Skip to main content

International Microbiology

Page 1

Volume 17 路 Number 1 路 March 2014 路 ISSN 1139-6709 路 e-ISSN 1618-1905

INTERNATIONAL MICROBIOLOGY www.im.microbios.org

17(1) 2014

Official journal of the Spanish Society for Microbiology


Publication Board

Editorial Board

Coeditors-in-Chief José Berenguer (Madrid), Autonomous University of Madrid Ricardo Guerrero (Barcelona), University of Barcelona

Juan Aguirre, Prince Edward Island University, Canada Ricardo Amils, Autonomous University of Madrid, Madrid, Spain Shimshon Belkin, The Hebrew University of Jerusalem, Jerusalem, Israel Albert Bordons, University Rovira i Virgili, Tarragona, Spain Albert Bosch, University of Barcelona, Barcelona, Spain Javier del Campo, University of British Columbia, Vancouver, Canada Victoriano Campos, Pontificial Catholic University of Valparaíso, Chile Josep Casadesús, University of Sevilla, Sevilla, Spain Rita R. Colwell, Univ. of Maryland & Johns Hopkins Univ., Baltimore, MD, USA Katerina Demnerova, Inst. of Chem. Technology, Prague, Czech Republic Esteban Domingo, CBM, CSIC-UAM, Cantoblanco, Spain Mariano Esteban, Natl. Center for Biotechnol., CSIC, Cantoblanco, Spain Mariano Gacto, University of Murcia, Murcia, Spain Juncal Garmendia, Institute of Agrobiotechnology, Pamplona, Spain Olga Genilloud, Medina Foundation, Granada, Spain Steven D. Goodwin, University of Massachusetts, Amherst, MA, USA Juan C. Gutiérrez, Complutense University of Madrid, Madrid, Spain Johannes F. Imhoff, University of Kiel, Kiel, Germany Juan Imperial, Technical University of Madrid, Madrid, Spain John L. Ingraham, University of California, Davis, CA, USA Juan Iriberri, University of the Basque Country, Bilbao, Spain Roberto Kolter, Harvard Medical School, Boston, MA, USA Germán Larriba, University of Extremadura, Badajoz, Spain Rubén López, Center for Biological Research, CSIC, Madrid, Spain Michael T. Madigan, Southern Illinois University, Carbondale, IL, USA Beatriz S. Méndez, University of Buenos Aires, Buenos Aires, Argentina Diego A. Moreno, Technical University of Madrid, Madrid, Spain Ignacio Moriyón, University of Navarra, Pamplona, Spain Juan A. Ordóñez, Complutense University of Madrid, Madrid, Spain José M. Peinado, Complutense University of Madrid, Madrid, Spain Antonio G. Pisabarro, Public University of Navarra, Pamplona, Spain Carmina Rodríguez, Complutense University of Madrid, Madrid, Spain Fernando Rojo, Natl. Center for Biotechnology, CSIC, Cantoblanco, Spain Manuel de la Rosa, Virgen de las Nieves Hospital, Granada, Spain Carmen Ruiz Roldán, University of Murcia, Murcia, Spain Claudio Scazzocchio, Imperial College, London, UK James A. Shapiro, University of Chicago, Chicago, IL, USA John Stolz, Duquesne University, Pittsburgh, PA, USA James Strick, Franklin & Marshall College, Lancaster, PA, USA Gary A. Toranzos, University of Puerto Rico, San Juan, Puerto Rico Antonio Torres, University of Sevilla, Sevilla, Spain José A. Vázquez-Boland, University of Edinburgh, Edinburgh, UK Antonio Ventosa, University of Sevilla, Sevilla, Spain Tomás G. Villa, Univ. of Santiago de Compostela, Santiago de C., Spain Miquel Viñas, University of Barcelona, Barcelona, Spain Dolors Xairó, Biomat, S.A., Grifols Group, Parets del Vallès, Spain

Associate Editors Mercedes Berlanga, University of Barcelona Mercè Piqueras, Catalan Association for Science Communication Nicole Skinner, Imperial College, London Wendy Ran, International Microbiology Secretary General Jordi Mas-Castellà, International Microbiology Webmaster Jordi Urmeneta, University of Barcelona Managing Coordinator Carmen Chica, International Microbiology Specialized editors Josefa Antón, University of Alicante Susana Campoy, Autonomous University of Barcelona Ramón Díaz, CIB-CSIC, Madrid Josep Guarro, University Rovira i Virgili Enrique Herrero, University of Lleida Emili Montesinos, University of Girona José R. Penadés, Inst. of Mountain Livestock-CSIC, Castellon Jordi Vila, University of Barcelona

Addresses Editorial Office International Microbiology C/ Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org www.im.microbios.org Spanish Society for Microbiology C/ Rodríguez San Pedro, 2 #210 28015 Madrid, Spain Tel. +34-915613381. Fax +34-915613299 E-mail: sem@microbiologia.org www.semicrobiologia.org Publisher (electronic version) Institute for Catalan Studies Carme, 47 08001 Barcelona, Spain Tel. +34-932701620. Fax +34-932701180 E-mail: int.microbiol@microbios.org © 2014 Spanish Society for Microbiology & Institute for Catalan Studies. Printed in Spain ISSN (print): 1139-6709 e-ISSN (electronic): 1618-1095 D.L.: B.23341-2004

The Spanish Society for Microbiology (SEM) is a scientific society founded in 1946 at the Jaime Ferrán Institute of the Spanish National Research Council (CSIC), in Madrid. Its main objectives are to foster basic and applied microbiology, promote international relations, bring together the many professionals working in this science, and contribute to the dissemination of science in general and microbiology in particular, among society. It is an interdisciplinary society, with about 1800 members working in different fields of microbiology.

p2


CONTENTS International Microbiology (2014) 17:1-64 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Volume 17, Number 1, March 2014 RESEARCH ARTICLES

Lhomme E, Mezaize S, Ducasse MB, Chiron H, Champomier-Vergès MC, Chaillou S, Zagorec M, Dousset X, Onno B A polyphasic approach to study the dynamics of microbial population of an organic wheat sourdough during its conversion to gluten-free sourdough

1

Matas M, Picornell A, Cifuentes C, Payeras A, Homar F, González-Candelas F, López-Labrador FX, Moya A, Ramon C, Castro JA Relating the outcome of HCV infection and different host SNP polymorphisms in a Majorcan population coinfected with HCV–HIV and treated with pegIFN-RBV

11

Sáez-Rosón A, Sevilla MJ, Moragues MD Identification of superficial Candida albicans germ tube antigens in a rabbit model of disseminated candidiasis. A proteomic approach

21

Yeates AM, Esteban GF Local ciliate communities associated with aquatic macrophytes

31

Luziatelli F, Crognale S, D’Annibale A, Moresi M, Petruccioli M, Ruzzi M Screening, isolation, and characterization of glycosyl-hydrolase-producing fungi from desert halophyte plants

41

Alippi AM, León IE, López AC Tetracycline-resistance-encoding plasmids from different Paenibacillus larvae, the causal agent of American foulbrood disease, isolated from commercial honeys BOOK REVIEWS

49

63

Journal Citations Reports The 2012 Impact Factor of International Microbiology is 2,556. The journal is covered in several leading abstracting and indexing databases, including the following ones: Agricultural & Environmental Bio­­technology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents/Agriculture, Biology & Environmental Sciences; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science & Technology Abstracts; ICYT/CINDOC; IBECS/ BNCS; ISI Alerting Services; MEDLINE/Index Medicus; Latindex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; SciSearch.

A1


Front cover legends Upper left. Analysis of a transfer mechanism exploited by the human immunodeficiency virus type 1 (HIV-1) to infect new target immune cells. Electron microscopy micrograph showing the intimate contact between a mature dendritic cell exposed to HIV-1 (top) and a CD4+ T cell (bottom). HIV-1 particles captured by the mature dendritic cell are polarized to the cell-to-cell contact area, favoring CD4+ T cell infection throughout the formation of an infectious synapse. Micrograph by M. Teresa Fernández-Figueras and Núria Izquierdo-Useros, Pathology Department at HUGTIP and AIDS Research Institute IrsiCaixa, Barcelona, Spain. (Magnification, ca. 20,000×)

Center. The honeybee Apis mellifera L. feeding on a flower in La Plata, Argentina. American foulbrood (AFB), caused by Paenibacillus larvae, a gram-positive, spore-forming bacterium, is the most contagious and destructive infectious disease affecting the larval and pupal stages of honeybees. Photograph by Adriana M. Alippi, Center for Phytopathology Research, National University of la Plata, La Plata, Argentina. (Magnification, ca. 5×) (See article by AM. Alippi et al., pp 49-61, this issue.)

Upper right. Transmission electron micrograph of Escherichia coli with amyloid inclusions of the prionoid REPA-WH1. Gold particles for immunodetection map the distribution of molecules of chaperone DnaK (Hsp70), involved in the conformational dynamics of the protein, generating, from globular amyloid aggregates, a variant amyloid that is less cytotoxic. Micrograph by Rafael Giraldo, Department of Cellular and Molecular Biology, CIB–CSIC, Madrid. (Magnification, ca. 32,000×)

late orders of the phylum Axostylata, specifically Tri­ cho­ monadida, Hypermastigida, and Oxymonadida. Photograph (dark-field microscopy) by Rubén Duro (Center for Microbiological Research, CIM, Barcelona). See covers of Int. Microbiol. vol. 14 (2011) and article by R. Guerrero, L. Margulis, M. Berlanga, Int. Microbiol. 15(2013):133-143. (Magnification, ca. 1,500×) Lower right. Scanning electron micrograph of a 24-h mixed biofilm containing Candida albicans hyphae and blastoconidia of Candida glabrata. Photo by Cristina Marcos Arias. Faculty of Medicine, Uni­versity of the Basque Country, UPV/EHU, Bizkaia Campus, Bilbao. (Magnification, ca. 5000×)

Lower left. Micrograph of Trychonympha sp., a protist from the intestine of the lower termite Reti­culitermes grassei. Lower termites have a symbiotic protist–bacteria community in their hindgut, that allows them to digest cellulose. The protists belong to basal eukaryotic taxa, i.e., flagel-

Back cover: Pioneers in Microbiology Vicente Izquierdo (1850–1926), Chile Portrait of Vicente Izquierdo Sanfuentes (1850–1926), one of the founding fathers of microbiology in Chile. He was born in Santiago in 1850, to Vicente Izquierdo Urmeneta and Ana Sanfuentes Torres. Although he had always been interested in the natural world, he was very fond of his mother and, in accordance with her wishes, studied law. After his graduation from law school in 1872, he pursued his scientific vocation and enrolled in the School of Medicine, from which he graduated in March 1875. At that time, the Chilean Government was granting stays in Europe to the best young scientists, which allowed Izquierdo to spend almost five years in prestigious laboratories in Leipzig, Vienna, and Strasbourg—the latter was then a German city. But in 1879, he and his fellow countrymen had to return to Chile, which had become involved in the “Pacific War” against Bolivia and Peru. Young physicians trained in Europe were very well acquainted with the work of the British surgeon Joseph Lister (1827–1912). Thus, Izquierdo was able to introduce Lister’s antiseptic and aseptic methods in his hospital in Santiago, where he treated wounded soldiers. By the 21st-century concept of microbiology, Izquierdo would not be considered a true microbiologist. In fact, the Chair that he held at the University of Chile, in Santiago, was that of Histology and Entomology. However, the focus of his work and research included topics related to

microbiology and to the epidemiology of infectious diseases. As a member of the Chilean Parliament, in 1886 he helped to launch a public health law aimed at preventing the spread of the cholera pandemic in Chile. In addition, he headed the Junta de la vacuna (Board of Vaccination), which directed the virtual eradication of smallpox from the country. In 1883, Izquierdo published his first work on experimental bacteriology, a study of the tuberculosis bacillus, which just one year earlier had been described by Robert Koch. In 1885, he published a study on the “Peruvian wart,” asserting that this common name was incorrect because the lesion was not characterized by papillary hypertrophy but by an inflammatory infiltration of the interstitial tissues. In the same year, the young Peruvian physician Daniel Alcides Carrion [(1857–1885), who at that time was still a student of medicine; see back cover and page A2 of Int Microbiol 12(3-4), 2009] would discover that it was in fact an infectious disease. The causative microorganism was later identified to be the bacterium known today as Bartonella bacilliformis. A major work by Izquierdo in microbiology was the 228-page Ensayo sobre los Protozoos de aguas dulces de Chile (Essay on the freshwater Protozoa of Chile), published in 1906 as an addendum to the Annales of the University. When he was 63, he suffered from retinal detachment, a disease for which an effective treatment had yet to be discovered. Not being able to read or use the microscope, Izquierdo resigned his university Chair in Histology in 1913. Despite his visual handicap, he did not abandon his scientific activity but instead devoted his time to entomology, his youngness’ interest. In the early 1920s, he described the principle of pheromones, compounds that were finally recognized and named around 30 years later. Izquierdo died in 1926.

Front cover and back cover design by MBerlanga & RGuerrero

A2


RESEARCH ARTICLE International Microbiology (2014) 17:1-9 doi:10.2436/20.1501.01.202 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

A polyphasic approach to study the dynamics of microbial population of an organic wheat sourdough during its conversion to gluten-free sourdough Emilie Lhomme,1 Sandra Mezaize,2 Maren Bonnand Ducasse,2 Hubert Chiron,3 Marie-Christine Champomier-Vergès,4, 5 Stéphane Chaillou,4,5 Monique Zagorec,6,7 Xavier Dousset,6,7 Bernard Onno1* 1 ONIRIS, Laboratory of Food and Industrial Microbiology, Nantes, France. 2Biofournil, Le Puiset Doré, France. INRA, UR1268 Biopolymers, Interactions & Assemblages, Nantes, France. 4INRA, UMR1319 Micalis, Jouy-en-Josas, France. 5AgroPArisTech, UMR Micalis, Jouy-en-Josas, France. 6INRA, UMR 1014 Secalim, France. 7 LUNAM Université, Nantes, France

3

Received 18 November 2013 · Accepted 25 February 2014 Summary. To develop a method for organic gluten-free (GF) sourdough bread production, a long-term and original wheat sourdough was refreshed with GF flours. The dynamics of the sourdough microbiota during five months of back-slopping were analyzed by classical enumeration and molecular methods, including PCR-temporal temperature gel electrophoresis (PCR-TTGE), multiplex PCR, and pulsed field gel electrophoresis (PFGE). The results showed that the yeast counts remained constant, although Saccharomyces cerevisiae, present in the initial wheat sourdough, was no longer detected in the GF sourdough, while lactic acid bacteria (LAB) counts increased consistently. In the first phase, which was aimed at obtaining a GF sourdough from wheat sourdough, Lactobacillus sanfranciscensis, L. plantarum, and L. spicheri were the main LAB species detected. During the second phase, aimed at maintaining the GF sourdough, the L. plantarum and L. spicheri populations decreased whereas L. sanfranciscensis persisted and L. sakei became the predominant species. Multiplex PCRs also revealed the presence of several L. sakei strains in the GF sourdough. In a search for the origin of the LAB species, PCR-TTGE was performed on the flour samples but only L. sanfranciscensis was detected, suggesting a flour origin for this typical sourdough species. Thus, while replacement of the wheat flour by GF flour influenced the sourdough microbiota, some of the original sourdough LAB and yeast species remained in the GF sourdough. [Int Microbiol 2014; 17(1):1-9] Keywords: Lactobacillus spp. · Saccharomyces · Candida · sourdough · gluten-free food · organic · lactic acid bacteria · yeast

Introduction Celiac disease (CD) is a common inflammatory disease of the small intestine that is triggered by storage proteins from wheat, rye, and barley, and it affects about 1 % of the world’s popuCorresponding author: B. Onno ONIRIS, Lab. Microbiologie Alimentaire et Industrielle Rue de la Géraudière Nantes Cedex 3, France Tel. +33-251785535. Fax +33-251785520 E-mail: bernard.onno@oniris-nantes.fr

*

lation [3]. Currently, the permanent exclusion of gluten from the diet is the only treatment for CD. However, although gluten-free (GF) breads are commercially available, they typically have poor crumble and poor mouth feel and flavor [15]. The use of sourdough, a mixture of flour and water fermented with yeasts and lactic acid bacteria (LAB) [7], may be a “clean label” solution to improve the sensory quality of GF bread. By influencing bread volume, flavor, texture, and staling, sourdough acts on the rheological and organoleptic properties of the dough [2,13]. In addition, the nutritional value and storage


2

Int. Microbiol. Vol. 17, 2014

of sourdough breads are improved by their enhanced mineral bioavailability and delayed starch retrogradation [24]. Moreover, the LAB present in sourdough act to inhibit some of the microorganisms detrimental to the quality and shelf-life of bread. Consequently, sourdough has been proposed as a natural, low-cost, and efficient technology for GF baking [35,40]. The microbiota of sourdough consists of adapted LAB and yeasts [2,19,12], and is frequently dominated by Lactobaci­ llus, Pediococcus, Leuconostoc, and Weissella [9] and by the yeasts Saccharomyces and Candida [20,29]. Although the microbiota of traditional wheat and rye sourdoughs have been well characterized, little is known about the sourdough from alternative GF cereals or pseudo-cereals [51] or about organic sourdough [39]. GF sourdough is generally prepared by spontaneous fermentation [51], commercial starters [34], or selected strains used as starters [50]. In this study, we asked whether the distinctive features of organic wheat sourdough could be maintained by back-slopping with GF flours, while retaining the initial characteristics and specificity of the sourdough. We therefore examined the dynamics of the LAB and yeast from a GF sourdough inoculated with a traditional and stable wheat sourdough, using both PCR combined with temporal temperature gradient gel electrophoresis (PCR-TTGE) and culture-dependent methods, including 16S or 28S rDNA gene sequence analysis. Our aim was to study the population dynamics of the microbiota during its adaptation to a GF sourdough.

Materials and methods Microbial strains, media, and growth conditions. The type strains Lactobacillus curvatus CIP 102992, L. paraplantarum CNRZ 1885, L. pentosus ATCC 8041, L. plantarum ATCC 14917, L. sanfranciscensis CIP 103252, L. spicheri CIP 108581, L. sakei ATCC 15521 and the strains L. sanfranciscensis ATCC 43332, and L. sakei 23K [4] were used as controls. L. sanfranciscensis BF and several strains of L. sakei were isolated in this study. LAB were cultured in modified de Man Rogosa Sharpe (MRS) medium [8], MRS4, in which the MRS medium was supplemented with maltose (1 % w/v), fructose (0.5 % w/v), cysteine (0.05 % w/v), and fresh yeast extract (1 % v/v) [25]. The strains were incubated at 30 ºC for 48 h under anoxic conditions (Anaerocult A, Merck, Darmstadt, Germany). The described strains of Saccharomyces cerevisiae and Candida humilis were isolated in this study using malt extract agar (Biokar, Beauvais, France) containing chloramphenicol (0.5 g/l) and incubated at 30 ºC for 48 h. For liquid cultures, yeast extract peptone dextrose (YPD) broth was used. The cultures were incubated under aeration overnight at 28 ºC. For the determination of cell counts in sourdough, 10 g of fresh sourdough was mixed with 90 ml of sterile tryptone salt (TS) solution [0.85 % (w/v) NaCl; 0.1 % tryptone (w/v)] and homogenized for 2 min (Stomacher, AES Laboratories, France). Serial 10-fold dilutions were then plated in triplicate on MRS4 agar and malt extract agar to determine LAB and yeast counts,

Lhomme et al.

respectively. After incubation, an average of 20 colonies per sourdough sample were randomly selected. The cultures were further purified and stored at –80 ºC in MRS4 medium glycerol (20 %). Yeasts were stored at –80 ºC in malt extract medium with added glycerol (20 %). Sourdough fermentation and sampling. An organic wheat sourdough (type I) more than 30 years old was used to prepare an organic GF sourdough by successive back-slopping in a GF environment. Fermentations were carried out with organic GF flours, blending rice (40 %), whole-meal rice (40 %), and buckwheat (20 %) flours with water. The dough yield, defined as the amount of dough obtained from 100 g of flour, was 245. The flours came from two different batches provided by the same supplier. After 12 h of incubation at 25 °C, back-slopping was performed with 25 % of the ripe dough. Theoretically, according to dilution rules, the sourdough had to be refreshed this way six times to become gluten-free. After the dilution step (refreshment steps R0–R8), in which a wheat sourdough was converted to a GF sourdough, maintenance was carried out by back-slopping the sourdough every 12 h during several months under the same conditions. During R0 to R8, samples were drawn from the ripe sourdough every 12 h. From R8 to R328, samples were drawn from the ripe sourdough about every 2 weeks. Physicochemical analyses. Ten grams of bread or sourdough were mixed with 90 ml of TS solution in a Stomacher for 2 min. Ten ml of the mixture was then homogenized and the pH and total titratable acidity (TTA) were measured with an automatic titrator (pH-Matic 23, Grosseron, SaintHerblain, France). TTA was expressed as the volume (ml) of 0.1 N NaOH required to adjust the solution to a pH of 8.5. For d- and l-lactic and acetic acid measurements, 10 ml of the homogenized mixture was centrifuged (8,500 rpm, 10 min) at room temperature (Beckman Coulter Genomics, Takeley, Essex, UK) and the supernatant was assayed using the Enzytec kit (Grosseron, Saint Herblain, France), as described in the instruction manual, and by measuring the absorbance at 340 nm (Genesys 10, Grosseron, Saint Herblain, France). Acid amounts were expressed as g/kg of sourdough or bread. DNA extraction. Bacterial chromosomal DNA was extracted either from the cell pellet of cultures grown in 5 ml of MRS4 or directly from flours and sourdoughs. DNA purification was carried out using a Qiagen DNeasy blood and tissue kit, as described in the instruction manual (Qiagen, SA, Courtaboeuf, France). DNA was extracted from sourdough or flour samples (30 g) as described previously [21]. To extract yeast chromosomal DNA, cells from 3-ml cultures were col­ lected by centrifugation and washed once with 50 mM EDTA, pH 8.0. The collected cells were then broken by vortexing the suspension with 300 mg of glass beads for 3 min at maximum speed in 0.2 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, 100 mM NaCl, 1 % SDS, and 2 % Triton X100) with 0.2 ml of phenol. After ethanol precipitation, the DNA was suspended in 50 µl TE and treated with 200 mg RNAse (Roche, Meylan, France)/ml for 30 min at 37 ºC [36]. DNA suspensions were stored at –20 ºC. PCR-TTGE. For PCR-TTGE, primers V3P2 and V3P3-GC-Clamp were used to amplify the V3 region of 16S rDNA as previously described [21]. Amplicons were analyzed on a 1.5 % agarose gel and visualized by DNA gel staining (SYBR Safe, Invitrogen, Villebon-sur-Yvette, France). The PCR products were subjected to TTGE analysis as described previously [21]. After the run, the gels were stained for 30 min in 300 ml of SYBR Safe 1X, rinsed in Milli-Q water, and visualized by UV illumination. LAB and yeast identification by 16S and 28S rDNA sequencing. The 16S rDNA (about 1,500 bp) of pure LAB isolates was PCRamplified using fD1 and rD1 primers [54], as described previously [21]. The amplification was checked by electrophoresis. The partial nucleotide sequen-


microbial population of sourdough

ce (about 700 bp) was determined with an automated sequencer (Beckman Coulter Genomics, Takeley, UK) using the internal SP1 primers (not published). Sequences were submitted to the Basic Local Alignment Search Tool program (BLAST) available at the National Center for Biotechnology Information [NCBI, Bethesda, USA http://ncbi.nlm.nih.gov/]. For each species, at least one strain representative of each group was selected and the whole 16S rDNA gene was sequenced (about 1500 bp). Since the 16S rDNA sequence did not allow discrimination among the various species belonging to the L. plantarum group, a multiplex PCR targeting the recA gene was performed as described previously [46]. In addition, a PCR targeting the katA gene (407 bp) was used, as described previously [1], to confirm the 16S rDNA identification of L. sakei species. The D1/D2 regions (579 bp) of the 28S rDNA gene were PCR-amplified from the chromosomal DNA of yeast isolates using NL1 and NL4 primers [26]. Bacterial identification by sequencing PCR-TTGE DNA fragments: Bands of interest, excised from TTGE gels using a sterile blade, were eluted in 200 ml of Milli-Q water. The eluted DNA (10 ml) was re-amplified with primers V3P2 and V3P3-GC-Clamp. The eluted DNA (10 ml) was then reamplified with V3P2 and V3P1 primers (V3P3 lacking the GC-Clamp). The PCR products were purified with the MinElute PCR purification kit (Qiagen), ligated into the pCRII-TOPO vector, and cloned in chemically competent Escherichia coli TOP10F′ using the TOPO TA cloning kit (Invitrogen, Cergy Pontoise, France). As previously recommended [37], the PCR products were cloned before sequencing in order to avoid the presence of weak bands in addition to the excised bands after re-amplification. For each fragment, about ten clones were selected for DNA extraction and sequencing using the Sp6 and T7 promoters (reverse and forward primers). The PCR-TTGE results were checked to confirm that the profile corresponded with the excised band. Pulsed field gel electrophoresis. Total DNA from L. sanfranciscen­ sis CIP 103252, L. sanfranciscensis ATCC 43332, and L. sanfranciscensis BF was analyzed by PFGE. The DNA was prepared in agarose plugs as described previously [27]. These DNA plugs were digested in fresh buffer containing 20 units of SmaI or ApaI (New England Biolabs, Beverly, MA, USA) [43]. Intraspecies genomic diversity of Lactobacillus sakei. The PCR cycling conditions have been described previously [4]. The gene content of the strains was described using a two-character matrix (gene markers × isolates) in which 0 indicates a gene marker not detected and 1 the presence of that marker. The data were analyzed using the BioNumerics software, version 6.0 (Applied Maths NV, Sint-Martens-Latem, Belgium). Similarities between the strains were determined by the unweighted pair group method, using the arithmetic averages (UPGMA) clustering method and the characterbased Dice similarity coefficient.

Results Generation of an organic GF sourdough from an organic wheat sourdough: dilution step. Table 1 shows the physicochemical characteristics of the sourdough and of the LAB and yeast microbiota as determined in the initial wheat sourdough and during the dilution step (R0– R8), after successive back-slopping. The pH remained stable during the dilution step whereas the concentrations of l- + d-lactic and acetic acids and the TTA slightly decreased.

Int. Microbiol. Vol. 17, 2014

3

The initial population density of yeast in the wheat sourdough was 3.6 ± 1.2 × 107 CFU/g (Table 2). Enumeration revealed that two-thirds of the yeast colonies were translucent and rather smooth, while the remaining one-third of the colonies were white, with a mucous appearance. 28S rDNA sequence identification of isolates from these two morphotypes showed that the first type consisted of C. humilis and the second type of S. cerevisiae. During back-slopping of the dilution step, the total yeast counts increased, from 3.6 × 107 to 6.7 × 107 CFU/g (Table 2), but the proportion of S. cerevisiae decreased such that C. humilis became the major species. The initial population density of LAB was 1.3 ± 0.6 × 108 CFU/g. Twenty-two isolates were selected from the MRS4 plates and identified by 16S rDNA sequence analysis, resulting in the identification of L. sanfranciscensis (n = 10), L. plantarum (n = 5), and L. spicheri (n = 7) as the predominant LAB species in the initial wheat sourdough. During backslopping of the dilution step, LAB counts gradually increased, from 1.3 × 108 to 7.4 × 108 CFU/g (Table 2). The 16S-based identification of the colonies showed that L. sanfranciscensis, L. plantarum, and L. spicheri persisted but their proportions fluctuated during the dilution step. Therefore, the PCR-TTGE approach was used to compare structural changes in the microbial communities and to monitor the dynamics of the bacterial population. To analyze the TTGE patterns and to detect the presence of bacterial species, fingerprints of the DNA samples obtained from sourdough after each refreshment (12 h) were compared with those of the reference strains. L. sanfranciscensis BF, a strain isolated from the sourdough at R76 and identified by 16S rDNA sequencing, was used as a control (Fig. 1). The results showed that the DNA profiles remained stable during the dilution step (R0–R8) whereas compared with the control strain, L. spicheri and L. plantarum were not detected by PCR-TTGE even though they had been identified by the culture-dependent method. The profile of each sourdough sample was similar to that of L. sanfranciscensis BF but different from the profiles of the L. sanfranciscensis reference strains. Thus, by this approach, only L. sanfranciscensis was detected in the sourdough. The PFGE profiles of L. sanfran­ ciscensis BF were compared with those of L. sanfranciscensis ATCC 43332 and L. sanfranciscensis CIP 103252 [38] to assess the genetic diversity of this sourdough isolate. Different genetic patterns were obtained for these three strains (data not shown), indicating that strain L. sanfranciscensis BF indeed differed from the reference strains, which may also explain its different PCR-TTGE pattern.


4

Int. Microbiol. Vol. 17, 2014

Lhomme et al.

Table 1. Organic acids, pH, and total titratable acidity (TTA) in the ripe sourdough at the end of the fermentation step (T0), at the end of the dilution step, and three times during the maintenance step

l+d

[lactic acid] g / kg

[acetic acid] g / kg

FQa

pHc

TTAb,c

Initial sourdough

6.9 ± 0.1

1.2 ± 0.1

5.8

4.1 ± 0.0

16.0 ± 1.0

Sourdough R7

4.8 ±0.1

0.8 ± 0.1

4.3

4.1 ± 0.01

12.0 ± 0.8

Sourdough R76

3.6 ± 0.2

0.8 ± 0.1

4.5

4.0 ± 0.1

14.0 ± 1.4

Sourdough R114

4.6 ± 0.2

0.5 ± 0.1

9.9

4.2 ± 0.1

10.2 ± 0.6

Sourdough R198

4.2 ± 0.1

0.4 ± 0.1

9.3

4.3 ± 0.01

9.0 ± 1.7

Sourdough R328

5.6 ± 0.2

0.5 ± 0.1

8.4

4.1 ± 0.1

10.4 ± 1.2

Fermentative quotient: [lactic acid] / [acetic acid]. TTA (ml 0.1 N NaOH / 10 g sourdough). c Three independent measurements were performed on each sample for both analyses. The results are presented as mean ± SD. a b

Characteristics of the organic GF sourdough and the dynamics of its microbiota during the maintenance step. The second step, i.e., maintenance of the sourdough on a GF formulation, lasted 5 months, with regular refreshments twice a day. Samples were drawn from the ripe sourdough about every 2 weeks. The fermentation characteristics of the sourdough are summarized in Table 1. From R76 to R328, the pH remained stable and similar to that of the initial sourdough but the TTA decreased. The concentration of l- + d- lactic acid increased whereas that of acetic acid decreased slightly, leading to a detectable increase in the fermentation quotient. The addition of GF sourdough to the bread formulation increased the fermentation quotient (data not

shown), which positively affects the sensorial properties and shelf-life of sourdough bread [44]. As shown in Table 2, the total yeast population decreased slightly, from a maximum of 8.7 × 107 to 5.9 × 107 CFU/g. At the end, Candida humilis was the only species detected. The LAB counts remained stable during the maintenance step, at 1.0 × 109 CFU/g, but were about 1 log higher than the counts in the initial wheat sourdough. 16S rDNA identification of the LAB isolates showed that L. sanfranciscensis, L. plantarum, and L. spicheri were present until R76. L. sakei became established beginning at R184 and persisted until R328. Therefore, PCR-TTGE was used to confirm the presence of L. sakei and to verify the presence or absence of the other bacterial

Table 2. Microbial sourdough populations of the lactic acid bacteria (Lactobacillus sanfranciscensis [Lsan], and L. spicheri [Lspi], L. plantarum [Lpla] and L. sakei [Lsak]) and yeasts (Candida humilis [Chum] and Saccharomyces cerevisiae [Scer]) during refreshement LAB counta

Lsanb

Lspib

Lplab

Lsakb

Yeast counta

Chumb

Scerb

R0 (wheat SD)

1.3 × 108

45 (n = 10)

32 (n = 7)

23 (n = 5)

ND

3.6 × 107

67

33

R1 (day 0)

1.1 × 10

8

53 ( n = 11)

47 (n = 9)

ND

ND

4.5 × 10

7

67

33

R4 (d2)

2.4 × 10

8

33 (n = 7)

50 (n = 10)

17 (n = 4)

ND

5.1 × 10

7

90

10

R8 (d4)

7.4 × 108

29 (n = 6)

71 (n = 14)

ND

ND

6.7 × 107

96

4

R58 (d29)

1.0 × 109

78 (n = 17)

ND

22 (n = 5)

ND

8.7 × 107

100

ND

R76 (d38)

5.3 × 108

42 (n = 7)

16 (n = 3)

42 (n = 7)

ND

7.6 × 107

100

ND

R184 (d92)

8.1 × 10

8

ND

ND

ND

100 (n = 19)

6.0 × 10

7

100

ND

R198 (d99)

1.0 × 10

9

ND

ND

ND

100 (n = 22)

5.9 × 10

7

100

ND

ND: Not detected. Expressed as CFU/g b Expressed as a percentage. The number of bacterial isolates identified are shown in parenthesis. a


Int. Microbiol. Vol. 17, 2014

5

Int Microbiol

microbial population of sourdough

Fig. 1. PCR-TTGE profiles during dilution of the wheat sourdough to the GF formulation. PCR-TTGE profiles were obtained with the primer pair V3P2 and V3P3. R0–R8: profiles obtained with DNA extracted from sourdough at each refreshment step. Control strains: 1: L. sanfranciscensisT CIP 103252; 2: L. sanfranciscensis ATCC 43332; 3: L. sanfranciscensis BF; 4: L. spicheriT CIP 108581; 5: L. plan­ tarumT ATCC 14917.

species. Figure 1 shows the fingerprints of the DNA samples of sourdough after each refreshment compared with those of the reference strains. The DNA of the type strain L. sakei ATCC 15521 was added as a control and its profile was compared with that of the L. sakei isolates in the GF sourdough. All L. sakei PCR-TTGE profiles were similar (data not shown). The PCR-TTGE profiles in Fig. 2 showed that the microbiota of the sourdough evolved during maintenance. After remaining stable, with identical profiles (R30–R114), a major band appeared beginning at R184 (92 days; band d, R184). By comparing band migration positions, band d was assigned to L. sakei, as subsequently confirmed by cloning and sequencing. The presence of this band correlated with the culturedependent detection of L. sakei. In addition, PCR-TTGE highlighted the stability of L. sanfranciscensis in the GF sourdough, as evidenced by a pattern similar to that of L. sanfran­ ciscensis BF, which was observed throughout the refreshments, except at R184 and R198. This species was not identified at the latter two steps by culture-dependent methods. Finally, beginning at R266 (133 days) onwards, the sourdough became stable (Fig. 2). Detection of bacterial species in organic flours by PCR-TTGE. Analysis by PCR-TTGE of the flours used at the beginning and end of back-slopping revealed, in wholemeal rice and rice flours, a single major band and many minor bands, whereas in the buckwheat flours only one major band was detected (Fig. 2). For each flour, there were few differen-

ces between the two batches tested. Band a was identified as rice chloroplast and band b as L. sanfranciscensis, although its migration differed from that of L. sanfranciscensis BF. Since the other bands were very weak, they were not cloned for sequencing and identification. Thus, while the results indicated the presence of L. sanfranciscensis in the rice flour, no such evidence was available for L. sakei, as neither the sequences nor the migration patterns of bands from the flour samples were similar to those of known L. sakei isolates. Diversity of Lactobacillus sakei in organic GF sourdough. The appearance and maintenance of L. sakei observed by the plating method and PCR-TTGE raised the question of the nature of this population and its implantation. As this species has already been described, in both sourdough [33] and in rice [23,41], we wondered whether one or several strains had derived from the bread flours and flourished in the GF sourdough. Taking advantage of our ability to discriminate among L. sakei isolates [5,28], the nature of the L. sakei population in the sourdough after R184 was examined. Multiplex PCR targeting several gene markers was used to determine the diversity of ten L. sakei isolates from R184 and R198. Based on markers described previously [5] a first subset of six gene markers (DrsB, FGP21-0001, FGP332-0009, FGP3320010, LSA0727, and SspA) was used to assign the genotype clusters of the isolates and a second subset of another six gene markers (LSA0219_b, FGP332-0001, FGP332-0002, FGP3320007, and FGP332-0012) to assess the strain level. The results showed that all isolates of L. sakei belonged to the same clus-


Int. Microbiol. Vol. 17, 2014

Lhomme et al.

