Volume 16 路 Number 4 路 December 2013 路 ISSN 1139-6709 路 e-ISSN 1618-1905
INTERNATIONAL MICROBIOLOGY www.im.microbios.org
16(4) 2013
Official journal of the Spanish Society for Microbiology
Publication Board
Editorial Board
Coeditors-in-Chief José Berenguer (Madrid), Autonomous University of Madrid Ricardo Guerrero (Barcelona), University of Barcelona
Juan Aguirre, Prince Edward Island University, Canada Ricardo Amils, Autonomous University of Madrid, Madrid, Spain Shimshon Belkin, The Hebrew University of Jerusalem, Jerusalem, Israel Albert Bordons, University Rovira i Virgili, Tarragona, Spain Albert Bosch, University of Barcelona, Barcelona, Spain Javier del Campo, University of British Columbia, Vancouver, Canada Victoriano Campos, Pontificial Catholic University of Valparaíso, Chile Josep Casadesús, University of Sevilla, Sevilla, Spain Rita R. Colwell, Univ. of Maryland & Johns Hopkins Univ., Baltimore, MD, USA Katerina Demnerova, Inst. of Chem. Technology, Prague, Czech Republic Esteban Domingo, CBM, CSIC-UAM, Cantoblanco, Spain Mariano Esteban, Natl. Center for Biotechnol., CSIC, Cantoblanco, Spain Mariano Gacto, University of Murcia, Murcia, Spain Juncal Garmendia, Institute of Agrobiotechnology, Pamplona, Spain Olga Genilloud, Medina Foundation, Granada, Spain Steven D. Goodwin, University of Massachusetts, Amherst, MA, USA Juan C. Gutiérrez, Complutense University of Madrid, Madrid, Spain Johannes F. Imhoff, University of Kiel, Kiel, Germany Juan Imperial, Technical University of Madrid, Madrid, Spain John L. Ingraham, University of California, Davis, CA, USA Juan Iriberri, University of the Basque Country, Bilbao, Spain Roberto Kolter, Harvard Medical School, Boston, MA, USA Germán Larriba, University of Extremadura, Badajoz, Spain Rubén López, Center for Biological Research, CSIC, Madrid, Spain Michael T. Madigan, Southern Illinois University, Carbondale, IL, USA Beatriz S. Méndez, University of Buenos Aires, Buenos Aires, Argentina Diego A. Moreno, Technical University of Madrid, Madrid, Spain Ignacio Moriyón, University of Navarra, Pamplona, Spain Juan A. Ordóñez, Complutense University of Madrid, Madrid, Spain José M. Peinado, Complutense University of Madrid, Madrid, Spain Antonio G. Pisabarro, Public University of Navarra, Pamplona, Spain Carmina Rodríguez, Complutense University of Madrid, Madrid, Spain Fernando Rojo, Natl. Center for Biotechnology, CSIC, Cantoblanco, Spain Manuel de la Rosa, Virgen de las Nieves Hospital, Granada, Spain Carmen Ruiz Roldán, University of Murcia, Murcia, Spain Claudio Scazzocchio, Imperial College, London, UK James A. Shapiro, University of Chicago, Chicago, IL, USA John Stolz, Duquesne University, Pittsburgh, PA, USA James Strick, Franklin & Marshall College, Lancaster, PA, USA Gary A. Toranzos, University of Puerto Rico, San Juan, Puerto Rico Antonio Torres, University of Sevilla, Sevilla, Spain José A. Vázquez-Boland, University of Edinburgh, Edinburgh, UK Antonio Ventosa, University of Sevilla, Sevilla, Spain Tomás G. Villa, Univ. of Santiago de Compostela, Santiago de C., Spain Miquel Viñas, University of Barcelona, Barcelona, Spain Dolors Xairó, Biomat, S.A., Grifols Group, Parets del Vallès, Spain
Associate Editors Mercedes Berlanga, University of Barcelona Mercè Piqueras, Catalan Association for Science Communication Nicole Skinner, Imperial College, London Wendy Ran, International Microbiology Secretary General Jordi Mas-Castellà, International Microbiology Webmaster Jordi Urmeneta, University of Barcelona Managing Coordinator Carmen Chica, International Microbiology Specialized editors Josefa Antón, University of Alicante Susana Campoy, Autonomous University of Barcelona Ramón Díaz, CIB-CSIC, Madrid Josep Guarro, University Rovira i Virgili Enrique Herrero, University of Lleida Emili Montesinos, University of Girona José R. Penadés, Inst. of Mountain Livestock-CSIC, Castellon Jordi Vila, University of Barcelona
Addresses Editorial Office International Microbiology C/ Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org www.im.microbios.org Spanish Society for Microbiology C/ Rodríguez San Pedro, 2 #210 28015 Madrid, Spain Tel. +34-915613381. Fax +34-915613299 E-mail: sem@microbiologia.org www.semicrobiologia.org Publisher (electronic version) Institute for Catalan Studies Carme, 47 08001 Barcelona, Spain Tel. +34-932701620. Fax +34-932701180 E-mail: int.microbiol@microbios.org © 2013 Spanish Society for Microbiology & Institute for Catalan Studies. Printed in Spain ISSN (print): 1139-6709 e-ISSN (electronic): 1618-1095 D.L.: B.23341-2004
p2
CONTENTS International Microbiology (2013) 16:211-268 ISSN 1139-6709 www.im.microbios.org
Volume 16, Number 4, December 2013 EDITORIAL
Berenguer J Year’s comments for 2013
211
RESEARCH ARTICLES
Guirao-Abad JP, Sánchez-Fresneda R, Valentín E, Martínez-Esparza M, Argüelles JC Analysis of validamycin as a potential antifungal compound against Candida albicans
217
Cubero M, Calatayud L, Tubau F, Ayats J, Peña C, Martín R, Liñares J, Domínguez MA, Ardanuy C Clonal spread of Klebsiella pneumoniae producing OXA-1 betalactamase in a Spanish hospital
227
Etxeberria M, López-Jiménez L, Merlos A, Escuín T, Viñas M Bacterial adhesion efficiency on implant abutments: A comparative study
235
Ramírez-Fernández L, Zúñiga C, Méndez MA, Carú M, Orlando J Genetic diversity of terricolous Peltigera cyanolichen communities in different conservation states of native forest from southern Chile
243
PERSPECTIVES
Barquinero J Next-generation scholarly communication: A researcher’s perspective
253
BOOK REVIEWS
259
ANNUAL INDEXES
263
A1
Spanish Society for Microbiology The Spanish Society for Microbiology (SEM) is a scientific society founded in 1946 at the Jaime Ferrán Institute of the Spanish National Research Council (CSIC), in Madrid. Its main objectives are to foster basic and applied microbiology, promote international relations, bring together the many professionals working in this science, and contribute to the dissemination of science in general and microbiology in particular, among society. It is an interdisciplinary society, with about 1800 members working in different fields of microbiology.
International Microbiology Aims and scope International Microbiology, the official journal of the SEM, is a peer-reviewed, open access journal whose aim is to advance and disseminate information in the fields of basic and applied microbiology among scientists around the world. The journal publishes research articles and complements (short papers dealing with microbiological subjects of broad interest such as editorials, perspectives, book reviews, etc.). A feature that distinguishes it from many other microbiology journals is a broadening of the term “microbiology” to include eukaryotic microorganisms (protists, yeasts, molds), as well as the publication of articles related to the history and sociology of microbiology. International Microbiology, offers high-quality, internationally-based information, short publication times (<3 months), complete copy-editing service, and online open access publication available prior to distribution of the printed journal.
The journal encourages submissions in the following areas: • Microorganisms (prions, viruses, bacteria, archaea, protists, yeasts, molds) • Microbial biology (taxonomy, genetics, morphology, physiology, ecology, pathogenesis) • Microbial applications (environmental, soil, industrial, food and medical microbiology, biodeterioration, bioremediation, biotechnology) • Critical reviews of new books on microbiology and related sciences are also welcome. Journal Citations Reports The 2012 Impact Factor of International Microbiology is 2,556. The journal is covered in several leading abstracting and indexing databases, including the following ones: Agricultural & Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents/ Agriculture, Biology & Environmental Sciences; EBSCO; EMBASE/ Elsevier Bibliographic Databases; Food Science & Technology Abstracts; ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services; MEDLINE/Index Medicus; Latindex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; SciSearch.
Cover legends
Front cover Center. Landscape of Karukinka Natural Park a protected area on the southern tip of Tierra del Fuego in the Patagonia region of Chile. It is a reserve of sub-Antarctic woodlands, peat bogs, windswept steppes, and snow-covered mountain ranges. Photograph by wikimapia (See article by L. Ramírez-Fernández et al., pp 243-252, this issue.) Upper left. Particles of the turnip mosaic virus, a Potyvirus that infects mainly cruciferous plants and is one of the most damaging viruses in plant crops. It causes chlorotic ringspots in young leaves; as the leaf ages, yellow or brownish spots surrounbded by circular or irregular necrotic rings appear. Micrograph by Fernando Ponz, CBGP, UPM-INIA, Madrid. (Magnification, ca. 100,000×) Upper right. Transmission electron micrograph of a group of cells of the polyhydroxyalcanoate-producing Halomonas venusta MAT-28. The cells are growing as a microcolony in an artificial biofilm of alginate beads. In this situation, cells maintain a metabolic state equivalent to that of the planktonic culture. Micrograph by M. Berlanga, Faculty of Pharmacy, University of Barcelona, and Carmen López, CCiT, University of Barcelona. [See article by Berlanga M., et al., Int Microbiol (2012) 15:191-199.] (Magnification, ca. 6,000×) Lower left. Scanning electron micrograph of Minorisa minuta, a bac terivorous protist described in 2012. With an average size of 1.4 mm, it is one of the smallest bacterial grazers known to date. It has a worldwide distribution and can account for 5 % of heterotrophic protists in coastal waters. Micrograph by Javier del Campo, Institute for Marine Sciences, CSIC, Barcelona, Spain. [For more information, see article by del Campo J, et al., ISME J (2013) 7:351-358] (Magnification, ca. 40,000×) Lower right. SEM micrograph of Saksenaea vasiformis (Saksenaeaceae, Mucorales, Mucoromycotina) sporangiophores isolated from human tissue. It is a filamentous fungus with characteristic flaskshaped sporangia that can cause severe human infections in both
immunocompromised and immunocompetent hosts. Micrograph by José F. Cano, University Rovira i Virgili, Reus-Tarragona, Spain. (Magnification, ca. 1000×) Back cover Portrait of Miguel Ángel Ugarte Vega (1862-1898), a pioneer of medicine in Honduras. Born in Tegucigalpa in May 8, 1862, from Miguel Ugarte and Manuela Vega, he attended medical school in Guatemala, but had to leave that country due to his revolutionary ideas, and was denied any documentary evidence of his academic record. He then moved to San Salvador city, El Salvador, where he successfully passed the official medical practitioner examination. He was a brilliant student of Professor Emilio Álvarez, a Colombian who promoted and modernized medical training in El Salvador. At only 19, Ugarte graduated in Medicine and Surgery. He then worked abroad and returned to Honduras in 1893, already married; within a year he was appointed Chief Surgeon and Director of the General Hospital of Tegucigalpa. Although he died young in 1898, the last years of his life were very fruitful, and he modernized medical practice and training in his country. As a follower of Koch’s principles, he introduced the concepts of asepsis and antisepsis, and the use of corrosive sublimate and iodoform; he also convinced Dr. Policarpo Bonilla, president of Honduras, to buy an X-ray machine—the first to be used in Central America. As director of the General Hospital of Tegucigalpa, Ugarte renovated the operating theaters to fully comply with advice on asepsis, and was the first surgeon from Honduras to perform major surgery successfully. He was also the first physician in Honduras to use microscopy techniques to study intestinal parasitosis with a microscope he brought from El Salvador. Although by his professional career Ugarte was not a microbiologist (in fact he is considered the developer of surgery in Honduras), because of his introducing microbiology concepts that advanced medicine in his country, he can be considered one of the pioneers of Microbiology in Latin America.
Front cover and back cover design by MBerlanda & RGuerrero
A2
EDITORIAL International Microbiology (2013) 16:211-215 doi: 10.2436/20.1501.01.196 ISSN 1139-6709 www.im.microbios.org
Year's comments for 2013 José Berenguer Coeditor-in-Chief, International Microbiology Center for Molecular Biology “Severo Ochoa”, Autonomous University of Madrid, Cantoblanco, Madrid, Spain jberenguer@cbm.uam.es
As we approach the end of 2013, it is a good exercise for every microbiologist to look back and select the year’s main findings and events related to microbiology, and to note the contributions of the Spanish Society for Microbiology (SEM). The 24th Congress of the SEM was held July 10 through 13, at the Bellvitge Campus of the University of Barcelona, in L’Hospitalet de Llobregat, and on the premises of the University of Barcelona (Paranimph, or C e r e m o n i a l Main Hall) and those of the Institute for Catalan Studies, in the center of the city (Fig. 1). Our biennial meeting gathered 618 microbiologists from Spanish universities and research centers as well as researchers from 24 countries. The main topics discussed in the Congress were new frontiers in research on the molecular basis of pathogenicity and bacterial resistance, fungal virulence, antimicrobial agents in biodegradation and bioremediation, “-omic” techniques in food microbiology, and bacteriophages in industrial microbiology. Two in memoriam symposia were held, one as a tribute to the American microbiologist Lynn Margulis (1938–2011) and the other to Miquel Regué (1953–2012), professor at the Fig, 1. Gaudi’s dragon (Python, Gaia’s son, spelled oracles, symbol of the communication of knowledge) at the entrance of Park Güell, Barcelona. Artistic representative of the 24th Congress of the Spanish Society for Microbiology (SEM), that was held in L’Hospitalet de Llobregat and in Barcelona, under the presidency of Prof. Miquel Viñas.
University of Barcelona. The dissemination of microbiology in society and how microbiology can take advantage of social networks were also discussed. [5]. The year 2013 marked the occurrence of a further rise in the concentration of carbon dioxide (CO2) in the Earth’s atmosphere, with the level reaching the symbolic record of 400 ppm (Mauna Loa, 10 May 2013), an amount that has not been reached in the last 5 to 3 million years, as far back as the Pliocene, when the average global temperature was around 4 °C higher than it is today. Symptoms of warming are ev erywhere; for example, a report published in 2013 concluded that the present temperatures in the Eastern Canadian Arctic are the highest since the beginning of the last ice age, 120,000 years ago [9]. Most theoretical models suggest that global warming is today an unavoidable future for the next 50 to 100 years, and somehow we humans will have to adapt to it again. There is broad consensus that only the use of renewable energies, rather than fossil fuels, will be able to reverse this process in the long term. Indeed, several reports have discussed recent developments in the use of biofuels and hydrogen-producing microbes [11,14]. Despite the carbon dioxide increase and the present economic crisis, significant scientific breakthroughs were made in 2013 that bring hope for the future of humankind. The journal Science chose cancer immunotherapy as the main scien-
212
Int. Microbiol. Vol. 16, 2013
Fig. 2. Rover Curiosity (NASA photograph recreation)
tific breakthrough of the year, based on the increased number of successful treatments. There is now hope that antibodies and selected T-cells can be used to treat patients with what previously were otherwise untreatable cancers [4]. In regenerative medicine, the development of in-vitro-grown organs and other body parts from stem cells of different kinds (livers, teeth, blood vessels and even rudimentary brain) constitutes an impressive step toward the in vitro synthesis of compatible organs for transplantations. Also, there were important reports describing successful gene therapy treatments, not only in animal models but also in humans with extremely disabling diseases [2,3]. Although apparently unrelated fields, gene therapy is only possible with the aid of microbiology, as it relies on the use of enzymes and vectors derived from microorganisms (usually bacteria and viruses). In fact, a major milestone in the genetic editing of eukaryotic genomes takes advantage of a RNA– DNA interference system derived from the type-II CRISPRCas system of Streptococcus pyogenes. This method, known as Cas9-edition, allows simultaneous mutations to be made in several genes of mammalian embryonic cells by using RNA oligonucleotides as guides. Cas9-edition is superior to methods based on zinc-finger nucleases and transcription activator-like effector nucleases (TALENs), and it has been immediately adopted for eukaryotic genome editing by many researchers throughout the world [7]. Two other hallmarks in human genetics and evolution reported in 2013 were the completion of the sequence of a Neanderthal individual, from a tiny toe bone found in a cave in Siberia [13], and, at the end of the year, the mitochondrial sequence from a 400,000-year-old hominid discovered in Atapuerca, in northern Spain [8]. In the former, the ancient DNA
Berenguer
matched that of the Denisovans, a Neanderthal-related hominid whose remains were found in the same cave from which the Neanderthal genome was obtained. As above, the extraction and amplification of very fragmented (<50 bp) DNA is possible only through the use of microbial enzymes. In the space-related sciences, the major findings of 2013 included the discovery of hundreds of Earth-like exoplanets (featured in a Science special issue in May 2013) that provide the basis for long-dreamed habitable worlds and give strong support to astrobiology. Closer to the Earth, 2013 brought news of the success of the Curiosity rover in its journey on the surface of Mars (Fig. 2). Reports compiled from this microlaboratory with drilling capability provide lend credence to the hypothesis that Mars was once suitable for microbial life. Analysis of several Martian rocks with names such as “John Klein,” “Tintina,” “Sutton Inlier” (area), “Knorr,” and “Wernecke” in the Gale Crater revealed the presence of water, carbon dioxide, oxygen, sulfur dioxide, hydrogen sulfide, chloromethane, dichloromethane, and calcium sulfate. In addition, the Curiosity’s instruments provided evidence for the presence of subsurface water in amounts as high as 4 %, down to a depth of 60 cm, suggesting that subsurface conditions still harbor water and mineral sources with enough energy to sustain living subterranean microbiota, such as those in the deep subsurface of our planet [21]. New frontiers of life were explored also on Earth. A group led by Scott O. Rogers, from Bowling Green State University, Ohio, published metagenomic data from the accretion ice of Lake Vostok, at a depth of more than 3700 m in the Antarctic [18]. This ice, which formed when the overlying glacial ice moved over the surface of the lake, contains an astonishing diversity of Bacteria, with minor representations of Eukarya and Archaea, all apparently thriving in a buried lake similar to the ice-covered seas of Europa and Enceladous, Jupiter and Saturn’s moons, respectively. Another hallmark was the finding of large populations of bacteria at the bottom of the Mariana Trench, the deepest part of the Earth’s surface. There were also reports on microbes living inside rocks buried deep below the sea floor. All of these extreme environments offer further evidence that microbial life requires very little in the way of nutrients to exist, and support the search for extraterrestrial life. Reports on the survival of microbes in outer space and the strong reminder of the effects of ancestral collisions with objects from space—provided by the explosion over Chelyabinsk, Russia, of the most significant meteor since the 1908 Tunguska event, in Siberia—are additional, potent arguments to study outer space as a major shaper of life on Earth.
Int. Microbiol. Vol. 16, 2013
year's comments
213
Fig. 3. Christian de Duve (1917–2013), Frederick Sanger (1918–2013), and François Jacob (1920–2013).
Also in 2013, a relevant advancement in our understanding of microbial evolution was achieved through the sequencing of the single-cell genomes of 201 uncultured Bacteria and Archaea [16]. In addition to being an impressive technical goal, the work revealed spectacular cases of lateral gene transfer and modifications of the genetic code, both of which expand our understanding of the evolution of prokaryotes since the origin of life on Earth. In related news, the discovery of some of the oldest fossils on Earth, in the Dresser sandstone formation in Western Australia, which has been dated back to almost 3500 million-years ago, was reported [10]. The fossils represent microbial mats and demonstrate the existence of phototrophic metabolism very early in evolution. In present earth-bound microbiology, the relationship between microbiota and health was a major topic in 2013. After the description, in 2012, of the human microbiome by an international consortium (“Human Microbiome Project”), a series of fascinating articles were published that related human health and sickness to the presence of specific microbiotal patterns. Equally fascinating were reports on the effects of the transplantation of microbiota from healthy individuals (“healthy microbiota”) to those with specific disorders. Papers published in Science in February and September, by a group directed by Jeffrey I. Gordon, from Washington University, St. Louis, Missouri, a world leader in gut microbiome research, described the transfer by fecal microbiota from twins discordant for obesity of obese or lean phenotypes, when the microbes were transplanted into mice [15]. These studies evidence the crucial role of gut microbes in maintaining health independently of genetic inheritance. Another article, published in Cell by the end of the year [6], showed that, in mice models, certain types of autism in animals that also have gastrointestinal disorders can be ameliorated by oral treatment
with gut microbes such as Bacteroides fragilis. This unexpected connection between microbiota and the brain points to a putative probiotic therapy for certain types of autism. Other major announcements in 2013 were related to the development of vaccines or improved treatments against major pathogens. In HIV therapy, the news of a “cure” of a 30-month-old child who had received antiretroviral therapy in the first 18 months of life [12] had a major impact in medical microbiology and in society. In fact, it is the first case in which the HIV virus has been eradicated from an infected infant. In addition, successful phase I clinical trials of an HIV vaccine offer new hopes in the fight against this devastating virus in developing countries, where present therapies are not affordable. A major step against malaria was also announced, when a new intravenous vaccine made of whole sporozoites was shown to be highly effective and safe [17]. These successes in the fight against infectious diseases were, however, accompanied by disappointments, especially the failure in human trials of a much anticipated new vaccine against tuberculosis [20]. In the 2012 comments of the year, we noted the death of Carl Woese, who had a major influence on our concept of life, by defining three domains based on the analysis of 16S–18S RNA as a molecular clock. Nowadays, this approach is a routine tool to establish the phylogenetic relationships and taxonomy of every new organism isolated. In 2013, we note the deaths of three other important scientists who also very significantly contributed to our understanding of how life functions and evolves. On April 19, François Jacob (b. 1920) passed away in Paris. As co-discoverer of the mechanism underlying the regulation of gene expression in bacteria (the “operon model”), he was a seminal figure in the development of modern microbiology and contributed to what became the
214
Int. Microbiol. Vol. 16, 2013
era of molecular biology, in the years following the publication of the structure of DNA. For this work he shared the 1965 Nobel Prize in Physiology or Medicine with Jacques Monod and André Lwoff. On May 4, Christian de Duve (b. 1917) died at his home in Belgium. He discovered lysosomes, an essential organelle in both the structure and function of the eukaryotic cell. He shared the 1974 Prize in Physiology or Medicine with Albert Claude and George E. Palade. On November 19, Frederick Sanger (b. 1918) died in Cambridge, UK, at the age of 95. Sanger was an exceptional scientist and was twice awarded the Nobel Prize in Chemistry, the first time (1958) for his work on the development of methods for sequencing proteins (Sanger’s method of peptide end-group analysis), with his groundbreaking work on the sequence of bovine insulin. The second time (1980), he shared the prize with Walter Gilbert, for the development of a sequencing method, in this case for DNA. Sanger’s method was based on the use of specific dideoxy-nucleotides as DNA strand terminators by DNA polymerases and their subsequent separation by size. This method is still in use, with some modifications, and has allowed the sequencing of whole genomes, including the human genome, and has paved the way to the present genomic era. The work of de Duve, Sanger, and Jacob forms a cornerstone in modern biology and will continue to guide and inspire all researchers involved in the biological sciences (Fig. 3). *** The funding of science in Spain remains a serious problem. In addition to a tremendous decrease in the science budget since 2009, the delayed publication of the National Plan for Science, which was published in November 2013 instead of December 2012, will postpone, for at least 6 months, the starting period of 2014 projects. Consequently, many of the planned projects, involving around one third of Spanish academic groups, many of them highly competitive, have been left without funding for half a year. Some of these groups will have to drastically reduce their sizes and activities, with adverse effects on scientific production over the next 2–3 years. We must denounce the short-sightedness of our politicians while we try to adapt to the lack of funds by concentrating and coordinating our research through collaborative programs, such as the European Horizon 2020, which has its first call in April 2014. On a more positive note, on December 19th, the last day of parliamentary activity in Spain for the year 2013, most of the parliamentary groups in Madrid signed an “agreement for research, development and innovation,” promoted by COSCE,
Berenguer
the Federation of Spanish Scientific Societies, with which SEM is affiliated. The signed agreement included four points: the recovery, in three years, of the 2009 levels of science funding and a progressive increase in the percentage of the national budget dedicated to science to reach the mean levels of the EU; the elimination of the 10 % limit on incorporating personnel in science; the avoidance of funding delays; and the creation of a State Agency of Research, as originally proposed in 2011. Despite our prudent skepticism regarding the promises of politicians, this agreement is a step forward in that it considers science as a matter of state, independent of the color of the government in turn. This should be also the case for education, but the needed level of maturity among our political parties has yet to be reached. In the dissemination of science, the last few years have witnessed an increase in the number of open access publications, a process in which International Microbiology is highly active, although the model is still a matter of controversy [1]. Both the European Union, in the Horizon 2020 program, and the Spanish National Plan for Science have explicitly specified that the research results of the projects they fund must be published in an open access format, and a specific budget to do so will be established. However, we are all aware of the high fees that major commercial scientific publishers charge for articles that will appear in their open access journals. Bearing in mind the decrease in public funding for science in Spain, such fees are clearly excessive and efforts at more reasonable fee structuring should be encouraged. For journals belonging to learned societies, including International Microbiology, efforts are and will be made to keep open access publication fees as low as possible, ensuring that they will not be significantly more expensive than those charged by the printed forms of journals of reference in the field. In this context, I would like to call our readers attention to the controversy sparked by the 2013 winner of the Nobel Prize in Physiology or Medicine, Randy Schekman, who made note of the pernicious role played by what he calls “luxury journals” in the evaluation of scientific quality and of the need for a greater number of open access journals combined with IF-independent criteria to properly evaluate the quality of the scientific work [19]. *** Perhaps as a reflection of our policy of keeping low publication fees combined with our commitment to maintaining high standards of quality, in 2013 International Microbiology received 160 manuscripts from 40 countries. Of these, 28 articles were published in four issues after being accepted by peer
year's comments
reviewers. The diffusion of the digital version of the journal through the web of the Institute for Catalan Studies, our coeditor, has increased constantly since 2011, the first year that the journal was available on the IEC publication’s portal; in 2011, there were 64,108 downloads; in 2012, 101,783; and in 2013, 173,822. The articles published in 2013 covered the great diversity of microbiology, from environmental biology and biodiversity to biodegradation and pathogenesis. From these pages we encourage all members of the SEM as well as microbiologists from Latin America to publish in International Microbiology. In 2013, the four images featured as the central cover photo were: a leaf-cutter ant from Costa Rica (Atta colombica) (March), a marsh of the Lerma River in Mexico (June), the Gaudi’s famous dragon in Barcelona (September), and a Chilean desert landscape (December). The four micrographs (representing viruses, bacteria, protists, and fungi) that regularly appear as the background of the front cover of International Microbiology were made by microbiologists from Spain. One of them, from the Institute for Marine Sciences (CSIC, Barcelona), provided us with an image of the recently discovered bacteriovorous protist Minorisa minuta, one of the smallest eukaryotic cells known so far (1.4 µm average). Latin American countries have a long history of prominent researchers in public health and infectious diseases, since the early 18th century. Continuing our tradition of promoting microbiologists pioneers from the “South”, our back covers featured the portraits of Rafael Rangel (1877–1909), the Venezuelan founder of parasitology and biological analytics in his country, in March and June, and Miguel Ángel Ugarte Vega (1862–1898), pioneer of medicine in Honduras, in September and December. As in previous years, on behalf of the publication and editorial board, I would like to thank and recognize the efforts of the many researchers who voluntarily devoted part of their time and expertise to reviewing the manuscripts received by our journal. A list of their names and affiliations can be found on page 267 of this issue. Their work is of utmost importance in sustaining the quality and validity of International Microbiology.
