW promote the establishment of several pathways for organic matter degradation and influence the range of electron donors available to support the growth and activity of the electricigenic population [13]. Acetate, a preferred electron donor for efficient electricigens in the genus Geobacter [31], is the most common electron donor generated in these anaerobic pathways and often enriches for Geobacter species in the anode biofilms of bioelectrochemical systems fed with domestic wastewater [8,9,12]. More than half of the 16S rRNA sequences retrieved from anode biofilms grown in a single chamber microbial electrolysis cell (MEC) fed with domestic wastewater were, for example, most closely related to electricigenic species of Geo bacter available in pure culture (Geobacter metallireducens, Geobacter sulfurreducens, Geobacter lovleyi and Geobacter uraniireducens) [9]. Acetate is also available as an electron donor in CW [2]. Consistent with this, Operational Taxonomic Units (OTUs) most closely related to members of the Geobacteraceae family were enriched in the anode biofilms of an active CW-MFC fed with the effluent of a hydrolytic upflow sludge blanket reactor, with the highest relative abundance (13–16 of the total OTUs) corresponding to G. lovleyi [8]. However, despite the enrichment of Geobacter electricigens in the anode biofilms, power densities in these systems were low (<40 mW/m2) [8]. The fact that G. lovleyi OTUs dominate the electricigenic population in active CW-MFC ssuggests that further optimization must consider the factors that limit the growth and/or electrochemical activity of G. lovleyi in these systems. In contrast with the amount of information that is available for other model Geobacter representatives such as G. sulfurreducens and G. metallireducens (reviewed in [24]), little is known about the physiological constraints that may limit the growth and electrochemical activity of G. lovleyi under conditions relevant to CW. Evidence is indeed available that suggests that the physiology of G. lovleyi may be substantially different from previously investigated Geobacter species. The first strain of G. lovleyi recovered in pure culture, strain SZ, was
CORBELLA ET AL.
isolated from non-contaminated creek sediment microcosms based on its ability to grow by coupling the oxidation of acetate to the reductive dechlorination of tetrachloroethene (PCE) to cis-1,2-dichloroethene (cis-DCE) [37]. Closely related 16S rRNA gene sequences have been retrieved from environments where dechlorination is an active process, placing G. lovleyilike sequences in a distinct, dechlorinating clade within the metal-reducing Geobacter group, which model electricigens belong to [1,37]. Further, strain SZ retains the ability to reduce Fe(III), the major hallmark of the physiology of Geo bacter electricigens [37]. However, its genome shows marked reductions in the number of c-type cytochrome genes required for metal reduction in other Geobacter species [41], which could negatively affect its ability to couple growth to the reduction of an anode electrode. Strain SZ is also capable of dissimilatory nitrate reduction to ammonium (DNRA), a process that is promoted with acetate availability [40] and could potentially divert respiratory electrons away from the anode electrode in CW-MFCs. Moreover, while it is possible to harvest some low levels of current from anode biofilms of strain SZ grown in acetate-fed MECs with fumarate supplementation [36], its ability to gain energy for growth using an electrode as sole electron acceptor has never been evaluated. Also relatively unexplored is the range of electron donors and carbon sources that support the growth of G. lovleyi biofilms on anode electrodes. For example, organic acids more reduced than acetate such as lactate and formate are produced in CWs [2], yet not all Geobacter electricigens can efficiently assimilate them for carbon and/or oxidize them in bioelectrochemical systems [6,31]. Based on these considerations, we investigated the electrochemical activity of the model representative G. lovleyi strain SZ with electron donors (acetate, lactate and formate) commonly found in CW. The results reveal substantial metabolic differences between G. lovleyi and other model Geobacter electricigens that limit the performance of bioelectrochemical systems driven by these organisms. The implications of these findings for the optimization of CW-MFCs are discussed.
Materials and methods Bacterial strains and culture conditions. Geobacter lovleyi SZ (ATCC BAA-1151; DSM 17278), kindly provided by Dr. Dawn Holmes (Western New England University), was used throughout the study. The strain was routinely cultured anaerobically in DB medium, a medium opti-
MICROBIAL FUEL CELL PERFORMANCE
mized for the growth of current-harvesting anode biofilms in MECs [31]. Unless otherwise indicated, the medium was supplemented with 2.5 mM cysteine HCl as a reducing agent and with sodium acetate (20 mM) and sodium fumarate (40 mM) as the electron donor and acceptor, respectively (DBAF medium). The growth medium was dispensed into tubes (10 ml) and serum bottles (50 ml) and sparged with an oxygen-free gas mix of N2:CO2 (80:20) [32] before sealing the vessels with rubber stoppers and autoclaving for 30 minutes. When indicated, acetate, lactate and formate were provided to the medium at concentrations (9 mM sodium acetate, 6 mM d,l-lactate, or 36 mM sodium formate) that provided equimolar amounts of electrons (acetate, 8; lactate, 12; and formate, 2). Growth with each of these electron donors was studied using fumarate (40 mM) or Fe(III) citrate (80 mM) as an electron acceptor. For these experiments, cells were first grown to late exponential phase (OD600, ~0.4) in DB medium with the electron donor-acceptor pair to be tested, harvested by centrifugation (3200 ×g, 10 min, 30 °C), washed once in sterile medium, and suspended in 0.5 ml of the growth medium to prevent nutrient carry-over. In some experiments, the centrifugation and washing steps were omitted and the cultures were transferred three times in the same medium before calculating the growth rates for each electron donor-acceptor pair. All incubations were at 30 °C��������������������������������������� . Growth in fumarate cultures was monitored spectrophotometrically (OD600) and in Fe(III) citrate cultures, as the amount of HCl-extractable Fe(II) resulting from the reduction of Fe(III) [25] measured using the ferrozine assay [34]. Analytical techniques. Organic acids in filtered (0.45 µm syringe Titan3TM filters, Thermo Scientific) culture supernatant fluids were identified and quantified by high-performance liquid chromatography (HPLC) (Waters, Milford, MA, USA) as reported elsewhere [31]. Cysteine was measured spectrophotometrically (OD412) as freethiols with the Ellman’s Reagent, as described previously [29], and in reference to l-cysteine hydrochloride standards. When indicated, the total cell protein content in the culture was estimated using Pierce BCA Protein Assay Kit (Thermo Scientific) using a previously published method [44]. MECs and confocal microscopy. MECs were the same dual-chambered, H-type fuel cells described previously [31]. Anode and cathode chambers were separated by means of a Nafion membrane (N117, Ion Power, Inc. New Castle, DE, USA). Each chamber contained 90 ml of DB-acetate (1 mM) medium and housed a graphite rod electrode (1.27 cm diameter, 99 % metal basis, 12 cm2 anode surface area) similar to the graphite rods use to enrich for G. lovelyi OTUs in the anode biofilms of CW-MFCs [8]. The anode and cathode chambers were sparged with oxygen-free N2:CO2 (80:20) to ensure anaerobiosis and the anode potential was set with a potentiostat (VSP, BioLogic, Claix, France) at –0.179 V, 0.240 V or 0.561 V vs. a 3 M Ag/AgCl reference electrode (Bioanalytical Systems, Inc., West Lafayette, IN, USA). The anode chamber was then inoculated with cells of G. lovleyi or, when indicated, of G. sulfurreducens harvested by centrifugation (3200 rpm, 10 min, 30 ºC) from stationary phase cultures grown with DBAF ��������������� medium and suspended in 10 ml of DB medium with acetate. All experimental conditions were tested at least in duplicate MECs. Culture broth samples were periodically removed from the anode chamber and analyzed by HPLC. When indicated, anode biofilms were grown to the point of maximum current, stained with the BacLight viability kit (Molecular Probes), and examined by Confocal Laser Scanning Microscopy (CLSM) using a FluoView FV1000 inverted microscope system (Olympus, Center Valley, PA, USA), as described elsewhere [31].
Int. Microbiol. Vol. 20, 2017
57
Results and Discussion Effect of the redox potential during the reduction of Fe(III) citrate and fumarate. Because oxygen intrusions are common in CW, which could inhibit the growth and electroactivity of electricigens, we investigated the influence of the medium redox potential in the growth of G. lovleyi strain SZ. Although the media preparation involved extensive sparging of the broth and head space with oxygenfree gases (N2:CO2) [32], growth was only observed in cultures supplemented with cysteine as a reducing agent (Fig. 1). Strain SZ coupled, for example, the oxidation of acetate (20 mM acetate or 160 mM electron equivalents) to the reduction of Fe(III) citrate (Fig. 1A) but only when the cultures were supplemented with cysteine (2.5 mM). Replacing the cysteine with a mild reducing agent such as FeCl2 (2.5 mM) [35] did not support Fe(III) reduction (data not shown). Generation times in the cultures with cysteine were 18 ± 1 h (average and standard deviation of triplicate cultures) but were reduced to 8 h (± 0.1 h) after three direct transfers in the same medium that bypassed the centrifugation and washing steps of the cells prior to inoculation. These doubling times are within the ranges (~10 h) reported for G. sulfurreducens grown in the same DBA-Fe(III) citrate medium but without cysteine [31]. Furthermore, the total amount of Fe(II) (~50 mM) reduced by G. lovleyi was as in the G. sulfurreducens cultures [31], indicating that once the medium was pre-reduced optimally, strain SZ was able to couple the oxidation of acetate and Fe(III) as efficiently as G. sulfurreducens. Addition of cysteine as a reducing agent was also required to support optimal growth in cultures with acetate and fumarate (Fig. 1B). We tested various concentrations of cysteine ranging from 0.1 to 10 mM and we consistently measured maxima growth yields and shortest generation times at cysteine concentrations between 2 and 3 mM. Cultures supplemented with 2.5 mM (Fig. 1B) yielded, for example, maxima cell biomass (measured as total cell protein at the point of maximum growth, when all the acetate was depleted) similar to that measured in the DBA-Fe(III) citrate cultures (~ 10 g protein per mol acetate consumed). Cysteine in these cultures was rapidly oxidized within the first 10 h of incubation (Fig. 1B) at rates comparable to the oxidation of cysteine in uninoculated controls (Fig. 1C), consistent with its abiotic oxidization to cystine dimers [17]. Exponential growth started after a short (2–3 h) lag phase, when approximately 1 mM of cysteine had been oxidized, and proceeded with doubling times of 6 ± 0.4 h (average and stan-
Int. Microbiol. Vol. 20, 2017
CORBELLA ET AL.
Int Microbiol
58
Fig. 1. Effect of cysteine on growth of Geobacter lovleyi with acetate and Fe(III) citrate (A) or fumarate (B–D). A. Growth (log of the acid-extractable Fe[II]) with 15 mM acetate and 80 mM Fe(III) citrate in the presence (solid symbols) or absence (open symbols) of 2.5 mM cysteine. An uninoculated control with cysteine is shown as well (dashed line). B-C Growth (OD600, solid symbols) and cysteine concentration (mM, open symbols) in DBAF cultures with (solid line) or without (dashed line) 2.5 mM cysteine (B) in reference to uninoculated controls (C). D. Oxidation of acetate (solid circles) coupled to the reduction of fumarate (solid triangles) to succinate (open triangles) in the DBAF cultures supplemented with 2.5 mM cysteine shown in B. All of the data points in panels A-D are average and standard deviation of triplicate samples.
dard deviation of triplicate cultures) (Fig. 1B). But the lag phase was eliminated and doubling times were reduced (4.4 ± 0.1 h) when exponential phase cultures were sequentially transferred three times in the same medium with cysteine to avoid the cell centrifugation and washing steps prior to inoculation. These fast generation times are within the ranges we calculated (~ 4.6 ± 0.2 h) for the model electricigen G. sulfurreducens growing in the same DBAF medium but without cysteine [31]. Thus, the rates of acetate oxidation coupled to fumarate reduction are also comparable in the two strains, but growth by G. lovleyi requires the presence of sufficient concentrations of cysteine as a reducing agent. The absolute requirement to pre-reduce the medium sufficiently in order to support cell growth is in accordance with genomic data, which indicates that G. lovleyi cannot respire oxygen and lacks several key genes involved in oxygen tolerance and detoxification of reactive oxygen species [41]. Indeed, field experiments show significant (up to 50%) decreases in the relative abundance of G. lovleyi like sequences in uranium-contaminated sediments following the intrusion of oxygenated ground water [39]. By contrast, G. sulfurredu cens tolerates exposure to atmospheric oxygen for up to 24 h and can use oxygen as terminal electron acceptor for respiration under microaerophilic conditions, a metabolic capability that allows them to not only tolerate but also boost their growth in response to oxygen intrusions [21].
Metabolic constrains limiting growth with organic acids. Although G. lovleyi was able to double every 4–5 h, like G. sulfureducens, in acetate-fumarate cultures with cysteine, growth yields were significantly lower for G. lovleyi (OD600 max. ~0.5; Fig. 1B) than for G. sulfurreducens (OD600 max. ~0.8) [31]. Higher growth yields of G. sulfurreducens in cultures with acetate and fumarate have been attributed to the ability of this organism to assimilate some of the fumarate carbon, which diverts more of the acetate substrate (72.5%) for energy generation via respiration [43]. To investigate a similar metabolic capability in G. lovleyi, we monitored acetate and fumarate consumption and the production of succinate (from the reduction of fumarate) or malate (from the assimilation of fumarate carbon) in G. lovleyi DBAF cultures that contained growth-limiting concentrations of acetate (~9 mM or 72 mM electron equivalents) (Fig. 1D). Acetate was consumed during the first 16 h and, concomitantly, fumarate was reduced to succinate. We estimated that approximately 19 (±0.3) mM fumarate was consumed, or the equivalent of 60% of the electrons provided as acetate in the medium, suggesting that G. lovleyi diverted more acetate carbon (~40%) for biomass synthesis than G. sulfurreducens (27.5%) [43]. Although the assimilation of acetate carbon in the TCA cycle generates malate [30], we did not detect any malate in the acetate-fumarate cultures of G. lovleyi but measured an excess succinate (~7 mM) that could not be accounted for by the fumarate that
Int. Microbiol. Vol. 20, 2017
59
Int Microbiol
MICROBIAL FUEL CELL PERFORMANCE
Fig. 2. Growth (A-B) and electron donor consumption (C-D) of G. lovleyi with fumarate (A and C) or Fe(III) citrate (B and D) as electron acceptors, respectively. The electron donors tested were acetate (solid circles), lactate (open squares), and formate (open triangles). Other organic acids such as fumarate, succinate, malate, and pyruvate were also monitored in the culture broths (C and D) but were not detected.
was reduced (Fig. 1D). As strain SZ can reduce malate to succinate [37], the excess succinate detected in the cultures likely resulted from the reduction of acetate-derived malate. The finding that G. lovleyi diverts more acetate carbon for assimilation than G. sulfurreducens suggests that metabolic differences do exist between G. loveyi and model electricigens that could limit the performance of CW-MFCs despite the availability of acetate as an electron donor. Organic acids such as lactate and formate are also available as electron donors and carbon sources in CW [2]. Thus, we investigated the ability of G. lovleyi to grow with these two organic acids (Fig. 2) using the cultivation conditions with cysteine that supported optimal growth of G. lovleyi with acetate (Fig. 1). Although formate and lactate are more reduced than acetate and can, therefore, theoretically produce higher cell voltages (–0.403 and –0.325 V vs. standard hydrogen electrode [SHE], respectively), and more energy for growth, than acetate (–0.277 V vs. SHE) [18], neither electron donor supported the growth of G. lovleyi in cultures with fumarate or Fe(III) citrate serving as the electron acceptor and supplemented with 2.5 mM cysteine (Fig. 2A and B, respectively). Moreover, fumarate concentrations in the cultures with formate and lactate as electron donors remained relatively constant throughout the incubation period and the reduced product of the reaction, succinate, did not accumulate in the culture broth (Fig. 2C). Similarly, electron donor consumption was only detected in the positive controls that contained acetate as the electron donor (Fig. 2C and D). To better understand the metabolic constrains that limited
growth of strain SZ with formate and lactate, we used the BLAST engine (http://blast.ncbi.nlm.nih.gov/) to reconstruct the metabolism of these two organic acids in reference to the metabolism of the model electricigen G. sulfurreducens. As shown in Fig. 3, G. sulfurreducens oxidizes formate to carbon dioxide in a reaction catalyzed by the formate dehydrogenase (FDH) enzyme and assimilates formate carbon with acetylCoA in a separate reaction catalyzed by the pyruvate formate lyase (PFL) enzyme [31]. The genome of strain SZ contains two FDH homologues (Glov_1164 and Glov_0899) [41]. Furthermore, supplementing the formate cultures with 0.1 mM acetate to provide the acetyl-CoA substrate needed for formate carbon assimilation did not promote growth either, suggesting that formate cannot be oxidized with fumarate serving as electron acceptor, as observed during the reduction of PCE and Fe(III) [37]. Formate does not sustain the coupled oxidation of H2 and reduction of PCE or Fe(III) either [37], suggesting it cannot assimilate formate carbon either. Indeed, we were unable to identify PFL-like sequences in the genome of G. lovleyi. Thus, even with active FDH enzymes for formate oxidation, the lack of a PFL enzyme would prevent the cells from assimilating formate carbon to generate pyruvate for gluconeogenesis, biomass synthesis, and other assimilatory reactions (Fig. 3). As with the formate cultures, acetate additions to lactate cultures of G. lovleyi (Fig. 2) did not stimulate growth with either fumarate or Fe(III) citrate, indicating that lactate cannot be used as electron donor during the reduction of fumarate
Int. Microbiol. Vol. 20, 2017
CORBELLA ET AL.
Int Microbiol
60
Fig. 3. Metabolic pathways used by G. sulfurreducens for the oxidation (e–) and carbon assimilation (C) of acetate, formate, and lactate substrates (in bold) and identification of reactions (in gray) absent in G. lovleyi. Dashed arrows indicate reactions that operate in cultures with fumarate. Enzyme abbreviations, from left to right: PFL, pyruvate formate lyase; FDH, formate dehydrogenase; LctP, lactate permease; LDH, lactate dehydrogenase; ACK, acetate kinase; PTA, phosphotransacetylase; PFOR, pyruvate ferredoxin oxidoreductase; PDH, pyruvate dehydrogenase.
and Fe(III), as also reported for PCE reduction [37]. Lactate carbon, however, has been reported to be assimilated during the reduction of PCE and Fe(III) with H2 as electron donor [37]. However, a comparative search in the genome of G. lovleyi failed to identify any lactate permeases, including homologs of the two lactate transporters annotated in the genome of G. sul furreducens (GSU1622 and GSU0226). Furthermore, the SZ genome does not contain any genes annotated as lactate dehydrogenases (LDH), which catalyze the partial oxidation of lactate to pyruvate (Fig. 3). Similarly, our search retrieved no significant matches for homologs of the two subunits of the glycolate oxidase (GO) enzyme of G. sulfurreducens (GSU1623 and GSU1624), which is structurally homologous to LDH but has a reduced LDH activity [31]. Also unclear is how any lactatederived pyruvate could be fully oxidized in the TCA cycle by G. lovelyi. Also absents in the genome of strain Z were homologs of the subunit A of the pyruvate dehydrogenase E1 complex (PDH), which provides a route to convert pyruvate into acetyl-CoA substrate for the oxidative TCA cycle (Fig. 3). The genome of G. lovleyi does contain five gene clusters (one on plasmid pSZ77) encoding pyruvate ferredoxin/flavodoxin oxidoreductase (PFOR) complexes [41], which could catalyze the conversion of pyruvate into acetyl-CoA (Fig. 3). These PFOR complexes are homologous to the PFOR enzyme of G. sul
furreducens that has been proposed to preferentially work in the opposite direction to promote the flux of acetyl-CoA to gluconeogenetic pyruvate [43]. The preferential direction of the PFOR reactions towards pyruvate for gluconeogenesis in G. lovleyi is supported by the greater amounts of acetate carbon that we estimated to be assimilated by strain SZ (40%) compared to G. sulfurreducens (27.5%). Yet strain SZ does use pyruvate as sole electron donor [37], suggesting that one, if not more, of the PFOR enzymes may preferentially operate in the opposite direction to divert lactate-derived pyruvate to acetylCoA for its full oxidation in the TCA cycle (Fig. 3). The genome of G. lovleyi also contains two genes (Glov_1754 and Glov_1210) annotated as acetate kinase (ACK) and phosphotransacetylase (PTA), respectively. G. sul furreducens diverts pyruvate as acetyl-CoA substrate for the ACK/PTA pathway to excrete excess carbon as acetate in an ATP-yielding reaction (Fig. 3) [31]. This suggests that G. lovleyi could also partially oxidize lactate to acetate to balance excess fluxes of carbon while generating energy for growth. However, we did not measure any acetate in cultures with lactate (Fig. 2C and D). Thus, other rate-limiting steps such as inefficient lactate transport or oxidation to pyruvate likely prevented the oxidation and assimilation of lactate and prevented growth of G. lovleyi with lactate.
Int. Microbiol. Vol. 20, 2017
61
Int Microbiol
MICROBIAL FUEL CELL PERFORMANCE
Fig. 4. Current density (A) and growth of anode biofilms (B-C) in MECs driven by Geobacter lovleyi or G. sulfurreducens fed with an initial concentration of 1 mM acetate. A. Current density (mA/cm2) by G. lovleyi (maroon) and G. sulfurreducens (black) in MECs poised at an anode potential of 450 mV (vs. SHE) with (solid line) or without (dashed line) 2.5 mM cysteine. Inset, current density by G. lovleyi in MECs with cysteine as a function of the anode potential (771 or 31 mV vs. SHE). Axis units are as in panel A. B-C. Top and side views of CSLM projections of anode biofilms of G. lovleyi (B) and G. sulfurreducens (C) collected at the point of maximum current from MECs at 450 mV (vs. SHE) and supplemented with cysteine (A). The biofilms were stained with the BacLight viability dies (green, live; red, dead). Scale bar, 20 µm.