Int Microbiol

6

Fig. 2. PCR-TTGE profiles during the maintenance step. Profiles obtained with DNA extracted from flours used for back-slopping are shown: WRFd, whole-meal rice flours used during the dilution step; WRFm, whole-meal rice flours used during the maintenance step; RFd, rice flours used during the dilution step; RFm, rice flours used during the maintenance step; BWFd, buckwheat flours used during the dilution step; BWFm, buckwheat flours used during the maintenance step. R30–R328: Profiles obtained with DNA extracted from GF sourdough at different refreshments (R). Control strains: 1: L. sanfranciscensisT BF; 2: L. sanfranciscensis ATCC 43332; 3: L. spicheriT CIP 108581; 4: L. plantarumT ATCC 14917; 5 : L. sakei ATCC 15521. Bands a (choloroplast), b and c (L. sanfran­ ciscensis), and d (L. sakei) were identified by sequence characterization of the excised fragments.

ter as that of L. sakei ATCC 15521, the type strain previously isolated from spoiled rice alcohol [23]. This group is characterized by the presence of the FGP21-0001 marker, which encompasses “non-meat” isolates [5]. Three different profiles were defined, indicating that the L. sakei population that arose on GF sourdough after R184 was composed of at least three different strains.

Discussion This study describes the evolution of the microbiota in an organic GF sourdough derived from an organic wheat sourdough. In the initial long-term wheat sourdough, C. humilis was the main species although S. cerevisiae was also identified. The results confirm those of a previous study of this wheat sourdough (B. Onno, unpublished), and they are in agreement with previous investigations of sourdough yeasts [9]. In particular, S. cerevi­ siae and C. humilis were shown to be associated with LAB in type I sourdoughs [9,17,48]. However, in our study, after backslopping with rice and buckwheat flours, C. humilis was the

only yeast species present. Few studies have examined the yeasts in GF sourdough. In a previous study of the development of a commercial starter for the production of GF bread, yeast could not be isolated from the sourdough containing buckwheat [34]. In our sourdough, we recorded a decrease in the S. cerevisiae population although this species has been previously described as competitive and as the only species present in rice sourdough [30]. By contrast, L. sanfranciscensis, L. plantarum and L. spi­ cheri, the Lactobacillus species most frequently isolated from sourdough [7,11,30,53], were detected in the initial wheat sourdough but were not specific for it. Remarkably, the presence of L. sanfranciscensis and L. spicheri in this particular wheat sourdough has been reported in earlier studies [14,47], which confirms the long-term stability of these strains. After back-slopping with GF flours, Lactobacillus species could no longer be identified by the culture-dependent methods. However, L. sanfranciscensis was still identified by PCR-TTGE. The drop in the acetic acids concentration in the sourdough (Table 2) can be attributed to the implantation of homofermentative L. sakei. Although L. spicheri has been


microbial population of sourdough

described as a competitive LAB in rice sourdoughs [30], in our sourdough its presence gradually decreased until, finally, it was undetectable by culture-dependent and -indepenedent methods. In a previous study [51], L. spicheri has not predominated in rice sourdough. L. sakei, described as a meat-associated bacterium [4,6], is also less frequently found in traditional sourdough. However, this species has been isolated from wheat sourdough [47]; it has been described as the dominant species of spontaneously fermented amaranth [45] and spontaneously fermented buckwheat [33] sourdoughs. In our study, the type and quality of the substrate as well as the microbial interactions during fermentation might y have influenced the microbial populations of the sourdoughs. It is known that the type of flour, the sourdough-generating process, and other related factors strongly influence the composition of sourdough microbiota [10,31]. In addition, the species of wheat flour (Triticum durum or T. aestivum) may play a key role in both selecting the LAB population and determining the concentration of nutrients required by the microorganisms dominating the sourdough ecosystem [32]. Our study confirms that the nature of the cereals used might influence the competitiveness and interactions of LAB and yeasts in sourdough. The short-term adaptation of LAB and yeasts to sourdough prepared from cereals, pseudocereals, and cassava has been examined, but the dynamics of adaptation have not been reported [51]. Nevertheless, the authors observed the establishment of a stable sourdough after 13 and 12 days for rice and buckwheat sourdoughs, respectively. In our sourdough, the profile for refreshment after 15 days (R30) was similar to those of previous refreshments, except for the detection of L. sakei at R114 (57 days). It might therefore be the case that modifications in the microbiota were detected only after a long period of time. To our knowledge, ours is the first study to investigate the adaptability of sourdough refreshed with new flours and the long-term evolution of this sourdough. In earlier studies [30,31,34,35,49,50,53], only short-term (about 10–15 days) monitoring has been carried out, when the stability of the examined sourdoughs seemed to have been established. Other studies have analyzed sourdough evolution over several years but with either no or few changes in the process [39,42]. In the present study, specific LAB strains, such as L. sanfranciscen­ sis BF, persisted in the GF sourdough. These LAB might have originated from the wheat sourdough or from the bakery environment, and their persistence might have been the result of consistent fermentation variables (temperature, time), which ultimately led to the selection of LAB strains best adapted to the applied process conditions.

Int. Microbiol. Vol. 17, 2014

7

To establish a link between the flours used in sourdough generation and the species found in the sourdough, we searched for bacteria in the flours used. Although L. sanfrancis­ censis is considered a key sourdough LAB [16], its origin has not been clearly established. Contrary to most sourdough lactobacilli, which are also inhabitants of other ecosystems (e.g., human and animal intestines), no other habitats are currently known for L. sanfranciscensis [18,52]. However, unlike some species, the presence of L. sanfranciscensis in flours has yet to be clearly shown [52]. In our case, L. sanfranciscensis was detected in rice flour by PCR-TTGE but not by the culturedependent method of identification. Thus, this species either was non-cultivable under the chosen conditions or, most likely, was subdominant. Further investigations, using different growth conditions (media, temperature, and atmosphere) and quantitative-PCR will be necessary to confirm the pres­ ence of this species in rice flour. The origin of L. sakei, a meat-associated bacterium, in cereals has not been researched, although the bacterium has been isolated from sourdough [33,45,47] and from other vegetable substrates such as kimchi [22]. The analysis of ten L. sakei isolates showed their close relationship and that they grouped with L. sakei ATCC 15521, which has been isolated from rice wine [23]. At least three different strains were isolated from our GF sourdough. Since all L. sakei isolates originating from sourdough sources are genetically closely related [5], the adaptation of these strains to the sourdough ecosystem might be readily studied by searching for specific enzymatic activities, such as maltose utilization. In our polyphasic approach, only L. sanfranciscensis was detected by PCR-TTGE, a non-culture-dependent method. Under our experimental conditions, in which the sourdough being back-slopped was kept in the same facility where a conventional sourdough was maintained, the detection of L. san­ franciscensis only by the culture-independent method could indicate that this strain was an environmental contaminant. A possible explanation could be that the specific nutritional requirements of that strain were not provided by the chosen medium [19]. Moreover, the PCR-TTGE seemed to yield a specific profile for strain L. sanfranciscensis BF. Since the isolation method and PCR-TTGE are subject to different biases, our study confirms the need to simultaneously use culturedependent and independent methods to study the microbial diversity of the food fermentation process. Further investigations, including a metagenomic approach, will likely provide a wealth of information of the microbiota of sourdough, including identification of the relevant microorganisms, their genetic content, and the metabolic and


8

Int. Microbiol. Vol. 17, 2014

functional potential of the microbial communities to which they belong [22]. Acknowledgements. We thank the Biofournil bakery for their contribution to this study. We thank Jean-Jacques Joffraud for his help with BioNumerics Software, version 6.0, and Florence Valence-Bertel for the PFGE experiments. This work was supported by the French Ministère de l’Agriculture, de l’Alimentation et de la Pêche.

Competing interests. None declared.

References 1. Ammor S, Dufour E, Zagorec M, Chaillou S, Chevallier I (2005) Characterization and selection of Lactobacillus sakei strains isolated from traditional dry sausage for their potential use as starter cultures. Food Microbiol 22:529-538 2. Arendt EK, Ryan LAM, Dal Bello F (2007) Impact of sourdough on the texture of bread. Food Microbiol 24:165-174 3. Catassi C, Fasano A (2008) Celiac disease. In: Arent EK, Dal Bello F (eds) Gluten-free cereal products and beverages. Academic Press, San Diego, pp 1-27 4. Chaillou S, Champomier-Vergès MC, Cornet M, et al. (2005) The complete genome sequence of the meat-borne lactic acid bacterium Lactoba­ cillus sakei 23K. Nat Biotech 23:1527-1533 5. Chaillou S, Daty M, Baraige F, Dudez A-M, Anglade P, Jones R, Alpert CA, Champomier-Vergès MC, Zagorec M (2009) Intraspecies genomic diversity and natural population structure of the meat-borne lactic acid bacterium Lactobacillus sakei. Appl Environ Microbiol 75:970-980 6. Champomier-Vergès MC, Montel MC, Grimont F, Grimont PAD (1987) Genomic identification of meat lactobacilli as Lactobacillus sake. Ann Inst Pasteur Mic 138:751-758 7. Corsetti A, Settanni L (2007) Lactobacilli in sourdough fermentation. Food Res Int 40:539-558 8. De Man JC, Rogosa M, Sharpe ME (1960) A medium for the culitvation of lactobacilli. J Appl Microbiol 23:130-135 9. De Vuyst L, Neysens P (2005) The sourdough microflora: biodiversity and metabolic interactions. Trends Food Sci Tech 16:43-56 10. De Vuyst L, Schrijvers V, Paramithiotis S, Hoste B, Vancanneyt M, Swings J, Kalantzopoulos G, Tsakalidou E, Messens W (2002) The biodiversity of lactic acid bacteria in greek traditional wheat sourdoughs is reflected in both composition and metabolite formation. Appl Environ Microbiol 68:6059-6069 11. De Vuyst L, Vancanneyt M (2007) Biodiversity and identification of sourdough lactic acid bacteria. Food Microbiol 24:120-127 12. De Vuyst L, Van Kerrebroeck S, Harth H, Huys G, Daniel HM, Weckx S (2014) Microbial ecology of sourdough fermentations: Diverse or uniform? Food Microbiol 37:11-29 13. Decock P, Cappelle S (2005) Bread technology and sourdough technology. Trends Food Sci Tech 16:113-120 14. Ferchichi M, Valcheva R, Prévost H, Onno B, Dousset X (2008) Rapid identification of Lactobacillus nantensis, Lactobacillus spicheri and Lactobacillus hammesii species using species-specific primers. Int J Food Microbiol 123:269-276 15. Gallagher E, Gormley TR, Arendt EK (2003) Crust and crumb characteristics of gluten free breads. J Food Eng 56:153-161

Lhomme et al.

16. Gobbetti M, Corsetti A (1997) Lactobacillus sanfrancisco, a key sourdough lactic acid bacterium: a review. Food Microbiol 14:175-188 17. Gobbetti M, Simonetti MS, Rossi J, Cossignani L, Corsetti A, Damiani P (1994) Free d- and l-amino acid evolution during sourdough fermentation and baking. J Food Sci 59:881-884 18. Hammes WP, Brandt MJ, Francis KL, Rosenheim J, Seitter MFH, Vogelmann SA (2005) Microbial ecology of cereal fermentations. Trends Food Sci Tech 16:4-11 19. Hammes WP, Gänzle MG (1997) Sourdough breads and related pro­ ducts. In: BB Wood (ed.), Microbiology of fermented foods. Springer, New York, pp 199-216 20. Iacumin L, Cecchini F, Manzano M, Osualdini M, Boscolo D, Orlic S, Comi G (2009) Description of the microflora of sourdoughs by culture-dependent and culture-independent methods. Food Microbiol 26:128-135 21. Jaffrès E, Sohier D, Leroi F, Pilet MF, Prévost H, Joffraud JJ, Dousset X (2009) Study of the bacterial ecosystem in tropical cooked and peeled shrimps using a polyphasic approach. Int J Food Microbiol 131:20-29 22. Jung JY, Lee SH, Kim JM, Park MS, Bae JW, Hahn Y, Madsen EL, Jeon CO (2011) Metagenomic analysis of kimchi, a traditional Korean fermented food. Appl Environ Microbiol 77:2264-2274 23. Katagiri H, Kitahara K, Fukami K (1934) The characteristics if the lactic acid bacteria isolated from moto, yeast mashes for sake manufacture. Bull Agr Chem Soc Japan 10:156-157 24. Katina K, Arendt E, Liukkonen KH, Autio K, Flander L, Poutanen K (2005) Potential of sourdough for healthier cereal products. Trends Food Sci Tech 16:104-112 25. Kline L, Sugihara TF (1971) Microorganisms of the San Francisco sour dough bread process. II. Isolation and characterization of undescribed bacterial species responsible for souring activity. Appl Microbiol 21:459-465 26. Kurtzman CP, Robnett CJ (1998) Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A van Leeuw J Microbiol 73:331-371 27. Lortal S, Rouault A, Guezenec S, Gautier M (1997) Lactobacillus hel­ veticus: strain typing and genome size estimation by pulsed field gel electrophoresis. Curr Microbiol 34:180-185 28. Lucquin I, Zagorec M, Champomier-Vergès M, Chaillou S (2012) Fingerprint of lactic acid bacteria population in beef carpaccio is influenced by storage process and seasonal changes. Food Microbiol 29:187-196 29. Meroth CB, Hammes WP, Hertel C (2003) Identification and population dynamics of yeasts in sourdough fermentation processes by PCR-denaturing gradient gel electrophoresis. Appl Environ Microbiol 69:74537461 30. Meroth CB, Hammes WP, Hertel C (2004) Characterisation of the microbiota of rice sourdoughs and description of Lactobacillus spicheri sp. nov. Syst Appl Microbiol. 27:151-159 31. Meroth CB, Walter J, Hertel C, Brandt MJ, Hammes WP (2003) Monitoring the bacterial population dynamics in sourdough fermentation processes by using PCR-denaturing gradient gel electrophoresis. Appl Environ Microbiol 69:475-482 32. Minervini F, Di Cagno R, Lattanzi A, De Angelis M, Antonielli L, Cardinali G, Cappelle S, Gobbetti M (2012) Lactic acid bacterium and yeast microbiotas of 19 sourdoughs used for traditional/typical Italian breads: interactions between ingredients and microbial species diversity. Appl Environ Microbiol 78:1251-1264 33. Moroni AV, Arendt EK, Bello FD (2011) Biodiversity of lactic acid bacteria and yeasts in spontaneously-fermented buckwheat and teff sourdoughs. Food Microbiol 28:497-502


microbial population of sourdough

34. Moroni AV, Arendt EK, Morrissey JP, Bello FD (2010) Development of buckwheat and teff sourdoughs with the use of commercial starters. Int J Food Microbiol142:142-148. 35. Moroni AV, Dal Bello F, Arendt EK (2009) Sourdough in gluten-free bread-making: An ancient technology to solve a novel issue? Food Microbiol 26:676-684 36. Nguyen H-V, Gaillardin C, Neuv辿glise C (2009) Differentiation of De足 baryomyces hansenii and Candida famata by rRNA gene intergenic spacer fingerprinting and reassessment of phylogenetic relationships among D. hansenii, C. famata, D. fabryi, C. flareri (=D. subglobosus) and D. prosopidis: description of D. vietnamensis sp. nov. closely related to D. nepalensis. FEMS Yeast Res 9:641-662 37. Ogier JC, Son O, Gruss A, Tailliez P, Delacroix-Buchet A (2002) Identification of the bacterial microflora in dairy products by temporal temperature gradient gel electrophoresis. Appl Environ Microbiol 68:36913701 38. Picozzi C, Bonacina G, Vigentini I, Foschino R (2010) Genetic diversity in Italian Lactobacillus sanfranciscensis strains assessed by multilocus sequence typing and pulsed-field gel electrophoresis analyses. Microbiology 156:2035-2045 39. Rosenquist H, Hansen A (2000) The microbial stability of two bakery sourdoughs made from conventionally and organically grown rye. Food Microbiol 17:241-250 40. Sahota A (2009) Geneva: FiBL-IFOAM report. In: Willer H, Klicher L (eds) The world of organic agriculture: Statistics and emerging trends. FiBL-IFOAM. Bonn, Frick, Geneva, pp 281-304 41. Sakamoto N, Tanaka S, Sonomoto K, Nakayama J (2011) 16S rRNA pyrosequencing-based investigation of the bacterial community in nukadoko, a pickling bed of fermented rice bran. Int J Food Microbiol 144:352-359 42. Scheirlinck I, Van der Meulen R, Van Schoor A, Vancanneyt M, De Vuyst L, Vandamme P, Huys G (2008) Taxonomic structure and stability of the bacterial community in Belgian sourdough ecosystems as assessed by culture and population fingerprinting. Appl Environ Microbiol 74:24142423 43. Siragusa S, Di Cagno R, Ercolini D, Minervini F, Gobbetti M, De Angelis M (2009) Taxonomic structure and monitoring of the dominant population of lactic acid bacteria during wheat flour sourdough type I propagation using Lactobacillus sanfranciscensis starters. Appl Environ Microbiol 75:1099-1109 44. Spicher G, Br端mmer JM (2008) Baked goods. In: Rehm HJ, Reed G (eds) Biotechnology Set, 2nd ed, Wiley-VCH Verlag GmbH, Weinheim, Germany, doi:10.1002/9783527620999.ch7j

Int. Microbiol. Vol. 17, 2014

45. Sterr Y, Weiss A, Schmidt H (2009) Evaluation of lactic acid bacteria for sourdough fermentation of amaranth. Int J Food Microbiol 136:7582 46. Torriani S, Felis GE, Dellaglio F (2001) Differentiation of Lactobacil足 lus plantarum, L. pentosus, and L. paraplantarum by recA gene sequence analysis and multiplex PCR assay with recA gene-derived primers. Appl Environ Microbiol 67:3450-3454 47. Valcheva R, Korakli M, Onno B, et al. (2005) Lactobacillus hammesii sp. nov., isolated from French sourdough. Int J Syst Evol Microbiol 55:763-767 48. Valmorri S, Tofalo R, Settanni L, Corsetti A, Suzzi G (2010) Yeast microbiota associated with spontaneous sourdough fermentations in the production of traditional wheat sourdough breads of the Abruzzo region (Italy). A Van Leeuw J Microb 97:119-129 49. Van der Meulen R, Scheirlinck I, Van Schoor A, Huys G, Vancanneyt M, Vandamme P, De Vuyst L (2007) Population dynamics and metabolite target analysis of lactic acid bacteria during laboratory fermentations of wheat and spelt sourdoughs. Appl Environ Microbiol 73:4741-4750 50. Vogelmann SA, Hertel C (2011) Impact of ecological factors on the stability of microbial associations in sourdough fermentation. Food Microbiol 28:583-589 51. Vogelmann SA, Seitter M, Singer U, Brandt MJ, Hertel C (2009) Adaptability of lactic acid bacteria and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava and use of competitive strains as starters. Int J Food Microbiol 130:205-212 52. Vrancken G, De Vuyst L, Rimaux T, Allemeersch J, Weckx S (2011) Adaptation of Lactobacillus plantarum IMDO 130201, a wheat sourdough isolate, to growth in wheat sourdough simulation medium at different pH values through differential gene expression. Appl Environ Microbiol 77:3406-3412 53. Weckx S, Van der Meulen R, Maes D, Scheirlinck I, Huys G, Vandamme P, De Vuyst L (2010) Lactic acid bacteria community dynamics and metabolite production of rye sourdough fermentations share characteristics of wheat and spelt sourdough fermentations. Food Microbiol 27:1000-1008 54. Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697703

9


RESEARCH ARTICLE International Microbiology (2014) 17:11-20 doi:10.2436/20.1501.01.203 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Relating the outcome of HCV infection and different host SNP polymorphisms in a Majorcan population coinfected with HCV–HIV and treated with pegIFN-RBV Marina Matas,1 Antònia Picornell,1 Carmen Cifuentes,2 Antoni Payeras,2 Francesc Homar,2 Fernando González-Candelas,3 F. Xavier López-Labrador,3 Andrés Moya,3 Cori Ramon,1 José A. Castro1* University Institute of Research in Health Sciences and Laboratory of Genetics, Department of Biology, University of the Balearic Islands, Palma, Spain. 2Infectious Diseases Center, Son Llàtzer Hospital, Palma, Spain. 3 Joint Unit Genomics and Health, FISABIO-Public Health Research/Cavanilles Institute of Biodiversity and Evolutionary Biology, University of València, València, CIBER in Epidemiology and Public Health, Carlos III Health Institute, Spain 1

Received 9 December 2013 · Accepted 17 March 2014

Summary. Hepatitis C virus (HCV) is one of the major causes of chronic hepatitis, cirrhosis, and hepatocellular carcinoma, and the development of HCV-related disease is accelerated in individuals coinfected with human immunodeficiency-1 virus (HIV). In the present study, we correlated different host single-nucleotide polymorphisms (SNPs) in the IL28B, CTLA4, LDLr, and HFE genes and mitochondrial DNA (mtDNA) haplogroups with the outcome of HCV infection and the response to pegylated-interferon plus ribavirin (pegIFN-RBV) treatment. Our study population consisted of 63 Majorcan patients coinfected with HCV and HIV and 59 anonymous unrelated controls. Whereas the population frequency of IL28B alleles was similar to that found in a North-American cohort of European descent, the frequency of the rs12979860 C allele was lower than that determined in other cohorts from Spain. The frequencies of CTLA4 and LDLr polymorphisms were comparable to those reported in other populations. Significant differences between cases and control cohorts occurred only for the H63D mutation of the HFE gene. There were no other differences in the frequencies of other polymorphisms or mtDNA haplogroups. The IL28B rs12979860 CC genotype was shown to be associated with a rapid virological response, and the spontaneous viral clearance rate for HCV was higher in patients with the CTLA4+49 G allele. There was no relationship between SNPs in the LDLr and HFE genes and mtDNA haplogroups and the response to treatment. Our results suggest that the host genetic background plays a significant role in the pegIFN-RBV response of patients coinfected with HCV and HIV. [Int Microbiol 2014; 17(1):11-20] Keywords: HCV–HIV co-infection · mtDNA haplogroups · SNP polymorphisms

Corresponding author: J.A. Castro Laboratori de Genètica, Departament de Biologia Facultat de Ciències, Universitat de les Illes Balears Carr. Valldemossa, km. 7,5 07122 Palma, Spain Tel. +34-971173153. Fax +34-971173184 E-mail: jose.castro@uib.es

*

Introduction Hepatitis C virus (HCV) is the main cause of chronic liver disease, including chronic hepatitis, cirrhosis, and hepatocellular carcinoma [2]. The World Health Organization (WHO) estimates that up to 3 % of the world’s population is infected


12

Int. Microbiol. Vol. 17, 2014

with HCV, implying that there are 170–200 million carriers of the virus [18,33]. The prevalence of HCV infection ranges from less than 1 % in Northern Europe to more than 2 % on average in North Africa. The highest HCV prevalence (ca. 15 %) is in Egypt [21]. HCV transmission occurs primarily through transfusions of contaminated blood or blood products and in drug abusers through the sharing of contaminated needles and syringes. Because of the common routes of transmission, HCV-infected patients are also frequently infected with the human immunodeficiency virus (HIV). HIV positivity has been recognized as an important factor responsible for an increased morbidity and mortality in HCV-infected individuals, and antiviral treatment for HIV modifies HCV disease outcome and survival [1,33]. Although spontaneous virus clearance (SVC) occurs in 15–30 % of HCV-infected adults, in 75–85 % of patients the infection progresses to chronic disease. Children and young women have a higher rate of SVC, around 45 % of the total number of infected individuals in these groups [32]. For many years, the most effective treatment for HCV infection has been based on the administration of interferon (IFN), which produces a sustained viral response (SVR) in 20 % of HCV-infected patients. The combination of IFN with ribavirin (RBV) and the subsequent addition of polyethylene glycosylated IFN (pegIFN) was a breakthrough in the treatment of HCV-mediated disease, increasing the response rate to 50–80 %. Patients who fail to show an early decline in viral load during treatment are less likely to achieve a SVR [3]. In addition, patient characteristics such as older age, male gender, overweight, and the presence of cirrhosis or hepatic steatosis, insulin resistance, diabetes, or coinfection with HIV or hepatitis B virus (HBV) [3,13,27,29] are all associated with a lower rate of SVR. In HCV-infected patients, an important aspect of clinical practice is monitoring the efficacy of treatment and the duration of the effectiveness, through repeated measurements of HCV RNA levels. These measurements are typically performed before treatment is started, at 4, 12, and 24 weeks of treatment and, finally, 24 weeks after the end of the treatment, to determine whether the patients has achieved SVR. The probability of achieving a SVR is inversely proportional to the time until the viral load becomes undetectable. Treatment should be discontinued at week 12 if the decrease in viral load is less than 2 logs (IU/ml) and at week 24 if there is still detectable viral load, as in these patients the probability of a SVR is very low (1–3 %) [6]. Identification of the mechanisms underlying treatment failure in patients receiving pegIFN-RBV would be useful to anticipate the likelihood of their achieving a SVR. Different

matas et al.

single nucleotide polymorphisms (SNPs) located upstream of the interleukin 28B gene (IL28B) have been related to the outcome of HCV infection and to the success of peg-IFN-RBV therapy. For example, Ge et al. [9] have found a strong relation between the SNP rs12979860, located close to the IL28B gene, and treatment response. A large number of SNPs in other genes have also been studied for their association with disease outcome, including: (i) immune-related genes, such as the cytotoxic T-lymphocyte antigen 4 gene (CTLA4) [5,24,31,36]; (ii) lipid metabolism genes, such as the low density lipoprotein receptor gene (LDLr) [19,22,30,35]; and (iii) SNPs implicated in other liver diseases, such as mutations in the hereditary hemochromatosis gene (HFE) [4,10,16]. Other studies have used populationrelated markers such as mtDNA haplogroups, which are also an indicator of mitochondrial function [8,14,20]. In this study, we examined the frequencies of the SNPs associated with treatment response in a cohort of HCV–HIVcoinfected patients in Majorca. Specifically, we analyzed the frequencies of SNPs in the IL28B, CTLA4, LDLr, and HFE genes and the mtDNA haplogroups and whether either one correlated with the outcome of HCV infection in patients treated with pegIFN-RBV. At the same time, we determined whether the frequencies of these SNPs in our Majorcan cohort were similar to those in other populations.

Materials and methods Patient and control samples. Sixty-three HCV–HIV coinfected patients were selected from those attending the Infectious Diseases Unit of Son Llàtzer Hospital, Palma, Balearic Islands, Spain. Inclusion criteria were positive viremia for both viruses (HCV and HIV) and seronegativity (HBsAg negative) for HBV. Six patients showed spontaneous HCV clearance while being evaluated for inclusion for HCV treatment. Spontaneous HCV clearance was defined as HCV-RNA negativity but HCV seropositivity in a treatment-naive patient. Fifty-seven patients were treated for 48 weeks with pegIFN-RBV: pegIFNα-2a: 180 µg/week or peg-IFNα-2b: 1.5 µg/kg/week and ribavirin according to patient weight. Patients weighing < 75 kg received 1000 mg/day (2–0–3), and those weighing >75 kg, 1200 mg/day (3–0–3). Buccal epithelial cells were obtained from three oral swabs and then airdried and stored at room temperature. DNA samples from 59 anonymous control individuals (29 males and 30 females) from the general Majorcan population were randomly selected from those available in the Genetics Laboratory of the University of the Balearic Islands. The study was approved by the local institutional ethics committee and all patients provided informed consent regarding the use of their biological samples for medical research. Variables. We constructed a database with patient variables collected retrospectively by chart review. The variables consisted of the basic characteristics of the patients (age, sex, body mass index, alcohol consumption). Other variables were biochemical markers, including aspartate transaminase (AST), alanine transaminase (ALT), and cholesterol, blood count (hemoglobin, leukocytes, platelets), features related to infection, such as HCV genotype, HCV


Host SNP polymorphisms in HCV infection

Int. Microbiol. Vol. 17, 2014

13

Table 1. Host genetic polymorphisms analyzed Gene

Polymorphism

Nucleotide change

Interleukin 28B (IL28B)

rs12979860

C/T

Cytotoxic T-lymphocyte antigen 4 (CTL4)

+49 (rs231775)

G/A

–318 (rs5742909)

C/T

Low density lipoprotein receptor (LDLr)

rs14158

A/G

Hereditary hemochromatosis gene (HFE)

C282Y

G/A

H63D

C/G

S65C

T/A

Mitochondrial DNA haplogroup

H Others (non-H)

baseline viral load, transmission route, treatment with highly active antiretroviral therapy (HAART), and variables related to effects of the disease. The latter included CD4+ T-cell count, liver damage measured by fibroscan (transient elastography) and biopsy, and the presence of hepatomegaly, splenomegaly, and/or hepatic steatosis. Fibrosis stage was obtained by biopsy (stage F0–F1) and/or fibroscan measurements (values <7.2 kPa were also considered as F0–F1 stage). Biopsy data were taken into account when both measurements (biopsy and fibroscan) were available. Response to treatment was evaluated at 4, 12, 24, and 48 weeks (SVR). Patients were classified as having achieved a SVR when the viral load remained undetectable 24 weeks after the completion of treatment (week 48). Genetic polymorphisms. The SNPs IL28B rs12979860, CTLA4+49 rs231775, CTLA4–318 rs5742909, LDLr rs14158, HFE C282Y, HFE H63D, and HFE S65C were evaluated, together with the mtDNA haplogroup. In the control samples from the Majorcan population, only the polymorphisms not determined in previous studies were evaluated, i.e., IL28B, CTLA4+49, CTLA4-318, LDLr, and HFE S65C (Table 1). Genotyping was carried out using restriction fragment length polymorphism (RFLP) techniques and, when necessary, DNA sequencing (for LDLr SNPs and non-H mtDNA haplogroups). DNA extraction and amplification. DNA was extracted from the oral swabs using a standard phenol-chloroform extraction method followed by precipitation with ethanol and NaCl. The primers designed and used in the present work to amplify the IL28B upstream region and the LDLr were, respectively, IL28B-forward 5′-GCTTATCGCATACGGCTAGG-3′ and IL28Breverse 5′-AGGGACCGCTACGTAAGTCA-3′ (427 bp amplicon), and LDLr-forward 5′-TGGCAGAGACAGATGGTCAG-3′ and LDLr-reverse 5′-CACTGTCCGAAGCCTGTTCT-3′ (195 bp amplicon). The primers used to amplify CTLA4 (680 bp) and HFE gene (390 bp for C282Y and 208 for H63D/S65C) polymorphisms were those described by Nischalke et al. [24] and Feder et al. [7], respectively. PCRs were carried out using 40 ng of DNA, 0.2 pM of each primer, 0.2 mM of each dNTP, and 0.75 units of Taq polymerase (Dynazyme, Thermo Fisher, Lafayette, CO, USA). Amplification consisted of denaturation at 94ºC for 10 min followed by 35 cycles of denaturation at 94 ºC for 1 min, 1 min at the annealing temperature (59–60 ºC), and 1 min of extension at 72 ºC, with a final extension at 72 ºC for 10 min. The RFLP motif -7025 AluI was analyzed to determine mtDNA haplogroup H using the following primers: 5′-CCGTAGGTGGCCTGACTGGC-3′ (forward) and 5′- TGATGGCAAATACAGCTCCT-3′ (reverse) [25]. PCR (124 bp) was carried out using 60 ng of genomic DNA, 2 pM of each primer, 0.4 mM of each dNTP, and 1.25 units of Taq polymerase (Dynazyme). This

PCR conditions were denaturation at 94 ºC for 5 min, followed by 35 cycles of denaturation at 94 ºC for 50 s, 1 min 50 s at 59 ºC (annealing), and 1 min of extension at 72 ºC; 5 min at 72 ºC was added at the end of the cycles. The mtDNA hypervariable regions of non-H samples (a 453-nucleotide sequence in region I and a 401-nucleotide in region II ) were analyzed using the primers L15996 (5′-CTCCACCATTAGCACCCAAAGC-3′) and H16401 (5′-TGATTTCACGGAGGATGGTG-3′) for hypervariable region I, and L48 (5′-CTCACGGGAGCTCTCCATGC-3′) and H408 (5′-CTGTTAAAAGTGCATACCG CCA-3′) for hypervariable region II [34]. Each PCR consisted of 80 ng of DNA, 0.2 pM of each primer, 0.4 mM of each dNTP, and 1 unit of Taq polymerase (Dynazyme), with denaturation at 96 ºC for 5 min followed by 30 cycles of denaturation at 94 ºC for 1 min, 1 min at 50 ºC (annealing), and 1 min of extension at 72 ºC. Genotyping by RFLPs. Table 2 shows the restriction enzymes, cutting sites, conditions used in the RFLP digestions, and the resulting band patterns. RFLP assays not described in the literature were designed with the tools provided on the New England Biolabs website [http://tools.neb.com/NEBcutter2/]. Digested DNA was electrophoresed in EEO agarose with 1× TAE buffer, using ethidium bromide for DNA staining. To verify the results of the new RFLP assays, direct sequencing of the target SNP was performed from PCR amplicons. Genotyping by sequencing. Polymorphisms in the LDLr gene and the non-H mtDNA haplogroups were detected by DNA sequencing. The PCR products were purified using the PCRapace spin kit (Invitek, Berlin, Germany) and sequenced with the BigDye Terminator v.3.1. cycle sequencing kit (Applied Biosystems, Foster City, CA, USA). The samples were precipitated with ethanol and analyzed in an ABI 3130 automated sequencer (Applied Biosystems). The chromatograms and outputs were analyzed using the Bioedit Sequence Alignment Editor software [12]. Non-H mtDNA sequences were aligned and the most probable haplogroup was assigned by means of the Haplogrep software [haplogrep.uibk.ac.at]. Statistical methodology. The genotypic and allelic frequencies of the polymorphisms were calculated by direct counting. Chi-square or Fisher’s tests, when appropriate, were performed on contingency tables to identify differences in genotype distributions between cases and controls. To analyze associations with qualitative variables (sex, genotype virus, route of transmission, biopsy data, viral load, hepatomegaly, splenomegaly, and hepatic steatosis), the chi-square statistic or Fisher’s test was also used on contingency tables. The association of the host genotypes with a response to treat-


14

Int. Microbiol. Vol. 17, 2014

matas et al.