References 1. Abadal E (2013) Gold or green: the debate on Open Access policies. Int Microbiol 16:199-203 2. Aiuti A, Biasco L, Scaramuzza S, et al. (2013) Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science 341, doi:10.1126/science. 1233151
Int. Microbiol. Vol. 16, 2013
215
3. Biffi A, Montini E, lorioli L, et al. (2013) Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science 341, doi:10.1126/science. 1233158 4. Couzin-Frankel J (2013) The dizzying journey to a new cancer arsenal. Science 340:1514-1518 5. Fusté E, Viñas M (2013) The 24th Congress of the Spanish Society for Microbiology (L’Hospitalet de Llobregat, Barcelona, 10–13 July 2013). Int Microbiol 16:205-209 6. Hsiao EY, Mcbride SW, Hsien S, et al. (2013) Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell 155:1451-1463 7. Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J (2013). RNA-programmed genome editing in human cells. eLife 2:e00471 8. Meyer M, Fu Q, Petri AA et al. (2013) A mitochondrial genome sequence of a hominin from Sima de los Huesos. Nature, doi: 10.1038/nature12788 9. Miller GH, Lehman SJ, Refsnider KA, Southon JR, Zhong Y (2013) Unprecedent recent summer warmth in Arctic Canada. Geophys Res Lett 40:5745-5751 10. Noffke, N, Christian D, Wacey D, Hazen RM (2013) Microbially induced sedimentary structures recording an ancient ecosystem in the ca. 3.48 billion-year-old Dresser Formation, Pilbara, Western Australia. Astrobiology 13:1103-1124 11. Pawar SS, van Niel EWJ (2013) Thermophilic biohydrogen production: how far are we? Appl Microbiol Biotechnol 97:7999-8009 12. Persaud D, Gay H, Ziemniak C, Chen YH, Piatak M Jr, Chun TW, Strain M, Richman D, Luzuriaga K (2013) Absence of detectable HIV-1 viremia after treatment cessation in an infant. N Engl J Med 369:1828-1835 13. Prüfer K, Racimo F, Patterson, et al. (2013) The complete genome sequence of a Neanderthal from the Altai Mountains. Nature, doi: 10.1038/ nature12886 14. Rahji H, Conthe M, Puyol D, Díaz E, Sanz JL (2013) Dark fermentation: isolation and characterization of hydrogen-producingstrains from sludges. Int Microbiol 16:53-62 15. Ridaura VK, Faith JJ, Rey FE, et al. (2013) Gut microbiota from twins discordant for obesity modulate metabolism in mice. Science 341, doi: 10.1126/science.1241214 16. Rinke C, Schwientek P, Sczyrba A, et al. (2013) Insights into the phylogeny and coding potential of microbial dark matter. Nature 499:431-437 17. Seder RA, Chang LJ, Enama ME, et al. (2013) Protection against malaria by intravenous immunization with a nonreplicating sporozoite vaccine. Science 341:1359-1365 18. Shtarkman YM, Koçer ZA, Edgar R, Veerapaneni RS, D’Elia T, Morris PF, Rogers SO (2013) Subglacial Lake Vostok (Antarctica) accretion ice contains a diverse set of sequences from aquatic, marine and sedimentinhabiting Bacteria and Eukarya. PLoS One 8:e67221 19. Schekman R (2013) How journals like Nature, Cell and Science are damaging science. [http://www.theguardian.com/commentisfree/2013/dec/09/howjournals-nature-science-cell-damage-science] (Dec. 12, 2013) 20. Tameris MD, Hatherill M, Landry BS, et al. (2013) Safety and efficacy of MVA85A, a new tuberculosis vaccine, in infants previously vaccinated with BCG: a randomised, placebo-controlled phase 2b trial. Lancet 381:1021-1028 21. Teske AP (2005) The deep subsurface biosphere is alive and well. Trends Microbiol 13:402-404
RESEARCH ARTICLE International Microbiology (2013) 16:217-225 doi: 10.2436/20.1501.01.197 ISSN 1139-6709 www.im.microbios.org
Analysis of validamycin as a potential antifungal compound against Candida albicans José P. Guirao-Abad,1 Ruth Sánchez-Fresneda,1 Eulogio Valentín,2 María Martínez-Esparza,3 Juan-Carlos Argüelles1* Microbiology Area, School of Biology, University of Murcia, Murcia, Spain. 2Department of Microbiology and Ecology, University of Valencia, Burjassot, Spain. 3Department of Biochemistry and Molecular Biology and Immunology, University of Murcia, Murcia, Spain
1
Received 18 October 2013 · Accepted 12 December 2013
Summary. Validamycin A has been successfully applied in the fight against phytopathogenic fungi. Here, the putative antifungal effect of this pseudooligosaccharide against the prevalent human pathogen Candida albicans was examined. Validamycin A acts as a potent competitive inhibitor of the cell-wall-linked acid trehalase (Atc1p). The estimated MIC50 for the C. albicans parental strain CEY.1 was 500 mg/l. The addition of doses below MIC50 to exponentially growing CEY.1 cells caused a slight reduction in cell growth. A concentration of 1 mg/ml was required to achieve a significant degree of cell killing. The compound was stable as evidenced by the increased reduction of cell growth with increasing incubation time. A homozygous atc1Δ/atc1Δ mutant lacking functional Atc1p activity showed greater resistance to the drug. The antifungal power of validamycin A was limited compared with the drastic lethal action caused by exposure to amphotericin B. The endogenous content of trehalose rose significantly upon validamycin and amphotericin B addition. Neither serum-induced hypha formation nor the level of myceliation recorded in macroscopic colonies were affected by exposure to validamycin A. Our results suggest that, although validamycin A cannot be considered a clinically useful antifungal against C. albicans, its mechanism of action and antifungal properties provide the basis for designing new, clinically interesting, antifungal-related compounds. [Int Microbiol 2013; 16(4):217-225] Keywords: Candida albicans · Rhizoctonia solani · validamycin A · amphotericin B · trehalose
Introduction Substantial progress has been achieved in the last two decades in antifungal chemotherapy, which has been increasingly employed mainly because of the worldwide rise in the immunocompromised and aging human population [23] and the freCorresponding author: J.C. Argüelles Área de Microbiología, Facultad de Biología Universidad de Murcia, Campus de Espinardo 30071 Murcia, Spain Tel. +34-868887131. Fax 34-868883963 E-mail: arguelle@um.es *
quent isolation in hospitals of classical non-pathogenic fungi responsible for nosocomial outbreaks [27,28]. These isolates mainly belong to the genera Aspergillus, Cryptococcus, and “non-albicans” species of Candida, although Candida albicans remains the most prevalent infectious fungus in humans [8,9,24,27]. In recent years, the biggest problems associated with clinical fungal infections are related to the considerable increase in nosocomial bloodstream candidiasis, in which new factors of virulence [9], the rise of resistant fungal strains due to mutation, and the low selective toxicity of available antifungal therapies are characteristic [1,8,27]. This worrying scenario highlights the need for more secure and effective antifungal therapies.
218
Int. Microbiol. Vol. 16, 2013
In this context, considerable effort has been dedicated to improving conventional antimycotic drugs, e.g., the novel liposomal formulations of amphotericin B [15]. An alternative strategy requires the search for new cell targets combined with the screening of promising new antifungal compounds [23]. Our previous work supported both investigation into the enzymes involved in trehalose metabolism as potential antifungal targets and clinical trials of inhibitors specifically designed against trehalose-hydrolyzing enzymes [20,21,26]. Trehalose is a protective non-reducing disaccharide that is widely distributed in nature (bacteria, fungi, invertebrates, and plants) but absent in mammals. A loss of virulence is caused by the double disruption of the trehalose biosynthetic genes TPS1 and TPS2, and the corresponding tps1 and tps2 null mutants show striking susceptibility to oxidative stress and heat shock. These observations are strong arguments in favor of therapeutically targeting the trehalose pathway [3,4,13,32]. Within this hydrolytic pathway, the ATC1 gene encodes the cell-wall-linked acid trehalase (Atc1p), required to cleave off exogenous trehalose; it is also involved in the induction of filamentation and virulence in C. albicans, and in improved resistance against different types of stress, such as heat shock or oxidative stress [25,26]. Structural analogues of trehalose from different biological sources (e.g., validamycin A, trehalosamine, trehazoline, nojirimycin, and calistegin) act as competitive or non-competitive inhibitors of trehalase activity [10] and are therefore of interest for their putative antifungal activity. Notably, validamycin A was introduced at the beginning of the 1980s in Japan and China to control rice sheath blight, caused by the phytopathogenic fungus Rhizoctonia solani [5]. It has also been tested against several ascomycetes and basidiomycetes [29]. Today, it is successfully used in crop protection as a herbicide and fungicide, since it is innocuous to human and animal health [17]. The structure of this secondary metabolite from Streptomyces hygroscopicus consists of an aminocyclitol moiety, validoxylamine A, linked to glucose through a β-glycosidic bond [7]. Validamycin A shows strong competitive inhibition of several plant and insect trehalases, suggesting its potential as an herbicide or insecticide [6,11,22]. To our knowledge, however, the antifungal action of validamycin A for clinical purposes against human fungal pathogens has never been examined, although the compound was tested in studies on the heat- and trehalose-associated control of morphogenesis in C. albicans [31]. We therefore decided to investigate the putative antifungal action of validamycin A against Candida albicans, taking as our model the parental CEY.1 (CAI-4-URA+) strain and its isogenic homozygous atc1Δ/
guirao-abad et al.
atc1Δ mutant (deficient in acid trehalase). Our results suggest that although validamycin A has a limited antifungal action against C. albicans, it does merit consideration as a basis for the design of new, alternative antifungal compounds.
Materials and methods Yeast strains and culture conditions. Candida albicans strain CEY-1 (CAI-4-URA3+) (ura-3 Δ::imm-434/ura-3 Δ::im-434/ RP10::URA3) and the homozygous acid-trehalase-deficient mutant (atc1Δ/atc1Δ) (atc1Δ::hisG/atc1Δ::hisG-URA3-hisG-ura3Δ::imm434/ura3Δ::imm434) were used throughout this study. A detailed description of the constructions and procedures followed to obtain these strains is given elsewhere [26]. The cultures were grown at 37 °C (or 28 °C for experiments on dimorphic conversion; see below) with shaking in a medium consisting of 2 % peptone, 1 % yeast extract, and 2 % glucose (YPD). The strains were maintained by periodic subculturing in solid YPD medium. Growth was monitored by measuring the OD600 of cultures in a Shimadzu UV spectrophotometer. Sensitivity to validamycin A and amphotericin B. Validamycin was purchased from Duchefa Biochemie (Haarlem, The Netherlands) and two stock solutions were prepared by dissolving the compound in dimethyl sulfoxide at 100 mg/ml or 10 mg/ml (as the source for final doses of 1 mg/ml or 100 mg/ml validamycin A, respectively). The stock solutions were stored at –20 °C until use and diluted in sterile distilled water. Amphotericin B (Sigma, 80 % purity) was prepared as indicated elsewhere [12]. Fungal cultures were grown in liquid YPD at 37 °C until the exponential phase (OD600 0.8–1.0) and were then divided into several aliquots, which were treated with the indicated doses of validamycin A or amphotericin B. After incubation for 24 h at 37 °C, viability was determined (see viability determination) and compared with a control without validamycin A. The concentration of validamycin A that induced 50 % inhibition of growth (MIC50) was calculated. Viability determination. Cultures were grown in liquid YPD overnight and then refreshed in the same medium until they reached the early exponential phase of growth (OD600 0.2–0.3). Then, the samples were divided into several identical aliquots, which were treated with two different validamycin A concentrations, 0.1 and 1.0 mg/ml, chosen as a function of the MIC50, or maintained without treatment as a control; all cultures were incubated at 37 °C until an OD600 of 0.8–1.0. Viability was determined in samples diluted appropriately with sterile water, plated in triplicate on solid YPD, and then incubated for 2–3 days at 37 °C. Between 30 and 300 colonies were counted per plate. Survival was normalized to that of the control samples (100 % viability). Induction of germ tube formation. For germ-tube induction, samples were harvested at different stages of growth, rapidly washed with water, and resuspended at a density of 0.6–0.8 mg/ml (dry weight) in YPD prewarmed to 37 °C and containing 10 % (v/v) filter-sterilized (0.45 µm, Millipore) human serum. Filamentation was also examined in colonies growing on Spider medium plates incubated at 37 °C for 7 days. The appearance of germ tubes was monitored using a phase-contrast light microscope equipped with a hemocytometer. When required, clumped cells were dispersed by mild sonication (10–15 s) prior to microscopic examination. At least 250 cells were counted for each time-point and the percentage of dimorphism was defined as the ratio of germ-tube-forming cells to the total number of cells [2,26]. Preparation of cellular extracts. After exposure to validamycin A, samples from the cultures were harvested and resuspended at known densi-
Int. Microbiol. Vol. 16, 2013
Validamycin against C. albicans
ties (10–15 mg/ml, wet weight) in N-morpholine ethanesulfonic acid (MES) extraction buffer (100 mM), pH 6.0, containing 5 mM cysteine and 0.1 mM phenylmethylsulfonyl fluoride. The cellular suspensions were transferred into small, pre-cooled tubes (0.5 cm diameter) containing Ballotini glass beads (0.45 mm diameter). The cells were broken by vibrating the tubes vigorously in a vortex mixer. The tubes were cooled quickly on ice, and the cell extracts were then centrifuged at 12,000 ×g for 10 min. The supernatant (cytosolic extract) and the pellet, resuspended in the same buffer (cell-wall extract), were preserved at 4 °C if used immediately or at –20 °C for further enzymatic analysis. The protein content in cellular extracts was estimated according to Lowry et al. [19], with bovine serum albumin as standard. Enzymatic assays. The acid trehalase assay was performed by incubating 50 μl of cell-wall extract with 200 μl of trehalose (200 mM) prepared in 200 mM sodium citrate, pH 4.5, containing 2 mM EDTA. The reaction for neutral trehalase activity contained 50 μl of cytosolic extract (25–100 μg protein) and 200 μl of trehalose (200 mM) prepared in 25 mM MES, pH 7.1, and 125 μM CaCl2. The reactions were incubated at 30 °C for 30 min and stopped by heating in a water bath at 95 °C for 5 min. The amount of glucose released was determined by the glucose oxidase-peroxidase method. The specific activity is expressed as nmol glucose min–1 (mg protein)–1. Catalase activity was determined at 240 nm by monitoring the removal of H2O2, as described elsewhere [12]. Specific activity is expressed as mmol min min−1 (mg protein)–1.
Morphological analysis. The morphology of the cells after the different antifungal exposures was imaged with a Leica DM6000B microscope equipped with a Leica DFC280 camera connected to a PC and by using Leica Application Suite V 2.5.0 R1 software. Images were captured by bright field microscopy, using the 40× objective with an on-screen magnification of 920×, and then processed and analyzed with the public domain software ImageJ [http://rsb.info.nih.gov/ij/], a Java-based image processing program developed at the National Institute of Health. Statistical analysis. Data are presented as mean ± SD. The data were analyzed by Duncan´s multiple test. The results shown are from three to five independent experiments.
Results Effect of validamycin A on acid trehalase activity (Atc1p) in Candida albicans. Validoxylamine A, the aglycone fraction of validamycin A, behaves as a potent and specific competitive inhibitor of the soluble trehalase present in the pathogenic fungus Rhizoctonia solani [5]. Therefore, we initially analyzed whether this inhibitory action of validamycin A was also operative against the acid trehalase of C. albicans, a cell-wall-linked enzyme involved in the hydrolysis of exogenous trehalose [25,26]. According to the Dixon plot shown in Fig. 1, in the parental C. albicans strain CEY.1 (CAI-4-URA+), validamycin A also inhibited this enzymatic activity in a competitive manner, with an apparent dissociation constant (Ki) of about 1.5 µg/ml (3.02 × 10–6 M).
Int Microbiol
Determination of endogenous trehalose. Intracellular trehalose was measured according to a previously described method [26]. Briefly, cell samples (20–50 mg, wet weight) were washed, resuspended in 1 ml of water, and boiled for 30 min with occasional shaking. The concentration of trehalose released in the supernatant was determined with commercial trehalase (Sigma). The assay contained 90 μl of 25 mM sodium acetate buffer, pH 5.6, 100 μl of cell-free supernatant, and 10 μl of trehalase (2 units/ml). After incubation of the samples overnight at 37 °C, the amount of glucose produced was estimated by the glucose oxidase-peroxidase procedure. Parallel controls were run to correct for basal glucose levels.
219
Fig. 1. Dixon plot for validamycin A inhibition of acid trehalase activity in exponentially growing cells of the C. albicans CEY.1 (CAI-4-URA+) strain. The incubation mixtures contained the following concentrations of trehalose: 1 mM (closed circle), 10 mM (closed square), 25 mM (closed up triangle), and 100 mM (closed down triangle).
Int. Microbiol. Vol. 16, 2013
guirao-abad et al.
Int Microbiol
220
Fig. 2. Effect of validamycin A (Val A) and amphotericin B (AmB) on the growth (as determined by turbidimetric analysis) and cell viability of the parental CAI-4-URA+strain (panels A and B, closed symbols) and the congenic mutant atc1Δ/atc1Δ (panels C and D, open symbols) of C. albicans. Cultures were grown at 37 °C in YPD liquid medium with shaking, in the absence (circles) or presence of validamycin A at concentrations of 0.1 mg/ml (up triangle) and 1 mg/ml (down triangle) or amphotericin B at 0.5 μg/ml (square). Samples were harvested in duplicate at the indicated times for OD600 measurements in the CEY.1 (A) and atc1Δ/atc1Δ (C) strains. Cell viability was analyzed in CEY.1 (B) and atc1Δ/atc1Δ (D) strains subjected to the indicated treatments for 4 and 7 h. Identical, untreated samples were maintained at 37 °C as a control. The values shown are the mean ± SD of three independent measurements. The distinction between the values obtained for the treated samples and the controls was significant at *P < 0.05, **P < 0.01, and ***P < 0.001, according to Duncan’s multiple range test.
This value was higher than the Ki recorded for validoxylamine A in R. solani [5,6], although the two cannot be strictly compared because we used cell-wall extracts, rather than partially purified samples, as the enzymatic source. Furthermore, only acid trehalase activity can be measured in the crude homogenates, as demonstrated by specific antibody binding [30], which excludes hypothetical residual cross-contamination with the cytosolic fraction containing neutral trehalase. Effect of validamycin A on cell growth and the viability of the CAI-4 and atc1∆ null strains of Candida albicans. In C. albicans, the lack of a functional URA3 gene affect the growth and virulence capacity of the fungus [16]. Therefore, in this study we used two URA3+
strains previously employed in studies on dimorphism and infectivity [26]. To test the putative antifungal role of validamycin A, we measured the response of parental CEY.1 cells to the addition of two concentrations of this inhibitor, chosen according to the corresponding MIC50 and calculated in advance (500 mg/l) as described in the Materials and methods section. Turbidimetric inspection (Fig. 2A) showed that 0.1 mg validamycin A/ml caused a slight decrease in cell growth while the reduction was more prominent in samples exposed to a concentration of 1000 mg/l (2× MIC50) (Fig. 2A). The determined cell viability (Fig. 2B) was consistent with the previously obtained absorbance data (Fig. 2A). After 4 h of exposure, 0.1 mg validamycin A/ml caused a weak reduction in the number of viable cells compared with the control (Fig. 2B), and only the
Validamycin against C. albicans
221
(Fig. 2B and 2D). Throughout this experimental work, the antifungal action of validamycin was referred to that of amphotericin B (0.5 mg/ml) in an identically treated sample, which was used as a positive control. The presence of the polyene provoked a dramatic amount of cell killing in both cell types (Fig. 2B and 2D). Taken together, our results suggest that validamycin A causes only a partial loss of cell viability and that, compared with other well-tested compounds currently available, it behaves as a weak antifungal agent. By contrast, optical microscopy analysis of the yeast morphology seemed to suggest a possible direct effect of the two tested antifungal agents (validamycin A and amphotericin B) in the reduction of individual cell size, which, in the case of validamycin A, was more noticeable after prolonged treatment (Fig. 3). Thus, the results from five independent measurements in exponential CEY.1 cultures showed a direct correlation between the specific antifungal treatment applied for
Int Microbiol
highest concentration resulted in a significant level of cell death (ca. 50%). Prolonged incubation (7 h) in the presence of the compound produced only a slight additional increase in the fungicidal activity, which was dose-dependent (Fig. 2B). These results also suggested that validamycin A remained stable for long periods. We additionally analyzed the putative antifungal action of validamycin A on the homozygous null mutant atc1Δ/atc1Δ, which lacks a functional acid trehalase, the enzyme inhibited by the drug (Fig. 1). As expected, turbidimetric analysis revealed that the mutant was more resistant to the inhibitory action of the drug than the parental strain (Fig. 2C). This resistant phenotype was unequivocally confirmed through a count of viable cells in cultures incubated for 4 and 7 h in YPD liquid medium (Fig. 2D). Exposure to 1.0 mg validamycin A/ml for 7 h resulted in a higher survival percentage of the mutant than of the parental cells (55 vs. 46 %, respectively)
Int. Microbiol. Vol. 16, 2013
Fig. 3. Morphological changes induced by validamycin A and amphotericin B in C. albicans strain CAI-4. YPD-grown CAI-4-URA+ cells (OD600 0.3) were treated with 0.1 mg validamycin A/ml or 0.5 μg amphotericin B/ml for 8 and 10 h. Identical, untreated samples were maintained at 37 °C as a control.
