Skip to main content

International Microbiology

Page 1

CONTENTS International Microbiology (2015) 18:135-202 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Volume 18, Number 3, September 2015

EDITORIAL

González Fandos E The 25th SEM Congress (Logroño, Spain, July 7-10, 2015)

135

The 25th SEM CONGRESS (Logroño, Spain, July 7-10, 2015) RESEARCH REVIEWS

McLellan SL, Fisher JC, Newton RJ The microbiome of urban waters Reguera G Microbes, cables, and an electrical touch Berlanga M Functional symbiosis and communication in microbial ecosystems. The case of wood-eating termites and cockroaches RESEARCH ARTICLE

González-Fandos E, Maya N, Pérez-Arnedo I Effect of propionic acid on Campylobacter jejuni attached to chicken skin during refrigerated storage RESEARCH ARTICLES

Blesa A, Berenguer J Contribution of vesicle-protected extracellular DNA to horizontal gene transfer in Thermus spp. Guerra M, González K, González C, Parra B, Martínez M Dormancy in Deinococcus sp. UDEC-P1 as a survival strategy to escape from deleterious effects of carbon starvation and temperature PERSPECTIVES

LERU roadmap towards Open Access

141 151 159

171

177 189

195

Journal Citations Reports 5-year Impact Factor of International Microbiology is 2,10. The journal is covered in several leading abstracting and indexing databases, including the following ones: Agricultural & Environmental Bio­­technology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents/Agriculture, Biology & Environmental Sciences; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science & Technology Abstracts; ICYT/CINDOC; IBECS/ BNCS; ISI Alerting Services; MEDLINE/Index Medicus; Latindex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; SciSearch.

A1


Front cover legends bean plants from agricultural lands in Mexico using an enrichment method. Micrograph by Víctor González, Evolutive Genomics, Center of Genomic Sciences, UNAM, Cuernavaca, Morelos, México. (Magnification, 200,000×) Upper right. Darkfield micrograph of the cyanobacterium Nostoc sp., isolated from a freshwater pond. Note the differentiated cells known as heterocysts that fix atmospheric nitrogen. Photo by Rubén Duro, Center for Microbiological Research (CIM), Barcelona. (Magnification, 1000×)

Center. The three towers are some of the icons of city of Logroño, La Rioja, Spain. This central photograph commemorates the celebration of the 25th Congress of the Spanish Society for Microbiology (SEM), held in Logroño, on July 7-10, 2015 [www. semicrobiologia.org] (Photo by E. Glez-Fandos) [See article by González-Fandos, pp. 135-140 this issue]. Upper left. Electron micrograph showing morphology of bacteriophages that infect Rhizobium etli. They were obtained from rhizosphere soil of

Lower right. Photonic micrograph of spores of the fungus Alternaria. This fungus is a major aeroallergen in many parts of the world. Sensitivity to Alternaria has been increasingly recognized as a risk factor for the development and persistence of asthma. It is most common as an outdoor mold, as it thrives on various types of plants–including the black rot commonly seen on tomato fruit. Photo by Rubén Duro, Center for Microbiological Research (CIM), Barcelona.(Magnification, 1000×)

Lower left. Darkfield microsgraph of the unicellular cilliated Paramecium sp. Paramecia are widespread in freshwater, brackish and marine environments and are often very abundant in stagnant basins and ponds. Some species of Paramecium form mutualistic relationships with other organisms. Paramecium bursaria and P. chlorelligerum harbor endosymbiotic green algae, from which they obtain nutrients and protection from predators. Photo by Rubén Duro, Center for Microbiological Research (CIM), Barcelona. (Magnification, 1000×)

Back cover: Pioneers in Microbiology Enid de Rodaniche (1906-1988?), Panama Enid de Rodaniche (born Enid Cook) was the first professor of Parasitology and Microbiology at the University of Panama. Born in the United States in 1906, she graduated from Dunbar High School in Washington D.C., the first public high school for black students, and spent one year at Howard University also for black students. In 1927 she moved to Bryn Mawr College, in Pennsylvania, Philadelphia, which at those times was an all-white women’s institution. The President of the College had tried to convince her to give up from applying because of the discomfort she might experience due to white students’ and professors’ prejudices. She was aware of it but had already taken a decision and applied twice, the first time having not obtained a score in the entrance examination high enough to be on top of the list of applicant students. She

was finally admitted but was forced to live off campus with a local family. At Bryn Mawr, Enid majored in chemistry and biology, and graduated in 1931. In 1937 she earned a doctorate from the University of Chicago, and she was a lecturer at that university from 1937 to 1944, the year that she married Panaman physician Arcadio Rodaniche. The couple moved to Panama, where, from 1946 to 1954, she served as the chief of the Public Health Laboratory at the Instituto Conmemorativo Gorgas. She was in charge of the laboratory devoted to study diseases caused by viruses and rickettsias. When the first School of Medicine of the University of Panama was set up, in 1951, Enid became its first professor of Parasitology and Microbiology. She published 32 articles mainly on different rickettsiosis (Q fever, murine or endemic typhus, Rocky Mountain spotted fever), poliomyelitis, yellow fever and other diseases whose study she pioneered in Panama, such as Saint Louis encephalitis, Ilheus encephalitis, and those caused by arboviruses. She also studied parasitic diseases including toxoplasmosis, giardiasis and malaria. Enid de Rodaniche died in Panama in the late 1980s.

Front cover and back cover design by MBerlanga & RGuerrero

A2


EDITORIAL International Microbiology (2015) 18:135-140 doi:10.2436/20.1501.01.243. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

The 25th SEM Congress (Logroño, Spain, July 7–10, 2015) Elena González-Fandos Food Technology Department, CIVA Research Center, University of La Rioja, Logroño, Spain Received 27 August 2015 · Accepted 3 September 2015

Summary. The 25th Congress of the Spanish Society for Microbiology (SEM) took place on 7–10 July, 2015, at the University of La Rioja, in Logroño. This meeting brought together microbiologists from several prestigious universities and research centers throughout Spain, as well as experts from other countries including the United States, United Kingdom, Portugal, Germany, Mexico and Venezuela. The program included an opening lecture, one invited lecture and a closing lecture, twelve symposia on selected topics, ten sessions of oral presentations, four poster sessions, and three workshops. There were around 230 poster presentations and 55 oral communications. Relevant Spanish and foreign researchers participated at the symposia in order to get a straightforward vision of the new and more successful scientific results. Besides, joint symposia with the Portuguese Society for Microbiology as well as with the Spanish Society for Virology were held. One of the main goals of the meeting was to stimulate the participation of young microbiologists, given them an excellent opportunity to present their more recent results. [Int Microbiol 18(3):135-140 (2015)] Keywords: The 25th SEM Congress · Spanish microbiology · Logroño (La Rioja)

The 25th Congress of the Spanish Society for Microbiology (SEM) took place on 7–10 July, 2015 at the University of La Rioja, in Logroño [http//www./congresosem2015.unirioja.es] (Figs. 1 and 2) under my presidency. This was the first SEM biennal Congress presided by a woman. This meeting brought together microbiologists from several prestigious universities and research centers throughout Spain, as well as experts from other countries including the United States, United Kingdom, Portugal, Germany, Mexico and Venezuela. The program included an opening lecture, one invited lecture and a closing lecture, twelve symposia on selected topics, ten sessions of oral presentations, four poster sessions, and three workshops. There were around 230 poster presentations and 55 Correspondence: Elena González-Fandos Food Technology Department University of La Rioja Madre de Dios, 51 26006 Logroño, Spain Tel. +34-941299728. Fax 34-941299721 *

E-mail: elena.gonzalez@unirioja.es

oral communications. Relevant Spanish and foreign researchers participated at the symposia in order to get a straightforward vision of the new and more successful scientific results. Besides, joint symposia with the Portuguese Society for Microbiology as well as with the Spanish Society for Virology were held. One of the main goals of the meeting was to stimulate the participation of young microbiologists, given them an excellent opportunity to present their more recent results. The opening ceremony was presided over by José Arnáez Vadillo, Rector of the University of La Rioja; José Luis López de Silanes, President of the Social Council of the University of La Rioja; Antonio Ventosa, President of the Spanish Society for Microbiology (SEM) and Elena González-Fandos, President of the 25th SEM Congress (Fig. 3). The opening lecture, “The Spanish Society for Microbiology. Advances in Microbiology” was delivered by Prof. César Nombela, Rector of the University Menendez Pelayo. Prof. Sandra McLellan, from the University of Wisconsin-Milwaukee (USA) gave the invited lecture, “Metagenomics and microbes present and future” (see article by S. McLellan, in this issue, pp 141–149).


Int. Microbiol. Vol. 18, 2015

GONZÁLEZ-FANDOS

Int Microbiol

136

The closing lecture was delivered by Diego Romero Hinojosa, from CSIC-University of Malaga, SEM Prize Jaime Ferrán of this year. The topics covered by the program included interaction, communication and symbiosis in the microbial world; microbial pathogenesis from the molecular point of view; new methodologies applied to biodeterioration, biodegradation and bioremediation; emerging viral infections; Fungi: model for studying biological and biotechnological processes;

Fig. 1. The Ebro River, passing throug the city of Logroño.

microbial strategies development of biotechnology and environmental interest; environmental stress and biotechnology in photosynthetic microorganisms; the utility of -omics technologies on microbial taxonomy, diversity and adaptive evolution studies; beneficial bacteria in sustainable agriculture; microbiology of aquatic environment; microbial biofilms and food industry; update microbiology in the curriculum of preuniversity student. The different sessions of the conference were held at the University of La Rioja (Fig. 4).

Fig. 2. Poster announcing the 25th Congress of the Spanish Society for Microbiology (SEM).


Int. Microbiol. Vol. 18, 2015

137

Int Microbiol

25 SEM CONGRESS

Fig. 3. Opening ceremony of the 25th Congress of the Spanish Society for Microbiology (SEM).

The congress was particularly devoted to the young microbiologists. A workshop on “How to write a research article” was presented by Prof. Ricardo Guerrero (University of Barcelona, and past-president of SEM, 2006–2014). This topic, based on the large experience of Prof. Guerrero as founder and editor-in-chief of the official journal of SEM, International Microbiology, was of especial interest for young researchers. Moreover, the SEM gave 12 awards to those young researchers that presented the best oral and poster works; besides that, 15 travel grants were given to young microbiologists. Interaction, communication and sym­biosis in the microbial world The Congress included the traditional Joint Symposium Portuguese Society for Microbiology (SPM)-Spanish Society for Microbiology (SEM). The topic was “Interaction, communication and symbiosis in the microbial world”, and was chaired by Ricardo Guerrero (University of Barcelona) and Arsénio M. Fialho (Technical Institute, Lisbon). This was an all-women symposium in which researchers from different universities talked about their present research and achivements. Bacteria live in complex communities. Living organisms interact with their habitats, selectively taking up compounds from their surroundings to meet their particular needs but also excreting metabolic products and thus modifying their environment. It has been suggested that communication and cooperation, both within and among bacterial species, have

produced emergent properties that give such groups a selective advantage. Examples of symbiosis and communication in microbial ecosystems were provided in the talks given by Mercedes Berlanga (University of Barcelona) and Gemma Reguera (Michigan State University, USA). Biofilms are microbial communities adhered to surfaces, or formed on an air-liquid interface, composed of cells embedded in a self-produced polymeric matrix. Biofilm formation constitutes a smart strategy of bacterial survival in adverse environmental conditions and this is why biofilms are widespread in nature. The role of biofilms as a strategy for microbial survival and virulence was analyzed in the talk given by Joana Azeredo (University of Minho, Portugal). The Symposium ended with the contribution of Luísa Peixe (University of Porto, Portugal) on antimicrobial resistance. Emerging viral infections Emerging virus disease are a major threat to human and veterinary health, the majority are viruses originating from an animal host. A Symposium on emerging viral infections, chaired by Juan J. Borrego (University of Málaga) and Albert Bosch (University of Barcelona) was held. One strategy to better understand and address the contemporary health issues created by the convergence of human, animal, and environmental domains is the concept of “One Health”. The “One Health” concept recognizes that the health of humans is connected to the health of animals and the environment. This approach encourages the collaborative efforts


Int. Microbiol. Vol. 18, 2015

GONZÁLEZ-FANDOS

Int Microbiol

138

Fig. 4. Building of the University of La Rioja where the sessions were held.

to attain optimal health. Miguel Ángel Jiménez (Research Center of Animal Health, INIA) presented the one health concept and showed different examples. The most relevant emerging virus were reviewed: Ebola virus (Ana Negredo, Health Institute Carlos III), MERS (Inmaculada Casas, Health Institute Carlos III) and Ranavirus (Alí Alejo Herberg, Research Center for Animal Health, INIA). New methodologies applied to biode­ terio­ ration, biodegradation and biore­mediation A serie of talks examined the new methodologies applied to biodeterioration, biodegradation and bioremediation, chaired by Constantino Ruibal (Complutense University of Madrid). The potential confocal laser and electronic microscopy in bioremediation of environments contaminated with metals was presented by Antonio Solé (Autonomous University of Barcelona). Mohamed Larbi (University of Granada) presented microscopic and spectroscopic studies of microbial interactions with uranium for bioremediation purposes. Pedro M. Martín-Sánchez (BAM Federal Institute for Materials Research and Testing, Berlin) presented two study cases on the contribution of Quantitative PCR Assays to biodeterioration research. The quantitative PCR is a useful and reliable tool for monitoring the microbial communities involved in biodeterioration processes. In addition, such methods allow the early detection of microbial outbreaks improving control procedures. Finally, Concepción Abrusci (Autonomous University of Madrid) presented different monitoring techniques for biodegradation of polymers. Fungi: Model for studying biological and bio­ technological processes A series of talks examined the role of Fungi as a model for studying biological and biotechnological processes. The following lectures were included in the program: Yeast as

a model study in intracellular transport of proteins: from synthesis of chitin to Nobel Prize (Cesar Roncero, Institute of Functional Genomics and Biology), post-transcriptional regulation and pathogenesis in the fungus rice piriculariosis (Ana Sesma, Technical University of Madrid), Fungi that produce enzymes of industrial interest (María Jesús Martínez, Biological Research Center, Madrid) and S. cerevisiae (María Ángeles de la Torre, University of Lleida).

Environmental stress and biotechnology in photosynthetic microorganisms The program included lectures on environmental stress and biotechnology in photosynthetic microorganisms chaired by Juan Carlos Gutiérrez Fernández (Complutense University of Madrid). The lectures included were: response to stress in microalgae: new biomarkers of cytotoxicity (Angeles Cid Blanco, University of La Coruña), activation of autophagy by abiotic stress in the model alga Chlamydomonas reinhardtii (José Luis Crespo González. CSIC-University of Sevilla), using cyanobacteria in environmental monitoring aquatic environments (Francisca Fernández Piñas. Autonomous University of Madrid) and biotechnological applications of microalgae (Miguel García Guerrero, University of Sevilla). The utility of -omics technologies on mi­crobial taxonomy, diversity and adaptive evolution studies The Symposium on “The utility of –omics technologies on microbial taxonomy, diversity and adaptive evolution studies” was chaired by Juncal Garmendia (dAB-CSIC) and María José Figueras (University Rovira i Virgili). Genomics contribution to prokaryotic taxonomy was evaluated by David Ruiz Arahal (University of Valencia). The utility of genomics in the case of Legionella pneumophila (Fernando González-Candelas,


25 SEM CONGRESS

University of Valencia) and Haemophilus influenzae (Joshua Mell, Drexel University, USA) were also evaluated. The theoretical and real potential of –omics, enzyme discovery and human gut as cases of investigation, were presented by Manuel Ferrer (CSIC, Madrid). Evolution of the tuberculosis bacillus was discussed by Iñaki Comas (FISABIO Public Health, Valencia). Metagenomics reveals unknown or known microorganisms not detectable by conventional culture methods. The composition of the media and the incubation culturing conditions may select specific populations and this could be one of the reasons for discrepancies observed between both approaches. Results obtained by classical sequencing PCR or conventional culture methods are essential and needed for understanding and interpreting metagenomic data. M. José Figueras (University Rovira i Virgili) presented results obtained in the case of Arcobacter in wastewater. The Roseobacter lineage is a key component of marine bacterioplankton. Amongst the interesting capabilities of roseobacters there is the ability to degrade aromatic compounds. The capabilities for aromatic compound catabolism of Roseobacter isolates obtained from hydrocarbon-polluted samples by genome and proteome analysis was presented by Balbina Nogales (University of the Balearic Islands). Sandra McLellan (University of WisconsinMilwaukee) presented their work on detecting human sewage contamination in urban waters.

Int. Microbiol. Vol. 18, 2015

139

biofertilizers for sustainable agriculture (Manuel Megias Guijo, University of Sevilla), endophytes: tecnological potential (Jesús Mercado Blanco, IAS-CSIC Córdoba), reflections of a Gram-positive bacteria on their potential as biocontrol of plant diseases (Diego F. Romero Hinojosa, CSIC- Universty of Málaga).

Microbial biofilms and food industry It is well documented that biofilm has become a problem in food industries as it renders its inhabitants resistant to antimicrobial agents and cleaning. A symposium on Biofilms and Food Industry was celebrated. A first talk presented biofilms as a way of living in society, the ability of Staphylococcus aureus to form biofilms was also discussed (Jaione Valle, Institute of Agrobiotechnology of Navarra). Many foodborne outbreaks have been found to be associated with biofilm. The negatives consequences of biofilms in the Food Industry were evaluated by Belén Orgaz (Complutense University of Madrid). However, positive effects have been observed in fermented foods (Rufino Jiménez, Institute of Fats, CSIC). Advances in detection, control and elimination of biofilms were discussed by J. Juan Rodríguez (Autonomous University of Barcelona).

Microbial strategies development of bio­ tech­ nology and environmental interest

Microbiology of aquatic environment

The Symposium “Microbial strategies development of biotechnology and environmental interest” was chaired by María Jesús Martínez (CIB-CSIC) and José Antonio Gil (University of León). The following lectures were presented; Genetic manipulation of microorganisms for the production of monoterpenes (Margarita Orejas, IATA-CSIC, Valencia), towards a competitive and fully enzymatic production of biodiesel (Pilar Díaz, University of Barcelona), Streptomyces oxidative systems for degradation of emerging contaminants (María Enriqueta Arias, University of Alcalá de Henares), exploring the biotechnological potential of actinomycetes: search for new bioactive compounds (Carlos Olano, University of Oviedo).

A symposium on “Microbiology of aquatic environment” chaired by Manuel Lemos (Univ. of Santiago de Com­postela) was held. The following lectures were given: Effect of salinity on microbial populations of microbial mats of the Ebro delta (Isabel Esteve Martínez, Autonomous Univ. of Barcelona), Populations of wild fish: Are they responsible or sufferers of viral diseases in aquaculture? (Carlos Pereira Dopazo, Univ. of Santiago de Compostela), Diversity of Aeromonas in the aquatic environment and its implications for human and animal health (María José Figueras, Univ. Rovira i Virgili), and Marine microbial diversity on a global scale: where have we come (Silvia González Acinas, ICM-CSIC, Barcelona).

Beneficial bacteria in sustainable agriculture

Updating microbiology in the curriculum of pre-university students

The Symposium “Beneficial bacteria in sustainable agriculture” was chaired by Jesús Murillo Martínez (Public University of Navarra). The following lectures were given: probiotics for plants (Pedro F. Mateos, University of Salamanca). molecular

In order to promote microbiology teaching at different education levels it is relevant to evaluate the current situation. First, microbiology contents in primary and secondary


140

Int. Microbiol. Vol. 18, 2015

schools were evaluated (Cristina Valles and Bárbara Herrera). Afterwards, proposals for improvement and encourage students were discussed (Antonio Guillén and Silvia Lope).

GONZÁLEZ-FANDOS

and public culture collections from 19 countries throughout Europe collaborate to establish MIRRI as an European Research Infrastructure Consortium (ERIC) under EU law. The workshop was presented by Rosa Aznar (CECTUniversity of Valencia).

Microbial resources research infrastructure (MIRRI)

***

The aim of the Microbial Resources Research Infrastructure (MIRRI) [www.mirri.org] is to build a pan-European distributed research infrastructure that provides facilitated access to high quality microorganisms, their derivatives and associated data for research, development and application. The MIRRI connects resource holders with researchers and policy makers to deliver the resources and services more effectively and efficiently to meet the needs of innovation in biotechnology. Currently, more than 40 research centers

In summary, the Spanish Society for Microbiology held a high quality and successful meeting, complemented by social activities such as a visit to a cellar, and a guided tour to historical places in Logroño. The closing dinner was celebrated at a historic cellar in Logroño. Newspapers, radio and television showed a great interest in the Conference. Newspapers included eight comments on the Congress, seven interviews were included in radio and six news in television.


RESEARCH REVIEW International Microbiology (2015) 18:141-149 doi:10.2436/20.1501.01.244. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

The 25th SEM Congress (Logroño, Spain, July 7–10, 2015) The microbiome of urban waters Sandra L. McLellan,* Jenny C. Fisher, Ryan J. Newton

School of Freshwater Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI, USA Received 19 August 2015 · Accepted 10 September 2015

Summary. More than 50% of the world’s population lives in urban centers. As collection basins for landscape activity, urban waters are an interface between human activity and the natural environment. The microbiome of urban waters could provide insight into the impacts of pollution, the presence of human health risks, or the potential for long-term consequences for these ecosystems and the people who depend upon them. An integral part of the urban water cycle is sewer infrastructure. Thousands of miles of pipes line cities as part of wastewater and stormwater systems. As stormwater and sewage are released into natural waterways, traces of human and animal microbiomes reflect the sources and magnitude of fecal pollution and indicate the presence of pollutants, such as nutrients, pathogens, and chemicals. Non-fecal organisms are also released as part of these systems. Runoff from impervious surfaces delivers microbes from soils, plants and the built environment to stormwater systems. Further, urban sewer infrastructure contains its own unique microbial community seemingly adapted to this relatively new artificial habitat. High microbial densities are conveyed via pipes to waterways, and these organisms can be found as an urban microbial signature imprinted on the natural community of rivers and urban coastal waters. The potential consequences of mass releases of non-indigenous microorganisms into natural waters include creation of reservoirs for emerging human pathogens, altered nutrient flows into aquatic food webs, and increased genetic exchange between two distinct gene pools. This review highlights the recent characterization of the microbiome of urban sewer and stormwater infrastructure and its connection to and potential impact upon freshwater systems. [Int Microbiol 18(3):141-149 (2015)] Keywords: urban freshwaters · infrastructure and sanitation · next generation sequencing · human health · aquatic food webs

Introduction Microbes underpin the integrity of clean water. In past centuries, removing harmful microorganisms and remediating wastewater in urban areas proved very difficult and frequent disease outbreaks occurred. As urban areas grew and urban infrastructure advanced, humans recognized the need for Corresponding author: Sandra L. McLellan School of Freshwater Sciences University of Wisconsin-Milwaukee 600 E. Greenfield Ave. Milwaukee, WI 53204, USA *

E-mail: mclellan@uwm.edu

technologies capable of capturing and later, also treating wastewater to maintain high water quality in surrounding surface waters. Although these technologies have resulted in vastly improved water quality, human waste is still found in urban waterways. Further, large-scale urban infrastructure created in the past 100 to 150 years has created a number of relatively new ecological niches for colonization by microorganisms (e.g., sewer conveyance pipes, secondary wastewater treatment, drinking water infrastructure). Our understanding is limited with regards to the microbial communities now inhabiting these systems, how these communities interface with natural environments, and how new human pathogens may evolve or emerge.

This review was the inaugural lecture, held on July 7, 2015, at the 25th SEM Congress (Logroño, Spain, July 7–10, 2015), under the presidency of M. Elena González Fandos.


Int. Microbiol. Vol. 18, 2015

Sources and transport of urban mi­crobes The urban water cycle is a clear example of how human activity interfaces with aquatic environments (Fig. 1), where pipes and impervious surfaces serve as pathways for urban- and human-derived microbes to enter waterways. Within a large metropolitan area, sewer infrastructure can consist of thousands of miles of pipes that transport human waste and/or stormwater away from homes and city buildings to surface waters (rivers, estuaries, lakes). During the Industrial Revolution in Europe and North America, pipes were built to carry water from streets to prevent flooding and were later connected to houses and businesses to carry sanitary sewage waste directly to waterways [54]. These early systems were eventually connected to wastewater treatment plants, forming what are known as combined sewers. Older cities in Europe and the USA still have combined sewer systems, which often overflow, releasing untreated sewage mixed with stormwater into local rivers. In some combined sewer systems, only a few mm of rain can cause overflows, but the capacity varies greatly among cities [35,42]. In a single combined sewer overflow (CSO), millions to billions of gallons of stormwater runoff and untreated sewage can be released [57]. Bacterial densities in stormwater and

MCLELLAN ET AL.

sanitary sewage are much higher than the receiving waters [33]; therefore these overflow events could leave a significant imprint on the natural bacterial community. Newer sewer infrastructure (post 1920s) generally consists of separated sewers, where sanitary sewage is conveyed to wastewater treatment plants and stormwater is collected in a separate set of pipes and discharged directly to waterways. Separated sewer systems can also be a source of human microbial waste to area waterways, typically from sanitary sewage overflows during heavy rain or following pipe deterioration and sewage exfiltration. Fecal bacteria are not the only microbial inputs into sanitary sewage systems. These systems also collect and aggregate the microorganisms associated with grey water waste, such as those on human skin and in the oral cavity, food waste, industrial waste, pet waste, and miscellaneous waste items flushed from homes [21]. The majority of sanitary waste is treated at wastewater treatment plants; however, the resulting effluent contains residual influent microbes and newly introduced microbes from the treatment plant system. Although treated effluent has much lower cell densities than untreated sewage [69], it is a continuous source of urban derived microbes to receiving waters and has been shown to alter the makeup of communities in the natural environment [9,63]. Within separated sewer systems, stormwater systems col-

Int Microbiol

142

Fig. 1. Sanitary sewers act as collectors of organisms from “indoor” microbiomes, including bacteria associated with the human body and waste, food, and pipes. Stormwater sewers collect organisms from “outdoor” microbiomes, such as soil, impervious surfaces, plants, and animal feces. Sewers serve as transporters that deliver bacteria to aquatic environments; but microbial communities are also transformed within the sewers, including death of some organisms and growth of others within the pipe.


URBAN WATERS

lect runoff from impervious surfaces to prevent flooding. Rain events are essentially a citywide “cleansing”, thereby washing microbes from exposed surfaces within the urban built (e.g., buildings, roads) and natural (e.g. plants, soils, animals) environments into the pipe conveyance system and ultimately into area waterways via stormwater outfalls. While urban wildlife and domestic pet waste are the primary sources of fecal microbes in stormwater, human sewage also may migrate into these systems from leaking or failing sanitary sewer pipes [45,46] and through illicit pipe connections.

Human and animal microbiomes as trac­ ers of fecal pollution in the environ­ment The introduction of fecal pollution from urban discharge to surface waters is the most recognized and studied connection between urban water systems. Throughout history, self-perpetuating cycles of waterborne disease occurred with greater frequency in densely populated areas that lacked proper sanitation. Cholera outbreaks plagued major European cities throughout the mid-1800s, including multiple outbreaks in London that eventually led to an understanding of disease transmission [48]. Humans carry pathogenic bacteria, viruses, and protozoa; and even today, fecal pollution of drinking water sources and recreational waters creates a risk for waterborne disease transmission [12,19,24]. Cultivation of Escherichia coli or enterococci, two organisms found in fecal waste, has been used conventionally to assess fecal pollution in waters. However, the use of E. coli and enterococci as fecal pollution indicators does not identify fecal sources, since humans and the majority of animals carry these organisms. In urban areas, fecal pollution from humans is more likely to carry human pathogens than other fecal sources such as urban wildlife, like birds, squirrels, rabbits, and raccoons. Information on the source of fecal pollution is necessary to determine human health risk and provide direction for remediation efforts [12]. Recent discoveries in microbiome research have shed light on the complex communities associated with humans and animal fecal waste. Using the unique microbial assemblages of a host as a signature or profile is quickly becoming a feasible approach for characterizing pollution sources in surface waters [4,32]. Distinct sequence patterns (Fig. 2) within the microbiome create host signatures that include both unique organisms and organisms with differential relative abundance [13]. Animals of a given species as well as those with closely related physiology (e.g., ruminants) tend to have more similar fecal bacterial communities [26]. Recent studies also showed

Int. Microbiol. Vol. 18, 2015

143

that domestic animals (e.g., pets) tended to share a higher similarity with cohabiting humans [49]. Bacterial signatures associated with humans and specific animals can be used to identify the relative contributions of each group to urban waters [56]. Upstream of urban areas, agricultural inputs are often the major source of fecal pollution; but this signal transitions to a mixed signal of urban wildlife, domestic pet, and human fecal signatures within cities. There is high variability within individual human microbiomes [20,29,55,67]; therefore defining a “typical” human microbiome signature is challenging. Recent work by Newton et al. [37] demonstrated that sewage systems provide an integrative sample of individuals within a city and influent reflects the composite or population-level collection of a city’s human fecal microbial community. Sanitary sewage from 72 cities in the USA had highly similar fecal microbiomes, but also exhibited subtle differences that distinguished the cities. These differences included composition changes that reflected population demographics known to associate with the gut microbiome, in this case obesity levels [37]. Global differences in the gut microbiome have also been demonstrated in studies of humans in different geographic locations [1,66,67], sewage from different countries [11,23], and in source tracking studies of impacted waters [23,43]. While diet can affect the gut microbiome at an individual level [66], several studies showed that significant differences in the human microbiome were observed among geographically and culturally distinct groups as whole [1,7,66,67]. Certain groups of bacteria are more common and more abundant in different groups of humans, and may be more applicable for assessing human fecal pollution. While organisms from the order Bacteroidales have been the primary target for alternative fecal pollution indicators in the USA and Europe, they lack effectiveness in regions where these bacteria are in low abundance in the human gut due to diet or other factors [23,43]. Lachnospiraceae, although thus far less thoroughly explored, may be a preferable target, as these organisms are abundant and widely distributed in diverse human populations [11,23,34].

Urban infrastructure as a new niche for microbial communities The earliest known rudimentary stormwater and sanitary sewers were initially used for flood control (stormwater); they were later utilized to move human waste out of dense population centers. Despite their significance in early human settlements, this urban infrastructure is a relatively novel environ-


Int. Microbiol. Vol. 18, 2015

MCLELLAN ET AL.