Table 2. Conditions and band patterns in RFLP analyses

Table 2A. Conditions Polymorphisms

Enzymes

Target point (polymorphic nucleotide)

Temperature and time

Agarose

IL28B rs12979860

Hpy166II

GTN^NAC

37 oC – 3 h

2%

CTLA4 +49

Fnu4HI

GC^NGC

37 oC – 2 h

4%

CTLA4 –318

MnlI

HFE C282Y

CCTC(N)7^

37 C – 2 h

4%

RsaI

1

GT^AC

37 C – 3.5 h

3%

HFE H63D

BclI

1

T^GATCA

50 C – 2h

3%

HFE S65C

HinfI

G^ANTC

37 C – 3h

3%

Haplogrup H

AluI

AG^CT

37 C – 3h

o o o o o

Table 2B. Band patterns Polymorphisms

Motif

bp fragment

Motif

bp fragment

Unspecific fragment (bp)

IL28B rs12979860

C

320

T

28, 292

CTLA4 +49

A

223

G

28, 195

457

CTLA4 –318

C

59, 71

T

130

53, 111, 376

HFE C282Y

Normal

250

Mutated

110, 140

HFE H63D

Normal

70, 138

Mutated

208

HFE S65C

Normal

58, 150

Mutated

208

Haplogrup H

Haplo H

124

Non-H

80

Ref. Lynas [17].

1

ment (at 4, 12, and 24 weeks, SVR) or with spontaneous clarification was tested following the same approach. Quantitative variables were tested for a normal distribution by the Kolmogorov-Smirnov test. Variables with a normal distribution were analyzed using Student’s t test or an ANOVA when comparing two or three groups, respectively. Quantitative variables that did not follow a normal distribution were analyzed using the nonparametric Mann-Whitney or Kruskal-Wallis test, for comparisons of two or three groups, respectively. All statistical calculations were performed using SPSS software for Windows (Rel. 15.0.1 2006 Chicago: SPSS Inc.).

Results Baseline characteristics of the subjects. The main characteristics of the study subjects are shown in Table 3. Variables with a normal distribution were age, body mass index, cholesterol, hemoglobin levels, platelets, leukocytes and fibrosis assessed by fibroscan; quantitative variables that did not follow a normal distribution were AST, ALT, HCV viral load, and the absolute CD4 count. Gender was not evenly dis-

tributed as there were twice as many male as female patients. Males had higher levels of AST (P < 0.05), ALT (P < 0.05), and hemoglobin (P < 0.005) than females. Current injection drug usage was the main route of transmission, but it did not correlate with the degree of fibrosis. Relevant alcoholic consumption (> 50 mg/day for over 2 years) was present only in a few female patients. In the treated patients, AST and ALT levels and the frequency of HCV genotype 3 infection (all with a P < 0.05) were higher in patients with a SVR. Six out of 63 patients (9.5 %) had SVC during treatment evaluation and were therefore not treated with pegIFN-RIB. AST and ALT levels were significantly lower in patients with SVC than in treated patients (P < 0.005). Frequencies of the genetic polymorphisms. All of the studied host genetic polymorphisms were unequivocally assigned in all cases. IL28B, LDLr, CTLA4, and HFE (S65C) polymorphisms were analyzed in 53–58 individuals of the control group, depending on the SNP. The distribution


Host SNP polymorphisms in HCV infection

Int. Microbiol. Vol. 17, 2014

15

Table 3. Baseline demographic, epidemiological and clinical characteristics of HCV–HIV coinfected subjects. Frequencies and proportions or means plus standard deviations (in parenthesis) are indicated in categorical and continuous variables, respectively. SVC patients (n = 6)

Treated patients (n = 57) SVR (n = 24) AGE, years

42.42 (5.55)

BMI (na = 4)

24.74 (3.01)

Cholesterol, mg/dl (na = 2) AST level, U/ml (na = 1) ALT level, U/ml (na = 1)

175.70 (41.05) 76.29 (45.15) 95.17 (57.79)

no SVR (n = 31)

All patients (n = 63)

Total

40.77 (4.92)

41.53 (5.43)

41.67 (6.31)

42 (5)

23.58 (3.12)

24.10 (3.10)

22.64 (3.00)

23.97 (3.09)

174.26 (34.67)

174.57 (36.54)

212.40 (64.96)

178 (40)

58.52 (44.04)

66.02 (44.65)

P < 0.05

24.4 (8.20)

63 (44)

P < 0.005

70.48 (56.76)

81.40 (57.56)

P <0 .05

27.6 (11.31)

77 (57)

P < 0.005

526.95 (298.35)

375.40 (148.94)

515 (291)

CD4 cell count, cell/mm3 (na = 1)

468.33 (234.21)

582.55 (339.92)

Haemoglobin levels, g/dl (na = 11)

14.81 (1.70)

14.26 (1.48)

14.55 (1.58)

13.42 (1.66)

14.44 (1.61)

208.48 (63.37)

197.18 (60.84)

242.00 (30.16)

200.79 (6.08)

5.60 (1.14)

5.81 (1.75)

Platelet count, 10 /L (na = 1) 9

182.71 (57.37)

Leukocytes, 10 /mm (na = 12)

5.90 (2.16)

5.87 (1.60)

5.84 (1.81)

Gender (na = 2)

Male

20

19

39

2

41 (67.2)

Female

4

12

16

4

20 (32.8)

Low

8

12

20

–

20 (36.3)

High

16

19

35

–

35 (63.7)

1

9

15

24

–

24 (44.4)

3

12

5

17

–

17 (31.5)

4

2

11

13

–

13 (24.1)

F0-F1

3

10

13

2

15 (29.4)

F2-F4

18

18

36

0

36 (70.6)

Yes

2

1

3

0

3 (5.2)

No

16

25

41

5

46 (80.7)

Abstinent

5

3

8

0

8 (14.0)

IDU

21

22

43

5

48 (82.8)

Other

2

7

9

1

10 (17.2)

Yes

21

29

50

4

54 (91.5)

No

2

2

4

1

5 (8.5)

Yes

3

6

9

2

11(20.0)

No

20

23

43

1

44 (80.0)

Yes

4

5

9

1

10 (23.3)

No

14

18

32

1

33 (76.7)

Yes

5

8

13

1

14 (25.5)

No

18

21

39

2

41 (74.5)

3

HCV viral load (na = 8) HCV genotypes (na = 9)

Fibrosis stage (Metavir) (na = 12) Alcohol consump. (na = 6)

Route of Transmission (na = 5) Highly active antiretroviral therapy (na = 2) Hepatomegaly (na = 8) Hepatic steatosis (na = 20) Splenomegaly (na = 8)

3

P < 0.05

Note: BMI: body mass index. AST: aspartate transaminase. ALT: alanine transaminase. Alcohol consumption: Yes: >50g for >2 years; Abstinent: no alcohol consumption for 6 month. HCV viral load: High: >600,000 IU/ml: Routes of transmissions: heterosexual or homosexual contact and transfusions. Fibrosis stage: data from biopsy and Fibroscan (F0-F1 and <7.2 kpa).na: not available data. SVR: Sustained viral response. SVC: Spontaneous viral clearance.


16

Int. Microbiol. Vol. 17, 2014

matas et al.

Table 4. Polymorphism distribution in patients (treated versus SVC) and control cohorts Patients Polymorphisms IL28B rs12979860

CTLA4 +49

CTLA4 -318

HFE C282Y

HFE H63D

HFE S65C

LDLr

mtDNA haplogroups

Controls (%)

Treated

SVC

Total

CC

19

4

23

19 (35.8)

CT

29

2

31

27 (50.9)

TT

9

0

9

7 (13.2)

AA

29

0

29

30 (54.6)

AG

23

5

28

18 (32.7)

GG

5

1

6

7 (12.7)

CC

49

6

55

51 (87.9)

CT

7

0

7

6 (10.4)

TT

1

0

1

1 (1.7)

N

53

6

59

181 (94.3)*

Hz

4

0

4

11 (5.7)*

N

21

4

25

120 (62.5)*

Hz

32

2

34

69 (35.9)*

Ho

4

0

4

3 (1.6)*

N

55

5

60

51 (96.2)

Hz

2

1

3

2 (3.8)

GG

30

3

33

28 (51.8)

AG

21

3

24

19 (35.2)

AA

6

0

6

7 (13)

H

25

3

28

14 (32.6)**

J

9

1

10

4 (9.3)**

U

6

2

8

6 (14.0)**

Other

17

0

17

19 (44.2)**

Data from Guix et al. [11]. **Data from Picornell et al. [25]. N = normals; Ho = homozygotes; Hz = heterozygotes.

*

of the polymorphisms is shown in Table 4. All of the polymorphisms were in Hardy-Weinberg equilibrium and there was no correlation among the variations in the SNPs. The allele distribution between patients and controls differed only for the H63D mutation (HFE gene), with the heterozygote genotype occurring more frequently in the patient cohort than in the controls (P = 0.002). Mitochondrial haplogroups were grouped into four principal groups H, J, U, and the rest of the haplogroups. Statistical analyses showed that patients with the IL28B rs12979860 CC genotype had lower levels of leukocytes (P = 0.047) and platelets (P = 0.004), although for the former the difference was less when an outlier patient was removed from the analysis. In addition, HCV genotype 4 infection was less frequent in patients with the IL28B rs12979860 CC genotype

(P = 0.049). The relationships were most evident when heterozygous CT and homozygous TT genotypes were grouped and compared with the CC genotype. Moreover, ALT and AST transaminase levels were substantially higher in patient carriers of the G allele in CTLA4+49 (P = 0.021 and P = 0.063, respectively) than in patients with the AA genotype. The fibroscan values (fibrosis) of patients carrying the CC genotype of CTLA4â&#x20AC;&#x201C;318 were above average, although there were no differences when fibrosis measurements by biopsy and fibroscan were pooled under the same variable. Spontaneous HCV clearance was higher in patients carrying the G allele in the CTLA4+49 polymorphism (P = 0.02) (Table 4 and Fig. 1B). For LDLr, patients with the AA genotype were more likely to have hepatic steatosis (P = 0.047) and a lower body mass index (P = 0.029) than those with the AG or GG genotypes. None


Host SNP polymorphisms in HCV infection

Int. Microbiol. Vol. 17, 2014

17

B

Int Microbiol

A

Fig. 1. (A) Grouped IL28B genotype (CC and CT_TT) and response to treatment. (B) Grouped CTLA4+49 genotype (AA and AG_GG) and spontaneous viral clearance (SVC). The number of patients is indicated.

of the patients were homozygous for the C282Y mutation in the HFE gene, and the prevalence of the mutation S65C was extremely low in both controls and patients. Besides the different prevalences of the H63D mutation in patients vs. controls, the most remarkable feature was that three of the four C282Y/wt patients, the H63D/H63D patients, and the S65C/wt patients

had previously undergone liver biopsy, which suggests a suspicion of liver involvement. Hepatomegaly was a common feature of patients belonging to the major haplogroups H, J, and U. Finally, ALT levels were significantly higher in patients with mtDNA haplogroup H and those levels were also higher, but not significantly, in carriers of haplogroup J.

Table 5. Distribution of the response to pegIFN-RBV treatment in males and females of the patient cohort

VR4

VR12

VR24

SVR

SVC

Male

Female

Negative

14

4

18 (40.9 %)

Positive

19

7

26 (59.1 %)

Negative

30

8

38 (69.1 %)

< 2 log

3

1

4 (7.3 %)

Positive

8

5

13 (23.6 %)

Negative

31

8

39 (83.0 %)

Positive

5

3

8 (17.0 %)

No

19

12

31 (56.4 %)

Yes

20

4

24 (43.6 %)

No

41

16

57 (90.5 %)

Yes

2

4

6 (9.5 %)

VR4, VR12, VR24: Viral load after 4, 12 and 24 weeks. Negative: non detectable viral load; <2 log: viral load has decreased more than two log. Positive: viral load has not significantly changed. SVR: Sustained viral response 24 weeks after treatment. SVC: Spontaneous viral clearance.

Total


18

Int. Microbiol. Vol. 17, 2014

matas et al.

Table 6. Chi-square or Fisher tests of the response to pegIFN-RBV treatment when we analysed the differences between the genotypes ( “/” means that the genotypes have been compared, and “–” that the genotypes are grouped) VR4

VR12

VR24

SVR

SVC

CC / CT / TT

0.015

0.057

0.098

0.024

–

CC-CT / TT

0.076

–

–

–

–

CC / CT-TT

0.006

0.036

0.081

0.008

–

AA / AG / GG

–

–

–

–

0.040

AA-AG / GG

–

–

–

–

–

AA / AG–GG

–

–

–

–

0.020

CC / CT / TT

–

–

–

0.074

–

CC-CT / TT

–

–

–

–

–

CC / CT-TT

–

–

–

0.061

–

HFE C282Y

N / Hz

–

–

–

–

–

HFE H63D

N / Hz / Ho

–

–

–

–

–

HFE S65C

N / Hz

–

–

–

–

–

LDLr

AA / AG / GG

–

–

–

–

–

AA-AG / GG

–

–

–

–

–

AA / AG-GG

–

–

–

–

–

H / J / U / other

–

–

–

–

–

Polymorphisms IL28B rs12979860

CTLA4 +49

CTLA4 –318

mtDNA Haplogroups

Values indicated the significant probabilities. Lack of signification is indicated as “–”. The analyses were done between patients who have responded, or not, at 4 (VR4), 12 (VR12), 24 (VR24) weeks after starting the treatment and patients who have achieved, or not, spontaneous viral clearance (SVC) or sustained viral response (SVR).

Response to pegIFN-RBV treatment. Clinical and virological data were obtained for treatment response at 4, 12, and 24 weeks, and for the SVR endpoint at 48 weeks (Table 5). Of the 55 patients for whom response to treatment data were available, 31 (56.4 %) had not achieved a SVR. As expected, patients infected with HCV genotype 3 had significantly higher SVR rates than those infected with HCV genotypes 1 and 4 (P = 0.008). The relationship between treatment response and the different host polymorphisms is shown in Table 6. The most significant results were obtained for the IL28B rs12979860 polymorphism. Patients with the CC genotype had higher SVR rates than those with the CT or TT genotypes (P = 0.008). The difference was more evident when the CC genotype was compared to the pooled CT and TT genotypes (Fig. 1A). Finally, SVR rates were higher, but not statistically significant, in patients with the T allele in the CTLA4–318 SNP. Patients who did not achieve a SVR (n = 31; 56.4 %) were stratified in two groups. The first consisted of patients who never completely eliminated the virus (non-responders, n = 17; 30.9 %); the second comprised patients with negative viral load at some point after starting treatment but with a later re-

bound or relapse (relapsers, n = 14; 25.5 %). An analysis of the relationship between the IL28B polymorphism genotype and relapse after treatment showed that among patients with the CC genotype only one had never eliminated the virus. Otherwise, over 50 % of the patients who had achieved a SVR had this genotype (CC) (P = 0.05) (Fig. 1).

Discussion The role of host polymorphisms in the response to pegIFN+RBV treatment was studied in a cohort of Majorcan patients with HCV–HIV coinfection. In these patients, we confirmed the strong relationship between the SNP rs12979860 located upstream of the IL28B gene and the response to pegIFN+RBV treatment, as previously reported in HCV mono-infected patients. This relationship points to the importance of this polymorphism in the evolution of HCV infection in HIV coinfected individuals [9]. The allele frequencies detected in our cohort were similar to those of the EuropeanAmerican cohort analyzed by Ge et al. [9]. However, the frequency of the IL28B rs12979860 C allele was lower in our


Host SNP polymorphisms in HCV infection

cohort than in other Spanish cohorts [23,28], despite the similar allele frequencies of our patients and the controls. Also, in our cohort the frequencies of other SNPs in genes related to the immune system, such as CTLA4 [5,24,31,36], or to lipid metabolism, such as LDLr [19,22,35], were similar to those found in other populations [19,36]. As previously noted, there were no differences in allele frequencies between patient cases and controls, nor were there differences in the mitochondrial haplogroups. By contrast, the H63D mutation in the HFE gene was the only SNP that differed in occurrence between patients and controls. While the reason for this difference is unknown, it could be related to the extremely high frequency in Spain of the HFE H63D mutation [11]. The average SVR rate of our patient cohort was similar to those usually reported in the literature, although the percentage of patients with SVC was slightly lower and, as expected, SVR rates were lower in patients infected with HCV genotypes 1 and 4 than in those infected with HCV genotype 3 [29,32]. The effect of the IL28B genotypes on SVR was significant and more apparent when homozygotes for the favorable rs12979860 CC alleles were compared with a pooled group comprising heterozygotes and TT homozygotes. In the entire cohort, only one patient with the IL28B CC genotype (infected with HCV genotype 3) did not achieve a SVR. By contrast, only one IL28B rs12979860 TT patient infected with genotype 1 or 4 virus achieved a SVR. The analyses of patients who had relapsed showed that the only patient classified as a non-responder (unable to clear HCV viral load at any time during treatment) had the IL28B rs12979860 CC genotype. Taken together, these data show that HCV–HIV coinfected patients with the IL28B CC genotype were able to achieve an induced HCV clearance with treatment, whereas in nonresponders with IL28B rs12979860 TT, treatment could not “rescue” the non-clearance status. In patients infected with non-1 HCV genotypes, the role of IL28B polymorphisms in predicting SVR is still being investigated [29]. We found a very low frequency of the favorable IL28B rs12979860 CC genotype in carriers of HCV genotype 4, known to be a difficult-to-treat viral genotype. But whether the virus or the unfavorable IL28B genotype precluded SVR in these patients remains to be established. An important finding was that, irrespective of the viral genotype, the IL28B CC genotype promoted a rapid response to treatment, as early as 4 weeks after treatment initiation. There was no relationship between polymorphisms in the LDLr gene and the response to treatment. Several reports have associated the rs14158 GG genotype with a better re-

Int. Microbiol. Vol. 17, 2014

19

sponse [15,26], but in our cohort this genotype was related only to hepatic steatosis, although these results need to be interpreted with caution because of the limited sample size. Note that all six individuals in the group with spontaneous HCV clearance carried the CTLA4+49 G allele. In a previous report, Yee et al. [36] showed that this allele improves the likelihood of a treatment response in patients mono-infected with genotype 1 HCV who were treated with non-pegylated IFN. However, in our cohort of HCV–HIV coinfected patients with HCV genotypes 1, 3, and 4, there was no significant relationship between CTLA4 and the response to treatment. Other studies have associated the CTLA4+49 GG genotype with treatment response, but not with the spontaneous clearance of HCV [24]. Thus, our results add further controversy to this issue, as there was no tendency of a better response to treatment in our patients with the G allele. Finally, we found no relationship between HFE SNPs and any of the variables studied or the response to antiviral therapy. The results reported in the literature for other cohorts are somewhat contradictory. Note that, in our study, all H63D homozygotes, all S65C heterozygotes, and almost all C282Y heterozygotes had undergone liver biopsy previous to their inclusion in our study, which suggests at least the suspicion of liver damage in these patients, although this was not indicated in the pooled fibrosis data. In summary, the results of this study show the relevance of the CC genotype in the IL28B polymorphism regarding the response to pegIFN-RBV treatment in our cohort of HCV– HIVcoinfected individuals from the Balearic Islands. While we identified spontaneous HCV clearance only in CTLA4+49 G allele carriers, because of the limited sample size, this association needs to be confirmed in other, larger cohorts. Acknowledgements. This work was supported by grants 4326/2007 and 6557/2010 of the Direcció General de Recerca, Desenvolupament Tecnològic i Innovació. Conselleria d’Economia, Hisenda i Innovació, Govern Balear, Spain; projects PI10/00512, PI10/01734, and CIBEResp, Instituto de Salud Carlos III, Spain; projects BFU2008 03000BMC and BFU2011-24112 of Ministerio de Ciencia e Innovación, Spain. F.X.L. holds a P.I. position supported by the Fondo de Investigación Sanitaria, Instituto de Salud Carlos III, Spanish Ministry of Science. A draft of this article was included in the doctoral thesis of the first author [http://hdl.handle.net/10803/11133]). Competing interest. None declared.

References 1. Alter H (2006) Viral hepatitis. Hepatology 43:S230-234 2. Alter MJ (2007) Epidemiology of hepatitis C virus infection. World J Gastroenterol 13:2436-2441


20

Int. Microbiol. Vol. 17, 2014

3. Asselah T, Estrabaud E, Bieche I, et al. (2010) Hepatitis C: viral and host factors associated with non-response to pegylated interferon plus ribavirin. Liver Int 30:1259-1269 4. Bonkovsky HL, Naishadham D, Lambrecht RW, et al. (2006) Roles of iron and HFE mutations on severity and response to therapy during retreatment of advanced chronic hepatitis C. Gastroenterology 131: 1440-1451 5. Danilovic DL, Mendes-Correa MC, Lima EU, Zambrini H, Barros RK, Marui S (2012) Correlations of CTLA-4 gene polymorphisms and hepatitis C chronic infection. Liver Int 32:803-808 6. EASL (2011). EASL Clinical practice guidelines: management of hepatitis C virus infection. J Hepatol 55:245-264 7. Feder JN, Gnirke A, Thomas W, et al. (1996) A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 13:399-408 8. García-Álvarez M, Guzmán-Fulgencio M, Berenguer J, et al. (2011) European mitochondrial DNA haplogroups and liver fibrosis in HIV and hepatitis C virus coinfected patients. AIDS 25:1619-1926 9. Ge D, Fellay J, Thompson AJ, et al. (2009) Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 461:399-401 10. Geier A, Reugels M, Weiskirchen R, et al. (2004) Common heterozygous hemochromatosis gene mutations are risk factors for inflammation and fibrosis in chronic hepatitis C. Liver Int 24:285-294 11. Guix P, Picornell A, Parera M, et al. (2002) Distribution of HFE C282Y and H63D mutations in the Balearic Islands (NE Spain). Clin Genet 61: 43-48 12. Hall TA (1999) Bioedit: a user friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp Ser 41:95-98 13. Heathcote EJ (2007) Antiviral therapy: chronic hepatitis C. J Viral Hepatitis 14: 82-88 14. Hendrickson SL, Hutcheson HB, Ruiz-Pesini E, et al. (2008) Mitochondrial DNA haplogroups influence AIDS progression. AIDS 22: 2429-2439 15. Hennig BJ, Hellier S, Frodsham AJ, et al. (2002) Association of lowdensity lipoprotein receptor polymorphisms and outcome of hepatitis C infection. Genes Immun 3:359-367 16. Ishizu Y, Katano Y, Honda T, et al. (2012) Clinical impact of HFE mutations in Japanese patients with chronic hepatitis C. J Gastroenterol Hepatol 27:1112-1116 17. Lynas C (1997) A cheaper and more rapid polymerase chain reactionrestriction fragment length polymorphism method for the detection of the HLA-H gene mutations occurring in hereditary hemochromatosis. Blood 90:4235-4236 18. Marinho RT, Vitor S, Velosa J (2014) Benefits of curing hepatitis C infection. J Gastrointestin Liver Dis 23:85-90 19. Mas Marques A, Mueller T, Welke J, et al. (2009) Low-density lipoprotein receptor variants are associated with spontaneous and treatmentinduced recovery from hepatitis C virus infection. Infect Genet Evol 9: 847-852 20. Micheloud D, Berenguer J, Guzmán-Fulgencio M, et al. (2011) European mitochondrial DNA haplogroups and metabolic disorders in HIV/HCVcoinfected patients on highly active antiretroviral therapy. J Acquir Immune Defic Syndr 58:371-378

matas et al.

21. Mohamoud YA, Mumtaz GR, Riome S, Miller D, Abu-Raddad LJ (2013) The epidemiology of hepatitis C virus in Egypt: a systematic review and data synthesis. BMC Infect Dis 13:288 22. Molina S, Castet V, Fournier-Wirth C, et al. (2007) The low-density lipoprotein receptor plays a role in the infection of primary human hepatocytes by hepatitis C virus. J Hepatol 46:411-419 23. Montes-Cano MA, García-Lozano JR, Abad-Molina C, et al. (2010) Interleukin-28B genetic variants and hepatitis virus infection by different viral genotypes. Hepatology 52:33-37 24. Nischalke HD, Vogel M, Mauss S, et al. (2010) The cytotoxic lymphocyte antigen 4 polymorphisms affect response to hepatitis C virus-specific therapy in HIV(+) patients with acute and chronic hepatitis C virus coinfection. AIDS 24:2001-2007 25. Picornell A, Gómez-Barbeito L, Tomàs C, Castro JA, Ramon MM (2005) Mitochondrial DNA HVRI variation in Balearic populations. Am J Phys Anthropol 128:119-130 26. Pineda JA, Caruz A, Di Lello FA, et al. (2011) Low-density lipoprotein receptor genotyping enhances the predictive value of IL28B genotype in HIV/hepatitis C virus-coinfected patients. AIDS 25:1415-1420 27. Poynard T, Yuen MF, Ratziu V, Lai CL (2003) Viral hepatitis C. Lancet 362:2095-2100 28. Rallón NI, Naggie S, Benito JM, et al. (2010) Association of a single nucleotide polymorphism near the interleukin-28B gene with response to hepatitis C therapy in HIV/hepatitis C virus-coinfected patients. AIDS 24:F23-F29 29. Rauch A, Kutalik Z, Descombes P, et al. (2010) Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology 138:1338-1345 30. Rivero-Juarez A, Camacho A, Caruz A, et al. (2012) LDLr genotype modifies the impact of IL28B on HCV viral kinetics after the first weeks of treatment with PEG-IFN/RBV in HIV/HCV patients. AIDS 26:1009-1015 31. Schott E, Witt H, Hinrichsen H, et al. (2007) Gender-dependent association of CTLA4 polymorphisms with resolution of hepatitis C virus infection. J Hepatol 46:372-380 32. Seeff LB (2009) The history of the “natural history” of hepatitis C (19682009). Liver Int 29:89-99 33. Thomson BJ (2009) Hepatitis C virus: the growing challenge. British Med Bull 89:153-167 34. Vigilant L, Pennington R, Harpending H, Kocher TD, Wilson AC (1989) Mitochondrial DNA sequences in single hairs from a southern African population. Proc Natl Acad Sci USA 86:9350-9354 35. Ye J (2007) Reliance of host cholesterol metabolic pathways for the life cycle of hepatitis C virus. PLoS Pathog 3:e108 36. Yee LJ, Perez KA, Tang J, van Leeuwen DJ, Kaslow RA (2003) Association of CTLA4 polymorphisms with sustained response to interferon and ribavirin therapy for chronic hepatitis C virus infection. J Infect Dis 187: 1264 -1271


RESEARCH ARTICLE International Microbiology (2014) 17:21-29 doi:10.2436/20.1501.01.204 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Identification of superficial Candida albicans germ tube antigens in a rabbit model of disseminated candidiasis. A proteomic approach Aranzazu Sáez-Rosón,1 María-Jesús Sevilla,2 María-Dolores Moragues3* 1 Dept. of Immunology, Microbiology and Parasitology, School of Medicine and Odontology, Univ. of the Basque Country UPV/EHU, Leioa, Spain. 2Dept. of Immunology, Microbiology and Parasitology, School of Sciences and Technology, Univ. of the Basque Country UPV/EHU, Leioa, Spain. 3 Department of Nursing 1, Univ. of the Basque Country UPV/EHU, Leioa, Spain

Received 29 December 2013 · Accepted 26 March 2014 Summary. The diagnosis of invasive candidiasis remains a clinical challenge. The detection by indirect immunofluorescence of Candida albicans germ-tube-specific antibodies (CAGTA), directed against germ-tube surface antigens, is a useful diagnostic tool that discriminates between colonization and invasion. However, the standardization of this technique is complicated by its reliance on subjective interpretation. In this study, the antigenic recognition pattern of CAGTA throughout experimental invasive candidiasis in a rabbit animal model was determined by means of 2D-PAGE, Western blotting, and tandem mass spectrometry (MS/MS). Seven proteins detected by CAGTA were identified as methionine synthase, inositol-3-phosphate synthase, enolase 1, alcohol dehydrogenase 1,3-phosphoglycerate kinase, 14-3-3 (Bmh1), and Egd2. To our knowledge, this is the first report of antibodies reacting with Bmh1 and Egd2 proteins in an animal model of invasive candidiasis. Although all of the antigens were recognized by CAGTA in cell-wall dithiothreitol extracts of both germ tubes and blastospores of C. albicans, immunoelectron microscopy study revealed their differential location, as the antigens were exposed on the germ-tube cell-wall surface but hidden in the inner layers of the blastospore cell wall. These findings will contribute to developing more sensitive diagnostic methods that enable the earlier detection of invasive candidiasis. [Int Microbiol 2014; 17(1):21-29] Keywords: Candida albicans · germ tube antibodies · invasive candidiasis · rabbit model

Introduction Species of Candida are major fungal pathogens in humans, causing a wide variety of surface or mucocutaneous candidiases as well as systemic or invasive candidiasis (IC) in both immunocompromised and immunocompetent patients. Although new antifungal agents active against most Candida species have recently been introduced, the morbidity and Corresponding author: M.D. Moragues Departamento de Enfermería I Universidad del País Vasco Barrio Sarriena, s/n 48940 Leioa, Spain Tel. +34-946015599. Fax +34-946013300 E-mail: lola.moragues@ehu.es

*

mortality rates associated with IC remain high (10–49 %) [28]. Between 95 and 97 % of invasive candidiasis are caused by five species: C. albicans, C. glabrata, C. parapsilosis, C. tro­ picalis, and C. krusei. Of these, C. albicans is the most pre­ valent species involved in IC, but other species, such as C. kru­ sei, which is intrinsically resistant to azoles, and C. glabrata are increasingly being isolated [10]. The diagnosis of IC is difficult because there are no specific signs and it is difficult to distinguish between colonization and invasion. Furthermore, the available diagnostic techniques are of low sensitivity and specificity, and the aggressive methods sometimes required to obtain samples are often not feasible because of the critical condition of affected patients [37]. As a result, therapy is often implemented late or


22

Int. Microbiol. Vol. 17, 2014

not at all, which in part explains the high mortality associated with IC [26]. The limitations of traditional microbiological techniques have led to the search for new diagnostic methods based on the detection of biomarkers, most notably structural and metabolic components of Candida such as mannan, β-1,3-dglucan, d-arabinitol, and DNA, as well as Candida antigen components and antibodies, but none of these methods are conclusive enough for application in clinical practice [27,37,40]. García-Ruiz et al. developed an indirect immunofluorescence (IIF) technique that detects specific antibodies to antigens located on the surface of the cell wall of C. albicans germ tubes (C. albicans germ tube-specific antibodies, CAGTA) [8]. Since the mycelial phase of C. albicans is associated with tissue invasion, this technique differentiates between colonization and invasion. CAGTA detection has proved to be useful for the diagnosis of IC in both immunocompetent and immunocompromised patients, with a sensitivity and specificity of 79–89 % and 91–100 %, respectively [8,11,41,42]. The sensitivity and specificity of the commercial kit Invasive Candidiasis (CAGTA) IFA IgG (Vircell Microbiologists, Granada, Spain) in the diagnosis of IC are 84.4 % and 94.7 %, respectively [22], and data for its specificity and negative predictive values have been corroborated in a recent study focused on the discrimination of deep-seated candidemias from transient or catheter-related Candida infections not involving deep tissues [20]. León et al. [17] reported that positive CAGTA titers combined with positive β-glucan values accurately differentiated Candida colonization from IC in intensive care unit (ICU) patients with severe abdominal conditions. Also, an additional role for CAGTA, as prognostic markers in critically ill patients in ICUs has been suggested [50,51], based on the association of an increase in positive titers of CAGTA with a significant decrease in mortality (22.7 % vs. 61.2 % for those with negative CAGTA titers), particularly in patients undergoing antifungal treatment. The authors of those studies therefore have recommended that antifungal therapy be considered in critically ill patients with increasing CAGTA titers. The advantages of the CAGTA method are that it is simple and fast, with good sensitivity and specificity. Nonetheless, an important limitation is that it has to be evaluated visually by IIF, which is a subjective method and thus difficult to standardize. In the search for novel biomarkers in the development of new diagnostic tools for IC, immunoproteomics has received serious consideration [9,25,29,31–33,35]. Serum IgG profiles in patients with IC and in healthy controls have been compared in order to identify Candida antigens recognized only or mainly by sera from infected patients. This strategy has

Sáez-Rosón et al.

resulted in the identification of a large number of biomarkers with potential applications in the early diagnosis of IC [9,29,32,33] and in the development of vaccines or immunotherapies [7,25,31]. In this study an immunoproteomic strategy was used to determine the antigen recognition pattern of CAGTA throughout the course of a C. albicans infection in a rabbit animal model. Our results provide a time course and picture of the specific antibodies and marker antigens for IC and may serve as the basis for the development of new tools in the early and objective diagnosis of IC.