222
Int. Microbiol. Vol. 16, 2013
guirao-abad et al.
Table 1. Changes in endogenous trehalose storage measured in response to different concentrations of validamycin A in the C. albicans URA+ strains CAI-4 and the atc1Δ/atc1Δ mutant Trehalosea atc1Δ/atc1Δ
CAI-4
Treatment Control
5.9 ± 0.7
6.8 ± 0.9
Validamycin A (0.1 mg/ml)
13.8 ± 1.5c
15.3 ± 2.4c
Validamycin A (1 mg/ml)
7.3 ± 1.1
9.1 ± 1.3
Amphotericin B (0.5 µg/ml)
12.7 ± 2.1c
14.5 ± 2.2c
nmol trehalose/mg wet weight. P < 0.05, cP < 0.01 and dP < 0.001, according to Duncan’s multiple range test. Cultures were grown at 37 °C in YPD, harvested (OD600= 0.3), and exposed to the test concentrations of validamycin A for 4 h and to amphotericin B for 1 h. Control samples were maintained at 37 °C. The results are the mean ± SD of three independent measurements.
a
b
10 h and the subsequent cell size observed, the cell area of the control samples being larger than that of cells treated with 0.1 mg validamycin A/ml (25.42 + 6.3 vs. 21.73 ± 4.8 mm2). As expected, the smallest cell sizes occurred in samples treated with 0.5 mg amphotericin B/ml (17.52 ± 2.8 mm2). Changes in trehalose content during validamycin A treatment. In C. albicans, the non-reducing disaccharide trehalose acts as a specific protectant against oxidative stress [3] and is also synthesized in response to amphotericin B exposure [12]. Because the addition of validamycin A to several plant species triggers the rapid synthesis of the trehalose required to confront abiotic stresses [11,18,22], we measured the content of stored trehalose in CEY.1 and atc1Δ
null cells under our experimental conditions. As shown in Table 1, endogenous disaccharide accumulation was greatest in the samples exposed to a concentration of validamycin A (100 mg/l) lower than its MIC50, whereas a 10-fold increase in the validamycin A dose triggered lower trehalose storage, probably due, at least in part, to the moderate toxicity caused by acute exposure of the cells to the drug. The strong antifungal effect of amphotericin B caused similar damage to cell viability over short periods of time (1 h), as previously observed (Fig. 2B and 2D). Thus, taken as a whole, the residual population that survived the antifungal challenge synthesized trehalose de novo to a lesser extent [12]. Consistent with previous findings, in the congenic atc1Δ null cells the intracellular disaccharide content was slightly higher [26].
Table 2. Levels of enzymatic activities URA+ strains CAI-4
atc1Δ (null mutant of C. albicans)
Atc1p nmol glucose · (mg protein)–1
Ntc1p nmol glucose · (mg protein)–1
Catalase mmol min–1 · (mg protein)–1
Atc1p nmol glucose · (mg protein)–1
Ntc1p nmol glucose · (mg protein)–1
Catalase mmol min–1· (mg protein)–1
Control
2.3 ± 0.3 (1.0)
18.5 ± 1.9 (1.0)
0.77 ± 0.05 (1.0)
<0.3
19.1 ± 1.8 (1.0)
1.2 ± 0.3 (1.0)
Validamycin A (0.1 mg/ml) for 4 h at 37 ºC
1.7 ± 0.5 (0.74)
12.9 ± 1.6 (0.7)c
0.65 ± 0.07 (0.84)
<0.3
16.9 ± 1.7 (0.88)a
0.95 ± 0.5 (0.79)
Amphotericin B (0.5 mg/ml) for 1 h at 37 ºC
2.7 ± 0.8 (1.17)
27.2 ± 2,5 (1.47)c
2.8 ± 0.92 (3.63)c
<0.3
29.5 ± 1.4 (1.54)c
4.3 ± 0.2 (3.6)c
Treatment
Numbers in parentheses are the relative activity normalized in relation to the control for each parameter, with the control treatment taken as 1.0. The results are the mean ± SD of three independent measurements. a P < 0.05, bP < 0.01, and cP < 0.001 according to Duncan’s multiple range test.
Int. Microbiol. Vol. 16, 2013
223
Int Microbiol
Validamycin against C. albicans
Fig. 4. Effect of validamycin A on germ-tube formation. (A) Percentage of germ-tube formation induced by human serum. Exponentially growing cultures of CEY.1 (circles) and atc1Δ/atc1Δ (triangles) strains were incubated in YPD medium at 28 °C in the presence (open symbols) or absence (closed symbols) of 0.1 mg validamycin A /ml. At time zero, they were supplemented with sterile human serum (10 %) and incubated at 37 °C. CAI-4 cells grown at 28 °C without serum were run in parallel (filled squares) as the control. Values are the average of two determinations. (B) Germ-tube formation induced in colonies growing on Spider medium. The colony morphologies of strain CAI-4-URA+ on solid Spider medium were analyzed after a 7-day incubation at 37 °C in the presence or absence of 0.1 mg validamycin A /ml. The upper panel shows a whole colony and the lower panel a detail of the border.
Enzymatic activity of the two trehalases and catalase in validamycin-A-treated Candida albicans. To complement these studies, we tested a number of enzymatic activities that may play an important role in protecting the cellular integrity of C. albicans exposed to antifungal treatments [12,26], including in response to validamycin A exposure. In terms of possible changes in the enzymatic pathway involved in trehalose hydrolysis, Atc1p activity showed a certain degree of competitive inhibition in CAI-4- URA+ cells treated with 0.1 mg validamycin A/ml (Table 2), although basal enzymatic levels were very low because the ATC1 gene is subjected to catabolic repression by glucose in YPD medium [25]. As expected, acid trehalase was virtually undetectable in the atc1Δ null mutant (Table 2). Cytosolic Ntc1p activity was also diminished in the presence of validamycin A in CEY.1 cells and, albeit to a lesser extent, in the atc1Δ strain (Table 2). Conversely, amphotericin B caused an increase in this activity, probably because the cells obtained the energy necessary to withstand stress through trehalose degradation. These data also point to a possible inhibitory action of amphotericin B on this cytosolic neutral trehalase. The induction of catalase activity has also been cited as a component of cellular defenses against antifungal exposure [12].
However, there were no significant differences in the activity of this antioxidant between control samples and validamycin-Atreated cells in the two strains analyzed, with higher basal levels in the atc1Δ cells. This is consistent with the observation that the double disruption of ATC1 in C. albicans confers superior resistance to various environmental stresses [25,26]. In turn, in exponentially growing cultures of the studied strains subjected to amphotericin B (0.5 mg/ml) there was a clear activation of catalase, which likely reflected the capacity of the polyene to induce oxidative damage in C. albicans [12]. Therefore, this antioxidant activity seems to be a sensitive mechanism to withstand antifungal treatments that might seriously compromise cell integrity, but it does not appear to act against weak antifungal exposure. In addition, catalase activity was not induced after the addition of validamycin A, at least at the doses used in this study. Effect of validamycin A on germ-tube formation in Candida albicans. The addition of human serum (10 %) to cultures of C. albicans and the simultaneous transfer of the cells from 28 to 37 °C is a rapid and reliable procedure to induce germ-tube formation in this fungus [2]. We therefore analyzed whether validamycin A exerted some influence on the serum-induced dimorphic transition of the
224
Int. Microbiol. Vol. 16, 2013
atc1Δ null mutant compared with the isogenic parental CEY.1 cells. As shown in Fig. 4, the addition of validamycin A (0.1 mg/ml) did not induce any significant variation in the number or kinetics of human-serum-induced germ-tube formation (Fig. 4A). Furthermore, the level of filamentation in CEY.1 colonies that developed on Spider medium was not modified upon the addition of the inhibitor (Fig. 4B). Hence, these data suggested that validamycin A did not exert any conspicuous influence on the yeast-to-hypha conversion of C. albicans. Interestingly, the percentage of germ-tube formation recorded after 4 h of induction was similar in CEY.1 and atc1Δ cells, although in the latter strain dimorphic conversion was initially slower (Fig. 4A). This behavior might have well been due to structural perturbations in the intact cell wall that occurred as a consequence of the double disruption of ATC1 [26].
Discussion The analysis of commercially available validamycin A leads us to propose that this compound is a weak antifungal drug against the prevalent opportunistic pathogen C. albicans, as opposed to its customary application against the phytopathogenic fungus R. solani in China and Japan [5,6]. However, in both fungal species, validamycin A acts as a potent competitive inhibitor of cell-wall-linked acid trehalase, Atc1p (Fig. 1, Table 2) [5]. Notably, this compound also caused a significant reduction in cytosolic neutral trehalase activity (Ntc1p) in C. albicans (Table 2), although we do not presently regard Ntc1p inhibition as the main cause of the weak fungicidal effect recorded. This observation suggests that either validamycin A per se or its aglycone fraction (validoxylamine A) is able to cross the cell wall and plasma membrane in order to inhibit cytosolic hydrolases, although more experiments on specific transport are required to confirm this hypothesis. When provided in concentrations lower than the MIC50 (100 mg/l), the drug had less effect on the viability of the CEY.1 strain of C. albicans, while cell damage was virtually negligible in an atc1Δ/atc1Δ mutant lacking functional Atc1p activity. An evident, but still partial, reduction in the level of survival required an increase in the dose of validamycin A to two-fold the MIC50, but this was still only achieved in the parental cells. As expected, atc1Δ null cells were less sensitive to the drug. The usefulness of validamycin A as a clinical antifungal was thus clearly restricted compared with the important amount of cell killing recorded in assays performed with the classical polyene amphotericin B, at least with respect to C. albicans as a pathogenic yeast model (Fig. 2).
guirao-abad et al.
In addition, validamycin A appeared to play no significant role in the induction of an intracellular antioxidant state promoted by catalase activity (Table 2), which might be relevant for counteracting drastic antifungal exposure [12,15]. Furthermore, the content of endogenous trehalose increased after the addition of 0.1 mg validamycin A/ml (Table 1), in agreement with similar results obtained in distinct genetic backgrounds of C. albicans [31]. However, the degree of accumulation was lower in the presence of higher doses and after amphotericin B addition, probably because of the toxic effect provoked by these antifungal treatments (Table 1), whereas there was a slight decrease in antioxidant catalase activity in the presence of validamycin A (Table 2). Of note is the fact that ATC1, which encodes the acid trehalase activity, is not essential in C. albicans. However, it is clearly involved in virulence, since both heterozygous and homozygous mutants have a lower infectivity, as shown in a mouse model [25,26]. Thus, ATC1 is a potential target in the search for and design of new antifungals, although the specific inhibition of Atc1p by validamycin A only caused a partial reduction in cell viability and failed to affect the formation of hyphal structures (Figs. 2 and 4). Changes in the morphological and physical properties of fungal cells (shape, size, height, roughness or stiffness) are among the less well known toxic effects caused by the action of several antifungals, but they have been clearly demonstrated for amphotericin B and 5-flucytosine [14]. In our case, the addition of non-lethal doses of validamycin A caused a small but consistent diminution in cell size with respect to a control sample (Fig. 3). This effect on cell size was obviously dependent on the antifungal power of the compound used; hence, a greater reduction was achieved in cells treated with amphotericin B (Fig. 3). In turn, neither the percentage of serum-induced germ-tube formation by blastospores nor the filamentation recorded in macroscopic colonies grown on Spider medium was modified by exposure to validamycin A (Fig. 4). On the other hand, although trehalose hydrolysis does not seem to be a preferential energy source for serum-induced morphogenesis in C. albicans [2], recent evidence collated from a mutant deficient in the glucose sensing receptor Gpr1 indicated that trehalose acts as negative regulator of filamentous development by counteracting the inhibitory effect of the HSP90 protein [31]. Thus, we conclude that, although validamycin A cannot presently be considered as a suitable clinical antifungal, it is likely to be a promising substrate in the design of new compounds directed against the trehalose metabolism pathway as an antifungal target. This potential should promote future re-
Validamycin against C. albicans
search into the development and testing of new drugs to more effectively combat life-threatening systemic infections caused by C. albicans. Acknowledgements. We thank Dr. J. Tudela (University of Murcia) for helpful suggestions. The experimental work was supported by grant PI12/01797 (Ministerio de Economía y Competitividad, ISCIII, Spain). We are also indebted to the financial contract provided by Cespa Servicios Urbanos de Murcia, S.A. Competing interests: None declared.
References 1. Almirante B, Rodríguez D, Park BJ, et al. (2005) Epidemiology and predictors of mortality in cases of Candida bloodstream infection: Results from popularion-based surveillance, Barcelona, Spain, from 2002 to 2003. J Clin Microbiol 43:1829-1835 2. Álvarez-Peral FJ, Argüelles JC (2000) Changes in external trehalase activity during human serum-induced dimorphic transition in Candida albicans. Res Microbiol 151:837-843 3. Álvarez-Peral FJ, Zaragoza O, Pedreño Y, Argüelles JC (2002) Protective role of trehalose during severe oxidative caused by hydrogen peroxide and the adaptive oxidative stress response in Candida albicans. Microbiology 148:2599-2606 4. Argüelles JC (2000) Physiological roles of trehalose in bacteria and yeast: a comparative analysis. Arch Microbiol 174:217-224 5. Asano N, Yamaguchi T, Kameda Y, Matsui K (1987) Effect of validamycins on glycohydrolases of Rhizoctonia solani. J Antibiot 40:526-532 6. Asano N, Takeuchi M, Kameda Y, Matsui K, Kono Y (1990) Trehalase inhibitors, validoxylamine A and related compounds as insecticides. J Antibiot 43:722-726 7. Asamizu S, Yang J, Almabruk KH, Mahmud T (2011) Pseudoglycosyltransferase catalyzes nonglycosidic C-N coupling in validamycin A biosynthesis. J Am Chem Soc 133:12124-12135 8. Cowen LE, Anderson JB, Kohn LM (2002) Evolution of drug resistance in Candida albicans. Annu Rev Microbiol 56:139-165 9. Eggimann P, Garbino J, Pittet D (2003) Epidemiology of Candida species infections in critically ill non immunosuppressed patients. Lancet Infect Dis 3:685-702 10. El Nemr A, El Ashry SH (2011) Potential trehalase inhibitors: synthesis of trehazolin and its analogues. Adv Carbohydr Chem Biochem 65:45114 11. Goddijn OJM, Verwoerd TC, Voogd E, et al. (1997) Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants. Plant Physiol 113:181-190 12. González-Párraga P, Sánchez-Fresneda R, Zaragoza O, Argüelles JC (2011) Amphotericin B induces trehalose synthesis and simultaneously activates an antioxidant enzymatic response in Candida albicans. Biochim Biophys Acta 1810:777-783 13. Iturriaga G, Suárez R, Nova-Franco B (2009) Trehalose metabolism: From osmoprotection to signaling. Int J Mol Sci 10:3793-3810 14. Kim KS, Kim YS, Han I, Kim MH, Jung MH, Park HK (2011) Quantitative and qualitative analyses of the cell death process in Candida albicans treated by antifungal agents. PLoS One 6:e28176 15. Kim JH, Faria NC, Martins ML, Chan KL, Campbell BC (2012) Enhancement of antimycotic activity of amphotericin B by targeting the oxidative stress response of Candida and Cryptococcus with natural dihydroxybenzaldehydes. Front Microbiol 3:261
Int. Microbiol. Vol. 16, 2013
225
16. Lay J, Henry LK, Clifford J, Kotlin Y, Bulawa CE, Becker JM (1998) Altered expression of selectable marker Ura3 in gene-disrupted Candida albicans strains complicates interpretation of virulence studies. Infect Immun 66:5301-5306 17. Liao Y, Wei ZH, Bai L, Deng Z, Zhong JJ (2009). Effect of fermentation temperature on validamycin A production by Streptomyces hygroscopicus 5008. J Biotechnol 142:271-274 18. López M, Tejera NA, Lluch C (2009) Validamycin A improves the response of Medicago truncatula plants to salt stress by inducing trehalose accumulation in the root nodules. J Plant Physiol 166:1218-1222 19. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-275 20. Martínez-Esparza M, Martínez-Vicente E, González-Párraga P, Ros JM, García-Peñarrubia P, Argüelles JC (2009) Role of trehalose-6P phosphatase (TPS2) in stress tolerance and resistance to macrophage killing in Candida albicans. Int J Med Microbiol 299:453-464 21. Martínez-Esparza M, Tapia-Abellán A, Vitse-Standaert A, García-Peñarrubia P, Argüelles JC, Poulain D, Jouault T (2011) Glycoconjugate expression on the cell wall of tps1/tps1 trehalose-deficient Candida albicans strain and implications for its interaction with macrophages. Glycobiology 21:796-805 22. Müller J, Boller T, Wiemken A (1995) Effects of validamycin A, a potent trehalase inhibitor, and phytohormones on trehalose metabolism in roots and root nodules of soybean and cowpea. Planta 197:362-368 23. Odds FC, Brown AJ, Gow NA (2003) Antifungal agents: mechanisms of action. Trends Microbiol 11:272-279 24. Ortega M, Marco F, Soriano A, Almela M, Martínez JA, López J, Pitart C, Mensa J (2011) Candida species bloodstream infection: epidemiology and outcome in a single institution from 1991 to 2008. J Hosp Infect 77:157-161 25. Pedreño Y, Maicas S, Arguëlles JC, Sentandreu R, Valentin E (2004) The ATC1 gene encodes a cell wall-linked acid trehalase required for growth on trehalose in Candida albicans. J Biol Chem 39:40852-40860 26. Pedreño Y, González-Párraga P, Martínez-Esparza M, Sentandreu R, Valentin E, Argüelles JC (2007) Disruption of the Candida albicans ATC1 gene encoding a cell-linked acid trehalase decreases hypha formation and infectivity without affecting resistance to oxidative stress. Microbiology 153:1372-1381 27. Pfaller MA, Diekema DJ (2007) Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev 20:133-164 28. Pfaller MA, Diekema DJ (2010) Epidemiology of invasive mycoses in North America. Crit Rev Microbiol 36:1-53 29. Robson GD, Kuhn PJ, Trinci AP (1988) Effects of validamycin A on the morphology, growth and sporulation of Rhizoctonia cerealis, Fusarium culmorum and other fungi. J Gen Microbiol 134:3187-3194 30. Sánchez-Fresneda R, González-Párraga P, Esteban O, Laforet L, Valentín E, Argüelles JC (2009) On the biochemical classification of yeast trehalases: Candida albicans contains two enzymes with mixed features of neutral and acid trehalase activities. Biochem Biophys Res Commun 383:98-102 31. Serneels J, Tournu H, Van Dijck P (2012) Tight control of trehalose content is required for efficient heat-induced cell elongation in Candida albicans. J Biol Chem 287:36873-36872 32. Singer MA, Lindquist S (1998) Thermotolerance in Saccharomyces cerevisiae: the Yin and Yang of trehalose. Trends Biotechnol 16:460-468
RESEARCH ARTICLE International Microbiology (2013) 16:227-233 doi: 10.2436/20.1501.01.198 ISSN 1139-6709 www.im.microbios.org
Clonal spread of Klebsiella pneumoniae producing OXA-1 betalactamase in a Spanish hospital Meritxell Cubero,1,2 Laura Calatayud,1,2 Fe Tubau,1,2 Josefina Ayats,1,2 Carmen Peña,3 Rogelio Martín,1 Josefina Liñares,1,2 M. Ángeles Domínguez,1 Carmen Ardanuy1,2 Microbiology Department and 3Infectious Diseases Department, University Hospital of Bellvitge-University of BarcelonaIDIBELL, Barcelona, Spain. 2Network Biomedical Research Center in Respiratory Diseases (CIBERES)
1
Received 21 October 2013 · Accepted 18 December 2013
Summary. Multi-drug resistant Klebsiella pneumoniae isolates are associated with nosocomial infections, in which colonized patients act as a reservoir and source of cross-infection for other patients. In this study, the antimicrobial susceptibility of K. pneumoniae was tested by microdilution using the commercial method MicroScan (Siemens). The genetic relatedness of K. pneumoniae strains was determined by pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). PCR experiments were carried out to obtain primer sets and positive PCR products were purified and sequenced. From May 2007 until December 2009, 98 clonally related K. pneumoniae isolates were detected from clinical samples of 38 patients admitted to the University Hospital of Bellvitge, Barcelona, Spain, including 27 admitted to the intensive care unit (ICU). The most important sources of the isolates were: lower respiratory tract (n = 12), urine (n = 12), and blood (n = 11). The strains were resistant to amoxicillin/clavulanic acid, piperacillin/tazobactam, tobramycin, amikacin, and ciprofloxacin, and had diminished susceptibility to cefepime. All the isolates shared a common PFGE pattern related to sequence type 14 after MLST analysis. In K. pneumoniae isolates and their transconjugants, the blaOXA-1 gene was located in the variable region of a class I integron that also contains the aac(6′)Ib-cr gene. Sequencing of the quinolone resistance determinant regions of gyrA and parC revealed a S83F change in GyrA and no changes in ParC. [Int Microbiol 2013; 16(4):227-233] Keywords: Klebsiella pneumoniae · sequence type ST14 · gene blaOXA-1 · integrons · nosocomial outbreaks
Introduction Klebsiella pneumoniae is a human pathogen that often colonizes the skin and mucosae of hospitalized patients, producing respiratory and urinary tract infections and bacteremia. Multi-
* Corresponding author: C. Ardanuy Departament de Microbiologia Hospital Universitari de Bellvitge 08907 L'Hospitalet de Llobregat, Barcelona, Spain Tel. +34-932607930. Fax +34-932607547 E-mail: c.ardanuy@bellvitgehospital.cat
drug resistant isolates are associated with nosocomial infections, with colonized patients acting as a reservoir and source of cross-infection for other patients [3,16]. However, the genetic elements that encode resistance, especially betalactamases, are now spreading outside the hospital setting such that resistant isolates may also be recovered from patients with communityacquired infections [6]. The virulence of K. pneumoniae strains is related to several bacterial factors, including the polysaccharidic capsule, lipopolysaccharide, iron scavenging systems, and fimbrial and non-fimbrial adhesins [6]. While isolates causing severe community-acquired infections are usually associated with a restricted number of K. pneumoniae
Int. Microbiol. Vol. 16, 2013
serotypes and clones, nosocomial isolates are highly diverse, suggesting that the bacterium is an opportunistic pathogen. Since the clonal complex is a good predictor of the virulence of K. pneumoniae isolates, the use of multilocus sequence typing (MLST) of the strains would improve investigations of nosocomial outbreaks [8]. Multidrug resistance patterns of K. pneumoniae and other enterobacteria are usually associated with the most frequently occurring integrons, those of class I, which carry different resistance determinants in the variable region and can be horizontally transferred intra- and inter-species [11,15]. The structure of class I integrons includes two conserved regions, 5´CS and 3´CS, that flank the gene cassette. The 5´CS conserved segment contains a gene coding for an integrase (intI), a recombination site (attI), and a promoter of the gene cassette. The 3´CS conserved segment contains the qacEΔ1 and sulI genes, which confer resistance to quaternary ammonium compounds and sulfamethoxazole, respectively [11]. The variable region of the integrons is located between these two conserved segments and integrates the resistance genes. The variability of the gene cassettes causes the high diversity of antibiotic resistance [4,11]. Because of the easy bacterial acquisition of gene cassettes and their exchanges under different pressure conditions, many antibiotic resistance combinations are possible. The prolonged use of certain antibiotics also aids in the selection of certain resistance elements and promotes the persistence of multidrug-resistant (MDR) bacteria [4,11]. In our hospital, an active surveillance program against MDR K. pneumoniae started in 1993, after a nosocomial outbreak. Resistance was ascribed to extended-spectrum betalactamase (ESBL)-producing K. pneumoniae [16]. In May 2007, a possible new MDR strain of K. pneumoniae was isolated from a patient admitted to the intensive care unit (ICU). This strain spread in the following years, causing clustered infections throughout the hospital. Here we describe and characterize the K. pneumoniae isolates obtained during the subsequent surveillance program.