Int Microbiol

144

ment for microorganisms compared to natural ecosystems like soils, oceans, animals, or even human hosts. Sewer pipe-derived communities have been investigated primarily to study concrete-corroding biofilms [25,65]. However, recent analysis of bacterial sequences from untreated sewage influent samples from around the USA revealed that the majority of organisms did not match sequences from these biofilms or with human fecal bacteria. On average, nearly 35% of sewage communities were comprised of only five genera: Acinetobacter, Aeromonas, Arcobacter, Pseudomonas, and Trichococcus [12,34,38,50] (Fig. 3). Stormwater collected from pipes or directly from outfalls also contained relatively high proportions of Acinetobacter, Aeromonas, and Pseudomonas, with Arcobacter and Tricho­coccus nearly absent unless the stormwater had sewage contamination [15]. These organisms appeared to be resident in both sewer systems, as they were consistently present and not readily found in uncontaminated surface water or human or animal microbiomes [13,14,60,67]. Furthermore, the organisms known to cause concrete corrosion are rarely found in influent sewage communities, suggesting that there is a pipe-associated community within loose sediments that are more easily mo-

Fig. 2. Network analysis of the family Lachnospiraceae in fecal communities of animals, humans, and sewage. Large dots represent individual samples, small dots represent operational taxonomic units (OTUs). Lines connect samples and OTUs to show connections among different individuals from the same and from different host species. Sewage samples from Spain, Brazil, Malawi, and the USA are indicated by distinct shades of green. Clear trends within host species are present, as well as OTUs that are shared among hosts or associated with an individual sample.

bilized by turbulent water flow in pipes. This phenomenon has been observed in both sewer and drinking water systems: biofilm communities release very few organisms, while loose sediments contribute the bulk of organisms to flowing water [25,27]. The idea of niche growth in pipe infrastructure is further supported by observations of ecological shifts in populations. Recent work has demonstrated a shift in the distribution of non-fecal organisms in response to geography and season that appears to be driven by temperature differences. In one study of sewage across the USA, fecal communities were largely stable in a given city from season to season, however, the non-fecal organisms changed significantly [37]. A longterm study of sewage from two WWTPs in Milwaukee, WI, USA, showed seasonal variation in two Acinetobacter V6 sequences—sequence was more abundant in summer and fall, while sequence increased in abundance during winter and spring. These two sequences corresponded to different clades of Acinetobacter, confirming that they are different organisms that appear to have different growth optima [60]. Similarly, Arcobacter sequences, which were abundant in sewage from multiple cities in the USA and Reus, Spain, demonstrated


URBAN WATERS

145

Int Microbiol

Int. Microbiol. Vol. 18, 2015

Fig. 3. Dominant bacterial taxa found in (A) stormwater (n = 30) and (B) untreated sewage influent (n = 6). Several abundant taxa were shared between the two environments and were mainly of non-fecal origin. Both communities were very diverse, with a total of 1709 and 1491 designated taxa in stormwater and untreated sewage, respectively. (Figure adapted from Fisher et al. [15].)

temperature dynamics, where two distinct strains of A. cryaerophilus, showed reciprocal abundance trends at temperatures above or below 20째C. Cities with a moderate, consistent climate showed little seasonal variation in the distribution of Arcobacter sequences, while cities that experience more extreme temperature variation showed markedly different communities [14]. The ecology of these very closely related organisms (i.e. populations within a genus) appears to be tied to fine scale factors such as temperature, while the pipe environment itself is the larger driver for selection of these genera as a whole. It is interesting but not fully understood how such similar organisms (at the genus or species level) maintain these highly

abundant and ubiquitous populations but have variants that are driven by the same factors that are often major determinants of assemblages in natural environments. One primary concern is how these organisms may survive and function outside of the pipe environment, as these organisms become part of the natural environment along with the other organisms conveyed during storm runoff and sewage overflows. With the exception of Trichococcus, the pipe-associated genera all contain species with some degree of pathogenicity to humans. In the previous Arcobacter example, the two strains of A. cryaerophilus represent a known clinical strain and an environmental strain [14]; thus the relative human health risk associated with a sewage release may be greater when a


146

Int. Microbiol. Vol. 18, 2015

pathogenic species is in higher abundance. Depending on the particular strains of the genera present, the pipe environment may represent a new source of pathogens that contribute to waterborne illness.

Urban signature in surface water com­ munities Organisms from the urban microbiome are consistently transported to natural waters via sewer systems and urban runoff. Stormwater runoff and sanitary sewage (untreated waste in overflows and treated wastewater effluent) are two major sources of urban-associated bacteria to environmental waters. Little crossover exists between bacteria in natural aquatic communities and those in urban effluent; therefore, the imprint of the urban signature can be seen in contaminated waterways. This signature includes both fecal and infrastructureassociated organisms, and their presence increases in magnitude proportionally with storm intensity and duration. Shortterm observations reveal a small but persistent community of urban organisms present in chronically impacted aquatic resources, but the long-term consequences in terms of fate and function of the community are unknown. Evidence of urban impacts on the natural microbial community composition can be observed by both imprints of organisms constituting an urban infrastructure signal [15,48], or a human and animal fecal signal [21,42–45], or by changes in the composition [26,46] and/or functional output [47,48] of naturally occurring aquatic microbes. Annual fluxes of urban microbes from runoff, stormwater, and CSO/SSO depend on the number and intensity of storm events. In heavily urbanized cities with high impervious surface cover, rainfall with intensity of 10 mm h–1 produces >2.2 × 105 m3 day–1 of runoff for every 1 km2, and can deliver trillions of bacteria to surface waters. Stormwater alone is the cause of 32% of impaired

MCLELLAN ET AL.

estuaries in the USA [58], and CSOs introduce >107 m3 of combined sewage and stormwater in both North America and Europe every year [16]. Table 1 highlights bacterial taxa commonly associated with urban sources. Wastewater effluent is often discharged to surface waters surrounding urban areas and this effluent is not free from microbes, particularly effluent from treatment plants that do not disinfect their treated product [31,59]. The effluent community depends on the treatment processes used [2,28,68], but effluent flows are a constant source of microbes to natural waterways. The effects of WWTP effluent on aquatic communities have focused mainly on impacts to benthic communities in rivers or the analysis of indicator organisms [6,9,17,31,63,64]. Changes in surface water communities include increased densities of fecal coliforms, heterotrophic bacteria, and an altered species composition within the genus Acinetobacter [17]. An increased prevalence of culturable Arcobacter was observed at all urbanized sites downstream of a clean water reference cite in Catalonia, and both influent and treated wastewater effluent yielded isolates [6]. Our understanding of the alterations to natural aquatic microbial communities from the perspective of both acute environmental scenarios, such as following rain and heavy urban discharge, and the long-term influence of constant urban microbial input remain relatively obscure. Most analyses indicate persistent or widespread contamination of surface waters with microbes originating from fecal pollution sources [65,62,38], but fecal-derived organisms are typically a small portion (<20%) of the flow of microbes from pipes and urban run-off [37,47]. Two comprehensive analyses of urbanderived bacterial assemblages present in an urban estuary of Lake Michigan suggest these organisms make-up 1–10% of the bacterial community present, and this proportion is influenced heavily by recent rain intensity [15,36]. Therefore, by sheer mass effects, the flux of organisms coming from urban environments could have significant impacts on the micro-

Table 1. Bacterial taxa associated with urban sources Source

Dominant urban-associated organisms

Citation

Treated effluent

Vibrio, Mycobacterium, Serratia, TM7, Clostridium XI, Arcobacter, Rhodobacter, Pseudomonas, Legionella, Acinetobacter, Aeromonas, Dechloromonas, Thiothrix, Zooglea

[2,68, Unpublished data]

Stormwater

Oxalobacteraceae, Acinetobacter, Pseudomonas, Aeromonas, Tolumonas, Enterobacteriaceae, Pantoea

[13,15,36]

Combined sewer overflow

Pseudomonas, Enterobacteriaceae, Acinetobacter, Arcobacter, Trichococcus, Bacteroidaceae, Lachnospiraceae, Porphyromonadaceae, Clostridiaceae, Ruminococcaceae

[36]


URBAN WATERS

bial communities naturally present. Urban-derived microbes can compete for resources, and also could represent a large and supplemental food source for microbial predators, which could have implications for aquatic food webs and/or nutrient cycles. The urban water interface could also create new pathways for gene flow among microbial communities. Antibiotic resistant bacteria are selected for in human populations, and untreated sewage as well as treated sanitary effluent have a high occurrence of antibiotic resistant bacteria [5,30]. GoĂąi-Urriza et al. reported an increase in the number of antibiotic resistant Aeromonas and Enterobacteriaceae isolates downstream of WWTP effluent release in the Arga River (Spain), as well as increased instance of acquired resistance in the Aeromonas spp. (64). Similar results were observed for Acinetobacter spp. in the Huron River (MI, USA) with a higher prevalence of antibiotic resistance in isolates from downstream compared to upstream of the WWTP. Additionally, although the total abundance of Acinetobacter was reduced from influent to effluent, the percentage of isolates displaying multiple drug resistance increased significantly [69]. Chemicals, nutrients, and solid waste from urban areas can also alter the microbial community. For example, landscape changes and chemicals corresponded to microbial community changes in the Mississippi River, USA [51â&#x20AC;&#x201C;53]. Microplastics released from WWTPs, can act as both a growth substrate and as a vector for bacteria [31]. Notably, the organisms that tend to be enriched on the plastics are from the same families of organisms that are present in sewage as pipe-associated, namely Campylobacteraceae, Pseudomonadaceae, and Moraxellaceae [15,61]. Emerging contaminants have been noted for their effects on wastewater treatment plant sludge organisms [41,70], but their impact on natural aquatic communities has yet to be been determined.

Conclusions While stormwater and sanitary sewage infrastructure are clearly important for both the growth and transport of urban bacteria to urban waters, they are only two facets of the extensive urban water system, which in turn is only a part of the larger urban microbiome. King [70] discussed the idea of distinct urban microbiomes associated with the atmosphere, internal and external building surfaces, impervious surfaces such as roads and sidewalks, and vegetation, in addition to water distribution systems, waste treatment, and mobile organisms (humans and animals), that also interact with one

Int. Microbiol. Vol. 18, 2015

147

another. Just as humans are constantly shedding their bacteria onto surfaces as they move around, the urban environment as a whole is shedding its bacteria via water conveyance systems that collect and disperse these microorganisms â&#x20AC;&#x201C; with surface waters being the primary recipient. Urban water conveyance systems have a great potential to tell us about the microorganisms associated with cities, about health characteristics of human populations, and if or how these organisms influence the human interface with the natural environment. The microbial communities of urban surface waters (e.g., rivers, lakes, estuaries) also could provide significant insight into the degree of human impacts on these freshwater systems and provide clues as to the short and long term ecosystem alteration caused by human activity. The magnitude of stormwater and sanitary sewage fluxes make these systems important to study, but understanding the longterm fate of organisms derived from this infrastructure must be pursued. We are currently in a new area of exploration in which next generation sequencing can provide a wealth of information on the microorganisms inhabiting any environment of the world around us. Continued monitoring of urban aquatic microbiomes has the potential to benefit both human and ecological health and must be prioritized. Acknowledgements. We would like to thank our colleague Maria Josefa Figueras Salvat (University Rovira Virgili, Reus, Spain) for insightful discussion on infrastructure niche organisms and our colleague Mitchell Sogin (Marine Biological Laboratory, Woods Hole, MA, USA), who has worked with us over the years to gain invaluable insight into urban microbial communities using next generation sequencing. Competing interests. None declared.

References 1. Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, Fernandes GR, Tap J, et al., (2011) Enterotypes of the human gut microbiome. Nature 473:174-180 2. Cai L, Ju F, Zhang T (2014) Tracking human sewage microbiome in a municipal wastewater treatment plant. Appl Microbiol Biot 98:33173326 3. Cao Y, Van De Werfhorst LC, Sercu B, Murray JL, Holden PA (2011) Application of an integrated community analysis approach for microbial source tracking in a coastal creek. Environ Sci Technol 45:7195-7201 4. Cao Y, Van De Werfhorst LC, Dubinsky EA, Badgley BD, Sadowsky MJ, Andersen GL, Griffith JF, Holden PA (2013) Evaluation of molecular community analysis methods for discerning fecal sources and human waste. Water Res 47:6862-6872 5. Caplin JL, Hanlon GW, Taylor HD (2008) Presence of vancomycin and ampicillin-resistant Enterococcus faecium of epidemic clonal complex-17 in wastewaters from the south coast of England. Environ Microbiol 10:885-892


148

Int. Microbiol. Vol. 18, 2015

6. Collado L, Kasimir G, Pérez U, Bosch A, Pinto R, Saucedo G, Huguet JM, Figueras MJ (2010) Occurrence and diversity of Arcobacter spp. along the Llobregat River catchment, at sewage effluents and in a drinking water treatment plant. Water Res 44:3696-3702 7. De Filippo C, Cavalieri D, Di Paola M, Ramazzotti M, Poullet JB, Massart S, Collini S, Pieraccini G, Lionetti P (2010) Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc Natl Acad Sci USA 107:14691-14696 8. Doubek J, Carey C, Cardinale B (2015) Anthropogenic land use is associated with N-fixing cyanobacterial dominance in lakes across the continental United States. Aquat Sci 77:681-694 9. Drury B, Rosi-Marshall E, Kelly JJ (2013) Wastewater treatment effluent reduces the abundance and diversity of benthic bacterial communities in urban and suburban rivers. Appl Environ Microbiol 79:1897-1905 10. Dubinsky EA, Esmaili L, Hulls JR, Cao Y, Griffith JF, Andersen GL (2012) Application of phylogenetic microarray analysis to discriminate sources of fecal pollution. Environ Sci Technol 46:4340-4347 11. Eren AM, Sogin ML, Morrison HG, Vineis JH, Fisher JC, Newton RJ, McLellan SL (2015) A single genus in the gut microbiome reflects host preference and specificity. ISME J 9:90-100 12. Field KG, Samadpour M (2007) Fecal source tracking, the indicator paradigm, and managing water quality. Water Res 41:3517-3538 13. Fisher JC, Eren AM, Green HC, Shanks OC, Morrison HG, Vineis JH, Sogin ML, McLellan SL (2015) Comparison of sewage and animal fecal microbiomes using oligotyping reveals potential human fecal indicators in multiple taxonomic groups. Appl Environ Microbiol 81:7023-7033 14. Fisher JC, Levican A, Figueras MJ, McLellan SL (2014) Population dynamics and ecology of Arcobacter in sewage. Front Microbiol 5:525 15. Fisher J, Newton RJ, Dila DK, McLellan SL (2015) Urban microbial ecology of a freshwater estuary of Lake Michigan. Elem Sci Anth 3:000064 16. Gasperi J, Garnaud S, Rocher V, Moilleron R (2008) Priority pollutants in wastewater and combined sewer overflow. Sci Total Environ 407:263-272 17. Goñi-Urriza M, Capdepuy M, Raymond N, Quentin C, Caumette P (1999) Impact of an urban effluent on the bacterial community structure in the Arga River (Spain), with special reference to culturable Gramnegative rods. Can J Microbiol 45:826-832 18. Goñi-Urriza M, Capdepuy M, Arpin C, Raymond N, Caumette P, Quentin C (2000) Impact of an urban effluent on antibiotic resistance of riverine Enterobacteriaceae and Aeromonas spp. Appl Environ Microbiol 66:125-132 19. Harwood VJ, Staley C, Badgley BD, Borges K, Korajkic A (2014) Microbial source tracking markers for detection of fecal contamination in environmental waters: relationships between pathogens and human health outcomes. FEMS Microbiol Rev 38:1-40 20. Huttenhower C, Gevers D, Knight R, Abubucker S, Badger JH, Chinwalla AT, Creasy HH, Earl AM, et al., (2012) Structure, function and diversity of the healthy human microbiome. Nature 486:207-214 21. Keely SP, Brinkman NE, Zimmerman BD, Wendell D, Ekeren KM, De Long SK, Sharvelle S, Garland JL (2015) Characterization of the relative importance of human- and infrastructure-associated bacteria in grey water: a case study. J Appl Microbiol 119:289-301 22. King GM (2014) Urban microbiomes and urban ecology: how do microbes in the built environment affect human sustainability in cities? J Microbiol 52:721-728 23. Koskey AM, Fisher JC, Eren AM, Ponce-Terashima R, Reis MG, Blanton RE, McLellan SL (2014) Blautia and Prevotella sequences distinguish human and animal fecal pollution in Brazil surface waters. Environ Microbiol Rep 6:696-704

MCLELLAN ET AL.

24. Leclerc H, Schwartzbrod L, Dei-Cas E (2002) Microbial agents associated with waterborne diseases. Crit Rev Microbiol 28:371-409 25. Leung HD, Chen G, Sharma K (2005) Effect of detached/re-suspended solids from sewer sediment on the sewage phase bacterial activity. Water Sci Technol 52:147-152 26. Ley RE, Hamady M, Lozupone C, Turnbaugh PJ, Ramey RR, Bircher JS, Schlegel ML, Tucker TA, Schrenzel MD, Knight R, Gordon JI (2008) Evolution of mammals and their gut microbes. Science 320:1647-1651 27. Liu G, Bakker GL, Li S, Vreeburg JH, Verberk JQ, Medema GJ, Liu WT, Van Dijk JC (2014) Pyrosequencing reveals bacterial communities in unchlorinated drinking water distribution system: an integral study of bulk water, suspended solids, loose deposits, and pipe wall biofilm. Environ Sci Technol 48:5467-5476 28. Liu XC, Zhang Y, Yang M, Wang ZY, Lv WZ (2007) Analysis of bacterial community structures in two sewage treatment plants with different sludge properties and treatment performance by nested PCR-DGGE method. J Environ Sci (China) 19:60-66 29. Lozupone CA, Stombaugh JI, Gordon JI, Jansson JK, Knight R (2012) Diversity, stability and resilience of the human gut microbiota. Nature 489:220-230 30. Mao D, Yu S, Rysz M, Luo Y, Yang F, Li F, Hou J, Mu Q, Alvarez PJ (2015) Prevalence and proliferation of antibiotic resistance genes in two municipal wastewater treatment plants. Water Res 85:458-466 21. McCormick A, Hoellein TJ, Mason SA, Schluep J, Kelly JJ (2014) Microplastic is an abundant and distinct microbial habitat in an urban river. Environ Sci Technol 48:11863-11871 32. McLellan SL, Eren AM (2014) Discovering new indicators of fecal pollution. Trends Microbiol 22:697-706 33. McLellan SL, Huse SM, Mueller-Spitz SR, Andreishcheva EN, Sogin ML (2010) Diversity and population structure of sewage-derived microorganisms in wastewater treatment plant influent. Environ Microbiol 12:378-392 34. McLellan SL, Newton RJ, Vandewalle JL, Shanks OC, Huse SM, Eren AM, Sogin ML (2013) Sewage reflects the distribution of human faecal Lachnospiraceae. Environ Microbiol 15:2213-2227 35. Montserrat A, Bosch L, Kiser MA, Poch M, Corominas L (2015) Using data from monitoring combined sewer overflows to assess, improve, and maintain combined sewer systems. Sci Total Environ 505:1053-1061 36. Newton RJ, Bootsma MJ, Morrison HG, Sogin ML, McLellan SL (2013) A microbial signature approach to identify fecal pollution in the waters off an urbanized coast of Lake Michigan. Microb Ecol 65:1011-1023 37. Newton RJ, McLellan SL, Dila DK, Vineis JH, Morrison HG, Eren AM, Sogin ML (2015) Sewage reflects the microbiomes of human populations. mBio 6:e02574 38. Newton RJ, Vandewalle JL, Borchardt MA, Gorelick MH, McLellan SL (2011) Lachnospiraceae and Bacteroidales alternative fecal indicators reveal chronic human sewage contamination in an urban harbor. Appl Environ Microbiol 77:6972-6981 39. Nogales B, Lanfranconi MP, Pina-Villalonga JM, Bosch R (2011) Anthropogenic perturbations in marine microbial communities. FEMS Microbiol Rev 35:275-298 40. Okabe S, Odagiri M, Ito T, Satoh H (2007) Succession of sulfur-oxidizing bacteria in the microbial community on corroding concrete in sewer systems. Appl Env Microbiol 73:971-980 41. Ortiz de García SA, Pinto Pinto G, García-Encina PA, Irusta-Mata R (2014) Ecotoxicity and environmental risk assessment of pharmaceuticals and personal care products in aquatic environments and wastewater treatment plants. Ecotoxicology 23:1517-1533 42. Patz JA, Vavrus SJ, Uejio CK, McLellan SL (2008) Climate change and waterborne disease risk in the Great Lakes region of the U.S. Am J Prev Med 35:451-458


URBAN WATERS

43. Reischer GH, Ebdon JE, Bauer JM, et al. (2013) Performance characteristics of qPCR assays targeting human- and ruminant-associated bacteroidetes for microbial source tracking across sixteen countries on six continents. Environ Sci Technol 47:8548-8556 44. Satoh H, Odagiri M, Ito T, Okabe S (2009) Microbial community structures and in situ sulfate-reducing and sulfur-oxidizing activities in biofilms developed on mortar specimens in a corroded sewer system. Water Res 43:4729-4739 45. Sauer EP, VandeWalle JL, Bootsma MJ, McLellan SL (2011) Detection of the human specific Bacteroides genetic marker provides evidence of widespread sewage contamination of stormwater in the urban environment. Water Res 45:4081-4091 46. Sercu B, Van De Werfhorst LC, Murray J, Holden PA (2009) Storm drains are sources of human fecal pollution during dry weather in three urban southern California watersheds. Environ Sci Technol 43:293-298 47. Shanks OC, Newton RJ, Kelty CA, Huse SM, Sogin ML, McLellan SL (2013) Comparison of the microbial community structures of untreated wastewaters from different geographic locales. Appl Environ Microbiol 79:2906-2913 48. Shiode N, Shiode S, Rod-Thatcher E, Rana S, Vinten-Johansen P (2015) The mortality rates and the space-time patterns of John Snow’s cholera epidemic map. Int J Health Geogr 14:21 49. Song SJ, Lauber C, Costello EK, et al. (2013) Cohabiting family members share microbiota with one another and with their dogs. eLife 2:e00458 50. Staley C, Gould TJ, Wang P, Phillips J, Cotner JB, Sadowsky MJ (2014) Core functional traits of bacterial communities in the Upper Mississippi River show limited variation in response to land cover. Front Microbiol 5:414 51. Staley C, Gould TJ, Wang P, Phillips J, Cotner JB, Sadowsky MJ (2014) Bacterial community structure is indicative of chemical inputs in the Upper Mississippi River. Front Microbiol 5:524 52. Staley C, Sadowsky MJ (2015) Application of metagenomics to assess microbial communities in water and other environmental matrices. J Mar Biol Asso UK FirstView:1-9 53. Staley C, Unno T, Gould TJ, Jarvis B, Phillips J, Cotner JB, Sadowsky MJ (2013) Application of Illumina next-generation sequencing to characterize the bacterial community of the Upper Mississippi River. J Appl Microbiol 115:1147-1158 54. Thomas GB, Crawford D (2011) London Tideway Tunnels: tackling London’s Victorian legacy of combined sewer overflows. Water Sci Technol 63:80-87 55. Turnbaugh PJ, Hamady M, Yatsunenko T, Cantarel BL, Duncan A, Ley RE, Sogin ML, Jones WJ, Roe BA, Affourtit JP, Egholm M, Henrissat B, Heath AC, Knight R, Gordon JI (2009) A core gut microbiome in obese and lean twins. Nature 457:480-484 56. Unno T, Jang J, Han D, Kim JH, Sadowsky MJ, Kim OS, Chun J, Hur HG (2010) Use of barcoded pyrosequencing and shared OTUs to determine sources of fecal bacteria in watersheds. Env Sci Technol 44:7777-7782

Int. Microbiol. Vol. 18, 2015

149

57. USEPA (2004) Report to Congress: Impacts and Control of CSOs and SSOs. EPA 833-R-04-001 58. USEPA (2004) The National Water Quality Inventory: Report to Congress, Reporting Cycle. EPA-841-R-08-00 59. USEPA (2007) Report to Congress: Combined Sewer Overflows to the Lake Michigan Basin.Env Prot Agency USA, Office of Water, Washington, DC 60. Vandewalle JL, Goetz GW, Huse SM, Morrison HG, Sogin ML, Hoffmann RG, Yan K, McLellan SL (2012). Acinetobacter, Aeromonas and Trichococcus populations dominate the microbial community within urban sewer infrastructure. Environ Microbiol 14:2538-2552 61. VandeWalle JL, Goetz GW, Huse SM, Morrison HG, Sogin ML, Hoffmann RG, Yan K, McLellan SL (2012) Acinetobacter, Aeromonas and Trichococcus populations dominate the microbial community within urban sewer infrastructure. Environ Microbiol 14:2538-2552 62. Verhougstraete MP, Martin SL, Kendall AD, Hyndman DW, Rose JB (2015) Linking fecal bacteria in rivers to landscape, geochemical, and hydrologic factors and sources at the basin scale. Proc Natl Acad Sci USA 112:10419-10424 63. Wakelin SA, Colloff MJ, Kookana RS (2008) Effect of wastewater treatment plant effluent on microbial function and community structure in the sediment of a freshwater stream with variable seasonal flow. Appl Environ Microbiol 74:2659-2668 64. Wéry N, Monteil C, Pourcher AM, Godon JJ (2010) Human-specific fecal bacteria in wastewater treatment plant effluents. Water Res 44:18731883 65. Wu CH, Sercu B, Van de Werfhorst LC, Wong J, DeSantis TZ, Brodie EL, Hazen TC, Holden PA, Andersen GL (2010) Characterization of coastal urban watershed bacterial communities leads to alternative community-based indicators. PLoS One 5:e11285 66. Wu GD, Chen J, Hoffmann C, Bittinger K, Chen YY, Keilbaugh SA, Bewtra M, Knights D, Walters WA, Knight R, Sinha R, Gilroy E, Gupta K, Baldassano R, Nessel L, Li H, Bushman FD, Lewis JD (2011) Linking long-term dietary patterns with gut microbial enterotypes. Science 334:105-108 67. Yatsunenko T, Rey FE, Manary MJ, Trehan I, Domínguez-Bello MG, Contreras M, Magris M, Hidalgo G, et al., (2012) Human gut microbiome viewed across age and geography. Nature 486:222-227 68. Ye L, Zhang T (2013) Bacterial communities in different sections of a municipal wastewater treatment plant revealed by 16S rDNA 454 pyrosequencing. Appl Microbiol Biot 97:2681-2690 69. Zhang Y, Marrs CF, Simon C, Xi C (2009) Wastewater treatment contributes to selective increase of antibiotic resistance among Acinetobacter spp. Sci Total Environ 407:3702-3706 70. Zheng X, Huang H, Su Y, Wei Y, Chen Y (2015) Long-term effects of engineered nanoparticles on enzyme activity and functional bacteria in wastewater treatment plants. Water Sci Technol 72:99-105


RESEARCH REVIEW International Microbiology (2015) 18:151-157 doi:10.2436/20.1501.01.245. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

The 25th SEM Congress (Logroño, Spain, July 7-10, 2015) Microbes, cables, and an electrical touch Gemma Reguera Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI, USA Received 19 August 2015 · Accepted 9 September 2015 Summary. In nature, highly efficient and diverse consortia of microbes cycle carbon and other elements while generating energy for growth. Driving these reactions are organisms with the ability to extract electrons from the chemical substrates and transfer them to insoluble and soluble electron acceptors. One bacterial group in particular, Geobacter spp., can couple their respiratory metabolism to the reduction of insoluble minerals, such as iron and manganese oxides, and soluble toxic metals such as uranium. Key to these activities is the ability of the cells to transfer respiratory electrons extracellularly using an electroactive cell envelope containing abundant metalloproteins, including c-cytochromes, and conductive protein appendages or pili (known as nanowires). Thus, in addition to been ecological drivers of the cycling of carbon and metals in nature, these organisms show promise for the bioremediation of environments impacted with toxic metals. The electrical activity of Geobacter can also be mimicked in electrochemical reactors equipped with an electrode poised at a metabolically oxidizing potential, so that the electrode functions as an unlimited sink of electrons to drive the oxidation of electron donors and support cell growth. Electrochemical reactors are promising for the treatments of agricultural, industrial, and human wastes, and the electroactivity of these microbes can be used to develop materials and devices for bioenergy and bioremediation applications. [Int Microbiol 18(3):151-157 (2015)] Keywords: Geobacter · c-cytochromes · electrochemical reactors · microbial fuel cells · nanowires · type IV pili

Introduction At the most fundamental level, energy transduction in biological systems relies on the transfer of electrons from a donor to an acceptor, in reactions that generate energy for cell growth through processes such as respiration, photosynthesis and fermentation. Microbes are particularly creative at energy * Correspondence: Department of Microbiology and Molecular Genetics Michigan State University East Lansing, MI, USA

E-mail: reguera@msu.edu

generation, having diversified their metabolism in ways so varied that impact the cycling of many elements in nature. The fluxes of the six elements that make up the major building blocks of biological macromolecules—H, C, N, O, S, and P— are, for example, driven mostly by redox reactions catalyzed by microbes [9]. Diverse consortia of microorganisms efficiently cycle these elements by extracting electrons from the chemical substrates and harnessing energy to support their growth and activities. Some microbes have also evolved mechanisms to transfer electrons to extracellular electron acceptors such as insoluble and soluble metals, thus contributing to their cycling as well [12]. Metals are ubiquitous and abundant,

This review was a contribution to the Symposium SPM-SEM, Interaction, communication and symbiosis in microbial ecosystems, held on July 8, 2015, at the 25th SEM Congress, under the presidency of M. Elena González Fandos.


152

Int. Microbiol. Vol. 18, 2015

accounting for two thirds of the elements in planet Earth. Thus, metal transformations mediated by microorganisms impact environmental processes at a global scale. Two of the best-studied metal cyclers are Geobacter and Shewanella bacteria, particularly the strains Geobacter sulfurreducens PCA [2] and Shewanella oneidensis MR-1 [24]. The physiological hallmark of these two bacteria is their ability to couple their metabolisms to the reduction of insoluble minerals such as iron (Fe[III]) and manganese (Mn[IV]) oxides [40]. Key to this ability is the presence of numerous metalloproteins, mainly c-cytochromes, in their cell envelope, which are organized across the periplasm and outer membrane to efficiently transport respiratory electrons from the menaquinone pool in the inner membrane to extracellular electron acceptors [41]. In Shewanella, redox-active flavin compounds are secreted that shuttle electrons between the cell and the insoluble substrates, contributing as much as 75% to the reduction of iron and manganese minerals under laboratory conditions [19] By contrast, Geobacter bacteria do not secrete redox mediators and must establish electronic contact with the extracellular electron acceptor during respiration [25]. Shewanella and Geobacter bacteria have also evolved mechanisms for long-range electron transfer. S. oneidensis produces filamentous extensions of its outer membrane and periplasm [27], which organize their c-cytochrome complexes as a microbial redox chain that transports charges at rates [7] and with mobilities consistent with charges hopping between the redox-active sites in the chain [28]. Geobacter sulfurreducens, on the other hand, have evolved a conductive version of the type IV pili [29]. Other bacterial pili play roles in surface attachment and twitching motility [1]. However, in Geobacter, the pili are required to transfer electrons to insoluble electron acceptors such as iron oxides [29]. As illustrated in Fig. 1, the pili of G. sulfurreducens extend the redox active surface of the cell beyond the confines of its outer membrane, accessing Fe(III) oxide particles at a distance from the cell and promoting long-range electron transfer. This reduces the Fe(III) oxide minerals, solubilizing some of the iron as Fe(II) and generating a magnetic mineral of mixed iron valence, magnetite. The Geobacter pili also bind the soluble uranyl cation (U[VI]) and reductively precipitate it to a mononuclear phase of U(IV) outside the cell [3]. Not only are the pili the primary uranium reductase in this bacterium [30], the pili act as a protective shield that prevents the permeation and mineralization of the toxic metal in the cell envelope [3]. In addition, the pili are required to build electroactive biofilms on electrodes poised at an oxidizable potential [31] and on iron-oxide coatings [32]. Here I discuss

REGUERA

recent work providing novel insights into the mechanism(s) that may allow G. sulfurreducens to use the pilus protein filament as a nanowire between the cell and electron acceptors and the ecological and biotechnological implications of these findings.