Materials and methods Strain and culture conditions. All experiments were carried out with C. albicans NCPF 3153 (National Collection of Pathogenic Fungi, Bristol, UK). Yeast-phase cells were routinely grown on Sabouraud agar (Difco, Sparks, MD, USA) plates at 24 ºC for 48 h. To obtain germ tubes, cells grown on Sabouraud agar were inoculated into TC199 medium (Sigma-Aldrich, St. Louis, MO, USA) and incubated at 24 ºC with shaking (120 rpm) overnight. The resulting blastospores were harvested and then suspended in four volumes of TC199 medium pre-heated to 37 ºC. The germ tubes were collected after 4 h of shake-incubation at 37 ºC and 120 rpm. Rabbit model of disseminated candidiasis. Two female New Zealand White rabbits (Granja Cunícola San Bernardo S.L; Navarra, Spain) each weighing approximately 2 kg were injected through the ear marginal vein with 2 × 106 blastospores of C. albicans suspended in 0.2 ml of sterile saline solution (day 0); inoculation was repeated on days 28, 56, and 84. Preimmune sera were withdrawn prior to infection; immune sera were collected through the ear marginal vein every week after the onset of infection. Blood samples were left to clot at 4 ºC overnight, and sera were stored at –20 ºC until needed.The rabbits were maintained at the animal facilities of the University of the Basque Country UPV/EHU (Spain), according to animal welfare ethics policy. Quantification and purification of CAGTA. Serum CAGTA levels were titrated by IIF according to Moragues et al. [22]. The antibodies were purified from sera previously adsorbed with an equal volume of a suspension of heat-inactivated C. albicans blastospores (1010cell/ml) for 2 h at room temperature, to remove anti-mannan antibodies. Adsorbed sera were centrifuged at 2500 rpm for 5 min. The supernatants were mixed with an equal volume of a pellet of germ tubes washed with phosphate buffered saline (PBS; SigmaAldrich) and then incubated with gentle agitation at room temperature for 1 h. After centrifugation, the samples were washed with PBS and CAGTA bound to the mycelial surface were eluted in 5 ml of 2.5 M sodium iodide (SigmaAldrich) in PBS by gentle shaking at room temperature for 1 h. After centrifugation, the supernatants containing the eluted CAGTA were dialyzed against PBS (MWCO 12,000–4000 Da; Medicell International, London, UK) and concentrated with polyethylene glycol 20,000 (Merck, Hohenbrunn, Germany). Two-dimensional polyacrylamide gel electrophoresis (2DPAGE) of dithiothreitol (DTT) cell-wall extracts from Candida albicans. Cell-wall proteins of C. albicans NCPF 3153 were extracted with DTT from germ tubes (DTT-GT) or blastospores (DTT-B), ac-


C. albicans germ tubes

cording to Ponton and Jones [38]. Two hundred µg of DTT-extracted cellwall proteins were processed for western blotting, and 500 µg for Coomassie staining as follows: Cell-wall extracts were suspended in rehydration buffer containing 7 M urea, 2 M thiourea, 4 % 3-[(3-cholamidopropyl)dimethyl­ ammonio]-1-propanesulfonate (CHAPS), 20 mM DTT, 0.5 % IPG buffer pH 4–7 (v/v), and traces of bromophenol blue, and adsorbed onto 11-cm strips containing an immobilized pH gradient of 4–7 (IPG; GE Healthcare BioSciences, Uppsala, Sweden), with active rehydration at 50 V for 12 h at 20 ºC. Isoelectric focusing was carried out on a Protean IEF cell electrophoresis unit (Bio-Rad, Hercules, CA, USA) under the following conditions: step 1, 250 V for 20 min; step 2, ramped to 8000 V over 2.5 h; and step 3, 8000 V for a total of 30,000 V/h. After focusing, the IPG strips were equilibrated for 15 min in a reducing solution of 1 % DTT (w/v) in 75 mM Tris-HCl pH 8.8, 6 M urea, 30 % glycerol (v/v), 2 % sodium dodecyl sulfate (SDS) (w/v) (TUG-SDS) and then in an alkylating solution of 2.5 % iodoacetamide (w/v) in TUG-SDS, with gentle shaking. The second dimension was run in a Criterion XT Bis-Tris 4–12 % gel (Bio-Rad) in a Protean II electrophoresis chamber (Bio-Rad) at a constant voltage of 200 V for 55 min. Protein spots were stained with the colloidal blue staining kit (Invitrogen, USA) or electroblotted onto a polyvinyl difluoride (PVDF) membrane (Immobilon-P, Millipore, Bedford, MA, USA) using a semidry Fast-blot system (Biometra, Germany) and transfer buffer (25 mM Tris, 150 mM glycine, and 10 % methanol) at 0.25 mA/cm2 for 1 h. Western blotting. PVDF membranes were incubated with the eluted CAGTA in Tris-buffered saline (TBS; 10 mM Tris-HCl, 0.9 % NaCl [w/v], pH 7.3) containing 8 % skimmed milk (TBS-M) in a humid chamber at 37 ºC for 1 h with gentle shaking. After washing three times with TBS, the membranes were incubated with horseradish peroxidase (HRP)-conjugated antirabbit IgG antibody (Sigma-Aldrich; 1:300 in TBS-M) under the same conditions. After washing with TBS, the membranes were processed with the Immun-Star HRP chemiluminescence kit (Bio-Rad) and the reactions were visualized with the Chemidoc Quantity One system (Bio-Rad). The reactive proteins were excised from parallel gels and identified by tandem mass spectrometry (MS/MS). At least two replicates of each sample were obtained. Mass spectrometry analysis. Selected protein spots were excised manually from the gel and subjected to in-gel tryptic digestion according to Shevchenko et al.[44], with minor modifications. The gel pieces were swollen in digestion buffer (50 mM NH4HCO3 and 12.5 ng/ µl proteomics grade trypsin [Roche, Basel, Switzerland]) and the digestion was allowed to proceed at 37 °C overnight. The supernatant was recovered and peptides were extracted twice, first with 25 mM NH4HCO3 and acetonitrile (ACN, Thermo Scientific Pierce), and then with 0.1 % trifluoroacetic acid (Thermo Scientific Pierce) and ACN. The recovered supernatants and extracted peptides were pooled, dried in a SpeedVac, dissolved in 10 µl of 0.1 % formic acid (FA) (Thermo Scientific Pierce), and sonicated for 5 min. MS/MS analysis was performed in a SYNAPT HDMS mass spectrometer (Waters, Milford, MA, USA) interfaced with a nanoAcquity UPLC system (Waters). An 8-µl aliquot of each sample was loaded into a Symmetry300 C18 (180 µm × 20 mm) precolumn (Waters) and washed with 0.1 % FA for 3 min at a flow rate of 5 µl/min. The precolumn was connected to a BEH130 C18 column (75 µm x 200 mm; Waters) equilibrated in 3 % ACN and 0.1 % FA. Peptides were eluted with a 30-min linear gradient of 3–60 % ACN directly into a nano-electrospray capillary tip. The capillary voltage was set to 3500 V and data-dependent MS/MS acquisitions were performed on precursors with charge states of 2, 3, or 4 over a survey m/z range of 350–1990. Spectra were processed using the Virtual Expert Mass Spectrometrist (VEMS) software [21] and searched against the SwissProt database (restricted to “other fungi”) using Mascot (Matrix Science, London, UK). Protein identification was based on the following variables: carbamidomethylation of

Int. Microbiol. Vol. 17, 2014

23

cysteines as fixed modification, oxidation of methionines as variable modification, 50-ppm peptide mass tolerance, 0.1-Da fragment mass tolerance, and 1 missed cleavage. Electron microscopy and immunocytochemistry. Candida al­ bicans germ tubes or blastospores were washed in Sorenson’s buffer [0.133 M Na2HPO4, 0.133 M KH2PO4 [4:1 v/v], pH 7.4], treated with fixing solution (0.5 % glutaraldehyde, 4 % formaldehyde in Sorenson’s buffer) at 4 °C for 24 h, and washed with 88 mM sucrose in Sorenson’s buffer. The cells were dehydrated using graded concentrations of acetone, embedded in Spurr resin (lowviscosity embedding medium Spurr’s kit, Electron Microscopy Sciences, Hatfield, PA, USA), and polymerized at 56 ºC for 2 days. Sections 50- to 100-nm-thick were deposited on 200-mesh nickel grids coated with Formvar (Electron Microscopy Sciences) and blocked with blocking solution (10 % inactivated goat serum, 0.02 % sodium azide, 0.1 % Tween-20 in PBS, pH 8.2) at room temperature for 1 h with gentle shaking in a humid chamber. The samples were then incubated with the eluted CAGTA in the incubation solution (1 % inactivated goat serum, 1 % BSA, 0.02 % sodium azide, 0.1 % Tween-20 in PBS, pH 8.2) for 2 h under the same conditions. After washing with incubation solution, the samples were incubated with anti-rabbit IgG antibody labeled with 10-nm diameter colloidal gold (Sigma-Aldrich; 1:10 in incubation solution) under the same conditions. Finally, the samples were washed with blocking solution and distilled water, stained with 2 % uranyl acetate and lead citrate, and observed in a transmission electron microscope Philips EM208S. Negative controls without primary antibody were performed, and samples were obtained from two independent experiments.

Results Fungal infection of rabbits with Candida albicans. The injection of four doses of 2 × 106 blastospores of C. albicans NCPF 3153 produced a disseminated fungal infection in the two rabbits, and their immune systems developed antibodies (CAGTA) that recognized antigens on the surface of C. albi­ cans germ tubes, as determined by IIF (Fig. 1). CAGTA titers were estimated for each serum sample collected during the course of the experiment, and rabbits 1 and 2 showed a similar trend in their humoral immune responses to IC (Fig. 2). The levels of CAGTA rose moderately after the first injection but increased significantly after the second and third injections, reaching peak titers (1/640 and 1/1280) on day 72. Although differing in extent, the CAGTA titers for the two rabbits tended to stabilize by the end of the third round of infection (Fig. 2). Antigens recognized by CAGTA. Since CAGTA serve as markers of invasive Candida infection, we identified the reacting antigens in a DTT cell-wall extract of C. albicans germ tubes (DTT-GT) separated by 2D-PAGE. The reproducibility of the gels allowed a comparison of the Coomassie-stained reference protein map (Fig. 3A) with the spots reacting with the CAGTA by immunoblotting (Fig. 3C), and thereby the identification of the corresponding proteins by MS/MS analysis.


24

Int. Microbiol. Vol. 17, 2014

Sáez-Rosón et al.

Int Microbiol

Fig. 1. Reaction of serum CAGTA from a rabbit with disseminated candidiasis with the cell-wall surface of Candida albicans germ tubes, as evidenced by indirect immunofluorescence [22]. The germ-tube surfaces stain brightly (light green in the color version of the image) after their reaction with a secondary FITC-conjugated anti-rabbit IgG antibody (Sigma); the blastospores are red following contrast staining with Evan’s blue.

plex, α subunit (or Egd2) (Fig. 3A,C). CAGTA reactivity was highly similar for the two rabbits although the intensities of the reactions oscillated over the course of the infection (Table 1). Antigens Eno1 and Ino1 showed a strong reactivity that began at the early stages of infection (Table 1) and remained stable over time. Met6 and Adh1 displayed an intermittent reactivity with either of the rabbit antisera (Table 1). CAGTA exhibited strong reactivity against the 14-3-3 protein in the sera of both rabbits three days after the initial infection (Table 1), even though CAGTA were not appreciable by IIF at that time. This reactiv-

Int Microbiol

When analyzed by Western blotting, pre-immune sera (day 0) adsorbed with C. albicans blastospores were not reactive with C. albicans DTT-GT proteins. However, the eluted CAGTA purified from immune sera obtained on days 3, 17, 37, and 58 after the initial infection recognized several protein spots on the DTT-GT bidimensional map. Seven proteins were identified by MS/MS: methionine synthase (Met6), inositol-3-phosphate synthase (Ino1), enolase 1 (Eno1), alcohol dehydrogenase 1 (Adh1), 3-phosphoglycerate kinase (Pgk1), 14-3-3 (or Bmh1), and nascent polypeptide-associated com-

Fig. 2. Change over time of the serum CAGTA response of two rabbits infected with Candida albicans NCPF 3153. Arrows indicate the time (days 0, 28, 56, and 84) at which the rabbits were infected intravenously with 2 × 106 blastospores in saline.


C. albicans germ tubes

25

Int Microbiol

Int. Microbiol. Vol. 17, 2014

Fig. 3. Two-dimensional electrophoresis of DTT cell-wall extracts of germ tubes and blastopores of Candida albicans NCPF 3153. (A) Germ tubes (DTT-GT). (B) Blastopores (DTT-B). Gels were stained with the colloidal blue staining kit (Invitrogen). Immunoblot of DTTGT (C) and DTT-B (D) extracts assayed with CAGTA eluted from the serum of rabbit 2 on day 58 of the IC model of infection.

ity gradually diminished over time but recovered after the second inoculation with C. albicans. A reaction with Egd2 was not observed until day 37 (Table 1), after which the reactivity remained strong with rabbit 2 sera but gradually faded in the sera of rabbit 1. Similarly, CAGTA reactivity against Pgk1 was weaker in sera from rabbit 1 (Table 1). In addition, as shown in the 2D profiles stained with Coomassie blue (Fig. 3A), most antigens had several isoforms such that their reactivity with CAGTA in the sera of both rabbits was rather heterogeneous. In a different approach to characterize the antigens reacting with CAGTA, the 2D-PAGE protein pattern displayed by the DTT cell-wall extracts of C. albicans blastospores was compared with that of the germ tubes. The images from Coomassie stained 2D-gels were very similar for most of the proteins, although some of the bands differed in their relative concentrations and/or electrophoretic mobility (Fig. 3A,B). However, using CAGTA purified from the 58-day serum of rabbit 2, the main antigens recognized in the DTT-B extract were the same as those identified in the DTT-GT extract (Fig. 3C,D).

Location of antigens recognized by CAGTA. Immunoelectron microscopy, used to locate the identified antigens in the C. albicans cell wall, revealed that the CAGTA reacted with superficial elements of the germ-tube cell walls (Fig. 4A), although reactive components were also present in the inner layers. By contrast, CAGTA only reacted with compounds located in the inner layers of the blastospore cell wall (Fig. 4B).

Discussion Because of the commensal nature of C. albicans, one of the challenges of the serological diagnosis of IC has been to differentiate between colonized and infected patients. The detection of CAGTA solves this diagnostic problem since the antibodies recognize specific antigens on the surface of C. albi足 cans germ tubes, the morphological phase associated with invasion. However, immunofluorescence-based analysis requires subjective interpretation of the results, ruling out automation of the process and thus its standardization. In this study, we set out to characterize the antigen recognition pat-


26

Int. Microbiol. Vol. 17, 2014

Sáez-Rosón et al.

Table 1. Major cell-wall proteins in DTT extracts of Candida albicans germ tubes reacting with CAGTA raised in two rabbits with experimental disseminated candidiasis

CAGTA reactivitye (days of infection)

Rabbit 1

Rabbit 2

Protein name (Accesion No.)a

Spot No.b

Mr (kDa)c

pId

0

3

17

37

58

0

3

17

37

58

Methionine synthase (P82610)

1–4

85.8

5.44

–

–

++

–

+++

–

–

++

–

++

Inositol-3-phosphate synthase (P42800)

5–7

57.8

5.35

–

–

+++

+++

++

–

–

+++

++

++

Enolase-1 (P30575)

8–12

47.2

5.54

–

–

+++

+++

+++

–

+

++

++

+++

Alcohol dehydrogenase 1 (P43067)

13–15

37.2

6.02

–

–

++

–

++

–

–

+

–

++

Phosphoglicerate kinase 1 (P46273)

16–17

45.3

6.07

–

–

–

+

+

–

+

++

+

+++

18

29.6

4.75

–

+++

–

+++

+++

–

+++

+

++

+++

19–21

19.5

4.7

–

–

–

++

–

–

–

–

+++

+++

0

0

10

80

320

0

0

20

80

160

Bmh1 (O42766) Nascent polypeptide-associated complex subunit alpha (Q5ANP2)

CAGTA titerf

Protein name and accession number according to the UniProtKB database. bSpot numbers as indicated in the gel shown in Figure 3A. Protein molecular weight as shown in the SwissProt database. dTheoretical isoelectric point as shown in the SwissProt database. e CAGTA reactivity levels (+++, very strong; ++, strong; +, mild; –, no reactivity). fCAGTA titer (inverse) of sera evaluated by IIF. a c

tern of CAGTA over the duration of IC using a rabbit animal model. The recognition in IC patients of at least a subset of these antigens by one or more CAGTA may provide the basis for the development of more sensitive and specific diagnostic techniques for IC, as reported by Clancy et al. [3]. Western blot analysis of C. albicans DTT-GT extracts separated by 2D-PAGE identified Met6, Ino1, Eno1, Adh1, Pgk1, 14–3–3 (Bmh1), and Egd2 as the major proteins recognized by the CAGTA of rabbits with IC. Although these proteins are involved in cellular processes carried out in the cytoplasm, they have also been detected in the cell wall of C. albi­ cans blastospores [2,19,23,43,48] and mycelia [6,19,36,47,48]. Several of these proteins are involved in cellular metabolism, such as Eno1 and Pgk1, which are glycolytic enzymes. Eno1

has also been described as an allergen [12], while Pgk1 participates in the biogenesis and degradation of the C. albicans cell wall [1]. Adh1 is involved in glucose fermentation, by reducing acetaldehyde to ethanol, and is also an allergen. Note that these three proteins bind human plasminogen, generating the proteolytic enzyme plasmin, which could increase the capacity of C. albicans for tissue invasiveness and necrosis [5,13]. Ino1 catalyzes the conversion of glucose-6-phosphate to inositol-1-phosphate, the first step in the production of inositol-containing components such as phospholipids, which are essential for cell-membrane lipid bilayers [15]. Met6 is involved in the biosynthesis of methionine during C. albicans morphogenesis and is essential for growth, by limiting the toxicity of homocysteine [45].


Int. Microbiol. Vol. 17, 2014

27

Int Microbiol

C. albicans germ tubes

Fig. 4. Transmission electron microscopy images of the cell wall of Candida albicans NCPF 3153, showing the reaction of CAGTA purified from the serum of a rabbit infected with this fungal strain. Note that the colloidal gold particles are mainly located in the outermost cell-wall layers of the germ tubes (A), and in the inner cell-wall layers of blastospores (B). Arrows indicate the different positions of the colloidal gold particles.

Bmh1 and Egd2 are also involved in other cellular processes. Bmh1 is required for both the vegetative growth and the filamentation of C. albicans. In addition, it participates in processes such as the cellular response to stimuli, chlamydospore formation, pathogenesis, the regulation of carbohydrate metabolism, and signal transduction [4,14,24,49]. Therefore, this protein is likely to play a key role in colonization and invasion, by coordinating the necessary regulatory systems. Egd2 is the α subunit of the ribosomal nascent polypeptideassociated complex, which consists of Egd1 and Egd2. It participates in the transport of both cytoplasmic and mitochondrial proteins, binding to emerging polypeptides and thereby ensuring their proper orientation. All of the above proteins have been described in both blastospores and mycelia of C. albicans, but quantitative studies have shown differences in their expression depending on the morphology of the fungus. Pitarch et al. [36] have found that, among others, Pgk1, Eno1, Adh1, and Ino1 are overexpressed after the induction of C. albicans germination. Martínez-Gomariz et al. [19] have added Met6 to this group of proteins. While Ebanks et al. [6] have also reported the expression of Adh1 protein in the mycelial phase, they found greater amounts of Egd2 and Eno1 in the yeast phase. In our study the protein map of DTT-GT cell-wall extract separated by 2DPAGE also differed to some extent from that of DTT-B extracts. However, CAGTA eluted from germ tubes of C. albi­ cans reacted mainly with the same antigens in the two extracts. Since in the IIF assay CAGTA reacted only with compounds of the cell surface of germ tubes, we asked whether

the cellular location of the antigens depended on the morphology of C. albicans. Immunoelectron microscopy showed that CAGTA reacted with antigens that were mainly located on the outer layers of germ-tube cell walls, whereas in blastospores reactivity was in the inner layers of the cell wall. The morphological dependence of the position of some antigens in the C. al­ bicans cell-wall structure has been reported by Pontón et al. [39], who described four types of antigens in the C. albicans cell wall based on their differential reactivity with several monoclonal antibodies. According to that system, the CAGTA antigens described in our study belong to type II, since they were located on the surface of the germ-tube cell wall and in the inner layers of the blastospore cell wall. The location of at least some of the proteins on the outer germ-tube surface is in agreement with the development of CAGTA as a specific response of the host immune system during the invasive process. Our observations are consistent with those of other immunoproteomic studies that have attributed antigenic characteristics to most of the proteins identified using these antibodies, both in murine models of infection [30,46] and in patients with IC [9,25,29,31,32,34,35]. The immunogenicity of these proteins has allowed the development of ELISA tests to detect specific antibodies of diagnostic utility, with satisfactory results reported for recombinant Eno1 [16,18,32], Met6, and Pgk1 [3,33]. To the best of our knowledge, ours is the first study to identify Bmh1 and Egd2 in a study characterizing the CAGTA response in an animal infection model. In addition to this, CAGTA of both rabbits reacted with Bmh1 at a very early


28

Int. Microbiol. Vol. 17, 2014

stage of infection, only 3 days after the first inoculation, before CAGTA were detectable by IIF. The apparent absence of this reactivity in the preimmune sera may reflect previous sensitization to low levels of this protein, given the commensal nature of C. albicans in the yeast-phase morphology. Since Bmh1 belongs to a family of conserved regulatory proteins expressed in all eukaryotic cells, such that the rabbits may have been previously sensitized, the paradoxical behavior of CAGTA could be indicative of a quick response to the exposure of this antigen on the surface of the C. albicans germ tubes at the onset of fungal invasion. Because Bmh1 is involved in the filamentation process [14] and reacts with CAGTA of infected rabbits, the detection in serum of this protein and/or specific antibodies against it may allow its use as an early marker of IC. Further studies would be essential to confirm this relationship and whether it also pertains to IC in humans. Acknowledgements. This work was funded by UFI 11/25 from the University of the Basque Country, Saiotek S-PC12UN010, and Grupos de Investigación Consolidados IT788-13 of the Basque Government (to MDM). A.Sáez-Rosón is the recipient of a pre-doctoral grant from the Basque Government (Spain). Mass spectrometry and immunoelectron microscopy analyses were performed in the Proteomics Core Facility (member of ProteoRed) and Microscopy Facility of SGIKER, respectively, at the University of the Basque Country. The authors are grateful to Dr. M.L. Gainza for her valuable English review of the manuscript. Conflict of interest. None declared.

References 1. Alloush HM, Lopez-Ribot JL, Masten BJ, Chaffin WL (1997) 3-Phosphoglycerate kinase: a glycolytic enzyme protein present in the cell wall of Candida albicans. Microbiology 143 ( Pt 2):321-330 2. Castillo L, Calvo E, Martínez AI, Ruiz-Herrera J, Valentín E, López JA, Sentandreu R (2008) A study of the Candida albicans cell wall proteome. Proteomics 8:3871-3881 3. Clancy CJ, Nguyen ML, Cheng S, et al. (2008) Immunoglobulin G responses to a panel of Candida albicans antigens as accurate and early markers for the presence of systemic candidiasis. J Clin Microbiol 46:1647-1654 4. Cognetti D, Davis D, Sturtevant J (2002) The Candida albicans 14-3-3 gene, BMH1, is essential for growth. Yeast 19:55-67 5. Crowe JD, Sievwright IK, Auld GC, Moore NR, Gow NA, Booth NA (2003) Candida albicans binds human plasminogen: identification of eight plasminogen-binding proteins. Mol Microbiol 47:1637-1651 6. Ebanks RO, Chisholm K, McKinnon S, Whiteway M, Pinto DM (2006) Proteomic analysis of Candida albicans yeast and hyphal cell wall and associated proteins. Proteomics 6:2147-2156 7. Fernández-Arenas E, Molero G, Nombela C, Díez-Orejas R, Gil C (2004) Low virulent strains of Candida albicans: unravelling the antigens for a future vaccine. Proteomics 4:3007-3020

Sáez-Rosón et al.

8. García-Ruiz JC, del Carmen Arilla M, Regúlez P, Quindós G, Alvarez A, Pontón J (1997) Detection of antibodies to Candida albicans germ tubes for diagnosis and therapeutic monitoring of invasive candidiasis in patients with hematologic malignancies. J Clin Microbiol 35:3284-3287 9. Hernando FL, Calvo E, Abad A, Ramírez A, Rementeria A, Sevilla MJ, Pontón J (2007) Identification of protein and mannoprotein antigens of Candida albicans of relevance for the serodiagnosis of invasive candidiasis. Int Microbiol 10:103-108 10. Horn DL, Neofytos D, Anaissie EJ, Fishman JA, Steinbach WJ, Olyaei AJ, Marr KA, Pfaller MA, et al. (2009) Epidemiology and outcomes of candidemia in 2019 patients: data from the prospective antifungal therapy alliance registry. Clin Infect Dis 48:1695-1703 11. Iruretagoyena JR, Regúlez P, Quindós G, Pontón J (2000) Antibodies to Candida albicans germ tubes in two intensive care patients with invasive candidiasis. Rev Iberoam Micol 17:93-96 12. Ishiguro A, Homma M, Torii S, Tanaka K (1992) Identification of Can­ dida albicans antigens reactive with immunoglobulin E antibody of human sera. Infect Immun 60:1550-1557 13. Jong AY, Chen SH, Stins MF, Kim KS, Tuan TL, Huang SH (2003) Binding of Candida albicans enolase to plasmin(ogen) results in enhanced invasion of human brain microvascular endothelial cells. J Med Microbiol 52:615-622 14. Kelly MN, Johnston DA, Peel BA, Morgan TW, Palmer GE, Sturtevant JE (2009) Bmh1p (14-3-3) mediates pathways associated with virulence in Candida albicans. Microbiology 155:1536-1546 15. Klig LS, Zobel PA, Devry CG, Losberger C (1994) Comparison of INO1 gene sequences and products in Candida albicans and Saccharomyces cerevisiae. Yeast 10:789-800 16. Laín A, Moragues MD, García-Ruiz JC, Mendoza J, Camacho A, Del Palacio A, Pontón J (2007) Evaluation of a novel enzyme-linked immunosorbent assay to detect immunoglobulin G antibody to enolase for sero­ diagnosis of invasive candidiasis. Clin Vaccine Immunol 14:318-319 17. León C, Ruiz-Santana S, Saavedra P, Castro C, Úbeda A, Loza A, Martín-Mazuelos E, Blanco A, et al. (2012) Value of β-d-glucan and Candida albicans germ tube antibody for discriminating between Candida colonization and invasive candidiasis in patients with severe abdominal conditions. Intensive Care Med 38:1315-1325 18. Li FQ, Ma CF, Shi LN, Lu JF, Wang Y, Huang M, Kong QQ (2013) Diagnostic value of immunoglobulin G antibodies against Candida enolase and fructose-bisphosphate aldolase for candidemia. BMC Infect Dis 13:253-2334 19. Martínez-Gomariz M, Perumal P, Mekala S, Nombela C, Chaffin WL, Gil C (2009) Proteomic analysis of cytoplasmic and surface proteins from yeast cells, hyphae, and biofilms of Candida albicans. Proteomics 9:2230-2252 20. Martínez-Jiménez MC, Muñoz P, Guinea J, Valerio M, Alonso R, Escribano P, Bouza E (2014) Potential role of Candida albicans germ tube antibody in the diagnosis of deep-seated candidemia. Med Mycol 52: 270-275 21. Matthiesen R, Trelle MB, Hojrup P, Bunkenborg J, Jensen ON (2005) VEMS 3.0: algorithms and computational tools for tandem mass spectrometry based identification of post-translational modifications in proteins. J Proteome Res 4:2338-2347 22. Moragues MD, Ortiz N, Iruretagoyena JR, García-Ruiz JC, Amutio E, Rojas A, Mendoza J, Quindós G, et al. (2004) Evaluation of a new commercial test (Candida albicans IFA IgG) for the serodiagnosis of invasive candidiasis (In Spanish). Enferm Infecc Microbiol Clin 22:83-88 23. Mukherjee PK, Mohamed S, Chandra J, Kuhn D, Liu S, Antar OS, Munyon R, Mitchell AP, et al. (2006) Alcohol dehydrogenase restricts


C. albicans germ tubes

the ability of the pathogen Candida albicans to form a biofilm on catheter surfaces through an ethanol-based mechanism. Infect Immun 74:3804-3816 24. Palmer GE, Johnson KJ, Ghosh S, Sturtevant J (2004) Mutant alleles of the essential 14-3-3 gene in Candida albicans distinguish between growth and filamentation. Microbiology 150:1911-1924 25. Pardo M, Ward M, Pitarch A, Sánchez M, Nombela C, Blackstock W, Gil C (2000) Cross-species identification of novel Candida albicans immunogenic proteins by combination of two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. Electrophoresis 21:2651-2659 26. Parkins MD, Sabuda DM, Elsayed S, Laupland KB (2007) Adequacy of empirical antifungal therapy and effect on outcome among patients with invasive Candida species infections. J Antimicrob Chemother 60:613-618 27. Pemán J, Zaragoza R (2012) Towards an early diagnosis of invasive candidiasis in the critically ill patient. Rev Iberoam Micol 29:71-75 (In Spanish) 28. Pfaller MA, Diekema DJ, Gibbs DL, Newell VA, Ellis D, Tullio V, Rodloff A, Fu W, Ling TA, and the Global Antifungal Surveillance Group (2010) Results from the ARTEMIS DISK Global Antifungal Surveillance Study, 1997 to 2007: a 10.5-year analysis of susceptibilities of Candida species to fluconazole and voriconazole as determined by CLSI standardized disk diffusion. J Clin Microbiol 48:1366-1377 29. Pitarch A, Abian J, Carrascal M, Sánchez M, Nombela C, Gil C (2004) Proteomics-based identification of novel Candida albicans antigens for diagnosis of systemic candidiasis in patients with underlying hematological malignancies. Proteomics 4:3084-3106 30. Pitarch A, Díez-Orejas R, Molero G, Pardo M, Sánchez M, Gil C, Nombela C (2001) Analysis of the serologic response to systemic Candida albicans infection in a murine model. Proteomics 1:550-559 31. Pitarch A, Jiménez A, Nombela C, Gil C (2006) Decoding serological response to Candida cell wall immunome into novel diagnostic, prognostic, and therapeutic candidates for systemic candidiasis by proteomic and bioinformatic analyses. Mol Cell Proteomics 5:79-96 32. Pitarch A, Jiménez A, Nombela C, Gil C (2008) Serological proteome analysis to identify systemic candidiasis patients in the intensive care unit: Analytical, diagnostic and prognostic validation of anti-Candida enolase antibodies on quantitative clinical platforms. Proteomics Clin Appl 2:596-618 33. Pitarch A, Nombela C, Gil C (2007) Reliability of antibodies to Candida methionine synthase for diagnosis, prognosis and risk stratification in systemic candidiasis: A generic strategy for the prototype development phase of proteomic markers. Proteomics Clin Appl 1:1221-1242 34. Pitarch A, Nombela C, Gil C (2011) Prediction of the clinical outcome in invasive candidiasis patients based on molecular fingerprints of five antiCandida antibodies in serum. Mol Cell Proteomics 10:M110.004010 35. Pitarch A, Pardo M, Jiménez A, Pla J, Gil C, Sánchez M, Nombela C (1999) Two-dimensional gel electrophoresis as analytical tool for identifying Candida albicans immunogenic proteins. Electrophoresis 20:1001-1010

Int. Microbiol. Vol. 17, 2014

29

36. Pitarch A, Sánchez M, Nombela C, Gil C (2002) Sequential fractionation and two-dimensional gel analysis unravels the complexity of the dimorphic fungus Candida albicans cell wall proteome. Mol Cell Proteomics 1:967-982 37. Pontón J (2009) Utilidad de los marcadores biológicos en el diagnóstico de la candidiasis invasora. Rev Iberoamer Micol 26:8-14 (In Spanish) 38. Pontón J, Jones JM (1986) Identification of two germ-tube-specific cell wall antigens of Candida albicans. Infect Immun 54:864-868 39. Pontón J, Marot-Leblond A, Ezkurra PA, Barturen B, Robert R, Senet JM (1993) Characterization of Candida albicans cell wall antigens with monoclonal antibodies. Infect Immun 61:4842-4847 40. Quindós G, Eraso E, López-Soria LM, Ezpeleta G (2012) Enfermedad fúngica invasora: ¿Diagnóstico micológico convencional o molecular? Enferm Infecc Microbiol Clin 30:560-571 (In Spanish) 41. Quindós G, Pontón J, Cisterna R (1987) Detection of antibodies to Can­ dida albicans germ tube in the diagnosis of systemic candidiasis. Eur J Clin Microbiol 6:142-146 42. Quindós G, Pontón J, Cisterna R, Mackenzie DW (1990) Value of detection of antibodies to Candida albicans germ tube in the diagnosis of systemic candidosis. Eur J Clin Microbiol Infect Dis 9:178-183 43. Saville SP, Thomas DP, Lopez Ribot JL (2006) A role for Efg1p in Can­ dida albicans interactions with extracellular matrices. FEMS Microbiol Lett 256:151-158 44. Shevchenko A, Wilm M, Vorm O, Mann M (1996) Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68:850-858 45. Suliman HS, Appling DR, Robertus JD (2007) The gene for cobalaminindependent methionine synthase is essential in Candida albicans: a potential antifungal target. Arch Biochem Biophys 467:218-226 46. Thomas DP, Viudes A, Monteagudo C, Lazzell AL, Saville SP, LopezRibot JL (2006) A proteomic-based approach for the identification of Candida albicans protein components present in a subunit vaccine that protects against disseminated candidiasis. Proteomics 6:6033-6041 47. Urban C, Sohn K, Lottspeich F, Brunner H, Rupp S (2003) Identification of cell surface determinants in Candida albicans reveals Tsa1p, a protein differentially localized in the cell. FEBS Lett 544:228-235 48. Vialas V, Perumal P, Gutierrez D, Ximenez-Embun P, Nombela C, Gil C, Chaffin WL (2012) Cell surface shaving of Candida albicans biofilms, hyphae, and yeast form cells. Proteomics 12:2331-2339 49. Wang YK, Das B, Huber DH, Wellington M, Kabir MA, Sherman F, Rustchenko E (2004) Role of the 14-3-3 protein in carbon metabolism of the pathogenic yeast Candida albicans. Yeast 21:685-702 50. Zaragoza R, Pemán J, Quindós G, et al. (2009) Clinical significance of the detection of Candida albicans germ tube-specific antibodies in critically ill patients. Clin Microbiol Infect 15:592-595 51. Zaragoza R, Pemán J, Quindós G, et al. (2009) Kinetic patterns of Can­ dida albicans germ tube antibody in critically ill patients: influence on mortality. Clin Vaccine Immunol 16:1527-1528


RESEARCH ARTICLE International Microbiology (2014) 17:31-40 doi:10.2436/20.1501.01.205 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Local ciliate communities associated with aquatic macrophytes Anna M. Yeates,1 Genoveva F. Esteban2* School of Biological and Chemical Sciences, Queen Mary University of London, London, UK. 2Centre for Conservation Ecology and Environmental Science, Faculty of Science & Technology, Bournemouth University, Poole, Dorset, UK

1

Received 9 January 2014 · Accepted 30 March 2014 Summary. This study, based within the catchment area of the River Frome, an important chalk stream in the south of England, compared ciliated protozoan communities associated with three species of aquatic macrophyte common to lotic habitats: Ranunculus penicillatus subsp. pseudofluitans, Nasturtium officinale and Sparganium emersum. A total of 77 ciliate species were counted. No species-specific ciliate assemblage was found to be typical of any one plant species. Ciliate abundance between plant species was determined to be significantly different. The ciliate communities from each plant species were unique in that the number of species increased with ciliate abundance. The community associated with R. penicillatus subsp. pseudofluitans showed the highest consistency and species richness whereas S. emersum ciliate communities were unstable. Most notably, N. officinale was associated with low ciliate abundances and an apparent reduction in biofilm formation, discussed herein in relation to the plant’s production of the microbial toxin phenethyl isothiocyanate. We propose that the results reflect differences in the quantity and quality of biofilm present on the plants, which could be determined by the different plant morphologies, patterns of plant decay and herbivore defense systems, all of which suppress or promote the various conditions for biofilm growth. [Int Microbiol 2014; 17(1):31-40] Keywords: Ranunculus · Nasturtium · toxin phenethyl isothiocyanate (PEITC) · biofilms · macrophytes · ciliates · microbial biodiversity

Introduction The vast majority of eukaryotes live as single cells [37]; of these, ciliated protozoa are the most complex. They are ubiquitous in aquatic environments, where macrophytes that oxygenate the water and act as a substrate and refuge provide a key habitat for them and for other microorganisms and invertebrates [2,17,30,35]. Ciliates are major consumers of bacteCorresponding author: G.F. Esteban Faculty of Science & Technology Bournemouth University Talbot Campus Poole, Dorset BH12 5BB, UK Tel. +44-1202968936 E-mail: gesteban@bournemouth.ac.uk

*

ria, algae and other protozoa in aquatic food webs [16]. The protozoa collectively form a critical intermediate link between microbial and metazoan trophic levels [18]. They are also a fundamental component of the microbial loop [18,21], which describes the introduction of dissolved and particulate organic carbon into the food web through phytoplankton production and its consumption by microbes such that it becomes accessible to higher trophic levels [18,40]. There is evidence that without microbial reclamation of organic matter the levels of biomass in the food web could not be sustained by autotrophs alone [41]. Protozoa are now widely believed to play a major role in ecosystem processes [19], for example in soil ecology [9], freshwater ecology [16,20], biogeochemical cycling [29]


32

Int. Microbiol. Vol. 17, 2014

yeates et al.

such as carbon-fixation, and in the control of bacterial populations [19]. Despite their important ecological roles and their value as indicators of environmental health in ecosystem assessment [24], ciliate ecology remains underinvestigated. Studies of protozoan communities are scarce [23] and only a few of them have compared local biotopes [4,7,40], especially those in flowing waters [38]. For example, it is not known whether different aquatic macrophyte species in a stream support distinguishable protozoan communities. The aim of this study was to address this deficiency by comparing assemblages of ciliated protozoa associated with three different species of aquatic macrophytes in a Dorset (UK) chalk stream, and then characterising each ciliate community according to the ciliate species present, ciliate abundance and species richness.