Reduced electrode colonization and biofilm electroactivity limit MEC performance. The growth and electrochemical activity of strain SZ was investigated in acetate-fed MECs with an anode electrode poised at a metabolically oxidizing potential to provide a terminal electron acceptor for growth of the anode biofilms (Fig. 4). MECs with anode electrodes poised at a potential (450 mV vs. SHE) that is optimal for the growth of anode biofilms of the model electricigen G. sulfurreducens [31] produced current soon after inoculation but required the pre-reduction of the medium with 2.5 mM cysteine (Fig. 4A). Under optimal reducing conditions, current production increased over the course of ten days until it reached maximum current (0.086 ± 0.004 mA, average and standard error of duplicate MECs); it was sustained for several more days until all of the acetate was depleted (Fig. 4A). By contrast, control MECs driven by G. sul furreducens grown under the same conditions with cysteine reached a maximum current of 0.642 mA in less than 2 days. Moreover, coulombic efficiencies (CE) in MECs driven by G. lovleyi ranged from 30 to 40%, which is less than half of those estimated for G. sulfurreducens (~80%) [31]. Even when operated under optimal conditions, the growth and electrochemical activity of G. lovleyi was limited by poor electrode colonization and biofilm growth. Indeed, confocal laser scanning microscopy (CLSM) of anode biofilms from
MECs with cysteine and with anodes poised at the optimal potential (450 mV vs. SHE) revealed poor electrode coverage by G. lovleyi cells, in contrast to the saturating biofilms formed by G. sulfurreducens (Fig. 4B and C, respectively). Though sparse, the anode microcolonies formed by strain SZ reached average thickness (9.1 ± 1.2 µm) similar to that of the saturating biofilm of G. sulfurreducens (10.8 ± 2.3 µm). To reach this thickness, G. sulfurreducens anode biofilms couple cell growth to electron transfer to the underlying electrode, a process that requires the combined redox activities of matrixassociated c-type cytochromes such as OmcZs and conductive pili [33]. The genome of G. lovleyi contains a homologue of the gene encoding the peptide subunit or pilin that polymerizes to make the conductive pili of G. sulfurreducens [41]. However, we were unable to identify a clear homolog of OmcZ (GSU2078), the precursor of the matrix-associated c-type cytochrome OmcZs [14] that concentrates near and on the electrode and is required for efficient electron transport to the anode surface [15]. Outer membrane cytochromes required for extracellular electron transfer to solid-phase electron acceptors such as OmcS [26] did not retrieve a clear homolog either. Also absent in the genome of strain SZ are c-type cytochromes with more than 12 hemes [41], which have been proposed to store electrons and continue energy generation through a proton motive force until the cell establishes elec-
62
Int. Microbiol. Vol. 20, 2017
tronic contact with the electron acceptor [11]. Indeed, the genome of G. lovleyi contains less cytochrome-encoding genes than any other sequenced Geobacter genome [41]. Thus, the inability of G. lovleyi to colonize and respire the electrode efficiently could result, at least partially, from the lack of c-type cytochromes needed for the cells to establish electronic contact with the electrode. Poising the anode potential at 31 mV (vs. SHE) to mimic the theoretically lower energy gain derived from the two-electron reduction of fumarate to succinate reduced MEC performance proportionally (Fig 4A, inset). In G. sulfurreducens, the ability of the cells to reduce low potential, solid-phase electron acceptors depends on the expression of the inner membrane cytochrome CbcL [45]. A search of the genome of G. lovleyi retrieved no clear homologs of CbcL, consistent with the inability of the anode biofilms to efficiently reduce the electrode when poised at low metabolically oxidizable potentials. By contrast, we identified a gene (Glov_2063) encoding a protein homologous (63.9% identity and 72.8% similarity) to ImcH, an inner membrane cytochrome of G. sulfurreducens that is required for extracellular electron transfer at higher (>240 mV vs. SHE) redox potentials [20]. We also set up MECs with anodes poised at the potential (771 mV vs. SHE) of the Fe(III)/Fe(II) pair but maximum current (0.21 ��������������������������������������� ± 0.05��������������������������������� mA) and rates of current production (0.190 ± 0.071 mA/day) were still low in these MECs (Fig 4A, inset). Furthermore, acetate was not consumed in these MECs and confocal micrographs of the anode electrodes revealed very sparse cell colonization. Thus, current production in these MECs was not biological but rather mediated by redox interactions between the cysteine and the anode electrode, as previously observed in MFCs [22]. Implications for CW-MFC performance. The results presented herein demonstrate that the physiology of G. lovleyi is substantially different from previously studied Geo bacter electricigens. Indeed, we identified several physiological constraints not reported for other model electricigens that are likely to limit the performance of CW-MFCs. Of special significance is the low oxygen tolerance of G. lovleyi, which requires the presence of oxygen scavengers to maintain the redox potential of the medium at a level sufficiently low to permit growth. This sensitivity contrasts with the oxygen tolerance and respiratory capacity of model electricigens such as G. sulfurreducens, a metabolic capacity that contributes to their survival and growth in oxic environments [21]. Thus, environmental surveys in CW cannot solely rely on the pres-
CORBELLA ET AL.
ence of Geobacter-like sequences as a proxy of electricigenic activity, and need to consider species-specific genes, particularly those encoding proteins involved in oxygen tolerance such as superoxide reductase [16], superoxide dismutase [27], and NADH oxidase [42]. This is of particular relevance to planted systems such as HSSF CW, which comprise a macrophytes root system that continuously releases oxygen in the surrounding medium [38]. Moreover, plant evapotranspiration, which is needed to supply oxygen to the cathode in CWMFCs [10], causes daily fluctuations of the water level that favor oxygen intrusions in the gravel media and increase the redox potential in some areas of the treatment bed [28]. This is expected to reduce the representation in the anode biofilms and/or electrochemical activity of oxygen-sensitive electricigens, such as G. lovleyi, and reduce the performance of CWMFCs. Results from this study also suggest that power generation by G. lovleyi anode biofilms is limited by the inability of this organism to use reduced electron donors, such as lactate and formate, that are abundant in CW. Acetate is a key metabolic intermediate in anaerobic digestion and an abundant electron donor in HSSF CW [2], providing adequate conditions for the enrichment of Geobacter electricigens in CW-MFCs, including G. lovleyi [8]. However, the inability of G. lovleyi to oxidize and assimilate other abundant, and more reduced, organic acids such as formate and lactate limits the amount of power that can be harvested by anode biofilms during the degradation of organic matter in CW. We also show that optimal current harvesting from G. lovleyi anode biofilms required the anode to be poised at a sufficiently high potential (450 mV vs. SHE) (Fig. 4). Such operational parameters are difficult to implement in HSSF CW, where redox gradients fluctuate widely in response to external conditions [7]. Redox potentials in deep zones of planted HSSF CW can reach ca.–200 mV vs SHE, and generate a maximum voltage of 140 mV [7]. This suggests that the anode potential in CW-MFCs is negative and, thus, suboptimal for the growth and electroactivity of G. lovleyi on the anode electrode. Our MEC studies (Fig. 4) also revealed that, even under optimal conditions, the colonization of the anode electrode by G. lovleyi is sparse, in contrast to the saturating electrode coverage reported for the most efficient Geobacter electricigens [31]. The inability of G. lov leyi to grow saturating biofilms leaves areas of the anode electrode exposed and available for colonization by fastidious non-electricigens, whose growth on the electrode reduce the performance of MFC systems [5]. Indeed, the best performing
MICROBIAL FUEL CELL PERFORMANCE
CW-MFCs enriched for not only G. lovleyi OTUs, but also for methanogens [8]. However, increasing the electrode surface area and controlling substrate loadings could be used to help minimize the growth of methanogens on the anode electrode and increase the performance of CW-MFCs, as reported for other MFC systems [4]. The presence of alternative electron acceptors, which can divert electrons away from the anode electrode, also deserves special attention. G. lovleyi can use nitrate as electron acceptor to produce ammonia using the DNRA pathway [37]. Furthermore, high acetate-to-nitrogen ratios such as those that prevail in CW promote the DNRA activities and enrich for G. lovleyi-like organisms [40]. Hence, improved CW-MFC performance also needs to consider pretreatment approaches that either maintain acetate:nitrate ratios favoring electricity generation by G. lovleyi over DNRA or that enrich for more efficient Geobacter electricigens. In conclusion, we can say that the electrochemical characterization of the model representative G. lovleyi strain SZ identified critical parameters (low oxygen tolerance, limited range of oxidizable electron donors, requirement of sufficiently high anode potentials, and inefficient electrode colonization and reduction) limiting the growth and electroactivity of G. lovleyi anode biofilms in CW-MFCs. Further investigations are recommended that test the effectiveness of increases in anode electrode surface, controlled substrate loadings and pretreatments in the growth and electroactivity of G. lovleyi and perhaps other electricigens on the anode electrode so as to improve the performance of CW-MFCs.
Acknowledgements. This research was supported by funds from the AgBioResearch at Michigan State and the National Institute of Food and Agriculture (NIFA) of the US Department of Agriculture to G.R. and a predoctoral fellowship from the Generalitat de Catalunya (2014 FI_AGAUR) to C.C. We are grateful to Dawn Holmes (Western New England University) for providing a culture of G. lovleyi.
Competing interests. None declared.
References 1. Amos BK, et al. (2007) Detection and quantification of Geobacter lov leyi strain SZ: implications for bioremediation at tetrachloroethene- and uranium-impacted sites. Appl Environ Microbiol 73:6898-6904 2. Bagley DM, et al. (2000) Acclimation of anaerobic systems to biodegrade tetrachloroethene in the presence of carbon tetrachloride and chloroform. Water Res 34:171-178 3. Baptista JD, et al. (2003) Microbial mechanisms of carbon removal in subsurface flow wetlands. Water Sci Technol 48:127-34
Int. Microbiol. Vol. 20, 2017
63
4. Borole AP, et al. (2009) Improving power production in acetate-fed microbial fuel cells via enrichment of exoelectrogenic organisms in flowthrough systems. Biochem Eng J 48:71-80 5. Borole AP, et al. (2011) Electroactive biofilms: Current status and future research needs. Energy Environ Sci 4:4813-4834 6. Call DF, Logan BE (2011) Lactate oxidation coupled to iron or electrode reduction by Geobacter sulfurreducens PCA. Appl Environ Microbiol 77:8791-8794 7. Corbella C, Garfi M, Puigagut J (2014) Vertical redox profiles in treatment wetlands as function of hydraulic regime and macrophytes presence: Surveying the optimal scenario for microbial fuel cell implementation. Sci Total Environ 470:754-758 8. Corbella C, et al. (2015) Operational, design and microbial aspects related to power production with microbial fuel cells implemented in constructed wetlands. Water Res 84:232-242 9. Cusick RD, Kiely PD, Logan BE (2010) A monetary comparison of energy recovered from microbial fuel cells and microbial electrolysis cells fed winery or domestic wastewaters. Int J Hydrogen Energy 35:88558861 10. Doherty L, et al. (1985) A review of a recently emerged technology: Constructed wetland--Microbial fuel cells. Water Res 85:38-45 11. Esteve-Nunez A, et al. (2008) Fluorescent properties of c-type cytochromes reveal their potential role as an extracytoplasmic electron sink in Geobacter sulfurreducens. Environ Microbiol 10:497-505 12. Fang Z, et al. (2013) Performance of microbial fuel cell coupled constructed wetland system for decolorization of azo dye and bioelectricity generation. Bioresour Technol 144:165-171 13. Faulwetter JL et al. (2009) Microbial processes influencing performance of treatment wetlands: A review. Ecol Eng 35:987-1004 14. Inoue K et Al. (2010) Purification and characterization of OmcZ, an outer-surface, octaheme c-type cytochrome essential for optimal current production by Geobacter sulfurreducens. Appl Environ Microbiol 76:3999-4007 15. Inoue K, et al. (2011) Specific localization of the c-type cytochrome OmcZ at the anode surface in current-producing biofilms of Geobacter sulfurreducens. Environ Microbiol Rep 3:211-217 16. Jenney FE Jr, et al. (1999) Anaerobic microbes: oxygen detoxification without superoxide dismutase. Science 286:306-309 17. Kaden J, Galushko SG, Schink B (2002) Cysteine-mediated electron transfer in syntrophic acetate oxidation by cocultures of Geobacter sul furreducens and Wolinella succinogenes. Arch Microbiol 178:53-58 18. Kiely PD, et al. (2010) Anodic biofilms in microbial fuel cells harbor low numbers of higher-power-producing bacteria than abundant genera. Appl Microbiol Biotechnol 88:371-80 19. Kiely PD, Regan JM, Logan BE (2011) The electric picnic: synergistic requirements for exoelectrogenic microbial communities. Curr Opin Biotechnol 22:378-385 20. Levar CE, et al. (2014) An inner membrane cytochrome required only for reduction of high redox potential extracellular electron acceptors. MBio 2014. 5:e02034 21. Lin WC, Coppi MV, Lovley DR (2004) Geobacter sulfurreducens can grow with oxygen as a terminal electron acceptor. Appl Environ Microbiol 70: 2525-2528 22. Logan BE, et al. (2005) Electricity generation from cysteine in a microbial fuel cell. Water Res 39: 942-952 23. Logan BE, RabaeyK (2012) Conversion of wastes into bioelectricity and chemicals by using microbial electrochemical technologies. Science 337:686-690 24. Lovley DR, et al. (2011) Geobacter: The microbe electric’s physiol-
64
Int. Microbiol. Vol. 20, 2017
ogy, ecology, and practical applications, in Adv. Microb. Physiol., K.P. Robert, Editor. 2011, Academic Press. p. 1-100 25. Lovley DR, Phillips EJ (1986) Organic matter mineralization with reduction of ferric iron in anaerobic sediments. Appl Environ Microbiol 51:683-689 26. Mehta T, et al. (2005) Outer membrane c-type cytochromes required for Fe(III) and Mn(IV) oxide reduction in Geobacter sulfurreducens. Appl Environ Microbiol 71:8634-8641 27. Nakanishi T, Inoue H, Kitamura M (2003) Cloning and expression of the superoxide dismutase gene from the obligate anaerobic bacterium Desul fovibrio vulgaris (Miyazaki F). J Biochem 133:387-393 28. Pedescoll A, et al. (2013) Evapotranspiration affecting redox conditions in horizontal constructed wetlands under Mediterranean climate: Influence of plant species. Ecol Eng 58:335-343 29. Robyt JF, White BJ (1987) Biochemical techniques: Theory and practice. Prospect Heights. Waveland Press, IL, USA 30. Segura D, et al. (2008) Computational and experimental analysis of redundancy in the central metabolism of Geobacter sulfurreducens. PLoS Comput Biol 4:e36 31. Speers AM, Reguera G (2012) Electron donors supporting growth and electroactivity of Geobacter sulfurreducens anode biofilms. Appl Environ Microbiol 78:437-444 32. Speers AM, Reguera G (2015) Theoretical and practical considerations for culturing Geobacter biofilms in microbial fuel cells and other bioelectrochemical systems. In: Beyenal H, Babauta J (eds), Biofilms in bioelectrochemical systems. John Wiley & Sons, pp 37-60 33. Steidl R, Lampa-Pastirk S, Reguera G (2016) Mechanistic stratification in electroactive biofilms of Geobacter sulfurreducens mediated by pilus nanowires. Nature Comm 7:12217 34. Stookey LL (1970) Ferrozine: a new spectrophotometric reagent for iron. Anal Chem 42:779-781
CORBELLA ET AL.
35. Straub KL, Kappler A, Schink B (2005) Enrichment and isolation of ferric-iron- and humic-acid-reducing bacteria. In Mehods in enzymology. Leadbetter JR (ed) pp 58-77 36. Strycharz SM, et al. (2008) Graphite electrode as a sole electron donor for reductive dechlorination of tetrachlorethene by Geobacter lovleyi. Appl Environ Microbiol 74:5943-5947 37. Sung Y, et al. (2006) Geobacter lovleyi sp. nov. strain SZ, a novel metalreducing and tetrachloroethene-dechlorinating bacterium. Appl Environ Microbiol 72:2775-2782 38. Tanner CC (2001) Plants as ecosystem engineers in subsurface-flow treatment wetlands. Water Sci Technol 44:9-17 39. Thomas SH, et al (2010) Unique ecophysiology among U(VI)-reducing bacteria as revealed by evaluation of oxygen metabolism in Anaeromyxo bacter dehalogenans strain 2CP-C. Appl Environ Microbiol 76:176-183 40. van den Berg EM, et al. (2015) Enrichment of DNRA bacteria in a continuous culture. ISME J 9:2153-2161 41. Wagner DD et al. (2012) Genomic determinants of organohalide-respiration in Geobacter lovleyi, an unusual member of the Geobacteraceae. BMC Genomics 13 42. Ward DE, et al. (2001) The NADH oxidase from Pyrococcus furiosus. Implications for the protection of anaerobic hyperthermophiles against oxidative stress. Eur J Biochem 268:5816-5823 43. Yang TH, et al. (2010) Metabolic response of Geobacter sulfurreducens towards electron donor/acceptor variation. Microb Cell Fact 9:90 44. Young JM, Leschine SB, Reguera G (2011) Reversible control of biofilm formation by Cellulomonas spp. in response to nitrogen availability. Environ Microbiol. 14: 594-604 45. Zacharoff L, Chan CH, Bond DR (2016) Reduction of low potential electron acceptors requires the CbcL inner membrane cytochrome of Geo bacter sulfurreducens. Bioelectrochemistry 107:7-13
RESEARCH ARTICLE International Microbiology 20(2):65-73 (2017) doi:10.2436/20.1501.01.286. ISSN (print): 1139-6709. e-ISSN: 1618-1095
www.im.microbios.org
High prevalence of methicillin-resistant coagulase-negative staphylococci isolated from a university environment in Thailand Rathanin Seng,1 Udomluk Leungtongkam,1 Rapee Thummeepak,1 Wassana Chatdumrong,1,2 Sutthirat Sitthisak1,2* Department of Microbiology and Parasitology, Faculty of Medical Sciences, Naresuan University, Phitsanulok, Thailand. Centre of Excellence in Medical Biotechnology, Faculty of Medical Sciences, Naresuan University, Phitsanulok, Thailand
1 2
Received 22 March 2017 · Accepted 28 April 2017 Summary. The present study was conducted to isolate and characterize the molecular epidemiology of the methicillinresistant staphylococci in the general university environment, where all five locations; the library, restrooms, canteens, computer rooms and outdoor surfaces, are in common use by a large population of students. We used Mannitol Salt Agar (MSA) supplemented with 4 µg/ml of oxacillin to screen the methicillin-resistant staphylococci. The species level was identified by PCR of rdr (Staphylococcus epidermidis), groESL (Staphylococcus haemolyticus) and nuc (Staphylococcus aureus and Staphylococcus warneri) genes and DNA sequencing of tuf and dnaJ genes. The susceptibility patterns of the isolates were determined using the disk diffusion method. Antibiotic and disinfectant resistance genes, together with SCCmec types, were detected by the PCR method. The methicillin resistant-staphylococci were isolated from 41 of 200 samples (20.5%), and all of them were found to be methicillin-resistant coagulase negative staphylococci (MR-CoNS). The library had the highest percentage of contamination, with 43.3% of the samples found to be contaminated. All isolates belonged to 6 different species including S. haemolyticus, S. epidermidis, S. warneri, S. cohnii, S. saprophyticus and S. hominis. The antimicrobial resistance rates were highest against penicillin (100%), then cefoxitin (73.1%), erythromycin (73.1%) and oxacillin (68.3%). Altogether, the isolates were approximately 61.0% multidrug resistant (MDR), with the S. epidermidis isolates being the most multidrug resistant (P < 0.05). The prevalence of the qacA/B gene was detected in 63.4% of the isolates, and SCCmec could be typed in 43.9% (18/41) of the isolates. The type range was: II (n = 1), IVd (n = 1), I (n = 2), V (n = 6), IVa (n = 8) and untypeable (n = 23). This result indicates that these university environments are contaminated with methicillin-resistant coagulase negative staphylococci that carry various SCCmec types and high rate of disinfectant resistance genes. [Int Microbiol 20(2):65-73 (2017)] Keywords: Staphylococcus spp. · methicillin-resistant coagulase negative staphylococci · drug resistance · gene qacA/B · Phitsanulok (Thailand)
Introduction Staphylococci, particularly Staphylococcus aureus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. hominis, and *
Corresponding author: Sutthirat Sitthisak E-mail: sutthirats@nu.ac.th
S. lugdunensis are medically important pathogens which cause nosocomial and community infections [29]. Staphylococci are classified into coagulase-positive staphylococci known as S. aureus and coagulase-negative staphylococci (CoNS) such as S. epidermidis, S. saprophyticus, S. haemolyticus, S. hominis and another 49 species [28]. Most strains of these bacteria have developed methicillin resistance and
66
Int. Microbiol. Vol. 20, 2017
are therefore called methicillin-resistant S. aureus (MRSA) and methicillin resistant coagulase negative staphylococci (MR-CoNS), which constitute a major health problem. More recently, the number of reports of community-acquired MRSA (CA-MRSA) has been rapidly increasing. However, infections caused by MR-CoNS in the community have not been reported, but the gene transfer from these bacteria to MRSA has been identified [23]. The resistance in MRSA and MR-CoNS is caused by the acquisition of the mecA gene that encodes a modified penicillin-binding protein 2a (PBP2a) which has a low binding affinity for all beta-lactam antibiotics. The mecA gene is located within the mec operon carried by staphylococcal cassette chromosome mec (SCCmec). SCCmec are classified into 11 different types and various subtypes [46]. SCCmec type I, II and III are carried by hospital-acquired MRSA (HA-MRSA) and SCCmec type IV, V and VI are carried by communityacquired MRSA (CA-MRSA) [6]. In contrast to MRSA, the distribution of SCCmec types in MR-����������������������� CoNS is varied, depending on the human host and the geographical locations from where the isolates were obtained [40]. Moreover, the variety of other antibiotic and disinfectant resistance genes such as erythromycin resistance genes (erm) and the quaternary ammonium compound resistance gene (qacA/B) were either identified in plasmids of, or by mobile genetic elements of, staphylococci [44]. Recent studies have reported that a wide variety of different high-touch environmental surfaces in public facilities, universities, microbiological and computer laboratories, daycare centers, prisons and clinics are a potential reservoir of MRSA and drug resistance genes [7]. However, environmental colonization to the spread of MR-CoNS is poorly reported, although Widerström and coworkers [38] found that the hospital-acquire methicillin-resistant S. epidermidis was spread from environmental fomites to patients in Intensive Care Units. Xu, Mkrtchyan and Cutler [40] reported that 21% of hotel samples were contaminated with MR-CoNS, and Mkrtchyan and coworkers [20] found that staphylococci are the most predominant bacteria in non-hospital restrooms, in the UK. Moreover, 23 MR-CoNS were isolated from 7 beach sites in Washington State by Soge and coworkers [33]. We have been able to find only these three papers published on the matter, therefore there is little information available on the prevalence and molecular epidemiology of methicillin-resistant staphylococci isolated from non-hospital environments, and this is especially so in the case of Thailand.
SENG ET AL.
Therefore, exploration of this information has become an important issue demanding investigation, which was the purpose of the current study. We isolated and identified methicillinresistant staphylococci at the specie level, from a university environment in Thailand, and determined the antimicrobial susceptibility pattern, detected the antibiotic and disinfectant resistance genes, and characterized the SCCmec types of all isolates.
Materials and methods Population and samples. The sample size of the study was calculated using the Sample Size Determination in Health Studies Software of the World Health Organization [17]. A total of 200 swab samples were randomly collected from 5 locations of a university community in Thailand, including computer rooms (computer mouse, computer earpieces, computer keyboards and computer power buttons) (n = 40); restrooms (door handles, washbasins, washbasin areas, urinary taps and toilets) (n = 50), the library (books, escalators and tables) (n = 30), canteens (tables, bank notes and coins used for payment, ATM machines and water dispensers) (n = 40), and outdoor surfaces (handrails, exercise machines, public buses) (n = 40). The sample collection was carried out from September to December 2015 with temperature ranging from 31 ºC to 32 ºC at the study area. Bacterial isolation of methicillin-resistant staphylococci. The samples were collected using cotton swabs soaked in 0.85% normal saline, and then placed in transfer media (2% of skim milk powder, 3% of tryptone soya broth (TSB), 0.5% glucose and 10% glycerol). The swab samples were enriched in TSB with shaking at 180 rpm at 37 ºC for 18–24 h. Then, one loopful of overnight culture was streaked on MSA with 4 µg/ml of oxacillin and incubated at 30 ºC for 48–72 h for a primary screening for methicillin-resistant staphylococci base on the method of Lally et al. [15]. All colonies were selected for further identification using Gram’s stain, catalase and coagulase tests. All isolates were subsequently confirmed as staphylococci by the PCR method amplified by 16S rRNA specific primers [13]. Methicillin-resistance was further confirmed by oxacillin disk (1 µg), cefoxitindisk (30 µg) and the PCR method to detect mecA gene. Staphylococcus aureus COL was used as positive control of this method. Identification of methicillin-resistant staphylococci species. Staphylococcus aureus, S. epidermidis, S. haemolyticus and S. warneri were distinguished from other species by the PCR method based on the specific primer of nuc (S. aureus and S. warneri), rdr (S. epidermidis) and groESL (S. haemolyticus) as described by Schmidt et al. [28]. A specific gene of each species was sequenced to ensure the absence of bias in our method. The remaining isolates that could not be identified by PCR were identified by tuf and dnaJ gene sequencing using Sanger Sequencing Method, according to the methods described by Loonen et al. [16] and Shah et al. [30]. The PCR products were purified using an RBC purification kit and sequenced using Applied Biosystems. Sequence similarities of tuf and dnaJ genes > 97% were used to identify isolates at the species level. The primer sets of nuc, rdr, groESL, tuf and dnaJ genes are shown in Table 1.