Materials and methods Study design and sampling. The present study was performed at the Hospital Universitari de Bellvitge, L’Hospitalet de Llobregat (Barcelona), Spain, a university teaching hospital for adults, with an average yearly admission of 26,000 patients. The hospital has three 12-bed medical-surgical ICUs. The surveillance of MDR K. pneumoniae began in May 2007, after the detection of several MDR non-ESBL K. pneumoniae isolates, and continued until December 2009. Clinical charts of patients were reviewed and assessment was determined using previously described methods [16]. Clinical samples collected within a month of each other from the same patient and that yielded
cubero et al.
Int Microbiol
228
Fig 1. Double disk synergy test of OXA-1-producing Klebsiella pneumoniae. AMP: ampicillin; TIC: ticarcillin; CFO: cefoxitin: NAL: nalidixic acid; AZT: aztreonam; CAZ: ceftazidime; CXM: cefuroxime; CIPR: ciprofloxacin; CTX: cefotaxime; AMC: amoxicillin/clavulanic acid; FO: fosfomycin; NI: nitrofurantoin; IMI: imipenem; FEP: cefepime; GEN: gentamicin; SXT: trimethoprim-sulfamethoxazole. There are synergy of FEP and CTX with AMC.
isolates were considered as representative of different episodes. The isolation of K. pneumoniae from a patient without related signs or symptoms of infection was considered as a colonization. When K. pneumoniae was detected from a patient during an ICU stay or during the first week after ICU discharge, the infection was considered to be ICU-acquired. All other K. pneumoniae cases were considered as non-ICU-acquired. Antimicrobial susceptibility and molecular typing. Antimicrobial susceptibility was tested by microdilution using a commercial method MicroScan (Siemens). The multidrug resistance pattern was assessed by the disk diffusion method. The presence of an ESBL was screened by disk diffusion (Fig. 1) [1]. The genetic relatedness of K. pneumoniae strains was tested by pulsed field gel electrophoresis (PFGE). The entire DNA content was digested with XbaI. DNA-band analysis was performed by visual inspection following the criteria described by Tenover [18]. Strains differing in three or less bands were considered subtypes. Seven isolates were selected for multilocus sequence typing (MLST): two isolates with a common PFGE pattern (one isolated in August 2007 and the other in 2008) and one of each PFGE subtype pattern. MLST was performed following Protocol 2, which recommends universal sequencing primers, as described on the MLST web site of the Institut Pasteur [http://www.pasteur.fr/recherche/genopole/PF8/mlst/Kpneumoniae. html]. The allele’s number and sequence type (ST) were assigned according to the recommendations of this web site. Characterization of the multidrug resistance pattern. Isoelectric focusing of crude extracts was performed in accordance with previous procedures [1]. Strains of K. pneumoniae or their transconjugants were grown for 4 h in lysogeny broth (LB). The cells were then harvested by centrifugation, resuspended in distilled water, and sonicated. The resulting extracts were purified by ultracentrifugation. Isoelectric focusing was
K. pneumoniae betalactamase
Int. Microbiol. Vol. 16, 2013
229
Table 1. Primers used in this study Gene
Primer
Size PCR product
Ref.
blaSHV
SHV fw SHV rev
5′CTTTATCGGCCCTCACTCAA3′ 5′AGGTGCTCATCATGGGAAAG3′
273 bp
[9]
blaTEM
TEM fw TEM rev
5′CGCCGCATACACTATTCTCAGAATGA3′ 5′ACGCTCACCCGCTCCAGATTTAT3′
445 bp
[9]
blaCTX-M
CTX-M fw CTX-M rev
5′ATGTGCAGYACCAGTAARGTKATGGC3′ 5′TGGGTRAARTARGTSACCAGAAYCAGCGG3′
593 bp
[9]
blaOXA
OXA fw OXA rev
5′ACACAATACATATCAACTTCGC3′ 5′AGTGTGTTTAGAATGGTGATC3′
813 bp
[9]
aac(6’)
aac(6’)-Ia aac(6’)-Ib
5′TAATTGCTGCATTCCGC3′ 5′TGTGACGGAATCGTTGC3′
654 bp
[11]
5´CS 3´CS
5′GGCATCCAAGCAGCAAG3′ 5′AAGCAGACTTGACCTGA3′
Variable Variable
[11] [11]
IntI1-F IntI1-R
5′GGTCAAGGATCTGGATTTCG3′ 5′ACATGCGTGTAAATCATCGTC3′
Variable Variable
[12]
sulI
5′TGAAGGTTCGACAGCAC3′
Variable
[11]
parC
parC-up parC-dn
5′CTGAATGCCAGCGCCAAATT3′ 5′TGCGGTGGAATATCGGTCGC3′
319 pb
[5]
gyrA
gyrA-up gyrA-dn
5′CGCGTACTATACGCCATGAACGTA3′ 5′ACCGTTGATCACTTCGGTCAGG3′
589 pb
[5]
performed using the PhastSystem apparatus and polyacrylamide gels with a pH range of 3–9. The gels were then stained with 500 mg nitrocefin/ml, and the isoelectric points (pIs) were obtained by comparison with a set of different betalactamases of known pIs. Conjugation. These experiments were performed in LB using Escherichia coli J53-2 (rifampicin MIC ≥ 100 µg/ml) as recipient. Transconjugants were selected in trypticase soy agar plates containing both rifampicin (100 µg/ml) and tobramycin (16 µg /ml) and tested for antimicrobial susceptibility by disk diffusion and microdilution. PCRs and characterization of integrons. A multiplex PCR assay, which includes detection of the TEM, SHV, OXA, CTX-M9 and CTX-M10 families of betalactamases, was used to characterize the betalactamase gene family members carried in K. pneumoniae strains and their transconjugants [9]. PCR experiments were repeated separately for primer sets that yielded a positive result and the PCR products were purified and sequenced (Table 1). Characterization of ciprofloxacin resistance. Quinoloneresistance-determining regions (QRDR) of GyrA and ParC were amplified and sequenced using the primers and conditions described previously [5]. A PCR assay was performed to detect the presence of the aac(6´)Ib-cr gene. The PCR products were sequenced to detect the quinolonemodifying variant of this enzyme. The detection of class I integrons and the
characterization of their variable region were carried out using previously described procedures (Table 1) [11].
Results and Discussion Description of the outbreak. During the study period (2007–2009), 366 K. pneumoniae strains were isolated from 222 patients. Of these, 98 isolates obtained from the clinical samples of 38 patients shared a multidrug resistance pattern (see below). The mean age of the patients was 60.0 (SD ±18.4; range 19–85 years), and 23 patients (60.5 %) were men. Among the 38 patients studied, the infectious episodes in order of frequency were respiratory tract infection (bronchial aspirate, 7; bronchoalveolar lavage, 3; and tracheal aspirate, 1), bacteremia (9), and urinary tract infection (8). In the remaining ten patients, the isolates were collected from catheter-related samples (4), abdominal samples (3), wounds (2) and cerebrospinal fluid (1). Klebsiella pneumoniae infection was acquired in the ICU in 27 patients. Figure 2 shows the temporal detection pattern in
Int. Microbiol. Vol. 16, 2013
cubero et al.
Int Microbiol
230
Fig. 2. Temporal distribution of newly admitted patients infected with Klebsiella pneumoniae. Striped bars represent patients with ICU-acquired K. pneumoniae, and black bars those patients with non-ICU-acquired K. pneumoniae.
newly admitted patients with clonally related K. pneumoniae infection over the study period. Antibiotic susceptibility, molecular typing, and virulence profile. The isolates showed resistance to aminopenicillins, ureidopenicillins, amoxicillin/clavulanic acid, and piperacillin/tazobactam, and diminished susceptibility to cefepime (MIC range 2–4 µg/ml). They also showed resistance to tobramycin, amikacin, and ciprofloxacin (Table 2). A common PFGE pattern with five different subtypes was observed in all K. pneumoniae strains analyzed. This pattern was different from those determined in other MDR and nonMDR K. pneumoniae strains isolated in the same period (Fig. 3) and was associated with ST14, as confirmed by MLST of seven representative strains (allelic profile: gapA 1, infB 6, mdh 1, pgi 1, phoE 1, rpoB 1, and tonB 1). This ST is the founder of clonal complex 14 (CC14), originally described as nosocomial, which has been detected in many countries [8]. The CC14/K2 clone is associated with reduced lethality in mice, most probably because of the absence of virulence determinants [6]. CC14/K2 strains have been implicated in nosocomial outbreaks related to the global spread of antibiotic resistance [8]. For instance, the Hungarian epidemic clone producing CTX-M-15 belongs to CC14, as does an epidemic carbapenemase-producing clone isolated in various facilities in the Midwestern United States [10]. These epidemic clones,
in analogy to methicillin-resistant Staphylococcus aureus (MRSA) USA300, have been called the “new MRSAs” [7]. However, our results highlight the need for surveillance of all MDR K. pneumoniae strains, not only those that produce carbapenemase or ESBL. Characterization of resistance mechanisms. All strains were PCR-positive for the blaOXA gene, identified as blaOXA-1 after sequencing. On isoelectric focusing, the OXA-1 betalactamase produced a band with a pI of 7.3. This enzyme is widely disseminated in Enterobacteriaceae and is a common cause of amoxicillin/clavulanic acid resistance, especially in E. coli and Salmonella enterica [12,15]. OXA-1 has also been associated with diminished susceptibility to cefepime in E. coli and Pseudomonas aeruginosa [2,4]. The transfer of this betalactamase by conjugation in E. coli J53-2 yielded transconjugants that also exhibited the MDR pattern, with the exception of ciprofloxacin MIC, in which resistance was diminished in the recipient strain (Table 2). PCR followed by sequencing confirmed the presence of the aac(6’)Ib-cr gene in both MDR K. pneumoniae strains and their transconjugants. The resistance to tobramycin and amikacin was due to aac(6’)Ib, encoding an aminoglycoside-modifying enzyme [14]. A new variant of this enzyme, encoded by aac(6’)Ib-cr, has been recently shown to modify quinolones, thus conferring a low level of resistance [4]. QRDR sequencing of GyrA and ParC identified a S83F substitution in GyrA [7]. The presence of a
K. pneumoniae betalactamase
Int. Microbiol. Vol. 16, 2013
231
Table 2. Minimal inhibitory concentration to several antimicrobials of Klebsiella pneumoniae strain and its transconjugants K. pneumoniae strain 8260 TC1
MIC (µg/ml)
MIC (µg/ml)
Ampicillin
≥ 32
≥ 32
Piperacillin
≥ 128
≥ 128
Ticarcillin
≥ 128
≥ 128
Amox/ clavulanic
≥ 32/16
≥ 32/16
Piper/ tazobactam
32
32
Cefuroxime
16
16
Cefotaxime
≤2
≤2
Ceftacidime
≤1
≤1
Cefepime
2
2
Aztreonam
≤1
≤1
Imipenem
≤2
≤2
Gentamicin
≤4
≤4
Tobramycin
≥ 16
≥ 16
32
32
Cotrimoxazole
≥ 4/76
≥ 4/76
Ciprofloxacin
2
0.5
Antimicrobial
Amikacin
GyrA mutation in the strain described here supports the role of the enzyme encoded by aac(6´)-Ib-cr in achieving clinically relevant resistance levels to quinolones, by selection of mutations in QRDR (Table 1) [4]. Since blaOXA-1 is usually integron-located, specific amplifications of antibiotic resistance genes and integron-specific primers were performed (Table 3). These amplifications suggested the presence of a class I integron whose variable region contained two resistance genes: aac(6´) Ib-cr in the first part of the cassette and blaOXA-1 in the second. Nosocomial outbreaks due to MDR enterobacteria have become a serious problem worldwide, especially given the spread of ESBL- or carbapenemase-producing strains [3,16]. The OXA-1 betalactamase is widespread among enterobacteria and it has been described in isolates from hospitalized patients, from patients with community-acquired infections, and from sewage. The widespread distribution of the blaOXA-1 gene is associated with integrons that frequently carry other determinants, such as aac(6´)Ib, ESBLs of the CTX-M family, and carbapenemases. Moreover, class I integrons harboring
Int Microbiol
K. pneumoniae strain 8260
Fig. 3. PFGE patterns of OXA-1-producing Klebsiella pneumoniae isolates after restriction with XbaI. Asterisks (*) indicate contemporary non-clonally related K. pneumoniae strains. m: molecular weight marker.
232
Int. Microbiol. Vol. 16, 2013
cubero et al.
Table 3. Results of PCR reactions performed to characterize the class I integron Primer combination 5´CS and 3´CS
Size of amplified fragmenta 2 kb
aac 6´Ib-cr-fw and OXA-rev
1655 pb
OXA-fw and aac 6´Ib-cr-rev
No amplification
5´CS and aac 6´Ib-cr-rev
500 pb
OXA-fw and 3´CS
700 pb
Intl-fw and aac 6´Ib-cr-rev
2,3 kb
OXA-fw and Sul3
500 pb
Size is approximate
a
blaOXA-1-aac(6’)Ib-cr in the variable region are frequently described in MDR E. coli and Salmonella enteritidis isolates [4,5]. Klebsiella pneumoniae strains of this CC14 have been detected among ESBL-producing isolates in Spain; however, to the best of our knowledge, ours is the first report of clustered infections caused by a non-ESBL-producing K. pneumoniae strain harboring blaOXA-1 and aac(6’)Ib-cr. Moreover, the strain belonged to ST14 and was detected in a hospital setting in Spain [15]. In our studies of other non-MDR non-ESBLproducing K. pneumoniae strains we noted the high variability of these strains, a product of their multiclonality. In addition, the MDR strain belonged to ST14, which has been detected in European countries and in Tanzania, and Argentina [13,15,17]. The detection of these MDR strains in the community is a matter of concern because, in the clinical setting, the prolonged hospitalization of a colonized or infected patient in a high risk unit such as the ICU may allow their spread. These strains are not resistant to the majority of betalactam antibiotics used in clinical practice, and the problem is not as widespread as in the case of ESBL; however, since this multiresistance pattern is integron-located, new resistance determinants could be incorporated that threaten the effectiveness of the therapeutic options currently in use. Acknowledgements. We thank the staff at the Microbiology Department of Hospital Universitari de Bellvitge, for daily contributions to this project. We thank the Institut Pasteur for the platform Genotyping of Pathogens and Public Health (Institute Pasteur, Paris, France), coding MLST alleles, and for the profiles available at [www.pasteur.fr/mlst]. This study was partially supported by Centro de Investigación Biomédica en Red de Enfermedades Respiratorias (CIBERES), run by the Instituto de Salud Carlos III, Madrid, Spain (CB06/06/0037), Spanish Network for Research in Infectious Diseases (REIPI RD12/0015). Competing interests. None declared.
References 1. Ardanuy C, Liñares J, Domínguez MA, Hernández-Allés S, Benedí VJ, Martínez-Martínez L (1998) Outer membrane profiles of clonally related Klebsiella pneumoniae isolates from clinical samples and activities of cephalosporins and carbapenems. Antimicrob. Agents Chemother 42:1636-1640 2. Aubert D, Poirel L, Chevalier J, Leotard S, Pages JM, Nordmann P (2001) Oxacillinase-mediated resistance to cefepime and susceptibility to ceftazidime in Pseudomonas aeruginosa. Antimicrob Agents Chemother 45:1615-1620 3. Bradford PA (2001) Extended-spectrum betalactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev 14:933-951 4. Briales A, Rodríguez-Martínez JM, Velasco C, de Alba PD, RodríguezBaño J, Martínez-Martínez L, Pascual A (2012) Prevalence of plasmidmediated quinolone resistance determinants qnr and aac(6’)-Ib-cr in Escherichia coli and Klebsiella pneumoniae producing extendedspectrum β-lactamases in Spain. Int J Antimicrob Agents 39:431-434 5. Brisse S, Verhoef J (2001) Phylogenetic diversity of Klebsiella pneumoniae and Klebsiella oxytoca clinical isolates revealed by randomly amplified polymorphic DNA, gyrA and parC genes sequencing and automated ribotyping. Int J Syst Evol Microbiol 51:915-924 6. Brisse S, Fevre C, Passet V, Issenhuth-Jeanjean S, Tournebize R, Diacourt L, Grimont P (2009) Virulent clones of Klebsiella pneumoniae: identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS One 4:e4982 7. Damjanova I, Tóth A, Pászti J Hajbel-Vékony G, Jakab M, Berta J, Milch H, Füzi M (2008) Expansion and countrywide dissemination of ST11, ST15 and ST147 ciprofloxacin-resistant CTX-M-15-type betalactamaseproducing Klebsiella pneumoniae epidemic clones in Hungary in 2005the new ‘MRSAs’? J Antimicrob Chemother 62:978-985 8. Diancourt L, Passet V, Verhoef J, Patrick A, Grimont D, Brisse S (2005) Multilocus sequence tiping of Klebsiella pneumoniae nosomial isolates. J Clin Microbiol 43:4178-4182 9. Fang H, Ataker F, Hedin G, Dornbusch K (2008) Molecular epidemiology of extended-spectrum β-lactamases among Escherichia coli isolates collected in a Swedish hospital and its associated health care facilities from 2001 to 2006. J Clinical Microb 46:707-712
K. pneumoniae betalactamase
10. Hrabák J, Empel J, Bergerová T, Fajfrlík K, Urbásková P, KernZdanowicz I, Hryniewicz W, Gniadkowski M (2009) International clones of Klebsiella pneumoniae and Escherichia coli with extended-spectrum β-lactamases in a Czech hospital. J Clin Microbiol 47:3353-3357 11. Lévesque C, Piché L, Larose C, Roy PH (1995) PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 39:185-191 12. Machado E, Coque TM, Cantón R, Baquero F, Sousa JC, Peixe L; Portuguese Resistance Study Group (2006) Dissemination in Portugal of CTX-M-15-, OXA-1-, and TEM-1-producing Enterobacteriaceae strains containing the aac(6´)-Ib-cr gene, which encodes an aminoglycosideand fluoroquinolone-modifying enzyme. Antimicrob Agents Chemother 50:3220-3221 13. Mshana SE, Hain T, Domann E, Lyamuya EF, Chakraborty T, Imirzalioglu C (2013) Predominance of Klebsiella pneumoniae ST14 carrying CTX-M-15 causing neonatal sepsis in Tanzania. BMC Infect Dis 13:466 14. Miró E, Grünbaum F, Gómez L, Rivera A, Mirelis B, Coll P, Navarro F (2013) Characterization of aminoglycoside-modifying enzymes in enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion. Microb Drug Resist 2:94-99
Int. Microbiol. Vol. 16, 2013
233
15. Oteo J, Cuevas O, López-Rodríguez I, Banderas-Florido A, Vindel A, Pérez-Vázquez M, et al., (2009) Emergence of CTX-M-15-producing Klebsiella pneumoniae of multilocus sequence types 1, 11, 14, 17, 20, 35 and 36 as pathogens and colonizers in newborns and adults. J. Antimicrob Chemother 64:524-528 16. Peña C, Pujol M, Ardanuy C, Ricart A, Pallares R, Liñares J, Ariza J, Gudiol F (1998) Epidemiology and successful control of a large outbreak due to Klebsiella pneumoniae producing extended-spectrum betalactamases. Antimicrob Agents Chemother 42:53-58 17. Quiroga MP, Andres P, Petroni A, Soler Bistué AJ, Guerriero L, Vargas LJ, Zorreguieta A, Tokumoto M, Quiroga C, Tolmasky ME, Galas M, Centrón D (2007) Complex Class 1 Integrons with diverse variable regions, including aac(6′)-Ib-cr, and a novel allele, qnrB10, associated with ISCR1 in clinical enterobacterial isolates from Argentina. Antimicrob Agents Chemother 51:4466-4470 18. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B (1995) Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33:2233-2239
RESEARCH ARTICLE International Microbiology (2013) 16:235-242 doi: 10.2436/20.1501.01.199 ISSN 1139-6709 www.im.microbios.org
Bacterial adhesion efficiency on implant abutments: A comparative study Marina Etxeberria,1,2 Lidia López-Jiménez,1 Alexandra Merlos,1 Tomás Escuín,2 Miguel Viñas1* Laboratory of Molecular Microbiology and Antimicrobials. Department of Pathology and Experimental Therapeutics, University of Barcelona, Barcelona, Spain. 2Laboratory of Prosthodontics, Department of Dentistry, Medical and Dentistry Schools, University of Barcelona, IDIBELL, Barcelona, Spain
1
Received 28 October 2013 · Accepted 5 December 2013
Summary. The attachment of Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 28213 onto six different materials used to manufacture dental implant abutments was quantitatively determined after 2 and 24 h of contact between the materials and the bacterial cultures. The materials were topographically characterized and their wettability determined, with both parameters subsequently related to bacterial adhesion. Atomic force microscopy, interferometry, and contact angle measurement were used to characterize the materials’ surfaces. The results showed that neither roughness nor nano-roughness greatly influenced bacterial attachment whereas wettability strongly correlated with adhesion. After 2 h the degree of E. coli attachment markedly differed depending on the material whereas similar differences were not observed for S. aureus, which yielded consistently higher counts of adhered cells. Nevertheless, after 24 h the adhesion of the two species to the different test materials no longer significantly differed, although on all surfaces the numbers of finally adhered E. coli were higher than those of S. aureus. [Int Microbiol 2013; 16(4):235-242] Keywords: implant abutments · glass fiber · bacterial adhesion · nano-roughness · wettability · biomaterials
Introduction Bacteria can grow as sessile forms (biofilms) on almost all surfaces and under almost any environmental condition. In most infectious diseases, particularly those arising from infected implants and medical devices, bacterial growth as biofilms plays Corresponding author: M. Viñas Laboratory de Microbiologia Molecular Facultat de Medicina. Universitat de Barcelona Feixa Llarga s/n 08907 Hospitalet de Llobregat, Spain Tel. +34-934024265 E-mail: mvinyas@ub.edu *
a crucial role in disease pathogenesis [6]. Among all known biofilms occurring in pathologic settings, those in the oral cavity provide a good model system and as such have been extensively studied [13]. Oral biofilms are formed by a wide variety of gram-positive and gram-negative bacteria species and are a consistent feature of oral infections, mainly caries, periodontitis, and endodontitis, but they are also involved in infection-related implant failures, so-called peri-implantitis [23]. The adhesion and development of microbial biofilms depend upon the characteristics of the microbes that form them, but also on the environmental conditions. Chemical and surface properties such as roughness, nano-roughness, and wettability are relevant in controlling bacterial adhesion [28].