Materials and methods

Sampling methods. Samples were collected twice a week in August– September 2009. Three species of aquatic macrophytes were chosen for investigation; Ranunculus penicillatus (Dumort.) Bab. subsp. pseudofluitans (Syme) S.D.Webster (water crowsfoot), Nasturtium officinale. R.Br. (watercress) and Sparganium emersum Rehmann (unbranched bur reed) [29]. From these three species, six, five and five plants were sampled, respectively. The samples were picked by hand from plants as far from the bank as possible, to minimise effects of bank proximity. Handling and movement through the water were kept to a minimum. Plant samples of similar surface area, ca. 43 cm2 (see below), were taken from a branch fully submerged from at least mid-way in the water column or deeper and stored with ca. 45 ml of stream water in separate, sterile 50-ml Falcon tubes. Laboratory methods. The sampling tubes were shaken for 30 s to dislodge the ciliated protozoa from the plants and left to settle for 30 min before subsampling. Live ciliate subsamples (1 ml) were taken from the bottom of the tube using a sterile pipette and transferred to a Sedgewick Rafter counting chamber. The subsample was viewed under a light microscope until the entire 1-ml chamber had been inspected. The observed ciliates were measured and identified to species or genus level. For identification, several taxonomic guides were used in conjunction: [11,12,13,24 and references therein, 31]. Ciliates were measured either using an eyepiece graticule calibrated to the microscope or by photographing and measuring them using a MicroPublisher

Int Microbiol

Sampling site. Samples were taken from the East Stoke Millstream, a 1.2-km [10] diversion of the River Frome, Dorset, UK, 50°40′42′′ N, 2°10′48′′ W (Fig. 1). The River Frome is a designated UK Site of Special Scientific Interest (SSSI) and has been implemented as a priority habitat in the government’s UK Biodiversity Action Plan [6]. The stream study site was 2.5–4 m wide and 0.15–0.8 m deep. The substrate was a mixture of gravel, sand and silt on which a variety of submerged aquatic macrophytes grew in small patches, dominated by Ranunculus sp. Sampling took place within a 200-m reach of the stream (Fig. 1C) in a section typified by a “pool and riffle sequence” [10], i.e. alternations of deep and shallow zones along the straight course of a river (Fig. 1D). Sample collections were made where the stream had a depth between 0.45 and 0.20 m and water flow was between 0.20 and 0.40 m/s.

Fig. 1. The study site. (A) Map of the UK locating the study site in Dorset, S. England (taken from http://www.worldatlas.com). (B) The local area. The sampling site is marked by an arrow (map adapted from http://streetmap.co. uk/map). (C) The Millstream in East Stoke, located with an arrow. The sampling area in the Millstream is marked with a dotted line. The Freshwater Biological Association (FBA) is also located on the map (adapted from [http://streetmap.co.uk/map]). (D) Photograph of the Millstream at the time of sampling.

3.3 RTV High Resolution IEEE 1394 FireWire Digital CCD Colour Camera with real-time viewing. Three subsamples were analysed from each sample within three days of collection. The samples were refrigerated at 4 ºC between subsampling. Plant surface area calculation. For each plant species, three to six drawings representing the collected plant samples were made on graph paper from photographs of the original plant samples and from the plant morphology depicted in various taxonomic guides and herbarium catalogues (see supplementary material in the Bournemouth University repository; http:// eprints.bournemouth.ac.uk/21281/). Total surface area (cm2), including both


Ciliate communities on macrophytes

leaf sides and stem surface, was calculated from the squared graph paper. The average results of several drawings were 43 cm2, 43 cm2 and 46 cm2, for S. emersum, N. officinale and R. penicillatus subsp. pseudofluitans, respectively. Thus, the sample surface areas of the plant species were very similar (see supplementary material for surface area calculations). The original count format, that is the number of ciliates/ml, was retained for analysis of the data. Thus, each 1-ml subsample was taken from a community of ciliates that derived from a plant sample with an average total surface area of about 43 cm2. Statistical analyses. To test whether species-specific ciliate assem­ blages were associated with the different macrophyte species, multivariate analyses in the form of a principle components analysis (PCA) and a cluster analysis were performed using the MultiVariate Statistical Package (MVSP). These are similar statistical tests that present the data in different ways to enable improved interpretation. Differences in ciliate abundances between plant species were tested with a one-way ANOVA. Ciliate species evenness was compared between plant species using ciliate species rank abundance graphs. The relationship between species richness and abundance was investigated using cumulative species-abundance curves (CSAC), which were constructed for each plant species by comparing the number of additional ciliate species found in each subsequent 1-ml subsample with the abundance of ciliates found in each subsample. These graphs also indicate the amount of sampling effort required to reveal species diversity in a given community. To examine the relationship between ciliate abundances and cell sizes, the observed ciliates were classified into cell size categories (≤50, 50–99, 100–149, 150–199, and ≥ 200 mm). These were used to plot ciliate species richness and abundance as a function of cell size for each plant species [22].

Results The collection as a whole. The total sampled plant surface area was estimated to be 688 cm2. We examined 48 1-ml subsamples and found 508 ciliates (on average, 10.6 ciliates per ml) from 77 species, 18 of which were not identified beyond being recognised as separate species and were thus classifieed as unidentified. A list of the ciliate species grouped by class [32], an indication of which plant species they were associated with and the total number of individuals of each species is presented in Table 1. In terms of ciliate species composition, about half (52 %) of the total number of ciliates collected accounted for only seven species while a large proportion of ciliates (46 %) was observed only once (Table 1). Ciliate abundance and species richness associated with host plant. Within five samples of R. penicil­ latus subsp. pseudofluitans, 134 ciliates, comprising 42 species, were counted. Within the same number of samples of S. emersum, the number of species (46) was similar but the number of ciliates was more than two-fold higher (295). The samples of N. officinale, however, contained only 62 ciliates and 20 species. The mean average number of ciliates per sample differed significantly between the plant species (data trans-

Int. Microbiol. Vol. 17, 2014

33

formed using log (x+1); ANOVA, F (2,42) = 11.25, P < 0.001; Fig. 2). In addition, there were differences in the number of ciliates and the number of ciliate species between samples from the same host plant, reflected in the large standard deviations (Fig. 2). This was most obvious for S. emersum and N. officinale. By contrast, the standard deviations obtained for R. penicillatus subsp. pseudofluitans were comparatively smaller, denoting relative evenness in both ciliate abundance and species number between samples (Fig. 2). Species evenness within the ciliate communities associated with the three host-plant species was revealed by rank abundance graphs (Fig. 3). The greatest evenness was that of ciliate communities from R. penicillatus subsp. pseudoflui­ tans, in which half of the abundance was represented by 17 % of the ciliate species (8 species), while, in S. emersum and N. officinale, 50 % of the ciliates accounted for only 13 % (5.5 species) and 14 % (4 species) of the ciliate species, respectively. The four most abundant species within each ciliate community are listed in Fig. 3. Among the five species in the lists, Aspidisca sp. appeared within all top ranks, largely dominating S. emersum and N. officinale at 22.4 % and 20 % respectively and ranking third (8.2 %) in R. penicillatus subsp. pseudofluitans samples. Trochilia minuta also appeared within the five top ranks of all plant species. Acineria uncinata, Ho­ losticha sp. and Chilodonella sp. filled the remaining ranks. As shown in the CSACs (Fig. 4), the rate of discovery of further ciliate species as a function of cumulative abundance differed for each plant species. Sparganium emersum CSAC had a long shallow curve with occasional large gaps between data points, while R. penicillatus subsp. pseudofluitans CSAC had a deeper curve that reached the same number of ciliate species much more rapidly, indicating that these samples were more species-rich and more consistent in their numbers of species. Indeed, on average, there was one new (i.e. not previously observed in the countings) species for every 6.3 ciliates in the S. emersum samples, while, in R. penicillatus subsp. pseudofluitans and N. officinale, additional species occurred at a rate of one in 3.2 and 3.1 ciliates respectively, about double that of S. emersum. Although the average ratio of ciliate species/ciliates observed was similar for R. penicillatus subsp. pseudofluitans and N. officinale, the rate of discovery per ml of sample was much lower for N. officinale, as represented by the shortness of the N. officinale graph along both axes compared to the curve for R. penicillatus subsp. pseudofluitans, illustrating again that the N. officinale ciliate community was comparatively depauperate in ciliate numbers. The hyperbolic shape of the CSACs of S. emersum and R. penicillatus subsp. pseudofluitans illustrates the decrease in


34

Int. Microbiol. Vol. 17, 2014

yeates et al.

Table 1. Ciliate species comprising the α-diversity of the East Stoke Millstream, grouped by class [32]. Class abbreviations: Armophorea (Arm); Colpodea (Col); Heterotrichea (Het); Karyorelictea (Kar); Litostomatea (Lit); Nassophorea (Nas); Oligohymenophorea (Oli); Phyllopharyngea (Phy); Plagioplylea (Pla); Spirotrichea (Spi). Dots indicate with which plant species the ciliate species were found. Sparganium emersum (S) Ranunculus penicillatus pseudofluitans (R) and Nasturtium officinale (N). The number of individuals found in each ciliate species is also given. The ‘unidentified’ ciliate species are presented with respect to the macrophyte. In every case there was one individual only, indicated, for example, as ‘7*1’ (7 species, each with 1 individual ciliate). Class

Ciliate species

S

R

N

1

Spi

Aspidisca sp. (unridged)

●

●

●

86

32

Lit

Acineria uncinata

2

Spi

Aspidisca costata

●

6

33

Phy

Thigmogaster oppositevacuolatus

3

Spi

Euplotes sp1.

●

1

34

Phy

Trithigmostoma cucullulus

●

●

10

4

Spi

Euplotes sp2.

●

2

35

Phy

Chilodonella sp1.

●

●

8

5

Spi

Euplotes sp3. (unridged)

●

●

4

36

Phy

Chilodonella sp2.

●

●

6

Spi

Euplotes sp4.

●

1

37

Phy

Chilodonella sp3.

●

●

7

Spi

Oxytricha fallax

●

2

38

Phy

Chilodonella uncinata

●

●

8

Spi

Oxytricha sp1.

●

●

8

39

Phy

Gastronauta clatratus

9

Spi

Oxytricha sp2.

●

1

40

Phy

Trochilioides recta

10

Spi

Oxytricha sp3.

●

●

●

10

41

Phy

Trochilia sp.

●

●

●

14

11

Spi

Holosticha sp1.

●

●

●

32

42

Phy

Trochilia minuta

●

●

●

38

12

Spi

Holosticha sp2.

●

●

●

10

43

Nas

Microthorax sp.

●

●

13

Spi

Holosticha sp3.

●

●

●

14

44

Nas

Pseudomicrothorax sp.

●

1

14

Spi

Tachysoma sp.

●

5

45

Oli

Vorticella sp.

●

2

15

Arm

Metopus sp.

●

1

46

Oli

Campanella umbellaria

16

Arm

Metopus sp.

●

3

47

Oli

Epistylis digitalis

●

1

17

Arm

Metopus laminarius minor

●

1

48

Oli

Epistylis sp.

●

1

18

Col

Bryometopus pseudochilodon

●

1

49

Oli

Zoothamnium sp.

●

2

19

Het

Stentor sp.

●

2

50

Oli

Unidentified peritrich

●

1

20

Pla

Trimyema compressum

●

7

51

Oli

Lagenophrys vaginicola

●

21

Kar

Loxodes striatus.

●

5

52

Oli

Lembadion lucens

●

22

Kar

Loxodes sp.

●

●

8

53

Oli

Paramecium sp.

23

Kar

Loxodes magnus

●

1

54

Oli

Frontonia accuminata

●

●

●

23

24

Lit

Dileptus tenuis

●

3

55

Oli

Tetrahymena pyriformis

●

●

●

2

25

Lit

Dileptus sp.

●

3

56

Oli

Cinetochilum margaritaceum

●

●

●

8

26

Lit

Dileptus margaritifer

●

2

57

Oli

Unidentified hym.

●

1

27

Lit

Litonotus sp.

●

4

58

Nas

Nassula sp.

●

1

28

Lit

Litonotus anguilla

●

1

59

Nas

Leptopharynx costatus

●

1

29

Lit

Litonotus fasciola

●

●

●

6

60-66

-

Unidentified 1-7

30

Lit

Amphileptus procerus

●

1

67-71

-

Unidentified 8 -12

31

Lit

Loxophyllum sp.

●

●

14

72-77

-

Unidentified 13-18

●

Total no.

Class Ciliate species

S

R

N

●

●

●

33

●

●

1

●

●

14

●

1 1

15

●

1

1 ●

6

●

2

●

7*1 ●

●

11 33

●

●

Total no.

4*1 5*1


Ciliate communities on macrophytes

35

Int Microbiol

Int. Microbiol. Vol. 17, 2014

species yield per ciliate, indicated as the cumulative number of observed ciliates (Fig. 4). The S. emersum CSAC plateaus at the 11th ml (46 species, 266 ciliates) indicated the inefficiency of further sampling; indeed, from 7â&#x20AC;&#x201C;14 ml the rate of species discovery dropped to one in 9.1 ciliates species from one in every 4.9 in the first 7 ml. The rate of species discovery per number of ciliates also decreased for R. penicillatus subsp. pseudofluitans; in the first 7 ml another ciliate species was found on average in every 2.3 ciliates, dropping to one in every 4.6 ciliates in the next seven subsamples. This was still relatively frequent and implied that further sampling may have revealed more species. The N. officinale CSAC showed no signs of flattening; instead, a fairly steady, linear and shallow trajectory revealed a slow but fairly constant rate of about three additional ciliate species per ml, again indicating that more species might have been observed with further sampling. Specific ciliate assemblages. No specific ciliate assemblages were found to be distinctive of any plant species. In Fig. 5A the cluster analysis provides an index of similarity between individual plant samples. The similarity of the ciliate species composition between samples was low in all cases (<59 %). Between samples of the same plant species most samples fell below 30 % similarity. Maximum similarity values reached only 53 % in R. penicillatus subsp. pseudofluitans,

Int Microbiol

Fig. 2. Average number of ciliates and number of ciliate species per sample. Bars show the standard deviation. Se, Sparganium emersum; Rpp, Ranunculus penicillatus subsp. pseudofluitans; No, Nasturtium officinale.

Fig. 3. Rank abundance graphs for ciliate species associated with each hostplant. For each plant, each bar represents a ciliate species, ordered from the largest (position 1) to the smallest abundance. The grey areas of the bars depict the first 50 % of the total number of ciliates. The four most abundant ciliate species are listed for each plant.

40 % in S. emersum and 28 % in N. officinale samples. In fact the largest similarities were between samples of different plant species (Fig. 5, entries in bold) but these were also low. A PCA supported these findings in that the ordination showed no clustering of within-plant species samples and no discernible overall pattern was apparent between the plots, demonstrating that ciliate species did not characterise the communities associated with the host plant species (data not shown). Ciliate cell-size frequencies. Trends in ciliate abundance/cell size frequencies were similar between plant species (Fig. 6A). In general, the relationship was inversely related so that the smallest ciliates (<50 mm) were most abundant, comprising nearly 50 % of the ciliate associations for all three host plant species, whereas the largest ciliates (>200 mm) were least abundant in all cases, totaling 4.3 % of the abundance in S. emersum samples and a somewhat higher abun-


Int. Microbiol. Vol. 17, 2014

yeates et al.

Int Microbiol

36

Fig. 4. Cumulative abundance–species curves. The 15th 1-ml subsample plot has been enlarged and filled black as an indicator of sample number vs. no. of ciliate species and ciliate abundance.

(14.9 %) than those of smaller size (100–149 mm, 9.8 %) within the S. emersum samples. The number of ciliate species in each size category also decreased somewhat as cell size increased; however, the trend was much weaker and category

Int Microbiol

dance in R. penicillatus subsp. pseudofluitans samples (8.7 %), while in the samples of N. officinale they were entirely absent. There was a single exception to the ‘inverse trend’ in which ciliates of 150–199 mm had a slightly higher abundance

Fig. 5. An index of similarity produced from a cluster analysis of the plant samples. Each column and row is headed with a letter and number signifying a particular plant sample. S1–S5 represent the five samples taken from Sparganium emersum, R1–R6, the six samples from Ranunculus penicillatus subsp. pseudofluitans and N1–N6 the six samples from N. officinale. Entries in the table show the percentage similarity between two samples; 100 % = identical; 0 % = no common species. The entries against a grey background show similarity levels between the samples of a given plant species. The five highest values are indicated in bold. Asterisks signify entries of 100 %.


Fig. 6. Ciliate cell-size frequencies. Bars show the percentage ciliate abundance for each size category (A) and the percentage of ciliate species for each size category (B). Se, Sparganium em­ ersum; Rpp, Ranunculus penicillatus subsp. pseudofluitans; No, Nasturtium officinale. Size units are mm.

50–99 mm was an exception in each case, containing the highest numbers of ciliate species in S. emersum and N. officinale and the same number of ciliate species as the <50 mm category in R. penicillatus subsp. pseudofluitans (Fig. 6B).

Discussion The East Stoke Millstream ciliate community. Altogether 77 ciliate species were found, an indication of the active α-diversity of the ciliated protozoa associated with the aquatic macrophytes in the East Stoke Millstream. However, this is probably an underestimate because subsampling was not exhaustive, as shown by the CSAC, and rare or more elusive species might have remained undetected. Furthermore, due to the inherent difficulty in identifying smaller ciliates to the species level, this category was prone to misidentification and underestimation. Comparing our findings with those of previous studies is difficult because of the differences in sampling methods and quantification. Foissner et al. [25] have focused on different continents and their countings include non-freshwater species. Moreover, neither the sizes of the sample areas nor the sample volumes are reported. Finlay and Esteban [19] have stated that a freshwater lake was likely to contain 15 ciliates per ml, although this figure is an estimate of the number of ciliates in the water column rather than associated with a substrate; consequently, comparison of our findings with those

Int. Microbiol. Vol. 17, 2014

37

Int Microbiol

Ciliate communities on macrophytes

reported in that study is also limited. According to SchmidAraya [39] the total ciliate abundances in the sediments of an Austrian brook range from about 20 to 40 individuals per ml. The samples were taken in August, however, when ciliates are less abundant than at other times of the year. In addition, ciliate abundances in sediments may be quite different from those in plants. Gray [26], using a methodology similar to our own, has reported that the abundances of ciliates and ciliate species found on plant samples of R. penicillatus are ‘generally low’ (0–10 per ml). The data in that study, expressed per ml, reflect the ciliate abundance found in the present work when expressed in the same way, 10.6 ciliates/ml on average. Overall, the densities of ciliates detected in the current study were of the same order of magnitude as those previously reported [19,25,39]. Comparisons, however, should be viewed with caution given the disparity of the sampling methodologies, the habitats sampled, and the measurement techniques. The aim of this study was to determine whether in a local area distinguishable communities of ciliates are associated with distinct mesohabitats [1]. Specifically, we asked whether three different species of aquatic macrophytes, Sparganium emersum, R. penicillatus subsp. pseudofluitans and N. offici­ nale, living adjacently in the East Stoke Millstream, support differentiable communities of ciliated protozoa. Although the plant species did not host ciliate communities that were plantspecies-distinguishable, we found differences in terms of ciliate abundances, species richness, community evenness and the relationship between species richness and abundance.


38

Int. Microbiol. Vol. 17, 2014

We assumed that the potential for ciliate recruitment by each plant species was the same; in fact, each plant received ciliates from the same sources, originating from the seed bank in the soil, which had distributed them evenly along the stream, from re-inoculation from other macrophyte ciliate communities and from the running water itself [22,26]. Since the plants were selected from as far from the bank as possible, biases in the data relating to the proximity of the plants to the banks should be minimal, if any. Differences in the abundances and species composition of the ciliate communities on different host plants could thus be attributed to the different environments provided by the host plant species. Plant species–ciliate associations. The ciliate community associated with S. emersum was characterised by large variations between samples with respect to both the numbers of ciliates and the number of ciliate species, while species composition was skewed by just one or two species. Despite the large total number of ciliates, there were comparatively few species and very few large ciliates. The CSAC clearly indicated a maximum species richness of 46 species. We discuss these findings based on our view that they are symptomatic of an unstable habitat. Ranunculus penicillatus subsp. pseudofluitans hosted the most consistent ciliate community, given the relative reproducibility between samples both in ciliate species and numbers. This plant harboured as many species as S. emersum, with higher species richness per number of ciliates and the highest species evenness. In addition, R. penicillatus subsp. pseudofluitans was colonised by the greatest number of large ciliates (> 200 mm) and had the most even spread of ciliates between size categories. These findings are suggestive of a more developed community [9], which in our opinion is an effect of the habitat permanence and complexity provided by the host plant, as discussed below. Overall, N. officinale samples were depauperate in ciliate numbers, with correspondingly low numbers of species and an absence of large ciliates (> 200 mm). A determinant factor stronger than the stability or complexity of the environment offered by N. officinale might have influenced its associative ciliate community. One such potential factor is the plant’s use of phenethyl isothiocyanate (PEITC), a secondary metabolite produced as a defence against herbivory [34,36] (see below). The host-plant environment. It is a well-established tenet of biology that environmental complexity strongly determines community complexity and this in turn is characteristic of community stability [9,33]. To apply this theory in terms of macrophyte-associated microbial communities, we

yeates et al.

might consider the complexity of the environment of the host plant by way of its topology, such as leaf, branch and nodal patterns, together with patterns of plant growth and decay. The structure of the studied macrophytes in the stream habitat showed that R. penicillatus subsp. pseudofluitans was the most multifaceted in structure, based on its iteratively branching stems creating many internodal spaces and its varying branch lengths that bear thin, thread-like capillary leaves [43]. Nasturtium officinale morphology was also relatively multipart although it consisted of broad, pinnately compound leaves, less branching and fewer leaf nodes. S. emersum had a simple structure of long, flat, trailing, strap-like leaves from small stands. The contrasting morphologies and life cycles of these macrophytes may have translated into differing protozoan abundances, as discussed below. Work by Sleigh et al. [40] illustrates how environmental complexity and stability can directly produce community com­plexity. Those authors found that the internodal spaces of R. peni­cillatus subsp. pseudofluitans harbour a large protozoan diversity, in which the ciliates show little seasonal variation. The plant’s nodes were suggested to offer refuge from the water current and, for attached and for swimming ciliates, to provide habitats not apparently found elsewhere on the plant. The numerous leaf nodes of the R. penicillatus subsp. pseudofluitans samples collected for this study presumably offered similar refuge from seasonal variation and water currents, allowing certain species to reside on the plant, which otherwise would not have been suitable, and therefore time for communities to develop in complexity, thus accounting for both the high species richness and the comparatively low variation in ciliate abundance. Environmental constancy can also be ascribed to the per­ ennial, semi-deciduousness of R. penicillatus subsp. pseudo­ fluitans, which has capillary leaves all year round [43]. Furthermore, the small, multiple and iterated plant parts meant that disturbances of one area have small proportional effects on the ciliate community. Sparganium emersum is also a perennial species but with hard die-back in winter and growth peaks in summer [28]; throughout the year its leaves show various levels of decay. During the collection for this study, we noticed that the leaves of S. emersum often had brown patches of various sizes, indicating biodegradation. The leaves of S. emersum are much larger than those of R. penicillatus subsp. pseudofluitans, implying a higher potential for the total quantity of decay across the leaf. Decay entails bacterial colonisation, which in turn provides rich feeding grounds for protozoans and the establishment of an abundant protozoan community. However, its pro-


Ciliate communities on macrophytes

gression leads to eventual leaf drop-off or disappearance from the plant. Accordingly, while S. emersum provides rich feeding grounds that support ciliate communities of large abundance, they are temporary. Temporary environments are usually characterised by unevenness and relative species poorness in the communities associated with them [33]. In a microbial community, a temporary environment might restrict species establishment to those of rapid growth and high turnover, namely, smaller species. The results of our study were consistent with these explanations; in fact we found that the ciliate communities of S. emersum had large variations in ciliate abundances between samples: they were dominated by one or two species (Fig. 3) and inhabited mainly by smaller ciliates while larger ciliates were inhibited. It is thus suggested that the habitat provided by S. emersum is unstable in that it undergoes constant change in terms of decay, with the potential at times to recruit large microbial communities but also to cause a sudden and dramatic collapse of the community through the loss of a single leaf. The depauperate ciliate community associated with N. offi­ cinale is difficult to explain in terms of plant morphology or life-cycle. An additional source of environmental complexity, not yet fully discussed but perhaps the most important, is the presence of a microbial biofilm that typically grows upon the plant surface, providing shelter and food for its resident and constituent microorganisms [3]. Biofilm removal or reduction thus greatly impacts the number of ciliates. During sampling of N. officinale in the Millstream we noticed that it was relatively easy to detect in its submerged location from the stream bank, due to its bright green colour. By contrast, the other two plant species, and particularly S. emersum, were less visible partly because their outline and colour had been masked by an accumulation of biofilm and other particulate matter that seemed to be more or less absent from N. officinale. Micros­copy revealed a thinner biofilm on N. officinale than on the two other plant species; also, there was a remarkable absence of general particulate organic matter, flora and fauna, including the microbes (bacteria, diatoms, algal filaments, flagellates, amoeba, and ciliates) that typically have high abundances in and are the main constituents of biofilms [16]. The usual associated meiofauna, such as nematodes, copepods, rotifers and small insect larvae, were also all but absent. Indeed, the water was particularly clear and the plants from which the samples were collected could be easily seen. Sparganium emer­sum and R. penicillatus subsp. pseudofluitans samples contained variable, often relatively large quantities of additional matter such that flora and fauna, including ciliates, were much more difficult to observe as many of these organisms would have been obscured.

Int. Microbiol. Vol. 17, 2014

39

These observations are most likely explained by N. offici­ nale’s production of PEITC, a compound that protects against herbivory [34,36]. The antimicrobial effects of isothiocyanates in general have been reported in the scientific literature since the 19th century [14]. Walker et al. [in 41] reported the phenomenon in 1937 and Foter and Golick [in 42] found that PEITC, when extracted from the roots of turnips, acts like a “natural insecticide”. More recent research by Beevi et al. [5] confirmed these findings, in a study that also recounted the historical usage of cruciferous plants for food preservation. Less well studied is the effect of PEITC on aquatic fauna. In 2011, Dixon and Shaw [15] reported a negative impact of PEITC on Gammarus pulex, a freshwater shrimp known for its ecological robustness (Schmid-Araya, personal communication). In their study, Dixon and Shaw found that gammarid mortality increases with high concentrations of PEITC and that gammarids elude water containing PEITC. Our findings suggest that the ciliate community associated with N. officinale is in a state of constant renewal. In other words, each ciliate is only temporarily associated with N. of­ ficinale, through a process of constant loss and replenishment. The high and steady turnover of species suggested by the CSACs (Fig. 4) can be explained by a process of continual emigration and immigration of the ciliates, because the drift of the water column prevents them from settling on N. offici­ nale or the conditions are too unfavourable for them to settle for long on the plant’s surfaces such that they move on whilst the continual supply of ciliates in the drift replaces them. The low numbers of ciliated protozoa associated with N. officinale might then have been an indirect result of the impedance of bacterial colonisation and thus of the microbial fauna it supports both as a food source and as a structural component of the biofilm; alternatively, the paucity of ciliates may have reflected direct chemical inhibition of the ciliates themselves; or perhaps both mechanisms were involved. Thus, whether the perceptible lack of biofilm and the lower ciliate numbers were related to PEITC and its release from by N. officinale remains a question for future research. Acknowledgements. The authors acknowledge funding support from the Esmée Fairbairn Foundation (UK). Competing interests. None declared.

References 1. Armitage PD, Pardo I, Brown A (1997) Temporal constancy of faunal assemblages in ‘mesohabitats’–application to management? Arch Hydro­biol 133:367-387


40

Int. Microbiol. Vol. 17, 2014

2. Asaeda T, Rajapakse L, Kanoh M (2010) Fine sediment retention as affected by annual shoot collapse: Sparganium erectum as an ecosystem engineer in a lowland stream. River Res App 26:1153-1169 3. Baker JH (1984) Factors affecting the bacterial colonization of various surfaces in a river. Can J Microbiol 30:511-515 4. Baldock BM, Baker JH, Sleigh MA (1983) Abundance and productivity of protozoa in chalk streams. Hol Ecol 6:238-246 5. Beevi SS, Mangamoori LN, Dhand V, Ramakrishna DS (2009) Iso­thio­ cyanate profile and selective antibacterial activity of root, stem, and leaf extracts derived from Raphanus sativus L. Foodborne Path Dis 6:129136 6. Biodiversity Steering Group (1995) Biodiverstiy: The UK Steering Group Report, Vol. II: Action Plans. Tranche 1, Vol 2. UK Biodiversity Action Plan 7. Bradley MW, Esteban GF, Finlay BJ (2010) Ciliates in chalk-stream habitats congregate in biodiversity hot spots. Res Microbiol 161:619-625 8. Brussaard L (1998) Soil fauna, guilds, functional groups and ecosystem processes. App Soil Ecol, 9:123-135 9. Cleland EE (2011) Biodiversity and ecosystem stability. Nature Ed Knowl 3:14 10. Clough S, Beaumont RC (1998) Use of miniature radio-transmitters to track the movements of dace, Leuciscus leuciscus in the River Frome, Dorset. Hydrobiology 371/372:89-97 11. Curds CR (1982) British and other freshwater ciliated protozoa, Part I Ciliophora: Kinetofragminophora. Cambridge University Press, Cam­ bridge 12. Curds CR, Gates MA, Roberts DMcL (1983) British and other freshwater ciliated protozoa, Part I; Ciliophora: Kinetofragminophora. Cam­ bridge Univ Press, Cambridge 13. Curds CR, Gates MA, Roberts DMcL (1983) British and other freshwater ciliated protozoa, Part II Ciliophora: Oligohymenophora and Polyhemenophora. Cambridge Univ Press, Cambridge 14. Delaquis PJ, Mazza G (1995) Antimicrobial properties of isothiocyanates in food preservation. Food Technol 49:73-84 15. Dixon MJ, Shaw PJ (2011) Watercress and water quality: the effect of phenethyl isothiocyanate on the mating behaviour of Gammarus pulex. Int J Zool 2011:1-9 16. Dopheide A, Lear G, Stott R, Lewis G (2008) Molecular characterisation of ciliate diversity in stream biofilms. Appl Environ Microbiol 74:17401747 17. Esteban GF, Bradley MW, Finlay BJ (2009) A case-building Spirostomum (Ciliophora, Heterotrichida) with zoochlorellae. Eur J Protistol 45:156158 18. Fenchel T (2012) The microbial loop–25 years later. J Exp Mar Biol Ecol 366:99-103 19. Finlay BJ, Esteban GF (1998) Freshwater protozoa: biodiversity and ecological function. Biodiv Cons 7:1163-1186 20. Finlay BJ, Esteban GF (2001) Ubiquitous microbes and ecosystem function. Limnetica 20:31-43 21. Finlay BJ, Esteban GF (2013) Protozoa. In: Encyclopedia of Biodiversity. Academic Press 22. Finlay BJ, Fenchel T (2001) Protozoan community structure in a fractal environment. Protist 150:203-218 23. Finlay BJ, Téllez C, Esteban G (1993) Diversity of ciliates and other microbes in a Spanish stream in winter. J Gen Microbiol 139:2855-2863

yeates et al.