METHICILLIN-RESISTANT STAPHYLOCOCCI IN THAILAND
Int. Microbiol. Vol. 20, 2017
67
Table 1. Primers for antibiotic resistance gene amplification and bacterial identification Primers
Oligonucleotide sequence (5’-3’)
Tm (oC)
nuc-F(S. aureus)
TCGCTTGCTATGATTCTGG
55.2
nuc-R(S. aureus)
GCCAATGTTCTACCATAGC
55.2
nuc-F(S. horminis)
TACAGGGCCATTTAAAGACG
56.4
nuc-R(S. hominis)
GTTTCTGGTGTATCAACACC
56.4
nuc-F(S. warneri)
CGTTTGTAGCAAAACAGGGC
58.4
nuc-R(S. warneri)
GCAACGAGTAACCTTGCCAC
60.5
rdr-F
AAGAGCGTGGAGAAAAGTATCAAG
61.8
rdr-R
TCGATACCATCAAAAAGTTGG
61.8
groESL-F
GGTCGCTTAGTCGGAACAAT
57.8
groESL-R
CACGAGCAATCTCATCACCT
57.8
tuf-F
CCAATGCCACAAACTCGTGA
58.4
tuf-R
CAGCTTCAGCGTAGTCTAATAATTTACG
65.7
dnaJF
GCCAAAAGAGACTATTATGA
52.3
dnaJR
ATTGYTTACCYGTTTGTGTACC
56.6
mecA-F
TGGCTATCGTGTCACAATCG
58
mecA-R
GTTCTCTCATAGTATGACGTCC
58
ermA-F
AAGCGGTAAACCCCTCTGA
56.7
ermA-R
TTCGCAAATCCCTTCTCAAC
55.2
ermB-F
AATCGTCAATTCCTGCATGT
55.9
ermB-R
TAATCGTGGAATACGGGTTTG
55.9
ermC-F
AATCGTCAATTCCTGCATGT
53.2
ermC-R
TAATCGTGGAATACGGGTTTG
55.9
qacA/B-F
GCAGAAAGTGCAGAGTTCG
57.3
qacA/B-R
CCAGTCCAATCATGCCTG
56.1
Product size (bp)
Reference
359
[27]
177
[10]
999
[10]
130
[32]
271
[4]
480
[16]
920
[30]
310
[26]
190
[34]
142
[3]
299
[34]
361
[44]
Determination of antimicrobial susceptibility patterns. Antimicrobial susceptibility of all isolated methicillin-resistant staphylococci was tested using a standard disk diffusion test against fifteen antibiotics: penicillin (P, 10 units), clindamycin (DA, 2 µg), chloramphenicol (C, 30 µg), gentamicin (CN, 10 µg), erythromycin (E, 15 µg), cefoxitin (FOX, 30 µ���������� ����������� g), sulfamethoxazole/trimethoprim (SXT, 1.25/23.75 ������������������������������� µ������������������������������ g), oxacillin (OX, 1 µg), vancomycin (VA, 30 µg), rifampicin (RD, 5 µg), linezolid (LZD, 30 µg), mupirocin (MUP, 5 µg), ciprofloxacin (CIP, 5 µg), fusidic acid (FD, 10 µg) and novobiocin (NV, 5 µg). The plates were incubated at 35 ºC for 24 h. Staphylococcus aureus NCTC10442 was used as positive control and the results were interpreted according to the guidelines of the Clinical and Laboratory Standards Institute 2014. All isolates were categorized as MDR when they were resistant to at least three classes of antibiotics [19].
gene in the representative isolates. All PCR products were visualized using gel electrophoresis with 1% agarose gel stained with 0.5% ethidium bromide.
Detection of antibiotic and disinfectant resistance genes. The methicillin-resistance gene (mecA) was detected according to the method described by Kitti, Boonyonying and Sitthisak [12]. Staphylococcus aureus COL was used as positive control of this detection. Other antibiotic resistant genes, including erm(A), erm(B), erm(C) and qacA/B,were detected by PCR modified from the method described in [1,41,44]. The primers used are shown in Table 1. The absence of bias was ensured by the sequencing of each
environmental locations was calculated using logistic regression (P < 0.05).
Characterization of SCCmec types. SCCmec types of all isolates were characterized according to the method of Zhang et al. [43]. Staphylococcus aureus NCTC10442, S. aureus JCSC10442 , S. aureus WIS and S. aureus isolated from our previous study [36] were used as reference strains of SCCmec Type I, II, IVa, IVb and V. The amplicons were visualized using gel electrophoresis with 1% agarose gel stained with 0.5% ethidium bromide. Statistical analysis. All data was analyzed using Stata 12.0 (Stata Corporation, USA). The analysis of frequency (Chi-square test; P < 0.05) was used as the statistic to compare the MDR and antimicrobial susceptibility patterns among MR-CoNS species. The association between MR-CoNS prevalence and
Results The prevalence of methicillin-resistant staphylococci. We used MSA, supplemented with 4 µg/ml of oxa-
68
Int. Microbiol. Vol. 20, 2017
SENG ET AL.
Table 2. The association of MR-CoNS prevalence with environmental locations Locationsa
N
Positive MR-CoNS (%)
Negative MR-CoNS (%)
OR
95% CI
LB
30
13 (43.3)
17 (56.7)
RR
50
14 (28.0)
36 (72.0)
0.50
0.19, 1.31
CN
40
8 (20.0)
32 (80.0)
0.32
0.11, 0.94
CR
40
5 (12.5)
35 (87.5)
0.18
0.05, 0.60
US
40
1 (2.5)
39 (97.5)
0.03
0.00, 0.27
P-value
<0.001*
LB: Library, RR: Restroom, CN: Canteen, CR: Computer room and US: Outdoor surfaces OR: odds ratio. CI: confidence interval. *Significant at P < 0.001 a
prevalence. Overall, the environmental locations tested in our study were significantly associated with colonization of MRCoNS (P < 0.001). More precisely, the library was the most contaminated region (Table 2). Species distribution. The specie level of all isolates was identified by our combined method of biochemical test, PCR and DNA sequencing. All 41 isolates of MR-CoNS belonged to 6 different species including S. haemolyticus (41.5%), S. epidermidis (36.6%), S. warneri (12.2%), S. cohnii (4.9%), S. saprophyticus (2.4%) and S. hominis (2.4%) (Fig. 1).
Int Microbiol
cillin, to screen for methicillin-resistant staphylococci and confirmed by oxacillin disk (1 Âľg), cefoxitin disk (30 Âľg) and mecA gene detection. Among the 200 samples, 41 (20.5%) were identified as methicillin-resistant staphylococci, while all of them were MR-CoNS. The library was the most contaminated, with 43.3% of the locations tested showing staphylococci contamination. The next most contaminated were the restrooms (28%), canteens (20%), computer rooms (12.5%) and outdoor surfaces (2.5%). Logistic regression was performed to analyze the association between the environmental locations and MR-CoNS
Fig. 1. Prevalence of MR-CoNS and species distribution by environmental locations (LB: Library, RR: Restroom, CN: Canteen, CR: Computer room, and US: Outdoor surfaces.)
METHICILLIN-RESISTANT STAPHYLOCOCCI IN THAILAND
Fig. 2. Differences among MDR and NON MDR pattern of each species. *Significant at P < 0.05.
Antimicrobial susceptibility pattern. All isolates were resistant to penicillin (100%), cefoxitin (73.1%), erythromycin (73.1%), oxacillin (68.3%), sulfamethoxazole/trimethoprim (29.3%), fusidic acid (22.0%), clindamycin (14.6%), ciprofloxacin (12.2%), chloramphenicol (9.8%), novobiocin (9.8%), gentamicin (4.9%), rifampicin (2.4%), mupirocin (2.4%). All isolates were susceptible to vancomycin and linezolid. We found most of the isolates (approximately 61.0%) were MDR. We divided all 41 isolates into three species groups, S. haemolyticus, S. epidermidis and other species. Then, we compared the resistance rate of each antibiotic among these species using chi-square test. Significantly, the prevalence of MDR in each group was different (P < 0.05). Staphylococcus epidermidis and other species (S. warneri, S. cohnii, S. hominis and S. saprophyticus) were more associated with MDR than was S. haemolyticus (P < 0.05) (Fig. 2). Staphylococcus haemolyticus was more resistant to clindamycin than were S. epidermidis and other species (P < 0.05) (Table 3). Antibiotic and disinfectant resistance genes. Gene mecA was detected in all MR-CoNS isolates by the PCR method. Due to the high resistance to erythromycin, its resistance genes: erm(A), erm(B) and erm(C) were also detected. Only erm(C) was detected in 14.6% of isolates and 20.0% of
69
Int Microbiol
Int. Microbiol. Vol. 20, 2017
erythromycin resistant isolates, indicating the low correlation between the phenotypic pattern and the causative genes. We also detected qacA/B gene, the gene encoding resistance to several antiseptics and disinfectants. A high proportion (63.4%) of all isolates was positive with this gene. SCCmec types. All isolates were subjected to characterization by their SCCmec types using multiplex PCR. Among all the isolates, 43.9% (18/41) were characterized as SCCmec type I (n = 2), II (n = 1), IVa (n= 8), IVd (n = 1) and V (n = 6). We found 56.1% (23/41) were untypeable SCCmec types. The distribution of SCCmec types in each species is shown in Table 4.
Discussion To strengthen the understanding about the dissemination of methicillin-resistant staphylococci within non-health care environments, we examined isolates from a university environment in Thailand, and identified the specie levels in those isolates. Most of the MR-CoNS (43.3%) isolates in the study were obtained from items in the library, such as books and study tables. Hence, MR-CoNS can be easily spread by the simple act of reading a book at a table in the library.
70
Int. Microbiol. Vol. 20, 2017
SENG ET AL.
Table 3. The comparison of qacA/B gene and antimicrobial resistance patterns in each MR-CoNS species S. haemolyticus n = 17 (%)
S. epidermidis n = 15 (%)
Other species n = 9 (%)
Total n = 41 (%)
P-value
qacA/B
12 (70.6)
9 (60.0)
5 (55.6)
26 (63.4)
0.767
Oxacillin
12 (70.6)
12 (80.0)
4 (44.4)
28 (68.3)
0.187
Cefoxitin
12 (70.6)
13 (86.7)
5 (55.6)
30 (73.1)
0.238
Erythromycin
13 (76.5)
10 (66.7)
7 (77.8)
30 (73.1)
0.773
Sulfamethoxazole/ Trimethoprim
4 (23.5)
3 (20.0)
2 (22.2)
9 (22.0)
0.971
Chloramphenicol
0 (0.0)
2 (13.3)
2 (22.2)
4 (9.6)
0.162
Rifampicin
0(0.0)
1 (6.7)
0 (0.0)
1 (2.4)
0.411
Gentamicin
1 (5.9)
1 (6.7)
0 (0.0)
2 (4.9)
0.740
Fusidic acid
5 (29.4)
1 (6.7)
0(0.0)
6 (14.6)
0.071
Clindamycin
10 (58.8)
1 (6.7)
1 (11.1)
12 (29.3)
<0.05*
Mupirocin
0 (0.0)
0 (0.0)
1 (11.1)
1 1 (2.4)
0.162
Novobiocin
1 (5.9)
3 (20.0)
0 (0.0)
4 (9.6)
0.218
Ciprofloxacin
1(5.9)
2 (13.3)
2 (22.2)
5 (12.2)
0.473
Vancomycin
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
NA
Linezolid
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
NA
Antibiotics
*Significant at P < 0.05. NA = not analyzed.
Using our screening method, none of the isolates was identified as MRSA. Like in a previous report, on a study conducted in India, MRSA was not recovered from a hospital environment [31]. To ascertain the specie distribution of MR-CoNS isolates in this study, we identified that 6 different species were presented in all of the isolates (Fig. 1). These species are similar to the CoNS obtained from non-
hospital environments [20,40], clinical specimens [14,25], healthy adult volunteers [2] and chicken meat [22]. However, the prevalence of each species was different among these specimens. Staphylococcus epidermidis was categorized as the predominant species of CoNS isolated from clinical and commensal samples, while S. haemolyticus was found to have the highest prevalence in non-healthcare environments.
Table 4. Distribution of SCCmec types among MR-CoNS isolated from the university environment. The values in the table indicate the number of each SCCmec type in each species MR-CoNS Species
SCCmec I
II
IVa
IVd
V
Untypeable
S. haemolyticus
0
1
1
0
3
12
S. epidermidis
0
0
4
1
1
9
S. warneri
0
0
3
0
2
0
S. cohnii
2
0
0
0
0
0
S. saprophyticus
0
0
0
0
0
1
S. hominis
0
0
0
0
0
1
Total
2
1
8
1
6
23
METHICILLIN-RESISTANT STAPHYLOCOCCI IN THAILAND
In contrast, the species distribution on our study was different from CoNS contaminating fermented food and starter cultures [42]. More than 60% of all isolates were resistant to penicillin, cefoxitin, and erythromycin. Two notable antimicrobial resistance patterns of these isolates were found. First, 61.0% of all isolates was identified as MDR, which higher than the rate of staphylococci MDR isolated from commensal specimens [21], and about 10 times more than the prevalence reported by Cavanagh et al. [2]. Second, S. epidermidis and other species (S. warneri, S. cohnii, S. saprophyticus and S. hominis) were all significantly associated with MDR, and all higher than S. haemolyticus. To our knowledge, this is the first comparison of MDR patterns among MR-CoNS collected from nonhealthcare environments. However, studies with larger samples are needed to confirm these findings. We found 11 mecA positive isolates that were not resistant to oxacillin and cefoxitin. This may be explained by: (a) not all mecA positive staphylococci are resistant to oxacillin due to the low expression of PBP2a causing the low levels of minimum inhibitory concentration (MIC) [40], and (b) MR-CoNS can be incorrectly characterized by cefoxitin disk diffusion (35). Additionally, 63.4% of all isolates in the present study carried the qacA/B gene. This prevalence was higher than the rate of qacA/B gene carried by CoNS isolated from surgical sites [37], nurses and the general population in Hong Kong [44]. According to previous studies, the SCCmec types in MRCoNS are more diverse than in MRSA [11]. Hanssen et al. [8] revealed that staphylococcal strains from the same geographical region carry identical ccr genes and differ from sequences of strains from other regions. This agreement supports the evidence of horizontal SCCmec gene transfer among staphylococcal strains [9,46]. All 41 MR-CoNS isolates in our study were characterized for their SCCmec types, and we found that most of them (23/41) were assigned as untypeable. This result correlated with S. hominis isolates from blood that carried the high rate (82%) of untypeable SCCmec types [18]. These untypeable SCCmec were suspected to carry novel SCCmec types as described previously [24,45]. However, the bias may have occurred due to the use of primer sets developed for S. aureus. In addition to this result, 4/8 of SCCmec IVa and 1/1 of SCCmec IVd belonged to methicillin-resistant S. epidermidis (MRSE). This supported the description of Wisplinghoff et al. [39] and Du et al. [5] that found SCCmec IV in most MRSE strains. In conclusion, the university environments such as library,
Int. Microbiol. Vol. 20, 2017
71
canteen, restrooms and computer room are the essential reservoirs of MR-CoNS. The species distribution of these isolates was similar to the strains isolated from clinical and commensal specimens. We demonstrated the high prevalence of quaternary ammonium resistance gene of these MR-CoNS and most of the isolates were multidrug resistant bacteria. This finding provided useful information to support disease prevention strategies against staphylococcal infections. People should be careful when touching these surfaces because they can be the carrier of these high-antibiotic resistance bacteria to other people. Hand washing activity should be usually practiced to eliminate this reservoir.
Acknowledgement. This work was supported by a grant from the National Research Council of Thailand (R2560B064) to SS. RS was supported by the Royal Scholarship under Her Royal Highness Princess Maha Chakri Sirindhorn, 2015 of Naresuan University. We also acknowledge Dr. Keiichi Hiramatsu and Dr. Teruyo Ito for providing SCCmec type strains. Many thanks to Mr. Roy Morien of the Naresuan University Language Centre for his editing assistance and advice on English.
Competing interests. None declared.
References 1. Ardic N, Ozyurt M, Sareyyupoglu B, Haznedaroglu T (2005) Investigation of erythromycin and tetracycline resistance genes in methicillin-resistant staphylococci. Int J Antimicrob Agent 26:213-218 2. Cavanagh JP, Wolden R, Heise P, Esaiassen E, Klingenberg C, Aarag Fredheim EG (2016) Antimicrobial susceptibility and body site distribution of community isolates of coagulase�negative staphylococci. APMIS 124:973-978 3. Chaieb K, Zmantar T, Chehab O, Boucham O, Hasen AB, Mahdouani K, Bakhrouf A (2007) Antibiotic resistance genes detected by multiplex PCR assays in Staphylococcus epidermidis strains isolated from dialysis fluid and needles in a dialysis service. Jpn J Infect Dis 60:183 4. Chiang YC, Lu HC, Li SC, Chang YH, Chen HY, Lin CW, Tsen HY (2012) Development of PCR primers and a DNA macroarray for the simultaneous detection of major Staphylococcus species using groESL gene. Foodborne Pathog Dis 9:249-257 5. Du X, Zhu Y, Song Y, Li T, Luo T, Sun G, Li M (2013) Molecular analysis of Staphylococcus epidermidis strains isolated from community and hospital environments in China. PLoS One 8:e62742 6. Eed, EM, Ghonaim MM, Hussein YM, Saber T, Khalifa AS (2015) Phenotypic and molecular characterization of HA-MRSA in Taif hospitals, Saudi Arabia. J Infect Dev Ctries 9:298-303 7. Friedman L, Wallar LE, Papadopoulos A (2015) Environmental risk fac-
72
Int. Microbiol. Vol. 20, 2017
tors for community-acquired MRSA. National Collaboration Center for Environment Health. Retrieved from http://www.ncceh.ca/sites/default/ files/Environmental_Risk_Factors_MRSA_April_2015.pdf 8. Hanssen AM, Sollid JUE (2006) SCCmec in staphylococci: genes on the move. FEMS Immunol Med Microbiol 46:8-20 9. Hanssen AM, Kjeldsen G, Sollid JUE (2004) Local variants of staphylococcal cassette chromosome mec in sporadic methicillin-resistant Staphylococcus aureus and methicillin-resistant coagulase-negative staphylococci: evidence of horizontal gene transfer? Antimicrob Agents Chemother 48:285-296 10. Hirotaki S, Sasaki T, Kuwahara-Arai K, Hiramatsu K (2011) Rapid and accurate identification of human-associated staphylococci by use of multiplex PCR. J Clin Microbiol 49:3627-3631 11. Hisata K, Kuwahara-Arai K, Yamanoto M, Ito T, Nakatomi Y, Cui L, Kinoshita S (2005) Dissemination of methicillin-resistant staphylococci among healthy Japanese children. J Clin Microbiol 43:3364-3372 12. Kitti T, Boonyonying K, Sitthisak S (2011) Prevalence of methicillin resistant Staphylococcus aureus among university students in Thailand. Southeast Asian J Trop Med Public Health 42:1498-1504 13. Kohner P, Uhl J, Kolbert C, Persing D, Cockerill FR (1999) Comparison of susceptibility testing methods with mecA gene analysis for determining oxacillin (methicillin) resistance in clinical isolates of Staphylococcus aureus and coagulase-negative Staphylococcus spp. J Clin Microbiol 37:2952-2961 14. Koksal F, Yasar H, Samasti M (2009) Antibiotic resistance patterns of coagulase-negative Staphylococcus strains isolated from blood cultures of septicemic patients in Turkey. Microbiol Res 164:404-410 15. Lally RT, Ederer MN, Woolfrey BF (1985) Evaluation of mannitol salt agar with oxacillin as a screening medium for methicillin-resistant Staphylococcus aureus. J Clin Microbiol 22:501-504 16. Loonen AJ, Jansz AR, Bergland JN, Valkenburg M, Wolffs PF, van den Brule AJ (2012) Comparative study using phenotypic, genotypic, and proteomics methods for identification of coagulase-negative staphylococci. J Clin Microbiol 50:1437-1439 17. Lwanga SK, Lemeshow S (1991) Sample size determination in health studies: a practical manual. World Health Organization, Geneva, Switzerland 18. Mendoza-Olazarán S, Morfin-Otero R, Rodríguez-Noriega E, LlacaDíaz J, Flores-Treviño S, González-González GM, Garza-González E (2013) Microbiological and molecular characterization of Staphylococcus hominis isolates from blood. PLoS One 8:e61161 19. Mishra SK, Rijal BP, Pokhrel BM (2013) Emerging threat of multidrug resistant bugs–Acinetobacter calcoaceticus baumannii complex and methicillin resistant Staphylococcus aureus. BMC Res Notes 6:1 20. Mkrtchyan HV, Russell CA, Wang N, Cutler R (2013) Could public restrooms be an environment for bacterial resistomes? PLoS One 8:e54223 21. Morgenstern M, Erichsen C, Hackl S, Mily J, Militz M, Friederichs J, Post V (2016) Antibiotic resistance of commensal Staphylococcus aureus and coagulase-negative staphylococci in an international cohort of surgeons: a prospective point-prevalence study. PLoS One 11:e0148437 22. Osman, KM, Badr J, Al-Maary K, Moussa I, Hessain A, Girh Z, Saad A (2016) Prevalence of the antibiotic resistance genes in coagulase-positive-and negative-Staphylococcus in chicken meat retailed to consumers. Front Microbiol 7:1846
SENG ET AL.
23. Otto M (2013) Coagulase‐negative staphylococci as reservoirs of genes facilitating MRSA infection. Bioessays 35:4-11 24. Panda S, Jena S, Sharma S, Dhawan B, Nath G, Singh DV (2016) Identification of novel sequence types among Staphylococcus haemolyticus isolated from variety of infections in India. PLoS One 11:e0166193 25. Rahman A, Hosaain M, Mahmud C, Paul S, Sultana S, Haque N, Kubayashi N (2012) Species distribution of coagulase negative staphylococci isolated from different clinical specimens. Mymensingh Med J 21:195-199 26. Ryffel C, Tesch W, Birch-Machin I, Reynolds PE, Barberis-Maino L, Kayser FH, Berger-Bächi B (1990) Sequence comparison of mecA genes isolated from methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis. Gene 94:137-138 27. Sasaki T, Tsubakishita S, Tanaka Y, Sakusabe A, Ohtsuka M, Hirotaki S, Hiramatsu K (2010) Multiplex-PCR method for species identification of coagulase-positive staphylococci. J Clin Microbiol 48:765-769 28. Schmidt T, Kock MM, Ehlers MM (2015) Diversity and antimicrobial susceptibility profiling of staphylococci isolated from bovine mastitis cases and close human contacts. J Dairy Sci 98:6256-6269 29. Seshadri D, Sethuraman G (2016) Gram positive bacterial infections. In Singal, A, & Grover C. Comprehensive approach to infections in dermatology. Jaypee brothers Medical Pub, London, UK 30. Shah MM, Iihara H, Noda M, Song S.X, Nhung P.H, Ohkusu K, Ezaki T (2007) dnaJ gene sequence-based assay for species identification and phylogenetic grouping in the genus Staphylococcus. Int J Syst Evol Microbiol 57:25-30 31. Shobha K, Rao P, Thomas J (2005) Survey of Staphylococcus isolates among hospital personnel, environment and their antibiogram with special emphasis on methicillin resistance. Indian J Med Microbiol 23:186 32. Shome B, Das Mitra S, Bhuvana M, Krithiga N, Velu D, Shome R, Rahman H (2011) Multiplex PCR assay for species identification of bovine mastitis pathogens. J Appl Microbiol 111:1349-1356 33. Soge OO, Meschke JS, No DB, Roberts MC (2009) Characterization of methicillin-resistant Staphylococcus aureus and methicillin-resistant coagulase-negative Staphylococcus spp. isolated from US West Coast public marine beaches. J Antimicrob Chemother 64:1148-1155 34. Strommenger B, Kettlitz C, Werner G, Witte W (2003) Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J Clin Microbiol 41:4089-4094 35. Swenson JM, Tenover FC, Group CDS (2005) Results of disk diffusion testing with cefoxitin correlate with presence of mecA in Staphylococcus spp. J Clin Microbiol 43:3818-3823 36. Tangchaisuriya U, Yotpanya W, Kitti T, Sitthisak S (2014) Distribution among Thai children of methicillin resistant Staphylococcus aureus. Southeast Asian Trop Med Public Health 42:149-156 37. Temiz M, Duran N, Dura G G, Eryılmaz N, Jenedi K (2014) Relationship between the resistance genes to quaternary ammonium compounds and antibiotic resistance in staphylococci isolated from surgical site infections. Sci Monit 20:544 38. Widerström M, Wiström J, Edebro H, Marklund E, Backman M, Lindqvist P, Monsen T (2016) Colonization of patients, healthcare workers, and the environment with healthcare-associated Staphylococcus epidermidis genotypes in an intensive care unit: a prospective observational cohort study. BMC Infect Dis 16:743
METHICILLIN-RESISTANT STAPHYLOCOCCI IN THAILAND
39. Wisplinghoff H, Rosato AE, Enright MC, Noto M, Craig W, Archer GL (2003) Related clones containing SCCmec type IV predominate among clinically significant Staphylococcus epidermidis isolates. Antimicrob Agents Chemother 47:3574-3579 40. Xu Z, Mkrtchyan HV, Cutler RR (2015) Antibiotic resistance and mecA characterization of coagulase-negative staphylococci isolated from three hotels in London, UK. Front Microbiol 6:947 41. Youn JH, Park YH, Hang’ombe B, Sugimoto C (2014) Prevalence and characterization of Staphylococcus aureus and Staphylococcus pseudintermedius isolated from companion animals and environment in the veterinary teaching hospital in Zambia, Africa. Comp Immunol Microbiol Infect Dis 37:123-130 42. Zell C, Resch M, Rosenstein R, Albrecht T, Hertel C, & Götz F (2008) Characterization of toxin production of coagulase-negative staphylococci isolated from food and starter cultures. Int J Food Microbiol 127:246-251
Int. Microbiol. Vol. 20, 2017
73
43. Zhang K, McClure JA, ElsayedS, Louie T, Conly JM (2005) Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol 43:5026-5033 44. Zhang M, O’Donoghue M, Ito T, Hiramatsu K, Boost M (2011) Prevalence of antiseptic-resistance genes in Staphylococcus aureus and coagulase-negative staphylococci colonising nurses and the general population in Hong Kong. J Hosp Infect 78:113-117 45. Zong Z, Lü X (2010) Characterization of a new SCCmec element in Staphylococcus cohnii. PLoS One 5:e14016 46. Zong Z, Peng C, Lü X (2011) Diversity of SCCmec elements in methicillin-resistant coagulase-negative staphylococci clinical isolates. PLoS One 6:e20191
RESEARCH ARTICLE International Microbiology 20(2):75-84 (2017) doi:10.2436/20.1501.01.287. ISSN (print): 1139-6709. e-ISSN: 1618-1095
www.im.microbios.org
Characterization of high exopolysaccharideproducing Lactobacillus strains isolated from mustard pickles for potential probiotic applications Jing-Yao Huang,1 Cheng-Yen Kao,2 We-Sin Liu,1 Tony J. Fang1,3* Department of Food Science and Biotechnology, National Chung Hsing University, Taichung, Taiwan, 2Department of Biotechnology and Laboratory Science in Medicine, School of Biomedical Science and Engineering, National Yang Ming University, Taipei, Taiwan, 3Food Industry Research and Development Institute, Hsinchu, Taiwan 1
Received 27 March 2017 · Accepted 8 May 2017 Summary. The aim of this study was to characterize high exopolysaccharide (EPS)-producing lactic acid bacteria (LAB) isolated from mustard pickles in Taiwan for potential probiotic applications. Among 39 collected LAB strains, four most productive EPS-producing strains were selected for further analysis. Comparative analyses of 16S rDNA genes rpoA and pheS sequences demonstrated that these strains were members of Lactobacillus plantarum-group (LPG). NCD 2, NLD 4, SLC 13, and NLD 16 showed survival rates of 95.83% ± 0.49%, 95.07% ± 0.64%, 105.84% ± 0.82%, and 99.65% ± 0.31% under simulated gastrointestinal conditions, respectively. No cytotoxic effects on macrophage RAW 264.7 cells were observed when they were treated with a low dose (1 μg/ml) of stimulants extracted from the tested LAB strains. The production of nitric oxide in RAW 264.7 cells incubated with various LAB stimulants showed a dose-dependent increase. Among the four strains, SLC 13 showed higher inhibitory activity on growth of Enterococcus faecalis (BCRC 12302) and Yersinia enterocolitica (BCRC 10807). NLD 4 showed strong inhibitory activity against Escherichia coli O157:H7 (ATCC 43894) as compared with the other three strains. In summary, our results suggest that Lactobacillus pentosus SLC 13 may be a good candidate for probiotic applications and for development of antibacterial compounds. [Int Microbiol 20(2):75-84 (2017)] Keywords: Lactobacillus spp. · exopolysaccharide · probiotics
Introduction The market of dietary supplements that promote health has increased since 1990s. Among them, probiotics are defined as live microorganisms that could confer a health benefit on the host when adequate amounts are administered [18]. Currently, the genera Lactobacillus (a member of the lactic acid bacteria *
Corresponding author: Tony J. Fang E-mail: tjfang@nchu.edu.tw
(LAB) group) and Bifidobacterium are the most common probiotics used for human nutrition. LAB generally have many useful properties, including tolerance to gastric acid and bile salts, tolerance to antimicrobial agents, improvement of immune responses, gastrointestinal adsorption, and stability during processing [30]. Moreover, fermentation by the LAB group is a natural bioprocessing technology for production of foods such as milk, vegetables, yogurt, cheese, meat, and cocoa beans. LAB-mediated fermentation thus improves nutrition and preserves qualities of food and beverage products for long periods [7].