236
Int. Microbiol. Vol. 16, 2013
One of the main goals of oral implantology is to significantly reduce the risk of infection, e.g., by altering the local environment such that it is less favorable for bacterial biofilm formation. Accordingly, the elucidation of the mechanisms underlying bacterial adhesion, colonization, and biofilm development on prosthetic devices and implant surfaces is currently an area of great interest in both clinical and biomedical research. From a biomechanical engineering standpoint, the physical properties of implant surfaces can be optimized by taking advantage of recent progress in both materials science and nanotechnology. By modulating cell-substrate interactions, for example, the biological response of the infectious agent can be determined [2,23,27]. The effect of surface topography on cell attachment has received significant attention, with several recently published studies highlighting the critical role in cellular adherence played by nanotopography [19,20,22]. Nano-engineered surfaces can directly influence bacterial behavior, as shown in studies demonstrating that these cells align in the anisotropic direction of microscale ridges and grooves [14]. Based on these findings, a possible approach to restrict biofilm formation involves the use of materials whose surface properties hinder biofilm development, particularly in the early stages of implantation [13]. Different strategies can be adopted to achieve this purpose, such as by altering the nanoscale surface topography. However, there is no consensus regarding whether increased surface roughness correlates either positively or negatively with the extent of bacterial attachment. Clearly, materials enhancing biofilm formation should be discarded even if they have excellent mechanical properties. Metals, ceramics, polymers, and composites are currently used to manufacture prosthetic implant abutments. Among these materials, glass fiber-reinforced composites (glassFRC) are a promising low-cost alternative to metal alloys, metal ceramics, and ceramic restorations. Indeed, in the last few years glass-FRCs have been used successfully in a variety of dental applications [1,10]. Implant-supported fixed prostheses of glass-FRC may also offer a suitable alternative [5,11], but the potential and limitations of this promising material have not been adequately evaluated. A few studies have specifically examined the effect of the nanoscale morphology of dental implant abutment materials, and especially titanium, on surface-bacteria interactions in vitro. However, little is known about the extent of bacterial attachment on nanometrically characterized implant abutment surfaces, whether of titanium or other metals. Experimental approaches to explore topography with respect to bacterial adhesion include experimental bacteriology, atomic force microscopy (AFM), interferometry, and wettability measure-
etxeberria et al.
ments. In this study, we analyzed and compared the surface properties, roughness, and wettability of six test materials used in the manufacture of implant abutments in terms of the adhesion of the gram-positive bacterium Staphylococcus aureus and the gram-negative bacterium Escherichia coli. Our aim was to evaluate the biocompatibility of glass-FRC and the potential application of this material in dentistry.
Materials and methods Dental materials. Disks 10 mm in diameter and 2 mm thick were manufactured from each of six different implant abutment materials. The tested materials were: (i) Cast cobalt-chromium disks obtained from acrylic resin patterns (Pattern Resin LS, GC Corp.) and invested with phosphate-bonded investment material (CM-20 Cendrex+Métaux, Biel/Bienne, Switzerland) as indicated by the manufacturer (BEGO, Bremer Goldschlägerei Wilh. Herbst, Bremen, Germany). Casting was accomplished using Co-Cr Wirobond C alloy (BEGO). After melting and casting by induction (Ducatron Série 3 UGIN’Dentaire, Seyssins, France), the disks were sandblasted with 110-µm aluminum oxide particles (Korox, BEGO) under 3 bar pressure to remove oxide films and residual investment. (ii) Selective laser melted (SLM) Co-Cr disks (BEGO). Both the cast and the SLM Co-Cr disks were polished in three stages: (a) using a hard rubber disk at 15,000 rpm; (b) then with a soft rubber disk at 15,000 rpm, and (c) using a soft brush with a polishing paste at 1400 rpm. Each polishing phase lasted 90 s. (iii) Machined and polished titanium grade V disks (Klockner-Soadco, Andorra). (iv) Zirconia (Y-TZP) disks (Dentisel, Barcelona, Spain). (v) Glass-FRC disks, prepared from rods (Bioloren, Saronno, Varese, Italy). And (vi) polyetheretherketone (PEEK) disks, prepared from rods (Teknimplant, Barcelona, Spain). All disks were handled by their lateral walls. They were gently cleaned using a cotton pellet with ethanol and dried under warm dry air. Surface characterization. The disk surfaces were analyzed by three different methods: (i) Atomic force microscopy. It was carried out with an AFM XE-70 (Park Systems, Korea) in non-contact mode. The rectangularshaped cantilever (ACTA Si-cantilevers, Park Systems) had a force constant of 40 N/m, a resonance frequency of 300 kHz, and a tip radius with a curvature of <10 nm. All AFM variables, including scan rate and set point, were optimized for the type of sample measured. Scan areas were 5 × 5 μm², with a scan rate of 0.6 Hz and a resolution of 256 × 256 pixels. AFM images were processed using a scanning probe image processor XEI (Park Systems), correcting the plane of the AFM image for possible coupling of the lateral plane and the z-axis, caused by the instrument. The height, area, and volume of the surfaces were determined via polygon/ellipse/circle methods, in which a suitable shape is best fitted to the image. The average surface roughness (Ra) was calculated. (ii) White light interferometry; the specimens were visualized on a white light interferometer microscope (LeicaSCAN DCM3D, Leica Microsystems, Switzerland), which is a computerized optical interference microscope operating in the vertical scanning interferometry mode and producing a topographic image. The objective used was Leica N Plan H 50×/0.50, with an Mirau-interferometer objective lens and an image resolution of 250.64 × 190.90 μm². Images were analyzed using the software Leica map DCM 3D 6.2.6561 version (Leica Microsystems); the threshold was set to 1.0% and the Gauss filter to 25 µm. Ra was determined. And (iii) surface wettability measurements; they were conducted by measuring the contact angle using the sessile water-drop method [13,24]. Briefly, 10 µl of MilliQ-quality water was dropped onto the center of each specimen using an injector. Digital photo-
Int. Microbiol. Vol. 16, 2013
Bacterial adhesion
237
Table 1. Bacterial adhesion expressed as colony-forming units (CFU)/mm2 (average of 16 determinations). SLM, selective laser melted; PEEK polyetheretherketone Staphylococcus aureus
Escherichia coli
CFU/mm (2 h)
CFU/mm (24 h)
CFU/mm (2 h)
CFU/mm2 (24 h)
Cast Co-Cr
1.82 × 102
7.74 × 104
6.38 × 101
4.46 × 106
SLM Co-Cr
1.14 × 102
6.38 × 104
4.56
4.92 × 106
Titanium
1.18 × 102
6.83 × 104
1.41 × 101
7.84 × 106
Zirconia
3.42 × 102
3.37 × 105
1.00 × 101
4.92 × 106
GF-reinforced composite
2.64 × 102
4.15 × 105
2.73 × 102
4.24 × 106
PEEK
1.00 × 102
5.92 × 104
2.51 × 102
5.65 × 106
Material
2
2
graphs were taken (Nikon D70) and the resulting images were analyzed using IMAT software (CCIT, Barcelona, Spain). Sixteen samples were measured in each group, with each disk measured twice. Bacterial strains and culture media. Two collection bacterial strains were used to assess the adhesion properties of gram-negative and gram-positive bacteria on the test materials: Escherichia coli strain ATCC 25922 and Staphylococcus aureus strain ATCC 28213, respectively. Both strains were maintained on trypticase soy agar (TSA, Sharlau, Barcelona, Spain) plates. Adhesion experiments were carried out using two colonies selected from the plates to inoculate trypticase soy broth (TSB, Scharlau). The cultures were incubated at 37 ºC in a rotary shaker at 240 rpm in air for 18 h, at which time they had reached the late exponential phase of growth. Adhesion experiments. Disks to be used in the bacterial assays were sterilized in an autoclave (121 ºC, 15 min). The above-described overnight cultures were diluted in TSB to the desired concentration (106 colony forming units [CFU]/ml in TSB), as determined spectrophotometrically. For the adhesion experiment, the disks were covered with a suspension of the bacterial culture and incubated at 37 ºC with gentle (60 rpm.) shaking. samples were taken 2 and 24 h later, processing the disks by washing them four times in Ringer’s 1/4 to remove unattached bacteria and then placing them in test tubes containing 1 ml of Ringer’s 1/4. The tubes were submerged in an ultra-
2
sonic water bath for 3 min, vigorously vortexed for 1 min, and then treated ultrasonically again for 3 min to release the surface-attached bacteria. Serial dilutions (100 to 10–7) of these suspensions were used to inoculate agar plates, which were incubated for 48 h. Colonies were then scored and counted. The detachment of biofilm-forming bacteria from the disks was monitored by microscopic visualization of the disks after sonication and vortexing. Atomic force microscopy imaging. Bacteria were cultured in liquid media in which disks of tested materials were submerged; disks were then washed four-fold by using Ringer’s 1/4 and allowed to dry on air. Samples were imaged in air by using an atomic force microscope XE-70 [Park Systems]. All images were collected in non-contact mode by using rectangularshaped silicon cantilevers with a spring constant of ± 40 N/m and a resonance frequency of ±300 kHz. The upper surface of these cantilevers (the opposite side of the tip) is coated with aluminium to enhance the laser beam reflectivity. The data acquired during the surface scanning were converted into images of topography, amplitude and phase; and analysed by using XEP and XEI software (Park Systems). On topography images, it becomes possible to observe the shape, structure and differences of the sample surface, amplitude images accentuating the edges gives roughness and height information. Finally, the phase images show variations in elasticity and viscoelasticity of the sample. The four types of image were simultaneously acquired with scan size of 25 µm2 at a scan rate of 0.6 Hz.
Table 2. Roughness values as determined by interferometry and atomic force miscroscopy. SLM, selective laser melted; PEEK, polyetheretherketone Roughness
Nanoroughness
White light interferometry
Atomic force interferometry
Ra (µm)
Ra (nm)
Cast Co-Cr
0.0776
48
SLM Co-Cr
0.0388
14
Titanium
0.0474
29
Zirconia
0.108
136
GF-reinforced composite
0.553
236
PEEK
0.113
59
Material
Int. Microbiol. Vol. 16, 2013
Results Bacterial adhesion of gram-positive S. aureus and gram-negative E. coli onto disks of the tested materials were compared. The results are summarized in Table 1. Surface roughness, determined as the mean arithmetic surface roughness (Ra), was characterized by interferometry and AFM, as shown in Table 2. The angles formed between water and the test materials resulted to be as follows: the lowest angle (75º 64′) was formed on zirconia, followed by cast Co-Cr (79º 71′); three of
etxeberria et al.
the tested materials gave quite similar angles: SLM Co-Cr (85º 4′), Titanium (84º 23′) and PEEK (89º 75′), whereas the highest value corresponded to GF-reinforced composite (113º 36′). A set of selected images showing the surface roughness are presented for comparison in Fig. 1 (interferometry) and Fig. 2 (AFM). Imaging of bacterial cells grown as sessile forms onto the different tested material surfaces allowed to distinguish details concerning adhesion and morphologies. Fig. 3 shows two AFM images of both E. coli and S. aureus when developing biofilms onto glass-FRC.
Int Microbiol
238
Fig. 1. Interferometry images of the six surface materials tested. (A) Cast cobalt- chromium. (B) Selective laser melted cobalt-chromium. (C) Titanium. (D) Zirconia (Y-TZP). (E) Glass-FRC. (F) PEEK polyetheretherketone.
Fig. 2. AFM imaging of the six surface materials tested. (A) Cast cobaltchromium. (B) Selective laser melted cobalt-chromium. (C) Titanium. (D) Zirconia (Y-TZP). (E) Glass-FRC. (F) PEEK polyetheretherketone.
Discussion The ability of bacteria to form biofilms is among the most relevant factors in the pathogenesis of peri-implantitis and periodontitis. Since both gram-positive and gram-negative bacteria cause oral infections, in this study representatives of each one (E. coli and S. aureus) were used to determine bacte-
Int. Microbiol. Vol. 16, 2013
239
Int Microbiol
Bacterial adhesion
rial adhesion to the six tested materials. Our primary aim was to compare the efficiency of bacterial adhesion onto implant abutments currently in use, especially glass-FRC in order to assess its potential advantages. This focus reflects current interest in glass-FRC as an alternative to traditionally used materials. A recent report, showed that the use of glass-FRC for implant abutment or restoration material could significantly reduce physical stresses in the bone-implant contact area by
Int. Microbiol. Vol. 16, 2013
etxeberria et al.
Int Microbiol
240
Fig. 3. AFM imaging on glass-FRC disks: (A) Staphylococcus aureus phase; (B) S. aureus topography; (C) Escherichia coli phase; (D) E. coli topography.
acting as shock-absorbers and thus minimize the risk of eventual peri-implant bone loss [18]. However, there is still much to be learned about the potential application of glass-FRC. Progress in nanotechnology allows the design and production of materials, including biomaterials, with surface properties tailored to a given application. Today, one of the main focuses of biomaterials research is the physico-chemical properties of surfaces that determine bacterial adhesion [25]. In this study, the surface parameters of dental materials were measured using three different methodologies. In surface roughness analyses, we found important differences between the studied materials, with glass-FRC being significantly rougher than the other biomaterials examined, both at micro-
and nano-scales. Interferometry measurements of surface roughness showed higher values for glass-FRC than for either zirconia (5-fold) or titanium (10-fold). Similar results were obtained with AFM, which showed that the nano-roughness of glass-FRC was twice that of zirconia and eight times that of titanium. Nonetheless, the high Ra value of glass-FRC falls within the clinically acceptable range [4,25] (Table 2). The most highly polished surface was that of SLM chrome cobalt, followed by titanium. This result contradicts a previous report in which significantly greater differences in the Ra values of similar materials, including laser sinterized chrome cobalt, were reported, although in that study a profilometer was used whereas our measurements were obtained with AFM [16].
Int. Microbiol. Vol. 16, 2013
Bacterial adhesion
Likewise, zirconia was much rougher when assessed using AFM rather than interferometry. The discrepancy could be due to the well-recognized differences in roughness depending on the measurement method used and to the fact that zirconia surfaces are strongly affected by the material preparation procedure. In a recent study, glazing procedures were shown to reduce the surface roughness of Y-TZP [20]. In our study, AFM imaging demonstrated strong surface differences between zirconia and cast Co- Cr, laser sinterized Co-Cr, and titanium (Fig. 2). There have been a few reports examining the relationship between nanoscale topographical details and bacterial adhesion. Microbial adhesion was shown to be sensitive to nanoscale topography (commonly accepted with feature sizes <100 nm) but universal rules of attachment have yet to be determined. For example, some investigators have observed that the attachment of certain bacteria is higher on surfaces with nanophase than with conventional topographies [15,20], while others have found a bacteria-repelling effect of nanophase materials [19]. Our results, like those of do Nascimento et al. [7,8], do not provide insights into the relationship between roughness and bacterial adhesion. In bacterial attachment, contact between the cell and the surface is maximized. This process is aided by the ability of bacteria to assume different morphologies and to alter the number and size of their appendages, such as flagella or pili, or the amount of capsular material depending on the topographical details of the target surface or the physiological state or growth phase [14]. Gains in our knowledge of adhesion properties have important implications for the bioengineering of materials not only for use in the oral cavity but also with respect to a wide range of medical devices. Wettability is another key determinant of bacterial adhesion efficiency. In our study, the degree of surface hydrophobicity positively correlated with the degree of surface roughness, with the roughest surface exhibiting the highest surface hydrophobicity. This correlation is in accordance with the Wenzel model, which explains roughness-induced hydrophobicity [27], and with a 2011 study reporting similar roughness-wettability correlations [15]. Our conclusions regarding bacterial adhesion are based on experiments with two different bacterial species, S. aureus and E. coli, as mechanisms of adhesion are strongly dependent upon the structure of the bacterial envelope and thus reflect the two major types of biological and chemical organization of the bacterial surface. Although our results cannot be mechanistically extended to all microbes, large differences with other oral pathogens are not expected. As seen from the
241
data in Table 1, the dependence of adhesion on the physicochemical properties of the test materials was already evident after 2 h of incubation, since the most polished surface adsorbed the lowest amount of bacteria and vice-versa. After 24 h, differences in bacterial adhesion to the test surfaces were no longer significant, consistent with the findings in previous reports [3, 9]. While at 2 h S. aureus adhered more efficiently, by 24 h E. coli adhesion had increased. Bacterial growth on glass-FRC was similar to that measured on titanium, confirming the results obtained in a previous study [17].The absence of a difference between the different surfaces may have been due to their wettability, since glassFRC, is less wettable than the other materials tested. More research is needed assessing these aspects and other possible factors that may have influenced the results. Acknowledgements.We thank Teresa Tomas for her excellent technical assistance in the preparation of the dental materials. This work was partially supported by “Ajuts a la Recerca” awarded to the School of Dentistry, University of Barcelona. The generous gift of abutment materials from Bego (Bremen, Germany), Klockner-Soadco (Andorra), Dentisel (Barcelona, Spain), Bioloren (Varese, Italy) and Tekniimplant (Barcelona, Spain) is gratefully acknowledged. Competing interests. None declared
References 1. Adbulmajeed A, Walboomers X F, Massera J, Kokkari A K, Vallittu P K, Närhi TO (2013) Blood and fibroblast responses to thermoset BisGMATEGDMA/glass fiber-reinforced composite implants in vitro. Clin Oral Implants Res first published online: 16 apr 2013.doi: 10.1111/clr.12151 2. Anselme K, Davidson P, Popa AM, Giazzon M, Liley M, Ploux L (2010) The interaction of cells and bacteria with surfaces structured at the nanometre scale. Acta Biomater 6:3824-3846 3. Almaguer-Flores A, Olivares-Navarrete R, Wieland M, Ximénez-Fyvie LA, Schwartz Z, Boyan BD (2012) Influence of topography and hydrophilicity on initial oral biofilm formation on microstructured titanium surfaces in vitro. Clin Oral Implants Res 23:301-307 4. Barbosa SH, Zanata RL, Navarro MFL, Nunes OB (2005) Effect of different finishing and polishing techniques on the surface roughness of microfilled, hybrid and packable composite resins. Braz Dent J 16:39-44 5. Behr M, Rosentritt M, Lang R, Handel G. (2001) Glass fiber-reinforced abutments for dental implants. A pilot study. Clin Oral Implants Res 12:174-178 6. Costerton W, Veeh R, Shirtliff M, Pasmore M, Post, C. Ehrlich, G. (2003) The application of biofilm science to the study and control of chronic bacterial infections. J Clin Invest. 112:1466-1477 7. do Nascimento C, da Rocha Aguiar C, Pita MS, Pedrazzi V, de Albuquerque RF Jr, Ribeiro RF (2013) Oral biofilm formation on the titanium and zirconia substrates. Microsc Res Tech 76:126-132 8. do Nascimento C, Pita MS, Fernandes FHNC, Pedrazzi V, de Albuquerque RF Jr, Ribeiro RF (2013) Bacterial adhesion on the titanium and zirconia abutment surfaces. Clin Oral Implants Res 00:1-7; first published online:doi: 10.1111/clr.12093
242
Int. Microbiol. Vol. 16, 2013
9. Egawa M, Miura T, Kato T, Saito A, Yoshinari M (2013) In vitro adherence of periodontopathic bacteria to zirconia and titanium surfaces. Dent Mater J 32:101-106 10. Fischer H, Weber M, Eck M, Erdrich A, Marx R (2004) Finite element and experimental analyses of polymer-based dental bridges reinforced by ceramic bars. J Biomech 37:289-294 11. Freilich MA, Meiers JC, Duncan JP, Eckrote KA, Goldberg AJ (2002) Clinical evaluation of fiber-reinforced fixed bridges. J Am Dent Assoc 133:1524-1534 12. Gittens RA, Olivares-Navarrete R, Cheng A, et al. (2013) The roles of titanium surface micro/nanotopography and wettability on the differential response of human osteoblast lineage cells. Acta Biomater 9:6268-6277 13. Gorth DJ, Puckett S, Ercan B, Webster TJ, Rahaman M, Bal BS (2012) Decreased bacteria activity on Si3 N4 surfaces compared with PEEK or titanium. Int J Nanomedicine 7:4829-4840 14. Hsu L, Fang J, Borca-Tasciuc DA, Worobo RW, Moraru CI (2013) The effect of micro- and nanoscale topography on the adhesion of bacterial cells to solid surfaces. Appl Environ Microbiol 79:2703-2712 15. Ivanova EP, Truong VK, Webb HK, Baulin VA, Wang JY, Mohammodi N, Wang F, Fluke C, Crawford RJ (2011) Differential attraction and repulsion of Staphylococcus aureus and Pseudomonas aeruginosa on molecularly smooth titanium films. Sci Rep 1:165-177 16. Kilicarslan MA, Ozkan P (2012) Evaluation of retention of cemented laser-sintered crowns on unmodified straight narrow implant abutments. Int J Oral Maxillofac Implants 28:381-387 17. Lassila LV, Garoushi S, Tanner J, Vallittu PK, Söderling E (2009) Adherence of Streptococcus mutans to fiber-reinforced filling composite and conventional restorative materials. Open Dent J 4:227-232 18. Magne P, Silva M, Oderich E, Boff LL, Enciso R. (2013) Damping behavior of implant-supported restorations. Clin Oral Implants Res 24:143-148
etxeberria et al.
19. Puckett S D, Taylor E, Raimondo T, Webster TJ (2010) The relationship between the nanostructure of titanium surfaces and bacterial attachment. Biomaterials 31:706-713 20. Rizzello L, Sorce B, Sabella S, Vecchio G, Galeone A, Brunetti V, Cingolani R, Pompa PP (2011) Impact of nanoscale topography on genomics and proteomics of adherent bacteria. ACS Nano 5:1865-1876 21. Sabrah AH, Cook NB, Luangruangrong P, Hara AT, Bottino MC (2013) Full-contour Y-TZP ceramic surface roughness effect on synthetic hydroxyapatite wear. Dent Mater 29:666-673 22. Singh AV, Patil R, Thombre DK, Gade WN (2013) Micro-nanopatterning as tool to study the role of physicochemical properties on cell-surface interactions. J Biomed Mater Res A 101:3019-3032 23. Subramani K, Jung RE, Molenberg A. Hämmerle CH (2009) Biofilm on dental implants: a review of the literature. Int J Oral Maxillofac Implants 24:616-626 24. Truong VK, Lapovok R, Estrin YS, Rundell S, Wang JY, Fluke CJ, Crawford RJ, Ivanova EP (2010) The influence of nano-scale surface roughness on bacterial adhesion to ultrafine-grained titanium. Biomaterials 31:3674-3683 25. Uçtaşli MB, Bala O, Güllü A (2004) Surface roughness of flowable and packable composite resin materials after finishing with abrasive discs. J Oral Rehabil.31:1197-1202 26. Variola F, Brunski J, Orsini G, Tambasco de Oliveiran P, Wazen R, Nanci, A. (2011) Nanoscale surface modifications of medically-relevant metals:state-of-the art and perspectives. Nanoscale 3:335-3532 27. Wenzel RN (1949) Surface roughness and contact angle. J Phys Colloid Chem 53:1466-1467 28. Zareidoost A, Yousefpour M, Ghaseme B, Amanzadeh A (2012) The relationship of surface roughness and cell response of chemical surface modification of titanium. J Mater Sci Mater Med 23:1479-1488
RESEARCH ARTICLE International Microbiology (2013) 16:243-252 doi: 10.2436/20.1501.01.200 ISSN 1139-6709 www.im.microbios.org
Genetic diversity of terricolous Peltigera cyanolichen communities in different conservation states of native forest from southern Chile Lía Ramírez-Fernández,§ Catalina Zúñiga,§ Marco A. Méndez, Margarita Carú, Julieta Orlando* Department of Ecological Sciences, Faculty of Sciences, University of Chile, Santiago, Chile Received 13 November 2013 · Accepted 29 December 2013
Summary. Decreasing quality of forest habitats is among the major factors leading to a loss of epiphytic lichen diversity. However, there is little information about how this factor influences the diversity of terricolous lichens, which do not grow over living trees and could be less susceptible to such disturbances. In this work we describe the genetic diversity of Peltigera terricolous cyanolichens and their cyanobiont (Nostoc) from three habitats at the Karukinka Natural Park (Tierra del Fuego, southern Chile), which represent different conservation states: native mature-forest (low disturbance intensity), native youngforest (medium disturbance intensity) and grassland (high disturbance intensity). In both forest contexts, a higher diversity and a higher number of unique OTUs (operational taxonomic units) were found. In contrast, in the grassland, the diversity was lower and the Peltigera species were mostly cosmopolitan. The presence of unique OTUs and the higher diversity of lichens in native forest areas highlight the importance of their preservation, indicating that decreasing forest quality also has a negative impact on terricolous lichens diversity. [Int Microbiol 2013; 16(4):243-252] Keywords: Peltigera · Nostoc · lichens · genetic diversity · Karukinka Natural Park · southern Chile
Introduction Cyanolichens, colonize a wide variety of habitats in southern temperate rainforests, mainly because they are capable of performing photosynthesis at low light intensity, rapidly increase Corresponding author: J. Orlando. Departamento de Ciencias Ecológicas Facultad de Ciencias, Universidad de Chile Casilla 653 Santiago, Chile Tel. +56-229787401. Fax +56-222727363 E-mail: jorlando@u.uchile.cl
*
L. Ramírez-Fernández and C. Zúñiga contributed equally to this work and are considered joint first authors §
their photosynthetic activity when rehydrated, and can fix atmospheric nitrogen, contributing to natural reserves of this element in forests [28]. For these reasons, they have been described as an important component in maintaining the biodiversity of forests, particularly in soils with limited amounts of nitrogen [4,11]. Temperate forests of southern Chile are characterized by high levels of vascular flora endemism [8]. Therefore, habitat degradation, which is caused by natural or anthropogenic disturbances, has become one of the most worrying issues in current ecology due to its impact on biodiversity [39]. The main threats to general biodiversity also apply to lichens, the most important being habitat loss. Additionally, ecological factors
Int. Microbiol. Vol. 16, 2013
ramĂrez-fernĂĄndez et al.