24. Foissner W, Berger H (1996) A user-friendly guide to the ciliates (Protozoa, Ciliophora) commonly used by hydrobiologists in rivers, lakes, and waste waters, with notes on their ecology. Freshwater Biol 35: 375-482 25. Foissner W, Chao A, Katz LA (2008) Diversity and geographic distribution of ciliates (Protista: Ciliophora). Biodiv Cons 17:345-363 26. Gray E (1952) The ecology of the ciliate fauna of Hobson’s Brook, a Cambridgeshire chalk stream. J Gen Microbiol 6:108-122 27. Green J, Bohannan BJM (2007) Biodiversity scaling relationships: are microorganisms different? In: D Storch, PA Marquet, JH Brown (eds) Scaling biodiversity. Cambridge Univ Press, Cambridge, pp 129-149 28. Greulich S, Bornette G (2003) Being evergreen in an aquatic habitat with attenuated seasonal contrasts –a major competitive advantage? Plant Ecol 167:9-18 29. Haslam SM, Sinker CA, Wolseley PA (1975) British water plants. Field Stud 4:243-351 30. Hoare D, Jackson MJ, Perrow M (2006) The addition of artificial macrophytes to provide macroinvertebrate refugia at Alderfen Broad, Norfolk, England. Cons Evid 3:58-60 31. Kahl A (1935) Urtiere oder Protozoa I: Wimpertiere oder Ciliata (Infusoria) (In German). Tierwelt Deutschlands 18:1-886 32. Lynn DH (2008) The ciliated protozoa: Characterization, classification and guide to the literature. Springer, London 33. McCann KS (2000) The diversity–stability debate. Nature 405:228-233 34. Newman RM, Kerfoot WC, Hanscom Z (1990) Watercress and amphipods: Potential chemical defense in a spring stream macrophyte. J Chem Ecol 16:245-59 35. Olmo JL, Esteban GF, Finlay BJ (2011) New records of the ectoparasitic flagellate Colpodella gonderi on non-Colpoda ciliates. Int Microbiol 14:207-211 36. Palaniswamy UR, McAvoy RJ, Bible BB, Stuart JD (2003) Ontogenic variations of ascorbic acid and phenethyl isothiocyanate concentrations in watercress (Nasturtium officinale R.Br.) leaves. J Agr Food Chem 51:5504-5509 37. Pomeroy LR, Williams PJ, Azam F, Hobbie JE (2007) The microbial loop. Oceanography, 20:28-33 38. Reiss J, Schmid-Araya JM (2008) Existing in plenty: abundance, biomass and diversity of ciliates and meiofauna in small streams. Freshwater Biol, 53:652-668 39. Schmid-Araya JM (1994) Temporal and spatial distribution of benthic microfauna in sediments of a gravel streambed. Limnol Oceanogr 39: 1813-1821 40. Sleigh MA, Baldock BM, Baker JH (1992) Protozoan communities in chalk streams. Hydrobiology 248:53-64 41. Thorp JH, Delong MD (1994) The Riverine Productivity Model: a heuristic view of carbon sources and organic processing in large river ecosystems. Oikos 70:305-308 42. Vaughn S (1999) Glucosinolates as natural pesticides. In: H.G. Cutler & S.J. Cutler (eds) Biologically active natural products: Agrochemicals. CRC Press, Florida, pp 81-92 43. Webster SD (1988) Ranunculus penicillatus (Dumort.) Bab. in Great Britain and Ireland. Watsonia 17:1-22


RESEARCH ARTICLE International Microbiology (2014) 17:41-48 doi:10.2436/20.1501.01.206 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Screening, isolation, and characterization of glycosyl-hydrolase-producing fungi from desert halophyte plants Francesca Luziatelli, Silvia Crognale, Alessandro D’Annibale, Mauro Moresi, Maurizio Petruccioli, Maurizio Ruzzi* Department for Innovation in Biological Agro-food and Forest systems (DIBAF), University of Tuscia, Viterbo, Italy Received 1 January 2014 · Accepted 20 March 2014 Summary. Fungal strains naturally occurring on the wood and leaves of the salt-excreting desert tree Tamarix were isolated and characterized for their ability to produce cellulose- and starch-degrading enzymes. Of the 100 isolates, six fungal species were identified by ITS1 sequence analysis. No significant differences were observed among taxa isolated from wood samples of different Tamarix species, while highly salt-tolerant forms related to the genus Scopulariopsis (an anamorphic ascomycete) occurred only on the phylloplane of T. aphylla. All strains had cellulase and amylase activities, but the production of these enzymes was highest in strain D, a Schizophyllum-commune-related form. This strain, when grown on pretreated Tamarix biomass, produced an enzymatic complex containing levels of filter paperase (414 ± 16 IU/ml) that were higher than those of other S. commune strains. The enzyme complex was used to hydrolyze different lignocellulosic substrates, resulting in a saccharification rate of pretreated milk thistle (73.5 ± 1.2 %) that was only 10 % lower than that obtained with commercial cellulases. Our results support the use of Tamarix biomass as a useful source of cellulolytic and amylolytic fungi and as a good feedstock for the economical production of commercially relevant cellulases and amylases. [Int Microbiol 2014; 17(1):41-48] Keywords: Schizophyllum commune · Tamarix ssp. · cellulase activity · amylase activity

Introduction Over the last few decades, shortages of fossil fuels and the increasing demand for renewable energy sources have led to a strong interest in biomass-based products such as biofuels, chemicals, and biomaterials [4]. For example, there is strong market demand for cellulases, given that the production costs for this class of enzymes have a major impact on ethanol pro* Corresponding author: M. Ruzzi Dept. for Innovation in Biological Agro-food and Forest systems (DIBAF) University of Tuscia Via S. Camillo de Lellis, snc I-01100 Viterbo, Italy Tel. +39-761357317. Fax +39-761357459 E-mail: ruzzi@unitus.it

duction (40–49 % of net production costs) [Technical report NREL/TP-580-28893, National Renewable Energy Laboratory, Golden, CO, USA: http://www.nrel.gov/docs/fy01osti/28893.pdf] and pose a bottleneck for the commercialization of cellulosic ethanol [11,20]. One of the limiting factors in the development of an economical process for cellulase produc­ tion is the paucity of inexpensive substrates [12,17]. At present, commercial cellulases are mainly produced, as a multienzyme complex, by both Aspergillus niger and mutant strains of Tri­choderma including T. reesei, T. viride, and T. lon­ gi­brachium [25]. The hydrolytic efficiency of these enzymes in the saccharification of lignocellulosic material is strongly dependent on the relative ratios of the enzymatic components, endo-b-1,4-glucanase (EG, EC 3.2.1.4), cellobiohydrolase


42

Int. Microbiol. Vol. 17, 2014

(CBH, EC 3.2.1.91) and b-glucosidase (BG, EC 3.2.1.21), and the synergism among them [8,15]. Commercially available cellulase preparations from T. ree­ sei (i.e., Celluclast 1.5L from Novozymes) are generally char­ acterized by their very low b-glucosidase activity, such that their use results in incomplete saccharification of the substrate due to the accumulation of cellobiose, an inhibitor of both CBH and EG [18]. Hence, the use of commercial enzyme mixtures for specific substrate hydrolysis (e.g., different types of biomass) is conditioned and limited by the difficulty in varying the ratio of each specific hydrolase in order to obtain an optimized biomass-degrading enzyme system. An important advantage of optimizing the cellulase enzyme system for specific types of pretreated biomass is a significant reduction in enzyme loading without sacrificing hydrolysis yield [2]. Among feedstocks for biofuel production, higher plant species able to grow on marginal soils in arid or semiarid environments are of particular interest [5,30,35]. Tamarix (Tamaricaceae) species, which include small trees or shrubs, are desert halophytes adapted to grow on non-arable soils and highly tolerant of abiotic stresses, including salinity, drought, and defoliation [5,13]. These plants have several salinity tolerance mechanisms, one of which is their ability to secrete solutes onto the leaf surface through specialized salt glands [28]. Microorganisms living on Tamarix leaves are likewise exposed to multiple concurrent stresses, including high and fluctuating salinity, periodic desiccation, high temperatures, high levels of UV radiation, and high alkalinity [21,31]. However, the development of a diverse microbial community, even under extreme desert environments, is supported by the phylloplane of Tamarix spp., which provides a habitat that is rich in organic carbon (>3 g C/l) [21], phosphorus, and nitrogen (mostly available as phosphate and nitrate, respectively), and characterized by adequate moisture levels [7]. The aim of this study was to identify biomass-degrading fungi from leaves and wood of high-biomass-yielding genotypes of Tamarix aphylla “Erect” type and Tamarix jorda­ nis, and to use these strains to produce a multi-enzyme system consisting of cellulases and amylases.

Materials and methods Plant biomass. Tamarix aphylla “Erect” type and T. jordanis biomass (wood and leaves) were kindly provided by Prof. Amram Eshel, Dept. of Plant Sciences, Tel Aviv University, Israel, and were grown in the southern Aravah Valley in the Negev Desert in Israel. The material was sun dried and mechanically ground to yield particles within the 0.5- to 2.0-mm range and then stored in gunny bags. Poplar (Populus nigra L.) wood was kindly provided by Prof. Paolo De Angelis, DIBAF, University of Tuscia (Viterbo, Italy).

Luziatelli et al.

Hazelnut (Coriolus avellana) shell waste and milk thistle (Silybum maria­ num) biomass were provided by Stelliferi SpA (Caprarola, Italy) and Novamont SpA (Novara, Italy), respectively. Isolation of fungi. All chemicals were reagent grade and were purchased from Sigma–Aldrich (St. Louis, MO, USA) unless otherwise stated. Ta­ marix wood and leaf pieces were incubated at 30 °C and 180 rpm in 200 ml of sterile saline solution containing 100 mg chloramphenicol/l. After 24 h, appropriate dilutions were inoculated onto potato dextrose agar (PDA, BD Difco Lab., Detroit, MI, USA) and incubated at 25 °C for 7–10 days. Each fungal strain was isolated to obtain a pure culture, as determined on the basis of the microscopic and macroscopic features of the colonies, which were subsequently maintained and transferred every month in malt extract agar. Trichoderma viride DIBAF-10, used as the reference strain in comparisons of the hydrolytic activities of cellulose, was maintained in the same way. Fungal DNA extraction. Agar plugs (1 cm2) from 15-day-old cultures were transferred into 500-ml Erlenmeyer flasks containing 100 ml of potato dextrose broth medium (PDB, Difco). After 72 h of growth at 30 °C, the mycelium was recovered by filtration and ca. 100 mg dry weight was used for DNA extraction as described by Cassago et al. [3]. PCR and sequencing. The internal transcribed spacer (ITS) sequence was PCR-amplified using the primers ITS1 (5′-TCCGTAGGTGAACCT CGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) [1,35]. Amplification was carried out using the GeneAmp PCR system 9700 (Life Techn., Monza, Italy) with the following thermal conditions: 95 °C for 5 min, followed by 35 cycles of 30 s at 95 °C, 1 min at 55 °C, and 1.5 min at 72 °C, with a final extension for 10 min. The PCR product was cloned into the pGEM-Teasy vector (Promega, Madison, WI, USA) and the resultant recombinant plasmid DNA was sequenced. Identification and phylogenetic analysis of fungal strains. The ITS sequences were compared with those of all known fungal species available in the GenBank database [http://www.ncbi.nlm.nih.gov] to identify potential phylogenetic relationships. All sequences were aligned using the multiple sequence alignment program ClustalW2 [14]. An unrooted phylogenetic tree was constructed using the neighbor-joining program contained in the PHYLIP phylogeny inference package, version 3.6, and the confidence values of the branches were determined by performing a bootstrap analysis based on 100 replicates [http://evolution.gs.washington.edu/phylip.html]. Mol­ecular characterization of strain A and strain B indicated that these strains were virtually identical; thus only strain B was further characterized. Substrate pretreatment. The Tamarix jordanis suspension (16 %) was pretreated under acidic conditions (H2SO4 0.5 %) at 120 °C for 30 min. Solid material was recovered by centrifugation (6000 rpm, 10 min), neutralized, and used for media preparation. Milk thistle dry biomass was pretreated using the lab-scale direct steam apparatus described by Santi et al [23]. Ground Tamarix wood was pretreated with sodium hydroxide (NaOH) before enzymatic hydrolysis. Briefly, a mixture of the Tamarix particles (0.5–2 mm) and NaOH (0.8 % w/v) was incubated at room temperature for 18 h under a solid loading condition of 5 % w/v. The pretreated solids were washed with 800 ml of hot deionized water and total solids were then determined. The solids were dried at 55 ºC and weighed. Carbohydrates in biomass feedstocks and in pretreated biomass samples were analyzed by hydrolyzing 500 mg of dried material with 72 % sulfuric acid at 121 °C for 60 min, which allowed complete carbohydrate hydrolysis. The monomeric sugars (glucose and xylose) from completely acid-hydrolyzed biomass were analyzed quantitatively using the Enzytec d-Glucose (R-Biopharm AG, Darmstadt, Germany), and K-xylose (Megazyme International Ireland Ltd, Wicklow, Ireland) kits following the manufacturers’ instructions.


Fungi from halophyte plants

Culture media, inoculum preparation, and culture conditions. Preliminary screening for the selection of cellulolytic fungal isolates was performed in the following medium (g/l): NH4H2PO4, 2; KH2PO4, 0.6; K2HPO4, 0.4; MgSO4·7H2O, 0.8; thiamine, 0.01; adenine, 0.004; yeast extract, 0.5; Avicel PH-101, 5. The pH of the medium was adjusted to 6.0 prior to sterilization (121 °C, 15 min). The cellulase production medium had the following composition (g/l): NaNO3, 3; KCl, 0.5; KH2PO4, 1; MgSO4·7H2O, 0.5; FeSO4·7H2O, 0.01; CaCl2, 0.1; yeast extract, 5; Avicel PH-101, 5. Before the medium was sterilized (121°C for 15 min), the pH was adjusted to 7.0. Pre-culture was carried out by inoculating 15-day-old mycelium fragments into 500 ml baffled flasks containing 100 ml of PDB. After 72 h of incubation at 30 °C under orbital shaking (180 rpm), 10 ml of pre-culture (ca. 0.13 g dry biomass) was transferred to 200 ml of production medium. To evaluate the stimulatory effect of Tamarix biomass on the production of specific cellulases, Avicel was replaced with T.-jordanis-pretreated biomass at a concentration of 1 % (w/v). Parallel experiments, under the same culture conditions, were carried out using T. viride DIBAF-10 as the reference strain. All experiments were done in triplicate at 30 °C and 180 rpm. The results are reported as the mean values. Significant differences (P < 0.05) were analyzed using Tukey’s honestly significant difference (HSD) test. Enzymatic assay. Filter-paper-degrading activity (FPase), exocellulase (avicelase), endocellulase active against carboxymethylcellulose (CMC), and α-amylase activities were determined using Whatman filter paper no.1 (1 × 6 cm strip, 50 mg), Avicel PH-101, CMC, and starch as the respective substrates according to the methods described by Ghose [9]. Activities of a- and bglucosidase were measured by monitoring the formation of glucose from maltose and cellobiose, respectively; glucose was quantified using an analysis kit (d-glucose) based on the enzymes glucose oxidase and peroxidase (RBiopharm Roche, Darmstadt, Germany). Activities were expressed in international units (IU), defined as the amount of enzyme activity releasing 1 micromole of glucose reducing-sugar equivalents per ml of the sample per min under standard conditions. Determination of temperature-dependent activity profile and storage stability. The effect of temperature on FPase activity was determined by incubating the crude extract in citrate buffer (0.05 M, pH 4.8) within a 30–70 °C range and the standard assay was performed as described above. The results were expressed as percent relative activity with respect to the optimum (50 °C), taken as 100. To determine storage stability, residual FPase, b-glucosidase, a-amylase, and a-glucosidase activities in the crude preparation were measured after incubation of the enzymes at 4 °C for 30 days. The amount of retained activity was expressed as a percentage of the zero-time control. Enzymatic hydrolysis of cellulosic substrates. To evaluate the performance of the S. commune cellulolytic enzyme system in the hydrolysis of lignocellulosic substrates, saccharification experiments were conducted using Tamarix wood (untreated and alkaline-treated), poplar wood (untreated), hazelnut shell wastes (untreated), and milk thistle biomass (untreated and steam-exploded) as substrates. Substrate hydrolysis was catalyzed using the supernatant collected from S. commune strain D cultures grown on acidpretreated Tamarix biomass (FPase activity, 96.1 IU/ml; CMCase activity, 180 IU/ml). An enzyme cocktail (Novozymes’ cellulosic ethanol enzyme kit) containing cellulase complex (NS22086), xylanase (NS22083), β-glucosidase (NS22118), hemicellulase (NS22002), and glucoamylase (NS22035) was used for comparison (FPase activity, 1500 IU/ml; CMCase activity, 2900 IU/ ml). Enzyme preparations were diluted in 50 mM sodium citrate buffer at pH 4.8 with 1 mM sodium azide to prevent microbial contamination and loaded at a rate of 5 IU/g of dry material. The hydrolysis experiments were perfor-

Int. Microbiol. Vol. 17, 2014

43

med using a substrate concentration of 3 % (w/v) in citrate buffer (0.05 M, pH 4.8), incubating the samples at 50 °C on an orbital shaker (180 rpm), for 24– 48 h. Negative controls were produced by replacing enzyme preparations with the buffer. Samples were collected after defined time intervals, and the total reducing groups were quantified according to the DNS method [10]. Hydrolysis experiments with the addition of xylanases were conducted in the same way, except that a combination of two xylanase preparations (NS22083 and NS22002; Novozymes) was added to the reaction mix. Enzyme loading of the different xylanase preparations was the same used in control experiments carried out with Novozymes’ cellulosic ethanol enzyme kit. The saccharification yield (%), i.e., the amount of substrate converted to reducing sugars, was calculated as follows: yield (%) = reducing sugar concentration (g/l) × working volume (l) × 0.9 × 100/dry substrate wt (g) × cellulose in bio­mass (%) [9]. Nucleotide sequence accession numbers. The ITS sequences obtained in this study were deposited in GenBank under the sequential accession numbers KF028368 through KF028373.

Results Molecular and biochemical characterization. More than 100 isolates were obtained from wood and leaf samples from T. aphylla “Erect” type and T. jordanis. Based on colony morphology, hyphal morphology, and spore characteristics, these isolates were classified into six different mor­ phological taxa, with one isolate from each group characterized at the molecular level using the ITS rRNA region as the DNA barcode (see Materials and methods). Sequence data of ITS fragments were used to generate a phylogenetic tree for comparison of the relatedness among these fungi and known species. The results of this analysis indicated that five of these isolates belonged to the Ascomycota phylum and one, closely-related to Schizophyllum commune, belonged to the Basi­ diomycota (Fig. 1). Major forms isolated from wood and leaves were assigned to different taxa, based on their high bootstrap values (Fig. 1). All forms from decaying wood occurred on both T. aphylla “Erect” type and T. jordanis. Penicilliumrelated form (strain F) occurred on leaves of both Tamarix species, while a Scopuraliopsis-related form (strain G) occurred only on T. aphylla “Erect” type leaves (Fig. 1). The ability of single isolates to produce extracellular hydrolytic enzymes involved in cellulose and starch degradation was evaluated in cultures grown in liquid synthetic medium containing Avicel PH-101 as the sole carbon source. As shown in Table 1, all strains were able to produce cellulosedegrading enzymes in secreted form, but they differed greatly in the total amounts of β-glucosidase (which varied from 30 ± 1 to 2640 ± 40 IU/ml) and FPase (from 10 ± 2 to 400 ± 8 IU/ml) activity. Under the same culture conditions, all strains produced a basal level of α-amylase activity, ran-


Int. Microbiol. Vol. 17, 2014

Luziatelli et al.

Int Microbiol

44

Fig. 1. Molecular identification of the six morphotypes isolated from leaves and wood of Tamarix aphylla “Erect” type (Ta) and T. jordanis (Tj) based on ITS rDNA sequence analysis. The source of each strain is indicated on the right. Phylogenetic analysis was performed using the neighbor-joining method, with 100 bootstrap replicates. Full-length ITS nucleotide sequences were retrieved from the NCBI database (GenBank Acc. Nos. in parentheses). Phyla are indicated by parentheses on the right. Numbers at nodes represent bootstrap values >70 %; values for some terminal nodes were omitted for clarity.

ging from 150 ± 11 to 410 ± 20 IU/ml (Table 1). Among the tested isolates, strain D was the best producer of FPase, b-glucosidase, and a-amylase activities (400, 2640, and 410 IU/ml, respectively). Optimization of enzyme activity production on pretreated Tamarix biomass. To determine whether Tamarix biomass could be used as feedstock for the producti-

on of cellulose-degrading enzymes, further experiments were conducted with S. commune strain D on medium containing steam-acid pretreated T. jordanis biomass (1.6 % w/v) and glucose (0.5 % w/v) as carbon sources. Under this condition, significant levels of cellulolytic and amylolytic enzymes were produced by strain D. The onset of all activities occurred 72 h after the inoculation, except for α-glucosidase activity, which was detected earlier (Fig. 2).


Fungi from halophyte plants

Int. Microbiol. Vol. 17, 2014

45

Table 1. Maximal avicelase, FPase, β-glucosidase, and α-amylase activities of fungal strains isolated from Tamarix aphylla “Erect” type and T. jordanis wood and leaves. Strains were grown on synthetic medium containing Avicel PH-101 microcrystalline cellulose. Tamarix viride DIBAF-10 was included as a reference strain Strain

Enzymatic activity* (IU/l) Avicelase

FPase

Aspergillum niger strain B

60 ± 22

Fusarium spp. strain C

b-glucosidase

a-amylase

70 ± 11

180 ± 8

250 ± 21ab

60 ± 10a

120 ± 9c

160 ± 10b

250 ± 12ab

Schizophyllum commune strain D

60 ± 19a

400 ± 8f

2640 ± 40f

410 ± 20c

Gibberella spp. strain E

60 ± 12a

100 ± 13bc

250 ± 12c

210 ± 20a

Schizophyllum commune strain F

60 ± 8a

250 ± 20e

460 ± 20d

150 ± 11a

Scopulariopsis spp. strain G

60 ± 21a

10 ± 2a

30 ± 1a

170 ± 9a

T. viride DIBAF-10

80 ± 30a

200 ± 10d

1170 ± 7e

430 ± 21c

a

b

b

*Data are the mean ± standard deviation of three replicates. a–e Column means followed by the same superscript letter are not significantly different. (P < 0.05) according to Tukey’s HSD test.

Fig. 2. Time courses of glycosyl hydrolases from Schizophyllum commune strain D grown on pretreated Tamarix jordanis biomass. (A) Endocellulase (CMCase, closed diamond); exocellulase (avicelase, open diamond); b-glucosidase (open triangle); FPase activity (closed circle). (B) a-glucosidase (closed triangle); a-amylase (open circle).

activity was retained at the higher temperature and 62 % (30 °C) to 90 % (40 °C) at the lower temperature (data not shown). To assess the storage stability of both the cellulase and the amylase complex from S. commune strain D, the crude preparation was kept at 4 °C and residual activity was determined after 1 month. Table 2 shows that the amylase complex retained al-

Int Microbiol

Effect of temperature on activity and stability of cellulase complex. The extracellular cellulase complex from S. commune strain D grown on Tamarix biomass showed maximal FPase activity (100 %) at 50 °C. Enzyme activity decreased in samples incubated at higher or lower temperatures but 59 % (60°C) to 47 % (70 °C) of the maximal


46

Int. Microbiol. Vol. 17, 2014

Luziatelli et al.

Table 2. Residual cellulolytic and amylolytic activities of the multi-enzyme complex system from S. commune strain D after storage at 4 °C for 30 days Enzyme

Residual activity* (%)

α-amylase

100 ± 1a

α-glucosidase

96 ± 1a

FPase

81 ± 2b

β-glucosidase

81 ± 1b

*Data are the mean ± SD of three replicates. a,b Values with the same superscript letter are not significantly different (P < 0.05) according to Tukey’s HSD test.

most full activity (96–100 % residual activity) while the cellulase complex lost about 20 % of its activity under the same conditions. Enzymatic hydrolysis of cellulosic biomass. Schizophyllum commune’s multienzyme complex produced on pretreated Tamarix biomass was then used to hydrolyze different untreated and pretreated lignocellulosic substrates. The amount of reducing sugars released during 24–48 h of saccharification, using an enzyme load of 5 IU/g of biomass, ranged from 3.2 ± 0.1 to 8.6 ± 0.3 mg/g of biomass (Table 3), corresponding to less than 2.0 % cellulose hydrolysis when

untreated biomass was used as the substrate. As expected, bio­ mass hydrolysis significantly increased upon pretreatment, reaching a saccharification yield of 48.7 ± 1.2 % when pretreated milk thistle was the substrate and 14.5 ± 1.0 % in the case of alkaline-pretreated Tamarix wood. Comparable values for the Novozymes multienzyme mixture were 81.9 ± 2.3 % and 47.8 ± 1.8 %, respectively. However, the differences in the performances of S. commune and commercial cellulase preparations on pretreated herbaceous biomass (milk thistle) were markedly lower when the multienzyme complex from S. com­ mune strain D was supplemented with commercial xylanases commonly used to improve cellulase performance (Table 3).

Table 3. Reducing-sugar release and saccharification rate from different lignocellulosic substrates by the supernatant collected from Schizophyllum commune strain D cultures grown on acid-pretreated Tamarix biomass Source

Enzyme mix (5 FPU/g biomass)

Milk thistle

S. commune

None

8.3 ± 0.4

1.9 ±0.1a2

Hazelnut

S. commune

None

3.2 ± 0.1

1.4 ± 0.1

Poplar

S. commune

None

8.6 ± 0.3

1.7 ± 0.1

Tamarix

S. commune

None

7.4 ± 0.1

1.9 ± 0.1a1

Milk thistle

S. commune

Steam-explosion

222.6 ± 2.4

48.7 ± 1.2b2

Tamarix

S. commune

Alkaline

63.5 ± 1.2

14.5 ± 1.0b1

Milk thistle

Commercial1

Steam-explosion

373.8 ± 4.2

81.9 ± 2.3c2

Tamarix

Commercial1

Alkaline

207.6 ± 5.5

47.8 ± 1.8c1

Milk thistle

S. commune + xylanases2

Steam-explosion

335.6 ± 2.2

73.5 ± 1.2d2

Pretreatment

Glucose equivalent* (mg/g biomass)

Saccharification rate* (% g glucose equivalent/g cellulose)

*Average ± SD from three replicates. a–d Values with the same superscript letter are not significantly different (P < 0.05) according to Tukey’s HSD test: a1– c1Tamarix biomass; a2–d2 Milk thistle biomass. Enzyme components in the commercial cocktail1 and xylanases2 were from Novozymes (see Materials and methods).


Fungi from halophyte plants

Discussion In this study, fungi occurring on the wood and leaves of two Tamarix species cultivated in the Negev Desert (Israel), namely, T. aphylla “Erect” type and T. jordanis, were studied for their phylogenetic affinities and their ability to produce extracellular cellulolytic and amylolytic enzymes. Six species were identified by phylogenetic analysis of ITS sequences of nuclear ribosomal DNA: five ascomycetes and one basidiomycete (Fig. 1). The prevalence of Ascomycota in the phyllosphere microbial community of T. aphylla was also reported by Finkel et al. [7], who analyzed the effect of geographic location on the structure of the microbial community on leaf surfaces. Our data also showed that Ascomycota occurred on both the plant’s woody material and its leaves, whereas the basidiomycete S. commune (strain D; Fig. 1) was found only on decaying wood. In both Tamarix species, the wood and leaves were differentially colonized by fungal strains belonging to different taxa, which might explain the observed differences in fungal activity. There were no significant differences among taxa isolated from wood samples from T. aphylla “Erect” type and T. jor­danis, in agreement with the observation that the microbial communities on different Tamarix species grown in the same location are highly similar [8]. Quite different results were obtained in our analysis of the leaves of the two Tamarix species, where moulds belonging to Penicillium genus (strain F) were found on the leaf surfaces of both species, whereas fungi belonging to Scopulariopsis genus (strain G) occurred only on T. aphylla “Erect” type leaves (Fig. 1). The latter data are in agreement with the observation that stems and leaves of mature T. aphylla “Erect” type plants secrete higher amounts of salt than those of T. jordanis [Abbruzzese and Kuzminsky, http://hdl.handle.net/2067/2366], which may generate a more favorable environment for slow-growing, highly salt-tolerant fungal genera such as Scopulariopsis [16,27]. Biochemical data indicated that all strains produced exoglucanase (avicelase), total cellulase (FPase), b-glucosidase, and a-amylase activities (Table 1). These enzyme activities were highest in S. commune strain D, as determined in its culture broth, in which enzyme activity was twice as high as in the cellulase-producing reference strain T. viride DIBAF-10 (Table 1). Schizophyllum commune, a ubiquitous wood-degrading white-rot fungus with a worldwide distribution [24], is not known to be a pathogen for Tamarix species. This fungal spe-

Int. Microbiol. Vol. 17, 2014

47

cies is considered to be both a genetically tractable model for studying mushroom development [34] and a likely source of enzymes capable of efficiently degrading lignocellulosic biomass [6,33]. Comparative analyses of the 38.5-Mb genome of S. commune have shown that, among basidiomycetes, this fungus has one of the most extensive enzymatic machineries for the degradation of cellulose and hemicellulose [19]. In our study, S. commune strain D produced significant amounts of cellulolytic and amylolytic activities on medium containing either Avicel or pretreated Tamarix biomass. Induction of cel­ lulase production in fungi is usually mediated by low-molecular-weight soluble oligosaccharides that are released from complex substrates as a result of hydrolysis. These metabolites enter the cell, where they signal the presence of extracellular substrates and stimulate the accelerated synthesis of constituent enzymes of the cellulase complex [26]. Various mono-, oligo-, and polysaccharides have been shown to enhance the production of cellulase by S. commune [12,24]. The efficacy of cellulases from S. commune strain D in the hydrolysis of pretreated biomass from both woody and herbaceous crops and, when supplemented with extraneous commercial β-xylanase, the enhanced hydrolytic performance of these enzymes on pretreated biomass were shown in the enzymatic hydrolysis assay using untreated, alkaline (NaOH)pretreated, and steam-explosion-pretreated lignocellulosic substrates (Table 3). When the hydrolytic capacities of the cel­lulase complex from S. commune strain D and a commercial cellulase mixture were investigated at the same enzyme loading on milk thistle, the glucose yield correlated with the β-xylanase level in the mixture (Table 3). These data are in agreement with the observation that cellulose digestion generally improves following xylan and lignin removal by chemical or enzymatic treatment. In conclusion, Tamarix biomass is a useful source to isolate novel fungal strains able to produce enzymes for biomass saccharification. Using S. commune strain D and pretreated Tamarix biomass, cellulases and amylases can be obtained with the potential to compete with commercial enzymes. Acknowledgements. We thank Prof. Amram Eshel (Department of Plant Sciences, Tel Aviv University, Israel), Prof. Paolo De Angelis (DIBAF, University of Tuscia, Italy), Stelliferi SpA (Caprarola, Italy) and Novamont SpA (Novara, Italy) for providing plant material. This research was partially supported by a grant from the Italian Ministry of the Environment and Territories within the Italy-Israel Partnership in the Environmental R&D sector “Harnessing the biodiversity of Mediterranean plants for mitigating the effects of climate change and desertification”. Competing interests. None declared.


48

Int. Microbiol. Vol. 17, 2014

References 1. Begerow D, Nilsson H, Unterseher M, Maier W (2010) Current state and perspective of fungal DNA barcoding and rapid identification procedures. Appl Microbiol Biotechnol 87:99-108 2. Billard H, Faraj A, Ferreira NL, Menir S, Heiss-Blanquet S (2012) Optimization of a synthetic mixture composed of major Trichoderma reesei enzymes for the hydrolysis of steam-exploded wheat straw. Biotechnol Biofuels 5:9 3. Cassago A, Panepucci RA, Baião AMT, Silva FH (2002) Cellophane based mini-prep method for DNA extraction from the filamentous fungus Trichoderma reesei. BMC Microbiology 2:14 4. Clark JH, Luque R, Matharu AS (2012) Green chemistry, biofuels, and biorefinery. Ann Rev Chem Biomol Eng 3:183-207 5. Eshel A, Oren I, Alekperov C, Eilam T, Zilberstein A (2011) Biomass production by desert halophytes: alleviating the pressure on the scarce resources of arable soil and fresh water. Eur J Plant Sci Biotech 5:48-53 6. Fang J, Huang F, Gao P (1999) Optimization of cellobiose dehydrogenase production by Schizophyllum commune and effect of the enzyme on kraft pulp bleaching by ligninases. Proc Biochem 34:957-961 7. Finkel OM, Burch AY, Lindow SE, Post AF, Belkin S (2011) Geographical location determines the population structure in phyllosphere microbial communities of a salt excreting desert tree. Appl Environ Microbiol 77:7647-7655 8. Galbe M, Zacchi G (2002) A review of the production of ethanol from softwood. Appl Microbiol Biotechnol 59:618-628 9. Ghose TK (1987) Measurements of cellulose activity. Pure Appl Chem 59:257-268 10. Haltrich D, Sebesta B, Steiner W (1996) Induction of xylanase and cellulase in Schizophyllum commune. In: Saddler JN, Penner MH (eds) Enzymatic degradation of insoluble carbohydrates. ACS Symposium Series 618, American Chemical Society, Washington, pp 305-318 11. Hahn-Hägerdal B, Galbe M, Gorwa-Grauslund MF, Lidén G, Zacchi G (2006) Bio-ethanol—the fuel of tomorrow from the residues of today. Trends Biotechnol 24:549-556 12. Hayes DJ (2009) An examination of biorefining processes, catalysts and challenges. Catal Today 145:138–151 13. Hudgeons JL, Knutson AE, Heinz KM, DeLoach CJ, Dudley TL, Pattison RR, Kiniry JR (2007) Defoliation by introduced Diorhabda elongata leaf beetles (Coleoptera: Chrysomelidae) reduces carbohydrate reserves and regrowth of Tamarix (Tamaricaceae). Biological Control 43:213-221 14. Larkin MA, Blackshields G, Brown NP, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947-2948 15. Lynd LR, Weimer PJ, Van Zyl WH, Pretorius IS (2002) Microbial cellulose utilization: Fundamentals and biotechnology. Microbiol Mol Biol Rev 66:506-577 16. Mudau MM, Setati ME (2006) Screening and identification of endomannanase-producing microfungi from hypersaline environments. Curr Microbiol 52:477-481 17. Naik SN, Goud VV, Rout PK, Dalai AK (2010) Production of first and second-generation biofuels: a comprehensive review. Renew Sust Energ Rev 14:578-597 18. Nidetzky B, Steiner W, Hayn M, Claeyssens M (1994) Cellulose hydrolysis by the cellulases from Trichoderma reesei: a new model for synergistic interaction. Biochem J 298:705-710

Luziatelli et al.