76
Int. Microbiol. Vol. 20, 2017
The beneficial effects of LAB and its derivative exopolysaccharide (EPS), include the prevention and treatment of diarrheal disease, prevention of infections, antitumor activity, immunomodulation, prevention and treatment of allergies, and alleviation of lactose intolerance [10,22,29,30,31,37]. In addition, the EPS produced by LAB is an important source of natural alternatives to various chemical compounds and plays a critical role in the production of fermented dairy products in Asia, Eastern Europe, and Northern Europe. However, the characteristics and production of EPS by LAB show a great variety, which depends on the type of LAB strains, culture conditions, and composition of the medium [14]. Mustard pickles, a vegetable processing product that is fermented by LAB and yeast, is an important dietary dish in Taiwan. Traditional processing of mustard pickles is as follows: whole mustard vegetables (Brassica juncea) are packed in layers with addition of solar salt to each vegetable layer. Followed by placement of a large rock on top of the container, the mustard inside the container is slowly pressed and fermented. In this study, we aimed to isolate and characterize LAB strains with potential probiotic applications from mustard pickles. To our knowledge, this is the first report of characterization of EPS-overproducing LAB strains from mustard pickles in Taiwan.
Materials and methods Sampling and isolation of lactic acid bacteria. Fifteen mustard pickle samples for LAB isolation were collected in traditional markets (Beipu Township, Hsinchu County, 4 samples and Meinong District, Kaohsiung City, 3 samples) and a mustard pickle production center (Dapi Township, Yunlin County, 8 samples) in Taiwan. The samples were transported to the laboratory at room temperature for isolating LAB in batches within 24 h of acquisition. MRS (de Man, Rogosa, and Sharpe) agar plates were used for LAB isolation. Each mustard pickle sample was crushed and mixed with phosphatebuffered saline (PBS) buffer. A serial dilution of the suspension was spread onto the surface of MRS agar plates. Samples were then incubated under anaerobic conditions at 37 °C for 48 h. Six colonies were randomly selected from each MRS agar plates (total 90 colonies) and initially tested for acid production, catalase activity, bacterial motility, Gram staining, and cell morphology. Among 90 colonies, a total of 39 LAB strains were isolated from mustard pickles. The selected strains were stored at –80 °C in MRS broth containing 16% glycerol until testing. Exopolysaccharide production analysis. The EPS production of isolated LAB strains was evaluated according to a previous study with a modification [17]. In brief, the liquid fermented by LAB was centrifuged at
HUANG ET AL.
6000 ×g for 15 min after incubation for 48 h, and the resulting supernatant was collected carefully. An aliquot of the supernatant (1 ml) was mixed with 4 ml of 95% ethanol, and then incubated at 4 °C for 24 h. The precipitated EPS was centrifuged at 9000 ×g for 15 min, and the supernatant was discarded. The precipitate of pure EPS was dried in the oven at 60 °C for 24 h. The production of EPS was analyzed by the phenol-sulfuric method using glucose as a reference standard [35]. Among collected isolates, EPS yields were ranging from 0 to 0.43 ± 0.04 g/l. Four high EPS-producing LAB strains were further identified by means of the API 50 CH (BioMérieux, Marcy l’Etoile, France) strips and gene sequences (16S rDNA, rpoA, and pheS genes) to the species level [4]. DNA techniques. Mini Qiagen columns and a QiaAmp DNA extraction kit (Qiagen, Valencia, CA) were used for chromosomal DNA extraction. PCR was carried out according to the manufacturer’s instruction using Taq polymerase (Promega, Madison, WI, USA). DNA sequencing and phylogenetic analysis. The sequence of 16S rDNA gene, the housekeeping genes rpoA (the gene encoding the DNAdependent RNA polymerase alpha-subunit), and pheS (the gene encoding the phenylalanyl-tRNA synthase alpha-subunit) were used for phylogenetic analysis and species identification. Primers and conditions for PCR amplification of the 16S rDNA, rpoA, and pheS genes were described previously [4]. To draw a phylogenetic tree of the 16S rDNA, rpoA, and pheS genes, sequences were first aligned using the CLC Workbench (CLC sequence viewer 7.0, CLC Bio/Qiagen, Aarhus, Denmark), and the aligned file was then subjected to the neighbour-joining method to draw a phylogenetic tree with bootstrap analysis of 1000 replicates. Random amplified polymorphic DNA (RAPD)–PCR amplification. Three different primers (primers B, 5′-AACGCGCAAC-3′; primer E, 5′-GGCGTCGGTT-3′; and primer F, 5′-GGCCACGGAA-3′) for RAPD– PCR analysis used in this study were described previously [5]. In brief, the PCR mixtures were made in a volume of 50 μl containing 100 ng of DNA, 10 pmol of primer, 0.15 mM each deoxynucleoside triphosphate, reaction buffer with MgCl2, and 1 U of Taq DNA polymerase. The cycling program consisted of 1 cycle of 94 °C for 5 min; 8 cycles of 94 °C for 30 s, 36 °C for 1 min, and 72 °C for 90 s; 35 cycles of 94 °C for 20 s, 36 °C for 30 s, and 72 °C for 90 s; and a final cycle of 72 °C for 3 min. The PCR products were electrophoretically separated in 1% agarose gels. The RAPD profiles were used to discriminate between the different isolates. Tolerance of simulated gastrointestinal conditions. To evaluate the survival of LAB strains in an environment that mimics in vivo human upper-gastrointestinal tract conditions, an in vitro methodology was used. For acid tolerance analysis, 0.1 ml of a LAB culture medium from an overnight culture was added to 9.9 ml of PBS (pH = 3). The mixture was incubated at 37 °C with agitation (80 rpm) for 3 h. One milliliter of the culture medium was mixed with 9 ml of PBS, followed by serial dilution and spreading on MRS agar plates. The number of surviving bacteria was measured by the plate counts after 48-h incubation under anaerobic conditions. The survival rate of LAB strains under acidic conditions was calculated according to the following equation: Survival rate (%) = [A1(Log CFU/ml)/A0(Log CFU/ml)] × 100, where A1
EPS-PRODUCING LAB FOR PROBIOTIC APPLICATION
is the viable count of LAB after 3 h at pH 3.0, and A0 is the viable count of LAB at 0 h. For analysis of bile salt tolerance, after acid treatment for 3 h, the surviving LAB were collected by centrifugation (7000 ×g, 5 min) and washed two times with PBS (pH 7.2). The bacteria were resuspended in 10 ml of MRS broth with or without 0.3% (w/v) bile salt, and then incubated at 37 °C for 24 h under anaerobic conditions. One milliliter of the culture medium was mixed with 9 ml of PBS, followed by serial dilution and spreading on MRS agar plates. The number of surviving bacteria was determined by the plate counts after 48-h incubation under anaerobic conditions. The survival rate of LAB strains in the culture medium containing 0.3% of bile salt was calculated according to the following formula: Survival rate (%) = [B1(Log CFU/ml)/B0(Log CFU/ml)] × 100, where B1 is the viable count of LAB in 0.3% bile salt for 24 h, and B0 is the viable count of LAB cultured without 0.3% bile salt for 24 h. In addition, the survival rate of the analyzed LAB strains under simulated gastrointestinal conditions (pretreatment with acid conditions before bile salt treatment) was calculated according to the following formula: Survival rate (%) = [C1(Log CFU/ml)/C0(Log CFU/ml)] × 100. where C1 is the viable count of LAB under simulated gastrointestinal conditions, and C0 is the viable count of LAB at 0 h. Antibiotic sensitivity testing. Sensitivity to 15 selected antimicrobial agents was determined by the disk diffusion method on MRS agar plates as described elsewhere [39].����������������������������������� ���������������������������������� BD BBL Sensi-Discs (Becton Dickinson, Sparks, MD�������������������������������������������������������� , USA��������������������������������������������������� ) were used. We tested the antimicrobial agents ampicillin, cefalotin, chloramphenicol, cloxacillin, erythromycin, gentamicin, kanamycin, novobiocin, penicillin G, polymyxin B, rifampicin, tetracycline, neomycin, streptomycin, and vancomycin. All measurements were performed in triplicate. The interpretation of resistance to these antimicrobial agents was in accordance with the recommendations published elsewhere [1,13,38]. Cell culture. RAW 264.7 (mouse macrophage cell line, BCRC 60001) and HT-29 (Human colon colorectal adenocarcinoma cell line, ATCC HTB38) were purchased from Bioresource Collection and Research Center (Hsinchu, Taiwan) and maintained in the DMEM complete medium and McCoy’s 5A (modified) medium, respectively, supplemented with penicillin (100 IU/ ml), streptomycin (100 μg/ml), and 10% of fetal bovine serum at 37 °C with 5% of CO2 supplemented in a humidified incubator. Bacterial adhesion assay. Bacterial adhesion assay was performed according to a previousd study with a modification [34]. HT-29 cells (1 × 105/ well) were grown overnight in 12-well culture dishes to approximately 80% confluence. Bacteria were added to the wells at a multiplicity of infection (MOI) of 100 without centrifugation and were incubated for 1 h. Each dish with HT-29 Lactobacillus co-culture was washed twice with prewarmed PBS buffer to remove unbound bacteria. Adhered Lactobacillus cells were quantified by lysing the cells for 2 min with 1% Triton X-100-containing PBS buffer, followed by serial dilution and spreading on MRS agar plates. The number of adhered bacteria was measured by the plate counts after 3 days incubation. The percentage of bacterial adhesion was calculated according to the following formula: Adhesion ability (%) = (adhered bacteria)/(total bacteria) × 100
Int. Microbiol. Vol. 20, 2017
77
Cell viability testing and nitric oxide (NO) production. For the treatment of RAW 264.7 cells, LAB stimulants were prepared from an overnight LAB culture. The culture medium was separated by centrifugation, and the pellet was washed with deionized water three times. The LAB stimulants from the pellet were further sterilized, freeze-dried, mixed with a small amount of deionized water, and sterilized again. Cell viability was assessed by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. RAW 264.7 cell cultures grown overnight at the density of 105 cells/ml were incubated with various concentrations of LAB stimulants (1, 10, 50, 100 μg/ml) or lipopolysaccharide (LPS, 0.5 μg/ml) in 100 μl of the DMEM medium for 24 h. After removal of the supernatant from the plate, the cells were incubated at 37 °C with 30 μl of MTT (5 mg/������������������������������ l����������������������������� ) for 3 h. The medium was aspirated, and the crystals were dissolved in 200 μL of dimethylsulfoxide (DMSO). Absorbance of each well at 570 nm was measured using a microplate reader. Cell viability was calculated using the following equation: Cell viability (%) = (Asample/Acontrol) × 100, where Asample is the absorbance of the cells that were incubated with the DMEM medium containing various concentrations of LAB stimulants or LPS (0.5 μg/ml), and Acontrol is the absorbance of the cells alone. The NO production assay was performed according to a previous study with a modification [16]. RAW 264.7 cells incubated overnight were subcultured in 96-well plates at the density of 105/ml in 100 μl of the DMEM medium containing various concentrations of LAB stimulants (1, 10, 50, 100 μg/ml) or LPS (0.5 μg/ml) for 24 h. The culture supernatants were collected, and the NO production was measured by means of the Griess reagent. In brief, the supernatants were mixed with an equal volume of the Griess reagent (1:1 mixture of 0.1% N-1-naphthylethylenediamine in 5% phosphoric acid and 1% sulfanilamide in 5% phosphoric acid), and the samples were inoculated at room temperature with incubation for 15 min. The absorbance of each sample at 540 nm was measured using a microplate reader. NO production was calculated on the basis of a standard curve prepared using sodium nitrite. The antibacterial-activity assay. The agar well diffusion method as described previously was applied to detect and determine the antibacterial activities of the isolated LAB strains [36]. Staphylococcus aureus (BCRC 10908), Enterococcus faecalis (BCRC 12302), Streptococcus mutans (BCRC 15254), and Listeria monocytogenes Scott A [3] were used as Gram-positive indicator strains, and Yersinia enterocolitica (BCRC 10807), Escherichia coli (BCRC 11634), Escherichia coli O157:H7 (ATCC 43894), and Salmonella enterica sv. Typhimurium (BCRC 10747) served as Gram-negative indicator strains. All indicator strains were incubated in Luria-Bertani (LB) broth overnight and then diluted to 107 CFU/ml with LB broth. The LB agar plates were prepared with five wells of 6 mm in diameter. A hundred microliters of the indicator strains in LB broth was spread on the surface of an LB agar plate, followed by placing 50 μl of an overnight LAB culture medium into the wells. The LB agar plates were incubated at 37 °C for 24 h. The antibacterial activities of LAB strains were assessed by the diameter of the inhibition zones. The interpretation of antibacterial activities of these LAB strains was as follows: < 10 mm (–) no antibacterial activity; 10–15 mm (+) weak antibacterial activity; > 15 mm (++) strong antibacterial activity. The antibacterial activity of each strain were evaluated in three independent experiments.
78
Int. Microbiol. Vol. 20, 2017
HUANG ET AL.
Statistical analysis. The data were expressed as mean of three replicates ± SD. Duncan’s multiple-range test was used to identify the significant differences (P < 0.05) between means.
Results Isolation and characterization of LAB strains from mustard pickles. A total of 39 LAB strains were isolated from mustard pickles. Among them, 9, 23, and 7 strains were isolated from Beipu Township, Dapi Township, and Meinong District, respectively. All isolates that showed characteristics of acid production and were catalase-negative, immotile, Gram-positive, and rod-shaped were assumed to be LAB. Among them, four high ESP-producing LAB strains were selected for further analyses (Table 1). The EPS produc-
tion of strains NCD 2, NLD 4, and NLD 16 isolated from mustard pickle samples from the Beipu Township was 0.34 ± 0.04, 0.32 ± 0.02, and 0.35 ± 0.01 g/l, respectively (Table 1). The strain SLC 13 isolated from mustard pickles from the Meinong District produced the largest amount of EPS (0.43 ± 0.04 g/l) among the 39 collected LAB isolates (Table 1). LAB strains isolated from mustard pickles of the Dapi Township showed little or no EPS production. Identification of LAB from 16S rDNA, rpoA, and pheS sequences. Four isolated strains were further identified using the API 50 CHL species identification system, and the results showed that strains NCD 2 and SLC 13 belonged to Lactobacillus plantarum, whereas strains NLD 4 and NLD 16 were Lactobacillus pentosus. Boyd et al. showed that the use of the current API 50 CH database for identification of
Table 1. Characteristics, EPS production, acid and bile salt tolerance, and antibiotic sensitivity of the isolated LAB strains LAB straina NCD 2
NLD 4
SLC 13
NLD 16
Sources in Taiwan
Beipu Township, Hsin Chu
Beipu Township, Hsin Chu
Meinong District, Kaohsiung
Beipu Township, Hsin Chu
16S rDNA, rpoA, and pheS genes identification
Lactobacillus plantarum
Lactobacillus pentosus
Lactobacillus pentosus
Lactobacillus pentosus
EPS (g/l)b
0.34 ± 0.04b
0.32 ± 0.02b
0.43 ± 0.04a
0.35 ± 0.01b
Survival, pH 3.0 (% ± SD)b
73.73 ± 0.32c
88.32 ± 1.03b
99.37 ± 0.45a
87.36 ± 1.06b
Survival, 0.3% bile salt (% ± SD)b
97.57 ± 0.74a
97.40 ± 1.23a
98.94 ± 0.31a
97.97 ± 0.62a
Survival, pH 3.0 + 0.3% bile salt (% ± SD)b
95.83 ± 0.49c
95.07 ± 0.64c
105.84 ± 0.82a
99.65 ± 0.31b
R S R R S R R R S R I R R R R
I S S S S S R R S S S R R R R
R S I R S R R R S I R R R R R
I S S S S I R R S S S R S I R
Antimicrobial susceptibilityc Penicillin G Ampicillin Cephalothin Cloxacillin Erythromycin Novobiocin Vancomycin Polymyxin B Chloramphenicol Rifampicin Tetracycline Kanamycin Gentamicin Neomycin Streptomycin
Four isolated LAB strains showed characteristics of acid production, catalase negativity, a rod shape, immotility, and Gram-positive. Data are the mean of three replicates ± SD. Different letters indicate statistically significant differences at P < 0.05. c S, sensitive; I, intermediate resistance; R, resistant. a
b
Int Microbiol
EPS-PRODUCING LAB FOR PROBIOTIC APPLICATION
Int. Microbiol. Vol. 20, 2017
79
Fig. 1. Phylogenetic tree based on 16S rDNA, rpoA, and pheS sequences showing the relationship of strains NCD 2, NLD 4, SLC 13, and NLD16 with strains of closely related species. The phylogenetic tree was constructed by the neighbour-joining method on the basis of a comparison of (A). 16S rDNA gene (1,362 nt), (B). rpoA (614 nt), and (C). pheS (335 nt). Bootstrap values (%) based on 1000 replications are given at nodes. Bar, % sequence divergence.
Int. Microbiol. Vol. 20, 2017
HUANG ET AL.
Int Microbiol
80
commensal Lactobacillus species led to misidentification or uninterpretable results [2]. Therefore, 16S rDNA gene sequence of four isolates was used for species identification. The results showed that identical 16S rDNA gene sequence was observed between four isolated strains, L. plantarum JDM1 and L. plantarum WCFS1 (Fig. 1A). Currently, five different subspecies of L. plantarum-group (LPG) have been identified and are found to be closely related, which includes L. plantarum (subsp. plantarum and subsp. argentoratensis), Lactobacillus pentosus, Lactobacillus paraplantarum, Lactobacillus xiangfangensis, and Lactobacillus fabifermentans [6]. Therefore, the sequences of rpoA and pheS genes of 4 isolated LPG strains were analyzed for subspecies identification. The results showed that high rpoA and pheS gene sequence similarities were observed between strains NLD4, SLC 13, NLD 16, and L. pentosus KCA1 (Fig. 1B and 1C). For discrimination of the isolates, RAPD fingerprinting was performed, and the results showed that four examined strains had different RAPD profiles (Fig. 2).
Survival under simulated gastrointestinal conditions. To test the survival of the selected LPG strains under simulated gastrointestinal conditions, we used in vitro analysis which mimics the gastrointestinal conditions in the body according to other studies [9,32]. PBS at
Fig. 2. Genetic relatedness among the four LPG isolates by using RAPD-PCR analysis. Three primers with random sequences (B, E and F) were used. Marker, Thermo Scientific GeneRuler 1 Kb DNA ladder.
pH 3.0 was used to simulate gastric juice and the 0.3% bile salt was used to simulate intestinal conditions. All four selected strains were resistant to bile salts, but only SLC 13 showed high resistance to pH 3.0 (Table 1). The results of survival testing under simulated gastrointestinal conditions were as follows: strains NCD 2, NLD 4, SLC 13, and NLD 16 showed survival rates of 95.83% ± 0.49%, 95.07% ± 0.64%, 105.84% ± 0.82%, and 99.65% ± 0.31%, respectively (Table 1). Antibiotic susceptibility of the LPG strains. To examine the antibiotic sensitivity of the four LPG strains, we selected 15 antimicrobial agents for testing. All strains were resistant to penicillin G, vancomycin, polymyxin B, kanamycin, neomycin, and streptomycin but sensitive to ampicillin, erythromycin, and chloramphenicol (Table 1). The SLC 13 strain showed resistance to 12 selected antimicrobial agents but not to ampicillin, erythromycin, and chloramphenicol (Table 1). Adhesion ability of isolated LPG strains. ������� The adhesion rates to HT-29 cells varied depending on the tested strains and ranged from 0.04 to 1.69% (Fig. 3). Among four examined strains, NLD 16 showed significantly better binding rates. The adhesion rates of strain NLD 4 were significantly lower than those of other strains (Fig. 3).
EPS-PRODUCING LAB FOR PROBIOTIC APPLICATION
81
Int Microbiol
Int. Microbiol. Vol. 20, 2017
Effects of LPG stimulants on cell viability and NO production. On the basis of the observations that LPG stimulants have the ability to activate macrophages, we determined the potential effects of LPG stimulants on the cell viability and NO production of RAW 264.7 cells. Clearly, treatment with LPS or a high dose of the stimulants significantly inhibited proliferation of these cells. In addition, stimulants from SLC 13 showed a stronger inhibitory effect (Fig. 4A). Never������ theless, no cytotoxic effects on macrophages were observed when the cells were treated with a low dose (1 μg/ml) of the stimulants (Fig. 4A). RAW 264.7 cells were further incubated with different doses of LPG stimulants, and the amount of NO in the culture supernatant was determined. RAW 264.7 cells in DMEM alone without either LPS treatment or bacterial stimulants served as a negative control. The results showed that when RAW 264.7 cells were incubated with various bacterial stimulants, the production of NO increased in a dose-dependent manner (Fig. 4B). The stimulants from strain SLC 13 appeared to have a stronger effect on NO production than did the stimulants from the other three strains (Fig. 4B). Antibacterial activity of the LPG strains against bacterial pathogens. Eight �������������������������������� indicator pathogenic stra-
Int Microbiol
Fig. 3. Adhesion ability of four LPG isolates. The adhesion of LPG to HT-29 cells with MOI 1 : 100 in four examined strains. Values are the average of at least three independent biological replicates. Each vertical bar represents mean ± SD (n ≥ 3). Different letters indicate statistically significant differences (P < 0.05).