The electric touch of Geobacter pili Like other type IV pili, the conductive pili of G. sulfurreducens are an assembly of a single structural subunit, the pilin or PilA peptide [3]. Like other pilins, it is synthesized as a precursor with a signal peptide carrying the distinctive features of type IVa pilins, which are needed for recognition and cleavage by a dedicated type IV pilin peptidase or PilD in the inner membrane [38]. Upon cleavage, the processed pilin peptide is N-methylated in its first residue, a phenylalanine that participates in pilin assembly [6,26]. Despite conservation in signal peptide processing and assembly, the mature Geobacter pilins are shorter (61 amino acids long in G. sulfurreducens compared to an average length of ca. 150 amino acids in other bacterial pilins) [6]. Furthermore, phylogenetic analyses comparing the N-terminal regions of Geobacter and other bacterial type IVa pilins, places the Geobacter pilins in an independent line of descent [29]. Divergence is also found at the structural level [10]. The Geobacter pilin peptide retains for example the conserved amino-terminal (N-t) a-helix and amino acids required for assembly but has a short, randomcoiled segment at the carboxy-terminus (C-t) instead of the globular head with β-strands of other bacterial pilins [10]. The reduced pilinâ&#x20AC;&#x2122;s size, the absence of β-strands and the predominantly helical peptide all are structural features that promote electron transfer in peptides [13,20,42]. In addition, the Geobacter pilins contains aromatic residues (tyrosines and phenylalanines) and charged amino acids predicted to distribute the charges and density of states along the peptide to favor charge transport [10]. Hence, the structural and electronic characteristics of the Geobacter pilins are consistent with a peptide environment optimized for electron conduction. The prediction that the Geobacter pilin has evolved as a medium for charge transport [10] is in agreement with the conductivity measured on cell-associated and mechanically sheared pili filaments [22,29,47] and, more recently, the demonstration that the pilus protein fiber can transport charges like a nanowire at rates several orders of magnitude greater than the cellular rates of iron respiration [19bis]. However, the mechanism that could allow the pilus


MICROBIAL CABLES

153

Int Microbiol

Int. Microbiol. Vol. 18, 2015

Fig. 1. Extracellular electron transfer via conductive pili (top) allows Geobacter sulfurreducens to reduce Fe(III) oxides at a distance, solubilizing some of the iron as Fe(II) and producing a magnetite. The semiconducting properties of magnetite promote interspecies electron transfer between G. sulfurreducens and T. denitrificans (bottom), and electric syntrophy that couples acetate oxidation to nitrate reduction.

protein fiber to transport charges remains controversial. A metallic model was proposed to explain the metallic-like temperature-dependence of piliated, electrochemically active biofilms and crude preparations of pili and other proteins, including cytochromes, dried on gold electrodes [23]. In situ electrical conductivity measurements on living biofilms of G. sulfurreducens grown on an electrode later demonstrated the thermal dependence of incoherent redox conductivity [50] Evidence is also emerging for a thermal activation of charge transport across the pili, which is consistent with an incoherent mechanism for pilus conductance [19bis]. Additionally, the metallic model of pilus conductance invokes that the aromatic rings from phenylalanine and tyrosine residues of the pilins dimerize close to each other (~3.5 Å) and in π-π configurations [23]. Structural information provided in an atomic resolution model of the pilus fiber optimized in molecular dynamics simulations [11] confirmed the clustering as a right-handed helix and identified paths for transversal and axial charge transport (Fig. 2). Yet the geometries of aromatic dimers in the pilin assembly were always of the paralleldisplaced or T-shaped type, rather than the sandwich type

required for metallic conductance. The molecular dynamics simulations also revealed inter-aromatic distances from 3.5 to 8.5 Å [11], which are optimal for multistep hopping reactions [5,39]. Some of the aromatic side chains in the paths were brought closer together (less than 5 Å) during the simulations, forming aromatic contacts that are required for optimal charge transport in vivo [11]. Yet the aromatic contacts never formed at the same time, as in a metal wire. The local electrostatic environment around the aromatic contacts also influenced their geometric configuration and clustering of the aromatic residues and, in turn, the rates of electron transfer to Fe(III) oxides [11]. Positively charged amino acids were, for example, buried in the pilus fiber core, whereas the negatively charged residues were predominantly exposed on the pilus surface, thus promoting the binding of cationic ligands in the insoluble Fe(III) oxides and the soluble uranyl cation. Interestingly, these exposed carboxyl ligands are close to the most exposed aromatic residue of the pilus, a tyrosine predicted to catalyze the last step in electron transfer to extracellular electron acceptors [11]. In support of this, the carboxylic groups exposed on the pilus surface provide


154

Int. Microbiol. Vol. 18, 2015

an atomic environment similar to the atomic coordination of pili-bound uranium modeled from uranium LIII-edge extended X-ray absorption spectroscopy spectra [3]. These proximity of the carboxylic ligands to the tyrosine could also permit their transient protonation and proton-coupled electron transfer between the tyrosine and the bound electron acceptor. Such proton-coupled mechanism of electron transfer reduces the oxidation potential of aromatic residues to enable fast rates of electron transfer [46].

Nanowires and the birth of electromi­ crobiology The discovery of conductive pili in G. sulfurreducens and their role in iron reduction [29] followed by the finding of conductive filamentous structures in S. oneidensis [15] changed our understanding of how microbes respire and lead fellow microbiologist, Yuri Gorby, to forecast that we were standing “at the edge of a new scientific frontier”: a new field that he coined with the name “electromicrobiology” [16]. His words were indeed prophetic, as evidenced by the many reports published in the last decade demonstrating the creative ways used by microbes to transport charges at micrometer and even centimeter distances to couple spatially separated redox reactions. It is worth mentioning a few, as they relate to Geobacter and their nanowires. Iron oxides are some of the most abundant electron acceptors in soil and sedimentary environments. Their microbial reduction by Geobacter bacteria under anaerobic conditions mobilizes the iron as the soluble Fe[II] species (Fig. 1), which can then diffuse to the anoxic/oxic interface and be assimilated as a nutrient or reoxidized by other microbes [8]. The soluble Fe(II) species also influences the transformation of other metals [12]. Thus, dissimilatory iron reducers such as Geobacter bacteria, which gain energy for growth by coupling the oxidation of organic matter to the reduction of iron oxide, are key drivers of organic matter decomposition in anaerobic environments and influence the cycling of many other elements, directly or indirectly. One way Geobacter species influence the cycling of other elements is through the establishment of syntrophic associations with other microorganisms [18]. Geobacter sulfurreducens can, for example, couple the oxidation of acetate to the reduction of iron oxides but cannot reduce nitrate, a soluble electron acceptor with a more positive reduction potential [2]. However, the reduction of iron oxides by G. sulfurreducens generates magnetite, a semiconductor

REGUERA

mineral that permits electron flow to the syntrophic partner Thiobacillus denitrificans, which reduces nitrate [17]. Figure 2 illustrates the interactions that establish this electric syntrophy, where electrons rather than metabolites are transferred between species. This allows G. sulfurreducens to continue to oxidize acetate, and grow after the iron oxides have been reduced, using an electron acceptor, nitrate, that it cannot respire on its own. Geobacter pili are also the primary uranium reductase of the cell, binding the uranyl cation and reducing the soluble U(VI) species to the sparingly soluble U(IV) form [3,30]. The uranium reductase activity of the pili is further enhanced in biofilms [4], which provide a physical and chemical protective environment for the sustained immobilization and reduction of uranium. Not only have the biofilms enhanced capacity to immobilize and reduce uranium compared to planktonic cells, they also tolerate exposure to higher concentrations of the contaminant for prolonged periods of time [4]. Evidence indicates that the uranium is reduced extracellularly and mainly in the top biofilm stratum, in a catalytic process influenced by the biofilm structure and the presence of redox components of the electroactive biofilm matrix, most significantly the conductive pili. Thus, Geobacter biofilms contribute to the immobilization and reduction of uranium. This radionuclide is often found in complex mixtures with toxic inorganic and organic co-contaminants [37], which can compromise the viability of planktonic cells. However, the reduced susceptibility of the biofilms to the radionuclide makes them particularly suitable for uranium bioremediation applications. Furthermore, as uranium was reductively precipitated on the biofilm surface, the immobilization of the contaminant did not depend on the biofilm biomass and thickness, only on the substrate coverage. This is advantageous for the application of biofilm-based approaches for the in situ bioremediation of uranium, as there is no need to stimulate the growth of very thick biofilms to create effective biopermeable barriers.

From nature to industry The reductive activities of Geobacter cells via their pili ultimately depend on the availability of electron donors that the cells can oxidize in their respiratory metabolism. Not surprisingly, these microorganisms are adapted to growing within specialized, synergistic consortia that cooperate to degrade and ferment organic matter to carbon dioxide, thus returning the carbon fixed via photosynthesis back to the atmosphere [21]. The fermentation products are rapidly


Int. Microbiol. Vol. 18, 2015

155

Int Microbiol

MICROBIAL CABLES

Fig. 2. (A) Isodensity pilus map showing the clustering of aromatic residues (blue) as a right-handed helix. (B) Snapshot of an average pilus structure resulting from the molecular dynamics simulations showing the uniform distribution of aromatics (tyrosines, yellow; phenylalanines, green) and potential axial and transversal paths for multistep hopping.

removed by syntrophic partners to prevent feedback inhibition of biomass decomposition and fermentation [49]. Hence, microorganisms such as Geobacter bacteria, which use the abundant Fe(III) oxides as final electron sinks, play a key role in organic matter decomposition and the cycling of carbon. The syntrophic interactions that govern biomass decomposition in nature can be reproduced in the laboratory using electrodes poised at a metabolically oxidizing potential in devices known as microbial electrolysis cells (MECs). These devices are often two chambers containing the growth medium and separated by a proton permeable membrane. Each chamber is equipped with an electrode, which are wired to each other via a potentiostat to set up one of the electrodes (the anode) at an optimal potential for G. sulfurreducens. In this manner, the anode electrode provides an unlimited electron sink for the growth of an electrochemically active biofilm on the anode, a process that requires the expression of their conductive pili [31]. Acetate is often used as a carbon source and electron donor to grow and establish G. sulfurreducens anode biofilms [43]. However, the anode biofilms have been shown to have a broader range of electron donors in MECs than originally recognized, being able to oxidize organic acids such as formate, and lactate when provided in mixes with acetate [43]. The electrical input used to poise the anode electrode in MECs is also used to react the electrons with protons at the cathode,

simultaneously producing hydrogen fuel at much higher yields than those achieved fermentatively [14]. Furthermore, the applied potential removes cathodic limitations [35,36,48] and promotes the growth of exoelectrogenic biofilms on the anode electrode [31]. This maximizes the conversion of fermentation products to cathodic hydrogen while preventing the accumulation of feedback inhibitors of fermentation [43]. The ability of the anode biofilms to completely oxidize fermentation products to carbon dioxide with an electrode serving as the sole electron acceptor opens opportunities to use MECs for the conversion of complex substrates, such as organic wastes and renewable biomass, to electricity and/or biofuels in MECs. The efficient consolidated bioprocessing of corn stover to ethanol and cathodic hydrogen was demonstrated in a MEC driven by G. sulfurreducens [44]. Electron losses were minimized by selecting a consolidated bioprocessing strain, Cellulomonas uda, which hydrolyzed and fermented chemically-pretreated corn stover to ethanol and produced fermentation byproducts that served as electron donors for G. sulfurreducens. The synergistic interactions between the two partners promoted the removal and electrical conversion of all the fermentation byproducts and stimulated ethanol and cathodic hydrogen production, increasing the total energy recovery as ethanol and hydrogen fuel from corn stover to approximately 73%. A similar approach but using a strain of Clostridium cellobioparum adaptively evolved


156

Int. Microbiol. Vol. 18, 2015

for robust growth and fermentation of glycerol was used to develop a Geobacter-driven MEC for ethanol production from glycerin [45]. Thus, robust platforms can be developed for the treatment of and energy recoveries from agricultural and industrial wastes, reducing costs and carbon emissions associated with the treatment of wastes and biofuel production.

Microbial conversations with an elec­ trical touch? The discovery that microorganisms such as Geobacter bacteria can electrically wire their interactions demonstrates that cells can exchange electrical signals. In 2008, I raised the question “Are microbial conversations being lost in translation?” [33]. Physical modes of cell-cell communication were for long considered an esoteric subject, yet recent advances in electromicrobiology suggest that electronic communication may be widespread [34]. Cell growth reorientation (galva­ notropism), swimming patterns (galvanotaxis or electrotaxis) and the electrical reorientation of cells are well known phenomena. Voltage-activated ion channels are widespread in the three domains of life and could act as membrane receptors for electrical signals. Indeed, physical modes of communication may have played a significant role in the evolution of life on Earth and the metabolic diversification of microorganisms, because they require minimum energy investment in the form of energy released from natural cellular processes. Physical signals—not only electrical—also have other advantages when compared with chemical signals: they propagate faster and can bypass the requirement for a cognate receptor on the plasma membrane [34]. Thus, I would like to end this commentary raising a new question: Are we finally hearing microbial conversations that have for long been lost in translation? Stay tuned! More is surely yet to come. Competing interests. None declared.

References 1. Burrows LL (2012) Pseudomonas aeruginosa twitching motility: type IV pili in action. Annu Rev Microbiol 66:493-520 2. Caccavo F Jr, et al. (1994) Geobacter sulfurreducens sp. nov., a hydrogen- and acetate-oxidizing dissimilatory metal-reducing microorganism. Appl Environ Microbiol 60:3752-3759 3. Cologgi DL, et al. (2011) Extracellular reduction of uranium via Geobacter conductive pili as a protective cellular mechanism. Proc Natl Acad Sci USA 108:15248-15252 4. Cologgi DL, et al. (2011) Enhanced uranium immobilization and reduc-

REGUERA

tion by Geobacter sulfurreducens biofilms. Appl Environ Microbiol 80:6638-6646 5. Cordes M, et al. (2008) Influence of amino acid side chains on longdistance electron transfer in peptides: electron hopping via “stepping stones”. Angew Chem Int Ed Engl 47:3461-3463 6. Craig L, Pique ME, Tainer JA (2004) Type IV pilus structure and bacterial pathogenicity. Nat Rev Microbiol 2: 363-378 7. El-Naggar MY, et al. (2010) Electrical transport along bacterial nanowires from Shewanella oneidensis MR-1. Proc Natl Acad Sci USA 107:18127-18131 8. Emerson D, Roden E, Twining BS (2012) The microbial ferrous wheel: iron cycling in terrestrial, freshwater, and marine environments. Front Microbiol 3:383 9. Falkowski PG, Fenchel T, Delong EF (2008) The microbial engines that drive Earth’s biogeochemical cycles. Science 320:1034-1039 10. Feliciano GT, et al. (2012) The molecular and electronic structure of the peptide subunit of Geobacter sulfurreducens conductive pili from first principles. J Phys Chem A 116:8023-8030 11. Feliciano GT, Steidl RJ, Reguera G (2015) Structural and functional insights into the conductive pili of Geobacter sulfurreducens revealed in molecular dynamics simulations. Phys Chem Chem Phys 17:22217-22226 12. Gadd GM (2010) Metals, minerals and microbes: geomicrobiology and bioremediation. Microbiology 156:609-643 13. Galoppini E, Fox MA (1996) Effect of the electric field generated by the helix dipole on photoinduced intramolecular electron transfer in dichromophoric α-helical peptides. J Am Chem Soc 118:2299-2300 14. Geelhoed JS, Hamelers HV, Stams AJ (2010) Electricity-mediated biological hydrogen production. Curr Opin Microbiol 13: 307-315 15. Gorby YA, et al. (2006) Electrically conductive bacterial nanowires produced by Shewanella oneidensis strain MR-1 and other microorganisms. Proc Natl Acad Sci USA 103:11358-11363 16. Gorby Y (2009) Op-Ed: Microbes may be more networked than you are, in From the Fields Wired Science 17. Kato S, Hashimoto K,Watanabe K (2012) Microbial interspecies electron transfer via electric currents through conductive minerals. Proc Natl Acad Sci USA 109:10042-10046 18. Kouzuma A, Kato S, Watanabe K (2015) Microbial interspecies interactions: recent findings in syntrophic consortia. Front Microbiol 6:477 19. Kotloski NJ, Gralnick JA (2013) Flavin electron shuttles dominate extracellular electron transfer by Shewanella oneidensis. MBio 4(1) 19bis. Lampa-Pastirk S, Veazey JP, Walsh KA, Feliciano GT, Steidl RJ, Tessmer SH, Reguera G (2016) Thermally activated charge transport in microbial protein nanowires. Sci. Rep 6:23517. doi: 10.1038/srep23517 20. Long YT, Abu-Irhayem E, Kraatz HB (2005) Peptide electron transfer: more questions than answers. Chem Eur J 11:5186-5194 21. Lynd LR, et al. (2002) Microbial cellulose utilization: fundamentals and biotechnology. Microbiol Mol Biol Rev 66: 506-577 22. Malvankar NS, et al. (2014) Visualization of charge propagation along individual pili proteins using ambient electrostatic force microscopy. Nat Nanotechnol 9:1012-1017 23. Malvankar NS, et al. (2011) Tunable metallic-like conductivity in microbial nanowire networks. Nat Nanotechnol 9:573-579 24. Myers CR, Nealson KH (1988) Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor. Science 240:1319-1321 25. Nevin KP, Lovley DR (2000) Lack of production of electron-shuttling compounds or solubilization of Fe(III) during reduction of insoluble Fe(III) oxide by Geobacter metallireducens. Appl Environ Microbiol 66:2248-2251 26. Pelicic V (2008) Type IV pili: e pluribus unum? Mol Microbiol 68:827-837


MICROBIAL CABLES

27. Pirbadian S, et al. (2014) Shewanella oneidensis MR-1 nanowires are outer membrane and periplasmic extensions of the extracellular electron transport components. Proc Natl Acad Sci USA 111:12883-12888 28. Pirbadian S, El-Naggar MY (2012) Multistep hopping and extracellular charge transfer in microbial redox chains. Phys Chem Chem Phys 14:13802-13808 29. Reguera G, et al. (2005) Extracellular electron transfer via microbial nanowires. Nature 435:1098-1101 30. Reguera G (2012) Electron transfer at the cell-uranium interface in Geobacter spp. Biochem Soc Trans 40:1227-1232 31. Reguera G, et al. (2006) Biofilm and nanowire production lead to increased current in microbial fuel cells. Appl Environ Microbiol 72:7345-7348 32. Reguera G, et al. (2007) Possible nonconductive role of Geobacter sulfurreducens pilus nanowires in biofilm formation. J Bacteriol 189:2125-2127 33. Reguera G (2008) Are microbial conversations being lost in translation? Microbe 4:506-512 34. Reguera G (2011) When microbial conversations get physical. Trends Microbiol 19:105-113 35. Ren Z, et al. (2007) Characterization of the cellulolytic and hydrogenproducing activities of six mesophilic Clostridium species. J Appl Microbiol 103:2258-2266 36. Rezaei F, et al. (2009) Simultaneous cellulose degradation and electricity production by Enterobacter cloacae in a microbial fuel cell. Appl Environ Microbiol 75:3673-3678 37. Riley RG, Zachara JM, Wobber FJ (1992) Chemical contaminants on DOE lands and selection of contaminant mixtures for subsurface science research, S.S.P. Office of Energy Res US Dept of Energy. Washington, DC. 38. Richter LV, Sandler SJ, Weis RM (2012) Two isoforms of Geobacter sulfurreducens PilA have distinct roles in pilus biogenesis, cytochrome localization, extracellular electron transfer, and biofilm formation. J Bacteriol 194:2551-2563 39. Shih C, et al. (2008) Tryptophan-accelerated electron flow through proteins. Science 320:1760-1762

Int. Microbiol. Vol. 18, 2015

157

40. Shi L, et al. (2007) Respiration of metal (hydr)oxides by Shewanella and Geobacter: a key role for multihaem c-type cytochromes. Mol Microbiol 65:12-20 41. Shi LA, et al. (2009) The roles of outer membrane cytochromes of Shewanella and Geobacter in extracellular electron transfer. Environ Microbiol Reports 1:220-227 42. Shin Y-g. K, Newton MD, Isied SS (2003) Distance dependence of electron transfer across peptides with different secondary structures:â&#x20AC;&#x2030; The role of peptide energetics and electronic coupling. J Am Chem Soc 125: 3722-3732 43. Speers AM, Reguera G (2012) Electron donors supporting growth and electroactivity of Geobacter sulfurreducens anode biofilms. Appl Environ Microbiol 78:437-444 44. Speers AM, Reguera G (2012) Consolidated bioprocessing of AFEXpretreated corn stover to ethanol and hydrogen in a microbial electrolysis cell. Environ Sci Technol 46:7875-7881 45. Speers AM, Young JM, Reguera G (2014) Fermentation of glycerol into ethanol in a microbial electrolysis cell driven by a customized consortium. Environ Sci Technol 48:6350-6358 46. Stubbe J, et al. (2003) Radical initiation in the class I ribonucleotide reductase: long-range proton-coupled electron transfer? Chem Rev 103:2167 47. Veazey JP, Reguera G, Tessmer SH (2011) Electronic properties of conductive pili of the metal-reducing bacterium Geobacter sulfurreducens probed by scanning tunneling microscopy. Phys Rev E 84:060901 48. Wang X, et al. (2009) Bioaugmentation for electricity generation from corn stover biomass using microbial fuel cells. Environ Sci Technol 43:6088-6093 49. Wolin MJ (1982) Hydrogen transfer in microbial communities. In Bull AT, Slater JH (eds), Microbial interactions and communities. Academic Press, London 50. Yates MD, et al. (2015) Thermally activated long range electron transport in living biofilms. Phys Chem Chem Phys 17:32564-32570


RESEARCH REVIEW International Microbiology (2015) 18:159-169 doi:10.2436/20.1501.01.246. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

The 25th SEM Congress (Logroño, Spain, July 7–10, 2015) Functional symbiosis and communication in microbial ecosystems. The case of wood-eating termites and cockroaches Mercedes Berlanga Department of Microbiology and Parasitology, Faculty of Pharmacy, University of Barcelona, Barcelona, Spain Received 15 August 2015 · Accepted 10 September 2015 Summary. Animal hosts typically have strong specificity for microbial symbionts and their functions. The symbiotic relationships have enhanced the limited metabolic networks of most eukaryotes by contributing several prokaryotic metabolic capabilities, such as methanogenesis, chemolithoautotrophy, nitrogen assimilation, etc. This review will examine the characteristics that determine bacterial “fidelity” to certain groups of animals (e.g., xylophagous insects, such as termites and cockroaches) over generations and throughout evolution. The hindgut bacteria of wood-feeding termites and cockroaches belong to several phyla, including Proteobacteria, especially Deltaproteobacteria, Bacteroidetes, Firmicutes, Actinomycetes, Spirochetes, Verrucomicrobia, and Actinobacteria, as detected by 16S rRNA. Termites effectively feed on many types of lignocelluloses assisted by their gut microbial symbionts. Although the community structures differ between the hosts (termites and cockroaches), with changes in the relative abundances of particular bacterial taxa, the composition of the bacterial community could reflect at least in part the host evolution in that the microbiota may derive from the microbiota of a common ancestor. Therefore, factors other than host phylogeny, such as diet could have had strong influence in shaping the bacterial community structure. [Int Microbiol 18(3):159-169 (2015)] Keywords: holobiont · gut microbiota · ectosymbiosis · lower-termites · wood-eating cockroaches

Introduction Bacteria in nature usually form complex multispecies communities. Living organisms constantly interact with their habitats, selectively taking up compounds from their surround* Correspondence: Department of Microbiology and Parasitology Faculty of Pharmacy, University of Barcelona Av. Joan XXIII, s/n 08028 Barcelona, Spain Tel. +34-934024497. Fax +34-934024498 E-mail: mberlanga@ub.edu

ings to meet their particular needs but also excreting metabolic products and thus modifying their environment. It has been suggested that communication and cooperation, both within and among bacterial species, have produced emergent properties that give a selective advantage to such groups. Bacterial cells produce resources that benefit others in the same habitat. The recipients of such by-products will tend to lose their own costly pathways for those products, thus building dependency into the interactions. Such dependency can favor the spread of more obligate coevolved partnerships [58,59]. This paradigm suggests that bacteria might often form interdependent cooperative interactions in communities, and that

This review was a contribution to the Symposium SPM-SEM, Interaction, communication and symbiosis in microbial ecosystems, held on July 8, 2015, at the 25th SEM Congress, under the presidency of M. Elena González Fandos.


160

Int. Microbiol. Vol. 18, 2015

bacterial cooperation should leave a clear genomic signature via complementary loss of shared functions. Adaptive genome rearrangement is known to be common in parasites and symbionts, both of which can benefit from losing costly functions that are provided by their hosts [39]. Examples of the drastically reduced genomes of obligate intracellular bacteria (endosymbionts) from several insects include the 450 to 653-kb genome of Buchnera (aphids), the 697-kb genome of Wigglesworthia (tsetse flies), the 792-kb genome of Blochmannia (ants) and the 686-kb genome of Baumannia (sharpshooter leafhopper). These arthropod-associated mutualists form distinct but related lineages in the Gammaproteobacteria. Gene losses in endosymbionts affect loci that perform functions that are unnecessary in an intracellular environment, or that can be provided by the host, but maintain others related to amino acids, vitamins biosynthesis or cofactors essential to their host. The study of the complex relationship between host–microbe interactions and behavior requires an ecological perspective, involving several “stakeholders”: the host, the microbiota and the biotope, that in combination constitute the holobiont. Microbes are part of animal/plant systems, and they must be included in the animal/plant life histories. The holobiont is an essential life-changing force that has resulted in a complex coordinated coevolution of life forms [28,77] (Fig. 1). Interactions between the host and its microbiota are not only nutritional, but also include tissue development, immunity, circadian regulation, etc. [74]. Those interactions involve multiple microbial species and their genotypes, so that functions depend on bacterial communities rather than on individual microbial taxa. Lifestyles of bacterial symbionts can vary in four important ways, all of which contribute to the long-term evolution of symbiotic microbial lineages as well as to the co-evolution of the holobiont: (i) host- symbiont specificity, (ii) the mechanisms of symbiont acquisition, development and maintenance, (iii) the functional mechanisms that the symbiont employs to benefit or injur the host, and (iv) the host response to the presence of bacteria [71]. Ecological interactions among members of the microbial communities may have different net impacts on host fitness based on the actual environmental circumstances [41,74]. Of all aspects of the environment, nutrition is the most important in shaping the responses of the microbiota and their host (the “holobiont system”). In the case of the gut microbiota, the nutritional resources are dependent on host feeding behavior. The composition and physical form of the food change as it passes down the gastrointestinal tract, offering microbes at different locations a changing complement of nutrients. Finally, the host obtains multiple nutrients in appropriate quan-

BERLANGA

tities and balance to perform optimally [62]. Insect gut symbionts play an essential role in the insect adaptation to various food types, especially in herbivorous insects. Herbivory can be a successful feeding mode, but only after key obstacles are overcome, such as low nutrient content, and indigestibility or toxicity of many plant tissues. The herbivorous microbiota has been shown to be important for lignocellulosic material degradation, nutrient production (amino acids, vitamins, etc.), and compound detoxification [12,19]. Disrupting insect gut symbionts can significantly reduce the fitness of insects and can even cause serious diseases such as Colony Collapse Disease (CCD) [16]. This review examines the relationships between two xylophagous insects (lower-termites and cockroach), their gut microbiota and the characteristics that determine bacterial fidelity over generations and throughout evolution with their host. Termites from the perspective of the “holobiont” are considered as a single functional unit in which host and symbionts are physiologically tightly connected.

Insect gut as a microbial habitat The intestinal tracts of insects are small ecosystems comprising discrete and clearly delineated habitats that strongly differ in their abiotic and biotic environment. Many of those environmental features are intrinsic properties of the gut, whereas others result from physiological activities of the host or the microbial residents in the particular location. The basic structure of the digestive tract is similar across insects; it has three primary regions, foregut, midgut, and hindgut [23] (Fig. 2). The foregut transports food from the mouthparts into the crop, where it is incubated with secretions from the salivary glands. After further comminution by the gizzard, food passes into the midgut, where it is digested by enzymes secreted there. Part of the digestion products are resorbed by the midgut epithelium. The remaining material is transported into the hindgut. Many herbivorous insects have a tubular hindgut with several dilated compartments that harbor a dense gut microbiota. In these dilated compartments, or “fermentation chambers,” the prolonged residence time of food allows its degradation by microbial symbionts, a situation analogous to that in the rumen or colon of mammals [13,23]. After the removal of water and ions, the residues of digestion are released as feces. The excretory system in insects consists of the Malpighian tubules that extend into the body cavity and absorb wastes, such as uric acid, which are sent to the anterior hindgut [23,51]. All insect guts are surrounded by tissues aerated by


Int. Microbiol. Vol. 18, 2015

161

Int Microbiol

FUNCTIONAL SYMBIOSIS

Fig. 1. The “holobiont” as a single functional unit in which host and its symbionts are physiologically tightly connected. Relationship between host–microbe interactions involves the host, the microbiota and the environment. The holobiont a complex coordinated coevolution of different life forms. Interactions between the host and its microbiota are not only nutritional, but also include tissue development, immunity, etc. The human picture is based on the cover of The Economist magazine.

the insect’s tracheal system. Oxygen penetrates the peripheral hindgut contents to a depth of up to 150–200 μm below the epithelium. The removal of oxygen by the respiratory activity of the gut microbiota creates a microoxic periphery around an anoxic center [11,33]. The diversity of the hindgut microbiota of termites depends on several factors, including the variety of specialized structures present in the gut, the effect of pH, the sharp redox gradient, the type of food ingested and coevolution with their host insect [3,12,15,64]. In insect guts, the midgut is endodermal but foregut and hindgut are of ectodermal origin, and are always lined with a cuticle, so during ecdysis, insects replace their entire cuticle, and the hindgut has to be recolonized after each molt. In terms of host acquisition, symbionts can be acquired (i) horizontally from the environment, (ii) vertically from parental inheritance (e.g., endosymbionts such as Buchnera), or (iii) via a combination of these mechanisms. Horizontal symbiont transmission often leads to selection based on symbiont function rather than symbiont taxonomy [10]. Establishing horizontally acquired symbioses presents considerable challenges for both the host and the symbiont. The host may re-

quire mechanisms for the selection and retention of specific microbes from the environment whereas at the same time, it needs to retain a functioning immune system to destroy opportunistic or potentially pathogenic microorganisms [9]. The basic insect life cycle also presents potential challenges for transmission of microorganisms between generations. In most insects, females abandon eggs after depositing them. In this case, opportunities for direct transfer of gut symbionts between adults and juveniles are more limited compared to mammals and birds, which have extended parent–offspring contact. However, some insect species, including cockroaches, termites, ants, and some wasps and bees, show gregarious or social behavior, which can enable direct or indirect social transmission of their microbiota. In cockroaches, the neonatal digestive tract is free of microbes, and the establishment of the full complement of microbial symbionts is a sequential process that varies in length between species. Typically, it is not complete until the third instar, which is capable of nutritional independence but maintains close contact with adults [14,44,45]. Worker caste termites transfer food stomodeally (by regurgitation) and/or proctodeally (by excretion of the


162

Int. Microbiol. Vol. 18, 2015

B

Int Microbiol

A

BERLANGA

Fig. 2. (A) Macroscopical aspect of the worker caste from the lower termite Reticulitermes grassei showing the intestinal tract and a detail of their complex microbiota (Photo by R. Duro). (B) Generalized gut structure of insects, focusing on the structure of the gut of the lower termite R. grassei and factors that may influence the microbiota composition and distribution in the gut. Bacteria may colonize the intestinal wall (1); may be free-swimming in the lumen (2); they can be attached to food particles (3); or existing as ecto- or endosymbionts of protists (4).

hindgut contents). Both oral trophallaxis (feeding by mouths contact) and coprophagy (feeding feces to mouths) can promote a secure transmission of commensal microbiota between members of a colony of termites or of gregarious cockroaches [21,55].