19. Ohm RA, De Jong JF, Lugones LG, Aerts A, Kothe E, Stajich JE, De Vries RP (2010) Genome sequence of the model mushroom Schi­ zophyllum commune. Nat Biotechnol 28:957-963 20. Percival Zhang Y-H, Himmel ME, Mielenz JR (2006) Outlook for cellulase improvement: screening and selection strategies. Biotechnol Adv 24:452-481 21. Qvit-Raz N, Jurkevitch E, Belkin S (2008) Drop-size soda lakes: transient microbial habitats on a salt-secreting desert tree. Genetics 178:1615-1622 22. Rho D, Desrochers M, Jurasek L, Driguez H, Defaye J (1992) Induction of cellulose in Schizophyllum commune: thiocellobiose as a new inducer. J Bacteriol 149:47-53 23. Santi G, D’Annibale A, Petruccioli M, Crognale S, Ruzzi M, Valentini R, Moresi M (2012) Development and testing of a novel lab-scale direct steam-injection apparatus to hydrolyse model and saline crop slurries. J Biotechnol 157:590-597 24. Schmidt O, Liese W (1980) Variability of wood degrading enzymes of Schizophyllum commune. Holzforschung 34:67-72 25. Singhania RR, Sukumaran RK, Patel AK, Larroche C, Pandey A (2010) Advancement and comparative profiles in the production technologies using solid-state and submerged fermentation for microbial cellulases. Enzyme Microb Tech 46:541-549 26. Singhania RR, Patel AK, Sukumaran RK, Larroche C, Pandey A (2013) Role and significance of beta-glucosidases in the hydrolysis of cellulose for bioethanol production. Biores Technol 127:500-507 27. Steiman R, Guiraud P, Sage L, Seigle-Murandi F (1997) Soil mycoflora from the Dead Sea oases of Ein Gedi and Einot Zuqim (Israel). Anton Leeuw 72:261-270 28. Thomson WW, Berry WL, Liull L (1969) Localization and secretion of salt by the salt glands of Tamarix aphylla. Proc Natl Acad Sci USA 63:310-317 29. Tsujiyama S, Ueno H (2011) Production of cellulolytic enzymes containing cinnamic acid esterase from Schizophyllum commune. J Gen Appl Microbiol 57:309-317 30. Xiao LP, Shia ZJ, Xua F, Sun RC (2013) Hydrothermal treatment and enzymatic hydrolysis of Tamarix ramosissima: evaluation of the process as a conversion method in a biorefinery concept. Biores Technol 135:73-81 31. Waisel Y (1991) The glands of Tamarix aphylla: a system for salt secretion or for carbon concentration? Physiol Plant 83:506-510 32. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic Press, New York, pp 315-322 33. Willick GE, Seligy VL (1985) Multiplicity in cellulases of Schizophyllum commune. Derivation partly from heterogeneity in transcription and glycosylation. Eur J Biochem 151:89-96 34. Wösten HAB, Wessels JGH (2006) The emergence of fruiting bodies in basidiomycetes. In: Kües U, Fisher R (eds) The Mycota. Part I: Growth, differentiation and sexuality. Springer, Berlin, pp 393-414 35. Zheng Y, Zhongli P, Zhang R, Labavitch JM, Wang D, Teter SA, Jenkins BM (2007) Evaluation of different biomass materials as feedstock for fermentable sugar production. J Appl Biochem Biotech 136– 140:423-435


RESEARCH ARTICLE International Microbiology (2014) 17:49-61 doi:10.2436/20.1501.01.207 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Tetracycline-resistance encoding plasmids from Paenibacillus larvae, the causal agent of American foulbrood disease, isolated from commercial honeys Adriana M. Alippi,* Ignacio E. León, Ana C. López Bacteriology Unit, Phytopathology Research Center, Faculty of Agricultural and Forestry Sciences, National University of La Plata, La Plata, Argentina Received 5 January 2014 · Accepted 25 March 2014 Summary. Paenibacillus larvae, the causal agent of American foulbrood disease in honeybees, acquires tetracycline-resistance via native plasmids carrying known tetracycline-resistance determinants. From three P. larvae tetracycline-resistant strains isolated from honeys, 5-kb-circular plasmids with almost identical sequences, designated pPL373 in strain PL373, pPL374 in strain PL374, and pPL395 in strain PL395, were isolated. These plasmids were highly similar (99%) to small tetracycline-encoding plasmids (pMA67, pBHS24, pBSDMV46A, pDMV2, pSU1, pAST4, and pLS55) that replicate by the rolling circle mechanism. Nucleotide sequences comparisons showed that pPL373, pPL374, and pPL395 mainly differed from the previously reported P. larvae plasmid pMA67 in the oriT region and mob genes. These differences suggest alternative mobilization and/or conjugation capacities. Plasmids pPL373, pPL374, and pPL395 were individually transferred by electroporation and stably maintained in tetracycline-susceptible P. larvae NRRL B-14154, in which they autonomously replicated. The presence of nearly identical plasmids in five different genera of gram-positive bacteria, i.e., Bhargavaea, Bacillus, Lactoba­ cillus, Paenibacillus, and Sporosarcina, inhabiting diverse ecological niches provides further evidence of the genetic transfer of tetracycline resistance among environmental bacteria from soils, food, and marine habitats and from pathogenic bacteria such as P. larvae. [Int Microbiol 2014; 17(1):49-61] Keywords: American foulbrood disease (AFB) · Paenibacillus larvae · tetracycline resistance · plasmids · honeybees

Introduction American foulbrood (AFB) is a highly contagious and des­ tructive infectious disease affecting the larval and pupal stages of honeybees (Apis mellifera L.) and other Apis species [20]. * Corresponding author: A.M. Alippi Unidad de Bacteriología, Centro de Investigaciones de Fitopatología Facultad de Ciencias Agrarias y Forestales Universidad Nacional de La Plata Calles 60 y 119 s/n La Plata 1900, Argentina Tel. +54-2214236758. Fax +54 2214252346 E-mail: alippi@biol.unlp.edu.ar; adrianaalippi@gmail.com

The causative agent is Paenibacillus larvae, a gram-positive and spore-forming bacterium first described in the early 20th century. AFB occurs in temperate or sub-tropical regions throughout the world, and leads to huge losses not only in apiculture but also in plant pollination rates. Due to its highly contagious nature and virulence, AFB is an animal notifiable disease in many countries, and is listed by the World Organization for Animal Health (Office International des Épizooties, OIE) [39]. AFB-affected honeycombs show a patchy brood pattern, with dark and sunken cell cappings that have a greasy appearance and irregular holes; when these cappings are removed,


50

Int. Microbiol. Vol. 17, 2014

dead larvae can be drawn out into a dark ropy material. One month later, this resultant mass dries out to form a hard scale that is deposited on the lower sides of the comb cells. A single AFB scale can contain billions of spores that spread the disease between colonies through drifting bees, hive parts, and contaminated pollen or honey [20]. As viable P. larvae spores remain in combs and woodenware for decades, in most countries AFB-infected colonies are destroyed by burning [32]. In many North and South American honey-producing countries, the antibiotic oxytetracycline has long been used by beekeepers to prevent and control AFB in honeybee colonies, as an alternative to burning infected beehives in areas where disease incidence is high [44]. Tetracyclines are a group of broad-spectrum bacteriostatic drugs that inhibit protein synthesis by preventing the binding of aminoacyl-tRNA to the mRNA ribosome complex. Three known mechanisms underlying tetracycline resistance have been described, involving: (i) energy-dependent efflux proteins, (ii) ribosomal protection proteins, and (iii) enzymatic inactivation [45,46]. Resistance to tetracycline is mainly due to the acquisition of new genes, many of which are contained within mobile plasmids or transposons [22]. Currently, 40 different tetracycline resistance (tet) and three different oxytetracycline resistance (otr) genes have been described in bacteria [46]. In gram-positive bacteria of the genus Bacillus and its relatives, only four tet genes, tet(K), tet(L), tet(M), and tet(W) [45], and one otr gene, otr(A) [29] have been reported. Horizontal gene transfer (HGT) between bacterial cells is an integral means of genetic variability and evolution in bacteria [22,23]. It typically occurs in a mixed population where antibiotic-resistant bacterial cells are in contact with antibioticsusceptible bacteria. Natural ecosystems and the gut microbiota are privileged places for HGT. The gut microbiota of adult honeybees has indeed a large propensity for harboring a diverse set of tet genes [51]. In addition, the conjugable mobilization of the tet(L)-encoding plasmid pMV158 in Strepto­ coccus pneumoniae, Lactococcus lactis subsp. lactis, and Escherichia coli has been reported [16,43,53]. In the last decade, tetracycline-resistant (TcR) and oxytetracycline-resistant (OtcR) P. larvae isolates have been detected in the USA, Canada, and Argentina [1,34,35]. In North America, highly tetracycline-resistant P. larvae phenotypes have been correlated with the presence of native plasmids carrying tetracycline-resistance determinants [1,34,35], while in South America inducible resistant strains and intermediate P. lar­ vae phenotypes have been found [1]. Consequently, there is now general concern regarding both widespread tetracycline resistance in P. larvae, either by HGT via mobilizable and/or

alippi et al.

conjugative plasmids or by induced bacterial resistance via the presence of sub-inhibitory concentrations of tetracycline. In a previous work, we have shown that tetracycline resistance in P. larvae correlates with the presence of plasmids encoding tetracycline resistance and that resistance is transferable across bacterial species, as demonstrated in conjugation experiments using P. larvae TcR strains as donor and tetracycline-susceptible (TcS) strains of Bacillus subtilis as acceptors. The B. subtilis transconjugants were tetracycline-resistant but following heat treatment recovered their original susceptible phenotype [1]. In the present work, we followed up on those previous experiments by analyzing the complete nucleotide sequences of plasmids pPL373, pPL374, and pPL395, isolated from three different P. larvae strains having tetracycline resistance. We provide evidence for the existence of a tet(L) gene on those plasmids and infer the phylogenetic relationship of the P. lar­vae plasmids with other tet(L)-encoding plasmids. In further experiments, we transformed the P. larvae NRRL B-14154 TcS strain into TcR strains and then were able to cure both the electrotransformant and the donors. Finally, we analyzed the discrepancies between the origin of transfer site (oriT) and the mobilization (mob) genes and the previously characterized plasmid pMA67 from P. larvae.

Materials and methods Bacterial strains and growth conditions. Three P. larvae TcR strains were isolated from commercial honey samples from the USA: PL373 and PL374, from Boston, collected in 2001 as previously reported [1], and PL395, from Miami, collected in 2008. Minimal inhibitory concentrations (MICs) of tetracycline for PL373, PL374, and PL395 were 128 µg/ml, 128 µg/ ml, and 32 µg/ml, respectively, when tested in MYPGP agar and 64 µg/ml, 64 µg/ml, and 32 µg/ml, respectively, when tested in Oxoid Iso-Sensi-test agar. The P. larvae TcS strain NRRL B-14154 was used as acceptor in all transformation experiments. Each strain was stored at –80 °C in MYPGP broth in 20 % glycerol (v/v) [8]. These frozen stocks were the sources of the P. larvae strains for all experiments in this study. All strains were grown routinely on MYPGP agar, MYPGP broth, Oxoid Iso-Sensi-test agar, or Oxoid Iso-Sensi-test broth, according to the experiment performed, and incubated at 37 °C. Plasmid preparations and restriction enzymes digestion. Plasmid DNA was extracted from P. larvae strains PL373, PL374, and PL395 using the Qiaprep spin miniprep kit (Qiagen) with the addition of LyseBlue (Qiagen), following the manufacturer’s instructions. The plasmid preparations were named pPL373, pPL374, and pPL395 according to the strain obtained and were stored at 4 °C until needed. Plasmids were subjected to restriction digestion with EcoRI, BgIII, and NcoI (Promega) by using 3 µl of plasmid DNA, 10 U of the corresponding restriction enzyme, and the appropriate reaction buffer in a final volume of 15 µl and following the manufacturer’s protocols. Restriction fragments were separated for size approximations by agarose gel electrophoresis.


Plasmids of P. larvae

Int. Microbiol. Vol. 17, 2014

PCR conditions and primers. The presence of the tetracycline resistance genes tet(K), tet(L) and their combination, tet(KL), was assessed with PCR using the gene-specific primers reported by Ng et al. [38], You et al. [52], and Murray and Aronstein [34] for tet(L); those described by Ng et al. [38] and You et al. [52] for tet(K); and those of Pang et al. [40] for tet(KL) (Table 1). The total volume of each PCR was 20 µl; 10 ng of plasmid DNA was used as template. PCR products were resolved in 1.6 % agarose gels in 0.5× TBE buffer and observed under UV light after staining with Gelred (Biotium). In addition, DNA fingerprinting was carried out using repetitive sequence PCR (repPCR) and the BOXA-1 and ERIC primers (Table 1), as described elsewhere [54]. Total genomic DNA served as the template. The PCR products were resolved in 1.6 % and 0.8 % agarose gels for BOXA-1 and ERIC, respectively, in 0.5× TBE buffer, and observed under UV light after staining with Gelred (Biotium). DNA sequence determination and bioinformatics. Plasmid templates of pPL395, pPL373, and pPL374 were sequenced bidirectionally at CD Genomics (Shirley, NY, USA) through its primer walking sequencing service and using the ABI 3730 XL platform together with Sanger dideoxy sequencing. Homology searches were performed with BLAST. Multiple sequences were aligned with Clustal W or CLC Sequence Viewer, version 6.8.2. Physical maps of the plasmids were constructed with SnapGene version 2.3.5. Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 5 [50]. TMHMM was used to predict the presence of protein transmembrane helices [25]. To infer the phylogenetic relationship between the P. larvae plasmids and other plasmids carrying the tetracycline resistance gene tet(L), a maximum parsimony phylogeny based on the alignments of the amino acid sequences of the complete plasmids was inferred using MEGA software. For the parsimony analysis, heuristic searches for the most parsimonious trees were conducted using the branch swapping algorithm by tree-bisection-reconnection, treating gaps as missing data. Bootstrap

analysis was performed to verify robustness (1000 replications). The amino acid sequence of the pSTE2 plasmid containing the tet(K) gene from Staphylococcus lentus was used as the out-group. Nucleotide sequence accession numbers. The nucleotide sequences described herein were deposited in the GenBank database under the following accession numbers: KF433938 for pPL373, KF440690 for pPL395, and KF536616 for pPL374. Electroporation experiments. The three purified plasmids (pPL395, pPL373, and pPL374) were individually transferred by electroporation into P. larvae strain NRRL B-14154 (Syn = LMG 16250). This strain was selected as the recipient because it is highly susceptible to tetracycline (MIC = 0.016 µg/ml) and because of its characteristic red phenotype [8,20,21]. Electro­ competent P. larvae NRRL B-14154 cells were prepared as described by Murray and Aronstein [36] with minor modifications. Briefly, liquid MYPGP medium was inoculated with a 24-h culture of P. larvae strain NRRL B-14154 at 37 °C with shaking at 110 rpm overnight until an OD600 = 0.5 was obtained. Cells were harvested by centrifugation at 4000 ×g for 20 min at 4 °C and washed sequentially with one, one-half, and one-quarter volumes of cold 0.625 M sucrose. The final pellet was resuspended at a 1/500 dilution of the initial culture volume. Electrocompetent cells were stored in 40-µl aliquots at –80 °C until transformed with each plasmid preparation, obtained as explained above. A 40-µl aliquot of bacterial cells was mixed with 2 µl of each plasmid preparation at a concentration of 90 ng/µl in bidistilled water and incubated on ice for 15 min. The mixture was transferred to a chilled electroporation cuvette and pulsed at 2.8 kV using an EC 100 electroporator. After the addition of 1 ml of MYPGP broth, the bacterial cells were gently mixed, transferred to a screw-capped sterile tube, and incubated at 37 °C with shaking at 120 rpm overnight (18 h). The transformants were grown on tetracycline-containing MYPGP agar plates (8 µg/ml or 16 µg/ml) to select for suc-

Table 1. PCR primers used in this study Primer (pairs)

Target

51

Sequence (5´­­­→3´)

Amplicon size (bp)

Reference

TetL-F TetL-R

tet(L) gene

TCGTTAGCGTGCTGTCATTC GTATCCCACCAATGTAGCCG

269

[38]

TetK-F TetK-R

tet(K) gene

TCGATAGGAACAGCAGTA CAGCAGATCCTACTCCTT

169

[38]

TKI-F TL32-R

tet(K)/Tet(L) genes

CAAACTGGGTGAACACAG CCTGTTCCCTCTGATAAA

1048

[40]

TetK-F TetK-R

tet(K) gene

TTAGGTGAAGGGTTAGGTCC GCAAACTCATTCCAGAAGCA

718

[52]

TetL-F TetL-R

tet(L) gene

GTTGCGCGCTATATTCCAAA TTAAGCAAACTCATTCCAGC

788

[52]

PlarvTetL-F PlarvTetL-R

tet(L) gene (consensus)

GAACGTCTCATTACCTGA gagtagaagataggacca

596

[34]

BOXA-1R

Interspersed repetitive DNA sequences

CTACGGCAAGGCGACGCTGACG

Several amplicons

[54]

ERIC-1R ERIC-2

Interspersed repetitive DNA sequences

ATGTAA GCTCCTGGGGATTCAC AAGTAAGTGACTGGGGTGAGCG

Several amplicons

[54]


52

Int. Microbiol. Vol. 17, 2014

cessfully transformed colonies, determined by comparison with control MYPGP plates. The plates were incubated at 37 °C for 48 h and the number of colony-forming units (CFU) per plate was counted to calculate the transformation efficiency (TE; transformants/ng DNA) and the frequency of transformation (FT), expressed as a percent: FT = (CFU transformants/CFU total viable cells) × 100. DNA fingerprints generated by rep-PCR and the BOXA-1 primers [54] were used to confirm the identity of the transformants, by comparing their profiles with those produced by the acceptor strain P. larvae NRRL B-14154. Stability and curing of transformants. All TcR transformants obtained and the donor strains PL373, PL374, and PL395 were cultured and passaged ten times at 48-h intervals at 45 ºC in MYPGP agar. After the tenth passage, sub-cultures were transferred to 5 ml of MYPGP broth supplemented with 0.02 µg acridine orange/ml and incubated at 45 ºC for 48 h. Individual colonies were selected, sub-cultured, and tested for tetracycline resistance by determining their MIC and for the presence of tet genes by PCR, as previously described. The stability of the TcR transformants was determined by successive sub-culturing in MYPGP agar without tetracycline, passsing the cells 20 times at 48-h intervals and incubating them at 37 ºC. After the 20th passage, their MIC values were measured and compared with those of the original stocks kept at –80 °C in MYPGP broth in 20 % glycerol (v/v).

Results and Discussion Plasmids from P. larvae wild-type strains were successfully extracted and purified, yielding concentrations between 80 ng/µl and 120 ng/µl. Digestions with restriction enzymes suggested that PL395 contained one plasmid molecule of about 5000 bp and that PL373 and PL374 contained two plasmid molecules with sizes of about 5000 bp and 7000 bp, respectively. The three approximately 5000-bp plasmids were linearized by BgIII and NcoI, whereas two fragments of about 800 and̃ 4200 bp were obtained with EcoRI. The 7000-bp plasmid contained in PL373 and PL374 was linearized by EcoRI, BgIII, and NcoI. Complete DNA sequences were then obtained from the three ca. 5000-bp plasmids, referred to as pPL373, from P. larvae strain PL373; pPL374, from P. larvae strain PL374; and pPL395, from P. larvae strain PL395. BLAST analysis revealed that the nucleotide sequences of these three plasmids were virtually identical (99 %) to those of the tet-encoding plasmids pMA67 (GenBank, DQ367664.1), pBHS24 (GenBank HM235948), pBSDMV46A (GenBank, JN980138), pDMV2 (GenBank, JN980137), and pSU1 (GenBank, NC_014015). pMA67 was also isolated from an oxytetracycline-resistant strain of Paenibacillus larvae (Bacillales, Bacillaceae) from the USA [34,35]; pBHS24 was isolated from a Bacillus sp. (strain 24) (Bacillales, Bacillaceae), a bacterium associated with the marine sponge Haliclona simulans, in Ireland [42]. Plasmids pSU1, pDMV2, and pBSDMV46A were isolated from soils containing chicken-waste beneath a broiler-chicken

alippi et al.

farm in the USA [52], i.e., pSU1, from the gram-positive spore-former Sporosarcina ureae (Bacillales, Planococca­ ceae), pDMV2 from the gram-positive spore-former Bacillus galactosidilitycus (Bacillales, Bacillaceae), and pBSDMV46A from the gram-positive non-spore-forming Barghavaea cecembensis (Bacillales, Planococcaceae). Our three plasmids also had high similarity with plasmid pLS55 (EF605268.1), isolated from the gram-positive anaerobe Lactobacillus sakei (Lactobacillales, Lactobacillaceae) from an Italian Sola cheese [3], and with pAST4 (KC734563), from the uncultured bacterium AST4. All of these plasmids contain a tet(L) tetracycline resistance gene. Complete sequence analysis of P. larvae plasmids showed that pPL374 had a size of 5026 bp, with 36.77 % G+C, while both pPL373 and pPL395 were 5030 bp with 36.76 % G+C. In addition, 14 open reading frames (ORFs) were identified in the three plasmids, based on a minimum length of 45 amino acids and an ATG start codon (Fig. 1). Functions were attributed to the deduced products of the ORFs by comparing them to the gene products available in the databases. Sequence analysis of plasmids pPL373, pPL374, and pPL395 predicted genes and genetic elements involved in the rolling circle mechanism of replication (RCR) [4,24], i.e., a double strand origin of replication (dso), a copy control gene (cop), an antisense RNA (RNA II), an initiator gene (rep), a single-strand origin of replication (sso), a mobilization function (mob), and an origin of transfer (oriT) (Fig. 1). Besides those ORFs involved in replication and mobilization, another functional sequence present on the three plasmids was that of the tetracycline-resistance gene tet(L). Plasmid pPL374 and pPL395 had 99.9 % similarity, while pPL373 had 99.82 % similarity with pPL395 and 99.72 % similarity with pPL374. The previously reported P. larvae pMA67 plasmid had high similarity with pPL395 (99.96 %), pPL374 (99.86 %), and pPL373 (99.78 %). Both pDMV2 and pSU1 had 99.88 % similarity with pPL374, 99.8 % similarity with pPL373, and 99.98 % similarity with pPL395. Sequences of pPL373, pPL374, pPL395, and pMA67 differed from those of plasmids pBHS24, pBSDMV46A, pSU1, and pDMV2 at position 726 (gene rep), where P. larvae plasmids contained a T instead of a G. Minor differences were found in pPL374 at ten nucleotides (positions 3012, 3378, 3387, 3401, 3463, 3465, 3466, 3467, 3468, and 4369). By contrast, the nucleotide sequence of pPL373 differed only at positions 3060 and 3044. For each of the three plasmids, the dso was located between bases 22 and 161 and in each case it was identical to the dso of pMA67, pBHS24, pBSDMV46, pDMV2 and pSU1.


Int. Microbiol. Vol. 17, 2014

53

Int Microbiol

Plasmids of P. larvae

Fig. 1. Circular map of plasmid pPL374. Open reading frames are drawn as inner arrows showing the direction of transcription (minimum length 45 amino acids; ATG start codon). Elements are assigned based on sequence homology with known elements from other plasmids, i.e., dso: double strand origin of replication; cop: transcriptional repressor; RNA II: antisense RNA (counter-transcribed RNA, ctRNA); rep: an initiator gene for plasmid replication; tetL: tetracycline resistance gene; ssoT: single strand origin of replication; mob: mobilization function; and oriT: origin of transfer.

The same was true for the transcriptional repressor cop, located between bases 256 and 426. The dsos of RCR plasmids contain a Rep protein binding site and a nick site that are normally well conserved [14,24,27,28]. According to the Pfam database, the three plasmids belonged to the Rep_2 family of RCR-plasmids. The best matches in the NCBI databases between the predicted Rep proteins of pPL373 (GenBank, AGX86137), pPL374 (GenBank, AGX24958), and pPL395 (GenBank, AGX24952) were the Rep proteins from other P. larvae tetracycline-resistant plasmids and those reported for the replication initiator proteins of pBHS24, pBSDMV46A, pDMV2, pSU1, pAST4, and pLS55. In addition, an antisense RNA (RNA II) was produced by pPL373, pPL374 (Fig. 1) and pPL395, as in pMA67 [35] and in pMV158 from Streptococcus agalactiae and pLS1, a deleted derivative of pMV158 from Streptococcus pneumoniae [9,14,26].

Matches (100 %) to the sequences of Cop proteins from pPL373 (GenBank, AGX24947), pPL374 (GenBank, AGX24955), and pPL395 (GenBank, AGX24951) were protein sequences from pMA67 (Paenibacillus larvae), pBHS24 (Bacillus spp.), pBSDMV46A (Barghavaea cecembensis), pDMV2 (Bacillus galactosi足 dilitycus), pSU1 (Sporosarcina ureae), pAST4 (uncultured bacterium), and other Cop transcriptional repressors from different species within Bacillales. Sequence analyses suggested the presence of the same oriT and mob genes as found in the pMV158-superfamily of plasmids [17], which replicate by the RCR mechanism of the Rep_2 family. As shown in Fig. 2, the putative oriT was identical in pPL373, pPL374, and pPL395 (34 bp) but differed from that of the other plasmids analyzed here (pMA67, DMV9, pBSDMV46A, pNM5, pDMV2, pBHS24, pSU1, pLS55, and pAST4), having the base A at position 9 (35 bp). According to the classifi-


Int. Microbiol. Vol. 17, 2014

alippi et al.

Int Microbiol

54

group ssoT based on structural and sequence similarities (Fig. 3). Although there is usually a good correlation between sso type and plasmid host range, each particular sso is active only in

Int Microbiol

cation of the origin of replication of RCR plasmids proposed by Andrup et al. [4], which specified five different types, ssoA, ssoL, ssoT, ssoU, and ssoW, our three plasmids belong to

Fig. 2. Sequence alignment of the oriT from pPL373, pPL374, and pPL395 of P. larvae and from pMA67 (P. larvae), pBSDMV9 (Barghavaea cecembensis), pBSDツュ MV46A (B. ceツュcemツュbensis), pNM5 (uncultured bacterium), pDMV2 (Bacillus galactosidilitycus), pBHS24 (Bacillus sp.), pSU1 (Sporosarcina ureae), pAST4 (uncultured bacterium), and pLS55 (Lactobacillus sakei), compared to oriTpMV158. The shadowed sequences indicate nucleotide differences; the nicking site (G/T) is underlined.

Fig. 3. Alignment of the single strand origin of replication (sso) sequences of pPL373, pPL374, and pPL395 with the ssoT-type sequences from pMA67 (Paenibacllus larvae), pBSDMV46A (Barghavaea cecembensis), pDMV2 (Bacillus galactosidilitycus), pBHS24 (Bacillus sp.), pSU1 (Sporosarcina ureae), pAST4 (uncultured bacterium), pLS55 (Lactobacillus sakei), pBAA1 (Bacillus spp.), and pTX14-3 (Bacillus thuringiensis serovar israelensis). The positions of the three conserved nucleotide motifs (I窶的II), based on the analysis of Andrup et al. [4], are shadowed.


Int. Microbiol. Vol. 17, 2014

Int Microbiol

Plasmids of P. larvae

Fig. 4. Putative Mob proteins from pPL395, pPL373, pPL374, pBHS24, and pMA67. The three conserved motifs (I窶的II) of the MOBV family are underlined. Invariable amino acids are shown in white on black, and strongly conserved amino acids in black on light gray. The differences with plasmid pMA67 are marked in white on gray. Mob proteins from pAST4, pBSDMV46A, pSU1, and pLS55 are not schematized because they are identical to those of pBHS24. The MobM protein of pMV158 is included for comparison.

55


Int. Microbiol. Vol. 17, 2014

alippi et al.

Int Microbiol

56

Fig. 5. Phylogenetic tree of plasmid-borne tet(L) genes. Nucleotide sequences were aligned using the CLS sequence viewer and the tree was constructed with the MEGA 5 package using the maximum parsimony method. Bootstrap support values (as a percentage of 1000 replications) are indicated at the nodes. The amino acid sequence of the Staphylococcus lentus pSTE2-borne tetK gene form was used as the out-group.

closely related bacteria. Thus, the ssoT type is found in native Bacillus plasmids and was first reported in pBAA1 [11]. Nevertheless, while ssoA-type origins are reportedly hostspecific, ssoT- and ssoU-type origins support replication in a number of different gram-positive bacteria [10,31], including Staphylococcus aureus [47] and, as more recently reported, Barghavaea cecembensis and Sporosarcina ureae [52]. Unlike pMV158, which carries the ssoA-type and a second sso (ssoU-type), both our plasmids from Paenibacillus larvae and pPM67 [35] have the same ssoT-type (Fig. 3). The mob genes of pPL395, pPL373, and pPL374 are located at 3500â&#x20AC;&#x201C;4819 bp. The nucleotide sequences of the respective

genes are identical and they are also identical to the mob genes of pAST4, pBHS24, pSU1, pLS55, and pBSDMV46A. However, the mob gene of pMA67 differs by two nucleotides from the corresponding genes of pPL373, pPL374, and pPL395: at position 4777, where pMA67 lacks a base, and at position 4779, where pMA67 has a G instead of an A. Blast searches indicated that the predicted Mob proteins of pPL373, pPL374, and pPL395 were more closely related to the Mob proteins from pAST4, pBHS24, pSU1, pLS55, and pBSDMV46A (100 % identities) than to those from pMA67 (95 % identity). The alignment of Mob proteins from pPL395 (GenBank, AGX24954), pPL373 (GenBank, AGX24949), pPL374 (Gen-


Int. Microbiol. Vol. 17, 2014

57

Int Microbiol

Plasmids of P. larvae

Fig. 6. Predicted transmembrane protein topology for the TetL protein encoded by pPL374 (AGX24956). For this protein, 12 transmembrane helices are predicted. Transmembrane helices (red lines), inside (blue lines) and outside (purple lines) are displayed.

Bank, AGX24957), pBHS24 (GenBank, YP00­69­60887), and pMA67 (GenBank, YP001966010) is shown in Fig. 4. Only the Mob protein from pBHS24 was schematized because the Mob proteins from pAST4, pBSDMV46A, pSU1, and pLS55 were identical both to one another and to the Mob proteins of pPL395, pPL373, and pPL374. Because of the two sequence differences, the Mob protein of pMA67 generates a relaxase that differs at the N terminal from the respective proteins generated by pPL395, pPL373, pPL374, pAST4, pBHS24, pSU1, pLS55, and pBSDMV46A. These differences in the origin of transfer and mobilization genes between pPL373, pPL374, pPL395, and pMA67 indicate different mobilization and/or conjugation capacities. Further studies are needed to corroborate this hypothesis. According to the identification scheme for plasmid mobilization regions proposed by Francia et al. [17,18,19,23], pPL373, pPL374, and pPL395 must be placed in the MOBv1 subfamily, within the pMV158 MOBv family. The tet(L) gene sequences from pPL373, pPL374, and pPL395, located between 1603 and 2985, and those from pMA67, pDMV2, and PSU1 are identical. Small differences were found in the tet(L) gene of plasmid pBHS24 (three nucleotide differences, at positions 1757; 2432; and 2509, where pBHS24 contain G, A, and A instead of A, C, and G, respectively) and the tet(L) gene of plasmid pBSDMV46A (one nucleotide difference, T instead C, at position 1581). Compared with plasmid pLS55, P. larvae plasmids pPL373, pPL374, and pPL395 exhibit four differences in the tet(L) gene, at positions 1603, 1889, 2461, and 2799, respectively.

As shown in Fig. 5, a phylogenetic analysis performed on the tet(L) plasmid-borne genes available in the GenBank database (n = 26) showed that the predicted tet(L) proteins from pPL373 (GenBank, AGX24950), pPL374 (GenBank, AGX­ 24956), and pPL395 (GenBank, AGX24953) form a separate cluster that also includes pBSDMV46A, pAST4, pLS55, PSU1, pDMV2, pDMV44, pMA67, pBHS24, and pBSDMV9, reflecting a relatively ancient divergence of this tet(L) gene, as reported by You et al. [52]. Sequences of tet(L) genes obtained from other P. larvae and B. cecembensis strains were also included in the same cluster. Furthermore, the TetL proteins of pPL374 (GenBank, AGX24956), pPL373 (GenBank, AGX24950), and pPL395 (GenBank, AGX24953), based on analysis using TMHMN, were predicted to contain 12 transmembrane α-helices (Fig. 6), similar to family 3 of the drug efflux systems from the major facilitator superfamily (MFS) of transport proteins [41]. On pPL373, pPL374, and pPL395, a 20-amino-acid putative leader peptide was identified upstream of tet(L). It is identical to leader peptides identified on pBSDMV9, pNM5, pBSDMV46A, pDMV2, pLS55, and pSU1 [52]. A phylogenetic analysis performed on all complete sequences of plasmids containing the tet(L) gene and available in the GenBank database (n = 16) showed a similar structure (Fig. 7) when compared with a phylogram of plasmid-borne tet(L) genes (Fig. 5), suggesting that the whole plasmids, and not only their tet genes, were mobilized between hosts. Indeed, as reported previously [49], intra-class transfers between ba-


Int. Microbiol. Vol. 17, 2014

alippi et al.