Int Microbiol
244
Fig. 1. Sampling region at Karukinka Natural Park, Tierra del Fuego Island,southern Chile.
such as stand level limit the successful establishment of lichens under certain conditions [26,41], suggesting that lichens would also be affected by habitat degradation and changes in management. There are several reports supporting the idea that forest fragmentation may influence the diversity of epiphytic lichen communities (i.e. those that grow on plant species) [e.g., 1,3,5,7,13,16,27], since alterations of forests lead to a reduction in the availability of their substrate, isolating the communities and changing microclimatic conditions [17,23]. Conversely, there is less information on the effects of forest degradation on terricolous lichens (i.e. soil-growing lichens), most of which address the effects of changes in land use due to agriculture and livestock [25,32,35,38]. Additionally, lichens are considered one of the groups of organisms challenged by the taxonomic impediment [10], for
which many parts of the world remain poorly studied. In southern Chile, although certain lichens have been specifically collected [e.g., 6,14,29], many groups are still poorly known and little specialist expertise exists in the country. The biological model of this study were terricolous members of the genus Peltigera growing in different habitats in Tierra del Fuego Island (Chile), in order to determine the relationship between habitat quality and lichen genetic diversity. Most species of Peltigera are terricolous foliose cyanolichens (bipartite associations with cyanobacteria of the genus Nostoc as photobionts) and are one of the main groups involved in nitrogen and carbon fixation in different ecosystems. These characteristics, together with their ability to survive under stressful conditions at degraded areas, make these cyanolichens good colonizers in nutrient-poor environments and essential for ecological succession processes [31].
Diversity of Peltigera from Southern Chile
Int. Microbiol. Vol. 16, 2013
245
Peltigera species are an abundant component of lichen communities in the southernmost forests of the Karukinka Natural Park (Fig. 1), the largest protected area in Tierra del Fuego Island (Chile), which is preserved by the Wildlife Conservation Society (WCS) [33]. This park, which has also the largest area of continuous forests of the Chilean Patagonian region (approx. 150,000 ha), contains most of the diversity of species and habitats in Tierra del Fuego Island, including a diverse cryptogamic flora represented by a great number of mosses and lichens, a high percentage of which are endemic and constitute an important reservoir of diversity [2,8]. Although Karukinka Natural Park is currently a protected area, some primary native forests have suffered anthropogenic disturbances, such as logging or burning, and young forest patches were generated by regrowth of small trees. These secondary young forests are generally a poor habitat for many native species including lichens. In other areas of the park, changes in the forest vegetation are abrupt, generating grasslands, where the habitat loss and the soil degradation are even more severe. This degradation of the native forest produces patches surrounded by degraded areas of grassland [20] with the subsequent generation of landscape heterogeneity and changes in the habitat quality. The main objective of this study was to determine the genetic diversity of the symbiotic components (mycobiont and cyanobiont) of Peltigera lichens in three habitats that represent different disturbance intensities in these southern forests from Tierra del Fuego Island, southern Chile.
zines and venation types, even if they were represented by a single individual. Then, the groups were completed with a random selection between the remaining samples, until a final number of 20 individuals per habitat was reached (Y: K1-K20; M: K21-K40; G: K41-K60). This random selection was assessed separately for each habitat and adjusted for the corresponding frequencies of the different morphologically groups. Examples of the different morphotypes from the three habitats are shown in Fig. 2.
Materials and methods
Sequence alignment and phylogenetic analyses. DNA sequences were manually edited with the Mega5 software (available at http:// www.megasoftware.net), aligned with the Muscle alignment tool and some ambiguously aligned nucleotides were removed prior to analysis. Sequence fragments obtained from both, the mycobionts and the cyanobionts, were subjected to BLASTN queries for an initial verification of their identities by comparison to the non-redundant nucleotide database at GenBank (NCBI). Alignments of both sequence sets were subjected to phylogenetic reconstructions using the maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) methods. MP analyses were performed with the PAUP* 4.0b10 program, using a heuristic search by the tree bisection-reconnection (TBR) algorithm with 10 random additions and retaining 100 trees in each analysis. The statistical confidence of the nodes was evaluated using 1000 bootstrap pseudo-replicates. ML analyses were performed at the PhyML 3.0. online bioinformatic platform (available at http://www.atgc-montpellier.fr/phyml/), selecting the best nucleotide substitution model with the help of the jModelTest 2.1.1 program (available at http://darwin.uvigo.es). The general time-reversible substitution model assuming a gamma distribution (GTR + G) was selected according to the Akaike’s information criterion (AIC). BI was carried out using the Metropolis-coupled Bayesian Markov chain Monte Carlo algorithm (MC)3 implemented in the software MrBayes v. 3.1.2 (available at http://mrbayes.sourceforge.net/download.php). Two independent runs of 10 million generations each were made for both symbiont matrices, sampling the chains every 1000 generations.
Study site and lichens sampling. The sampling sites were located at “Estancia Vicuña” within the Karukinka Natural Park (approx. 300,000 ha) in the Tierra del Fuego Island, southern Chile (Fig. 1). This park is characterized by remnants of primary forests of “southern beeches” (Nothofagus pumilio [Poepp. et Endl.] Krasser, N. betuloides [Mirb.] Oerst. and N. antarctica [Forster] Oerst.), among other southern ecosystems [33]. An exhaustive sampling was performed on January 2011, when thallus fragments from 150 samples of Peltigera lichens separated by at least one meter to each other were collected, more closely to the edge than to the center of each habitat, which represent different conservation states: (i) 50 samples from a matureforest of N. pumilio (low disturbance intensity, M), (ii) 50 from a young-forest of N. pumilio (medium disturbance intensity, Y), and (iii) 50 from a grassland with no forest cover (high disturbance intensity, G). On average, the young-forest samples (Y) were at a distance of approx. 500 m from the mature-forest samples (M), which in turn were about 15 m far from the grassland samples (G). Geo-referencing data were taken for each sample point and the samples were stored in paper bags at room temperature until their analysis. After this initial sampling, a new selection from the 150 individuals was performed. The first step consisted in segregating Peltigera individuals into phenotypically different groups based on the color of the thallus, presence/absence of reproductive structures, sexual/asexual reproductive structures, rhi-
Pre-treatment of the samples and DNA extraction. All lichen thalli were superficially cleaned with a sterile brush and a spatula, and then thoroughly rinsed with sterile water. Eighty to 100 mg from each lichen thallus were mechanically fractioned with a mini-grinder, and DNA was extracted with the PowerSoil DNA Isolation kit (MoBio Laboratories, CA, USA) according to the manufacturer’s instructions. Quality and integrity of the extracted DNA was visualized in 0.8 % (w/v) agarose gels in TAE 1X buffer (40 mM Tris-acetate, 1 mM EDTA [pH 8.0]) stained with GelRed (Biotium, CA, USA). All DNA samples were stored at –20°C until analysis. PCR amplifications and sequencing. From the isolated DNA of each lichen thallus, the fungal 18S rRNA gene was amplified with the specific primers EF4 and EF3 [37], whereas the fungal 28S rRNA gene was amplified using the primers LIC24R [21] and LR7 [24]. On the other hand, the cyanobacterial 16S rRNA gene was amplified with the PCR1 and PCR18 primers [42]. All amplifications were performed according to the cited literature recommendations and using the GoTaq Green Master Mix (GoTaq DNA polymerase in 1X Green GoTaq Reaction Buffer [pH 8.5], 200 µM of each dNTP and 1.5 mM MgCl2) (Promega, WI, USA) in a Maxygene thermocycler (Axygen, CA, USA). The concentration and quality of the amplicons were determined electrophoretically as described above except that 1.2 % (w/v) agarose gels were used. The amplicons obtained from each molecular marker were sequenced (Macrogen, Seoul, South Korea) using the forward primers with a Genetic Analyzer 3730XL (Applied Biosystems, CA, USA). The 18S rRNA, 28S rRNA and 16S rRNA genes sequences obtained from this study, 60 per each molecular marker, were deposited in the GenBank database under accession numbers KC514684 to KC514743, KC514744 to KC514803 and KC514624 to KC514683, respectively.
Int. Microbiol. Vol. 16, 2013
ramírez-fernández et al.
Int Microbiol
246
Fig. 2. Morphotype representatives of the genus Peltigera. Violet frames: samples from young forest; red frames: samples from mature forest; green frame: sample from grassland.
Phylogenetic trees were drawn using the program FIGTREE v1.3.1 [available at http://tree.bio.ed.ac.uk/software/figtree/). For the mycobiont analyses, Solorina saccata isolate AFTOL-ID 127 was used as an out-group (accession numbers DQ973021.1 and DQ973044.1 for the 18S rRNA and 28S rRNA genes nucleotide sequences, respectively), while for the cyanobiont analyses the out-group used was the 16S rRNA gene nucleotide sequence of Anabaena spiroides strain PMC9403 (accession number AJ293116.1). Based on the phylogenetic analyses, an operational definition of the different mycobionts and cyanobionts present in the samples was established. The Peltigera mycobiont OTUs (PmOs) were defined as the statistically supported monophyletic groups identified from the three phylogenetic analyses performed (maximum-likelihood bootstrap values ≥75 %, Bayesian posterior probabilities ≥95 %, and parsimony bootstrap values ≥75 %); each of which was in addition identified, based on sequence data, as a different Peltigera species. On the other hand, the Nostoc cyanobiont OTUs (NcOs) were defined as the sequences with a 100% identity or haplotypes, separating the different cyanobionts according just to the nucleotide identity.
individuals; and (ii) the Margalef index DMg = (S–1)/ln N, where S is the number of OTUs and N is the total number of individuals collected. The diversity of the mycobionts and cyanobionts was determined by the weighted Shannon index (Hw = –∑ wi pi log pi,), where pi is the proportion between the number of individuals of the same OTU and the total number of individuals; and wi is a factor that weights the similarity relationship between OTUs, in this case the average of the genetic p-distances between one OTU and the other OTUs present in each of the three habitats. The relationship between the habitats was estimated based on the weighted frequencies of the mycobionts and cyanobionts using the Bray-Curtis index and the UPGMA algorithm. The correlation between the geographic distances of each individual thallus with respect to the p-distances of the components of each cyanolichen, was performed by means of the Mantel test using the PAST tool v2.16.
Data analyses. In order to ensure that a suitable number of individuals were considered in the analyses, some parameters were calculated based on the mycobiont OTUs detected in each habitat: (i) the coverage estimation Cx = 1 – (Nx/n), where Nx is the number of OTUs and n is the total number of
Sixty fungal 18S rRNA and 28S rRNA genes nucleotide sequences were successfully amplified from the DNA extracted directly from the lichen samples. Both sets were concatenated
Results
Diversity of Peltigera from Southern Chile
247
The analysis allowed the establishment of seven monophyletic groups with strong branch support, which were defined as the operational taxonomic units (OTUs) of the mycobionts and named from PmO1 to PmO7. They were identified with a 100% nucleotide identity, using the BLASTN bioinformatic tool, as P. rufescens (Weiss) Humb. (PmO1), P. “fuscopraetex-
Int Microbiol
and the phylogenetic analyses of MP, ML and BI were performed with a total of 1711 positions in the final dataset. All three methods yielded similar tree topologies with significant and similar support for the groups. Only the best tree obtained from the ML analysis is shown (log-likelihood: –3367.4162; nucleotide frequencies: A = 0.2717, C = 0.1975, G = 0.2756, T = 0.2552) (Fig. 3).
Int. Microbiol. Vol. 16, 2013
Fig. 3. Phylogenetic relationships among Peltigera mycobionts. The phylogeny was based on maximum likelihood analysis of 18S and 28S rRNA genes sequences. Support values are indicated in dashed boxes for nodes that received significant support from at least one method (maximum-likelihood bootstrap values ≥75 %, Bayesian posterior probabilities ≥95%, and maximum-parsimony bootstrap values ≥75 %; ML-BS/pp/MP-BS). KM1-KM20 (violet circles), young forest; KM21-KM40 (red circles), mature forest; KM41-KM60 (green circles), grassland. The names in parentheses next to each sample indicate the Nostoc cyanobiont OTU (NcO) associated with each individual mycobiont. The mycobiont OTUs from PmO1 to PmO7 and the species and complex names are indicated next to the brackets.
248
Int. Microbiol. Vol. 16, 2013
ramírez-fernández et al.
Int Microbiol
Fig. 4. Phylogenetic relationships among Nostoc cyanobionts. The phylogeny was based on Bayesian Inference analyses of 16S rDNA sequences. Support values are indicated in dashed frames for nodes that received significant support from at least one method (maximum-likelihood bootstrap values ≥75 %, Bayesian posterior probabilities ≥95 %, and maximum-parsimony bootstrap values ≥75 %; ML-BS/pp/MP-BS). KC1-KC20 (violet circles): young forest; KC21KC40 (red circles): mature forest; KC41-KC60 (green circles): grassland. The names in parentheses next to each sample indicate the Peltigera mycobiont OTU (PmO) associated with each individual cyanobiont. The cyanobiont OTUs from NcO1 to NcO10 are indicated next to the brackets.
tata” (PmO3), P. extenuata (Nyl.) Vain. (PmO4), P. frigida R. Sant. (PmO5), P. ponojensis Gyeln. (PmO6) and P. hymenina (Ach.) Delise ex Duby (PmO7). PmO2, on the other hand, presented some ambiguities on its 18S rRNA and 28S rRNA genes BLAST analyses, so the ITS (Internal Transcribed Spacers including the 5.8S rRNA gene) was used as a third molecular marker (data not shown). The BLAST analysis showed that it might be related to P. “papuana” described by Sérusiaux et al. [36]. In addition, its ITS1-HR [22] was similar
to the one presented for the P. papuanorum division, but with an insertion of 52 nucleotides. The analyses showed the existence of two main sister clades, the first one consisted of mycobionts from the P. canina complex and included OTUs from PmO1 to PmO6; the other clade consisted on a single OTU, corresponding to PmO7, from the P. neopolydactyla-dolichorizha complex [21]. The most abundant OTU was PmO1, with 25 specimens, being the only one present in all three habitats (Y, M and G;
Int. Microbiol. Vol. 16, 2013
Diversity of Peltigera from Southern Chile
249
Table 1. Weighted Shannon index of mycobionts and cyanobionts per habitat Weighted Shannon Index Mycobionts
Cyanobionts
M
0.0199 ± 0.0006
0.0289 ± 0.0028
Y
0.0115 ± 0.0013
0.0195 ± 0.0019
G
0.0000 ± 0.0000
0.0113 ± 0.0007
M: mature-forest, Y: young-forest, G: grassland. Values are means ± standard deviation.
violet, red and green circles, respectively). The second largest OTU was PmO3, comprising 14 specimens that were present at both forest covered environments (violet and red circles). PmO4 and PmO6 were the third largest groups, with 8 members each; PmO4 was present exclusively at the young forest (violet circles), while PmO6 was present at both forests (violet and red circles). PmO5 was the second smallest OTU with 3 members from the mature forest (red circles); whereas PmO2 was the smallest OTU of this clade, with only one representative from the mature forest (KM38). From the P. neopolydactyla-dolichorhiza complex, PmO7 was the only OTU, with a single member from the mature forest (KM25). The weighted Shannon index of mycobiont OTUs was higher in the matureforest (M), followed by the young forest (Y) and presenting only one mycobiont OTU in the grassland (G) (Table 1). On the other hand, all 60 cyanobacterial 16S rRNA gene nucleotide sequences were successfully amplified from the lichen samples, and every sequencing reaction produced welldefined reads with no evidence of secondary peaks. A final dataset with a total of 717 positions was subjected to phylogenetic analyses of MP, ML and BI and the three methods yielded similar topologies. Only the tree from the BI analysis is shown since it delivered the best resolution between the groups (Fig. 4). The analyses allowed the establishment of 10 haplotypes, named from NcO1 to NcO10. All monophyletic groups obtained significant support, except NcO9, whose position was not determined by any of the performed analyses. Despite that, it was still considered as a group, since the nucleotide sequences of the included samples were 100% identical. There were two main sister clades on the cyanobiont tree. The first included from NcO1 to NcO9, while the second included only NcO10. NcO1 was the largest cyanobiont OTU, with 20 samples present in lichens from both forest-covered environments (violet and red circles). The second largest OTU was NcO8 with 15 samples, 14 of which were found in lichens
from the grassland (green circles) and one from the mature forest (red circles). NcO2 and NcO6 were represented by 7 cyanobiont sequences each; NcO2 cyanobionts were from the young forest and the grassland (violet and green circles, respectively), while NcO6 was exclusively from the young forest (violet circles). NcO5, NcO9 and NcO10 comprised 2, 3 and 3 samples, respectively, whereas NcO3, NcO4 and NcO7 were only formed by a single sequence each. In the case of the diversity of cyanobiont OTUs, the weighted Shannon index was higher than that of the mycobionts and the highest diversity was also present in the mature-forest (M), followed by the young-forest (Y) and the grassland (G) showing the lowest diversity (Table 1). As a measure of the expected species richness, the Margalef index resulted in values of 5.7, 3.7 and 0.7, considering the samples of the mature-forest (M), the young-forest (Y) and the grassland (G), respectively. For the coverage estimation, values were 70%, 80% and 95%, for the mature-forest (M), the young-forest (Y) and the grassland (G), respectively. Finally, when comparing the different environments in terms of the weighted frequencies of each OTU (mycobionts and cyanobionts), the grassland (G) was the most different environment (dissimilarity of 0.91 with the cluster M-Y), while the young-forest (Y) and the mature-forest (M) were more related to each other (dissimilarity of 0.52). Moreover, the correlation of the geographical distances between the samples with respect to the genetic distances of the lichen’s symbiotic components, using the Mantel test, revealed very low values (R = 0.1607, P = 0.0066 and R = 0.2094, P = 0.0002 for mycobionts and cyanobionts, respectively).
Discussion Most of the current research on conservation of lichens biodiversity states that changes in forest cover directly affect epiphytic species. However, they could also affect the micro-
250
Int. Microbiol. Vol. 16, 2013
climatic conditions inside the forests, especially light and moisture, which are key influences to lichens in general, including the terricolous ones [18]. A substantial percentage of species from the native forests of the Karukinka Natural Park are endemic to the Park or to the region, and represent an important reservoir of diversity [2,8]. However, despite several efforts to protect this diversity, there are areas of the Park that present low habitat quality, either by anthropogenic (road construction, logging, introduction of exotic species, etc) or natural (fires, high winds, etc.) factors [33]. A previous baseline study conducted in different areas of the Park determined that in forest habitats, most lichens inhabit the trunks of trees (105 species, 58 %), with fewer species in the canopy (20 species, 19 %) and in the soil (25 species, 23 %). Within the latter, only 6 species of the genus Peltigera were reported, which are fewer species than the ones reported in the present study; even though the 18S rRNA and 28S rRNA genes provide just a conservative estimate of the Peltigera diversity, being slow-evolving compared with ITS, the standard species barcode for fungi [15,34]. The maximum value obtained by the Margalef index (5.7 for M) coincides with the number of species of Peltigera reported in this area in the previous baseline study, which agrees with the highest expected species richness in the forest contexts. Together, these data show that the sampling carried out was enough to cover most of the previously reported Peltigera species richness in the area and represented a substantial portion of the diversity present. The correlation of the geographical distances and the genetic distances of the lichen’s symbiotic components between the samples indicated that the habitat differences appear to be a better descriptor of the diversity of these lichens and their components than the geographic distance. In this work, the diversity of the symbiotic components of Peltigera cyanolichens was quantified to determine the influence of the habitat conservation state. Considering that in microbial systematics there is not a general agreement to define the fundamental biological diversity unit [30], most of the studies based on molecular techniques adopt the concept of operational taxonomic units (OTUs) to define taxa. Therefore, this concept was applied to determine the diversity of the Peltigera symbiotic components based on robust phylogenetic analyses. Our results confirm that in an undisturbed environment, such as a mature native forest, a higher diversity of lichens of the genus Peltigera can be found, including some specimens exclusive of this area. For example, the OTU PmO5 was associated with P. frigida, a cyanolichen that has mainly been
ramírez-fernández et al.
reported in Tierra del Fuego Island [19]. Furthermore, the OTU PmO2 was potentially related to P. “papuana”, which has been only reported in a few places [36]. Strikingly, the cyanobiont OTUs related to the above mentioned mycobiont OTUs were also found exclusively in the mature-forest and associated only with one mycobiont OTU. Hence, some of the lichen fungi found in the mature native forest showed seemingly high photobiont specificity. In the case of the young-forest, lower mycobiont and cyanobiont OTU diversities than in the mature-forest were found. Only one unique mycobiont OTU (PmO4) to this environment, and related to P. extenuata, was detected. Moreover, just two cyanobiont OTUs unique to this environment were found, which coincidentally were associated with the mycobiont PmO4. Members of this species of Peltigera have an asexual reproductive mode [9], which could be related to a low dispersal and a high specificity of the association. In the most degraded environmental context, the grassland, a single mycobiont OTU was found (PmO1, related to the species P. rufescens), which was in turn the only one present in all the three environments. This species has a cosmopolitan distribution and it has been widely reported as one of the most common species of the genus Peltigera in the world [19,21,40]. Members of this species inhabit different environments, their presence is not necessarily linked to a wooded area, and they can often be found in grasslands, open forests (meadows) and high mountain areas [19]. In this environment, PmO1 was associated with four cyanobiont OTUs, accounting for the versatility of this organism, which could be regarded as a pioneer in the successful colonization of an environment. It is known that loss of habitat quality can affect mating systems, causing an increase of inbreeding and an erosion of genetic diversity within populations, with differentiation between populations through stochastic processes associated with genetic drift [12,18]. The presence of unique OTUs and the greatest diversity of lichens in native forest areas highlight the importance of their preservation and thus conserve this important source of diversity. Acknowledgements. The authors acknowledge the support provided by the Wildlife Conservation Society Chile (WCS-Chile) for sampling at the Karukinka Natural Park. A careful and thorough review of the manuscript was provided by three anonymous reviewers; their constructive suggestions have strengthened the manuscript considerably and are appreciated. We are grateful to R. Yahr for the correction of the English language. The research was funded by the project FONDECYT 11100381. Competing interests: None declared.