Prokaryotic community in wood-feeding Dictyoptera Termites (Isoptera), cockroaches, and mantids form a wellestablished lineage of insects, the Dictyoptera. In fact, termites are actually social cockroaches, with the family Cryptocercidae as their closest relative and the Mantodea (mantids) as the sister group to the clade comprising cockroaches and termites [69]. The order Blattodea is now made up of termites and all cockroach taxa [2]. The most recent common ancestor of cockroaches and termites dates back to the Permian (~275 Mya), which contradicts the hypothesis of a Devonian (~375 Mya) origin of cockroaches. Stem-termites can be traced to the Triassic/Jurassic boundary, which refutes a Triassic origin [36].There are fundamental differences in the diets of termites and cockroaches. While termites feed almost exclusively on lignocellulose in various stages (i.e., wood, leaves, humus, detritus, and herbivore dung), cockroaches

subsist on a highly variable diet (omnivorous or xylophagous). The gut of wood-feeding “lower” termites (e.g., Reticulitermes grassei) and that of, the cockroach Cryptocercus harbors a complex microbial community comprising protists and bacteria [31]. “Higher” termites lack the symbiotic gut protists, instead having a gut microbiota composed of prokaryotic microorganisms [12]. Transient bacteria acquired from food and/or from the environment could modify the composition of gut microbial communities, but a dynamic core gut microbiota (commensal) is maintained even after environmental shifts [8,38,61,63]. Gut protists of termites belong to either the phylum Parabasalia or to phylum Preaxostyla (order Oxymonadida) (Fig. 3). Most of those protists are unique to termites and the related cockroach genus Cryptocercus. Parabasalia was traditionally divided into two orders, Hypermastigida and Trichomonadida. Hypermastigida were subsequently reclassified into three different orders, Trichonymphida, Spirotrichonymphida, and Cristamonadida [48]. Representative protist genera found in the gut of Cryptocercus are: Trichonympha, Eucomonympha, Urinympha, Barbulanympha, Idionympha, Leptospironympha, Macrospironympha (order Trichonymphida); Prolophomonas (order Cristamonadida) and Saccinobaculus (order Oxymonadida) [52]. Protists observed in Reticulitermes sp. (lower termite)


FUNCTIONAL SYMBIOSIS

Int. Microbiol. Vol. 18, 2015

A

B

C

D

163

Fig. 3. Scanning electron micrographs showing several protists from the gut of lower termites and the cockroach Cryptocercus. Note the presence of ectosymbiotic bacteria. (Scanning micrographs by Kevin J. Carpenter; shown at the exhibition at the Exploratorium museum, San Francisco, CA, USA. Micrographs were artificially colored by M. Berlanga to contrast the ectosymbionts from the protists.) (A) Trichonympha showing their rod shaped symbiotic bacteria (red) and flagella (blue). (B) The protist Saccinobaculus in front of the larger protist Barbulanympha, which is completely covered by rod-shaped bacteria (green). (C) The protist Staurojoenia showing spirochaetes (blue), rod-shaped symbiotic bacteria (orange) and flagella (brown). (D) The protist Staurojoenia (whole cell) showing spirochaetes in their surface (orange).

were: Holomastigotes, Microjoenia, Trichonympha, Spironympha, Monocercomonas sp., Dinenympha sp., Spirotrichonympha sp., and Pyrsonympha sp. [49]. While lower termites and Cryptocercus support a characteristic community of gut protists, many protist species are not necessarily restricted to one termite species. Moreover, they may be simultaneously associated with different bacterial ectosymbionts, such as Spirochaetes, Bacteroidetes and Synergistetes, and endosymbionts, such as Bacteroidetes, Elusimicrobia, methanogens (genus Metanobrevibacter) [32,47,51] and, as recently described, spirochetes [53]. The hindgut of termites and Cryptocercus accommodate diverse bacteria from more than 20 phyla, with the majority constituting novel lineages with uncultured representatives that are unique to termites [4,5,20,30;38,65]. Among the lower termites examined, the phyla Spirochaete, Proteobacteria, Firmicutes, Bacteroidetes are predominant. Other phyla are also represented, such as Actinobacteria, Synergistetes, Ver-

rucomicrobia, Elusimicrobia (formerly candidate phylum Termite Group 1-TG1), and candidate phylum Termite Group 2 (TG2) (Fig. 4). In higher termites, Spirochaete, candidate phylum TG3 and Fibrobacteres were the most dominant groups. Firmicutes and Bacteroidetes were generally more abundant in cockroaches than in termites. Spirochaetes were absent or not described in omnivorous cockroaches. Distinct termite species harbor different bacterial species with community structures specific to their host, but several of those bacteria are unique to termites/Cryptocercus, and were shared among diverse termite species (e.g., Spirochaetes, Bacteroidetes). Those bacteria may derive from the microbiota of a common ancestor before the diversification of cockroaches, and then diversified and adapted in each host [3,4,30,42,64]. Spirochetes in the guts of termites and Cryptocercus fall into three clusters named Treponema cluster I, II and III. Treponema-termite cluster I comprises both ectosymbionts at-


Int. Microbiol. Vol. 18, 2015

BERLANGA

Int Microbiol

164

Fig. 4. Phyletic composition (%) of the gut microbiota in several xylophagous insects. Data from Nasutitermes spp. (Termitidae) [33]. Data from Reticulitermes grassei (Rhinotermitidae) [5]. Data from the xylophagous cockroach Cryptocercus punctulatus [4]. Data from the cockroach Panesthia angustipermis [20]. Data from the cockroach Shelfordella laterals (omnivorous) [20]. Data from Periplaneta americana [7].

tached to protists and free-swimming gut spirochetes from lower and higher termites. Treponema-I includes the only three isolates of the entire cluster, Treponema primitia [25], Treponema azotonutricium [26], and Treponema isoptericolens [22]. Although none of its cultivated members seem to be cellulolytic, Treponema primitia is able to catabolize catechol under microoxic conditions, which suggests a possible role of Treponema bacteria in the breakdown of aromatic compounds released from the lignin fraction of lignocellulose [37]. Members of Cluster II are ectosymbiotic spirochetes of oxymonad protists. However, not all ectosymbiotic spirochetes are in Cluster II. Treponema-termite cluster III contained Treponema sequences from other cockroaches and from higher termites, such as in fungus-cultivating termites [3,42]. Ohkuma et al. [50] classified the Bacteroidetes in five clusters (Iâ&#x20AC;&#x201C;V). Group V consists of sequences from uncultured strains isolated from termites and cockroaches, such as Shelfordella (omnivorous) and Cryptocercus (wood-feeding). Many of these Bacteroidetes represent symbionts of gut flagellates from the protist Pseudotrichonympha. Group V also contains the diazotroph Azobacteroides pseudotrichonymphae [18] and

ectosymbionts described previously in Devescovinid flagellates from the Kalotermitidae (lower-termite) [17].

Functional symbiosis as a driving force of cooperation Identifying microbes responsible for particular environmental functions is challenging. Termites may harbor different microbial symbiont populations with specialized functionalities geared towards different feeding regiments that performed similar functions such as lignocellulose degradation and homoacetogenesis and nitrogen fixation [13]. Carbon source of the host. The major component of plant material is cellulose (20â&#x20AC;&#x201C;40%), a linear polysaccharide consisting of glucose units. It represents the most abundant biomass on earth. Hemicellulose is a general term for major noncellulosic polysaccharides in plant cell walls. Main chains of hemicellulose are composed of xylose, or glucose and mannose, which are often acetylated or shortly branched with


FUNCTIONAL SYMBIOSIS

165

hydrolases are classified into more than 100 families. All endogenous (provided by the termite) GH are affiliated with the glycoside hydrolase family (GHF) 9, and GHF1 [46]. The endogenous cellulolytic system of wood-feeding higher termites is thought to contribute to cellulose digestion more significantly than that of lower termites. Compared to host cellulases, symbiotic protistan communities in lower termites produce more complex cellulolytic enzymes, such as GHF3, GHF5, GHF7, etc. In higher termites, hindgut bacteria, principally Spirochaetes, Fibrobacteres and TG3, apparently took over the role of flagellates in cellulose degradation [70]. Also, members of Bacteroidetes and Clostridia are thought to be specialized in the degradation of complex organic matter, including lignocellulosic compounds [43,76]. Ingested cellulosic particles are fragmented in the foregut. There, the wood particles that are produced by the mandibles mix with enzymes secreted by the salivary glands. Any glucose that is released in the midgut is resorbed via the epithelium, whereas the partially digested wood particles pass through the enteric valve into the hindgut. In lower termites, the wood particles are immediately phagocytized by

Int Microbiol

arabinose, galactose, or other acidic sugars. Chemical compositions of hemicelluloses vary across plant species. Lignocellulose consists of cellulose (20â&#x20AC;&#x201C;50%), hemicellulose (15â&#x20AC;&#x201C; 35%), and lignin (18â&#x20AC;&#x201C;35%) [68]. Insects feeding on plant matter, especially wood (xylophagous), can harbor gut microbial communities involved in cellulose degradation [1], at least from the Miocene [72]. Cellulose exists as crystalline or amorphous microfibrils in plant cell walls and thus is not readily accessible to the host [70]. In the gut, the cellulose fibers are broken down into simpler sugar residues, a process which microbiota are typically involved in [12,76]. Termites have also been found to have their own cellulases [46,70]. The degradative process of cellulose/lignocellulose differs in higher and lower termites. In lower termites and Cryptocercus, cellulose digestion is mostly accomplished by protists and to a lesser extent by bacteria. The cellulolytic activity of bacteria in higher termites might replace the functions provided by protists in lower termites (Fig. 5). Glycoside hydrolases (GH), necessary for cellulose and hemicellulose degradation, are highly represented and expressed in termite hindguts. Based on peptide sequence similarities, glycoside

Int. Microbiol. Vol. 18, 2015

Fig. 5. Lignocellulose digestion in termites (showing in this case a lower termite) involves activities of both the host and its gut microbiota. The illustration shows the fermentative breakdown of wood polysaccharides.


Int. Microbiol. Vol. 18, 2015

BERLANGA

Int Microbiol

166

Fig. 6. Nitrogen supplied to the host by their bacterial symbionts.

cellulolytic flagellates, which hydrolyze the remaining polysaccharides using glycoside hydrolases that are secreted into their digestive vacuoles. Protists convert cellulose to acetate, H2 and CO2 [12]. The flagellates are probably also responsible for the production of lactate [54]. Lactate may be rapidly converted to acetate by bacteria that are located in the gut periphery in an oxygen-dependent process. Furthermore, formate is produced in the hindgut of many termite species. Depending on the termite species, hindgut formate is either accumulated, or oxidized to CO2, or reduced to acetate, presumably by homoacetogenic bacteria [54]. The microbial fermentation products (which are mainly short-chain fatty acids, e.g., acetate) are principally resorbed by the host, and the lignin-rich residues are voided as feces (Fig. 5). Hydrogen source of the host. Hydrogen is a key fermentation product that fuels many bacteria in the gut [54], and can be generated and consumed through nickel-iron (NiFe)-hydrogenase or iron-only (FeFe)-hydrogenase activities. (NiFe)-hydrogenases were present in members of the Synergistetes and Deltaproteobacteria. (FeFe)-hydrogenases, which are widely distributed in termites, have been assigned only to Spirochaetes. Homoacetogenesis (i.e., CO2 reduction to form acetate) is the major H2 sink in wood-feeding termites

[34]. Formyl tetrahydrofolate synthase (FTHFS), a key enzyme in the homoacetogenic pathway, has been assigned principally to Spirochaetes. It was suggested that termite symbiotic Spirochaetes may have acquired their CO2 reductive acetogenesis capability through lateral gene transfer from Firmicutes. However, whether the gene transfer event occurred before or after Spirochaetes having initially become termite symbionts has not been determined [60]. Nitrogen source of the host. Wood is poor in nitrogen content, which it is an important constraint to the growth of wood-feeding termites and Cryptocercus. The microbiota plays an important role in the fixation, recycling, and upgrading of nitrogen [75]. Dinitrogen fixation by hindgut diazotrophic bacteria can represent 30â&#x20AC;&#x201C;60% of the new acquisition of nitrogen. The nifH genes in termite guts are present among Spirochaetes, Clostridia and Bacteroidetes [18,48]. The bacterial symbionts (ecto-, or endosymbionts) of the protists seem to play important roles in nitrogen fixation, the assimilation of ammonia, and the synthesis of amino acids and vitamins [17,53]. The major waste product of nitrogen metabolism is uric acid. It is formed in the fat body and secreted into the hindgut via the Malpighian tubules, where uricolytic hindgut bacteria convert uric acid nitrogen to ammonia. The recy-


FUNCTIONAL SYMBIOSIS

cling of uric acid nitrogen is an important and significant aspect of the symbiosis with gut microbiota. The assimilation of ammonia into new microbial biomass completes the nitrogen cycle [67]. Uric acid recycling by gut bacteria seems to be a general mechanism for the conservation of nitrogen in terrestrial insects, particularly those whose natural diets are low in combined nitrogen [12] (Fig. 6). The endosymbiotic bacterium Blattabacterium is present in cockroaches (including Cryptocercus) and the lower termite Mastotermes darwiniensis but is absent in the rest of termites (lower and higher). The members of Blattabacterium that inhabit the fat bodies of cockroaches are thought to participate in uric acid degradation, nitrogen assimilation, and nutrient provisioning. Genomic analysis and metabolic reconstruction indicate that Blattabacterium sp., despite lacking recognizable uricolytic enzymes, is able to recycle nitrogen from urea and ammonia (both of which are uric acid degradation products) into glutamate by using the enzymes urease and glutamate dehydrogenase [56]. The genome of Blattabacterium cuenoti, whether from the termite Mastotermes darwiniensis or the social wood-feeding cockroach Cryptocercus punctulatus, lacks most of the pathways for the synthesis of essential amino acids found in the genomes of relatives of this bacterium isolated from non-wood-feeding hosts. This deficit may be filled by the other members of the complex gut microbiota, which provide their host with all essential amino acids [57].

Final conversations In 2004, Carl Woese wrote: “The time has come to replace the purely reductionist ‘eyes-down’ molecular perspective with a new and genuinely holistic, eyes-up, view of the living world, one whose primary focus is on evolution, emergence, and biology’s innate complexity.” [73]. Today, it is common knowledge that the majority of microorganisms play essential roles in maintaining life on Earth. We, and our related “macrobes”, are ultimately dependent on the assorted activities of the “invisible” microbial world. The miniscule size of its members belies their tremendous importance [6,27,29,40]. Interactions between animals and microbes are not specialized occurrences but rather are fundamental aspects of animal biology [40]. Symbiotic microbes are fundamental to nearly every aspect of host form, function, and fitness, including the traits that once seemed intangible to microbiology: behavior [24], and sociality [66]. Symbionts recognize one another and communicate. The gut is likely the most dynamic

Int. Microbiol. Vol. 18, 2015

167

organ, with intense and constant cross-talk between the huge diversity of microbes it hosts and the epithelium and the rest of the host. It is intriguing to consider that these kinds of communication evolved to conserve an association’s balance with its hundreds of beneficial bacterial species, and that pathogens have “taken control of” these conversations to enhance their fitness through disease. As Lederberg wrote [35], reminding us of August Krogh’s principle, [f] “for any given scientific challenge there is a critter fittest towards its solution.” Conflict of interests. None declared. Acknoledgements. Some of the photographs of insects and microorganisms in this review were made by Rubén Duro, biologist, camerographer and member of our research group. His outstanding work is highly recognized internationally. Part of the experimental work from our lab mentioned in this review was developed thanks to grant CGL2009-08922 from the Spanish Ministry of Economy and Competitiveness.

References 1. Anand AAP, Vennison SJ, Sankar SG, Prabhu DIG, Vasan PT, Raghuraman T, Geoffrey CJ, Vendan SE (2010) Isolation and characterization of bacteria from the gut of Bombyx mori that degrade cellulose, xylan, pectin and starch and their impact on digestion. J Insect Sci 10:107. doi:10.1673/031.010.10701 2. Beccaloni G, Eggleton P (2013) Order Blattodea. Zootaxa 3703:46-48 3. Berlanga M, Paster BJ, Guerrero R (2007) Coevolution of symbiotic spirochete diversity in lower termites. Int Microbiol 10:133-139 4. Berlanga M, Paster BJ, Guerrero R (2009) The taxophysiological paradox: changes in the intestinal microbiota of the xylophagous cockroach Cryptocercus punctulatus depending on the physiological state of the host. Int Microbiol 12:227-236 5. Berlanga M, Paster BJ, Grandcolas P, Guerrero R (2011) Comparison of the gut microbiota from soldier and worker castes of the termite Reticulitermes grassei. Int Microbiol 14:83-93 6. Berlanga M, Guerrero R (2015) The holobiont concept: The case of xylophagous termites and cockroaches. Symbiosis. (In press) 7. Bertino-Grimaldi D, Medeiros MN, Vieira RP, et al. (2013) Bacterial community composition shifts in the gut of Periplaneta americana fed on different lignocellulosic materials. SpringerPlus 2:609. doi:10.1186/2193-1801-2-609 8. Boucias DG, Cai Y, Sun Y, Lietze VU, Sen R, Raychoudhury R, Scharf ME (2013) The hindgut lumen prokaryotic microbiota of the termite Reticulitermes flavipes and its responses to dietary lignocellulose composition. Mol Ecol 22:1836-1853. doi: 10.1111/mec.12230 9. Bright M, Bulgheresi S (2010) A complex journey: transmission of microbial symbionts. Nat Rev Microbiol 8:218-230. doi:10.1038/nrmi-cro2262 10. Burke C, Steinberg P, Rusch D, Kjelleberg S, Thomas T (2011) Bacterial community assembly based on functional genes rather than species. Proc Natl Acad Sci USA 108:14288-14293. doi:10.1073/pnas.1101591108 11. Brune A, Friedrich M (2000) Microecology of the termite gut: structure and function on a microscale. Curr Opinion Microbiol 3:263-269 12. Brune A (2014) Symbiotic digestion of lignocellulose in termite guts. Nat Rev Microbiol 12:168-180


168

Int. Microbiol. Vol. 18, 2015

13. Brune A, Dietrich C (2015) The gut microbiota of termites: digesting the diversity in the light of ecology and evolution. Annu Rev Microbiol 69: 145-166 14. Carrasco P, Pérez-Cobas AE, van de Pl C, Baixeras J, Moya A, Latorre A (2014) Succession of the gut microbiota in the cockroach Blattella germanica. Int Microbiol 17:99-109 15. Colman DR, Toolson EC, Takacs-Vesbach CD (2012) Do diet and taxonomy influence insect gut bacterial communities? Mol Ecol 21: 5124-5137 16. Cox-Foster DL, Conlan S, Holmes EC, et al. (2007) A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318:283-287 17. Desai MS, Strassert JFH, Meuser K, Hertel H, Ikeda-Ohtsubo W, Radek R, Brune A (2010) Strict cospeciation of devescovinid flagellates and Bacteroidales ectosymbionts in the gut of dry-wood termites (Kalotermitidae). Environ Microbiol 12:2120-2132 18. Desai MD, Brune A (2012) Bacteroidales ectosymbionts of gut flagellates shape the nitrogen-fixing community in dry-wood termites. ISME J 6:1302-1313 19. Despres L, David JP, Gallet C (2007) The evolutionary ecology of insect resistance to plant chemicals. Trends Ecol Evol 22:298-307 20. Dietrich C, Köhler T, Brune A (2014) The cockroach origin of the termite gut microbiota: patterns in bacterial community structure reflect major evolutionary events. Appl Environ Microbiol 80:2261-2269 21. Diouf M, Roy V, Mora P, Frechault S, Lefebvre T, Hervé V, RoulandLefèvre C, Miambi E (2015) Profiling the succession of bacterial communities throughout the life stages of a higher termite Nasutitermes arborum (Termitidae, Nasutitermitinae) using 16S rRNA gene pyrosequencing. PLoS One 10:e0140014. doi:10.1371/journal.pone.0140014 22. Dröge S, Rachel R, Radek R, König H (2008) Treponema isoptericolens sp.nov., a novel spirochaete from the hindgut of the termite Incisitermes tabogae. Int J Syst Evol Microbiol 58:1079-1083 23. Engel P, Moran NA (2013) The gut microbiota of insects – diversity in structure and function. FEMS Microbiol Rev 37:699-735. doi:10.1111/1574-6976.12025 24. Ezenwa VO, Gerardo NM, Inouye DW, Medina M, Xavier JB (2012) Animal behavior and the microbiome. Science 338:198-199. doi:10.1126/science.1227412 25. Graber JR, Breznak JA (2004) Physiology and nutrition of Treponema primitia, an H2/CO2-acetogenic spirochete from termite hindguts. Appl Environ Microbiol 70:1307-1314 26. Graber JR, Leadbetter JR, Breznak JA (2004) Description of Treponema azotonutricium sp. nov. and Treponema primitia sp. nov., the first spirochetes isolated from termite guts. Appl Environ Microbiol 70:1315-1320 27. Guerrero R, Berlanga M (2009) The evolution of microbial life: paradigm changes in microbiology. Contrib Sci 5:55-61 28. Guerrero R, Margulis L, Berlanga M (2013) Symbiogenesis: the holobiont as a unit of evolution. Int Microbiol 16:133-143 29. Guerrero R, Berlanga M (2015) From the cell to the ecosystem: The physiological evolution of symbiosis. Evol Biol. doi:10.1007/s11692015-9360-5 30. Hongoh Y (2010) Diversity and genomes of uncultured microbial symbionts in the termite gut. Biosci Biotechnol Biochem 74:1145-1151 31. Hongoh Y (2011) Toward the functional analysis of uncultivable, symbiotic microorganisms in the termite gut. Cell Mol Life Sci 68:1311-1325 32. Ikeda-Ohtsubo W, Brune A (2009) Cospeciation of termite gut flagellates and their bacterial endosymbionts: Trichonympha species and ‘Candidatus Endomicrobium trichonymphae’. Mol Ecol 18:332-342 33. Köhler T, Dietrich C, Scheffrahn RH, Brune A (2012) High-resolution analysis of gut environment and bacterial microbiota reveals functional compartmentation of the gut in wood-feeding higher termites (Nasutitermes spp.). Appl Environ Microbiol 78:4691-4701

BERLANGA

34. Leadbetter JR, Schmidt TM, Graber JR, Breznak JA (1999) Acetogenesis from H2 plus CO2 by spirochetes from termite guts. Science 283:686-689 35. Lederberg J (2006) The microbe’s contribution to biology–50 years after. Int Microbiol 9:155-156 36. Legendre F, Nel A, Svenson GJ, Robillard T, Pellens R, Grandcolas P (2015) Phylogeny of Dictyoptera: dating the origin of cockroaches, praying mantises and termites with molecular data and controlled fossil evidence. PLoS ONE 10:e0130127. doi:10.1371/journal.pone.0130127 37. Lucey KS, Leadbetter JR (2014) Catechol 2,3-dioxygenase and other meta-cleavage catabolic pathway genes in the anaerobic termite gut spirochete Treponema primitia. Mol Ecol 23:1531-1543 38. Makonde HM, Mwirichia R, Osiemo Z, Boga HI, Klenk H-P (2015) 454 Pyrosequencing-based assessment of bacterial diversity and community structure in termite guts, mounds and surrounding soils. SpringerPlus 4:471. doi:10.1186/s40064-015-1262-6 39. Martínez-Cano DJ Reyes-Prieto M, Martínez-Romero E, Partida-Martínez LP, Latorre A, Moya A, Delaye L (2015) Evolution of small prokaryotic genomes. Front Microbiol 5:742. doi:10.3389/fmicb.2014.00742 40. McFall-Ngai MJ, Hadfield MG, Bosch TCG, Carey HV, Domazet-Loso T, Douglas AE et al. (2013) Animals in a bacterial world, a new imperative for the life sciences. Proc Natl Acad Sci USA 110:3229-3236 41. Mejía-León ME, Calderón de la Barca AM (2015) Diet, microbiota and immune system in type1 diabetes development and evolution. Nutrients 7:9171-9184 doi:10.3390/nu7115461 42. Mikaelyan A, Köhler T, Lampert N, Rohland J, Boga H, Meuser K, Brune A (2015) Classifying the bacterial gut microbiota of termites and cockroaches: A curated phylogenetic reference data base (DictDb). Syst Appl Microbiol 38:472-482 43. Munir RI, Schellenberg J, Henrissat B, et al. (2014) Comparative analysis of carbohydrate active enzymes in Clostridium termitidis CT1112 reveals complex carbohydrate degradation ability. PLoS ONE 9: e104260 doi:10.1371/journal.pone.0104260 44. Nalepa CA (1990) Early development of nymphs and establishment of hindgut symbiosis in Cryptocercus punctulatus (Dictyoptera: Cryptocercidae). Ann Entomol Soc Amer 83:786-789 45. Nalepa CA (2015) Origin of termite eusociality: trophallaxis integrates the social, nutricional, and microbial environments. Ecol Entomol 40: 323-335 46. Ni J, Tokuda G (2013) Lignocellulose-degrading enzymes from termites and their symbiotic microbiota. Biotechnol Adv 31:838-850 47. Noda S, Kitade O, Inoue T, Kawai M, Kanuka M, Hiroshima K, Hongoh Y, et al. (2007) Cospeciation in the triplex simbiosis of termite gut protists (Pseudotriconympha spp.), their hosts, and their bacterial endosymbionts. Mol Ecol 16:1257-1266 48. Noda S, Hongoh Y, Sato T, Ohkuma M (2009) Complex coevolutionary history of symbiotic Bacteroidales bacteria of various protist in the gut of termites. BMC Evol Biol 9:158. doi:10.1186/1471-2148-9-158 49. Ohkuma M, Ohtoko K, IIda T, Tokura M, et al. (2000) Phylogenetic identification of Hypermastigotes, Pseudotrichonympha, Spirotrichonumpha, Holomastigotoides, and Parabasalian symbionts in the hindgut of termites. J Eukaryot Microbiol 47:249-259 50. Ohkuma M, Noda S, Hongoh Y, Kudo T (2002) Diverse bacteria related to the Bacteroides subgroup of the CFB phylum within the gut symbiotic communities of various termites. Biosci Biotechnol Biochem 66:78-84 51. Ohkuma M (2008) Symbioses of flagellates and prokaryotes in the gut of lower termites. Trends Microbiol 16:345-352 52. Ohkuma M, Noda S, Hongoh Y, Nalepa CA, Inoue T (2009) Inheritance and diversification of symbiotic trichonymphid flagellates from a common ancestor of termites and the cockroach Cryptocercus. Proc R Soc London B 276:239-245 53. Ohkuma M, Noda S, Hattori S, Lida T, Yuki M, Starns D, Inoue J-I,


FUNCTIONAL SYMBIOSIS

Darby AC, Hongoh Y (2015) Acetogenesis from H2 plus CO2 and nitrogen fixation by an endosymbiotic spirochete of a termite-gut cellulolytic protist. Proc Natl Acad Sci USA 112:10224-10230. doi:10.1073/ pnas.1423979112 54. Pester M, Brune A (2007) Hydrogen is the central free intermediate during lignocellulose degradation by termite gut symbionts. ISME J 1:551-565 55. Rahman NA, Parks DH, Willner DL, et al. (2015) A molecular survey of Australian and North American termite genera indicates that vertical inheritance is the primary force shaping termite gut microbiomes. Microbiome 3:5. doi:10.1186/s40168-015-0067-8 56. Sabree ZL, Kambhampati S, Moran NA (2009) Nitrogen recycling and nutricional provisioning by Blattabacterium, the cockroach endosymbiont. Proc Natl Acad Sci USA 106:19521-19526 57. Sabree ZL, Moran NA (2014) Host-specific assemblages typify gut microbial communities of related insect species. SpringerPlus 3:138. doi:10.1186/2193-1801-3-138 58. Sachs JL, Skophammer RG, Regus JU (2011) Evolutionary transitions in bacterial symbiosis. Proc Natl Acad Sci USA 108:10792-10799. doi:10.1073/pnas.1100304108 59. Sachs JL, Hollowell AC (2012) The origins of cooperative bacterial communities. mBio 3:e00099-12 60. Salmassi TM, Leadbetter JR (2003) Analysis of genes of tetrahydrofolate dependent metabolism from cultivated spirochaetes and the gut community of the termite Zootermopsis angusticollis. Micro­ biology 149:2529-2537 61. Schauer C, Thompson C, Brune A (2014) Pyrotag sequencing of the gut microbiota of the cockroach Shelfordella lateralis reveals a highly dynamic core but only limited effects of diet on community structure. PLoS ONE 9:e85861. doi:10.1371/journal.pone.0085861 62. Simpson SJ, Le Couteur DG, Raubenheimer D (2015) Putting the balance back in diet. Cell 161:18-23 63. Sudakaran S, Salem H, Kost C, Kaltenpoth M (2012) Geographical and ecological stability of the symbiotic mid-gut microbiota in European firebugs, Pyrrhocoris apterus (Hemiptera, Pyrrhocoridae). Mol Ecol 21:6134-6151. doi:10.1111/mec.12027 64. Tai V, James ER, Nalepa CA, Scheffrahn RH, Perlman SJ, Keeling PJ (2014) The role of host phylogeny varies in shaping microbial diversity in the hindguts of lower termites. Appl Environ Microbiol 8:1059-1070 65. Tarayre C, Bauwens J, Mattéotti C, Brasseur C, Millet C, Sebastien M, Destain J, et al. (2015) Multiple analyses of microbial communities applied to the gut of the wood-feeding termite Reticulitermes flavipes fed on artificial diets. Symbiosis 65:143-155