Fig. 4. Cell viability and NO production of RAW 264.7 cells treated with various concentrations of LPG stimulants for 24 h. (A). Cell viability. (B). NO production. Each vertical bar represents mean ± SD (n = 3). Cells treated with 0.5 μg/ml LPS served as a positive control. NC, negative control (DMEM medium only). Different letters indicate statistically significant differences (P < 0.05).
ins (four Gram-positive strains and four Gram-negative strains) were selected to evaluate the antibacterial activity of the four LAB strains. The results revealed that strains NCD 2, NLD 4, and SLC 13 had higher antibacterial activities (Table 2). Among them, SLC 13 showed higher inhibitory activity against the growth of E. faecalis and Y. enterocolitica. NLD 4 strain showed strong inhibitory activity against E. coli O157:H7 compared with the other three strains (Table 2).
82
Int. Microbiol. Vol. 20, 2017
HUANG ET AL.
Table 2. Antibacterial activity of the four isolated LPG against eight indicator pathogenic strains Inhibition levela Pathogenic bacteria
NCD 2
NLD 4
SLC 13
NLD 16
Staphylococcus aureus (BCRC 10908)
++
+
++
++
Enterococcus faecalis (BCRC 12302)
–
+
++
–
Streptococcus mutans (BCRC 15254)
+
+
+
–
Listeria monocytogenes Scott A [3]
+
+
+
+
Yersinia enterocolitica (BCRC 10807)
+
+
++
+
Escherichia coli (BCRC 11634)
+
+
+
–
Escherichia coli O157:H7 (ATCC 43894)
+
++
+
+
Salmonella enterica sv. Typhimurium (BCRC 10747)
+
+
+
+
Gram-positive
Gram-negative
Inhibition level was determined by the diameter of the inhibition zone: (–) < 10 mm; (+) 10–15 mm; (++) > 15 mm
a
Discussion Previous studies showed that the EPS production of LAB strains was highly variable and could be influenced by the genotype and environmental conditions, such as pH, temperature, incubation time, and the medium [11,21,35]. In this study, we isolated four high EPS-producing LPG strains (Table 1). The factors that affect EPS production of selected LPG strains would be worth investigating for probiotic applications in the future. Jiang et al. showed that EPS production was reduced in the variant strains compared with wild-type B. longum BBMN68, causing a reduction in the acid resistance of the variant [15]. The EPS production also contributes to bile tolerance in L. brevis strains [33]. In the present study, we isolated four high EPS-producing LPG strains showing high tolerance to simulated gastrointestinal conditions (Table 1). These results suggest that higher EPS production of selected LPG strains may protect bacteria from a harsh environment, and these strains may be used for probiotic development in the future. Mongkolrob et al. showed a possible correlation between antibiotic resistance and biofilm formation in Burkholderia pseudomallei, in which the EPS was supposed to be the main component in creation of the diffusion barrier for the antibiotics [27]. As a
result, whether the EPS production is associated with the antibiotic resistance in our four LPG strains remains to be verified. In addition, the composition of EPS of our selected strains is still unclear and thus worth investigating. Here, we showed the adhesion rates to HT-29 cells varied depending on the tested strains and ranged from 0.04 to 1.69% (Fig. 3). A previous study showed that Lactobacillus strains isolated from human fecal samples exhibited higher HT-29 cell adhesion ability compared to the strain isolated from cheese [8]. Martin et al. showed that Lactobacillus strains isolated from human intestinal origin presented higher affinity to HT-29 cells [24]. These results suggest that Lactobacillus strains isolated from human source have strong adhesin-receptor interaction for adapting to human cells. In the presence of a pathogen, macrophages can engulf microorganisms, produce NO to kill the pathogens, present antigens to helper T cells, and further secrete proinflammatory cytokines such as IL-6 and TNF-α to activate the immune response. In the present work, SLC 13 stimulants induced significant NO production in RAW 264.7 cells. These findings suggest that the possible mechanism of NO upregulation in macrophages treated with SLC 13 stimulants may be mediated by the l-arginine pathway [8]. Nonetheless, the cellular component(s) of SLC 13 that activates RAW 264.7 cells has
EPS-PRODUCING LAB FOR PROBIOTIC APPLICATION
yet to be identified. At the physiological level, NO plays a protective and critical role in human defense systems, whereas overproduction of NO during inflammation may lead to cytotoxicity [28]. As a result, the use of the selected LPG strains that can induce macrophages producing appropriate levels of NO may potentially enhance an immune response of the host. Here, we showed that strains NCD 2, NLD 4, and SLC 13 had higher antibacterial activities (Table 2). L. plantarum has been demonstrated to produce bacteriocins, such as plantaricin NC8, plantaricin 35d, plantaricin W, plantaricin A, plantaricin C, and plantacin B, and thus to prevent the growth of some pathogenic bacteria [12,23,25,26]. Currently, whole genome sequences of L. plantarum LZ206 and L. paraplantarum L-ZS9 strains were used to identify potential gene cluster, which is responsible for bacteriocins biosynthesis and could be associated with its broad-spectrum antimicrobial activity [19,20]. The comparative genome analysis might facilitate probiotic applications to protect food products from pathogens’ contamination in the dairy industry. Therefore, whether the LPG strains isolated in this study can synthesize antimicrobial peptides/compounds for inhibition of growth of multidrug-resistant pathogens is worth clarifying. In conclusion, the present study indicates that four isolated high EPS-producing LPG strains show good tolerance to simulated gastrointestinal conditions. Among them, SLC 13 shows the highest EPS production, stress tolerance, antibacterial activity, and immunopotentiating effect. Thus, we believe that Lactobacillus pentosus SLC 13 may be a good candidate for development of probiotics. Further in vivo verification of our findings is necessary. Acknowledgments. This study was supported by grant NSC952313-B005-054 from the Ministry of Science and Technology, Taiwan. Competing interests. None declared.
References 1. Acar JF, Goldstein FW (1991) Disk susceptibility test. In: Lorian V (ed). Antibiotics in Laboratory Medicine, 3rd edition. New York: Williams & Wilkins, pp 17-52 2. Boyd MA, Antonio MA, Hillier SL (2005) Comparison of API 50 CH strips to whole-chromosomal DNA probes for identification of Lactobacillus species. J Clin Microbiol 43:5309-5311 3. ������������������������������������������������������������������ Briers Y, Klumpp J, Schuppler M, Loessner MJ (2011) Genome sequen-
Int. Microbiol. Vol. 20, 2017
83
ce of Listeria monocytogenes Scott A, a clinical isolate from a foodborne listeriosis outbreak. J Bacteriol 193:4284-4285 4. Chao SH, Tomii Y, Sasamoto M, Fujimoto J, Tsai YC, Watanabe K (2008) Lactobacillus capillatus sp. nov., a motile bacterium isolated from stinky tofu brine. Int J Syst Evol Microbiol 58:2555-2559 5. Chao SH, Wu RJ, Watanabe K, Tsai YC (2009) Diversity of lactic acid bacteria in suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan. Int J Food Microbiol 135:203-210 6. ������������������������������������������������������������������� Devi SM, Aishwarya S, Halami PM (2016) Discrimination and divergence among Lactobacillus plantarum-group (LPG) isolates with reference to their probiotic functionalities from vegetable origin. Syst Appl Microbiol 39:562-570 7. Dolye MP, Beuchat LR (2007) Food Microbiology: Fundamentals and Frontiers, 3rd ed. ASM Press, Washington, DC 8. ������������������������������������������������������������������� Duary RK, Rajput YS, Batish VK, Grover S (2011) Assessing the adhesion of putative indigenous probiotic lactobacilli to human colonic epithelial cells. Indian J Med Res 134:664-671 9. �������������������������������������������������������������������� Garriga M, Pascual M, Monfort JM, Hugas M (1998) Selection of lactobacilli for chicken probiotic adjuncts. J Appl Microbiol 84:125-132 10. ������������������������������������������������������������������������ Gill HS, Guarner F (2004) Probiotics and human health: a clinical perspective. Postgrad Med J 80:516-526 11. Grobben ��������������������������������������������������������������������� GJ, Boels IC, Sikkema J, Smith MR, de Bont JA (2000) Influence of ions on growth and production of exopolysaccharides by Lactobacillus delbrueckii subsp. bulgaricus NFB 2772. J Dairy Res 67:131-135 12. ���������������������������������������������������������������� Hauge HH, Mantzilas D, Eijsink VG, Nissen-Meyer J (1999) Membrane-mimicking entities induce structuring of the two-peptide bacteriocins plantaricin E/F and plantaricin J/K. J Bacteriol 181:740-747 13. Isenberg HD (1992) Antimicrobial susceptibility testing. In: Isenberg HD (ed). Clinical Microbiology Procedures Handbook, vol. 1. New York: ASM Press. p 5.1.1-5.6.14 14. Ismail B, Nampoothiri KM (2010) Production, purification and structural characterization of an exopolysaccharide produced by a probiotic Lactobacillus plantarum MTCC 9510. Arch Microbiol 192:1049-1057 15. �������������������������������������������������������������������� Jiang Y, Ren F, Liu S, Zhao L, Guo H, Hou C (2016) Enhanced acid tolerance in Bifidobacterium longum by adaptive evolution: comparison of the genes between the acid-resistant variant and wild-type strain. J Microbiol Biotechnol 26:452-460 16. Kim DW, Cho SB, Yun CH, Jeong HY, Chung WT, Choi CW, Lee HJ, Nam IS, Suh GH, Lee SS, Lee BS (2007) Induction of cytokines and nitric oxide in murine macrophages stimulated with enzymatically digested Lactobacillus strains. J Microbiol 45:373-378 17. Kim HO, Lim JM, Joo JH, Kim SW, Hwang HJ, Choi JW, Yun JW (2005) Optimization of submerged culture condition for the production of mycelial biomass and exopolysaccharides by Agrocybe cylindracea. Bioresour Technol 96: 1175-1182 18. ������������������������������������������������������������������ Klein G, Pack A, Bonaparte C, Reuter G (1998) Taxonomy and physiology of probiotic lactic acid bacteria. Int J Food Microbiol 41:103-125 19. Li P, Gu Q, Zhou Q (2016) Complete genome sequence of Lactobacillus plantarum LZ206, a potential probiotic strain with antimicrobial activity against food-borne pathogenic microorganisms. J Biotechnol 238:52-55 20. Liu L, Li P (2016) Complete genome sequence of Lactobacillus paraplantarum L-ZS9, a probiotic starter producing class II bacteriocins. J Biotechnol 222:15-16 21. ��������������������������������������������������������������������� Looijesteijn PJ, Hugenholtz J (1999) Uncoupling of growth and exopo-
84
Int. Microbiol. Vol. 20, 2017
lysaccharide production by Lactococcus lactis subsp. cremoris NIZO B40 and optimization of its synthesis. J Biosci Bioeng 88:178-182 22. Maldonado NC, de Ruiz CS, Otero MC, Sesma F, Nader-Macias ME (2012) Lactic acid bacteria isolated from young calves--characterization and potential as probiotics. Res Vet Sci 92:342-349 23. Maldonado A, Ruiz-Barba JL, Jimenez-Diaz R (2003) Purification and genetic characterization of plantaricin NC8, a novel coculture-inducible two-peptide bacteriocin from Lactobacillus plantarum NC8. Appl Environ Microbiol 69:383-389 24. Martin R, Sanchez B, Suarez JE, Urdaci MC (2012) Characterization of the adherence properties of human lactobacilli strains to be used as vaginal probiotics. FEMS Microbiol Lett 328:166-173 25. Messi P, Bondi M, Sabia C, Battini R, Manicardi G (2001) Detection and preliminary characterization of a bacteriocin (plantaricin 35d) produced by a Lactobacillus plantarum strain. Int J Food Microbiol 64:193-198 26. Moll GN, Konings WN, Driessen AJ (1999) Bacteriocins: mechanism of membrane insertion and pore formation. Antonie Van Leeuwenhoek 76:185-198 27. ������������������������������������������������������������������ Mongkolrob R, Taweechaisupapong S, Tungpradabkul S (2015) Correlation between biofilm production, antibiotic susceptibility and exopolysaccharide composition in Burkholderia pseudomallei bpsI, ppk, and rpoS mutant strains. Microbiol Immunol 59:653-663 28. Pipenbaher N, Moeller PL, Dolinsek J, Jakobsen M, Weingartl H, Cencic A (2009) Nitric oxide (NO) production in mammalian nontumorigenic epithelial cells of the small intestine and macrophages induced by individual strains of lactobacilli and bifidobacteria. Int Dairy J 19:166-171 29. Ruiz-Bravo A, Jimenez-Valera M, Moreno E, Guerra V, RamosCormenzana A (2001) Biological response modifier activity of an exopolysaccharide from Paenibacillus jamilae CP-7. Clin Diagn Lab Immunol 8:706-710
HUANG ET AL.
30. Saarela M, Mogensen G, Fonden R, Matto J, Mattila-Sandholm T (2000) Probiotic bacteria: safety, functional and technological properties. J Biotechnol 84:197-215 31. Stiles ME, Holzapfel WH (1997) Lactic acid bacteria of foods and their current taxonomy. Int J Food Microbiol 36:1-29 32. Suskovic J, Brkic B, Matosic S, Maric V (1997) L. acidophilus M92 as potential probiotic strain. Milchwissenschaft 52:430-435 33. Suzuki S, Kimoto-Nira H, Suganuma H, Suzuki C, Saito T, Yajima N (2014) Cellular fatty acid composition and exopolysaccharide contribute to bile tolerance in Lactobacillus brevis strains isolated from fermented Japanese pickles. Can J Microbiol 60:183-191 34. Tallon R, Arias S, Bressolier P, Urdaci MC (2007) Strain- and matrixdependent adhesion of Lactobacillus plantarum is mediated by proteinaceous bacterial compounds. J Appl Microbiol 102:442-451 35. Torino MI, Taranto MP, Sesma F, de Valdez GF (2001) Heterofermentative pattern and exopolysaccharide production by Lactobacillus helveticus ATCC 15807 in response to environmental pH. J Appl Microbiol 91: 846-852 36. Toure R, Kheadr E, Lacroix C, Moroni O, Fliss I (2003) Production of antibacterial substances by bifidobacterial isolates from infant stool active against Listeria monocytogenes. J Appl Microbiol 95:1058-1069 37. Wang K, Li W, Rui X, Chen X, Jiang M, Dong M (2014) Characterization of a novel exopolysaccharide with antitumor activity from Lactobacillus plantarum 70810. Int J Biol Macromol 63:133-139 38. Woods GL, Washington JA (1995) Antibacterial susceptibility tests: dilution and disk diffusion methods. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH (eds). Manual of Clinical Microbiology, 6th ed. ASM PressWashington, DC, pp 1327-1341 39. Zhou JS, Pillidge CJ, Gopal PK, Gill HS (2005) Antibiotic susceptibility profiles of new probiotic Lactobacillus and Bifidobacterium strains. Int J Food Microbiol 98:211-217
RESEARCH ARTICLE International Microbiology 20(2):85-93 (2017) doi:10.2436/20.1501.01.288. ISSN (print): 1139-6709. e-ISSN: 1618-1095
www.im.microbios.org
Antimicrobial resistance gene expression associated with multidrug resistant Salmonella spp. isolated from retail meat in Hanoi, Vietnam Minh Ngoc Nghiem,1 Viet Thanh Nguyen,2 Thu Thi Hoai Nguyen,1 Ton Dang Nguyen,1 Thuy Thi Bich Vo1* Institute of Genome Research, Vietnam Academy of Science and Technology, Cau Giay, Hanoi, Vietnam. 2 Vietnam Medical Military University, Ha Dong, Hanoi, Vietnam
1
Received 4 April 2017 ¡ Accepted 8 May 2017
Summary. The purpose of this study was to further characterize the multi-antimicrobial resistance and antibiotic resistance gene expression associated with multi-drug resistance (MDR) in Salmonella spp. isolates from retail meats in Hanoi, Vietnam. A total of 14 Salmonella spp. belonging to 9 serotypes (e.g., Warragul, London, Derby, Indiana, Meleagridis, Give, Rissen, Assine, and Typhimurium) were tested for sensitivity to 8 antibiotics. Resistance to at least one antibiotic was shown in 13 strains (92.85%). The multiple antimicrobial resistances accounted for 64.29% of isolates (9/14). One hundred percent of MDR isolates possessed antibiotic resistant genes, in which 17, 16 and 11 genes were found in Salmonella (Salm) Typhimurium S360, S384, S181 respectively; 12 genes in each strain as Indiana, Warragul, and Meleagridis; 11 genes in Give, 8 genes in Derby and 6 genes in Rissen. Three antibiotic resistance genes (ssaQ, aadA, and gyrB) were present in all isolates, whereas Cephalosporinresistant gene (e.g., CTX-M3-like) was not detected in any isolates. The results suggest that retail meats could constitute a source of human exposure to multi-drug resistant Salmonella and future research should focus on the impact of these MDR source on the human genome. [Int Microbiol 20(2): 85-93 (2017)] Keywords: Salmonella spp. ¡ multidrug resistance ¡ retail meat
Introduction The increasing human population around the world places a huge demand on food in order to ensure the survival of mankind. It exerts pressure on a number of food industries as an effort to satisfy the increasing food demand. At the same time,
Corresponding author: Thuy Thi Bich Vo E-mail: thuytbvo@igr.ac.vn *
food poisoning with the cause of contaminating bacteria is also increasing and greatly affecting human health. Salmonellosis is one of the most major causes of foodborne infections in the world and it is still one of the most widespread foodborne bacterial illnesses in humans [26]. The presence of Salmonella in retail meat and its related products has often caused them to be unsafe for human consumption [6]. Salmonella is associated with approximately 2500 serovars. Serovars are generally found in animal origin products include Salm. Enteriditis, Salm.Typhimurium, Salm. Gallinarum,
86
Int. Microbiol. Vol. 19, 2016
NGHIEM ET AL.
Salm. Weltevreden and Salm. Infantis. These vehicles that cause infection appear to be more prevalent in poultry than in any other food animal [15]. The worldwide increase of foodborne infections associated with antibiotic resistant pathogens and the spread of antibiotic resistance is one of major concern in both developed and developing countries [10]. The use of antibiotics in any venue, including disease treatment and growth promotion in domestic livestock, can potentially lead to widespread dissemination of antibiotic resistant bacteria [17,39]. Increasing evidence demonstrates that antimicrobial usage in animals promotes the emergence of a wide range of resistant zoonotic pathogens such as Salmonella, which compromises the effectiveness of antibiotic treatments used in humans when an infection occurs [19]. Therefore, surveillance of multiple antimicrobial resistance and resistance genes expression associated with multi-drug resistance in pathogenic bacteria such as Salmonella is crucial for providing information on the magnitude and tendency of resistance in foodborne pathogens in each country [2]. Salmonella strains resistant to antimicrobial drugs are now increasing because of selection from the use of antimicrobial drugs [34,40]. Various studies have focused on investigating the prevalence of antimicrobial resistance and resis-
Table 1. Salmonella strains used in this study ID
Description
Source of sample (Year)
Salm 1
Salmonella Warragul
Chicken (2016)
Salm 2
Salmonella London
Pork (2016)
Salm 3
Salmonella Derby
Pork (2016)
Salm 4
Salmonella Indiana
Chicken (2016)
Salm 5
Salmonella Derby
Pork (2016)
Salm 5.1
Salmonella Meleagridis
Pork (2016)
Salm 6
Salmonella Derby
Pork (2016)
Salm 7
Salmonella Give
Pork (2016)
Salm 7.1
Salmonella Rissen
Chicken (2016)
Salm 8
Salmonella Typhimurium S360
Beef (2016)
Salm 9
Salmonella Derby
Pork (2016)
Salm 10
Salmonella Assine
Chicken (2016)
Salm 11
Salmonella Typhimurium S384
Pork (2016)
Salm 12
Salmonella Typhimurium S181
Pork (2016)
tance genes in Salmonella such as Thailand and Laos [32], the United States [16], Japan [31], China [24], Vietnam [36], the UK [26], and Mexico [29]. In recent years, contamination and antibiotic resistance of Salmonella isolates from foodstuffs and animals in Vietnam are increasing due to the use disorder of antibiotics in disease treatment and domestic livestock [36,35]. Thus, assessing the distribution of antimicrobial resistance genes in Salmonella will represent a more detailed and potentially useful tool for improving our understanding of antimicrobial resistance epidemiology, particularly in Hanoi, where such information is also disorderliness.
Material and methods Bacterium strains. A total of 14 strains were serotyped and received from laboratory in Institute of Genome Research (Hanoi, Vietnam) (listed in Table 1) including 1 Warragul, 1 London, 4 Derby, 1 Indiana, 1 Meleagridis, 1 Rissen, 1 Give, 3 Typhimurium and 1 Assine. The originated strains from pork, beef and chicken meat at retail markets in Hanoi, Vietnam. Antibiotic susceptibility testing. The antimicrobial susceptibility test was performed according to the Clinical and Laboratory Standards Institute (CLSI-2015) [9] and used the disk diffusion method as Kirby-Bauer’s description. The isolated strains were grown overnight in Brain Heart Broth Infusion (Biolife-Italia) and prepared in a lawn on Mueller-Hinton agar [20]. The antibiotic disks were placed aseptically on it and incubated at 37°C for 16–18 hours. The results were recorded by measuring the inhibition zones and scored as sensitive, intermediate, and resistant according to guide in CLSI-2015. The eight tested antimicrobials were often used in husbandry and treatment of animal farms as well as human diseases in Vietnam, namely, ampicillin (AM) 10 µg, ceftazidime (CAZ) 30 µg, gentamicin (GN) 10 µg, streptomycin (S) 10 µg, ciprofloxacin (CIP) 5 µg, chloramphenicol (C) 30 µg, tetracycline (TE) 30 µg, and trimethoprim/sulfamethoxazole (SXT) 1.25/23.75 µg (BD Diagnostics). Total RNA extraction and cDNA synthesis. Total RNA was extracted from one milliliter of Brain Heart Broth Infusion contained 108 Salm bacteria as the manufacturer's protocol (TRIzol Reagent, Life Technologies Inc.). The RNA was treated with RNase-free DNase to remove contaminating genomic DNA. RNA quality and quantity were determined with a NanoDrop ND-1000 spectrophotometer (NanoDrop® Technologies, Thermo Scientific) by measuring the absorbance at 260 nm and the ratio of A260/A280, respectively. RNA integrity was confirmed by gel electrophoresis, stained with ethidium bromide, and visualized under UV light using a gel documentation system (Herolab, Wiesloch, Germany). The total RNA samples were reversetranscribed with oligo-dT primers of SuperScript III (Invitrogen) as the manufacturer's instructions. The prepared cDNA samples were stored at −20 °C until use. Reverse transcription polymerase chain reaction (RT-PCR) methods. The target genes were detected in the MDR Salmonella spp. isolates including Βeta-lactams (blaTEM), Cephalosporin (CTX-M3-like), Quinolones (gyrB), tetracyclines (tetA, tetB, tetC), sulfonamides (sul I, sul II, sul III, sodC1), chloramphenicol (cmlA, cat2, floR, avrA, ssaQ, mgtC) and
SALMONELLA SPP. FROM RETAIL MEAT
Int. Microbiol. Vol. 19, 2016
87
Table 2. Primers used for the detection of antibiotic resistance genes in Salmonella spp. isolates Gene
Forward/ Reverse primer (5′-3′)
Annealing temp (°C)
Size (bp)
tetA
TTGGCATTCTGCATTCACTC / GTATAGCTTGCCGGAAGTCG
55
494
tetB
CAGTGCTGTTGTTGTCATTAA / GCTTGGAATACTGAGTGTAA
55
570
tetC
AGGTAAACGCCATTGTCAGC / AAGCCGCGGTAAATAGCA
55
594
sul I
TGGTGACGGTGTTCGGCATTC / GCGAGGGTTTCCGAGAAGGTG
57
789
sul II
CCTGTTTCGTCCGACACAGA / GAAGCGCAGCCGCAATTCAT
57
434
sul III
ATGAGCAAGATTTTTGGAATCGTAA / CTAACCTAGGGCTTTGGATATTT
57
791
sodC1
AACGGATACGTGGCTGTACC / CGGTCTGCTTTTCACTCCTC
55
243
cmlA
GGCCTCGCTCTTACGTCATC / GCGACACCAATACCCACTAGC
55
682
cat2
AACGGCATGATGAACCTGAA / ATCCCAATGGCATCGTAAAG
55
546
floR
ATGACCACCACACGCCCCG / AGACGACTGGCGACTTCTCG
57
1212
avrA
GTTGAGGACCAAAGCAGCTC / TCACCACACAGACGTTCACA
55
192
ssaQ
AATGAGCTGGGTAGGGTGTG / ATGCAACGCTAGCTGATGTG
55
216
mgtC
TGTCTCTGGGATTGGCTTTC / TTCTCCCTCAGCGGATATTG
55
232
aph3-IIa
TCTGAAACATGGCAAAGGTAG / AGCCGTTTCTGTAATGAAGGA
55
581
aph A1
ATGGGCTCGCGATAATGTC / CTCACCGAGGCAGTTCCAT
55
600
aadA
GTGTCACAGGCGATACGTTG / GAACCAGCTGCGAATAAAGC
55
228
aac3-IIa
CGGCCTGCTGAATCAGTTTC / AAAGCCCACGACACCTTCTC
55
438
strA
CTTGGTGATAACGGCAATTC / CCAATCGCAGATAGAAGGC
55
548
blaTEM
GCACGAGTGGGTTACATCGA / GGTCCTCCGATCGTTGTCAG
57
310
gyrB
CTGCGCTATCACAGCATCAT / CGCGATGGAAATCTGGTACT
55
219
CTX-M3like
GGAATCTGACGCTGGGTAAA / GGTTGAGGCTGGGTGAAGTA
55
232
16SrRNA
AGAGTTTGATCMTGGCTCAG / CCGTCAATTCMTTTRAGTTT
55
907
aminoglycosides (aph3-IIa, aphA, aadA, aac3-IIa, strA) by RT-PCR method. The sequence primers and annealing temperature conditions were described in Table 2. Briefly, the RT- PCR was performed in 20 μl lumes containing 2 μl of 10X buffer (100 mmol/l Tris-HCl [pH 9], 1.5 mmol/l MgCl2, 500 mmol/l KCl, 0.1% gelatin), 2 μl of 100 μmol/l concentrations each of dATP, dTTP, dGTP and dCTP, 0.5 μl of 5 pmol of each primer, and 0.2 μl of 5U of Taq DNA polymerase (Bangalore Genei, Bangalore, India), with 1.0 μl of cDNA templates. The reactions were carried out by using an Eppendorf’s Mastercycler pro (Eppendorf, German). A lume of 8 μl of PCR product was loaded on 2% agarose gel and stained with ethidium bromide. The gel photograph was scanned and analyzed using Quantity One program (Gel Doc EQ; Bio-Rad, Hercules, CA). Statistical analyses. Data were analyzed by one-way ANOVA, followed by Tukey’s test for multiple comparisons of columns. Statistical analysis was performed using GraphPad Prism5 for Windows Edition (GraphPad Software Inc., La Jolla, CA). A P value of < 0.05 was considered statistically significant. The occurrence of differences in ratio of sensitive/ resistant antibiotics among
Salmonella isolates or antibiotic groups was verified using Fisher’s exact probability test. The rejection value for the null hypothesis was P ≤ 0.05.