Diversity of Peltigera from Southern Chile
References 1. Aragón G, Martínez I, Izquierdo P, Belinchón R, Escudero A (2010) Effects of forest management on epiphytic lichen diversity in Mediterranean forests. Appl Veg Sci 13:183-194 2. Arroyo MTK, Riveros M, Peñaloza A, Cavieres L, Faggi AM (1996) Phytogeographic relationships and regional richness patterns of the cool temperate rainforest flora of southern South America. In Lawford RG, Fuentes E, Alaback PB (eds) High-latitude rainforests and associated ecosystems of the west coast of the Americas. Springer-Verlag, New York, USA, pp 134-172 3. Belinchón R, Martínez I, Otálora MAG, Aragón G, Dimas J, Escudero A (2009) Fragment quality and matrix affect epiphytic performance in Mediterranean forest landscape. Am J Bot 96:1974-1982 4. Caldiz MS, Brunet J, Nihlgård B (2007) Lichen litter decomposition in Nothofagus forest of Northern Patagonia: biomass and chemical changes over time. Bryologist 110:266-273 5. Ellis CJ, Coppins BJ, Dawson TP, Seaward MRD (2007) Response of British lichens to climate change scenarios: trends and uncertainties in the projected impact for contrasting biogeographic groups. Biol Conserv 140:217-235 6. Elvebakk A, Morberg R (2002) Foliose and placodioid species of the lichen family Physciaceae in southernmost Chile. Lichenologist 34:311-320 7. Fritz Ö, Gustafsson L, Larsson K (2008) Does forest continuity matter in conservation? A study of epiphytic lichens and bryophytes in beech forests of southern Sweden. Biol Conserv 141:655-668 8. Galloway D (2008) Austral lichenology: 1690-2008. New Zeal J Bot 46:433-521 9. Goffinet B, Miadlikowska J, Goward T (2003) Phylogenetic inferences based on nrDNA sequences support five morphospecies within the Peltigera didactyla complex (lichenized Ascomycota). Bryologist 106:349-364 10. Grube M, Kroken S (2000) Molecular approaches and the concept of species and species complexes in lichenized fungi. Mycol Res 104:1284-1294 11. Guzmán G, Quilhot W, Galloway DJ (1990) Decomposition of species of Pseudocyphellaria and Sticta in a southern Chile forest. Lichenologist 22:325-331 12. Hamrick JL (2004) Response of forest trees to global environmental changes. Forest Ecol Manag 197:323-335 13. Johansson P (2008) Consequences of disturbance on epiphytic lichens in boreal and near boreal forests. Biol Conserv 141:1933-1944 14. Jorgensen PM (2004) Further contributions to the Pannariaceae (lichenized Ascomycetes) of the Southern Hemisphere. In Döbbeler P, Rambold G (eds) Contributions to Lichenology. Festschrift in Honour of Hannes Hertel. Bibliotheca Lichenologica, Berlin, Stuttgart, Germany, pp 229-253 15. Kelly LJ, Hollingsworth PM, Coppins BJ, Ellis CJ, Harrold P, Tosh J, Yahr R (2011) DNA barcoding of lichenized fungi demonstrates high identification success in a floristic context. New Phytol 191:288-300 16. Király I, Nascimbene J, Tinya F, Ódor P (2013) Factors influencing epiphytic bryophyte and lichen species richness at different spatial scales in managed temperate forests. Biodivers Conserv 22:209-223 17. Kivistö L, Kuusinen M (2000) Edge effects on the epiphytic lichen flora of Picea abies in middle boreal Finland. Lichenologist 32:387-398 18. Martínez I, Belinchón R, Otálora MAG, Aragón G, Prieto M, Escudero A (2011) Effects of forest fragmentation on epiphytic lichens in the Mediterranean Region. Ecosistemas 20:54-67 [in Spanish]
Int. Microbiol. Vol. 16, 2013
251
19. Martínez I, Burgaz AR, Vitikainen O, Escudero A (2003) Distribution patterns in the genus Peltigera Willd. Lichenologist 35:301-323 20. McGarigal K, Cushman S (2002) Comparative evaluation of experimental approaches to the study of habitat fragmentation. Ecol App 12:335-345 21. Miadlikowska J, Lutzoni F (2000) Phylogenetic revision of the genus Peltigera (lichen forming Ascomycota) based on morphological, chemical and large subunit nuclear ribosomal DNA data. Int J Plant Sci 161:925-958 22. Miadlikowska J, Lutzoni F, Goward T, Zoller S, Posada D (2003) New approach to an old problem: incorporating signal from gap-rich regions of ITS and nrDNA large subunit into phylogenetic analyses to resolve the Peltigera canina species complex. Mycologia 95:1181-1203 23. Moen J, Jonsson BG (2003) Edge effects on liverworts and lichens in forest patches in a mosaic of boreal forest and wetland. Conserv Biol 17:380-388 24. Moncalvo JM, Rehner SA, Vilgalys R (1993) Systematics of Lyophyllum section Difformia based on evidence from culture studies and ribosomal DNA sequences. Mycologia 85:788-794 25. Motiejûnaitë J, Faùtynowicz W (2005) Effect of land-use on lichen diversity in the transboundary region of Lithuania and northeastern Poland. Ekologija 3:34-43 26. Öckinger E, Niklasson M, Nilsson S (2005) Is local distribution of the epiphytic lichen Lobaria pulmonaria limited by dispersal capacity or habitat quality? Biodivers Conserv 14:759-773 27. Otálora MAG, Martínez I, Belinchón R, Widmer I, Aragón G, Escudero A, Scheidegger C (2011) Remnants fragments preserve genetic diversity of the old forest lichen Lobaria pulmonaria in a fragmented Mediterranean mountain forest. Biodivers Conserv 20:1239-1254 28. Palmqvist K, Sundberg B (2000) Light use efficiency of dry matter gain in five macro-lichens: relative impact of microclimate conditions and species-specific traits. Plant Cell Environ 23:1-14 29. Passo A, Calvelo S (2011) Pannaria byssoidea (Pannariaceae), a new squamulose species from southern South America. Bryologist 114:756-763 30. Pedrós-Alió C (2006) Marine microbial diversity: can it be determined? Trends Microbiol 14:257-263 31. Rai AN, Bergman B, Rasmussen U (eds) Cyanobacteria in symbiosis. Kluwer Academic, Dordrecht, Netherlands 32. Rai H, Upreti DK, Gupta RK (2012) Diversity and distribution of terricolous lichens as indicator of habitat heterogeneity and grazing induced trampling in a temperate-alpine shrub and meadow. Biodivers Conserv 21:97-113 33. Saavedra B, 2006. Karukinka, new model for the conservation of biodiversity. Ambient Desarro 22:21-27 [in Spanish] 34. Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chenb W, Fungal Barcoding Consortium (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA 109:6241-6246 35. Scutari NC, Bertiller MB, Carrera AL (2004) Soil-associated lichens in rangelands of north-eastern Patagonia. Lichen groups and species with potential as bioindicators of grazing disturbance. Lichenologist 36: 405-412 36. Sérusiaux E, Goffinet B, Miadlikowska J, Vitikainen O (2009) Taxonomy, phylogeny and biogeography of the lichen genus Peltigera in Papua New Guinea. Fungal Divers 38:185-224 37. Smit E, Leeflang P, Glandorf B, van Elsas JD, Wernars K (1999) Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel electrophoresis. Appl Environ Microb 65:2614-2621
252
Int. Microbiol. Vol. 16, 2013
38. St. Clair LL, Johansen JR, St. Clair SB, Knight KB (2007) The influence of grazing and other environmental factors on lichen community structure along an Alpine tundra ridge in the Uinta Mountains, Utah. USA. Arct Antarct Alp Res 39:603-613 39. Thuiller W, Araújo MB, Pearson RG, Whittaker RJ, Brotons L, Lavorel S (2004) Biodiversity conservation: uncertainty in predictions of extinction risk. Nature 430:1-2 40. Vitikainen O (1994) Taxonomic revision of Peltigera (lichenized Ascomycotina) in Europe. Acta Bot Fenn 152:1-96
ramírez-fernández et al.
41. Werth S, Wagner HH, Gugerli F, Holderegger R, Csencsics D, Kalwij JM, Scheidegger C (2006) Quantifying dispersal and establishment limitation in a population of an epiphytic lichen. Ecology 87:2037-2046 42. Wilmotte A, Van der Auwera G, De Wachter R (1993) Structure of the 16S ribosomal RNA of the thermophilic cyanobacterium Chlorogloeopsis HTF (‘Mastigocladus laminosus HTF’) strain PCC7518, and phylogenetic analysis. FEBS Lett 317:96-100
PERSPECTIVES International Microbiology (2013) 16:253-257 doi: 10.2436/20.1501.01.201 ISSN 1139-6709 www.im.microbios.org
Next-generation scholarly communication: A researcher’s perspective Jordi Barquinero Gene and Cell Therapy Laboratory, Vall d’Hebron Research Institute (VHIR), Autonomous University of Barcelona, Barcelona, Spain E-mail: jordi.barquinero@vhir.org
Accessing scientific information Only a couple of decades ago, searching and accessing scientific articles in order to remain up to date in one’s field of research was very time-consuming, as it required access to a well-supplied, specialized, physical library (within a university, research institution, hospital, etc.). Nonetheless, the retrieval of some articles was not immediate because they had to be transferred from another library, which implied a delay of several days or even weeks. Fortunately, many changes have occurred since then; indeed, those times are gone and almost forgotten. Among these changes, in the 1990s it became clear that the current model of scientific publishing, which is still the one that prevails, was not only extremely irregular but also raised many ethical issues. The idea of open access (OA) that developed in response paralleled similar movements in many other fields, such as Open Source, which advocated free open software. One of the strongest arguments in favor of OA is the following: if scientific research is mainly paid for by citizens, in the form of taxes, why are its results not freely available to this same society? And why are the rights to disseminate these results in the hands of private commercial publishers? [5]. However, despite the obvious validity
of this argument, OA has been struggling for more than a decade to compete in a world still dominated by the traditional subscription model of scholarly publishing. The director of the Harvard OA Project, Peter Suber, defined OA as “literature that is digital, online, free of charge, and free of most copyright and licensing restrictions.” In a previous article in this journal [1], Ernest Abadal precisely dissected the key concepts of OA, its two different forms, i.e., the gold and green ways, the controversy elicited by the Finch report [3], which overtly advocated the gold way (in which OA journals are sustained by the authors) over the green way (mainly based on freely accessible institutional digital repositories). Abadal also pointed out that the latter strategy has advantages in countries where there are both good digital infrastructures for establishing these repositories and few and relatively modest science publishers, as opposed to countries such as the UK, the USA, Germany, and the Netherlands, where the largest science publishing companies are concentrated. The Finch report has been accused by some OA supporters of serving the interests of the publishing industry. However, as Abadal noted, many voices of authority consider the two ways to be complementary and that both need to be fostered if OA is to succeed. In the present article, I first offer my personal view, as a researcher, in commenting on some of
254
Int. Microbiol. Vol. 16, 2013
the factors that may delay the spread of OA in scholarly publications and then speculate on the future of scholarly communication. In the long history of science, significant leaps forward have often been made in the form of breakthroughs that completely changed the way things were seen or done. Also very often, and almost as an inflexible rule, these revolutions and the people who have led them have been fiercely attacked by those representing mainstreams of conservative opinion. The invention of the printing press by Johannes Gutenberg in the 15th century is an often-cited example of one such breakthrough. The Internet is another, obviously much more recent example, and it has deeply changed the world in just two decades. But the Internet is not only a revolution by itself, it is also a tool that has catalyzed revolutions in other fields. Among them is scholarly publishing, and OA is probably the movement that will change it forever. The Internet and related advances in media distribution have made the print versions of journals unnecessary for a growing number of people all over the world. Similar to what has happened in many other markets that make use of contents that are or have the potential to be virtual, including software, music, books, and movies, the Internet has turned the world of scientific publications on its head. However, for the former markets the change is largely in the way their contents are sold and distributed, while the transformation in scholarly publishing is much deeper, as it is not only formal but also conceptual. And this has to do with the fact that the status quo of scholarly publishing, which is still dominant in 2013, is a tremendously peculiar one. Let’s consider why.
Reasons for a change In the academic world, researchers generally must compete for funding of their scientific projects, with the funds most commonly provided by public local, regional, national, or supranational agencies and ultimately financed by taxpayers. Funding allows researchers to carry out their research and the generated results must be disseminated. Until recently, this last step necessarily involved publication in subscriptionbased journals that, in addition to charging fees to subscribers, often also charged authors to publish or, in some cases, even to submit their manuscripts. Furthermore, the copyright for the published articles was not held by the authors nor by the funding agencies or learned societies that had financed the research, but by the publishers. Although researchers are both the authors and the main target of scholarly publications, and
barquinero
thus, together with taxpayers, the main players in this market, they were left out of the game, as publishers were the recipients of the entire economic profit and held the rights to continued gains. Today, at the beginning of the 21st century, this model of scientific publishing continues to thrive. Over the last decade, institutional subscription fees for academic journals have risen so rapidly that they are making academic libraries, even those of the wealthiest institutions, unsustainable. For instance, institutional subscription fees to the print + online Journal of Comparative Neurology are more than 23,000 euros for countries in the Euro zone. It is therefore not surprising that, in 2012, a faculty council at Harvard University asked students and professors to no longer make use of scientific journals with the highest subscription fees. The recognition of this atypical structure of scholarly publishing and that journal subscriptions are progressively becoming unaffordable has served as a point of no return for the current scholarly publishing system. As for the emergence of the OA movement, the key to its rapid, unstoppable run is the Internet and its limitless potential. Nowadays, many believe that the future of science communication is OA, as its growing rates of implementation seem to show. Will OA fully replace the current subscription-based system? And how long will this take? Nobody yet has the answers to these questions, but perhaps the best indicator of the long-term success of OA is the clear support it has received not only from the governments of the, scientifically speaking, most relevant countries, but also from an increasing number of academic and private institutions. Of course, these institutions have powerful reasons for supporting OA, including ethical ones. Access to research publications is a tremendous limitation for many researchers and health professionals, mainly in developing countries. In this regard, OA is already contributing to democratizing science; more importantly, it is accelerating scientific progress, as an increasing number of people, including scientists, gain free, immediate, and online access to the latest research articles published on any possible subject. OA publishing is especially valuable to scientific enterprises in countries that lack the economic resources to allow their professionals to access subscription-based scientific publications. As for the representation of OA in the global scholarly publishing market, in December 2013 there were 9804 gold OA scholarly journals, according to the Directory of Open Access Journals [http://www.doaj.org]. A list with links to more than 1000 OA journals can be found at [http://www.sciencemedia.de]. However, a report in 2012 noted that gold OA journals represented only 11 % of all scholarly journals [8]. Approximately 17 % of the 1,66 million articles published in
Scholarly communication
2011 and indexed in Scopus (a comprehensive article-level index of scholarly articles) are available by OA through journal publishers, either immediately or after an embargo of 12 months following publication [8]. Despite the optimism that OA generates, its undeniable advantages, and the support it has received from the majority of the most relevant players in science communication, its progress has been surprisingly slow. Many questions regarding the implementation of OA must still be answered, and there is some resistance to its broad acceptance, and not only from publishers. In my opinion, two main reasons explain the reluctance of authors to submit their articles to OA journals: (1) the greater prestige of many of the traditional subscription journals and (2) the perception that publishing in gold OA journals is expensive. Researchers tend to be very conservative, and, understandably, most authors aspire to publish their works in the most renowned journals. This is partly because the majority of their collegues tend to believe that articles published in these journals, which typically have high impact factors (IFs), are intrinsically better than those published in journals with lower IFs, as is the case with most of the current OA journals. This belief is widely shared by media professionals, the average citizen and, even more worrisome, the people responsible for assessing the researcher and his or her research. In fact, as scientists, we and our work are currently evaluated mainly based on the number of authored or co-authored publications and the IFs of the journals in which they were published. In peer evaluations, the articles written by the target researcher are rarely read, nor are his or her possible scientific contributions analyzed. Usually, evaluators simply count the number of papers on the researcher’s CV and the IFs of the journals in which they were published. The use of such metrics is easy and tempting, but it poisons and devaluates the research process and ultimately the results of research. It is like judging people according to the brand of the cars they drive. As the practical value of a research work is no longer defined by the intrinsic contributions it makes, but by the IF of the journal in which it is published, the goal of many becomes publishing more articles, and the higher the IF of the journal that accepts those articles, the better. Fortunately, digital communication allows the use of alternative types of measurements and metrics to assess the impact of an article, ones that are much more immediate and directly related to the article itself and not to the journal that publishes it. These “altmetrics” are able to collect all sorts of references to individual scholarly papers from all across the Internet, by gathering information from blogs, tweets, newspapers, and any other digital source [7].
Int. Microbiol. Vol. 16, 2013
255
Peer review and Open Access A related concern is the misconception that peer review in OA is more relaxed than in conventional subscription journals. This idea is probably fueled by the fact that the acceptance rates for submitted articles are usually higher in many OA publications, as space is not a limitation. Another factor that erodes the trustworthiness of OA is the emergence of “predator” publishers, i.e., illegitimate or blatantly corrupt operators whose sole aim is to make money from authors through articles processing fees, which have largely emerged under the gold OA market. An updated list of suspicious or questionable publishers can be found at [http://scholarlyoa.com/publishers/]. To counteract these threats and to maintain or gain confidence and prestige, OA will have to uphold and strengthen rigorous peer review policies and offer high-quality publishing, so that a significant number of OA journals are at least as reliable, prestigious, and of the same impact as their top conventional subscription-based counterparts. The fact that some OA journals have already gained a strong reputation, with high IFs, in a relatively short period of time indicates that these goals are attainable. In the long term, the best solution will be a progressive change in the mentality of authors, publishers, journalists, and other players in scholarly publishing. This will lead to changes in the distorted current system of research assessment. An example is the Research Excellence Framework, the current UK system for assessing the quality of research, which in 2012 stated that no grant-review panel “will make any use of journal impact factors, rankings, lists or the perceived standing of publishers in assessing the quality of research outputs” [http://www.ref.ac.uk/faq/researchoutputsref2/]. An additional, important concern is the perception that publishing in gold OA journals is costly. For a journal to persist, it has to be sustainable, no matter whether it is OA or not. If the articles are to be made freely available, the costs of publishing them must somehow be covered. One possibility is for authors to pay a fixed amount per article. This is the model adopted by many OA publishers, including the Public Library of Sciences (PLoS) and BioMed Central. Since PloS launched its first journal, PloS Biology, in 2003, it has published more than 100,000 articles. Its journal PLoS One, launched in 2006, is the largest gold OA journal worldwide. PLoS uses the Creative Commons Attribution License (CCAL) for all of the articles it publishes. Under this license, authors retain ownership of the copyright for their articles, but they allow anyone to download, distribute, reuse, modify, reprint, and/or copy them, as long as the original authors and source are cited.
256
Int. Microbiol. Vol. 16, 2013
When, in November 2013, Creative Commons announced a new generation of open licenses (version 4.0) PLoS decided to incorporate them in all of its journals [http://www.plos.org/ plos-welcomes-cc-v4-0-licenses]. PloS One has an acceptance rate for all submissions of almost 70 % (data for the period July 1, 2010–September 30, 2010) and charges 1350 USD per article. The average fee for publishing an article in an OA journal is 900 USD [10], but it may be as high as 3900 USD. It is true that these amounts of money are not negligible, but the fees can be reduced, e.g., in the case of PLoS One, to 500 USD for authors from countries of lower middle income or even waived for authors from lowincome countries. Some institutions also partially or totally cover the costs of publishing articles by their staff researchers in OA. Other models can include authors being subsidized by funders of research. An example is eLife, an OA publication founded by the currently doubly famous (because his 2013 Nobel Prize and his speaking out against “luxury” journals [9]) Randy Schekman in 2012. The exclusively online journal eLife is sustained by the Howard Hughes Medical Institute, the Wellcome Trust, the Max Planck Society, and others. Several current OA journals are subsidized or funded by a variety of institutions and they do not charge authors for submitting their articles. Another relatively new OA publisher of research articles in the biological sciences, medical sciences, and health sciences, Peer J, requires that all authors become members, with pre-paid (before acceptance of the first manuscript) fees ranging from 99 USD (one paper per year) to 299 USD (unlimited papers). An additional concern for many authors who are willing to publish their articles in OA is the fact that some funding agencies, universities, and research institutions do not facilitate the payment of author fees from the projects’ budgets. If publication fees have to be taken from grants, then publication in that journal will have to be seriously considered; otherwise the resources available for research projects will be further reduced, and this at a time of shrinking funds for research. Funding agencies and research institutions will have to be flexible enough to allow payments for publications arising after the investigator’s grants have expired. To gain a foothold in the OA revolution, an increasing number of traditional paid subscription journals have adopted a hybrid model that allows authors to publish their articles as OA upon payment of a fixed fee, usually about 3000 USD. However, although this OA option is likely to increase the number of citations [4], it is only chosen by a small minority, about 1–2 % of authors [2].The number of gold OA journals varies enormously among countries. The USA leads, with 1214 OA journals, followed by Brazil, with 911 (which represents 90 % of all
barquinero
scholarly journals published in that country). Spain is fifth in the ranking, with 522 OA journals (data as of December 2013) [http://tinyurl.comp/p7fcc67].
Digital repositories In the OA green alternative, most experts agree that self-archiving scientific documents in institutional digital repositories can reduce the costs of publishing, which could easily be covered by universities or research institutions. In the biomedical sciences, the largest digital archive of full-text scientific articles is PubMed Central, developed by the US National Library of Medicine, which offers articles that can be read for free, with varying conditions for their reuse. Some participating publishers delay the release of their articles on this database for a period of time after publication in print (usually from six months to one year). PubMed archives, which in May 2013 contained over 2.7 million articles, is growing by around 70,000 articles per year. Another option for the retrieval of full-text OA articles is PubGet [http://pubget.com/]. In addition to providing free access, digital repositories offer the advantage that they store not only traditional but also non-traditional scientific texts, including Ph.D. dissertations, patents, conference proceedings, seminars, presentations, and other kinds of scientifically relevant digital information, collectively known as the “grey literature.” However, in countries with strong science publishers, experts tend to endorse the gold rather than the green way of OA, partly because it is less disruptive with respect to their own interests and allows them to eventually adapt to the new scenario, as they are already doing. On the other hand, in countries like Brazil or Spain, with a relatively short history of science publishing, OA proponents favor the green way. In November 2013 there were more than 2500 OA digital repositories (an updated list can be found at http://www.opendoar.org), and they were in various ways promoted by public research funding agencies (by requiring that their research institutions have their own digital repositories to be eligible for receiving grants). Yet, for areas such as biomedical sciences, digital repositories are still relatively underdeveloped, because authors in these disciplines who choose OA clearly prefer the gold way. For other disciplines, such as mathematics and physics, the situation is different, perhaps because the markets are smaller and authors are much more receptive to green OA. In fact, the digital repository [arXiv.org] has become the most strongly preferred tool for communicating mathematics and physics results. But for those researchers with limited access to the scientific lit-
Int. Microbiol. Vol. 16, 2013
Scholarly communication
257
erature such that they cannot readily obtain the article they are looking for (usually in their attempt to remain up to date in their specific disciplines or topics), there are not many alternatives. Either they have to pay the downloading fee, typically about 30 euros per article (if they have access to a good librarian they can obtain the article through the library), or they can request an electronic reprint by directly contacting the authors (whose email addresses can be easily found through the Internet), or they can try to find colleagues with access to the article, etc.
only a few will survive. However, it is also possible that the OA and non-OA worlds coexist in this future market, at least for a while. The outlook is uncertain and difficult to predict, and there is no guarantee that any particular format will succeed or prevail in the long term as the only one standing. For the moment, as authors continue to submit their research articles to reputable subscription journals, these publishers will lack incentive to turn their traditional model into OA. Still, most people agree that the future of science publication will be better than the status quo [6].