Int. Microbiol. Vol. 18, 2015

169

66. Theis KR, Venkataraman A, Dycus JA, et al. (2013) Symbiotic bacteria appear to mediate hyena social odors. Proc Natl Acad Sci USA 110:19832-19837 67. Thong-On A, Suzuki K, Noda S, Inoue J-I, Kajiwara S, Ohkuma M (2012) Isolation and characterization of anaerobic bacteria for symbiotic recycling of uric acid nitrogen in the gut of various termites. Microbes Environ 27:186-192 68. Tomme P, Warren RAJ, Gilkes NR (1995) Cellulose hydrolysis by bacteria and fungi. Adv Microb Physiol 37:1-81 69. Trautwein MD, Wiegmann BM, Beutel R, Kjer KM, Yeates DK (2012) Advances in insect phylogeny at the dawn of the postgenomic era. Annu Rev Entomol 57:449-468. doi:10.1146/annurev-ento-120710-100538 70. Watanabe H, Tokuda G (2010) Cellulolytic systems in insects. Annu Rev Entomol 55:609-632 71. Webster NS (2014) Cooperation, communication, and co-evolution: grand challenges in microbial symbiosis research. Front Microbiol 5:164. doi:10.3389/fmicb.2014.00164 72. Wier A, Dolan M, Grimaldi D, Guerrero R, Wagensberg J, Margulis L (2002) Spirochete and protist symbionts of a termite (Mastotermes electrodominicus) in Miocene amber. Proc Natl Acad Sci USA 99:1400-1403 73. Woese CR (2004) A new biology for a new century. Microbiol Mol Biol Rev 68:173-186 74. Wong AC-N, Holmes A, Ponton F, Lihoreau M, Wilson K, Raubenheimer D, Simpson SJ (2015) Behavioral microbiomics: A multi-dimensional approach to microbial influence on behavior. Front Microbiol 6:1359. doi:10.3389/fmicb.2015.01359 75. Yamada A, Inoue T, Noda Y, Hongoh H, Ohkuma M (2007) Evolutionary trend of phylogenetic diversity of nitrogen fixation genes in the gut community of wood-feeding termites. Mol Ecol 16:3768-3777 76. Yuki M, Kuwahara H, Shintani M, Izawa K, Sato T, Starns D, Hongoh Y, Ohkuma M (2015) Dominant ectosymbiotic bacteria of cellulolytic protists in the termite gut also have the potential to digest lignocellulose. Environ Microbiol 17:4942–4953. doi: 10.1111/1462-2920.12945 77. Zilber-Rosenberg I, Rosenberg E (2008) Role of microorganisms in the evolution of animals and plants: the hologenome theory of evolution. FEMS Microbiol Rev 32:723-735


RESEARCH ARTICLE International Microbiology (2015) 18:171-175 doi:10.2436/20.1501.01.247. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

The 25th SEM Congress (Logroño, Spain, July 7–10, 2015) Effect of propionic acid on Campylobacter jejuni attached to chicken skin during refrigerated storage Elena González-Fandos,* Naiara Maya, Iratxe Pérez-Arnedo Food Technology Department, CIVA Research Center, University of La Rioja, Logroño, Spain Received 27 August 2015 · Accepted 10 September 2015 Summary. The ability of propionic acid to reduce Campylobacter jejuni on chicken legs was evaluated. Chicken legs were inoculated with Campylobacter jejuni. After dipping legs in either water (control), 1% or 2% propionic acid solution (vol/vol), they were stored at 4ºC for 8 days. Changes in C. jejuni, psychrotrophs and Pseudomonas counts were evaluated. Washing in 2% propionic acid significantly reduced (P < 0.05) C. jejuni counts compared to control legs, with a decrease of about 1.62 log units after treatment. Treatment of chicken legs with 1 or 2% propionic acid significantly reduced (P < 0.05) numbers of psychrotrophs 1.01 and 1.08 log units and Pseudomonas counts 0.75 and 0.96 log units, respectively, compared to control legs. The reduction in psychrotrophs and Pseudomonas increased throughout storage. The highest reductions obtained for psychrotrophs and Pseudomonas counts in treated legs were reached at the end of storage, day 8, being 3.3 and 2.93 log units, respectively, compared to control legs. Propionic acid treatment was effective in reducing psychrotrophs and Pseudomonas counts on chicken legs throughout storage. It is concluded that propionic acid is effective for reducing C. jejuni populations in chicken. [Int Microbiol 18(3):171-175 (2015)] Keywords: Campylobacter jejuni · Pseudomonas spp. · poultry · meat safety · pathogen reduction

Introduction Human campylobacteriosis is one of the most frequently reported food-borne diseases in the European Union, with 214,779 confirmed cases in 2013. Consumption of conta­mi­ nated chicken meat is often the source of infection [10]. Various strategies to control Campylobacter in chicken have been Corresponding author: Elena González-Fandos Food Technology Department University of La Rioja Madre de Dios, 51 26006 Logroño, Spain Tel. +34-941299728. Fax 34-941299721

*

E-mail: elena.gonzalez@unirioja.es

suggested [9]. The treatment with organic acids is one approach to decontaminate chicken [2,11–13]. Propionic acid has antibacterial activity and could play a role in reducing pathogens in meat and poultry. Mani-López et al. [12] suggested that propionic acid has promising applications in meat and poultry products since it is more effective against Salmonella than are other organic acids such as acetic or lactic acids. Because Campylobacter jejuni is a pathogen often asso­ ciated with chicken, it would be of particular importance to reduce the levels of this bacterium on chicken. The activity of organic acids such as acetic or lactic acid on C. jejuni has been investigated by other authors [6]. The efficacy of propionic acid on C. jejuni has been investigated in vitro [16]. However, there are few works on the efficacy of propionic acid against C. jejuni in chicken [16].

This article was a contribution at the 25th Congress of the Spanish Society for Microbiology


172

Int. Microbiol. Vol. 18, 2015

GONZÁLEZ-FANDOS ET AL.

The purpose of this study was to evaluate the ability of a propionic acid dip to reduce Campylobacter jejuni in chicken stored at 4ºC.

were made using a Crison model 2002 pHmeter (Crison Instruments, Barcelona, Spain). Statistical analyses. Plate count data were transformed to logarithms prior to their statistical treatment. Analysis of variance was performed using the SYSTAT program for Windows; Statistics version 5.0 (Evanston, Illinois). Tukey’s test for comparison of means was performed using the same program. All experiments were performed in duplicate. Significance level was defined at P < 0.05.

Material and methods Preparation of inocula. Campylobacter jejuni ATTCC 33291 was grown in Preston Campylobacter enrichment broth (Oxoid, Hampshire, UK) under microaerobic conditions (85% N2 10% CO2 and 5% O2) at 42ºC for 24h. Anaerobic jars and Gas Generating Kits (BR 56, Oxoid) were used to create microaerobic conditions. After, the culture was centrifuged at 10000 g for 15 min at 4ºC (Sorvall RC-5B, GMI Inc., Minnesota, USA). The supernatant was decanted and the pellet resuspended in sterile peptone water (0.1%) (Merck, Darmstadt, Germany) by vortexing. The suspension of washed cells was diluted in a sterile peptone water (0.1%) to obtain an appropriate cell concentration for inoculation.

Results Microbiological quality. Tables 1 and 2 show the effect of different propionic acid concentrations on psychrotrophs and Pseudomonas counts, respectively. Immersion of chicken legs in 1 or 2% propionic acid reduced psychrotrophs counts between 1.01 and 3.3 log units compared to the control legs throughout storage. After treatment (day 0), psychrotrophs counts were 1.08 log units higher in control samples than in legs treated with 2% propionic acid. On day 8, psychrotrophs counts in legs washed with 2% propionic acid were 3.3 log units lower compared to control samples. After treatment, Pseudomonas counts were 0.96 log units lower in legs treated with 2% propionic acid than in control ones (day 0). Pseudomonas reductions varied between 0.75 (day 0, control-1% propionic acid) and 2.93 log units (day 8, control-2% propionic acid) for propionic acid treated legs compared to the control ones throughout storage. Propionic acid was found to reduce significantly (P < 0.05) the population of psychrotrophs and Pseudomonas. Significant differences (P < 0.05) in psychrotroph and Pseudomonas counts were also found between the legs treated with 1 and those treated with 2% propionic acid on day 3, 6 and 8 of storage. The psychrotrophs and Pseudomonas reductions increased throughout storage. The highest reductions compared to control were reached at the end of storage, day 8. Propionic acid was effective in reducing microbial counts both immediately after treatment and during storage.

Inoculation of chicken legs and treatment. Ninety fresh chicken legs were collected from a commercial chicken processing plant (Logroño, La Rioja, Spain). The legs were transported on crushed ice to the laboratory. Fresh chicken legs with skin were inoculated with C. jejuni by dipping them into a suspension of this pathogen for 5 min at room temperature. After the inoculation, the legs were removed and kept for 30 min at room temperature to allow the bacteria to attach to the skin. The inoculated chicken legs were randomly divided into three batches, each containing 30 legs. Samples of each batch were immersed for 5 min into sterile distilled water (control) (batch one), 1% (batch 2) or 2% (batch 3) propionic acid (Scharlab, Barcelona, Spain). After immersion, all legs were removed and drained for 5 min at room temperature. Afterwards, legs were placed individually in sterile bags and stored at 4ºC for 8 days. Microbiological analyses and pH determination. Analyses were performed on days 0 (after immersion treatment), 1, 3, 6 and 8. On the sampling days, six legs of each batch were taken out from storage to carry out microbiological and pH analysis. Ten grams of skin were aseptically weighed and homogenized in a Stomacher (IUL, Barcelona, Spain) for 2 min with 90 ml of 0.1% sterile peptone water (Oxoid). Serial decimal dilutions were prepared using the same diluent. The number of psychrotrophs was determined on Plate Count Agar (Merck) using the pour plate method. The plates were incubated at 7ºC for 10 days [18]. Pseudomonas spp were determined on King´s B medium with an incubation temperature of 25ºC for 48h [29]. Enumeration of C. jejuni was conducted on modified charcoal-cefoperazonedeoxycolate agar (mCCDA) (Oxoid, Basingstoke, UK) with an incubation temperature of 42ºC for 48 hours under microaerobic conditions. Suspected C. jejuni colonies were confirmed microscopically [2]. Measurements of pH

Table 1. Psychrotroph counts on chicken legs dipped in propionic acid solutions and stored up to 8 days at 4ºC (log CFU/g) Days of storage Batch

0

1

3

6

8

Control

3.91 ± 0.06a

5.13 ± 0.35a

7.18 ± 0.09a

8.80 ± 0.24a

9.50 ± 011a

1% Propionic acid

2.90 ± 0.11b

3.62 ± 0.35b

5.17 ± 0.30b

6.89 ± 0.11b

7.16 ± 0.26b

2% Propionic acid

2.83 ± 0.03b

3.53 ± 0.12b

4.31 ± 017c

5.53 ± 0.13c

6.20 ± 0.28c

Mean ± standard deviation, n = 6 Means within columns followed by the same letter were not significantly different (P > 0.05).


EFFECT OF PROPIONIC ACID ON C. JEJUNI

Int. Microbiol. Vol. 18, 2015

173

Table 2. Pseudomonas counts on chicken legs dipped in propionic acid solutions and stored up to 8 days at 4ºC (log CFU/g) Days of storage Batch

0

1

Control

3.22 ± 0.13

1% Propionic acid 2% Propionic acid

3

6

8

4.52 ± 0.13

6.76 ± 0.07

8.34 ± 0.23

9.30 ± 011a

2.47 ± 0.18b

3.54 ± 0.17b

5.19 ± 0.26b

6.45 ± 0.28b

7.14 ± 0.13b

2.26 ± 0.17b

3.45 ± 0.15b

4.49 ± 015c

5.50 ± 0.35c

6.37 ± 015c

a

a

a

a

Mean ± standard deviation, n = 6 Means within columns followed by the same letter were not significantly different (P > 0.05).

Campylobacter jejuni. Analysis of C. jejuni counts (Table 3) show that propionic acid caused significant reductions (P < 0.05) in the C. jejuni populations. When legs were treated with 2% propionic acid C. jejuni counts were reduced 1.62 log units. After 8 days of storage, C. jejuni counts were 1.71 log units lower in legs treated with 2% propionic acid than in control ones. Significant differences (P < 0.05) were obtained between legs treated with 1 and 2% propionic acid. On day 8, C. jejuni counts were 0.7 log units lower in samples treated with 2% propionic acid than in those treated with 1%. pH changes. Propionic treatment significantly reduced (P < 0.05) the pH of chicken legs. The pH was lower when the propionic acid concentration was higher. Initial pH values in legs immersed in 1 or 2% propionic acid (day 0) were 5.75 ± 0.18 and 5.31 ± 0.10, respectively (0.92 and 1.36 units lower than in control legs). The pH differences did not decrease throughout storage.

Discussion The reductions in������������������������������������������� psychrotrophs����������������������������� counts obtained in the present work are in agreement with the findings of other authors when using organic acids. Organic acids (1–3%) reduce microbial counts by 1–2 log units [14,28].

In an earlier study, it was found that a washing with 2% propionic acid reduced psychrotrophs counts between 1.27 and 2.19 log units in chicken legs [15]. In the current study, a washing with 2% propionic acid decreased psychrotrophs counts between 1.08 and 3.3 log units. After treatment with 2% propionic acid the reductions of ������������������������ psychrotrophs counts obtained were very similar (1.08 log units in the present study and 1.32 in the previous study). In the current work, propionic acid at concentrations of 1 or 2% reduced Pseudomonas counts in 2.16 and 2.93 logs units in chicken legs after 8 days of storage at 4ºC, compared to control samples. Odgen et al. [25] observed higher Pseudomonas count reductions in pork meat treated with 1% propionic acid (3 log units after 13 days of storage at 4ºC). The higher efficacy of propionic acid in pork meat could be explained by the pH, since pork meat has a lower pH than chicken. Propionic acid has optimal inhibitory activity at low pH because it favors the uncharged form, which has stronger antimicrobial activity than the dissociated form [7,8]. Spoilage of poultry meat is mainly attributed to growth and metabolic activity of bacteria. Pseudomonas is the major spoilage bacterium in chicken meat [20]. The shelf life of chicken meat depends on the level of its microbial contamination. Therefore, reducing the spoilage bacteria in chicken, mainly Pseudomonas, could extend their shelf life. Bacterial counts by 9 log cfu/g are related to the detection of off-odors

Table 3. Campylobacter jejuni counts on chicken legs dipped in propionic acid solutions and stored up to 8 days at 4ºC (log CFU/g) Days of storage Batch

0

Control

4.58 ± 0.09

1% Propionic acid 2% Propionic acid

1

3

6

8

4.25 ± 0.12

4.00 ± 0.21

4.02 ± 0.04

4.01 ± 0.12a

3.70 ± 0.70b

3.31 ± 0.03b

3.39 ± 0.22b

3.26 ± 0.20b

3.00 ± 0.14b

2.96 ± 0.29c

2.78 ± 0.19c

2.65 ± 0.17c

2.50 ± 0.10c

2.30 ± 0.10c

a

a

a

Mean ± standard deviation, n = 6 Means within columns followed by the same letter were not significantly different (P > 0.05).

a


174

Int. Microbiol. Vol. 18, 2015

and spoilage in chicken [15]. In the present work after 6 days of storage, psychrotrophs reached populations by 8.80 log cfu/g in control legs. However, in the legs treated with 1 or 2% propionic acid, psychrotroph and Pseudomonas counts were below 8 log cfu/g at the end of storage, day 8. In consequence, propionic acid could extend the shelf life of chicken meat. On the other hand, Pseudomonas could affect the survival of pathogens in chicken. Hilbert et al. [17] reported that C. jejuni isolated from chicken meat were able to benefit from cocultivation with Pseudomonas spp. This interaction could explain the survival of C. jejuni on chicken meat. In the present work, no growth of C. jejuni was detected in chicken legs. C. jejuni do not grow on meat at low temperatures, 30ÂşC being the minimum temperature for growth [5]. This pathogen has a low infective dose, thus the main problem is its survival. Futhermore, C. jejuni survives better in refrigerated foods than in food held at room temperature [19]. Another factor that affects its survival is pH. C jejuni is very sensitive to low pH. Its survival is optimal in the range 6.5 to 7.5 [1]. In the present study, initial pH of control legs was 6.6, the treatment with 1 or 2% of propionic decreased the pH, reaching values of pH of 5.75 and 5.31, respectively. The efficacy of propionic acid against C. jejunii has been studied in vitro [3, 16]. Chaveerach et al. [3] found that propionic acid has a very strong bactericidal effect on Campylobacter jejuni culturability at low pH. Grilli et al. [16] reported that the minimum inhibitory concentration (%) for propionic acid against C. jejuni was 0.46. Only a few works have investigated the effect of propionic acid on C. jejuni in chicken. Propionic acid is effective as feed additive in broilers to reduce caecal C. jejuni [16]. Shin et al. [27] studied the effect of propionic acid against Campylobacter jejuni in a chicken model system. These authors observed that the addition of propionic acid showed strong antibacterial activity against C. jejuni at pH 5.5 or 6.5. Propionic acid has been investigated for its ability to reduce Salmonella [21]. Propionic acid inhibits the growth of Salmonella at higher pH values (pH 5.5) than do lactic (pH 4.4) or citric acid (pH 4.05) [4]. Tamblyn and Conner [31] found that 2% propionic reduced Salmonella attached to chicken skin in 1.2 log units. In an earlier study, the ability of propionic acid to reduce the populations of L. monocytogenes on poultry meat was evaluated [15]. Legs washed with 2% propionic acid showed a significant (P < 0.05) reduction in L. monocytogenes counts compared to control legs, with a decrease of about 2.72 log units after 3 days of storage.

GONZĂ LEZ-FANDOS ET AL.

The efficacy of propionic acid against C. jejuni on chicken observed in the present study is higher than the efficacy reported by other authors in chicken treated with other organic acids such as lactic or acetic acids. Cosansu and Ayhan [6] found that after washing with 1 and 3% lactic acid reduced C jejuni counts on chicken 0.36 and 1.06 log units, respectively, while acetic acid at concentrations of 1% and 3% reduced C jejuni in 0.78 and 1.27 log units, respectively. Zhao and Doyle [32] found that a treatment with 2% acetic acid caused a reduction of 1.2 log units in C. jejuni in chicken wings. In the present study 2% propionic acid reduced C. jejuni populations 1.62 log units after treatment. Therefore, propionic acid was more effective against C. jejuni than lactic or acetic acid. Grilli et al. [16] also reported that propionic acid was more effective against C jejuni than acetic, lactic and citric acids in vitro assays.The higher efficacy of propionic acid compared to other organic acids (lactic, acetic and citric acid) has also been observed against Salmonella [23] and L. monocytogenes [11,12,13,14]. Propionic acid exerts a greater antimicrobial effect compared to lactic acid, despite the fact that lactic acid is a stronger acid with a pKa value of 3.66, whereas the pKa value of propionic acid is 4.87 [30]. The greater antimicrobial effect of propionic acid could be explained since propionic acid is more lipophilic and hence is transported through the bacterial cell wall quicker [24]. Moreover, antimicrobial activity of propionic acid is attributed to both the undissociated and dissociated acid forms [7]. Contamination of chicken meat with C. jejuni can occur at many stages of processing [9]. C. jejuni has been found on chicken skin during slaughter process, whereas internal tissues are sterile [1]. Therefore, it is of particular importance to reduce C. jejuni on the surface of chicken. The relevance of reducing Campylobacter jejuni counts on chicken for decreasing the incidence of human campylobacteriosis has been shown by quantitative risk assessment. The incidence of campylobacteriosis associated with consumption of chicken could be reduced 30 times by introducing a 2 log reduction of the number of Campylobacter on the chicken carcasses [26]. In the current work reduction of 1.62 log units of C. jejuni were achieved by decontamination with 2% propionic acid. This fact is of particular interest since reducing the levels of C. jejuni may help to decrease the incidence of human campylobacteriosis. Alterations in sensorial characteristics should be taken into account in the selection and application of organic acids as carcass decontaminants. In a previous study it was observed


EFFECT OF PROPIONIC ACID ON C. JEJUNI

that chicken sensory quality was not adversely affected by propionic acid [15]. Acknowledgements. The authors thank the Regional Government of La Rioja (Spain) (Project Reference FOMENTA 2007-11) and University of La Rioja (Spain) (Project Reference PROFAI 13/24) for its financial support. Competing interests. Not declared.

References 1. Bell C, Kyriakides A (2009) Campylobacter. A practical approach to the organism and its control. Wiley-Blackwell, Oxford, UK 2. Carpenter CE, Smith JV, Broadbent JR (2011) Efficacy of washing meat surfaces with 2% levulinic, acetic, or lactic acid for pathogen decontamination and residual growth inhibition. Meat Sci 58:256-260 3. Chaveerach P, Keuzenkamp DA, Urlings HAP, Lipman LJA, Knapen F (2002) In vitro study on the effect of organic acid on Campylobacter jejuni/coli populations in mixtures of water and feed. Poultry Sci 81:621628 4. Chung KC, Goepfert JM (1970) Growth of Salmonella at low pH. J Food Sc 35:326-328 5. Corry JEL, Atabay HI (2001) Poultry as a source of Campylobacter and related organisms. J Appl Microbiol 90:96S-114S 6. Coşansu S, Ayhan K (2010) Effects of lactic and acetic acid treatments on Campylobacter jejuni inoculated onto chicken leg and breast meat during storage at 4ºC and –18ºC. J Food Process Pres 34:98-113 7. Eklund T (1985) Inhibition of microbial growth at different pH levels by benzoic and propionic acids and esters of p-hydrosybenzoic acid. Int J Food Microbiol 2:159-167 8. El-Shenawy MA, Marth EH (1989) Behaviour of Listeria monocytogenes in the presence of sodium propionate. Int J Food Microbiol 8:8594 9. EFSA (2011) Scientific opinion on Campylobacter jejuni in broiler meat production: control options and performance objectives and/or targets at different stages of the food chain. EFSA J 9:2105 10. EFSA (2015) The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2013. EFSA J 13:3991 11. González-Fandos E, Dominguez JL (2006) Efficacy of lactic acid against Listeria monocytogenes attached to poultry skin during refrigerated storage. J Appl Microbiol 101: 1331-1339 12. González-Fandos E, Dominguez JL (2007) Effect of potassium sorbate on the growth of Listeria monocytogenes on fresh poultry. Food Control 18:842-846 13. González-Fandos, E, Herrera, B, Maya N (2009). Efficacy of citric acid against Listeria monocytogenes attached to poultry skin during refrigerated storage. Int J Food Sci Technol 44:262-268 14. González-Fandos E, Herrera B (2013) Efficacy of malic acid against Listeria monocytogenes attached to poultry skin during refrigerated storage. Poultry Sci 92:1936-1941 15. González-Fandos E, Herrera B (2013) Efficacy of propionic acid against Listeria monocytogenes attached to poultry skin during refrigerated storage. Food Control 34:601-606

Int. Microbiol. Vol. 18, 2015

175

16. Grilli E, Vitari F, Domeneghini C, Palmonari A, Tosi G, Fantinati P, Massi P, Piva A (2013) Development of a feed additive to reduce caecal Campylobacter jejuni in broilers at slaughter age: from in vitro to in vivo, a proof of concept. J Appl Microbiol 114:308-317 17. Hilbert F, Scherwitzel M, Paulsen P, Szostak M (2010) Survival of Campylobater jejuni under atmospheric oxygen tension with the support of Pseudomonas spp. Appl Environ Microbiol 76:5911-5917 18. ICMSF (International Commission on Microbiological Specifications for Foods) (1978) Microorganisms in foods. 1: Their significance and methods of enumeration. 2nd ed. University of Toronto Press, Toronto, Canada 19. ICMSF (International Commission on Microbiological Specifications for Foods) (1996) Microorganisms in foods. Vol 5. Characteristic of microbial pathogens. Blackie Academic & Professional, London, UK 20. ICMSF (International Commission on Microbiological Specifications for Foods) (1998). Microorganisms in foods. Vol 6. Microbial specifications of food commodities. Blackie Academic & Professional, London, UK 21. Kwon YM, Ricke SC (1999). Salmonella typhimurium poultry isolate growth response to propionic acid and sodium propionate under aerobic and anaerobic conditions. Int Biodeter Biodegr 43:161-165 22. Mani-López E, García HS, López-Malo A (2012) ���������������������� Organic acids as antimicrobials to control Salmonella in meat and poultry products. Food Res Int 45:713-721 23. Milillo SR, Ricke SC (2010) Reduction of Salmonella in a model raw chicken media using a combined thermal and acidified organic acid salt intervention treatment. J Food Sci 75:121-125 24. Odgen SK, Guerrero I, Taylor AJ, Escalona H, Gallardo F (1995) Chang������ es in odour, colour and textute during the storage of acid preserved meat. Lebensm-Wiss und Technol 28:521-527 25. Odgen SK, Taylor AJ, Dodd ER, Guerrero I, Escalona H, Gallardo F (1996) The ���������������������������������������������������������������� effect of combining propionic and ascorbic acid on the keeping qualities of fresh minced pork during storage. Lebensm-Wiss und Technol 29:227-233 26. Rosenquist H, Nielsen NL, Sommer HM, Norrung B, Christensen BB (2003) Quantitative risk assessment of human campylobacteriosis associated with thermophilic Campylobacter species in chickens. Int J Food Microbiol 83:87-103 27. Shin SY, Hwang HJ, Kim WJ (2001) Inhibition of Campylobacter jejuni in chicken by ethanol, hydrogen peroxide, and organic acids. J Microbiol Biotechn 11:418-422 28. Simón A, González-Fandos E (2009) Effect of washing with citric acid and antioxidants on the color and microbiological quality of whole mushrooms (Agaricus bisporus L.). Int J Food Sci Tech 44:2500-2504 29. Simón A, González-Fandos E, Vázquez M (2010) Effect of washing with citric acid and packaging in modified atmosphere on the sensory and microbiological quality of sliced mushrooms (Agaricus bisporus L.). Food Control 21:851-856 30. S�������������������������������������������������������������������� urekha M, Reddy SM (2000) Preservatives. Classsification and properties. In: Robinson RK, Batt CA, Patel C (eds) Encyclopedia of Food Microbiology. Academic Press, New York, USA, pp 17190-1717 31. Tamblyn, KC, Conner DE (1997) Bactericidal activity of organic acids against Salmonella typhimurium attached to broiler chicken skin. J Food Protect 60:629-633 32. Zhao T, Doyle MP (2006) Reduction of Campylobacter jejuni on chicken wings by chemical treatments. J Food Protect 69:762-767


RESEARCH ARTICLE International Microbiology (2015) 18:177-187 doi:10.2436/20.1501.01.248. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Contribution of vesicle-protected extracellular DNA to horizontal gene transfer in Thermus spp. Alba Blesa, José Berenguer* Center of Molecular Biology Severo Ochoa, Autonomous University of Madrid-CSIC, Madrid, Spain Received 15 July 2015 · Accepted 15 August 2015

Summary. Highly efficient apparatus for natural competence and conjugation have been shown as the major contributors to horizontal gene transfer (HGT) in Thermus thermophilus. In practical terms, both mechanisms can be distinguished by the sensitivity of the former to the presence of DNAse, and the requirement for cell to cell contacts in the second. Here we demonstrate that culture supernatants of different strains of Thermus spp. produce DNAse-resistant extracellular DNA (eDNA) in a growth-rate dependent manner. This eDNA was double stranded, similar in size to isolated genomic DNA (around 20 kbp), and represented the whole genome of the producer strain. Protection against DNAse was the consequence of association of the eDNA to membrane vesicles which composition was shown to include a great diversity of cell envelope proteins with minor content of cytoplasmic proteins. Access of the recipient cell to the protected eDNA depended on the natural competence apparatus and elicited the DNA–DNA interference defence mediated by the Argonaute protein. We hypothesize on the lytic origin of the eDNA carrying vesicles and discuss the relevance of this alternative mechanism for HGT in natural thermal environments. [Int Microbiol 18(3):177-187 (2015)] Keywords: Thermus · horizontal gene transfer · extracellular vesicles

Introduction Horizontal gene transfer (HGT) is a common trait among bacteria, playing a main role in sudden acquisition of complex properties for adaptation to changing environments. In this sense, HGT seems to have played a major role in the adaptation of hyperthermophilic bacteria to high temperatures given the high percentage of genes from Archaeal origin in phylogenetic groups such as Thermotogales and Thermales [2,54]. Despite the description in the last decade of alternative mechanisms for HGT such as nanopods [49], gene transfer Corresponding author: J. Berenguer Centro de Biología Molecular Severo Ochoa (UAM-CSIC) Facultad de Ciencias Universidad Autónoma de Madrid 28049 Cantoblanco (Madrid), Spain Tel. +34-911964498. Fax +34-911964420 E-mail: jberenguer@cbm.csic.es *

agents (GTAs) [30] or nanotubes [17], transformation, transduction and conjugation still remain as the major mechanisms for HGT in bacteria [20, 24]. From these classical pathways, transformation requires either the secretion of DNA to the environment or the lysis of the donor cells to produce the extracellular DNA (eDNA) taken up by natural competent cells. The bulk of this eDNA is linked to cell death and lysis, including fratricide processes [25]. In particular, eDNA release is often triggered by the lysis of a subpopulation of cells, sometimes as part of the end stage of the bacterial life cycle or as a consequence of unbalanced growth prompted by environmental variations such as nutrient availability or predation [43]. In other cases, eDNA release is related to apoptotic cell lysis, induced by autolysins such as LytM and AtlE in Staphylococcus aureus [4], GelE an SprE in Enterococcus faecalis [53] or LytF and AtlS in Streptococcus gordonii [57]. Also bacteriophage-mediated lysis contribute to the production of eDNA,


178

Int. Microbiol. Vol. 18, 2015

in different bacteria [40]. In addition, antibiotic treatments, especially with beta-lactams produce cell lysis and eDNA accumulation. In contrast to cell-lysis mediated eDNA production, many bacteria actively secrete extracellular eDNA in a lysis-independent way, leaded by specific mechanisms under the control of quorum-sensing systems [14,42]. Several studies in both Grampositive and Gram-negative bacteria have pointed out variations in eDNA production during the growth cycle [28], either to battle host defence responses [38], or associated to high cell density populations [7]. Likewise, presence of antibiotics and detergents in the environment and changes in the salinity or pH of the extracellular milieu, for instance, may alter eDNA production as a reaction to environmental stress [13,37]. Whichever the mechanism involved, eDNA can play different roles in the environment. On the one hand, eDNA can be used by competent cells as the HGT source of new genes, including antibiotic resistances, virulence factors or enzymes. Also, eDNA is used by several bacteria as a stabilizing component of the biofilm matrix [14], being vital in the early stages of biofilm development [19, 46], as it facilitates adhesion, aggregation and maintenance of the integrity biofilm structures [4,14,44]. This is of particular interest from a clinical point of view, where biofilms play major roles in colonization and infection [9]. Studies on pathogenic multidrug-tolerant Staphylococci, Pneumococci or Streptococci have emphasized the high yields of eDNA present in their biofilms, being up to 50 % more than in P. aeruginosa biofilms [51], where degradation by DNase I treatment significantly reduced biofilm pathogenicity [31,33]. Therefore, eDNA production within the biofilm not only contributes to the spread of toxins but also promotes biofilm persistence, enduring the resistance of pathogens against antibiotics, ultimately broadening the prevalence of its virulence [9,31,33,38,51]. However, in the environment, eDNA coexists with DNases and nucleases secreted by the surrounding microbial community, which will rapidly degrade it as a way to gain nutrients for growth. An apparently widespread mechanism to protect eDNA from degradation involves the production of the so-called extracellular vesicles (EVs), that shelter the eDNA from the action of nucleases either by effective encapsulation, shielding the DNA, or by adsorption to their surface, blocking the access of DNAses by steric interactions. This way, the half-life of the eDNA in the environment increases, expanding the time window for HGT [5]. Such protective mechanisms could be especially relevant in thermal environments, where protective strategies could be required to prevent eDNA also from denaturation [50].