Results Antimicrobial susceptibility of the Salmonella isolates. All the fourteen isolates of Salmonella were tested to a panel of eight antibiotics. Total 13/14 (93%) of these Salmonella isolates were resistant to at least one antimicrobial agent and 9/14 (64.29%) of the strains demonstrated the multi antimicrobial resistance (e.g., Salm 1, 4, 5.1, 6, 7, 7.1, 8, 11, and 12). The Salmonella strains (n = 13) exhibited antimicrobial resistance towards S (84.6%, 11⁄13), TE (84.6%, 11⁄13), C (61.54%, 8⁄13), AM (53.84%, 7⁄13), SXT (53.84%, 7⁄13),
88
Int. Microbiol. Vol. 19, 2016
NGHIEM ET AL.
Table 3. Susceptibility results of Salmonella isolates Antibiotics AM
CAZ
GN
S
CIP
C
TE
SXT
Ratio R/S
(P)
Salm 1
S
S
S
S
S
R
R
R
3/5
(0.62)
Salm 2
S
S
S
R
S
S
R
S
2/6
(0.13)
Salm 3
S
S
S
R
S
S
S
S
1/7
(0.01)
Salm 4
R
S
R
R
R
R
R
R
7/1
(0.01)
Salm 5
S
S
S
R
S
S
R
S
2/6
(0.13)
Salm 5.1
R
S
S
R
S
R
R
R
5/3
(0.61)
Salm 6
R
S
S
R
S
S
R
S
3/5
(0.62)
Salm 7
R
S
S
R
S
R
R
R
5/3
(0.61)
Salm 7.1
I
S
S
R
S
R
R
R
4/3
(1.00)
Salm 8
R
S
S
R
S
R
R
R
5/3
(0.62)
Salm 9
S
S
S
S
S
S
S
S
0/8
(0.02)
Salm 10
S
S
S
S
S
R
S
S
1/7
(0.01)
Salm 11
R
S
R
R
S
R
R
R
6/2
(0.13)
Salm 12
R
S
S
R
S
S
R
S
3/5
(0.62)
Ratio R/S
7/6
0/14
2/12
11/3
1/13
8/6
11/3
7/7
(P)
(P = 1)
(P = 0.001)
(P = 0.004)
(P = .007)
(P = 0.007)
(P = 0.7)
(P = 0.007)
(P = 1)
Isolate
GN (16.66%, 2â „13), and CIP (7.69%, 1/13). All strains were susceptible to CAZ (Table 3). The most common multi-drug resistant profiles were observed (C, TE, SXT, S, and AM) and (AM, S, and TE) (Table 4). Antibiotic resistance gene expression of MDR Salmonella isolates. All of the nine MDR Salmonella isolates were selected to determine the association between
the antimicrobial resistance results and mRNA levels of the antibiotic resistance genes by RT-PCR amplification of the twenty-one genes. A total of 20 different antibiotic resistance genes were identified in all MDR Salmonella isolates (Tables 4 and 5). All MDR Salmonella isolates possessed antibiotic resistant genes, in which 17 genes were found in Salm 8; 16 genes in Salm 11; 12 genes in each Salm 4, 1, and 5.1; 11 genes in
Table 4. Multi-drug antimicrobial resistance profile of Salmonella isolates Number of antimicrobial resistance
Antimicrobial resistance pattern (number of isolates)
Number of isolates (%)
Three
C, TE, SXT (1); AM, S, TE (2)
3 (33.33)
Four
C, TE, SXT, S (1)
1 (11.13)
Five
C, TE, SXT, S, AM (3)
3 (33.33)
Six
C, TE, SXT, S, AM, GN (1)
1 (11.13)
Seven
C, TE, SXT, S, AM, GN, CIP (1)
1 (11.11)
Total
9
Abbreviations: S: sensitive, R: resistant, I: intermediate; AM (ampicillin), CAZ (ceftazidime), GN (gentamicin), S (streptomycin), CIP (ciprofloxacin), C (chloramphenicol), TE (tetracycline), SXT (trimethoprim-sulfamethoxazole).
SALMONELLA SPP. FROM RETAIL MEAT
Int. Microbiol. Vol. 19, 2016
89
Table 5. Antibiotic resistance gene profiles of MDR Salmonella isolates Isolates
Antimicrobial-resistant gene(s)
Number of genes (%)
Salm 8
tetA, tetB, tetC, sul II, sul III, sodC1, blaTEM, gyrB, cmlA, cat2, floR, avrA, ssaQ, mgtC, aph3-IIa, aadA, aac3-IIa
17/21 (80.95)
Salm 11
tetA, tetB, tetC, sul II, sodC1, blaTEM, gyrB, floR, avrA, ssaQ, mgtC, aph3-IIa, aphA1, aadA, aac3-IIa, strA
16/21 (76.19)
Salm 1
tetA, sul I, sul II, blaTEM, gyrB, cmlA, floR, avrA, ssaQ, mgtC, aph3-IIa, aadA
12/21 (57.14)
Salm 4
tetA, sul I, sul II, blaTEM, gyrB, cmlA, floR, ssaQ, mgtC, aph3-IIa, aphA1, aadA
12/21 (57.14)
Salm 5.1
tetA, sul II, sul III, blaTEM, gyrB, cmlA, cat2, floR, avrA, ssaQ, mgtC, aadA
12/21 (57.14)
Salm 7
tetA, sul II, sul III, blaTEM, gyrB, cmlA, cat2, floR, avrA, ssaQ, aadA
11/21 (52.38)
Salm 12
tetA, sul II, sodC1, blaTEM, gyrB, cmlA, avrA, ssaQ, mgtC, aadA, strA
11/21 (52.38)
Salm 6
tetA, blaTEM, gyrB, cmlA, floR, avrA, ssaQ, aadA
8/21 (38.1)
Salm 7.1
gyrB, floR, avrA, ssaQ, mgtC, aadA
6/21 (28.57)
Salm 12, and 7; 8 genes in Salm 6; and 6 genes in Salm 7.1. There were 3 antibiotic resistance genes per total 20 differentially gene expression (e.g., ssaQ, aadA, and gyrB) were expressed in all isolates, whereas Cephalosporin-resistant gene (CTX-M3-like) was not detected in any isolates (Table 5). Table 6 has shown the fold change of mRNA levels between the resistant genes and housekeeping gene (16S rRNA gene) from all Salmonella isolates. The results were shown the unrelationship between the prevalence of an antibiotic resistance gene expression and the resistant phenotype in some Salmonella isolates. For example, the tetA, tetB, tetC genes were undetected in TE-resistant as Salm 7.1, and the SXT-resistant Salm 7.1 did not carry sul I, sul II, sul III, and sodC1 genes, while the blaTEM gene was expression (0.5 fold) in AM-susceptible Salm 1, gyrB gene expression varied from 0.6 fold to 1.32 fold in CIP-susceptible strains. In other words, these antibiotic resistance genes expressions did not correlate with the number of antibiotics to which a particular strain showed resistance. The cross-resistance to antibiotics is generally a combination of mechanisms, permeability (several antibiotics use the same way to enter or leave the cell), and changes in target and enzymes. Therefore, further studies are needed.
Discussion The present study, about the global antibiotic resistance genes in MDR Salmonella serovars isolated from Hanoi, revealed a high antimicrobial resistance in Salmonella spp. isolated from retail chicken, beef and pork meats. The high levels of resistance were found to three or more of antimicrobials (64.28%
of isolates), which were higher than other studies conducted in Vietnam [30,35,36 ], China [5] and somewhere in the world [4,27], but lower than figures reported from elsewhere as Romania, Egypt, Japan, and Laos [1,3]. This difference may be due to the increasing rate of inappropriate utilization of antibiotics in the farms and humans, which increased the advantage of maintaining resistance genes in bacteria [29,42]. Some researchers reported that the isolates of Salmonella from food items were resistant to the commonly used [5,21,38]. The results of the current research also indicated the resistance of Salmonella isolates to commonly used antimicrobials, including streptomycin and tetracycline (78.57%). Followed by resistance to chloramphenicol (57.14%), ampicillin and trimethoprim-sulfamethoxazole (50%), gentamicin (14.28%) and ciprofloxacin (7.14%). The high resistance to tetracycline was not surprising since tetracycline is widely used in Vietnam, both in human and veterinary medicine. This finding is in line with previous reports from Romania (66.6% of isolates) [38], Tokyo (77.8% of isolates) [21], Colombia (60.8% of isolates) [11b] and China (66.3% of isolates) [25]. Here, ceftazidime showed a good antimicrobial activity against in all isolates and no cephalosporin-resistant gene was detected. This result is the same as previously reported by Donado-Godogy [11b], Tiziu [38], Andoh [2] and lower than the reports by Katoh [21] from Tokyo who reported a resistance rate of 0.2%, or by Mihaiu from Romania with a resistance rate of 11.4% [28], and Thong (8%) [37]. Even though ceftazidime has been widely available the reason for its effectiveness until this time need investigations. Besides, the resistance to ampicillin and trimethoprim-sulfamethoxazole were found to be 50%, notably higher than the resistance re-
90
Int. Microbiol. Vol. 19, 2016
NGHIEM ET AL.
Table 6. Antibiotic resistance gene expression studies contributing to antimicrobial resistance. Numbers express the level of gene expression (fold change*) Isolate Gen
Salm 1
Salm 6
Salm 12
Salm 5.1
Salm 7.1
Salm 4
Salm 7
Salm 8
Salm 11
tetA
0.54
0.14
0.20
0.58
–
0.66
0.80
1.01
1.01
tetB
–
–
–
–
–
–
–
0.16
1.09
tetC
–
–
–
–
–
–
–
0.44
1.05
sul I
0.27
–
–
–
–
1.03
–
–
–
sul II
0.30
–
1.13
0.52
–
0.22
0.16
0.31
0.36
sul III
–
–
–
0.64
–
–
0.87
0.98
–
sodC1
–
–
0.97
–
–
–
–
1.42
1.67
blaTEM
0.50
0.78
0.77
0.93
–
0.64
0.86
0.89
1.02
gyrB
1.32
0.97
0.98
0.89
0.60
0.91
0.78
0.95
1.00
cmlA
0.62
0.29
0.28
0.76
–
0.64
0.79
1.00
–
cat2
–
–
–
0.84
–
–
0.95
0.92
–
floR
1.44
0.17
–
1.31
1.52
0.83
0.17
0.95
0.87
avrA
1.15
1.03
1.14
1.40
1.40
–
0.47
0.58
0.68
ssaQ
1.15
1.02
1.12
0.81
1.01
0.87
0.89
0.98
0.83
mgtC
0.35
–
1.11
0.76
0.42–
0.64
–
0.84
0.81
aph3-IIa
0.07
–
–
–
–
0.66
–
0.71
1.11
aph A1
–
–
–
–
–
0.67
–
–
1.10
aadA
0.93
0.96
1.15
1.03
1.40
0.58
0.76
0.70
0.64
aac3-IIa
–
–
–
–
–
–
–
0.31
1.07
strA
–
–
0.97
–
–
–
–
–
1.09
* Means of the relative expression of the antibiotic resistant genes and 16S rRNA gene from all MDR Salmonella isolates analyzed as inidicated in Materials and methods description. – Negative gene expression
ported in other countries [4,37,41], may be due to both ampicillin and SXT are frequently used in animal and humans therapy in Vietnam. CIP-resistant gene (gyrB) occurred most frequently in our study, and also detected in both CIP-susceptible and resistant isolates. All of the nine C-resistant and C-susceptible isolates carried ssaQ gene. Likewise, all of the nine aminoglycosides resistant and susceptibility isolates carried aadA gene. TETresistant genes were also detected in one TET-susceptible isolate. Therefore, it can be seen that identification of resistance machanisms based on gene expression analysis may be complicated when several mechanisms affect the same class of antibiotics are at work [12]. Thus, the present results and those of Deekshit [11] have agreed that some antimicrobial resistant genes are “silent” in bacteria in vitro; it further pro-
vides an indication that these silent genes can spread to other bacteria or turn on in vi, especially under the selection pressure of antibiotic use. Tetracycline resistance genes (tetA, tetB, and tedC) were detected in 88.88%, 22.22% and 22.22% respectively of the isolates. This result is common as tetA has been reported to be widely distributed among Salmonella isolates of animal origin. Tetracycline is a broad spectrum antibacterial agent commonly used in the treatment of animals and human. Thus the isolates could have acquired these genes from other enteric bacteria via horizontal transfer of plasmids and transposons [8]. The blaTEM genes, which code the β-lactamases, have a tendency to mutate and secrete enzymes with the extended spectrum of activity, this could have accounted for the high resistance to ampicillin in the study population [13], and similarly, the blaTEM gene was detected in
SALMONELLA SPP. FROM RETAIL MEAT
100% of ampicillin resistant isolates, and one susceptible strain (Salm 1) in the study. Aminoglycosides, particularly streptomycin and gentamicin are often used for the treatment of animals and humans in Vietnam. This could also explain the moderate to high acquisition and detection of aadA gene encoding for aminoglycoside resistance in 100% of the isolates. The aadA family of genes encode aminoglycoside-3″-adenylyltransferases, which confer resistance to streptomycin and spectinomycin by adenylation mechnism[38]. In addition, sulfonamide resistance in Gram-negative bacteria arises from the acquisition of either of the two genes, sul I or sul II, encoding forms of dihydropteroate synthase that are not inhibited by the drug [13]. In the present study, resistance to sulfamethoxazole was highly expressed in sul II gene (6 isolates). Genes sul II are located on small nonconjugative plasmids [33] or on a large transmissible multi-resistance plasmid. The presence of sul II resistance genes may be as a result of successive pressure exerted by sulfonamides and other antimicrobial agents commonly used. These results were similar to previous studies in other European countries [13,22]. Sul III is the new sulfonamide resistance gene, has been detected in Gram-negative bacteria such as Salmonella [18]. In our study, the sul III gene has now been identified in 4 Salmonella isolates. The consumption of sulfonamides for veterinary use is also generally widespread in Vietnam, particularly in the small farmers and directly sells retail meat to the market. Thus, the appearance of a newly described gene and the simultaneous presence of several sul genes may reflect antibiotic abuse in local animal husbandry. In addition, the present study found that antimicrobial resistance genes expression did not correlate with the number of antibiotics to which a particular strain showed resistance, e.g., the multidrug-resistant isolates (Salm 5.1, Salm 7 and Salm 8) and (Salm 6, Salm 12) shared identical phenotype profile (AM, S, C, TE, SXT) and (AM, S, TE) respectively, but exhibited different antimicrobial resistance gene profiles. Multiple mechanisms contribute to the development of resistance to antimicrobial agents in Salmonella, including enzyme production to inactivate antimicrobial agents, reduction of cell permeability, activation of the antimicrobial efflux pump and drug target modification. Moreover, the resistance genes could be transferred between organisms via transformation, transduction, and conjugation [14] . A large number of genes are inlved in these pathways and in gene regulation. In some cases, gene presence may not relate to the actual resistance phenotype, and a single gene may not solely be responsible for the resistance profiles. Taken together, the results have shown the various antibi-
Int. Microbiol. Vol. 19, 2016
91
otic resistance genes are widely distributed in the MDR Salmonella isolated in retail meat in Hanoi. However, the relationship between the prevalence of an antibiotic resistance gene expression and the antimicrobial resistant phenotype was not clearly defined in some Salmonella isolates. Therefore, to control the further emergence of antimicrobial resistance, monitoring the food processing and the prudent use of antibiotics in animal husbandry is essential.
Acknowledgements. This research is funded by Vietnam National Foundation for Science and Technology Development (NAFOSTED) under grant number 106-NN.04-2015.41. V.T.N. is grateful to the Medical Microbiology Department, Vietnam National Institute of Burns for assistance in Antibiotic susceptibility testing.
Competing interests. None declared.
References 1. Ahmed AM, Shimamoto T, Shimamoto T (2014) Characterization of integrons and resistance genes in multidrug-resistant Salmonella enterica isolated from meat and dairy products in Egypt. Int J Food Microbiol 39-44 2. Andoh LA, Dalsgaard A, Obiri-Danso K, Newman MJ, Barco L, Olsen JE (2016) Prevalence and antimicrobial resistance of Salmonella serovars isolated from poultry in Ghana. Epidemiol Infect 15:32883299 3. Boonmar S, Morita Y, Pulsrikarn C, Chaichana P, Pornruagwong S, Chaunchom S, Sychanh T, Khounsy T, Sisavath D, Yamamoto S, Sato H, Ishioka T, Noda M, Kozawa K, Kimura H (2013) Salmonella prevalence in meat at retail markets in Pakse, Champasak Province, Laos, and antimicrobial susceptibility of isolates. J Glob Antimicrob Resist 3:157-161 4. Cabrera-Diaz E, Barbosa-Cardenas CM, Perez-Montano JA, Gonzalez-Aguilar D, Pacheco-Gallardo C, Barba J (2013) Occurrence, serotype diversity, and antimicrobial resistance of Salmonella in ground beef at retail stores in Jalisco state, Mexico. J Food Prot 12:2004-2010 5. Cai Y, Tao J, Jiao Y, Fei X, Zhou L, Wang Y, Zheng H, Pan Z, Jiao X (2016) Phenotypic characteristics and genotypic correlation between Salmonella isolates from a slaughterhouse and retail markets in Yangzhou, China. Int J Food Microbiol 56-64 6. CDC (2013) Incidence and trends of infection with pathogens transmitted commonly through food — Foodborne Diseases Active Surveillance Network,10 U.S. Sites, 1996–2012. Weekly Report 62: 283-287 7. Choi D, Chon JW, Kim HS, Kim DH, Lim JS, Yim JH, Seo KH (2015) Incidence, antimicrobial resistance, and molecular characteristics of nontyphoidal Salmonella including extended-spectrum
92
Int. Microbiol. Vol. 19, 2016
beta-lactamase producers in retail chicken meat. J Food Prot 11:1932-1937 8. Chopra I, Roberts M (2001) Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev 2:232-260 9. CLSI (2015) Performance standards for antimicrobialsusceptibility testing. In twenty-fifth informational supplement (M100-S25). Clinical and Laboratory Standards Institute, Wayne, PA, USA 10. Dalton CB, Gregory J, Kirk MD, Stafford RJ, Givney R, Kraa E, Gould D (2004) Foodborne disease outbreaks in Australia, 1995 to 2000. Commun Dis Intell Q Rep 2:211-224 11. Deekshit VK, Kumar BK, Rai P, Srikumar S, Karunasagar I, Karunasagar I (2012) Detection of class 1 integrons in Salmonella Weltevreden and silent antibiotic resistance genes in some seafood-associated nontyphoidal isolates of Salmonella in south-west coast of India. J Appl Microbiol 6:1113-1122 11b.Donado-Godoy P, Byrne BA, Leon M, Castellanos R, Vanegas C, Coral A, Arevalo A, Clavijo V, Vargas M, Romero Zuniga JJ, Tafur M, Perez-Gutierrez E, Smith WA (2015) Prevalence, resistance patterns, and risk factors for antimicrobial resistance in bacteria from retail chicken meat in Colombia. J Food Prot 4:751-759 12. Dumas JL, van Delden C, Perron K, Kohler T (2006) Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol Lett 254:217-225. 13. Enne VI, Livermore DM, Stephens P, Hall LM (2001) Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet 9265:1325-1328 14. Foley SL, Lynne AM (2008) Food animal-associated Salmonella challenges: pathogenicity and antimicrobial resistance. J Anim Sci 14 Suppl:E173-187 15. Foley SL, Nayak R, Hanning IB, Johnson TJ, Han J, Ricke SC (2011) Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl Environ Microbiol 13:42734279 16. Folster JP, Grass JE, Bicknese A, Taylor J, Friedman CR, Whichard JM (2016) Characterization of resistance genes and plasmids from outbreaks and illness clusters caused by Salmonella resistant to ceftriaxone in the United States, 2011-2012. Microb Drug Resist 23:188-193 17. Gomez-Lus R (1998) Elution of bacterial resistance to antibiotics during the last three decades. Int Microbiol 4:279-284 18. Guerra B, Junker E, Helmuth R (2004) Incidence of the recently described sulfonamide resistance gene sul3 among German Salmonella enterica strains isolated from livestock and food. Antimicrob Agents Chemother 7:2712-2715 19. Gyles CL (2008) Antimicrobial resistance in selected bacteria from poultry. Anim Health Res Rev 2:149-158 20. Hendriksen RS (2002) Susceptibility testing of Salmonella using disk diffusion. 3rd Ed. World Health Organization-WHO: USA; 2002 21. Katoh R, Matsushita S, Shimojima Y, Ishitsuka R, Sadamasu K, Kai A (2015) Serovars and drug-resistance of Salmonella strains isolated from domestic chicken meat in Tokyo (1992-2012). Kansenshogaku Zasshi 1:46-52 22. Kerrn MB, Klemmensen T, Frimodt-Moller N, Espersen F (2002)
NGHIEM ET AL.
Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J Antimicrob Chemother 4:513-516 23. Leung KY, Ruschkowski SR, Finlay BB (1992) Isolation and characterization of the aadA aminoglycoside-resistance gene from Salmonella choleraesuis. Mol Microbiol 17:2453-2460 24. Li R, Lai J, Wang Y, Liu S, Li Y, Liu K, Shen J, Wu C (2013) Prevalence and characterization of Salmonella species isolated from pigs, ducks and chickens in Sichuan Province, China. Int J Food Microbiol 1:14-18 25. Li YC, Pan ZM, Kang XL, Geng SZ, Liu ZY, Cai YQ, Jiao XA (2014) Prevalence, characteristics, and antimicrobial resistance patterns of Salmonella in retail pork in Jiangsu province, eastern China. J Food Prot 2:236-245 26. Little CL, Richardson JF, Owen RJ, de Pinna E, Threlfall EJ (2008) Prevalence, characterisation and antimicrobial resistance of Campylobacter and Salmonella in raw poultrymeat in the UK, 2003-2005. Int J Environ Health Res 6:403-414 27. Medeiros MA, Oliveira DC, Rodrigues Ddos P, Freitas DR (2011) Prevalence and antimicrobial resistance of Salmonella in chicken carcasses at retail in 15 Brazilian cities. Rev Panam Salud Publica 6:555-560 28. Mihaiu L, Lapusan A, Tanasuica R, Sobolu R, Mihaiu R, Oniga O, Mihaiu M (2014) First study of Salmonella in meat in Romania. J Infect Dev Ctries 1:50-58 29. Miranda JM, MondragĂłn AC, Martinez B, Guarddon M, RodrĂguez JA (2009) Prevalence and antimicrobial resistance patterns of Salmonella from different raw foods in Mexico. J Food Prot 5:966-971 30. Nguyen DT, Kanki M, Nguyen PD, Le HT, Ngo PT, Tran DN, Le NH, Dang CV, Kawai T, Kawahara R, Yonogi S, Hirai Y, Jinnai M, Yamasaki S, Kumeda Y, Yamamoto Y (2016) Prevalence, antibiotic resistance, and extended-spectrum and AmpC beta-lactamase productivity of Salmonella isolates from raw meat and seafood samples in Ho Chi Minh City, Vietnam. Int J Food Microbiol XX:115-122 31. Noda T, Murakami K, Etoh Y, Okamoto F, Yatsuyanagi J, Sera N, Furuta M, Onozuka D, Oda T, Asai T, Fujimoto S (2015) Increase in resistance to extended-spectrum cephalosporins in Salmonella isolated from retail chicken products in Japan. PLoS One 2:e0116927 32. Sinwat N, Angkittitrakul S, Coulson KF, Pilapil FM, Meunsene D, Chuanchuen R (2016) High prevalence and molecular characteristics of multidrug-resistant Salmonella in pigs, pork and humans in Thailand and Laos provinces. J Med Microbiol 10:1182-1193 33. Skold O (2000) Sulfonamide resistance: mechanisms and trends. Drug Resist Updat 3:155-160 34. Solghan SM, Dumas NB, Root TP, Quinlan TM, Armstrong LR, Spina NL, Zansky SM (2010) Multidrug-resistant nontyphoidal Salmonella in New York state's foodborne diseases active surveillance network counties. Foodborne Pathog Dis 2:167-173 35. Ta YT, Nguyen TT, To PB, Pham da X, Le HT, Thi GN, Alali WQ, Walls I, Doyle MP (2014) Quantification, serovars, and antibiotic resistance of Salmonella isolated from retail raw chicken meat in Vietnam. J Food Prot 1:57-66 36. Thai TH, Lan NT, Hirai T, Yamaguchi R (2012) Antimicrobial resis-
SALMONELLA SPP. FROM RETAIL MEAT
tance in Salmonella serovars isolated from meat shops at the markets in North Vietnam. Foodborne Pathog Dis 11:986-991 37. Thong KL, Modarressi S (2011) Antimicrobial resistant genes associated with Salmonella from retail meats and street foods. Food Res International 9:2641-2646 38. Tirziu E, Lazar R, Sala C, Nichita I, Morar A, Seres M, Imre K (2015) Salmonella in raw chicken meat from the Romanian seaside: frequency of isolation and antibiotic resistance. J Food Prot 5:10031006 39. Tollefson L, Altekruse SF, Potter ME (1997) Therapeutic antibiotics in animal feeds and antibiotic resistance. Rev Sci Tech 2:709-715
Int. Microbiol. Vol. 19, 2016
93
40. Wouafo M, Nzouankeu A, Kinfack JA, Fonkoua MC, Ejenguele G, Njine T, Ngandjio A (2010) Prevalence and antimicrobial resistance of Salmonella serotypes in chickens from retail markets in Yaounde (Cameroon). Microb Drug Resist 2:171-176 41. Yan H, Li L, Alam MJ, Shinoda S, Miyoshi S, Shi L (2010) Prevalence and antimicrobial resistance of Salmonella in retail foods in northern China. Int J Food Microbiol 3:230-234 42. Zewdu E, Cornelius P (2009) Antimicrobial resistance pattern of Salmonella serotypes isolated from food items and personnel in Addis Ababa, Ethiopia. Trop Anim Health Prod 2:241-249
RESEARCH ARTICLE International Microbiology 20(2):95-104 (2017) doi:10.2436/20.1501.01.289. ISSN (print): 1139-6709. e-ISSN: 1618-1095
www.im.microbios.org
Impact of motility and chemotaxis features of the rhizobacterium Pseudomonas chlororaphis PCL1606 on its biocontrol of avocado white root rot Álvaro Polonio, Carmen Vida, Antonio de Vicente, Francisco M. Cazorla* Instituto de Hortofruticultura Subtropical y Mediterránea “La Mayora”, IHSM-UMA-CSIC. Departamento de Microbiología, Facultad de Ciencias, Campus de Teatinos, 29071 Málaga, Spain Received 6 April 2017 · Accepted 28 April 2017
Summary. The biocontrol rhizobacterium Pseudomonas chlororaphis PCL1606 has the ability to protect avocado plants against white root rot produced by the phytopathogenic fungus Rosellinia necatrix. Moreover, PCL1606 displayed direct interactions with avocado roots and the pathogenic fungus. Thus, nonmotile (flgK mutant) and non-chemotactic (cheA mutant) derivatives of PCL1606 were constructed to emphasize the importance of motility and chemotaxis in the biological behaviour of PCL1606 during the biocontrol interaction. Plate chemotaxis assay showed that PCL1606 was attracted to the single compounds tested, such as glucose, glutamate, succinate, aspartate and malate, but no chemotaxis was observed to avocado or R. necatrix exudates. Using the more sensitive capillary assay, it was reported that smaller concentrations (1 mM) of single compounds elicited high chemotactic responses, and strong attraction was confirmed to avocado and R. necatrix exudates. Finally, biocontrol experiments revealed that the cheA and fglK derivative mutants reduced root protection against R. necatrix, suggesting an important role for these biological traits in biocontrol by P. chlororaphis PCL1606. [Int Microbiol 20(2):94-104 (2017)]
Keywords: Pseudomonas chlororaphis · Rosellinia necatrix · avocado white root rot · multitrophic interactions · rhizosphere
Introduction Plant roots serve a multitude of functions in the plant, including anchorage, the provision of nutrients and water, and the production of exudates with growth regulatory properties. All plant roots have the remarkable ability to secrete both lowand high-molecular-weight molecules into the rhizosphere *
Corresponding author: Francisco M. Cazorla E-mail: cazorla@uma.es
[2]. Root exudation includes the release of ions, as well as oxygen and water, but root exudates mainly consist of a mixture of carbon-containing compounds derived from the products of photosynthesis, thus influencing plant growth and soil ecology [4]. One of the main impacts of root exudates is on the soil microbial community in their immediate vicinity, influencing pest resistance, supporting beneficial symbiosis, altering the chemical and physical properties of the soil and inhibiting the growth of competing plant species [4].
96
Int. Microbiol. Vol. 20, 2017
The composition of root exudates varies with plant species, environmental conditions and even with agricultural managements, causing a nutrient gradient in the soil with attractive activity to motile bacteria [39,45], and stimulating the selection of different members of the rhizospheric microbial community [3,47]. It is well known that plant root exudates can be considered the primary sources of carbon and energy in the rhizosphere [35,36,42,47]. Most motile bacteria can sense and respond to low concentrations of organic compounds in this environment by the process of chemotaxis [20], defined as the ability of motile bacteria to direct their movement in gradients of chemorepellents and chemoattractants [39]. Thus, chemotaxis has been suggested to be the first step in the bacterial colonization of roots of several plant species [44]. Furthermore, an enrichment in the motile bacteria with chemotaxis-encoding genes in the rhizosphere compared to the bulk soil, have been reported in previous studies [39]. In this case, bacterial chemotaxis provides a competitive advantage to motile flagellated bacteria in root colonization as an essential characteristic for the improvement of plant health [2]. Both motility and chemotaxis could then be considered key characteristics of plant-growth-promoting rhizobacteria and could thus play important roles in the interactive process that occurs in the soil [1]. One of the beneficial interactions among plant and bacterial, is the promotion of plant growth, where the chemotaxis of plant-growth-promoting rhizobacteria (PGPR) towards the roots system occurs prior to the colonization [12]. The microbial colonization is one of the most important aspects in the plant-bacteria interactions, since the success in the colonization is considered as an initial step in the protection of plants from soilborne pathogens [15,42]. For example, many Bacillus [48] and Pseudomonas [25,28,46] strains which have been used as biocontrol agents and/or to induce plant growth, have been described as flagellar motile bacteria to root exudates. In general, pseudomonads can sense chemical gradients and respond to them using flagella or pili coupled to a chemosensory system with multiple copies of chemosensory genes [38]. For example, de Weert et al. [14], described that Pseudomonas fluorescens WCS365 is an excellent competitive colonizer of tomato root tips with biocontrol activity against tomato foot and root rot (TFRR), caused by the phytopathogenic fungus Fusarium oxysporum f. sp. radicis-lycopersici. In this case, the strain WCS365 was able to colonize both, the tomato roots [15] and the fungal hyphae, in order to control the disease [14].
POLONIO ET AL.
The biocontrol rhizobacterium Pseudomonas chlororaphis PCL1606 has protective features against different soilborne phytopathogenic fungi, including Rosellinia necatrix, which is the causal agent of avocado white root rot, and Fusarium oxysporum f. sp. radicis-lycopersici, which is the causal agent of tomato crown and foot rot [10,13]. The production of the antifungal antibiotic 2-hexyl-5-propyl-resorcinol (HPR) is considered the major factor responsible for the antagonistic phenotype of this rhizobacterium [10]. Moreover, additional studies have demonstrated a crucial role for HPR in the biocontrol of R. necatrix and F. oxysporum [9,19]. This bacterium has demonstrated efficient colonization of avocado roots, where it can be established at least for several weeks. Interestingly, during the multitrophic interactions that occur during biocontrol events, PCL1606 can also directly interact with the pathogenic fungus R. necatrix, suggesting a possible role for exudates from plant roots and/or fungal mycelium in such efficient interactions [7]. The aim of the present study was to analyse the potential involvement of motility and chemotaxis in the biocontrol activity to better understand the biology of the multitrophic interactions of P. chlororaphis PCL1606.
Materials and methods Microorganisms and growth conditions. The microorganisms used in the present study are listed in Table 1. The wild-type rhizobacterium Pseudomonas chlororaphis PCL1606 was isolated from avocado roots [10]. Its genome sequence is available from the NCBI database (NCBI accession number CP011110.1; [9]). Luria-Bertani medium (LB) was routinely used to culture Pseudomonas strains at 25 °C. Agar (Difco Laboratories, Detroit, MI, USA) was added to a final concentration of 1.5% to produce solid medium. The medium was supplemented with kanamycin (50 µg/ml) when using or selecting derivatives containing the plasmid pCR2.1 (InvitroGen, Waltham, MA, USA). The bacterial strains were stored at –80 °C in LB with 10% dimethyl sulfoxide. In this study, the virulent strain Rosellinia necatrix CH53 was used [33]. The fungus was grown at 25 °C on potato dextrose agar (PDA; Difco Laboratories, Detroit, MI, USA). For preservation, microsclerotia of the fungal strain were stored in TPG at 4 °C as previously described [22]. Construction of Pseudomonas chlororaphis PCL1606 insertional mutants. The genome sequence of P. chlororaphis PCL1606, allowed the identification of only one functional cheA gene, and a derivative mutant on it was constructed in order to obtain an impaired strain in chemotactic abilities. Additionally, and to be used as a negative control in experimentation, a derivative mutant in motility was also obtained in flgK gene. PCR, cloning and plasmid purification were performed following standard procedures [37]. The selected cheA and flgK genes of P. chlororaphis PCL1606 (loci AKA25886.1 and AKA25937, respectively) were inactivated by insertional mutagenesis as previously described [8]. To accomplish this
CHEMOTAXIS INFLUENCE ON BIOCONTROL
Int. Microbiol. Vol. 20, 2017
97
Table 1. Main characteristics of bacterial and fungal strains, and plasmids used in this study Strain / Plasmid
Relevant characteristicsa
Reference
Bacteria Pseudomonas chlororaphis PCL1606
Wild-type, isolated from Spanish avocado rhizosphere, motility +, antagonism +
[10]
PCL1606-cheA
PCL1606 derivative insertional mutant in cheA gene, motility +, antagonism +, Km
This study
PCL1606-flgK
PCL1606 derivative insertional mutant in flgK gene, motility -, antagonism +, Kmr
This study
Wild-type, Motility +, antagonism +
[13]
General-purpose Escherichia coli host strain
[6]
Wild-type, isolated from avocado trees with symptoms of white root rot; high virulence
[33]
Cloning vector for PCR products; used to construct mutants in cheA and flgK. Ampr, Kmr
TA Cloning Kit, Invitrogen, UK
r
Pseudomonas fluorescens Pf0-1 Escherichia coli DH5α Fungi Rosellinia necatrix CH53 Plasmids pCR2.1-TOPO
a Motility: spreading behaviour of a bacterial suspension (10 µl of 1.5 × 107 cfu/ml) on diluted KB soft agar [23]. + = motility, and – = no motility. Antagonism: bacterial strains showing a mycelial inhibition zone of Rosellinia necatrix after 5 days of growth on TPG agar plates [10]. + = antagonistic, and – = non antagonistic. Antibiotic-resistance: Kmr = kanamycin, Ampr = ampicillin.
inactivation, vectors were constructed via insertion to disrupt the cheA and flgK genes using single-crossover homologous recombination. To construct the integrative plasmids, DNA fragments of 565 and 477 bp from inside the open reading frame of the cheA and flgK genes, respectively, were obtained using specific PCR primers (Table 2), and DNA from P. chlororaphis PCL1606 was used as a template. The amplified DNA fragments were then cloned independently into the pCR2.1-TOPO vector on E. coli DH5α (Table 1). Subsequently, these integrative plasmids were isolated and transformed into electrocompetent wild-type P. chlororaphis PCL1606 cells using standard electroporation [11]. Five colonies from each independent transformation assay were randomly selected, and the correct insertion and orientation of the plasmid within the target gene were confirmed by PCR using the primers described in Table 2, followed by sequencing of the amplified DNA to confirm gene disruption. The resulting derivative mutants were named PCL1606cheA and PCL1606-flgK (Table 1). The insertional mutants were selected in the presence of kanamycin (50 µg/ml). Growth characterization on M9 minimal medium [34] and LB, compared with the wild-type strain, was performed to confirm that these derivative mutants did not have altered growth. Antagonistic activity. The antagonistic activity of rhizobacterial wildtype PCL1606 and derivative isolates (PCL1606-cheA and PCL1606-flgK) was tested as described previously [10]. Initial screening for in vitro antifungal activity on LB and PDA agar plates against R. necatrix CH53 was performed by placing on the agar in the centre of a Petri dish a 0.6-cm diameter mycelium disk from a 5-day-old fungal culture grown at 25 °C, followed by inoculation of the bacterial strains at a distance of approximately 3 cm from the fungus. Bacterial strains inhibiting mycelial growth after five days of growth, as judged by a growth inhibition zone, were considered antagonistic.
Motility and chemotaxis plate assays. Motility assay was performed essentially as described previously [16], using plates of King’s B medium [23] twenty times diluted and amended with 0.3% agar. A bacterial suspension (10 µl drop containing approximately 1.5 × 107 cfu/ml) was placed in the center of the plate and was incubated for 24 h at 25 ºC. Halo diameters of motility were recorded, and additionally, the motility of the bacteria into the suspension was also confirmed under light microscopy (100×). Plate chemotaxis assay was performed as previously described [35] with slight modifications and using M9 minimal medium containing 0.2% Noble agar (Difco) and no carbon source. Ten microliters of a bacterial suspension (approximately 107 cfu/ml), obtained from an overnight culture on M9 plates with glucose or glycerol (10 mM), was placed in the center of a chemotaxis plate. Then, three separate drops (10 µl each) of the compound to be tested as the chemoattractant carbon source were placed on the right side of the interior of the plate, and on the left side, as a control for no attraction, three separate drops (10 µl each) of sterile saline solution were placed. The plates were then incubated at 25 ºC for 36 h. The experiments were performed in triplicate. Single compounds assayed by the chemotaxis plate assay included lglutamate, and mix of d- and l-glucose, succinate, aspartate and malate (Sigma, St Louis, MO, USA) as representative compounds previously reported to be present in the plant rhizosphere [2,4,15,26,35,40]. Different concentrations of the test compounds were assayed (from 1 mM to 100 mM). Avocado root exudates and R. necatrix exudates were also tested. Exudates from avocado were obtained as follows. One-month-old commercial avocado seedlings (var. Walter Hole) were provided by Brokaw nursery (Brokaw España, Vélez Málaga, Spain). The plant was removed from the pots, and the roots were washed and disinfected as previously described [10]. Avocado cotyledons were carefully removed, and these plants were then in-
98
Int. Microbiol. Vol. 20, 2017
POLONIO ET AL.
Table 2. Primer sequences and use in this study Primer
Sequence
MutcheA-F
5′-CACATCCTGTTGTCGATCTC
MutcheA-R
5′-GTTGATCGACGACGAAGCCG
MutflgK-F
5′-AACATCAACGGCAACCTGAG
MutflgK-R
5′-GTTCTTGTCGATACCCTGGC
M13-F
5′-GTAAAACGACGGCCAGT
M13-R
5′-CAGGAAACAGCTATGAC
ExMutcheA-F
5′-AGGAAGCTTAGATCTGGTTGCGGCTGTAG
ExMutcheA-R
5′-TGCTCTAGACATCCATCCATATCGGCATCTCG
ExMutflgk-F
5′-GCCAAGCTTACAACCTGTTCGGCATCAAG
ExMutflgK-R
5′-GAATCTAGAGTTCTTCTGATAGTTGGCGG
troduced into gnotobiotic tubes, as similarly described in a previous work [41]. Gnotobiotic avocados were placed into a growth chamber (25 ºC, 16:8 h of light:dark) and were watered every other day with 8–10 ml of sterile distilled water. After 10 days, the clear exudates were recovered from the bottoms of the tubes, were sterilized by filtration (0.2 µm pore diameter, ©Merck Millipore, Darmstadt, Germany), and were preserved in the dark at –20 ºC. To obtain R. necatrix exudates, the method previously described was followed [32]. Briefly, the fungus R. necatrix CH53 was grown at 25 ºC on BM [25] agar plates until the plates were completely covered by the fungus. Pieces of fungal mycelia were collected from one plate and were inoculated on 100 ml of minimal medium BM. The culture was incubated at 25 ºC for 2 weeks without shaking. Exudates obtained from the culture medium were obtained by filtration using ALBET filter paper in reams of 73 g/m and were preserved in the dark at –20 ºC. To avoid low concentration of both exudates, fractions of 20 ml of avocado and R. necatrix exudates were concentrated 20 times with a speed vacuum (Savant SpeedVac SCV100M, Thermo Fisher Scientific, USA) for further experimentation. Modified capillary chemotaxis assay. The chemotaxis capillary assay with some modifications from the previous description [29] was performed using a disposable 200 µl pipette tip as a chamber to hold 100 µl of bacterial suspension (usually 1 × 107 cells) in sterile saline solution (0.85% NaCl). A 13 mm needle with inner diameter of 0.3 mm (Becton Dickinson, Ireland) was used as the chemotaxis capillary and was attached to a 1 ml tuberculin syringe (Becton Dickinson) containing 100 µl portion of the compound (1 mM to 100 mM) to be tested in sterile saline solution. As controls, saline solution and a solution of casamino acids (10%) were used. Casamino acids are an attractant of Pseudomonas sp. Pf0-1, which was also used as a control bacterial strain for chemotaxis [35]. After 45 min of incubation at 25 ºC, the needle syringe was removed from the bacterial suspension, and the contents were diluted and plated in LB medium. Accumulation of bacteria in the capillaries was calculated as the average of the bacterial counts obtained in triplicate from the plates, and the results were expressed as the means of at least three separate capillary assays for each determination. The relative chemotaxis index (RCI) was calculated as the ratio of the bacteria that entered the test capillary to that in the control capillary with saline solution. An RCI of 2 or greater has been described as significant with this method [29].
Use Used to partially amplify the genes cheA and flgK of PCL1606, in order to be used for construction of insertional mutants Used to determine orientation of the insert in the constructed derivative mutants by insertion. M13 primers from vector pCR2.1, and external primers on the sequence or each gen
Biocontrol. The roles of motility and chemotaxis in biocontrol were evaluated. Biocontrol assays against avocado white root rot were performed using the avocado-R. necatrix system, as previously described [10]. Sixmonth-old commercial avocado plants (cv. Walter Hole) were obtained from Brokaw nurseries (Brokaw España, S.L., Vélez-Málaga, Spain). The roots of the avocado plants were disinfected by immersion in 0.1% NaOCl for 20 min and then were washed and bacterized following the method previously described [10], with slight modifications. The roots of the avocado plants were immersed in a suspension of the bacterial isolate (109 cfu/ml) or in sterile tap water for 20 min. For these experiments, a rifampicin resistantderivative of PCL1606 was used [13,19]. Any excess bacterial suspension was allowed to drip off, after which the seedlings were placed into pots containing 30 g of wet potting soil (Jongkind Grond B.V., Aalsmeer, the Netherlands) and were infected with R. necatrix CH53 using inoculated wheat grains (four infected grains per pot), as described previously [18]. Three sets of five avocado seedlings each were tested per treatment. The seedlings were grown in a chamber at 24 °C and 70% relative humidity with 16 h of daylight, and they were watered twice per week. Because it was difficult to monitor the symptoms on the avocado roots due to the overgrowth of R. necatrix, aerial symptoms were recorded on a scale of 0 to 3, and a disease index (DI) was calculated using a previously described formula [10]. The DI was determined approximately 21 days after bacterization. To report whether the mutations in motility and chemotaxis had effects on bacterial survival on the roots, bacterial counts were performed at the end of the biocontrol assays. Avocado root samples were gently shaken to remove loosely adhering soil and were aseptically transferred to sterile bags and immediately processed. Roots from each set of five avocado seedlings were combined in the same bag and were analysed (3 samples per treatment). Root samples were washed twice in tap water, weighed and homogenized in a stomacher (Colworth Stomacher-400, Seward Ltd.) for 3 min with 10 ml of sterile phosphate-buffered saline (PBS, pH 7.2) per gram of fresh root material. Suspensions were diluted 10-fold and were plated on TPG amended with cycloheximide (100 μg/ml) to prevent fungal growth or amended or not with kanamycin (50 µg/ml) or rifampicin (50 µg/ml). The plates were incubated at 24 °C for 48 h. After incubation, the numbers of antibiotic-resistant bacterial colonies with the typical morphology were recorded.