Int Microbiol

58

Fig. 7. Phylogenetic tree of the complete sequences of plasmids encoding the tetracycline resistance gene tetL. Nucleotide sequences were aligned using the CLS sequence viewer program. The tree was constructed with the MEGA 5 package using the maximum parsimony method with treebisection-reconnection as the heuristic search for the best tree topology. Bootstrap support values (1000 replicates) are indicated at the nodes as percentage. The amino acid sequence of pSTE2, containing the tetK gene from Staphylococcus lentus, was used as the out-group.

cilli and lactobacilli are more abundant than expected based on random assignment of the transfer events between plasmids, particularly with respect to antibiotic resistance. Lactobacillus, Bacillus, and Paenibacillus species are commonly found in the gut contents of honeybees (both adults and larvae) and are therefore transferred to honey [48]. Nearly identical plasmids have been found in different genera of gram-positive bacteria belonging to Lactobacillales and Bacillales, within the class Bacilli, i.e., Lactobacillus, Bhar­ga­vaea, Bacillus, Paenibacillus, and Sporosarcina. As these plasmids were isolated from bacterial strains belonging to different ecological niches, our findings reaffirm the genetic transfer of these tet-encoding mobilizable plasmids among environmental bacteria from soils, food, and marine habitats and pathogenic bacteria such as Paenibacillus larvae. The presence of the resistance genes tet(K), tet(L), and tet(KL) was also evaluated by PCR using plasmid DNA, with different results obtained according to the set of primers used (Table 1). Plasmids pPL373, pPL374 and pPL395 had the expected 788-bp amplicon when tested with the specific tet(L)

primers designed by You et al. [52] and yielded the expected 596-bp amplicon when tested with the consensus primers designed by Murray and Aronstein [34]. For the combination of primers TKI-F and TL32-R in the amplification of the tet(K)/ tet(L) genes [40], all the plasmids were positive for the expected amplicon of 1048 bp. Nevertheless, the results were inconsistent when the tet(L) primers designed by Ng et al. [38] were used, with positive results obtained with pPL395 and variable results with pPL373 and pPL374. Furthermore, the expected amplicon of 169 bp, corresponding to the tet(K) gene, as stated by Ng et al. [38], was detected for pPL373 and pPL374 but not for pPL395. Surprisingly, no amplification products were generated with any of the plasmid DNAs in tests of the tet(K)-specific primers designed by You et al. [52]. These inconsistencies regarding the primers designed by Ng et al. [38] could have been due to the high similarity between the tet(K) and tet(L) sequences selected to design primers for tet(L)- and tet(K)-specific PCRs. As these genes have 60â&#x20AC;&#x201C;63 % DNA sequence identity with each other [7], false-positive tet(K) and/or tet(L) amplicons can be detected by PCR, which


Plasmids of P. larvae

covers small regions of the gene. Indeed, strains PL373 and PL374 did not contain the tet(K) gene, as reported previously [1], but did contain the tet(L) gene, as confirmed by complete plasmid sequencing and an analysis of the tet genes of plasmids pPL373, pPL374, and pPL395, located between 1603 and 2985. Using complete plasmid sequences, our Blast search through the ARDB-antibiotic resistant gene database showed that pPL373, pPL374, and pPL395, as well as pBSDMV46A, pSU1, and pDMV2 matched 88.51 % with respect to tet(L) and 83.24 % with respect to tet(K), while plasmids pMA67 and pBHS24 matched 87.54 % with respect to tet(L) and only 62.02 % with respect to tet(K). In an analysis of the sequence of the tet(K)-containing plasmid pSTE2 from S. aureus, the matches were 99.99 % for tet(K) and 85.27 % for tet(L). The results from electroporation experiments showed that pPL373, pPL374, and pPL395 were able to transform P. lar­ vae strain NRRL B-14154 at an efficiency of 3.48 × 105 transformants/µg DNA (FT = 0.083 %), 6.56 ×105 transformants/ µg DNA (FT = 1.25 %), and 4.66 ×105 transformants/µg DNA (FT = 0.33 %), respectively. These transformation efficiencies are similar to those obtained by Murray and Aronstein [36] using P. larvae strain B-2605 and pDM60, a shuttle vector constructed from pMA67. To confirm that plasmid transfer had occurred and to analyze the effect of this transfer on the phenotype, we examined the plasmids and Tc resistance profiles of the transformants. Thirteen transformants for which MIC values ranging between 16 µg/ml and 64 µg/ml were selected for further study. Eight transformants (A, B, C, D, E, F, G, and I) were obtained by electroporation with pPL374; transformant 1 was obtained by electroporation with pPL373, and transformants 2,3,4, and 5 by electroporation with pPL395. All 13 transformants were stable, as demonstrated after 20 passages in MYPGP medium without tetracycline. After the 20th passage, the MIC values were the same as those of the original stocks kept at –80 °C. The presence of the tetracycline resistance gene tet(L) was confirmed, by both colony-PCR and PCR using plasmid DNA, in transformants 2–5 (containing pPL395), transformants A–G and I (containing pPL374), and transformant 1 (containing pPL373). The recipient strain P. larvae NRRL B-14154 did not contain any of the amplicons corresponding to either the tet(L) or the tet(K) resistance gene. In addition, as seen in Eckhardt preparations [13], all P. larvae transformants (n = 12) were positive for a plasmid band of approximately 5000 bp (data not shown). Plasmids pPL373, pPL374, and pPL395 were transferred and stably maintained in P. larvae NRRL B-14154, in which they autonomously replicated. All the transformants and the

Int. Microbiol. Vol. 17, 2014

59

P. larvae donor strains were cured after ten successive passages during which they underwent heat and acridine orange treatment. All cured strains lost their tetracycline resistance. DNA fingerprints generated by rep-PCR using the BOXA-1R and ERIC primers (Table 1) confirmed the identity of both the transformants and their corresponding cured strains compared with the recipient strain P. larvae NRRL B-14154. As expected, the profiles were the same (E for primers BOX and ERIC IV for primers ERIC). In addition, rep-PCR results for the donor strains showed that the genotypes of PL373, PL374, and PL395 were the same (ERIC I and BOX D). In previous experiments, we achieved the transfer of pPL374 and of pPL373 into Bacillus subtilis Tcs strains by conjugation in liquid medium [1]. Indeed, when strains PL373 and PL374 were examined for the presence of indigenous plasmids using the lysis in situ procedure, as described by Eckhardt [13], we detected two plasmid bands with estimated sizes of ca. 4000 pb and ca. 8000 pb, respectively [1], but only the smaller one contained the tetracycline resistance gene. After complete sequencing of the smaller plasmids from both transformants, their sizes were determined to be 5026 bp for pPL374, and 5030 bp for pPL373. Thus, we hypothesized that the larger accompanying plasmids (ca. 8000 bp as determined by the Eckhardt method and ca. 7000 bp as estimated by electrophoretic mobilities) present in strains PL373 and PL374 facilitate conjugation of the small mobilizable plasmids that replicate by the RCR mechanism. However, all conjugation experiments conducted with strain PL395 were unsuccessful. Note that when strain PL395 was examined by the Eckhardt method, only the presence of one plasmid band, of approximately 5000 bp, was observed (data not shown). EcoRI digestion generated two fragments of ca. 800 and ca. 4200 bp, as estimated by their electrophoretic mobilities. The presence of larger plasmids (ca. 9000, ca. 9400, and ca. 11,500 bp) in P. larvae strains from European countries have been reported by other authors [5,6] and, along with pMA67, plasmids of about 7000 bp, 10,000 bp, and >10,000 kb have been detected in P. larvae strains from the USA [34], but none of them was further characterized. Recently, two almost identical plasmids of 9700 bp, derived from P. larvae strains DSM 25719 and DSM 25430 and referred to as pPLA1_10 (ADFW01000008.1) and pPLA2_10 (CP003356.1), respectively, have been described and shown to contain a replication initiation factor [12]. These larger plasmids, including those found in strains PL373 and PL374, could have conjugation functions. Their further study may provide insights into the mechanisms of plasmid transmission in P. larvae.


60

Int. Microbiol. Vol. 17, 2014

While mobilizable plasmids encode only a minimal MOB machinery that allows transport by other plasmids, conjugative or self-transmissible plasmids encode a complete set of transfer genes. The only essential ingredient of the MOB machinery is the relaxase, which initiates and terminates conjugative DNA processing [18]. In summary, our study showed that the tetracycline resistance of P. larvae strains PL373, PL374, and PL395 correlated with the presence of a 5000-bp mobilizable plasmid that replicated by the RCR mechanism. This trait was found to be transferable across bacterial strains by electrotransformation. The tet(L) gene carried by pPL395, ppL373, and pPL374 was alone sufficient to confer tetracycline resistance on the susceptible strain P. larvae NRRL B-14154, in which the plasmids autonomously replicated and were stably maintained. Cure was achieved only after successive passages under conditions of heat and acridine orange treatment. Antibiotic resistance is complex and is linked to the ability of bacteria to rapidly adapt to their environment. Initially, the development of resistant strains was considered to be a local and undesirable side effect of antibiotic therapy, but it is now clear that it reflects a profound change in our environment [2]. Indeed, antibiotics, resistant bacteria, and resistance determinants existed before the discovery and use of antibiotics by humans. Resistance to antimicrobial agents is a trait that allows bacteria to proliferate and survive in their environment. The composition and the balance of any mixed bacterial population in an ecosystem can be changed by the presence of an antibiotic, as demonstrated by Tian et al. [51] in the gut microbiota of honeybees with prolonged exposure to oxytetracycline. In addition to strains with innate resistance, susceptible species may acquire resistance by various mechanisms involving cross-resistance. The very similar sequences included in plasmids isolated from different genera of gram-positive bacteria from geographically distinct locations suggest that the mob genes of these plasmids are involved in effective HGT. Given that toxin-producing Bacillus strains have been found in honey samples [29,30], the risk that tetracyclineresistance genes will be introduced into human pathogenic bacteria through honey-bee pathogens cannot be ruled out. The extensive use of tetracycline and oxytetracycline to control AFB in some North and South American countries has contributed to an increase of TcR in P. larvae, by enhancing the interspecific transfer of small TetL-encoding plasmids between P. larvae strains and by the intergeneric transfer of tet(L) genes from other gram-positive bacteria, such as Barghavaea, Sporosarcina, Lactobacillus, and the ubiquitous species of Bacillus.

alippi et al.

Acknowledgements. This study was supported by grants from the Comisión de Investigaciones Científicas de la Provincia de Buenos Aires, Argentina (CIC), the Agencia Nacional de Promoción Científica y Tecno­ lógica, Argentina (ANPCyT) and the Consejo Nacional de Investigaciones Científicas y Técnicas, Argentina (CONICET). AMA and ACL are members of the Scientific Research Career of CIC and CONICET, respectively. IEL was the recipient of a scholarship from the CIC. Competing interests. None declared.

References 1. Alippi AM, López AC, Reynaldi FJ, Grasso DH, Aguilar, OM (2007) Evidence for plasmid-mediated tetracycline resistance in Paenibacillus larvae, the causal agent of a American Foulbrood (AFB) disease in honeybees. Vet Microbiol 125:290-303 2. Aminov RI (2011) Horizontal gene exchange in environmental micro­ biota. Front Microbiol 2:158 doi:10.3389/fmicb.2011.00158 3. Ammor M S, Gueimonde M, Danielsen M, Zagorec M, van Hoeck AHAM, de los Reyes-Gavilán CG, Margolles A (2008) Two different tetracycline resistance mechanisms, plasmid-carried tet(L) and chromosomally located transposon-associated tet(M), coexist in Lactobacillus sakei Rits 9. Appl Environ Microbiol 74:1394-1401 4. Andrup L, Jenseb GB, Wilcks A, Smidt L, Hoflack L, Mahillon J (2003) The patchwork nature of rolling-circle plasmids: comparison of six plasmids from distinct Bacillus thuringiensis serotypes. Plasmid 49:205-232 5. Benada O, Drobnikova V, Kalachova L, Ludvik J (1988) Plasmid DNA in Bacillus larvae. J Apic Res 27:35-39 6. Bodorova-Urgosikova J, Benada O, Tichy P (1992) Large-scale isolation and partial characterization of plasmid DNA form B. larvae. Folia Microbiol 37:82-86 7. Chopra I, Roberts MC (2001) Tetracycline antibiotics: mode of action, applications, molecular biology and epidemiology of bacterial resistance. Microbiol Mol Biol Rev 65:232-260 8. de Graaf DC, Alippi AM, Antúnez K, et al. (2013) Review Article: Standard methods for American foulbrood research. J Apicult Res 52(1), doi:10.3896/IBRA.1.52.1.11 9. del Solar G, Acebo P, Espinosa M (1995) Replication control of plasmid pLS1: efficient regulation of plasmid copy number is exerted by the combined action of two plasmid components, copG and RNA II. Mol Microbiol 18:913-924 10. del Solar G, Kramer MG, Ballester S, Espinosa M (1993) Replication of the promiscuous plasmid pLS1: a region encompassing the minus origin of replication is associated with stable plasmid inheritance. Mol Gen Genet 241:97-105 11. Devine KM, Hogan ST, Higgins DG, McConnell DJ (1989) Replication and segregational stability of Bacillus plasmid pBAA1. J Bacteriol 171:1166-1172 12. Djucik M , Brzuszkiewicz E, Fünfhaus A, Voss J, Gollnow K, Poppinga L, Liesegang H, Garcia-Gonzalez E, Genersch E, Rolf D (2014) How to kill the honey bee larva: Genomic potential and virulence mechanisms of Paenibacillus larvae. PLos One 9(3):e90914, doi:10.1371/journal.pone. 0090914 13. Eckhardt T (1978) A rapid method for identification of plasmid DNA in bacteria. Plasmid 1:584 14. Espinosa M (2013) Plasmids as models for studying macromolecular interactions: the pMV158 paradigm. Res Microbiol 164:199-204


Plasmids of P. larvae

16. Farías, ME, Espinosa M (2000) Conjugal transfer of plasmid pMV158: uncoupling of the pMV158 origin of transfer from the mobilization gene mobM, and modulation of pMV158 transfer in Escherichia coli mediated by IncP plasmids. Microbiology 146:2259-2265 17. Francia MV, Varsaki A, Garcillán-Barcia MP, Latorre A, Drainas C, de la Cruz FA (2004) Classification scheme for mobilization regions of bacterial plasmids. FEMS Microbiol Rev 28:79-100 18. Garcillán-Barcia MP, Francia MV, de la Cruz FA (2009) The diversity of conjugative relaxases and its application in plasmid classification. FEMS Microbiol Rev 33:657-687, doi:10.1111/j.1574-6976.2009.00168.x 19. Garcillán-Barcia MP, Alvarado A, de la Cruz F (2011) Identification of bacterial plasmids based on mobility and plasmid population biology. FEMS Microbiol Rev 35:936-956 20. Genersch E (2010) American Foulbrood in honeybees and its causative agent, Paenibacillus larvae. J Invertebr Pathol 103 Suppl 1:S10-S19 21. Genersch E, Forsgren E, Pentikäinen J, Ashiralieva A, Rauch S, Kilwinski J, Fries I (2006) Reclassification of Paenibacillus larvae subsp. pulvifaciens and Paenibacillus larvae subsp. larvae as Paenibacillus larvae without subspecies differentiation. Int J Syst Evol Microbiol 56:501-511, doi:10.1099/ijs.0.63928-0 22. Grohmann E, Muth G, Espinosa M (2003) Conjugative plasmid transfer in Gram-positive bacteria. Microbiol Mol Biol Rev 67:277-301 23. Guglielmini J, Quintais L, Garcillán-Barcia MP, de la Cruz F, Rocha EPC (2011) The repertoire of ICE in prokaryotes underscores the unity, diversity, and ubiquity of conjugation. PLoS Genet 7:e1002222 24. Khan SA (1997) Rolling-circle replication of bacterial plasmids. Micro­ biol Mol Biol Rev 61:442-455 25. Krogh A, Larsson B, von Heijne G, Sonnhammer EL (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305:567-580, doi:10.1006/ jmbi.2000.4315 26. Lacks SA, López P, Greenberg B, Espinosa M (1986) Identification and analysis of genes for tetracycline resistance and replication functions in the broad-host-range plasmid pLS1. J Mol Biol 192:753-765 27. López-Aguilar C, del Solar G (2013) Probing the sequence and structure of in vitro synthetized antisense and target RNAs from the replication control system of plasmid pMV158. Plasmid 70:94-103 28. López-Aguilar C, Ruiz-Masó JA, Rubio-Lepe TS, Sanz M, del Solar G (2013) Translation initiation of the replication initiator repB gene of promiscuous plasmid pMV158 is led by an extended non-SD sequence. Plasmid 70:69-77 29. López AC, De Ortúzar RVM, Alippi AM (2008) Tetracycline and oxytetracycline resistance determinants detected in Bacillus cereus strains isolated from honey samples. Rev Arg Microbiol 40:231-236 30. López AC, Minnaard J, Perez P, Alippi AM (2013) In vitro interaction between Bacillus megaterium strains and Caco-2 cells. Int Microbiol 16:27-33 31. Lorenzo-Díaz F, Espinosa M (2009) Lagging strand DNA replication origins are required for conjugal transfer of the promiscuous plasmid pMV158. J Bacteriol 191:720-727 32. Matheson A, Reid M (1992) Strategies for the prevention and control of American foulbrood. Parts I, II, and III. Amer Bee J 132:399-402; 133:471-475; 143:534-547 33. Miyagi T, Peng CYS, Chuang RY, Mussen EC, Spivak MS, Doi RH (2000) Verification of oxytetracicline-resistant American foulbrood pathogen Paenibacillus larvae in the United States. J Invert Pathol 75: 95-96 34. Murray D, Aronstein KA (2006) Oxytetracycline-resistance in the honey bee pathogen Paenibacillus larvae is encoded on novel plasmid pMA67. J Apicult Res 46:207-214 35. Murray KD, Aronstein KA, de Leon, JH (2007) Analysis of pMA67, a predicted rolling-circle replicating, mobilizable, tetracycline-resistance

Int. Microbiol. Vol. 17, 2014

61

plasmid from the honey bee pathogen, Paenibacillus larvae. Plasmid 58:89-100 36. Murray KD, Aronstein KA (2008) Transformation of the Gram-positive honey bee pathogen, Paenibacillus larvae by electroporation. J Microbiol Meth 75:325-328 37. Neuendorf S, Hedtke K, Tangen G, Genersch E (2004) Biochemical characterization of different genotypes of Paenibacillus larvae subsp. larvae, a honeybee bacterial pathogen. Microbiology 150:2381-2390, doi:10.1099/mic.0.27125-0 38. Ng L-K, Martin I, Alfa M, Mulvey M (2001) Multiplex PCR for the detection of tetracycline resistant genes. Mol Cell Probes 15:209-215 39. OIE (2012) Chapter 2.2.2. American foulbrood of honeybees, In: World Organization for Animal Health (OIE), Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (mammals, birds and bees), 7th ed. Vol 1, Paris, France, pp 365-374 40. Pang Y, Bosch T, Roberts MC (1994) Single polymerase chain reaction for the detection of tetracycline resistant determinants TetK and TetL. Mol Cell Probes 8:417-422 41. Pao SS, Paulsen IT, Saier MH (1998) Major facilitator superfamily. Microbiol Mol Biol Rev 62:1-34 42. Phelan RW, Clarke C, Morrissey JP, Dobson ADW, O’Gara F, Barbosa TM (2011) Tetracycline resistance-rncoding plasmid from Bacillus sp. strain #24, isolated from the marine sponge Haliclona simulans. Appl Environ Microbiol 77:327-329 43. Priebe S, Lacks S (1989) Region of the streptococcal plasmid pMV158 required for conjugative mobilization. J Bacteriol 171:4778-4784 44. Reybroeck W, Daeseleire E, De Brabander HF, Herman L (2012) Antimicrobials in beekeeping. Vet Microbiol 158:1-11 45. Roberts MC (2005) Update on acquired tetracycline resistance genes. FEMS Microbiol Letters 245:195-203 46. Roberts MC (2011) Environmental macrolide–lincosamide–streptogramin and tetracycline resistant bacteria. Front Microbiol 2:40, doi:10.3389/ fmicb.2011.00040 47. Seery L, Devine KM (1993) Analysis of features contributing to activity of the single-stranded origin of Bacillus plasmid pBAA1. J Bacteriol 175:1988-1994 48. Snowdon JA, Cliver DO (1996) Microorganisms in honey. Int J Food Microbiol 31:1-26 49. Tamminen M, Virta M, Fani R, Fondi M ( 2012) Large-scale analysis of plasmid relationships through gene-sharing networks. Mol Biol Evol 29:1225-1240, doi:10.1093/molbev/msr292 50. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731-2739 51. Tian B, Fadhil NH, Powell JE, Kwong WK, Moran NA (2012) Longterm exposure to antibiotics has caused accumulation of resistance determinants in the gut microbiota of honeybees. mBio 3(6):e00377-12, doi10.1128/mBio.00377-12 52. You Y, Hilpert M, Ward MJ (2012) Detection of a common and persistent tet(L)-carrying plasmid in chicken-waste-impacted farm soil. Appl Environ Microbiol 78:3203-3213 53. van der Lelie D, Wosten HAB, Bron S, Oskam L, Venema G (1990) Conjugal mobilization of streptococcal plasmid pMV158 between strains of Lactococcus lactis subsp. lactis. J Bacteriol 172:47-52 54. Versalovic J, Schneider M, de Bruijn FJ, Lupski JR (1994) Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Meth Cell Mol Biol 5:25-40


BOOK REVIEWS International Microbiology (2014) 17:63-64 ISSN 1139-6709, e-ISSN 1618-1095 www.im.microbios.org

Evolution from the Galapagos. Two centuries after Darwin

G. Trueba, C. Montúfar (eds.) 2013. Springer Science+Business Media NewYork 168 pp, 13.5 × 20.5 cm ISBN 978-1-4614-6731-1 ISBN 978-1-4614-6732-8 (eBook) Price: € 103.99

Few maritime voyages deserve the honored place in history as that of the young Charles Darwin (1809–1882), who set out on at the end of December 1831 aboard the HMS Beagle, under the command of Captain Robert FitzRoy (1805–1865), almost as young as Darwin. The trip greatly exceeded its expected duration, returning to England after five long years. However, our historical memory is apparently short and the momentousness of that journey may soon be forgotten, since a Google search of “Beagle” will first provide entries related to the dog breed (that, by the way, gave the name to the ship)! For any event with as many implications as those of Darwin’s journey, a consideration of its historical and social context is important, by placing it in a broader environment and thereby helping us to understand its reception—whether acceptance, rejection or indifference—and to assess its influence. As shown in the present book, Evolution from the Gala­ pagos. Two centuries after Darwin, contemporary ideas about the origin of life and its evolution had a great impact on Darwin as he later formulated his theory. The high intellectual level in 19th century English society, which included an intense interest in science, and recognition of the need to facilitate communication between experts, resulted in the creation of scientific societies. These were already well established in several European countries and in the USA. Their headquarters served as meeting places where members could comment on the latest scientific findings and discuss the advancement of knowledge in various fields. In Evolution from the Galapagos, the first chapter, Darwin-Wallace Paradigm Shift, by Ricardo Guerrero and Lynn Margulis (1938–2011), shares with the reader the efforts of Charles Lyell and Joseph Hooker to conduct a joint presen-

tation of the work of Darwin and Wallace at the Linnean Society of London in July of 1858. Lyell and Hooker were both eminent Fellows of the Linnean. The latter can be considered a pioneer in modern geology, and Hooker was one of the greatest botanists and explorers of his time. Their insistence that the two studies be jointly presented is remarkable, although it was not the first time that researchers working independently had arrived at similar conclusions. Nonetheless, in their report, the two senior scientists pointed out clearly that the work of Darwin preceded that of Wallace. Indeed, primacy has long been a contentious issue and is not only a feature of modern-day science. The chapter by Guerrero and Margulis (both of them Fellows of the Linnean) also describes in detail the vicissitudes that accompanied the presentation of the two documents before the Society in its meeting of July 1, 1858, and the lack of attention paid to what was subsequently recognized as a momentous event in the history of science. In fact, Thomas Bell, the Linnean’s president at the time, could not have made a bigger mistake as the one recorded in the minutes of that meeting. Bell did not appreciate the importance of Darwin and Wallace’s findings, and in the absence of the two authors (Darwin had remained at his home in Kent; Wallace was still in Indonesia) did not feel compelled to even mention their works in the annual report of the Society that he prepared for its members in May 1859. The ten days between the planning of the meeting of the Linnean and its embodiment were hectic ones for the organizers. Unlike the Russian Revolution, as reported by John Reed (1887–1920), these ten days did not shake the world, at least not immediately, but they would substantially produce a para-


64

Int. Microbiol. Vol. 17, 2014

digm shift, undoubtedly one of the most important in the history of science. The work of both Darwin and Wallace, besides transforming existing ideas about the origin and evolution of life, established the foundation for future research and discoveries in the field of biology but also in many other fields outside strictly scientific ones. In the second chapter, From Copernicus to Darwin (1473– 1882), Carlos Montúfar, one of the coeditors of the book, looks at the other major paradigm shift in our perception of the universe and our role in it as privileged beings. Prior to De Revolutionibus Orbium Coelestium (1543), the universe and the Earth were seen through a prism in which religious beliefs and ecclesiastical power played key roles. With its heliocentric model, Copernicus’ work was the beginning of a longlasting series of scientific breakthroughs that culminated with Darwin’s grand theory of evolution and with modern evolutionary biology. Evolution from the Galapagos is the second book in the series Social and Ecological Interactions in the Galapagos Islands. The series consists of lectures presented at the two “summits on evolution” that took place in GAIAS (Galapagos Institute for the Arts and Sciences) of the Universidad San Francisco de Quito on June 9–12, 2005, and August 22–26, 2009. The second meeting also commemorated Darwin’s 200th birthday. The different contributors to the book are well known scien­tists in their respective fields. Their areas of expertise include evolutionary biology, zoology, bacterial genetics, systematics, microbial evolution, molecular evolution, genetics, geosciences, chemistry, and physics. Special mention should be made of the contributions of Ada Yonath, who shared the 2009 Nobel Prize in Chemistry with Venkatraman Rama­ krishnan and Thomas A. Steitz for studies of the structure and function of the ribosome, and the chapter by the second couple of the book (the first one being that of Guerrero and Margulis), Rosemary and Peter R. Grant, the senior authors of this series. The Grants are emeriti professors at the University of Princeton and recipients of a number of awards in recognition of their long and tireless research into Darwin’s finches on the Galapagos Island Daphne Major. The twelve chapters in this volume deal with questions about the origin of life, including the appearance of the first eukaryotes, and the role of symbiosis in evolution. Ecological selection is also considered, specifically, how disruptive ecological selection could serve as the driving force in the evolution. This is shown by the viariation in body and sexual size dimorphism within a species and across species within a clade, based on the example of the flightless Galapagos cormorant.

BOOK REVIEWS

This is a short book if one considers the seemingly endless aspects to be considered when the subject is evolution. Nevertheless, it deals with the most important aspects and especially those that have benefited from the large quantity of resources provided by new technologies, which have yielded new perspectives and knowledge. The authors of the book also remind us of the many questions about evolution that have yet to be answered and how much remains to be done in describing the organisms on Earth, how they evolved, and how they are related. Although we are well aware that there are many species on Earth that have not yet been described or identified, we do not know how many. For instance, it has been estimated that only 5 % of existing fungi are known. Moreover, in the words of Vaughan Southgate, past president of the Linnean Society, writing in the foreword of the book, “it is of crucial importance that we should know what is on Earth before it disappears forever.” A good example is provided by the fourteen subspecies of tortoises. Three of them have disappeared while a fourth was represented by a single male specimen, named by its keepers as Lonesome George, and that died in 2012. There are also challenges to the preservation of the Galapagos Islands themselves, as the measures required to preserve their fragile ecosystems often conflict with the interests and needs of their population. Population growth has exacerbated the problem: according to the census of 1950 there were 1346 inhabitants on all of the islands, compared to 17,000 in the year 2000. Tourism also seems to be unstoppable, as the Galapagos Islands are visited by more than 60,000 persons per year Anyone interested in the origin and evolution of life should be grateful to the organizers of the meetings that resulted in the publication of this book, both for the quality of the chapters and, by holding the meetings in the Galapagos, reminding us of their fragile nature (the islands were declared a World Heritage Site by UNESCO in 1978 and a Biosphere Reserve in 1983). The efforts of the University of San Francisco de Quito, the founders of GAIAS, located on San Cristobal island, where Darwin arrived in October 1835, also deserve special mention. The need for continued research into the origin and evolution of life was passionately recognized by Lynn Margulis, our dear colleague and good friend, who died on 22 November 2011. Gabriel Trueba and Carlos Montúfar have dedicated the book to this exceptional scientist and woman whose work on symbiosis revised many of our long held notions of evolution. Carmen Chica International Microbiology cchica@microbios.org


Volume 17(1) MARCH 2014

Acknowledgement of Institutional Subscriptions International Microbiology staunchly supports the policy of open access (Open Access Initiative, see Int Microbiol 7:157161). Thus, the journal recognizes the help received from the many institutions and centers that pay for a subscription—in spite of the possibility to download complete and current issues of the journal free of charge. We would therefore like to thank those entities. Their generous contribution, together with the efforts of the many individuals involved in preparing each issue of International Microbiology, makes publication of the journal possible and plays an important role in improving and expanding the field of microbiology in the world. Some of those institutions and centers are: Area de Microbiología. Departamento de Biología Aplicada. Universidad de Almería / Biblioteca. Institut Químic de Sarrià. Universitat Ramon Llull. Barcelona / Biblioteca. Instituto Nacional de Seguridad e Higiene en el Trabajo-Ministerio de Trabajo y Asuntos Sociales. Barcelona / Ecologia microbiana. Departament de Genètica i de Microbiologia. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Biblioteca. Institut de Biotecnologia i Biomedicina. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Laboratori d’Ecogenètica. Departament de Microbiologia. Universitat de Barcelona / Departament de Microbiologia i Parasitologia Sanitàries. Facultat de Farmàcia. Universitat de Barcelona / Societat Catalana de Biologia. Institut d’Estudis Catalans. Barcelona / Departamento de Microbiologia. Universidade Federal de Minas Gerais. Belo Horizonte. Brasil / Departamento de Inmunología, Microbiología y Parasitología, Universidad del País Vasco, UPV-EHU. Bilbao / Biblioteca. Universidad de Buenos Aires. Argentina / Biblioteca. Facultad de Ciencias. Universidad de Burgos / Biblioteca. Departamento de Producción Animal CIAMCentro Mabegondo. Abegondo (Coruña) / Laboratorio de Microbioloxia. Universidade da Coruña. Coruña / Biblioteca.

Divisió Alimentària del IRTA-Centre de Tecnologia de la Carn. Generalitat de Catalunya. Monells (Girona) / Biblioteca Montilivi. Facultat de Ciències. Universitat de Girona / Área de Microbiología. Departamento de Ciencias de la Salud. Universidad de Jaén / Microbiologia. Departament de Ciències Mèdiques Bàsiques. Facultat de Medicina. Universitat de Lleida / Laboratorio de Microbiología Aplicada. Centro de Biología Molecular. Universidad Autónoma de Madrid-CSIC. Cantoblanco (Madrid) / Laboratorio de Patógenos Bacterianos Intracelulares. Centro Nacional de Biotecnología-CSIC. Cantoblanco (Madrid) / Grupo de Investigación de Bioingeniería y Materiales (BIOMAT). Escuela Técnica Superior de Ingenieros Industriales. Universidad Politécnica de Madrid / Biblioteca. Centro de Investigaciones Biológicas, CSIC. Madrid / Merck Sharp & Dohme de España. Madrid / Departamento de Microbiología. Facultad de Ciencias. Universidad de Málaga / Grupo de Fisiología Microbiana. Depto. de Genética y Microbiología. Universidad de Murcia. Espinardo (Murcia) / Library. Department of Geosciences. University of MassachusettsAmherst. USA / Biblioteca de Ciencias. Universidad de Navarra. Pamplona / Grupo de Genética y Microbiología. Departamento de Producción Agraria. Universidad Pública de Navarra. Pamplona / Microbiología Ambiental. Departamento de Biología. Universidad de Puerto Rico. Río Piedras. Puerto Rico / Biblioteca General. Universidad San Francisco de Quito. Ecuador / Biblioteca. Facultat de Medicina. Universitat Rovira Virgili. Reus / Instituto de Microbiología Bioquímica-Departamento de Microbiología y Genética. CSIC-Universidad de Salamanca / Departamento de Microbiología y Parasitología. Universidad de Santiago de Compostela. Santiago / Laboratorio de Referencia de E. coli (LREC). Facultad de Veterinaria. Universidad de Santiago de Compostela. Lugo / Departamento de Genética. Universidad de Sevilla / Tecnología de los Alimentos. Facultad de Ciencias. Universidad de Vigo / General Library. Marine Biological Laboratory. Woods Hole, Massachusetts, USA.

A3


Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz

S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686 Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter.SI units should be used throughout. For Nomenclature of organisms genus and species names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.

A4


General Information

http://creativecommons.org/licenses/by-nc-nd/4.0/

International Microbiology is a quarterly, open-access, peer-reviewed journal in the fields of basic and applied microbiology. It publishes two kinds of papers: research articles and complements (editorials, perspectives, books, reviews, etc.). Aims and scope International Microbiology, the official journal of the SEM, is a peer-reviewed, open access journal whose aim is to advance and disseminate information in the fields of basic and applied microbiology among scientists around the world. The journal publishes research articles and complements (short papers dealing with microbiological subjects of broad interest such as editorials, perspectives, book reviews, etc.). A feature that distinguishes it from many other microbiology journals is a broadening of the term “microbiology” to include eukaryotic microorganisms (protists, yeasts, molds), as well as the publication of articles related to the history and sociology of microbiology. International Microbiology, offers high-quality, internationally-based information, short publication times (<3 months), complete copy-editing service, and online open access publication available prior to distribution of the printed journal. The journal encourages submissions in the following areas: • Microorganisms (prions, viruses, bacteria, archaea, protists, yeasts, molds) • Microbial biology (taxonomy, genetics, morphology, physiology, ecology, pathogenesis) • Microbial applications (environmental, soil, industrial, food and medical microbiology, biodeterioration, bioremediation, biotechnology) • Critical reviews of new books on microbiology and related sciences are also welcome. Submission Manuscripts must be submitted by one of the authors of the manuscript by e-mail to int.microbiol@microbios.org. As part of the submission process, authors are required to comply with the following items, and submissions may be returned if they do not adhere to these guidelines: 1. The work described has not been published before, including publication on the World Wide Web (except in the form of an Abstract or as part of a published lecture, review, or thesis), nor is it under consideration for publication elsewhere. 2. All the authors have agreed to its publication. The corresponding author signs for and accepts responsibility for releasing this material and will act on behalf of any and all coauthors regarding the editorial review and publication process. 2. The submission file is in Microsoft Word, RTF, or OpenOffice document file format. 3. The manuscript has been prepared in accordance with the journal’s accepted practice, form, and content, and it adheres to the stylistic and bibliographic requirements outlined in “Preparation of manuscripts.” 4. Illustrations and figures are placed separately in another document. Large files should be compressed. Creative Commons The journal is published under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International.

All articles in International Microbiology will be available on the Internet to any reader at no cost. The journal allows users to freely download, copy, print, distribute, search, and link to the full text of any article provided the authorship and source of the published article is cited, it is not used for commercial purposes and it is not remixed, transformed, or built upon. We recommend authors read about the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License before submitting their paper. Open access and article processing charges Open access publishing provides immediate, permanent, free online access to the full texts of all the journal’s peer-reviewed research articles. It allows all interested readers to view, download, print, and/or redistribute any article without requiring a subscription on the principle that making research freely available to the public supports a greater global exchange of knowledge. International Microbiology’s open access policy enables a far greater distribution and impact of an author’s work and is in the interest of the scientific community worldwide. The journal’s expenses for providing immediate, permanent, free online access to the full text of research articles are recovered partly from article-processing charges (APC). Currently many research funding agencies not only allow these expenses to be paid from their grants, but also encourage open access publication. The journal’s APC (Open Access Charges, or Fees) is 800.00 €. If a manuscript requires extensive editorial work, an extra charge may be requested. The acceptance of a paper, however, will not depend on the authors’ ability to pay these charges. Individual waiver requests must be done during the submission process and will be considered on a case-to-case basis. Information for Subscribers International Microbiology is published quarterly (March, June, September and December). Recommended annual subscription is 300.00 €, plus shipping and handling. Single-issue prices are available upon request. Cancellations must be received by 30 September to take effect at the end of the same year. Change of address: allow six weeks for all changes to become effective. Please contact int.microbiol@microbios.org if you have any questions regarding your subscription. Information for advertisers For advertising inquiries, please contact us at int.microbiol@microbios.org. All advertisements are subject to the publisher’s approval. Disclaimer While the contents of this journal are believed to be true and accurate at the date of its publication, neither the authors and editors nor the publisher

can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no guarantee, expressed or implied, with regard to the material contained therein.

p3


INTERNATIONAL MICROBIOLOGY Official journal of the Spanish Society for Microbiology Volume 17 · Number 1 · March 2014 RESEARCH ARTICLES

Lhomme E, Mezaize S, Ducasse MB, Chiron H, Champomier-Vergès MC, Chaillou S, Zagorec M, Dousset X, Onno B A polyphasic approach to study the dynamics of microbial population of an organic wheat sourdough during its conversion to gluten-free sourdough

1

Matas M, Picornell A, Cifuentes C, Payeras A, Homar F, González-Candelas F, LópezLabrador FX, Moya A, Ramon C, Castro JA Relating the outcome of HCV infection and different host SNP polymorphisms in a Majorcan population coinfected with HCV– HIV and treated with pegIFN-RBV

11

Sáez-Rosón A, Sevilla MJ, Moragues MD Identification of superficial Candida albicans germ tube antigens in a rabbit model of disseminated candidiasis. A proteomic approach

21

Yeates AM, Esteban GF Local ciliate communities associated with aquatic macrophytes

31

Luziatelli F, Crognale S, D’Annibale A, Moresi M, Petruccioli M, Ruzzi M Screening, isolation, and characterization of glycosyl-hydrolase-producing fungi from desert halophyte plants

41

Alippi AM, León IE, López AC Tetracycline-resistance encoding plasmids from different Paenibacillus larvae, the causal agent of American foulbrood disease, isolated from commercial honeys

49

BOOK REVIEWS

INDEXED IN

Agricultural and Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents®/Agriculture, Biology & Environmental Sciences®; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science and Technology Abstracts; ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services®; MEDLINE®/Index Medicus®; Latindex; MedBioWorldTM; SciELO-Spain; Science Citation Index Expanded®/SciSearch®

63


Turn static files into dynamic content formats.

Create a flipbook
International Microbiology by Institut d'Estudis Catalans - Issuu