BLESA, BERENGUER

Thermus thermophilus is one of the best known thermophilic bacteria because its easy growth under laboratory conditions, sequence availability [23] and genetic accessibility [10]. Many strains of T. thermophilus can acquire linear or circular DNA at exceptionally high rates through a constitutively-expressed transformation apparatus [48]. Most of the DNA taken up by the cell is destroyed through a yet poorly understood DNA-DNA interference mechanism dependent on a thermophilic homologue (ttAgo) to the human Argonaute protein [52], supporting that natural competence more likely evolved to get nutrients from the environment than to acquire new genetic information. On the other hand, T. thermophilus is also able to transfer DNA by means of a conjugation-like mechanism poorly characterized, but that allows the transferred DNA to escape from the ttAgo’s surveillance, suggesting a major relevance in HGT within the genus [6]. We describe here the existence of an alternative route of HGT in T. thermophilus based on the production of DNaseprotected eDNA. Long-term protection of T. thermophilus eDNA is due to its association to extracellular membrane vesicles generated by cell lysis. We show that this vesicle associated eDNA can be incorporated into the genome of recipient T. thermophilus cells through its natural competence apparatus.

Materials and methods Bacterial strains and growth conditions. The bacterial strains used in this study are listed in Table 1. Escherichia coli DH5α was used for plasmid construction. E. coli was routinely grown at 37 ºC in LB broth or plates [32]. T. thermophilus was grown aerobically under rotational shaking (150 rpm) at 60°C or 70ºC in TB [41] or in mineral M162 medium [15]. Kanamycin (Km, 30 µg/l), Ampicillin (Am, 100 µg/l) and/or Hygromycin B (Hyg, 100 µg/l) were added when needed for selection. Plasmids and insertional mutants. pMKpnqosYFP is a bi-functional plasmid selectable with Km both in E. coli and T. thermophilus. It encodes a thermostable yellow fluorescent protein (sYFP) expressed in T. thermophilus from the nqop promoter [1]. Transformation of this plasmid into Thermus spp. was done either by natural competence or by electroporation, depending on the strain. Insertion mutants in the pyrE or gdh genes was done by transformation with plasmid pK18::pyrE and genomic DNA from a gdh::kat derivative of T. thermophilus HB27 [11], respectively. Isolation of extracellular membrane vesicles for TEM analysis. Isolation of EVs was performed following described methods [29]. Briefly, cultures were filtered through 0.45 μm nitrocellulose filters (Whatman PROTRAN BA85) and the cell-free fraction was further centrifuged at 6000 × g for 20 min at room temperature to eliminate large cell fragments. Supernatants were further filtered through 0.22 μm filters before ultracentrifugation (150.000 × g for 2.5 h at 4ºC) to collect the EVs. The EVs were washed twice in HEPES (50 mM, pH: 7.5) buffer by cen-


HGT IN T. THERMOPHILUS

Int. Microbiol. Vol. 18, 2015

179

Table 1. Strains used in this work Strain

Genotype

Phenotype/use

Reference

Escherichia coli DH5α

F- endA1 hsdR17 supE44 thi-1 recA1 gyrA96 relA1 Δ(argF-lacZYA) U 169 Φ80dlacΔM15

Cloning

[22]

Thermus aquaticus YT1

Wild type

T. aquaticus syfp

T. aquaticus YT1 [pMKPnqosyfp]

T. scotoductus SA01

Wild type

T. scotoductus pyrE

∆pyrE:kat

KmR

This work

T. scotoductus syfp

T. scotoductus SA01 [pMKPnqosyfp]

KmR

This work

T. thermophilus HB27

ATCC BAA-163 / DSM7039

Wt

Y. Koyama

T. thermophilus HB27 gdh

gdh::kat

KmR

[11]

T. thermophilus HB27EC

ago::ISTth7

Enhanced competence

[52]

T. thermophilus HB27ago-

∆ago

Enhanced competence

[52]

T. thermophilus HB27ago-gdh

∆ago, gdh::kat

Enhanced competence. KmR

[6]

T. thermophilus HB27∆pilA4

HB27EC ∆pilA4

Non competent

[6]

T. thermophilus HB27∆pilQ

HB27EC ∆pilQ

Non competent

[6]

T. thermophilus HB8

Wild type

T. thermophilus HB8 syfp

T. thermophilus HB8 [pMKPnqosyfp]

T. thermophilus SG0.5JP17-16

Wild type

T. thermophilus SG0.5 pyrE

∆pyrE:kat

KmR

This work

T. thermophilus NAR I pyrE

∆pyrE:kat

KmR

This work

T. thermophilus VG7 pyrE

∆pyrE:kat

KmR

This work

PK1

T. thermophilus HB27 [ttp0211::kat]

KmR

This work

CK1

T. thermophilus HB27 EC [gdh::kat]

KmR

[11]

CK2

T. thermophilus HB27EC [ttc1844::kat]

KmR

[6]

CK3

T. thermophilus HB27EC ∆pilA4::kat, ∆ago

KmR; non competent

[6]

DSZM 625 KmR

This work [21]

Y. Koyama KmR

This work J. Gladden

EC

trifugation (60.000 × g for 30 min), and re-suspended in 50 μl phosphate buffer (50 mM, pH 7.5). Control samples from each of the supernatants in the process were analysed for the presence of living cells and eDNA. For TEM analysis, EVs were adsorbed onto ionized Collodion-coated copper grids (300 mesh) and negatively stained with 2% (w/v) aqueous uranyl acetate. Grids were examined in a JEM 1010 transmission electron microscope (JEL, Japan) equipped with a TVIPS Tem Cam F416 (CCD SystemB) digital camera (Gauting, Germany).

[45]. Concentration of eDNA was measured by spectrophotometry and its integrity was analysed by agarose gel electrophoresis. Digestion with HindIII (Thermo Scientific) was carried out following manufacturers’ indications. Susceptibility assays to DNase I (10 units, Roche) and nuclease SI enzymes (100 units, Thermo Scientific) were carried out according to manufacturers’ indications. PCR assays of different regions of the genome were carried out with 9 oligonucleotide pairs (Table 2) that were further analysed by agarose gel electrophoresis.

Quantification and analysis of eDNA. Total DNase resistant eDNA was precipitated from 1 mL of filtered growth medium treated with DNase I (5 units, Roche) for 1 h at 37ºC. EVs-associated eDNA was extracted from EV fractions by phenol-chloroform and precipitation method

Protein analysis. EVs samples from T. thermophilus HB27 were treated at 90ºC for 10 min with Laemli´s sample buffer [29] and incubated with trypsin in gel (Promega, Madison, WI) following manufacturer’s indications. Gel extracted peptides were desalted and concentrated by OMIX C18 (Agilent


180

Int. Microbiol. Vol. 18, 2015

BLESA, BERENGUER

Table 2. Oligonucleotides used in this work. Sequence shown in low case indicates restriction site (underlined) and additional bases required for cloning Name

Use

Oligonucleotides sequence (5′ to 3′)

AB225

Construction of pk18:: pyrE

aaagaattcCTAGACCTCCTCCAAGGGCAC

AB226

Construction of pk18:: pyrE

atcaagcttATGGACGTCCTGGAGCTTTAC

AB92

Check pilA4 mutation

AAATGCTGAAGCTTGGCGGCAAC

AB93

Check pilA4 mutation

AAAAGAATTCGGGAGTTAGGCTTGGGATTGTG

AB115

Check pilQ mutation

CTTCCCAAGAGGAGGCCCAG

AB116

Check pilQ mutation

CACGTCCCTCAGGTCCTTGTG

AB171

Check ∆ago mutation

GTCTTCCTTCTCCCTCCGGAC

AB172

Check ∆ago mutation

CTTCGGGCTTTCCCTGGAG

AB63

PCR analysis for ttp0084 amplification

ttcgaattcCTTCATCCCCACCAAGTTTGAC

AB64

PCR analysis for ttp0084 amplification

aacaagcttGTCCTTCACCTTCTTGAGCTCCAG

AB67

PCR analysis for ttp00208 amplification

ttcgaattcTCCTCAAGGAGGCCCTCTG

AB68

PCR analysis for ttp00208 amplification

atcaagcttGAAGTCCGCGAACTCGGTAAG

AB90

PCR analysis for ttp00145-146 amplification

GATGCTGCTCGGATGGTTTG

AB91

PCR analysis for ttp00145-146 amplification

CCTCCAGGGAACATCCAGTAGAG

CEC78

PCR analysis for ttp00167 amplification

ttcgaattcGTCGCTGGTCATGGCGTC

CEC79

PCR analysis for ttp00167 amplification

atcaagcttCACCGCTACCTGGTGGACTC

CEC82

PCR analysis for ttc0893 amplification

ttcgaattcTACGTGGTGCTGGACGAGCTC

CEC83

PCR analysis for ttc0893 amplification

atcaagcttGTTCCGCACCAGGTAGCTCTC

CEC84

PCR analysis for ttc1415 amplification

ttcgaattcGTGGCGATGAGGATCTCCAG

CEC85

PCR analysis for ttc1415 amplification

atcaagcttGTCCGGATAGACGGCAAGCTC

AB109

PCR analysis for ttc1017-1018 amplification

atcagatctCAATGTCCCCATGCGGTTTC

AB110

PCR analysis for ttc1017-1018 amplification

ttcaagcttGTAGATGGCGTCGTGGACCTC

CEC94

PCR analysis for ttc638 amplification

ttcgaattcGCCAAAAGCCGCTCCTTCTC

CEC95

PCR analysis for ttc638 amplification

atcaagcttCGGGACGAGGTCTTTCTTTC

AB169

PCR analysis for ttc1879 amplification

atcaagcttGAGTTATTGGCCGCGCTTC

AB170

PCR analysis for ttc1879 amplification

aaaccatggCATGCGGGTGCTCAGGTG

Technologies). Results from the LC-MS/MS analysis were surveyed with SEQUEST search algorithm from Proteome Discoverer software (v. 1.4; ThermoScientific) employing Uniprot’s T. thermophilus HB27 database. Subcellular compartment allocation was performed according to PSORTb software results (v.3.0.2; Brinkman Laboratory). The frequency of peptides detected in relation to the molecular masses of the corresponding proteins was used as a proxy for the quantification of the proteins in the sample. Transformation frequency assays. T. thermophilus HB27 and its ago- derivatives strains were transformed by natural competence with either DNase-treated filtered supernatants of cultures, purified EVs, or purified DNA. DNase treatment of the DNA templates involved 1 ml of each filtered supernatant incubated in presence of 5 units of DNase I (Roche) for 1 h, amended with extra 5 units DNase I upon induction of transformation. In all cases, the donor strain was labelled with the kat gene cassette, and transfor-

mation frequencies were calculated as the number of transformants grown on Km-containing selective plates per recipient cell in triplicate assays.

Results Production of DNase-resistant e-DNA by different Thermus spp. Occurrence of DNase-resistant eDNA was detected while performing conjugation assays with T. thermophilus strains, as we observed low levels of transfer of an antibiotic resistance marker in cultures of T. thermophilus HB27 derivatives separated by 0.22 ������� ��������� m nitro-


HGT IN T. THERMOPHILUS

Int. Microbiol. Vol. 18, 2015

181

Analysis of eDNA produced by Thermus spp. The genomic content of the DNase-resistant eDNA present in the growth media was analysed by gel electrophoresis. As shown in Fig. 2A, the eDNA from the HB27 strain and its CK2 and HB27EC derivatives have a size (around 20 kbp) similar to that of whole genomic DNA isolated by conventional methods. Furthermore, confirmation of eDNA whole genome representation was attempted by two experimental strategies. On the one hand, the restriction pattern obtained from digesting eDNA samples with a restriction enzyme that has a relatively small number of cutting sites in the genome (HindIII), showed no defined products (Fig. 2A). In addition, PCR reactions on eDNA extracts provided positive products for the amplifications of several genes distributed along the chromosome (ttc genes) and the pTT27 megaplasmid (ttp genes) in all cases (Fig. 2B).

Int Microbiol

cellulose filters. Moreover, the control experiment showed that this DNA transfer was also detectable in the presence of DNase I, supporting that the transferred eDNA was protected from the enzyme activity. To confirm this, we used DNasetreated filtered growth medium of cultures from three T. thermophilus HB27 derivatives harbouring the kat gene cassette in the pTT27 megaplasmid (PK1) or in the chromosome (CK1, CK3), in transformation assays. As shown in Fig. 1A, we detected the transfer of the kanamycin resistance to the high transformation-efficiency T. thermophilus HB27 Δago strain in the three cases (1.7 ± 0.68 × 10–6). In addition, we found no differences between the frequencies found for the transfer of megaplasmid genes (PK1) compared to that of genes located in the chromosome (CK1 and CK3). Transformation assays mediating the single recombination of pK18pyrE::kat plasmid into the highly conserved pyrE gene were performed using a variety of Thermus strains. As shown in Fig. 1B, all the strains assayed (T. thermophilus NARI, T. thermophilus SG0.5JP17-16, T. thermophilus VG7, and T. scotoductus SA1) produced enough DNase-protected eDNA as to allow the detection of pyrE::kat transformants in T. thermophilus ago- derivatives. In addition, the low sized plasmid pMKpnqosYFP could also be transferred as DNaseprotected eDNA (Fig. 1C), alike the observed transfer of genes from the chromosome and the megaplasmid.

Fig. 1. Production of DNase-resistant e-DNA by Thermus spp. (A) Production of eDNA by T. thermophilus HB27. Transfer frequencies of two chromosome (CK1, CK3) and one megaplasmid (PK1) gene labelled with the kat cassette to the T. thermophilus Δago strains were measured. (B) Production of eDNA by different Thermus spp. Transformation efficiencies to T. thermophilus Δago were measured with eDNA from cultures of the indicated Thermus spp. pyrE::kat mutants. Donor pyrE::kat strains: T. thermophilus NARI (NARI), T. scotoductus SA01 (Tsco), T. thermophilus SG0.5JP17-16 (SG0.5), T. thermophilus VG7 (VG7). (C) eDNA mediated transference of replicative plasmid. Transformation efficiencies were obtained as above for different Thermus spp. strains harboring plasmid pMKPnqosYFP. Donor strains: T. aquaticus YT1 (Taq), T. scotoductus SA01 (Tsco), T. thermophilus HB8 (HB8), T. thermophilus HB27EC (HB27EC). Error bars correspond to the mean standard deviation (n = 3)


Int. Microbiol. Vol. 18, 2015

BLESA, BERENGUER

Int Microbiol

182

Production of eDNA along cell growth. The production of eDNA along the growth cycle was assayed for the wild type HB27 strain, its Δago derivative, and the insertional mutants CK1 and CK2 (Table 1). As shown in Fig. 3, production of eDNA in the four strains was high in early exponential phase and decreased with the growth rate. Actually, production of eDNA was exacerbated during growth in rich medium at 70ºC compared to 60ºC. In contrast, in mineral medium, no eDNA was detected at 60 or 70ºC (data not shown). Protection of eDNA within extracellular mem­ brane vesicles. All the Thermus spp. strains assayed in Fig. 1, were shown to produce extracellular vesicles. Figure 4A shows a representative image of such structures. In all cases, the sizes of such vesicles were rather heterogeneous. The composition of such EVs was explored through a proteomic analysis. In addition to the identification of tryp-

Fig. 2. DNase-protected eDNA is representative of the whole genome of T. thermophilus. (A) Samples of DNase resistant eDNA, isolated from cultures of the T. thermophilus strain strains HB27, HB27EC and CK2, were treated (+) or not (-) with HindIII. Size markers (bp): M1 (23130-9420-6560-4360-23202020); M2 (4370-2899-2498-2201-1933-13311150-759-611). (B) PCR products of the indicated genes were obtained from eDNA isolated from the CK2 strain. Genomic DNA from the HB27 strain was used as positive control. Oligonucleotides employed for PCR are described in Table 2.

sin-generated peptides, we deduced a semi-quantitative analysis that gives an approximate idea of the protein content of the vesicles. Our data supported the abundance of ABC transporters and cell wall associated proteins. Moreover, bioinformatic prediction of the subcellular allocation of the identified proteins showed that most of the proteins for which a localization could be predicted belonged to cell envelope components (inner/outer membranes and periplasm) (Fig. 4B). However, a lower but significant fraction of proteins in the external vesicles were identified as cytoplasmic components (14.2%). In summary, there was a great diversity of both the EVs morphology as well as the protein components extracted from such EVs. Analysis of the DNA within EVs. As shown in Fig. 5, eDNA purified from supernatants or chemically extracted from EVs was sensitive to DNase (lanes 3 and 5) but not to S1 nuclease (lane 6). Control experiments with whole EVs


HGT IN T. THERMOPHILUS

183

Int Microbiol

Int. Microbiol. Vol. 18, 2015

Fig. 3. Production of eDNA is linked to the growth rate. The production of DNAse-resistant eDNA by different strains of T. thermophilus along the growth (OD550 nm) in TB rich medium is represented for the HB27 wild type strain and its derivatives Δago, CK2 and CK3.

show the expected protection against both enzymes (lanes 2 and 4). Thus, EV-associated eDNA is double stranded.

Discussion

Activation of Argonaute interference by EVslinked eDNA. The relevance of the competence apparatus in the mechanisms by which the EV-associated eDNA gets access to the cell was analysed. For this, we used as host the HB27 wild type strain or mutant derivatives defective in transformation (ΔpilQ, ΔpilA4). The outcome of these assays (Fig. 6A) was that neither ΔpilA4 nor ΔpilQ could be transformed, whereas transformation was detected in the wild type strain with both EVs and genomic DNA, but with much lesser efficiency in the first. We further checked if acquisition of eDNA was also subjected to DNA-DNA interference mediated by the Argonaute protein. For this, the wild type strain and its Δago derivative were transformed with EVs isolated from strains CK1 or PK1. As shown in Fig. 6B, the Δago strain was around 10 folds more efficient in transformation than its parental wild type strain, in a way similar to that found for genomic DNA.

Transformation and conjugation have been described as the major contributors to HGT in Thermus spp. [3,6,12]. Whereas the success of HGT by conjugation depends on a donor cell to encode a selectable property beneficial for the recipient cell, the broad range transformation capability of the genus allows the cells to receive DNA from distant Phyla including Archaea, as described for many genes of T. thermophilus [3,8,48]. However, the success of a transformation event depends on the availability of large sized dsDNA in the natural environment in which Thermus spp. live. In thermal environments, the integrity of the eDNA is challenged not only by the presence of DNases, secreted by several organisms to gain nutrients, but also by the melting of dsDNA at high temperatures. In this scenario, the protection of the extracellular DNA from both hydrolytic action of enzymes and melting could expand the possibility of HGT both in time and distance. Here, we provided evidence, on the one


Int. Microbiol. Vol. 18, 2015

BLESA, BERENGUER

Int Microbiol

184

Int Microbiol

Fig. 5. eDNA is double stranded and barrier-protected from nucleases. Samples were treated with DNase I (10 units, 1 h at 37ยบC) or Nuclease S1 (100 units, 1 h at 37ยบC) as indicated. Su) Supernatant from HB27; Se) eDNA extracted from Su by phenol-chloroform treatment and precipitated with ethanol; EV) Evs purified from Su by ultracentrifugation and washing; Eve) eDNA extracted from EVs; M) Molecular size markers: 23130-9420-65604360-2320-2020 bp.

Fig. 4. eDNA is protected within membrane vesicles. (A) Representative TEM images of EV fractions of the HB27EC and CK2 strains are presented. Samples adsorbed onto Collodion-coated copper grids were negatively stained with uranyl acetate. Samples were observed in a JEM 1010 transmission electron microscope. Bar represents 400 nm. (B) Pie chart displaying the relative abundance of the proteins associated to the EVs fraction, classified by their predicted subcellular localization, as predicted by P-SORT software after LC MS/MS analysis.

hand, of the ability of all the strains of Thermus spp. assayed to produce DNase-resistant eDNA, and on the other, of the capability of T. thermophilus to integrate this eDNA into its genome. The production of DNase-resistant DNA was assayed in T. aquaticus YT1, T. scotoductus SA1, and different strains of T. thermophilus, for which Km resistant insertion mutants or Km-resistance plasmid transformants could be isolated. Thus, it is likely that production of eDNA is a common trait of the genus. Moreover, through a double experimental strategy involving restriction profiles and PCR amplification, we could

demonstrate that the eDNA was double stranded, not fragmented, and included the whole genome of the producer, distributed in a random manner, with no overrepresentation of any specific genome regions (Figs. 2 and 5). Therefore, under the decribed growth conditions the genome of all the Thermus spp. strains assayed was available in the growth medium in a DNase protected form. Then, we wondered what was the nature of such protection against DNases. As classical chemical treatments to purify eDNA makes it sensitive to these enzymes (Fig. 5), we deduced that protection was the consequence of physical barriers blocking the access of the enzymes to the eDNA, and related it with the production of membrane vesicles (EVs) that were easily isolated and visualized by electron microscopy in cultures of all the strains analysed (Fig. 4A). Therefore, protection against DNase would be the consequence of the association or integration of eDNA to or into the EVs Production of EVs is a relatively common trait described in many bacteria and in a few Archaea, including extreme thermophiles [34,35,50]. In Gram-negative bacteria, EVs are produced in many species through the local destabilization of the outer membrane that produces unspecific spontaneous release of membrane blebs [34,35]. These EVs can play different functions, from secretion of proteins, to production of encapsulated eDNA. In the latter case, their function as vehicles for HGT has been shown for Neisseria gonorrhoeae [16],


Int. Microbiol. Vol. 18, 2015

185

Int Microbiol

HGT IN T. THERMOPHILUS

Fig. 6. Transformation with eDNA requires the competence apparatus and elicits Argonaute DNA-DNA interference. (A) Transformation of the HB27 strain and competence defective mutants ΔpilQ and ΔpilA with EVs fraction containing 300 ng of eDNA produced by cultures of the CK1 strain or with 20 ng of genomic DNA from the same strain. (B) Transformation frequencies of T. thermophilus HB27 (ago+) (grey bars) and its Δago (ago–) (black bars) derivative with EVs fraction (EV) from the CK1 and PK1 strains containing 500 ng of eDNA. Transformation controls with 20 ng of genomic DNA from same strains were carried out in parallel (gDNA). Transformation efficiency is expressed as the number of Kmresistant colonies per viable Δago cell. Error bars correspond to the mean standard deviation. (n = 3)

Haemophilus spp [27], E. coli [58], Pseudomonas aeruginosa [26], Helicobacter pylori [42] and Salmonella spp [55]. Among Gram-positives, production of EVs seems less frequent, or at least few reports have been published, including production of vesicles in Streptomyces [47] and Thermoanaerobacterium thermosulfurogenes EM1 [36]. Among extreme thermophiles there are fewer reports on EVs. In Sulfolobus the formation of EVs seems to be the result of a specific process mediated by endosomal sorting complex similar to that of eukaryotic cells [18]. In Thermococcus and Pyrococcus, virus-like membrane vesicles are produced that contain genomic DNA making it highly resistant to DNase treatment and heat denaturation [50]. The EVs produced by Thermus spp. were quite heterogeneous in size (Fig. 4A) and contained such a large variety of proteins (including cytoplasmic ones) that we concluded that their generation was more likely the consequence of cell lysis rather than the products of a specific EV-generation apparatus, for which a much defined protein composition pattern could be expected. Actually, our data showing decreased pro-

duction of eDNA in cells growing at lower rates (60ºC in rich medium, or mineral medium), support that exacerbation of lysis is the consequence of unbalanced growth under non natural conditions. In this sense, population stress increased by accelerated nutrient demand of fast growing cultures would drive a higher cell lysis which, in return, would feed the survivals [39,56]. In this scenario, protection of eDNA against DNases would be a lateral consequence of the production of lytic vesicles. If, as supported by our data, the EVs produced are the consequence of lysis of fast growing cultures, the following question is how the EVs-protected eDNA gets access to a recipient cell. Fusion processes between the EVs and the outer envelope of Thermus spp. cannot be ruled out at present, but having in mind the presence of a regular surface layer acting as a scaffold of the outer membrane in these bacteria [10], the existence of such fusion processes seems unlikely. On the other hand, the likely lytic origin of these EVs suggests that the eDNA could be not just inside the EVs, but that it could be adsorbed to their surface tight or deep enough as to block the


186

Int. Microbiol. Vol. 18, 2015

access to DNase, but still allowing the competence apparatus of Thermus to take it up. In favour of this hypothesis we found >100-fold difference in transformation efficiencies between eDNA and genomic DNA (Fig. 6B). Moreover, the requirement for an active competence system, demonstrated by the lack of Km resistance colonies on transformation assays involving ΔpilQ and ΔpilA4 strains (Fig. 6A), and the sensitivity of this eDNA to the Argonaute DNA-DNA mediated interference supports that transformation is the way by which EVs-associated eDNA enters the cell. A final question is the biological significance of the EVs in HGT in natural environments. Under the laboratory conditions assayed, production of EVs is associated to rapid growth in rich medium, an unlikely circumstance in environmental context where the scarcity of nutrients makes the growth uneven and rarely fast. However, cell lysis is part of normal life in nature more related with cell stress than with fast growth, and the formation of lytic EVs from different origins with protected eDNA bound to their surface but still accessible to the competence apparatus of Thermus is likely to occur frequently. In this scenario, EVs could function as reservoir of genetic material in a protected but still accessible way, increasing its resistance to enzymes, heat and time, as shown for the EVs of Thermococcus and Pyrococcus [50]. Actually, EVs produced by Thermus and stored at 4ºC for 20 months in the presence of DNase are still active in transformation experiments, supporting the role of EVs as vehicles for HGT over long periods of time. Acknowledgements. This work has been supported by grant BIO201344963-R from the Spanish Ministry of Economy and Competence, and Grant number 324439 of the FP7-PEOPLE-2012-IAPP from the European Union to J. Berenguer. An institutional grant from Fundación Ramón Areces to CBMSO is also acknowledged. AB holds a FPI fellowship for by the Spanish Ministry of Education. Competing interests. None declared.