CHEMOTAXIS INFLUENCE ON BIOCONTROL
Int. Microbiol. Vol. 20, 2017
99
Motility assay in swim plates. To study the importance of motility in accessing some of the compounds that P. chlororaphis PCL1606 could transform or use as carbon sources, we constructed mutants impaired in motility (PCL1606-flgK) and in chemotaxis (PCL1606-cheA) for P. chlororaphis PCL1606. Characterization of the constructed derivative mutants revealed that no effect on growth rate in TPG was observed. Checking the motility of these microorganisms in soft agar plates of KB medium diluted twenty times, a clear motility response was observed for PCL1606 (Fig. 1). The swimming behaviour of P. chlororaphis PCL1606 in plate assay was very similar to that displayed by the also motile Pseudomonas sp. Pf0-1 strain. The motility of PCL1606-cheA was statistically less than the wild-type strain PCL1606 but still motile, as also confirmed by microscopic analysis. In contrast, the PCL1606-flgK mutant was not motile (Fig. 1), neither by plate assay nor by microscopic analysis. Chemotactic responses of P. chlororaphis PCL1606 to different compounds. Using the chemotaxis plate assay, P. chlororaphis PCL1606 displayed a clear attraction and motility towards casamino acids, as well as the positive control strain Pseudomonas sp. Pf0-1. No chemotactic movement was observed in any case for the PCL1606-cheA and PCL1606-flgK derivative mutants (Fig. 2A). Individual compounds (l-glutamate and mixtures of dand l-aspartate, succinate, malate and glucose) were tested as attractants at different concentrations (1, 10, 40 and 100 mM; Fig. 2B). Attraction at different levels to all of the compounds was observed for Pf0-1 and PCL1606 compared with the negative control of attraction (sterile saline solution). A repulsion phenotype was observed at high concentrations of some compounds, especially for aspartate and L-glutamate at 100 mM (Fig. 2B). Bacterial chemotaxis increased with an increase in compound concentration (with a maximum of approximately 10–40 mM of concentration). Concentrations of 100 mM did not increase attraction, showing that, at such concentrations, these compounds could act as repellents for PCL1606. However, no chemotactic activity to root and fungal compounds was observed by the chemotaxis plate assay. These results were complemented using the more accurate capillary chemotaxis assay for those individual compounds commonly present on plant roots. The capillary assays showed that P. chlororaphis PCL1606 cells accumulated preferably in capillaries containing lower concentrations with the maxi-
Int Microbiol
Results
Fig. 1. Swimming motility of the wild-type strains Pseudomonas sp. Pf0-1 and Pseudomonas chlororaphis PCL1606, and mutant derivatives mutants PCL1606-cheA and PCL1606-flgK, constructed by gene insertion. Ten µl of a bacterial suspension (1.5 × 107 cells/ml) were placed in the centre of the plate containing King’s B medium diluted twenty times. Movement was recorded after incubation at 25 ºC during 24 h, and disk area of motility was calculated. Data were analyzed for significance after arcsine square root transformation with analysis of variance, followed by Fisher’s least significant test (P = 0.05). Values of bars with different letter indications denote a statistically significant difference.
mum number of cells obtained at 1 mM. Concentrations greater than 10 mM did not show attraction or show themselves to be repellent for the tested compounds, except for glucose, which was still an attractant at 100 mM (data not shown). Testing these compounds at 1 mM of concentration showed that glucose and L-glutamate concentrated a greater number of cells inside the capillary, with RCI values of 8.1 and 7.5, respectively (Fig. 3). No chemotactic response was found for PCL1606-cheA and PCL1606-flgK derivative mutants impaired in chemotaxis and motility, respectively. When using R. necatrix and avocado root exudates, cells were clearly attracted and concentrated inside the capillary needle. A strong attraction was observed to the avocado exudates (with an RCI of 12.5) but also to the R. necatrix exudates (RCI of 3.75). The use of more concentrated exudates (20×) resulted in a stronger chemotactic phenotype (Fig. 4). No chemotaxis derived from the media used to obtain the R. necatrix exudates (BM medium) was observed (Fig. 5). Biocontrol experiments. The biocontrol experiments, performed with 6-month-old commercial avocado plants under greenhouse conditions, revealed high biocontrol activity of the wild-type strain P. chlororaphis PCL1606 (Fig. 6). However, the disease index of the derivative mutants, im-
Int. Microbiol. Vol. 20, 2017
POLONIO ET AL.
Int Microbiol
100
Fig. 2. Chemotaxis assay on plate. a) Visualization of chemotactic response on plate assay towards glucose (40 mM) of different Pseudomonas sp. Ten µl of a bacterial suspension was allocated at the centre of the plate, and three 10 µl separate drops of the test solution at the right side of the plate. The strain of Pseudomonas sp. Pf0-1 was used as positive control of chemotaxis. b) Chemotactic response by plate assay of P. chlororaphis PCL1606 towards different individual compounds and concentrations. Error bars indicated the SDs based in three independent experiments.
paired in motility (PCL1606-flgK) and chemotaxis (PCL1606cheA), was significantly affected in biocontrol compared with the wild-type strain PCL1606. However, those derivative mutants still displayed antagonism and biocontrol ability (Table 1) but with significantly lower levels of protection (Fig. 6). Bacterial counts on avocado roots after 21 days of growth were analysed. The bacterial counts of the rifampicin-resistant wild-type strain PCL1606 (1.5 × 106 cfu/g of fresh root) and its derivative mutants (1.1 × 106 cfu/g of fresh root for PCL1606cheA, and 2.3 × 106 cfu/g of fresh root for PCL1606-flgK) revealed non-significant differences (P = 0.05) among them after ANOVA.
Discussion Plant biocontrol activity is the result of multitrophic interactions among, at least, a susceptible host plant, a phytopathogenic agent and a beneficial organism. Plant roots are able to
exude an extensive range of organic compounds, which can function as nutrients or carbon sources for microorganisms. This ability is one of the reasons why the rhizosphere is inhabited by a broad range of microorganisms. Unfortunately, not only beneficial microbes are attracted by root exudate but also microorganisms that can damage the plant [2]. Pseudomonas chlororaphis PCL1606 is a beneficial bacterium that can be stablished on avocado root for several weeks, and it is able to interact directly with the root and with phytopathogenic fungi [7]. Motility analysis revealed that P. chlororaphis showed swimming motility, which is considered a common trait of several biocontrol Pseudomonas sp. [15,46]. Many pseudomonads, like P. aeruginosa [21], P. syringae and strains of P. fluorescens [30], have more than one functional chemotaxis system. However, in the case of P. chlororaphis PCL1606, only one functional chemotactic cheA gene has been identified (locus AKA25886.1). The construction of the non-chemotactic cheA and the flagella-less flgK mutants of
CHEMOTAXIS INFLUENCE ON BIOCONTROL
101
Int Microbiol
P. chlororaphis PCL1606 resulted in lack of response of these two derivative strains to chemotactic assay. Potential effects of the insertion on downstream genes cannot discarded; however, the genes susceptible to be affected in PCL1606cheA and PCL1606-flgK would be the genes cheY and flgL, respectively, also involved in the same phenotype. It is important to indicate that the cheA mutant retained motility, in agreement with results previously described for other PCL1606-cheA mutants of biocontrol Pseudomonas sp. [15]. By chemotaxis plate assay, the rhizobacterium P. chlororaphis PCL1606 was attracted to all of these individual compounds. The tested individual compounds selected have been described to be found in plant root exudates, and they include sugars and simple polysaccharides, such as glucose, amino acids, such as aspartate and L-glutamate and organic acids, such as malate or succinate [4,26,40,41]. Amino acids and organic acid fractions of root exudates have been described as very important for Pseudomonas sp. chemotaxis [31,42], and some of them have been considered among the major chemoatFig. 4. Chemotaxis response by capillar assay of Pseudomonas chlororaphis PCL1606 and its derivatives to (A) Rosellinia necatrix and (B) avocado exudates. Error bars indicated the SDs based in three independent experiments. Numbers above each bar indicate the relative chemotactic index (RCI). RCI values equal or above 2 indicate positive chemotactic response. Data were analyzed for significance after arcsine square root transformation with analysis of variance, followed by Fisher’s least significant test (P = 0.05). Values of bars with different letter indications denote a statistically significant difference.
tractants for Pseudomonas sp. cells in the tomato rhizosphere [15]. The observed increase in the chemotaxis response when increasing the attractant concentration in some cases (1 mM, 10 mM, and in some cases 40 mM) suggested that this process might enable bacteria to detect a concentration gradient of at-
Int Microbiol
Fig. 3. Chemotaxis response of Pseudomonas chlororaphis PCL1606 to single compounds (1 mM) by capillary assay. A bacterial suspension was allocated into the capillary and immersed into a bacterial suspension for 45 min. Afterwards, bacterial counts were calculated. Error bars indicated the SDs based in three independent experiments. Numbers above each bar indicates the relative chemotactic index (RCI). RCI values equal or above 2 indicate positive chemotactic response. Data were analyzed for significance after arcsine square root transformation with analysis of variance, followed by Fisher’s least significant test (P = 0.05). Values of bars with different letter indications denote a statistically significant difference.
Int. Microbiol. Vol. 20, 2017
Int. Microbiol. Vol. 20, 2017
POLONIO ET AL.
Int Microbiol
Int Microbiol
102
Fig. 5. Chemotaxis response by capillary assay of Pseudomonas chlororaphis PCL1606 to BM minimal medium used to obtain Rosellinia necatrix CH53 exudates. Error bars indicated the SDs based in three independent experiments. Numbers above each bar indicates the relative chemotactic response (RCI). RCI values equal or above 2 indicate positive chemotactic response. Data were analyzed for significance after arcsine square root transformation with analysis of variance, followed by Fisher’s least significant test (P = 0.05). Values of bars with different letter indications denote a statistically significant difference.
Fig. 6. Biocontrol of avocado white root rot caused by Rosellinia necatrix by Pseudomonas chlororaphis PCL1606 and derivatives impaired in chemotaxis (PCL1606-cheA) and in flagellar motility (PCL1606-flgK). Roots of avocado seedlings were inoculated with the different strains before transferring them to potting soil infested with R. necatrix. Plants were scored as sick or healthy after 21 days of growth after bacterization. Data were analyzed for significance after arcsine square root transformation with analysis of variance, followed by Fisher’s least significant difference test (P = 0.06). Values of bars with different letter indications denote a statistically significant difference.
tractant and to reach the immediate vicinity of the roots. However, as previously described, the development of similar-size chemotactic rings in different concentrations (e.g., aspartate at 1, 10 and 40 mM) is difficult to explain [29]. Higher concentrations tested (100 mM) act as repellents for PCL1606, likely due to local changes in pH, as previously reported [24]. The lack of chemotaxis response of PCL1606 by plate assay when using complex root and fungal exudates as attractants could be due to some interference among the components present in the exudates and the agar media. The presence of a white precipitate could be the result of a reduction in solubility and precipitation of some components, and absence of available compounds. However, because the plate assay is not considered ideal for quantifying bacterial migration [17], the use of the capillary assay showed greater sensitivity at lower concentrations (1 mM), thus revealing cell responses to compound concentrations closer to those present in nature [4,26]. The calculation of the RCI at a concentration of 1 mM has been extensively studied [20,29]. Nevertheless, slightly higher concentrations, such as 5 mM, have also been reported [30]. By cap-
illary chemotaxis assay of P. chlororaphis PCL1606, higher attraction was shown to glucose and L-glutamate (1 mM) as well as to the other individual compounds tested. This attraction to these compounds, together with the swim plate assay, suggested that they could be used as carbon sources, which could also be considered an advantage to the microorganism, as previously reported [43]. Interestingly, the use of the capillary assay also allowed for the confirmation of raw and concentrated avocado exudates as very powerful attractants for PCL1606, as indicated by RCI values of 12.5 for raw exudates or 25 for concentrated exudates. Attraction for R. necatrix exudates was also observed but with lower RCI values than avocado roots, supporting that chemotaxis could be considered one of the first steps for PCL1606 in initiating interaction with the avocado root and the fungi, which could lead to biocontrol activity, as previously observed [7]. In this sense, it has been described previously that chemotaxis could be considered the first step in root colonization [1,15]. Finally, the use of PCL1606 derivative strains impaired in motility or chemotaxis did not lead to a complete lack of bio-
CHEMOTAXIS INFLUENCE ON BIOCONTROL
control, but statistically lower protection could be observed when those strains colonized the roots. In fact, plant protection was reduced, but there was significant protection against R. necatrix that was better than with the non-bacterized control. This finding could be due to the PCL1606-cheA and PCL1606-flgK derivative mutants being inoculated directly on the root for the biocontrol experiments [10]. Thus, the bacterial counts at the end of the experiment did not provide relevant conclusions for colonization behaviour, the involvement of which in plant interaction has been reported previously [1,5,15]. However, a stable population of derivative mutants was reported on avocado roots after 21 days post-inoculation. The wild-type strain and the derivative mutants attained values of approximately 1–2 × 106 cfu/g of root, corresponding to the persistence values for PCL1606 on avocado roots after several weeks [19]. That cheA and flgK mutants still established stable populations on plant roots has been previously described [4,13], suggesting additional adhesive molecules on their cell surfaces to promote cell-root interaction [27]. Interestingly, these strains still produced the antifungal antibiotic HPR, which is considered the primary factor responsible for antagonism and biocontrol [8], and it could help to maintain some biocontrol activity. Thus, the lack of protection by the mutants PCL1606cheA and PCL1606-flgK could result in a delay of the earlier interactions in response to environmental signals (e.g., root and fungal exudates), resulting in a decrease in biocontrol ability but not a complete lack of it. This hypothesis was also supported by the crucial role of the attraction mediated by the plant root and fungal exudates, as well as for individual compounds commonly present in them, for such multitrophic interactions [5]. This study demonstrated that P. chlororaphis PCL1606 can detect the compounds exudated by avocado roots and R. necatrix. Thus, PCL1606 could have the capacity to detect and move through soil particles towards a gradient of the avocado exudates, as well as to R. necatrix exudates, which would result in a more efficient microbe-substrate interaction. For these reasons, motility and chemotaxis could be considered the first steps for biocontrol activity of P. chlororaphis PCL1606. Acknowledgements. This research was supported by the Spanish Plan Nacional I +D+ I. Grant AGL2014-52518-C2-1-R, MINECO, Spain, and was partially supported by the European Union (FEDER). C. Vida was supported by a grant from FPI (MICINN), Spain. We would like to thank Drs. Jesús Hierrezuelo and Claudia E. Calderón, the postgraduate student Mrs. Franc-
Int. Microbiol. Vol. 20, 2017
103
esca Aprile, and the laboratory technician of Mrs. Irene Linares for their helpful assistance in some parts of this work. Competing interest. None declared.
References 1. Bacilio-Jimenez M, Aguilar-Flores S, Ventura-Zapata E, Pérez-Campos E, Bouquelet S, Zenteno E (2003) Chemical characterization of exudates from rice (Oryza sativa) and their effects on the chemotactic response of endophytic bacteria. Plant Soil 249:271-277 2. Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM (2006) The role of root exudates in rhizosphere interactions with plants and other organisms. Annu Rev Plant Biol 57:233-266 3. Berg G, Smalla K (2009) Plant species and soil type cooperatively shape the structure and function of microbial communities in the rhizosphere. FEMS Microbiol Ecol 68:1-13 4. Bertin C, Yang X, Weston LA (2003) The role of root exudates and allelochemicals in the rhizosphere. Plant Soil 256:67-83 5. Bolwerk A, Lagopodi AL, Wijfjes AHM, Lamers GEM, Chin-A-Woeng TFC, Lugtenberg BJJ, Bloemberg GV (2003) Interaction in the tomato rhizosphere of two Pseudomonas biocontrol strains with the phytopathogenic fungus Fusarium oxysporum f. sp. radicis-lycopersici. Mol PlantMicrobe Interact 16:983-993 6. Boyer HW, Roulland-Dussoix D (1969) A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 41:459-472 7. Calderón EC, de Vicente A, Cazorla FM (2014) Role of 2-hexyl, 5-propyl resorcinol production by Pseudomonas chlororaphis PCL1606 in the multitrophic interactions in the avocado rhizosphere during the biocontrol process. FEMS Microbiol Ecol 89:20-31 8. Calderón EC, Pérez-García A, de Vicente A, Cazorla FM (2013) The dar genes of Pseudomonas chlororaphis PCL1606 are crucial for biocontrol activity via production of the antifungal compound 2-hexyl, 5-propyl resorcinol. Mol Plant-Microbe Interact 26:554-565 9. Calderón CE, Ramos C, de Vicente A, Cazorla FM (2015) Comparative genomic analysis of Pseudomonas chlororaphis PCL1606 reveals new insight into antifungal compounds involved in biocontrol. Mol PlantMicrobe Interact 28:249-260 10. Cazorla FM, Duckett S, Bergström E, Noreen S, Odijk R, Lugtenberg BJJ, Thomas-Oates J, Bloemberg GV (2006) Biocontrol of avocado Dematophora root rot by antagonistic Pseudomonas fluorescens PCL1606 correlates with the production of 2-hexyl, 5-propyl resorcinol. Mol PlantMicrobe Interact 19:418-428 11. Choi K-H, Kumar A, Scheweizer HP (2006) A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. J Microbiol Meth 64:391-397 12. Compant S, Clément C, Sessitsch, A (2010) Plant growth-promotion bacteria in the rhizo- and endosphere of plants: their role, colonization, mechanisms involved and prospects for utilization. Soil Biol Biochem 42:669-678 13. Compeau G, Alachi BJ, Platsouka E, Levy SB (1998) Survival of rifampin-resistant mutants of Pseudomonas fluorescens and Pseudomonas putida in soil systems. Appl Environ Microbiol 54:2432-2438 14. de Weert S, Kuiper I, Lagendijk E.L, Lamers G.E.M, Lugtenberg BJJ (2004) Role of chemotaxis toward fusaric acid in colonization of hyphae of Fusarium oxysporum f. sp. radicis-lycopersici by Pseudomonas fluo-
104
Int. Microbiol. Vol. 20, 2017
rescens WCS365. Mol Plant Microbe Interact 11:1185-1191 15. de Weert S, Vermeiren H, Mulders IHM, Kuipers I, Hendrickx N, Bloemberg GV, Vanderleyden J, de Mot R, Lugtenberg BJJ (2002) Flagelladriven chemotaxis towards exudate components is an important trait for tomato root colonization by Pseudomonas fluorescens. Mol Plant-Microbe Interact 15: 1173-1180 16. Dekkers LC, Bloemendaal CJ, de Weger LA, Wijffelmand CA, Spaink HP, Lugtenberg BJJ (1998) A two-component system plays an important role in the root-colonizing ability of Pseudomonas fluorescens WCS365. Mol Plant-Microbe Interact 11:45-56 17. Englert DL, Manson MD, Jayaraman A (2010) Investigation of bacterial chemotaxis in flow-based microfluidic devices. Nature Protocols 5:864872. 18. Freeman S, Sztejnberg A, Chet I (1986) Evaluation of Trichoderma as a biocontrol agent for Rosellinia necatrix. Plant Soil 94:163-170 19. González-Sánchez MA, Pérez-Jiménez RM, Pliego C, Ramos C, de Vicente A, Cazorla FM (2010) Biocontrol bacteria selected by a direct plant protection strategy against avocado white root rot show antagonism as a prevalent trait. J Appl Microbiol 109:65-78 20. Gordillo F, Chávez FP, Jerez CA (2007) Motility and chemotaxis of Pseudomonas sp. B4 towards polychlorobiphenyls and chlorobenzoates. FEMS Microbiol Ecol 60:322-328 21. Güvener ZT, Tifrea DF, Harwood CS (2006) Two different Pseudomonas aeruginosa chemosensory signal transduction complexes localize to cell poles and form and remould in stationary phase. Mol Microbiol 61:106-118 22. Gutiérrez-Barranquero JA, Pliego C, Bonilla N, Calderón CE, PérezGarcía A, de Vicente A, Cazorla FM (2012) Sclerotization as a long-term preservation method for Rosellinia necatrix strains. Mycoscience 53:460-465 23. King EO, Ward MK, Raney DE (1954) Two simple media for the demonstration of pyocyanin and fluorescein. J Lab Clin Med 44:301-0307 24. Koshland Jr. DE (1988) Chemotaxis as a model second-messenger system. Biochemistry 27:5829-5834 25. Li P, Ma L, Feng YL, Mo MH, Yang XF, Dai HF, Zhao YX (2012) Diversity and chemotaxis of soil bacteria with antifungal activity against Fusarium wilt of banana. J Ind Microbiol Biotechnol 39:1495-1505 26. Lugtenberg BJJ, Kravchenko LV, Simons M (1999) Tomato seed and root exudate sugars: composition, utilization by Pseudomonas biocontrol strains and role in rhizosphere colonization. Environ Microbiol 1:439-446 27. MacEachran DP, O’Toole G (2007) Do not fear commitment: the initial transition to a surface lifestyle by Pseudomonas. In: “The biofilm mode of life. Mechanisms and adaptations”. Kjelleberg, S. & Givskov, M. (eds.) Horizon Bioscience, Norkfolk, UK, pp. 23-36 28. Martínez-Granero F, Rivilla R, Martín M (2006) Rhizosphere selection of highly motile phenotypic variants of Pseudomonas fluorescens with enhanced competitive colonization ability. Appl Environ Microbiol 72: 3429-3434 29. Mazumder R, Phelps TJ, Krieg NR, de Benoit RE (1999) Methods determining chemotactic responses by two subsurface microaerophiles using a simplified capillary assay method. J Microbiol Meth 37:255-263 30. Muriel C, Jalvo B, Redondo-Nieto M, Rivilla R, Martín M (2015) Chemotactic motility of Pseudomonas fluorescens F113 under aerobic and denitrification conditions. PLoS One 10:e0132242
POLONIO ET AL.
31. Oku S, Komatsu A, Nakashimada Y, Tajima T, Kato J (2014) Identification of Pseudomonas fluorescens chemotaxis sensory proteins for malate, succinate, and fumarate, and their involvement in root colonization. Microbes Environm; 29:413-419 32. Pliego C, de Weert S, Lamers G, de Vicente A, Bloemberg GV, Cazorla FM, Ramos C (2008) Two similar enhanced root-colonizing Pseudomonas strains differ largely in their colonization strategies of avocado roots and Rosellinia necatrix hyphae. Environ Microbiol 10:3295-3304 33. Pliego C, Kanematsu S, Ruano-Rosa D, de Vicente A, López-Herrera C, Cazorla FM, Ramos C (2009) GFP shed light on the infection process of avocado roots by Rosellinia necatrix. Fun Gen Biol 46:137-145 34. Rainey PB (1999) Adaptation of Pseudomonas fluorescens to the plant rhizosphere. Environ Microbiol 3:243-257 35. Robleto EA, López-Hernández J, Mark W, Levi SB, Lu I, Silby MW (2003) Genetic analysis of the AdnA regulon in Pseudomonas fluorescens: non essential role of flagella in adhesion to sand and biofilm formation genetic. J Bacteriol 185:453-460 36. Rovira AD (1969) Plant root exudates. Bot Rev 35:35-57 37. Sambrook J, Russel D (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Laboratory Press, Cold Spring Harbor NY, USA 38. Sampedro I, Parales RE, Krell T, Hill JE (2015) Pseudomonas chemotaxis. FEMS Microbiol Rev 39:17-46 39. Scharf BE, Hynes MF, Alexandre GM (2016) Chemotaxis signaling systems in model beneficial plant-bacteria associations. Plant Mol Biol 90:549-559 40. Simons M, Permentier HP, de Weger LA, Wijffelman CA, Lugtenberg BJJ (1997) Amino acid synthesis is necessary for tomato root colonization by Pseudomonas fluorescens strain. Mol Plant-Microbe Interact 10:102-106 41. Simons M, van der Bij AJ, Brand I, de Weger LA, Wijffelman CA, Lugtenberg BJJ (1996) Gnotobiotic system for studying rhizosphere colonization by plant-growth-promoting Pseudomonas bacteria. Mol PlantMicrobe Interact 9:600-607 42. Sood SG (2003) Chemotactic response of plant-growth-promoting bacteria towards root of vesicular-arbuscular mycorrhizal tomato plants. FEMS Microbiol Ecol 45:19-227 43. Tso WW, Adler J (1974) Negative chemotaxis in Escherichia coli. J Bacteriol 118:560-576 44. Turnbull GA, Morgan JAW, Whipp JM, Saunders JR (2001) The role of motility in the in vitro attachment of Pseudomonas putida PaW8 to wheat roots. FEMS Microbiol Ecol 35:57-65 45. Webb BA, Helm RF, Scharf BE (2016) Contribution of individual chemoreceptors to Sinorhizobium meliloti chemotaxis towards amino acids of host and nonhost seed exudates. Mol Plant-Microbe Interact 29:231239 46. Weller DM (2007) Pseudomonas biocontrol agents of soilborne pathogens: looking back over 30 years. Phytopathology 97:250-256 47. West PM, Lochhead AG (1940) Qualitative studies of soil microorganisms. IV. The rhizosphere in relation to the nutritive requirements of soil bacteria. Can J Res 18:129-135 48. Yuan J, Zhang N, Huang Q, Raza W, Li R, Vivanco Jm, Shen Q (2015) Organic acids from root exudates of banana help root colonization of PGPR strain Bacillus amyloliquefaciens NJN-6. Sci Rep 5:13438
A3
A4
A5
Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686 A6
Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter.SI units should be used throughout. For Nomenclature of organisms genus and species scientific names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.