References 1. Al-Ramahi, Y (2013) Ingeniería de proteínas fluorescentes y aplicaciones de localización celular en microorganismos termófilos. 2013. PhD Thesis. Universidad Autónoma de Madrid 1. Aravind L, Tatusov R, Wolf Y, Walker D, Koonin E (1998) Evidence for massive gene exchange between archaeal and bacterial hyperthermophiles. Trends Genet 14:442-444 2. Averhoff B (2009) Shuffling genes around in hot environments: the unique DNA transporter of Thermus thermophilus. FEMS Microbiol Rev 33:611-626 3. Bao Y, Zhang X, Jiang Q, Xue T, Sun B (2015) Pfs promotes autolysis-

BLESA, BERENGUER

dependent release of eDNA and biofilm formation in Staphylococcus aureus. Med Microbiol Immun 204:215-226 4. Basse G, Lorenz MG, Wackernagel W (1994) A biological assay for the sensitive and quantifiable detection of extracellular microbial DNases. J Microbiol Methods 20:137-147 5. Blesa A, César CE, Averhoff B, Berenguer J (2015) Non canonical cellto-cell DNA transfer in Thermus spp. is insensitive to Argonaute-mediated interference. J Bacteriol 197:138-146 6. Blokesch M, Schoolnik GK (2008) The extracellular nuclease Dns and its role in natural transformation of Vibrio cholerae. J Bacteriol 190:7232-7240 7. Brüggemann H, Chen C (2006) Comparative genomics of Thermus thermophilus: Plasticity of the megaplasmid and its contribution to a thermophilic lifestyle. J Biotechnol 124:654-661 8. Carrolo M, Frias MJ, Pinto FR, Melo-Cristino J, Ramirez M (2010) Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae. PLoS One 5:e15678-e15678 9. Cava F, Hidalgo A, Berenguer J (2009) Thermus thermophilus as biological model. Extremophiles 13:213-231 10. Cava F, Zafra O, Magalon A, Blasco F, Berenguer J (2004) A new type of NADH dehydrogenase specific for nitrate respiration in the extreme thermophile Thermus thermophilus. J Biol Chem 279:45369-45378 11. César CE, Álvarez L, Bricio C, van Heerden E, Littauer D, Berenguer J (2012) Unconventional lateral gene transfer in extreme thermophilic bacteria. Int Microbiol 14:187-199 12. Chatterjee S, Chaudhuri K (2012) Outer membrane vesicles of bacteria. Springer Science & Business Media 13. Das T, Sehar S, Manefield M (2013) The roles of extracellular DNA in the structural integrity of EPS and bacterial biofilm development. Env Microbiol Rep 5:778-786 14. Degryse E, Glansdorff N, Pierard A (1978) A comparative analysis of extreme thermophilic bacteria belonging to the genus Thermus. Arch Microbiol 117:189-196 15. Dorward DW, Garon CF (1989) DNA-binding proteins in cells and membrane blebs of Neisseria gonorrhoeae. J Bacteriol 171:4196-4201 16. Dubey GP, Ben-Yehuda S (2011) Intercellular Nanotubes Mediate Bacterial Communication. Cell 144:590-600 17. Ellen A, Albers SV, Huibers W, Pitcher A, Hobel CV, Schwarz H, Folea M, Schouten S, Boekema E, Poolman B, Driessen AM (2009) Proteomic analysis of secreted membrane vesicles of archaeal Sulfolobus species reveals the presence of endosome sorting complex components. Extremophiles 13:67-79 18. Flemming H-C, Wingender J (2010) The biofilm matrix. Nat Rev Microbiol 8:623-633 19. Gogarten JP, Townsend JP (2005) Horizontal gene transfer, genome innovation and evolution. Nat Rev Microbiol 3:679-687 20. Gounder K, Brzuszkiewicz E, Liesegang H, Wolherr A, Daniel R, Gottschalk G, Reva O, Kumwenda B, Srivastava M, Bricio C, Berenguer J, van Heerden E, Litthauer D (2011) Sequence of the hyperplastic genome of the naturally competent Thermus scotoductus SA-01. BMC Genomics 12:577 21. Grant SG, Jessee J, Bloom FR, Hanahan D (1990) Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylationrestriction mutants. Proc Natl Acad Sci USA 87:4645-4649 22. Henne A, Bruggemann H, Raasch C, Wiezer A, Hartsch T, Liesegang H, Johann A, Lienard T, Gohl O, Martinez-Arias R, Jacobi C, Starkuviene V, Schlenczeck S, Dencker S, Huber R, Klenk H, Kramer W, Merkl R, Gottschalk G, Fritz H (2004) The genome sequence of the extreme thermophile Thermus thermophilus. Nat Biotechnol 22:547-553 23. Jain R, Rivera MC, Moore JE, Lake JA (2003) Horizontal gene transfer accelerates genome innovation and evolution. Mol Biol Evol 20:1598-1602


HGT IN T. THERMOPHILUS

24. Jakubovics NS, Shields RC, Rajarajan N, Burgess JG (2013) Life after death: the critical role of extracellular DNA in microbial biofilms. Lett Appl Microbiol 57:467-475 25. Kadurugamuwa JL, Beveridge TJ (1995) Virulence factors are released from Pseudomonas aeruginosa in association with membrane vesicles during normal growth and exposure to gentamicin: a novel mechanism of enzyme secretion. J Bacteriol 177:3998-4008 26. Kahn ME, Barany F, Smith HO (1983) Transformasomes: specialized membranous structures that protect DNA during Haemophilus transformation. Proc Natl Acad Sci USA 80:6927-6931 27. Kulp A, Kuehn MJ (2010) Biological functions and biogenesis of secreted bacterial outer membrane vesicles. Annu Rev Microbiol 64:163-184. 28. Laemmli UK, Paulson JR, Hitchins V (1974) Maturation of the head of bacteriophage T4. V. A possible DNA packaging mechanism: In vitro cleavage of the head proteins and the structure of the core of the polyhead. J Supramol Struct 2:276-301 29. Lang AS, Zhaxybayeva O, Beatty JT (2012) Gene transfer agents: phagelike elements of genetic exchange. Nat Rev Microbiol 10:472-482 30. Lappann M, Claus H, Van Alen T, Harmsen M, Elias J, Molin S, Vogel U (2010) A dual role of extracellular DNA during biofilm formation of Neisseria meningitidis. Mol Microbiol 75:1355-1371 31. Lennox E (1955) Transduction of linked genetic characters of the host by bacteriophage P1. Virology 1:190-206 32. Martins M, Henriques M, Lopez‐Ribot JL, Oliveira R (2012) Addition of DNase improves the in vitro activity of antifungal drugs against Candida albicans biofilms. Mycoses 55:80-85 33. Mashburn LM, Whiteley M (2005) Membrane vesicles traffic signals and facilitate group activities in a prokaryote. Nature 437:422-425 34. Mashburn‐Warren LM, Whiteley M (2006) Special delivery: vesicle trafficking in prokaryotes. Mol Microbiol 61:839-846 35. Mayer F, Gottschalk G (2002) The bacterial cytoskeleton and its putative role in membrane vesicle formation observed in a Gram-positive bacterium producing starch-degrading enzymes. J Mol Microbiol Biotechnol 6:127-132 36. McBroom AJ, Kuehn MJ (2007) Release of outer membrane vesicles by Gram-negative bacteria is a novel envelope stress response. Mol Microbiol 63:545-558 37. Olaya-Abril A, Prados-Rosales R, McConnell MJ, Martín-Peña R, González-Reyes JA, Jiménez-Munguía I, Gómez-Gascón L, Fernández J, Luque-García JL, García-Lidón C, Estévez H, Pachón J, Obando I, Casadevall A, Pirofski L, Rodríguez-Ortega MJ (2014) Characterization of protective extracellular membrane-derived vesicles produced by Streptococcus pneumoniae. J Prot 106:46-60 38. Pavlostathis SG, Marchant R, Banat IM, Ternan NG, McMullan G (2006) High growth rate and substrate exhaustion results in rapid cell death and lysis in the thermophilic bacterium Geobacillus thermoleovorans. Biotechnol Bioeng 95:84-95 39. Petrova OE, Schurr JR, Schurr MJ, Sauer K (2011) The novel Pseudomonas aeruginosa two‐component regulator BfmR controls bacteriophage‐mediated lysis and DNA release during biofilm development through PhdA. Mol Microbiol 81:767-783 40. Ramirez-Arcos S, Fernandez-Herrero LA, Marin I, Berenguer J (1998) Anaerobic growth, a property horizontally transferred by an Hfr-like mechanism among extreme thermophiles. J Bacteriol 180:3137-3143

Int. Microbiol. Vol. 18, 2015

187

41. Ricci V, Chiozzi V, Necchi V, Oldani A, Romano M, Solcia E, Ventura U (2005) Free-soluble and outer membrane vesicle-associated VacA from Helicobacter pylori: two forms of release, a different activity. Biochem Biophys Res Commun 337:173-178 42. Rice KC, Bayles KW (2008) Molecular control of bacterial death and lysis. Microbiol and Mol Biol Rev 72:85-109 43. Sahu PK, Iyer PS, Oak AM, Pardesi KR, Chopade BA (2012) Characterization of eDNA from the clinical strain Acinetobacter baumannii AIIMS 7 and its role in biofilm formation. Scientific World J 2012 44. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press. 45. Schooling SR, Beveridge TJ (2006) Membrane vesicles: an overlooked component of the matrices of biofilms. J Bacteriol 188:5945-5957 46. Schrempf H, Merling P (2015) Extracellular Streptomyces lividans vesicles: composition, biogenesis and antimicrobial activity. Microb Biotech 8:644-658. 47. Schwarzenlander C, Averhoff B (2006) Characterization of DNA transport in the thermophilic bacterium Thermus thermophilus HB27. FEBS J 273:4210-4218 48. Shetty A, Chen S, Tocheva EI, Jensen GJ, Hickey WJ (2011) Nanopods: a new bacterial structure and mechanism for deployment of outer membrane vesicles. PLoS One 6:e20725 49. Soler N, Marguet E, Verbavatz J-M, Forterre P (2008) Virus-like vesicles and extracellular DNA produced by hyperthermophilic archaea of the order Thermococcales. Res Microbiol 159:390-399 50. Steinberger RE, Holden PA (2005) Extracellular DNA in single- and multiple-species unsaturated biofilms. Appl Env Microbiol 71:54045410 51. Swarts DCJ, Matthijs M, Westra ER, Zhu Y, Janssen JH, Snijders AP, Wang Y, Patel DJ, Berenguer J, Brouns ST, van der Oost J (2014) DNA- guided DNA interference by a prokaryotic Argonaute. Nature 507:258-261 52. Thomas VC, Thurlow LR, Boyle D, Hancock LE (2008) Regulation of autolysis-dependent extracellular DNA release by Enterococcus faecalis extracellular proteases influences biofilm development. J Bacteriol 190:5690-5698 53. van Wolferen M, Ajon M, Driessen AJ, Albers SV (2013) How hyperthermophiles adapt to change their lives: DNA exchange in extreme conditions. Extremophiles 17:545-563 54. Wang H, Huang Y, Wu S, Li Y, Ye Y, Zheng Y, Huang R (2014) Extracellular DNA inhibits Salmonella enterica serovar Typhimurium and S. enterica serovar Typhi biofilm development on abiotic surfaces. Curr Microbiol 68:262-268 55. Wells JE, Russell JB (1996) The effect of growth and starvation on the lysis of the ruminal cellulolytic bacterium Fibrobacter succinogenes. Appl Env Microbiol 62:1342-1346 56. Xu Y, Kreth J (2013) Role of LytF and AtlS in eDNA release by Streptococcus gordonii. PLoS One 8: e62339 57. Yaron S, Kolling GL, Simon L, Matthews KR (2000) Vesicle-mediated transfer of virulence genes from Escherichia coli O157: H7 to other enteric bacteria. Appl Env Microbiol 66:4414-4420


RESEARCH ARTICLE International Microbiology (2015) 18:189-194 doi:10.2436/20.1501.01.249. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Dormancy in Deinococcus sp. UDEC-P1 as a survival strategy to escape from deleterious effects of carbon starvation and temperature Matías Guerra, Karina González, Carlos González, Boris Parra, Miguel Martínez* Department of Microbiology, Faculty of Biological Sciences, University of Concepción, Concepción, Chile Received 29 July 2015 · Accepted 20 September 2015

Summary. Dormancy is characterized by low metabolism and absence of protein synthesis and cellular division enabling bacterial cells to survive under stress. The aim was to determine if carbon starvation and low temperature are factors that modify the proportion of dormant/active cells in Deinococcus sp. UDEC-P1. By flow cytometry, RedoxSensor Green (RSG) was used to quantify metabolic activity and Propidium Iodide (PI) to evaluate membrane integrity in order to determine the percentage of dormant cells. Cell size and morphology were determined using scanning electronic microscopy. Under carbon starvation at 30°C, Deinococcus sp. UDEC-P1 increased its proportion of dormant cells from 0.1% to 20%, decreased the count of culturable cells and average cell volume decreased 7.1 times. At 4°C, however, the proportion of dormant cells increased only to 6%, without a change in the count of culturable cells and an average cellular volume decrease of 4.1 times and 3% of the dormant cells were able to be awakened. Results indicate a greater proportion of dormant Deinococcus sp. UDEC-P1 cells at 30ºC and it suggests that carbon starvation is more deleterious condition at 30ºC than 4ºC. For this reason Deinococcus sp. UDEC-P1 cells are more likely to enter into dormancy at higher temperature as a strategy to survive. [Int Microbiol 18(3):189-194 (2015)] Keywords: Deinococcus · dormancy · metabolism · starvation · flow cytometry

Introduction Bacterial metabolism depends directly on physiochemical environmental conditions, such as carbon availability [31]. Under nutrient-limited conditions, bacteria exhibit intermittent growth [24] and a bacterial population often contains cells in distinct physiological states: metabolically active, damaged, dead, or dormant [17]. Dormant cells are characterized by low metabolism, halted DNA and protein synthesis and nonproliferation [22]. Lennon and Jones [21] proposed that Corresponding author: Miguel Martínez Departamento de Microbiología Facultad de Ciencias Biológicas Universidad de Concepción, P.O. Box 160-C Concepción, Chile Tel. +56-41-2207050. Fax +56-41-2245975 E-mail: mimartin@udec.cl *

dormant bacteria serve as a “seed bank,” permitting the later recuperation of the population once conditions improve. In fact, metabolic dormancy can be induced in response to unfavorable environmental changes, triggering modifications in gene expression and protein synthesis, which in turn reduce bacterial metabolism [5,12]. In low temperature environments, for example, bacterial cell have almost undetectable metabolic activity [25,27]. It has been described that bacteria belonging to the genus Deinococcus have a greater ability to resist and survive under rigorous conditions [11,30]. Considering that limited nutrients and temperatures close to the freezing point of water are known to decrease the rate of bacteria growth and lead to metabolic dormancy [2,16,27], the aim of this work was to determine if carbon starvation and low temperature are factors that modify the proportion of dormant/active cells in Deinococcus sp. UDEC-P1.


190

Int. Microbiol. Vol. 18, 2015

Material and methods Bacterial strain. Deinococcus sp. UDEC-P1 was isolated from Témpanos Lake, an oligotrophic lake in the Chilean Patagonia [7] and Escherichia coli HB101 was used as control. Carbon starvation. The bacterial strains were cultured at 30°C in R2A broth for 36 h with constant shaking (120 rpm). Subsequently, 30 ml of the culture was centrifuged at 1500 g for 30 min at 4°C, the supernatant was removed, and the pellet was resuspended in Mineral Saline Medium (MSM) [1], a procedure which was repeated three times. The washed bacterial cells were then inoculated in 100 ml of MSM without carbon source at a cellular density of ca 1.0 ×106 cells/ml in Erlenmeyer and incubated at 30°C or 4°C for 20 days. The experiment was carried out three times at each temperature. Additionally, bacterial cells from the R2A broth were inoculated at a cellular density of ca. 1.0 ×106 cells/ml in 300 ml of R2A broth and incubated at 30ºC with constant shaking (120 rpm) until the end of the exponential phase (48 h). At the beginning of the experiment, and after 20 days of carbon starvation, culturable cells were counted in agar R2A [10]. The number of cells with intact or damaged membrane was assessed by fluorescence microscopy using the Live/Dead BacLight Bacterial Viability Kit (Molecular Probes, Oregon, USA). Bacterial counts were compared by means of an ANOVA statistical analysis, with a 95% confidence interval (P < 0.05). Determination of metabolic activity and membrane integrity. Flow cytometry was used to evaluate the metabolic state of bacterial cells after 20 days of carbon starvation at 30°C or 4°C. First, aliquots were filtered through polycarbonate membrane filters, pore size 0.2 μm, and washed with PBS, after which the cells were resuspended in 0.5 ml of PBS and adjusted to a cellular density of 1.0 ×107 cells/ml. Bacterial suspensions were stained with LIVE/DEAD BacLight RedoxSensor Green Viability Kit (Molecular Probes, Oregon, USA) containing RedoxSensor Green (RSG), to quantify metabolic activity, and Propidium Iodide (PI), to evaluate membrane integrity. Analysis of the flow cytometry data was performed using FlowJo v.10 software, as recommended by MIFlowcyt [20]. In order to discriminate cells from the background debris, a gate for cell detection was applied. Bacterial cells were grouped into gates, by those stained with RSG, those with PI, and those not stained neither with RSG nor PI. Bacterial cell size and volume. Using the cytometry data obtained in the previous step, the size variation of Deinococcus sp. UDEC-P1 cells stained with RedoxSensor Green (RSG+), Propidium Iodide (PI+), and those without staining (RSG-PI-) were compared using the Forward Scatter (FSC) parameter [34]. To determine the volume of cells exposed to carbon starvation at 30°C or 4°C, the length and width of 300 cell images, taken with a Scanning Electron Microscope (Jeol, JF12M6380LUV), were measured. The average cellular volume in each treatment was calculated after using the formula V = π/4d 2(L – d/3) for each cell [8]. Cell awakening. Deinococcus sp. UDEC-P1 cells incubated without carbon source at 4°C for 20 days were stained with the Kit RedoxSensor Green Viability and separated by cell sorting into events stained with RSG and those without neither RSG nor PI dye. The separated cells were adjusted to a density of ca. 2.0 ×105 cells/ml, and in each group, the culturable cell counts were determined by plating 0.1 ml on R2A agar. To evaluate the awaking of the unstained cells, considered as dormant, 150 μL of this cellular suspension were mix with either 500μl of R2A broth or 250 μl of that broth plus 250 μL of a supernatant from a 24 h Deinococcus sp. UDEC-P1 culture [7]. These mixtures were incubated for 1 h at 30°C and culturable cell counts were determined by spreading 0.1 ml on R2A agar or

GUERRA ET AL.

on R2A agar supplemented with 1 ml of supernatant, as suggested by Ayrapetyan [2]. In addition, an aliquot of 500μl of the unstained events was stained with 1μl (1.67 mM) of SYTO 9, Green Fluorescent Nucleic Acid Stain (Molecular Probes, Oregon, USA), in order to detect DNA by flow cytometry in cells considered as dormant. Flow cytometry and cell sorting. Flow cytometry was conducted with a BD FACSAria III sorter (BD, New Jersey, USA) equipped with a 20 mW 488 nm argon solid state laser. Bacterial samples were suspended in PBS buffer with 6.0 μm diameter microspheres at a concentration of approximately 106 beads/ml, and 100,000 events were analyzed with the Forward Scatter (FSC) and Side Scatter (SSC) detectors with a 500 to 5000 events/s sampling rate. Thresholds in FSC were set at 1000 and 200 for Deinococcus sp. UDEC-P1 and E. coli HB101, respectively. Bacteria stained with the RSG and SYTO 9 dyes were detected with a 530/30 band-pass filter, and the red fluorescent emission of the PI stain with a 616/23 band-pass filter. Fluorescence signals of stains were compensated using controls with only RSG or PI for a each experiment. The PI single-stained controls were performed using dead cells previously treated with ethanol at –20°C. Cell sorting was carried out to obtain dormant bacterial subpopulations, for this purpose cells that emitted fluorescence (RSG or PI) were separated from the non-fluorescent cells and collected in a sterile flask contained PBS buffer.

Results Cellular response to carbon starvation. At the beginning of the experiment, 89% of the Deinococcus sp. UDEC-P1 cells inoculated in MSM without carbon were stained with RSG, 10% with PI and 0.1% were unstained (Table 1). After 20 days of carbon starvation at 30°C, the number of culturable cells and cells with an intact membrane decreased one order of magnitude (P < 0.05), (Fig. 1A). Flow cytometry analysis showed that 68% of the Deinococcus sp. UDEC-P1 population incorporated PI, 25% were stained with RSG, and 7% were nonstained and therefore considered as dormant (Table 1). When the analysis did not included PI stained cells [3], dormant cells accounted for 20%. Under the same conditions, E. coli also significantly decreased its cell count (P < 0.05) (Fig. 1B), besides RSG stain cells decreased from 83% to 5% after carbon starvation while unstained cells increased from 5% to 71% (Table 1). When only cells with an intact membrane were taken into account, this proportion increased to 93%. Under carbon starvation at 4°C for 20 days, Deinococcus sp. UDEC-P1 showed no change in culturable cells counts (Fig 1a). Flow cytometry showed that 76.4% of the cells stained with RSG and there was a 5% of dormant cells (Table 1), but representing 6% if only cells with intact membrane are considered. Under identical conditions, the E. coli significantly reduced the number of culturable cells (P < 0.05) (Fig. 1B). Approximately 61% of the E. coli cells were stained with PI, 5% with RSG, and 34% were unstained (Table 1). If PI stain cells are disregarded, unstained cells (dormants) account for 87%.


DORMANCY IN DEINOCOCCUS

Int. Microbiol. Vol. 18, 2015

191

Table 1. Metabolic activity of Deinococcus sp. UDEC-P1 and E. coli HB101 performed by flow cytometry using the RedoxSensor Green Vitality Kit Deinococcus sp. UDEC-P1 (% cells) RSG(+)

RSG(–)

a

b

Escherichia coli HB101(% cells)

RSG(–)

RSG(+)

c

a

RSG(–)b

RSG(–)c

Treatment

PI(–)

PI(+)

PI(–)

PI(–)

PI(+)

PI(–)

Control R2A broth

89.3%

10.5%

0.1%

83.4%

11.3%

5.3%

Carbon starvation at 30ºC

25.3%

67.8%

6.6%

5.3%

23.5%

71.3%

Carbon starvation at 4ºC

76.4%

18.6%

5.0%

5.0%

61.3%

33.6%

a

Cells stained with RedoxSensor Green (RSG). Cells stained with Propidium Iodide (PI). Unstained cells . b

Awakening. Deinococcus sp. UDEC-P1 cells that underwent carbon starvation at 4°C were separated, by cell sorting, and RSG+ cells were adjusted to ca 2.0x105 ml-1 and 50% of these bacteria with an active metabolism were culturable (Table 2). Regarding unstained events (dormant cells), also adjusted to ca 2.0 ×105 cells/ml only 6.2×103 CFU/ ml were culturable (3.1%) (Table 2). Incubating these cells for 1h in R2A broth supplemented with Deinococcus UDEC-P1 supernatant did not increased the number of culturable cells (Table 2). Furthermore, application of SYTO 9 to the unstained events separated by cell sorting indicated the presence of DNA in dormant cells.

(SSC) median value (1,163 at 30ºC and 1,152 at 4ºC) when compared to the control (1,589) after the analysis of 5,000 events per group. Cellular volume before carbon starvation ranged from 0.6 to 15.52 μm3, with an average of 3.85 ± 2.1 μm3 (Fig. 3A). After 20 days of carbon starvation at 30°C, the cells decreased their volume 7.1 times, with an average length of 1.05 ± 0.24 μm and showed a coccobacillar morphology (Fig. 3B). Cells incubated at 4°C were only 4.1 times smaller than their initial condition, with bacillar morphology and an average length of 1.27 ± 0.31 μm (Fig. 3C).

Discussion It has been reported that during carbon starvation, some bacteria modify their morphology and cell size, decrease the synthesis of DNA, mRNA and proteins, and enter a reversible state of low or undetectable metabolic activity known as

Int Microbiol

Granularity, relative cell size and volume. Carbon starved Deinococcus sp. UDEC-P1 cells stained with RSG were larger than those unstained (or dormant cells) when cultured at 4°C or 30°C (Fig. 2) and both showed a decrease in cytoplasmic granularity, indicated by a lower Side Scatter

c

Fig. 1. Survival during carbon starvation. (A) Bacterial counts of Deinococcus sp. UDEC-P1 and (B) Escherichia coli HB101, at the beginning of the experiment (control) and after 20 days of carbon starvation at 4°C or 30°C. Culturable cells (dotted gray bar), (Log CFU/ml); cells with intact membrane (black bar ), and cells with damaged membrane (gray bar), (Log Cell/ml). *Indicates significant differences (P < 0.05) between bacteria exposed to carbon starvation and those without carbon starvation. The data was obtained in three independent experiments.


192

Int. Microbiol. Vol. 18, 2015

GUERRA ET AL.

Table 2. Awakening of dormant Deinococcus sp. UDEC-P1 cells, previously incubated under carbon starvation at 4ºC, and separated by cell sorting (adjusted at 2.0 × 105 cells/ml) non-stained events Cultivable cells (UFC/ml) Treatment

Agar R2A

Agar R2A + Supernatanta

Non-stained events

6.23 × 103

–

Non-stained events incubated 1h in R2A broth

6.51 × 103

7.28 × 103

Non-stained events incubated 1h in R2A broth supplemented with supernatant

6.73 × 10

7.49 × 103

a

3

Deinococcus sp. UDEC-P1 culture in R2A broth without cells.

a deleterious effect on this cellular structure [26]; while only 5% of E. coli HB101 cells under carbon starvation were metabolically active. This last percentage is consistent with that described by Rezaeinejad & Ivanov [29] also for E. coli. Additionally these authors determined that metabolically inactive cells preserve their protein motor force and are, therefore, potentially viable. The lower proportion of dormant cells in Deinococcus sp. UDEC-P1, when compared to E. coli HB101, may be attributed to the fact that dormancy plays a central role in ensuring survival in adverse conditions for E. coli [17,19,32]. On the other hand Deinococcus sp. UDEC-P1 cells, contain cytoplasmic inclusions such as polyphosphate and carbo­ hydrate granules [7,29,33], that could prolong metabolic activity in Deinococcus sp. UDEC-P1delaying the entrance into dormancy, as it has been previously suggested in other

Int Microbiol

dormancy [9]. Kalyuzhnaya et al [14] indicated that bacterial cells non-stained by both IP and RSG are alive but dormant, having an intact membrane. Furthermore, Zacharias et al, [35] using a monoculture of Eschericha coli, compared the results of flow cytometry associated with the Live/Dead BacLight Bacterial Viability Kit with those of qPCR, obtaining similar results with both methodologies with respect to viable bacteria. However, it has been described that high concentrations of PI (over 20 µg/mL) modifies the proportion of dormant/inactive cells [23] but PI concentrations used in the present work did not reached this concentration. Our results indicated that Deinococcus sp. UDEC-P1 increased the percentage of cells in dormancy under carbon starvation at 30°C. This increase was concomitant with a decreased count of culturable cells and an increase in the percentage of cells with a damaged membrane, indicative of

Fig. 2. Comparison of cell sizes of the different metabolic states of Deinococcus sp. UDEC-P1. Cells stained with RSG (white curve) or PI (gray curve) and those not stained (black curve) were grouped in different gates and expressed in function of Forward Scatter (FSC), proportional to cell size. These results were compared using the median value of the cells at the beginning of the experiment.


DORMANCY IN DEINOCOCCUS

193

Int Microbiol

Int. Microbiol. Vol. 18, 2015

Fig. 3. Scanning electronic microscopy of Deinococcus sp. UDEC-P1. Image at the beginning of the experiment (A), and after carbon starvation for 20 days at 30°C (B) and 4°C (C).

bacterial strains [13,28]. Our results indicated that under carbon starvation, the percentage of survival of Deinococcus sp. UDEC-P1 cells was larger at 4°C than at 30ºC. Furthermore, at 4ºC a higher proportion of cells showed active metabolism in comparison to 30°C. Perhaps, the detrimental effects of carbon starvation at 30ºC, due to a more active metabolism, results in a more rapid dead and damaged to cells [15]. Epstein [6] described that low levels of recovery of dormant cells could be due to a deep state of dormancy, with undetectable metabolic activity. Indeed, it has been proposed that the reduction of bacterial metabolism is gradual, with metabolically active cells existing alongside those with low metabolic activity and others in a state of deep dormancy [32]. These dormant cells are not immediately culturable, and the recuperation of their metabolic activity is gradual, or stochastic, according to the microbial scout hypothesis [4,6]. In concordance with this hypothesis, the presence of molecules able to stimulate the waking of dormant cells was not detected in the supernatant of Deinococcus sp. UDEC-P1. However, previous studies in this strain have described mechanisms of Quorum Sensing associated with stress [2,7]. For this reason, we suggest that future studies investigating the relationship between Quorum Sensing signals and the entry into and exit from dormancy in Deinococcus sp. UDEC-P1 should be done. Carbon starvation causes morphological and cellular volume changes in Deinococcus sp. UDEC-P1. A smaller cell size was detected in bacteria incubated at 30°C than at 4°C, reaffirming the more intense effect of carbon starvation at 30ºC than at 4ºC. By flow cytometry analysis of the Deinococcus sp. UDEC-P1 cells considered dormant showed a smaller size than metabolically active cells, similar to that described by Kim et al., [18]. Moreover, our results indicate that Deinococcus sp. UDEC- P1 decrease the cytoplasmic granularity upon carbon starvation at both temperatures,

indicating the consumption of intracellular material [26]. The dormant cells detected in Deinococcus sp. UDEC-P1 under carbon starvation at 4°C showed only a 3% culturability, this could be related to a low metabolic activity and reduced growth rate described in dormant cells [9,22]. Potential toxicity of RSG stain upon Deinococcus sp UDEC-P1 was discarded because cells stained with RSG were 52% culturable [14]. Furthermore, staining dormant events with SYTO 9 revealed the presence of DNA, indicating that the unstained events correspond to cells. Our results indicate that the strain Deinococcus sp. UDEC-P1 is less affected during carbon starvation at 4ºC. On the other hand, the increased proportion of dormant cells at 30ºC could reflect a cellular survival response to deleterious conditions, allowing them to maintain their genetic material and restart growth once conditions improve. These findings also help to explain Deinococcus ubiquity in extreme conditions. Acknowledgments. This study was supported by grants Fondecyt 1100462 and Enlace VRDI No. 214.036.041-1.0. Additionally, the authors would like to thank Ruth Contreras for her technical support and Sara Schilling for her editing support and Dr. Carlos T. Smith for the critical review of the manuscript Competing interests. None declared.

References 1. Aranda C, Godoy F, Becerra J, Barra R, Martínez M (2003) Aerobic secondary utilization of a non-growth and inhibitory substrate 2,4,6-trichlorophenol by Sphingopyxis chilensis S37 and Sphingopyxis-like strain S32. Biodegradation 14:265- 274 2. Ayrapetyan M, Williams TC, Oliver JD (2014) Interspecific quorum sensing mediates the resuscitation of viable but nonculturable vibrios. Appl Environ Microbiol 80:2478-83


194

Int. Microbiol. Vol. 18, 2015

3. Boulos L, Prevost M, Barbeau B, Coallier J, Desjardins R (1999) LIVE / DEAD BacLightE: application of a new rapid staining method for direct enumeration of viable and total bacteria in drinking water. J Microbiol Methods 37:77-86 4. Buerger S, Spoering A, Gavrish E, Leslin C, Ling L, Epstein SS (2012) Microbial scout hypothesis, stochastic exit from dormancy, and the nature of slow growers. Appl Environ Microbiol 3221-3228 5. Dworkin J, Shah IM (2010) Exit from dormancy in microbial organisms. Nat Rev Microbiol 8:890-896 6. Epstein SS (2009) ESSAY Microbial awakenings. Nature 457:1083 7. Fernandez-Bunster G, Gonzalez C, Barros J, Martinez M (2012) Quorum sensing circuit and reactive oxygen species resistance in Deinococcus sp. Curr Microbiol 65:719-725 8. Fry JC (1990) Direct methods and biomass estimation. In: Grigorova R, Norris J (eds) Methods Microbiol. Tech. Microb. Ecol. vol 22. Academic Press, London, UK, pp 41-86 9. Gengenbacher M, Rao SPS, Pethe K, Dick T (2010) Nutrient-starved, non-replicating Mycobacterium tuberculosis requires respiration, ATP synthase and isocitrate lyase for maintenance of ATP homeostasis and viability. Microbiology 156:81-87 10. Herbert RA (1990) Methods for enumerating microorganisms and determining biomass in natural environments. In: Grigorova R, Norris JW (eds) Methods Microbiol. Tech. Microb. Ecol. vol 22. London, pp 1-39 11. Hirsch P, Gallikowski CA, Siebert J, Peissl K, Kroppenstedt R, Schumann P, Stackebrandt E, Anderson R (2004) Deinococcus frigens sp. nov., Deinococcus saxicola sp. nov., and Deinococcus marmoris sp. nov., low temperature and draught-tolerating, UV-resistant bacteria from continental Antarctica. Syst Appl Microbiol 27:636-645 12. Jones SE, Lennon JT (2010) Dormancy contributes to the maintenance of microbial diversity. Proc Natl Acad Sci USA 107:5881-5886 13. Kadouri D, Jurkevitch E, Okon Y, Castro-Sowinski S (2005) Ecological and agricultural significance of bacterial polyhydroxyalkanoates. Crit Rev Microbiol 31:55-67 14. Kalyuzhnaya MG, Lidstrom ME, Chistoserdova L (2008) Real-time detection of actively metabolizing microbes by redox sensing as applied to methylotroph populations in Lake Washington. Int Soc Microb Ecol 2:696-706 15. Kaprelyants AS, Gottschal JC, Kell DB (1993) Dormancy in non-sporulating bacteria. FEMS Microbiol Rev 104:271-285 16. Kaprelyants AS, Kell DB (1993) Dormancy in stationary-phase cultures of Micrococcus luteus: Flow cytometric analysis of starvation and resuscitation. Appl Environ Microbiol 59:3187-3196 17. Kell DB, Young M (2000) Bacterial dormancy and culturability: the role of autocrine growth factors. Curr Opin Microbiol 3:238-243 18. Kim J, Hahn J-S, Franklin MJ, Stewart PS, Yoon J (2009) Tolerance of dormant and active cells in Pseudomonas aeruginosa PA01 biofilm to antimicrobial agents. J Antimicrob Chemother 63:129-135

GUERRA ET AL.

19. Korch SB, Henderson T, Hill TM (2003) Characterization of the hipA7 allele of Escherichia coli and evidence that high persistence is governed by (p)ppGpp synthesis. Mol Microbiol 50:1199-1213 20. Lee J, Spidlen J, Boyce K, Cai J, Crosbie N, et al. (2008) MIFlowCyt: the minimum information about a Flow Cytometry Experiment. Cytometry A 73:926-930 21. Lennon JT, Jones SE (2011) Microbial seed banks: the ecological and evolutionary implications of dormancy. Nat Rev Microbiol 9:119-130 22. Lewis K (2007) Persister cells, dormancy and infectious disease. Nat Rev Microbiol 5:48–56 23. Manini E, Danovaro R (2006). Synoptic determination of living/dead and active/dormant bacterial fractions in marine sediments. FEMS Microbiol Ecol 55:416-423 24. Morita Y (1988) Bioavailability of energy and its relationship to growth and starvation survival in nature. Can J Microbiol 34:436-441 25. Oliver J, Nilsson L, Kjelleberg S (1991) Formation of nonculturable Vibrio vulnificus cells and its relationship to the starvation state. Appl Environ Microbiol 57:2640-2644 26. Pavez P, Castillo JL, González C, Martínez M (2009) Poly-beta-hydroxyalkanoate exert a protective effect against carbon starvation and frozen conditions in Sphingopyxis chilensis. Curr Microbiol 59:636-640 27. Price PB, Sowers T (2004) Temperature dependence of metabolic rates for microbial growth, maintenance, and survival. Proc Natl Acad Sci USA 101:4631-4636 28. Ratcliff WC, Denison RF (2011) Bacterial persistence and bet hedging in Sinorhizobium meliloti. Commun Integr Biol 4:98-100 29. Rezaeinejad S, Ivanov V (2011) Heterogeneity of Escherichia coli population by respiratory activity and membrane potential of cells during growth and long-term starvation. Microbiol Res 166:129-135 30. Slade D, Radman M (2011) Oxidative stress resistance in Deinococcus radiodurans. Microbiol Mol Biol Rev 75:133-191 31. Tanghe A, Van Dijck P, Thevelein JM (2003) Determinants of freeze tolerance in microorganisms, physiological importance, and biotechnological applications. Adv Appl Microbiol 53:129-176 32. Tashiro Y, Kawata K, Taniuchi A, Kakinuma K, May T, Okabe S (2012) RelE-mediated dormancy is enhanced at high cell density in Escherichia coli. J Bacteriol 194:1169-1176 33. Thornley MJ, Horne RW, Glauert a M (1965) The fine structure of Micrococcus radiodurans. Arch Mikrobiol 51:267-289 34. Tzur A, Moore JK, Jorgensen P, Shapiro HM, Kirschner MW (2011) Optimizing optical flow cytometry for cell volume-based sorting and analysis. PLoS One 6:e16053 35. Zacharias N, Kistemann T, Schreiber C (2015). Application of flow cytometry and PMA-qPCR to distinguish between membrane intact and membrane compromised bacteria cells in an aquatic milieu. Int J Hyg Envir Health. doi:10.1016/j.ijheh.2015.04.001


PERSPECTIVES International Microbiology (2015) 18:195-202 doi:10.2436/20.1501.01.250. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

LERU roadmap towards Open Access LERU open access working group Summary. Money which is not directly spent on research and education, even though it is largely taxpayers´ money. As Harvard University already denounced in 2012, many large journal publishers have rendered the situation “fiscally unsustainable and academically restrictive”, with some journals costing as much as $40,000 per year (and publishers drawing profits of 35% or more). If one of the wealthiest universities in the world can no longer afford it, who can? It is easy to picture the struggle of European universities with tighter budgets. In addition to subscription costs, academic research funding is also largely affected by “Article Processing Charges” (APC), which come at an additional cost of €2000/article, on average, when making individual articles Gold Open Access. Some publishers are in this way even being paid twice for the same content (“double dipping”). In the era of Open Science, Open Access to publications is one of the cornerstones of the new research paradigm and business models must support this transition. It should be one of the principal objectives of Commissioner Carlos Moedas and the Dutch EU Presidency (January–June 2016) to ensure that this transition happens. Further developing the EU´s leadership in research and innovation largely depends on it. With this statement “Moving Forwards on Open Access”, LERU calls upon all universities, research institutes, research funders and researchers to sign this statement and give a clear signal towards the European Commission and the Dutch EU Presidency. [Int Microbiol 18(3):195-202 (2015)] Keywords: Open Access

LERU: League of European Research Universities Universiteit van Amsterdam - Universitat de Barcelona - University of Cambridge - University of Edinburgh - Albert- Ludwigs-Universität Freiburg Université de Genève - Ruprecht-Karls-Universität Heidelberg - Helsingin yliopisto (University of Helsinki) - Universiteit Leiden - Katholieke Universiteit Leuven - Imperial College London –University College London - Lunds universitet - Università degli Studi di Milano - Ludwig-Maximilians-Universität München - University of Oxford - Université Pierre et Marie Curie, Paris - Université Paris-Sud 11 - Université de Strasbourg - Universiteit Utrecht - Universität Zürich

Executive Summary • The LERU Roadmap towards Open Access represents a conscious decision by the League of European Research Universities to investigate new models for scholarly communication and the dissemination of research outputs emanating from LERU universities.

• The European Commission has singled out “the dissemination, transfer and use of research results, including through open access to publications and data from publicly funded research”, as one of the action points to be pursued in order to achieve a well-functioning European Research Area (ERA).1 Access to research information must be optimised if the European research community is to operate effectively, producing high-quality research that has a wider social and economic impact.2 • We are seeing a growing interest across the world in the moves made in recent years to stimulate an ‘Open Access’ environment, where scholarly literature is made freely available on the internet, so that it can be read, downloaded, copied, distributed, printed, searched, text mined, or used for any other lawful purpose, without financial, legal or technical barriers, subject to proper attribution of authorship.3

1 See Europe 2020 Flagship Initiative Innovation Union. European Commission. COM (2010) 546, 6 October 2010. 2 See Overcoming barriers: Access to research information content. Research Information Network, London, 2009. Available at http://www.rin.ac.uk/system/ files/attachments/Sarah/Overcoming-barriers-report-Dec09_0.pdf and Friend, F.J. (2007) UK Access to UK Research, in Serials, vol. 20 (3), pp. 231-34. Available at http://eprints.ucl.ac.uk/4842/.


196

Int. Microbiol. Vol. 18, 2015

• The idea of Open Access is not new; the first major international statement on Open Access was set out in the Declaration of the Budapest Open Access Initiative in 2002.4 However, ‘the pathway’ to Open Access is not a smooth one. Many parties are involved and there are many competing interests. There are costs and there are advocates, agnostics and critics. There are gains and impacts which need to be carefully assessed. • This Roadmap traverses some of this landscape and aims to assist LERU members who wish to put in place structures, policies and practices to facilitate Open Access. Whilst the Roadmap is primarily intended for LERU members, other European universities may find it useful. • The two basic mechanisms through which researchers can make their work freely available are often termed as the ‘gold route’ and the ‘green route.’ The adoption of either or both routes could lead to a transformation in the means of disseminating research outputs by LERU and other universities across the globe. • LERU and/or other universities can consider having Open Access repositories into which, copyright permissions allowing, copies of their members’ research outputs could be deposited. Those who already have such repositories are continuing to develop them. Many universities have found the Green route a helpful one to follow as a means of improving the dissemination of research outputs. In Webometrics listings of the impact of institutional repositories, LERU universities are significant contributors. The July 2010 listing shows that five of the top ten European universities listed are members of LERU.5 Further guidance, including some costing information, on implementing the Green route is given in section III. • Several universities have supported the Gold route for Open Access, whereby authors in these institutions either publish in Open Access journals or pay publication charges (funded by the research funder or from an institutional Open Access fund) to make their article available in Open Access on publication. Some research funders, such as the Wellcome Trust in the UK, the Austrian Science Fund (FWF) and the Netherlands Organisation for Scientific Research (NWO), will fund such publication payments. The Gold route is a bold route, which may also change

LERU WORKING GROUP

the pattern of publication. Further information, including some financial information, is given in section IV. • All of the changes described in this Roadmap require leadership. Universities could usefully nominate a senior person who can lead on Open Access issues for the whole university. These people could, in turn, work together collaboratively to take forward the Open Access agenda in Europe, making links as appropriate to other bodies in Europe who support Open Access developments. At an institutional level, the senior Open Access champion could usefully draw together a pan-university committee, with representatives from disciplines/ support services to take the agenda forward.

I. Open Access in a wider context: Open Scholarship and Open Knowledge 1. Open Access is not a new phenomenon and can be seen, for example, in Stevan Harnad’s work in 1990.6 As with any Roadmap, understanding the directions requires a knowledge of the surrounding landscape; Open Knowledge and Open Scholarship. 2. Open Knowledge is ‘any kind of information –sonets to statistics, genes to geodata– that can be freely used, reused, and redistributed’ (Open Knowledge Foundation definition).7 Open Scholarship refers to research that generates Open Knowledge. While the LERU Roadmap focuses on more traditional research outputs, it is important to note that ‘Open Knowledge’ is much broader than this, and would encompass primary data, associated software, and educational resources. The reason for focusing on Open Access to more traditional research outputs is that they have common issues around making them freely available that make it reasonable to consider them together, and separately from other types of knowledge. 3. In brief these issues are around: • Costs –Open Knowledge costs nothing to the user, but needs sustainable business models. • Time –Open Knowledge is available immediately and permanently. Open Access research outputs may be

3 See Getting your feet wet: An introduction to Open Access, http://www.rin.ac.uk/our-work/using-and-accessing-information-resources/introduction-openaccess. 4 See http://www.soros.org/openaccess/view.cfm. 5 See http://www.webometrics.info/top100_continent.asp?cont=europe. 6 See Harnad, S. (1990) Scholarly Skywriting and the Prepublication Continuum of Scientific Inquiry; available at http://cogprints.org/1581/.


OPEN ACCESS

Int. Microbiol. Vol. 18, 2015

197

subject to publisher embargos, which have to be balanced with the public interest as expressed, for example, by research funders’ conditions of grant. • Rights and rewards –Open Knowledge is available for people to use in any lawful way, including for commercial purposes. For Open Access research outputs, this maximises the impact of the research, and acceptable ways need to be found to assess and reward that impact. • Technology –Open Knowledge is made available in ways that enable computer-based tools to exploit it, via aggregation, data-mining, annotation and so on, as well as supporting tools to assist disabled people, such as screen readers.

engines index Open Access repositories, authors’ work is easily found and, being Open Access, can be retrieved for use by everyone.

4. Open Access, therefore, is one element in a broader landscape of Open Scholarship and Knowledge, which could rapidly change the way research is undertaken and communicated globally. Universities leading these changes will be well-placed to attract the best researchers and students, and show how they contribute to the growing European knowledge economy and society.

9. It is sobering to note that the World Health Organisation found in a survey conducted at the start of the millennium that more than half of research based institutions in lower-income countries had no current subscriptions to international research journals, nor had they had any for the previous five years.9 Unsurprisingly, researchers in developing countries rank access to the research literature as one of their most pressing problems.10 By making work available in Open Access, researchers are helping to create a global knowledge commons so that all may benefit, not just the relatively wealthy.

II.Benefits accruing from Open Access for researchers, Universities and Society 5. Open Access brings benefits for a variety of constituencies. Open Access has its philosophical roots in the traditional values and goals of the academy –collegiality, research and knowledge creation as a shared endeavour, a collaborative approach to enquiry, the furtherance of human understanding and the diffusion of knowledge to the benefit of Society at large. Open Access has appeared and the advent of the Internet enables the realisation of these things in a way not possible in the print-onpaper age. Researchers 6. The authors of academic works enjoy increased visibility, usage and impact for their research outputs when they are made in Open Access.8 Because Google and other web search

7. Open Access also allows different types of research to be undertaken –using the literature as data, alongside other data. 8. This visibility and usage are new: before Open Access, the only way to see academic work was by paying for subscriptions to journals or by paying a fee to view an article on the publisher’s website. This restricted access to those who could afford to pay for access in these ways.

10. There have been some important efforts made to address issues affecting researchers and policy makers in the developing world. • For example, the HINARI Programme, set up by the World Health Organisation (WHO) together with major publishers, enables the poorest developing countries to gain access to one of the world’s largest collections of biomedical and health literature.11 Institutions in countries with GNI per capita below $1,600 are eligible for free access. Institutions in countries with GNI per capita between $1,601–$4,700 pay a fee of $1,000 per year/institution. • Under the Oxford Journals Developing Countries Offer, institutions within qualifying countries based on country incomes as established by the World Bank

7 See http://okfn.org/. 8 See aggregations of studies on the Open Access impact advantage: Swan, A. (2010) The Open Access citation advantage: Studies and results to date, ECS EPrints, 17 Feb 2010; Wagner, A. B. (2010) Open Access Citation Advantage: An Annotated Bibliography, Issues in Science and Technology Librarianship, No. 60, Winter 2010. 9 Note that many developing countries do not qualify for schemes that supply journal access at cheap rates. See eligibility rules for Research4Life, for instance: http://www.research4life.org/institutions.html. 10 Aronson, B (2004) Improving Online Access to Medical Information for Low-income Countries, in New England Journal of Medicine, 350, pp. 966–968 at http://content.nejm.org/cgi/content/full/350/10/966. 11 See http://www.who.int/hinari/en/.


198

Int. Microbiol. Vol. 18, 2015

Report (2006) can apply for free or greatly reduced online access to the full Developing Countries collection, the Humanities and Social Science subset, or the Science, Technical and Medical subset. Universities 11. Universities benefit from the aggregated impact of their researchers. The new audiences that Open Access brings to research can use this access to build on research findings and to make further discoveries. A university’s mission is to create knowledge and to disseminate it; Open Access may help universities to fulfil this mission. Having university research open and showcased to the world potentially boosts a university’s profile and enables the uptake and use of the fruits of research effort funded for the benefit of Society. Society 12. The free diffusion of knowledge into Society in general from Europe’s universities aids the building of a knowledge economy and the raising of scientific and cultural literacy. 13. There are potential economic benefits, too, and these accrue to the research sector and to Society as a whole. Economic modelling by the Australian economist, Professor John Houghton of Victoria University, Melbourne, has shown that in all the countries modelled so far (Australia, UK, Netherlands, Denmark and the USA) Open Access works out as the most cost-effective option for disseminating research. It increases accessibility and the efficiency with which researchers can do their work, and streamlines library operations.12 With worldwide Open Access, researchers would spend less time looking for and accessing research information for their reading, writing and peer reviewing activities; far less time would be spent gaining permissions from publishers to re-use researchers’ own and others’ work; and avoiding blind alleys and duplication of research would be easier. And libraries would spend far less on buying content and handling journal administration. There are costs associated with Open Access dissemination models, of course, but these are far outweighed by the economic benefits across the system from free and easy access to all research

LERU WORKING GROUP

outputs. Houghton and his team estimate that savings would be many times the costs in every case modelled and could amount to substantial sums: for example, the Netherlands could enjoy economic benefits every year to the value of around €133 million.13 Benefits and costs fall unevenly however. 14. It is important to note that the Houghton report remains controversial and debated: publishers, a major stakeholder, were not consulted in the research and some of the input data in the models is disputed. In addition, many of the savings would only be achievable if all information went Open Access, not just that from LERU members. Otherwise universities would end up paying subscriptions and all of the associated costs, as well as Open Access costs for their research. For research intensive universities, such as the LERU members, a direct comparison of Gold Open Access charges compared to current subscription costs shows that they would pay more under the Gold Open Access route; under a Green Open Access model, universities incur new costs with no immediate savings on subscriptions. However, a new study by CEPA, Heading for the Open Road,14 in which the Publishing Research Consortium was a partner, looks again at financial modelling and concludes that a prudent approach for policy makers wishing to promote access would be to encourage the take-up of Green and Gold Open Access. 15. Economic benefits can accrue across Society, outside the research sector. Businesses, such as biotechnology companies, that innovate using basic research as their raw material –creating wealth in Society in the process –benefit from Open Access to the information they need. The professional sector, including examples such as family doctor practices, legal businesses, and the secondary and higher education communities, can access and use hitherto unavailable research material. The practitioner community –such as civil engineering firms, software engineers, consultancies and the financial sector –can transfer knowledge from basic research into their commercial practices. 16. Through Open Access, Europe’s populations can be better informed, not only by their own efforts at seeking out specific research information on topics of interest, but through better-informed media bringing to their attention new develop-

12 For example, the average handling times (minutes per journal per year) calculated by university libraries involved in a recent study were: Print journals 143 minutes, electronic journals 56 minutes, Open Access journals 10 minutes. For more data see Swan, A. (2010) Modelling scholarly communication options: costs and benefits for universities. Technical Report, Scholarly Communications Group, JISC, at http://eprints.ecs.soton.ac.uk/18584/. 13 For John Houghton’s comparison of Denmark, The Netherlands and the UK in June 2009, see http://www.knowledge-exchange.info/Default. aspx?ID=316. 14 See http://www.publishingresearch.net/documents/RINHeadingforopenroadDynamicsoftransition.pdf.


OPEN ACCESS

ments and findings from basic research. Knowledge societies can be built around the world much more strongly and effectively if knowledge is easily accessed and spread. Open Access is a key to this transformation.

III. LERU and the Green route for Open Access Overview 17. The Green route has been defined as the route where copies of peer-reviewed research outputs are made freely available on the web, using an Open Access repository, alongside any formal published versions. 18. In this model research is deposited into the institutional repository, subject to copyright/license permissions. Many journal publishers do allow deposition after embargo periods (e.g., 12 months) and these embargo periods are maintained to ensure the continued value of subscriptions and therefore ensure sustainable business models for commercially-published journals. Many book publishers do not allow full deposition (of the full work) into institutional repositories. It should be noted, however, that advocates of Open Access would wish to keep embargo periods as short as possible. 19. For journal materials, this does lead to more than one version of the article being available (the postprint version as well as the version of record). Some feel that this benefits research, others worry that it is confusing to readers and can be dangerous in, for example, medical areas. Under the Green route, however, it is possible to isseminate the publication of errata. Green Route - Stage 1: Getting Started 20. An institution that has established such an Open Access repository has the technical tools that enable it to manage and share its research outputs on the web. In doing so, it joins a broad range of European institutions with such tools. Such repositories should use standard protocols. 21. There is a significant body of literature which can inform institutions in their decision making processes when establishing a repository.15 22. The costs of establishing an Open Access repository vary from institution to institution. The costs to establish the Southampton Institutional Repository in the UK amounted to

Int. Microbiol. Vol. 18, 2015

199

approximately €13,000 for technical costs, a 0.5 FTE senior post as Institutional Repository manager, a 0.5 FTE Research Fellow for advocacy and 0.7 FTE support staff.16 From a range of UK universities consulted, the annual costs of holding research papers in a repository range from €30,000 to €242,000.17 Further clarity on the costs of Open Access will be obtained by LERU universities exchanging information and from studies that will result from such collaboration. 23. In parallel with the establishment of an institutional repository or repositories, universities should consider creating a communications and advocacy strategy, which informs the academy of both the drivers for establishing a repository system and also how university researchers can submit their outputs to the new dissemination system. Regular monitoring will identify what proportion of the university’s research output is available via the institutional repository. 24. An important part of the university’s strategy for advocacy will be to identify the benefits which Open Access may bring both to the researcher and the institution. These benefits are listed in section II. 25. Universities should be clear on the type of materials which can be deposited. By way of example, the University of Helsinki requires researchers to deposit copies of their research articles published in academic journals in HELDA, the open digital repository maintained by the University of Helsinki. It is also possible to store other types of publications in the repository, such as popular articles, other published documents, the University’s publications as well as monographs and teaching material, if permitted by publishing contracts. Where such materials have been peer reviewed in commercial publications, this should be noted in the metadata accompanying the full text. 26. There may be differing views within the academic community, and policies set that are appropriate for each disciplinary area. There are those who suggest that there must be an academic quality control process for repositories, and that only those items at or above the threshold quality should be made public. This is why some repositories, for example, will only accept peer reviewed outputs. Others contend that rather than restrict the type of item, what is important is that their exact status be described (so, for example, the reader can distinguish between a draft working paper and a copy of an item published by a peer reviewed journal).

15 See http://www.sherpa.ac.uk/ and also an important RAND Europe evaluation of the London SHERPA-LEAP consortium at http://eprints.ucl.c.uk/13760. 16 See http://www.driver-repository.eu/PublicDocs/D7.2_1.1.pdf, p. 171. 17 Swan, A. (2010) Modelling scholarly communication options: costs and benefits for universities. A report for the JISC. http://eprints.ecs.soton. ac.uk/18584/.


200

LERU WORKING GROUP

Int. Microbiol. Vol. 18, 2015

27. Harvard University provides an interesting case study in Open Access policy making. With support from the Office for Scholarly Communication, Open Access policies are now in place in more than half of the Harvard Schools (as at April 2011). These policies apply only to ‘scholarly articles’ in the form of a final manuscript sent to the publisher after the completion of the peer review process. 28. Using terms from the Budapest Open Access Initiative, Harvard Faculty’s scholarly articles are articles that describe the fruits of their research and that they give to the world for the sake of inquiry and knowledge without expectation of payment. Such articles are typically presented in peer reviewed scholarly journals and conference proceedings. 29. Not included under this notion of scholarly article are: books, popular articles, commissioned articles, fiction and poetry, encyclopedia entries, ephemeral writings, lecture notes, lecture videos, or other copyrighted works. This is not to denigrate such writings. Rather, they are generated as part of separate publishing or distribution mechanisms that function in different ways, the integral qualities of which, if any, the present policies do not and are not meant to address.18 30. At an early stage, the institution can embed their Open Access efforts into pan-university strategies. This is important because work on Open Access needs to be fully aligned with an institution’s mission. Institutional strategies in at least the following areas can be aligned with the new developments: • Research/Teaching and Learning • Copyright/Intellectual Property Rights (IPR) • Publications 31. LERU recognizes that LERU and/or other universities can work together in collaboration to avoid duplicating effort. Such collaborative activity can also embrace working with research funders, who have their own strategies and requirements for the dissemination of funded research outputs. National/regional examples of guidance will help to shape work at an institutional level. Green Route Stage 2: Embedding the Green route 32. In many ways, a real sign of success at an institutional level is to agree an institutional mandate where, copyright permissions allowing, all research outputs from the institution are

deposited in Open Access in the institutional repository. Such a step is a bold one and will need explicit support from the academy. Commonly, such a policy is agreed by the institution’s academic Senate, as was the case in UCL (University College London) which is described in more detail in section V. 33. If the mandate requires self-archiving by the authors, this can be facilitated by friendly and simple systems, preferably integrated with current research information systems. Utrecht University, for example, has created a simple “Upload Full text button” in their (mandatory) research registration system. 34. LERU and/or other universities can consider adopting Open Access mandates for their research outputs. Where materials are lodged in subject-based Open Access repositories, or published in Open Access journals, or in journals that make materials available after a certain period of time, cross-linking can make all such materials visible in one search. Partnerships with publishers and research funders will help to avoid unnecessary duplication of activity. 35. LERU and/or other universities are able to take a proactive stance on copyright issues, safe in the knowledge that the vast majority of commercial journals allow some form of archiving of an author’s own research outputs. Where assignment of copyright is required by a publisher as a condition of publication, researchers should instead consider the use of a Licence to Publish, where copyright is retained by the author and a licence to publish granted to the publisher by the author.19 It is the author’s responsibility to check the policies of the journals they are publishing with, but mechanisms to check they are abiding by the license they have published should be in place. Green Route Stage 3: Furthering the process 36. It is important that universities actively continue current investigations into the feasibility of storing open primary data in repositories, linking the open data to the secondary research publication. This is potentially a new area for repositories and will bring to light different issues and concerns. Primary data, across all subject areas, forms the building blocks from which secondary research articles and monographs are

18 See http://osc.hul.harvard.edu/policies#articles. 19 See the Copyright Tool Box, produced by the JISC and SURF, and listed below in section V for further information. 20 See http://bulletin.sciencebusiness.net/ebulletins/showissue.php3?page=/548/6589/20007. 21 Available at http://base.ub.uni-bielefeld.de/en/about_sources_date_dn.php?menu=2. 22 Available at http://www.europeana.eu/portal/.


OPEN ACCESS

created. Such primary data, once available in Open Access, can be interrogated by researchers, or re-used to avoid duplication of research effort. Universities that have well-developed repository infrastructures are well placed to meet the new challenges which such a development will bring, a position which is in line with developments in the EU.20 37. The relationship of the BASE search interface21for Open Access with the Europeana portal22 and with other information providers needs to be clear, to avoid duplication of effort and to ensure that the European user has access to the best possible tools for search and retrieval. 38. There is currently a gap in the provision of a secure digital curation infrastructure across Europe for the contents of Open Access repositories and Open Access journals. European universities, research funders and other stakeholders can usefully work together to identify and put in place the infrastructure that is needed.

IV. LERU and the Gold route for Open Access Overview 39. The Gold route has been defined as journal publishing operating with a business model not based on subscription, but rather on either publication charges (where the author or an organization on behalf of the author funds the publishing costs) or on subsidy. Gold Open Access journals do not charge readers and grant extensive usage rights in accordance with the authoritative definition of the Budapest Open Access Initiative.23 40. Substantial changes are taking place in the scholarly communications process. These changes may well affect all universities across the world and LERU universities are no exception. 41. In the production of scholarly monographs and research articles, peer and editorial review and indeed improved peer review are of paramount importance and therefore business models that support their sustainability need to be in place. 42. As it is proposed by LERU that Open Knowledge is

Int. Microbiol. Vol. 18, 2015

201

beneficial to research efficiency, institutions can work for change in the existing publishing system in the direction of sustainable business models for Open Access publishing. 43. There are two types of journal under which authors can adopt Gold Open Access: full Open Access journals and hybrid (or optional) journals. Whilst Gold Open Access has been shown to increase usage, there is no decisive evidence to date that it increases citations. Many full Open Access journals are young journals and so may not have the same profile or impact factor of their more traditional/established competitors, but this not reflect their future influence. 44. Some publishers ‘double dip’ –i.e. charge full subscription prices as well as charging authors publication fees in hybrid journals. LERU members have the choice to push back on such pricing or to require their researchers not to pay Open Access fees in such publishers’ journals. Gold Route - Stage 1: Getting started 45. LERU and/or other universities may advocate the benefits for their researchers and for European research in publishing in Open Access journals.24 LERU and/or other universities may also consider allocating funds to pay for publication charges in those Open Access journals which charge for submissions and publication, where funding is not provided by the research funder.25 46. In order to maximize the investments in paying for publication charges, there is a need to investigate the feasibility of LERU and/or other universities as a group entering into agreement with Gold Open Access publishers for membership and/or bigger discounts on publication charges.26 Guidance on this can be made available to European university groupings and consortia as a whole. 47. As with the Green route, universities should embed their approach to Open Access publishing in panuniversity strategies. Gold Route Stage 2: Embedding the Gold route 48. The research community can lobby to convince research funders and other stakeholders that meaningful chang-

23 See http://www.soros.org/openaccess. 24 The recommendation is primarily to publish in fully Open Access journals, where such journals exist in a subject field. 25 It is recommended that an institutional Publication Fund is primarily allocated for paying publication charges for fully Open Access Journals (Gold), not for Hybrid Journals in the first resort. Hybrid journals are subscription-based journals operating with an Open Access publishing option, whereby an author pays a publication fee allowing the specific article to be Open Access. Both roads lead to Open Access and are examples of how publishing models are changing (at different speeds) to support Open Access. Implementation is not easy. For example, who decides on the allocation of funds? Is it ‘first come-first served’ until the annual allocation runs out? Or does every researcher have a credit limit? 26 For example, BioMed Central, Public Library of Science (PLoS), Hindawi, Copernicus, Springer Open.


202

Int. Microbiol. Vol. 18, 2015

es to the existing model for scholarly publishing require investments (transition costs); LERU and/or other universities can liaise with other university associations on this matter. 49. Given that European scholarly monograph publishing (especially in the humanities and social sciences) is in flux, and that LERU institutions are involved in institution-based monograph publishing (especially in non-English languages), European institutions could connect to the activities of the OAPEN net-work27 or other Open Access monograph publishing initiatives, in order to promote Open Access publishing of scholarly monographs. Guidance can be made available to the wider university community. Gold Route - Stage 3: Furthering the process 50. As in the Green route LERU and/or other universities can work together in collaboration wherever possible. 51. In order to contribute to changes in the existing model for scholarly publishing, there is a need for an overview of institutional involvements in commercial non-Open Access journal and peer reviewed monograph publishing, by means of an investigative study of the yearly institutional output in terms of numbers of articles and books, subject spread and the in-kind editorial and refereeing work done by institutional employees for different journals and peer reviewed monographs. Creating such an overview could offer a valuable starting point for approaching specific journals

LERU WORKING GROUP

and/or publishers to discuss whether the overall contribution to specific journals could be addressed in terms of bringing a journal into an Open Access publishing mode, thereby potentially unlocking those journals from ‘big deal’ subscription packages. Such a study would help inform possible future developments in publishing activity, including Gold Open Access publishing.

V. External Subject-Based, DisciplineBased or Funder Repositories 52. Whilst this Roadmap focuses largely on University Green and Gold Route Open Access initiatives,28 it is important to note that there are subject-based, discipline-based and research funder repositories which seek to curate and provide access to research publications (of varying kinds) and/or to research data. 53. One of the challenging questions for universities is how their repositories relate to these other repositories. At a practical level, for example, would a researcher be asked to deposit work in both their university repository and, say, an international repository? If they submit work to one repository, should metadata tags be used to ensure cross-linking?

*** The paper has been written by the LERU working group on open access. Contributing authors to the paper are: Paul Ayris, Director of UCL Library Services and UCL Copyright Officer, President of LIBER (Association of European Research Libraries) and Co-chair of the LERU working group on open access Lars Björnshauge, Director of Libraries, Lunds universitet, and Co-chair of the LERU working group on open access Mel Collier, Head Librarian, K.U.Leuven Eelco Ferwerda, Amsterdam University Press, Digital projects, & Coordinator of OAPEN Neil Jacobs, Programme Director, Joint Information Systems Committee (JISC) Kaisa Sinikara, University Librarian, University of Helsinki Alma Swan, Convenor, Enabling Open Scholarship Saskia de Vries, Director, Amsterdam University Press Astrid van Wesenbeeck, Director, SPARC-Europe

27 See http://www.oapen.org/. OAPEN is an initiative in Open Access publishing for humanities and social sciences monographs. The consortium of Universitybased academic publishers who make up OAPEN are all active in Open Access publishing. The OAPEN partners consist of a number of European university presses and universities. The OAPEN project will explore ways of publishing scholarly work in Open Access, providing access to important peer reviewed research from across Europe and exploring new business models. 28 See sections III and IV of this Roadmap.


A3


Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686 A4

Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter.SI units should be used throughout. For Nomenclature of organisms genus and species scientific names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.


Turn static files into dynamic content formats.

Create a flipbook
International Microbiology by Institut d'Estudis Catalans - Issuu