The long road to Open Access
Competing interests. None declared.
Most subscription-based publishers must see a future dominated by OA because they are rapidly adapting to it by adopting either the hybrid model system (today there are more than 4000 such journals) or a direct, “pure” gold OA model. A remarkable recent development is the dramatic increase in these publications, as evidenced by the 13,400 OA articles in 2005 to the 119,900 in 2011. Indeed, the majority of OA articles are published by subscription-based publishers [8]. Nonetheless, in spite of the ethically and non-ethically related reasons that make OA theoretically superior to the traditional model of science publishing, OA is facing tremendous challenges that are slowing its progress. As mentioned above, one of them is the prejudices and attitudes of the scientists themselves. Since journal subscription fees are usually covered by institutional libraries, researchers tend to perceive access to articles as free merchandise, whereas the cost for publishing in OA journals, often hundreds or thousands of dollars per article, comes directly from their own funds or their research grants. Moreover, some authoritative voices have substantial doubts about the future of OA (citing reasons such as poor sustainability and the eventual loss of quality). In 10 or 15 years, perhaps most scientific information will be OA but it is likely that, of the many OA journals and initiatives that arise,
References 1. Abadal E (2013) Gold or green: the debate on Open Access policies. Int Microbiol 16:199-203 2. Björk BC (2012) The hybrid model for open access publication of scholarly articles: A failed experiment? J Am Soc Inform Sc Tech 63:1496-1504 3. Finch J, et al. (2012) Accessibility, sustainability, excellence: how to expand access to research publications. Report of the Working Group on Expanding Access to Published Research Findings. Int Microbiol 16:199-203 4. Gargouri Y, Hajjem C, Larivière V, Gingras Y, Carr L, Brody T, Harnard S (2010) Self-selected or mandated, open access increases citation impact for higher quality research. PLoS One 5:e13636 doi: 10.1371/journal.pone.0013636 5. Guerrero R, Piqueras M (2004) Open access: a turning point in scientific publication. Int Microbiol 7:157-160 6. Guerrero R (2013) Microbiology and the Black Swans. SEMaforo (bulletin of the Spanish Society for Microbiology) 56:3-4 [In Spanish] 7. Kwok R (2013) Research impact: Altmetrics make their mark. Nature 500:491-493 8. Laakso M, Björk BC (2012) Anatomy of open access publishing: a study of longitudinal development and internal structure. BMC Med 10:124 9. Schekman R (2013) How journals like Nature, Cell and Science are damaging science. [http://www.theguardian.com/commentisfree/2013/ dec/09/how-journals-nature-science-cell-damage-science] (Dec. 12, 2013) 10. Solomon DJ, Björk BC (2012) A study of open access journals using article processing charges. J Am Soc Inform Sc Tech 63:1485-1495
Volume 16(4) DECEMBER 2013
Acknowledgement of Institutional Subscriptions International Microbiology staunchly supports the policy of open access (Open Access Initiative, see Int Microbiol 7:157161). Thus, the journal recognizes the help received from the many institutions and centers that pay for a subscription—in spite of the possibility to download complete and current issues of the journal free of charge. We would therefore like to thank those entities. Their generous contribution, together with the efforts of the many individuals involved in preparing each issue of International Microbiology, makes publication of the journal possible and plays an important role in improving and expanding the field of microbiology in the world. Some of those institutions and centers are: Area de Microbiología. Departamento de Biología Aplicada. Universidad de Almería / Biblioteca. Institut Químic de Sarrià. Universitat Ramon Llull. Barcelona / Biblioteca. Instituto Nacional de Seguridad e Higiene en el Trabajo-Ministerio de Trabajo y Asuntos Sociales. Barcelona / Ecologia microbiana. Departament de Genètica i de Microbiologia. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Biblioteca. Institut de Biotecnologia i Biomedicina. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Laboratori d’Ecogenètica. Departament de Microbiologia. Universitat de Barcelona / Departament de Microbiologia i Parasitologia Sanitàries. Facultat de Farmàcia. Universitat de Barcelona / Societat Catalana de Biologia. Institut d’Estudis Catalans. Barcelona / Departamento de Microbiologia. Universidade Federal de Minas Gerais. Belo Horizonte. Brasil / Departamento de Inmunología, Microbiología y Parasitología, Universidad del País Vasco, UPV-EHU. Bilbao / Biblioteca. Universidad de Buenos Aires. Argentina / Biblioteca. Facultad de Ciencias. Universidad de Burgos / Biblioteca. Departamento de Producción Animal CIAMCentro Mabegondo. Abegondo (Coruña) / Laboratorio de Microbioloxia. Universidade da Coruña. Coruña / Biblioteca.
258
Divisió Alimentària del IRTA-Centre de Tecnologia de la Carn. Generalitat de Catalunya. Monells (Girona) / Biblioteca Montilivi. Facultat de Ciències. Universitat de Girona / Área de Microbiología. Departamento de Ciencias de la Salud. Universidad de Jaén / Microbiologia. Departament de Ciències Mèdiques Bàsiques. Facultat de Medicina. Universitat de Lleida / Laboratorio de Microbiología Aplicada. Centro de Biología Molecular. Universidad Autónoma de Madrid-CSIC. Cantoblanco (Madrid) / Laboratorio de Patógenos Bacterianos Intracelulares. Centro Nacional de BiotecnologíaCSIC. Cantoblanco (Madrid) / Grupo de Investigación de Bioingeniería y Materiales (BIO-MAT). Escuela Técnica Superior de Ingenieros Industriales. Universidad Politécnica de Madrid / Biblioteca. Centro de Investigaciones Biológicas, CSIC. Madrid / Merck Sharp & Dohme de España. Madrid / Departamento de Microbiología. Facultad de Ciencias. Universidad de Málaga / Grupo de Fisiología Microbiana. Depto. de Genética y Microbiología. Universidad de Murcia. Espinardo (Murcia) / Library. Department of Geosciences. University of Massachusetts-Amherst. USA / Biblioteca de Ciencias. Universidad de Navarra. Pamplona / Grupo de Genética y Microbiología. Departamento de Producción Agraria. Universidad Pública de Navarra. Pamplona / Microbiología Ambiental. Departamento de Biología. Universidad de Puerto Rico. Río Piedras. Puerto Rico / Biblioteca General. Universidad San Francisco de Quito. Ecuador / Biblioteca. Facultat de Medicina. Universitat Rovira Virgili. Reus / Instituto de Microbiología Bioquímica-Departamento de Microbiología y Genética. CSIC-Universidad de Salamanca / Departamento de Microbiología y Parasitología. Universidad de Santiago de Compostela. Santiago / Laboratorio de Referencia de E. coli (LREC). Facultad de Veterinaria. Universidad de Santiago de Compostela. Lugo / Departamento de Genética. Universidad de Sevilla / Tecnología de los Alimentos. Facultad de Ciencias. Universidad de Vigo / General Library. Marine Biological Laboratory. Woods Hole, Massachusetts, USA.
BOOK REVIEWS International Microbiology (2013) 16:259-262 ISSN 1139-6709, e-ISSN 1618-1095 www.im.microbios.org
Microbiología y Parasitología Médicas G. Prats 2013. Editorial Médica Panamericana, S.A., Madrid, Spain 581 pp, 21 × 28 cm Price: 70.00 € ISBN 978-84-9835-429-4 ISBN 978-84-9835-688-5 (eBook)
In clinical and basic microbiology, as in other fields of knowl edge, the speed that characterizes modern societies and the vast amount of information available increasingly leaves behind illustrative aspects of the origins of ideas and discoveries as well as the bases and foundations of our current “wisdom.” This gap is obvious in university curricula, which must adhere to plans that are for the most part bureaucratically designed, with criteria not always efficient or integrative. Such programs inevitably lead to superficial academic training, as they fail to recognize that the ability to relate facts and ideas is an essential quality of all forms of learning. Today, students know where to find the information they need; the Internet and specialized search engines immediately answer their questions. This same mechanism allows teachers to resolve doubts and to incorporate recent data into their teaching. The usefulness and advantages of the system are obvious; but we need something else, including criteria to select what is being sought, and to assess the information that is retrieved. Focusing on clinical microbiology, there is a vast amount of information that is spread over a large amount of media: books, scientific journals, magazines, and specialized reports both printed and online. The abundance of information may be overwhelming for students, who do not always know how to separate the wheat from the chaff. For this reason, textbooks such as Microbiología y Parasitología Médicas are to be valued. This richly illustrated, 582-page book gathers all the essential contents that physicians and medical students need to know regarding the many subjects that make up such a
vast science as microbiology. Microbiology and parasitology study the causative agents of infectious diseases, as well as the mechanisms that trigger disease and the defense reactions of the host. They also deal with the diagnostic techniques used to identify the organisms that cause infections, and with the treatments that are available. Guillem Prats, author of the book, is Emeritus Professor of Microbiology and Parasitology at the Autonomous University of Barcelona. He is a member of the Research Spanish Net in Infectious Pathology and has devoted all of his professional life to research, medical practice, and academic training, as evidenced by his having authored or coauthored several other textbooks and manuals (Microbiología clínica; Microbiología médica. Cuadernos de prácticas y demostraciones; Guía de terapéutica antimicrobiana). This Microbiología y parasito logía médicas, however, is a much more ambitious work. It covers a wide range of subjects and as such will be of great benefit to medical science students. The author’s experience and the collaboration of 41 experts in different branches of microbiology and medicine, who have reviewed the various sections and chapters of the book, guarantee the quality and scientific rigor of this work. The book is divided into four parts or sections. The first, (I. Introduction to Microbiology), presents the basics of medical microbiology and outlines the main clinical syndromes with an infectious etiology, their pathogenicity, the defense mech anisms used by the body to combat them, and the techniques that allow for their etiologic diagnosis. The causative agents of human infectious diseases are discussed in the following
260
Int. Microbiol. Vol. 16, 2013
part (II. Descriptive Microbiology), which includes a chapter on the drugs to fight them. The fundamentals and concepts of innate and adaptive resistance to antibiotics are discussed in the third part, which includes also a chapter on vaccines (III. Antimicrobials and vaccines). In the last part (IV. Microbiological diagnosis of infective syndromes), the major infectious syndromes are discussed, with descriptions of their etiologic agents, sampling methods, and diagnostic tests. This last part is intended to be used as reference material by students in the preparation of seminars to discuss clinical cases. The book contains learning aids, self assessment exercises, and supplementary material to facilitate the reader’s under standing of the topics covered. There are also tables and boxes that broaden the information in the text, and appendices and summaries that review aspects of general interest. As for teachers, the book has a website that will be updated with useful materials for classes, presentations or seminars, and clinical cases. The author recognizes the collaboration of several coauthors of specific chapters, and reviewers of chapters or sections, all of them experts in the field, and with a broad experience in both research and teaching. Disease is a concept that has been changing since we stopped considering microorganisms only as pathogens and began to regard them in an environmental context. But there is still a long way to go. An appreciation by health science professionals of the role of microorganisms in main
BOOK REVIEWS
taining human health and physiological stability, and the recognition that changes in either one may promote the activity of pathogenic microorganisms would lead to a better understanding of disease and of ways to treat patients with infectious diseases. Wherever there is life, there are microorganisms, and their study is crucial to understanding the biology of all other living beings. Microbiology provides us with insights into all kinds of life on Earth, from prokaryotes, whose origin dates back 3800 million years, as the first and only inhabitants of our planet for a great part of its history, until eukaryotes, which evolved much later, some 1500 million years ago. The study of infectious diseases in humans, which is now considered to be a practical application of microbiology, was indeed at the origin of this science. In summary, Microbiología y parasitología médicas is an excellent textbook on medical microbiology, that can be most useful to students and teachers in the schools of medicine and pharmacy, and also to students and teachers in nursing and biomedical sciences. In addition, it will be of great help to professional physicians or biologists who wish to update their knowledge in the intrincate and continously changing field of infectious diseases. Ricardo Guerrero University of Barcelona
Int. Microbiol. Vol. 16, 2013
BOOK REVIEWS
261
La vida al límite. Carlos Pedrós-Alió
2013. CSIC, Madrid, Spain 142 pp, 13 × 20.5 cm Price: 12 € ISBN 978-84-8319-807-0
The characters created by John le Carré (George Smiley) and Ian Fleming (James Bond 007) live their lives on the edge and to do so they—especially the ineffable 007— rely on sophisticated, clever devices that allow them to fight and triumph against the malevolent forces with which they are confronted. Of the two, Smiley is much more discreet and his challenges are those of the real world, as they arise from the Cold War. But for both men, life always hangs by a thread. Perhaps even more interesting than the heroes from novels and cinema are the flesh and blood individuals who during their lives were faced with extreme situations; some were able to overcome them whereas others met with their death. The first paragraph of La vida al límite summarizes the tragic self-perception of a man’s end. That man was Robert Falcon Scott, who was hopelessly trapped in the open and frozen environment of Antarctica. The limits of life that interest Carlos Pedros-Alio are, however, of another kind. In his book, he delves in the bacterial world, which for many years has captured his mind… certainly not fatally. Based on his first-hand experience, as a long time researcher in microbial ecology, he shares his knowledge of how bacteria resist and adapt to extreme environments, where no other forms of life can be found. To appreciate how that is possible, it is necesary to understand the structure and physiology of cells, both prokaryotic and eukaryotic, and their evolutionary changes. Of equal importance is to understand the complexity and characteristics of the physical environment inhabited by the so-called extremophiles. The author’s passion for his subject is clear, as evidenced in the many examples aimed at facilitating our understanding and enhanced by the pinches of humor sprinkled through the text.
The accumulation of knowledge requires a degree of culture and learning, both of which we typically begin to acquire in high school. What we ourselves must contribute, however, is interest and curiosity. This small—by size—popular-science book on microbiology and microbial ecology builds on our knowledge and piques our curiosity; as such, it will no doubt interest both experts in this field of science and anyone curious about it. To explain what is life, the author begins, literally, at home; specifically, with a look inside our refrigerators and at our spice racks. From almost the beginning of microbiology, microbiologists have been immersed in two crusades aimed at refuting two prominent misperceptions of microbes. One is to make us realize that microbes are by no means inferior to the rest of life, whether human, animal, or plant. The other is to allow us to appreciate that microbes are many other things besides pathogens and that our own survival depends on them. The author engages in both of these battles with a simple sentence that follows his discussion of obsolete classification systems. “So, the great diversity of life is among microorganisms, not among toucans and orchids of the tropics, but in the multitude of bacteria, archaea and microscopic eukaryotes living in all parts of Earth.” And the reason for this greater diversity of microorganisms is the 2500 million years during which they were the only living beings on Earth. That was more than enough time for them to develop an astounding number of survival strategies, including the ability to carry out metabolic activity at temperatures as low as –20 °C. Prokaryotic life also occurs in the deep, in deep subsurface and deep sea environemts, by exploiting CO2 fixation, oil degradation, and ni-
262
Int. Microbiol. Vol. 16, 2013
trogen fixation as nutrient sources. In South Africa, for example, the bacterium Desulfutomaculum and the archaeal Methanobacterium were detected in mines nearly 3.5 km below ground level. There are also suggestions that bacteria have overcome even further limits to life, but these observations await confirmation. The nature and function of the cellular pathways that enable bacterial survival and even growth in extremes of temperature, pH, salinity, radiation, dryness, etc., are truly awe-inspiring. La vida al límite is an example of how research itself has evolved in response to new contributions, both methodological and theoretical, that reflect the talent and curiosity of researchers eager to ask “What if… ? ” and to design experiments that will guide them to the answer. But the author ends his book by also asking the question “what is that for?, ” and even devotes the final chapter to finding out the answer. After reading this short but lovely book, one is left with a few questions of one’s own: Why, given the joys and contributions of science to our daily lives, and to life itself, is it recognized and promoted in advanced countries, but not in Spain? Why is it so difficult, for the public and especially for politicians, to understand that science is a cornerstone in a
BOOK REVIEWS
country’s development? The knowledge gained from basic scientific research will have myriad applications in our future. Ignoring these long term-benefits and instead focusing on those to be had in the short-term encourages and supports mediocrity. In fact, the book points out some of the long-term applied benefits of research, which are abundant and have been derived from the efforts of researchers willing to do the hard work without thought of immediate reward. Thus, in addition to those interested in microbiology and microbial ecology, La vida al límite is highly recommended to politicians, either in the government or in the opposition, as well as their distinguished advisors. For these non-scientists, who might claim that their time for reading is limited, I would suggest that they read pages 130–137. But one hopes that in doing so their curiosity and appreciation will be awakened and that they will read this book, from cover to cover. In any case, his/her secretary can make them a summary that they are able to understand even minimally.
Carmen Chica International Microbiology
INDEX VOLUME 16 International Microbiology (2013) www.im.microbios.org
Contents Volume 16 · 2013 Abadal E à Gold or green: the debate on Open Access policies, 199 DOI: 10.2436/20.1501.01.194 Abdel-Fattah M à Zahran HH Aguilar J à Guzmán K Aguilera L à Guzmán K Alarcón M à Cardenas PA Alegret JO à Bordas M Alippi AM à López AC Álvarez MA à Suebwongsa N Araque I à Bordas M Ardanuy C à Cubero M Argüelles JC à Guirao-Abad JP Ayala JA à Hernández SB Ayats J à Cubero M Badia J à Guzmán K Baldoma L à Guzmán K Barquinero J à Next generation scholarly communication: A researcher’s perspective, 253 DOI:10.2436/20.1501.01.201 Barros J à A modular reactor to simulate biofilm development in orthopedic material, 191 DOI: 10.2436/20.1501.01.193 Bedmar EJ à Zahran HH Bell S à Finch J Bellingan L à Finch J Berlanga M à Guerrero R Berenguer J à Year 2013 comments, 211 DOI:10.2436/20.1501.01.197 Bordas M à Isolation, selection, and characterization of highly ethanol-tolerant strains of Oenococcus oeni from south Catalonia, 113 DOI: 10.2436/20.1501.01.186 Bordons A à Bordas M Borrego CM à Plasencia A Calatayud L à Cubero M Campbell R à Finch J Campos E à Guzmán K Cardenas PA à Staphylococcus aureus outbreak in the intensive care unit of the largest public hospital in Quito, Ecuador, 81 DOI: 10.2436/20.1501.01.182 Cardoza RE à Hermosa R Carú M à Ramírez-Fernández L Casadesús J à Hernández SB Chahboune R à Zahran HH Conthe M à Rajhi H Cubero M à Clonal spread of Klebsiella pneumoniae producing OXA-1 betalactamase in a Spanish hospital, 227 DOI:10.2436/20.1501.01.198 Currie CR à Marsh SE
da Silva LF à Tortajada M Díaz E à Rajhi H Divakar PK à Molina MC Domínguez MA à Cubero M Donelly P à Finch J Egginton R à Finch J El Khoury M à Bordas M Escuín Tà Exteberria M Espinel à Cardenas PA Etxeberria M à Bacterial adhesion efficiency on implant abutments: a comparative study, 235 DOI: 10.2436/20.1501.01.199 Falconí G à Cardenas PA Ferraz MP à Barros J Ferreira C à Barros J Filippini M à Wróbel B Fillol M à Plasencia A Finch J à Accessibility, sustainability, excellence: how to expand access to research publications. Executive summary, 125 DOI: 10.2436/20.1501.01.187 Fusté E à The 24th Congress of the Spanish Society for Microbiology (L’Hospitalet de Llobregat, Barcelona, 10–13 July 2013), 205 DOI: 10.2436/20.1501.01.195 García-del Portillo F à Hernández SB Gardner R à Finch J Gich F à Plasencia A Giménez R à Guzmán K González N à Molina MC González-Pastor JE à López-Pérez M Gorosito NB à Marsh SE Grenho L à Barros J Guerrero R à Symbiogenesis: the holobiont as a unit of evolution, 133 DOI: 10.2436/20.1501.01.188 Guirao-Abad JP à Analysis of validamycin as a potential antifungal compound against Candida albicans, 217 DOI: 10.2436/20.1501.01.197 Gutiérrez S à Hermosa R Guzmán K à Characterization of the gene cluster involved in allantoate catabolism and its transcriptional regulation by the RpiR-type repressor HpxU in Klebsiella pneumoniae, 165 DOI: 10.2436/20.1501.01.191
Hall M à Finch J Hall S à Finch J Hashimoto W à A novel bleb-dependent polysaccharide export system in nitrogenfixing Azotobacter vinelandii subjected to low nitrogen gas levels, 35 DOI: 10.2436/20.1501.01.178 Hermosa R à The contribution of Trichoderma to balancing the costs of plant growth and defense, 69 DOI: 10.2436/20.1501.01.181 Hernández SB à Increased bile resistance in Salmonella enterica mutants lacking Prc periplasmic protease, 87 DOI: 10.2436/20.1501.01.183 Jardón-Valadez E à López-Pérez M Jubb M à Finch J Kędra M à Wróbel B Kiley R à Finch J Kuliński K à Wróbel B Liñares J à Cubero M López AC à In vitro interaction between Bacillus megaterium strains and Caco-2 cells, 27 DOI: 10.2436/20.1501.01.177 López-Jiménez L à Exteberria M López-Pérez M à Identification and modeling of a novel chloramphenicol resistance protein detected by functional metagenomics in a wetland of Lerma, Mexico, 103 DOI: 10.2436/20.1501.01.185 Lucas P à Bordas M Lulitanond V à Suebwongsa N Mahmoud AM à Zahran HH Manuel CM à Barros J Margulis L à Guerrero R Marsh SE à Association between Pseudonocardia symbionts and Atta leafcutting ants suggested by improved isolation methods,17 DOI: 10.2436/20.1501.01.176 Martín R à Cubero M Martínez-Esparza M à Guirao-Abad JP Masiulionis VE à Marsh SE Mayo B à Suebwongsa N Melo LF à Barros J Méndez MA à Ramírez-Fernández L Merlos A à Exteberria M Middelboe M à Wróbel B Minnaard J à López AC Mirete S à López-Pérez M
263
Miyamoto Y à Hashimoto W Molina MC à Non-developing ascospores in apothecia of asexually reproducing lichenforming fungi, 145 DOI: 10.2436/20.1501.01.189 Monte E à Hermosa R Monteiro FJ à Barros J Moreno S à Zahran HH Murata K à Hashimoto W Namwat W à Suebwongsa N Narvaez I à Cardenas PA Nicolás C à Hermosa R Nunes OC à Barros J Orlando J à Ramírez-Fernández L Panya M à Suebwongsa N Peña C à Cubero M Pérez PF à López AC Pinto-Tomás A à Marsh SE Piwowarczyk J à Wróbel B Plasencia A à Phylogenetic characterization and quantification of ammonia-oxidizing archaea and bacteria from Lake Kivu in a long-term microcosm incubation, 177 DOI: 10.2436/20.1501.01.192 Poulsen M à Marsh SE Prieto MA à Tortajada M Puyol D à Rajhi H
264
Rajhi H à Dark fermentation: isolation and characterization of hydrogen-producing strains from sludges, 53 DOI: 10.2436/20.1501.01.180 Ramírez-Fernández L à Genetic diversity of terricolous Peltigera cyanolichen communities in different conservation states of native forest from Southern Chile, 243 DOI: 10.2436/20.1501.01.200 Redruello B à Suebwongsa N Reguant C à Bordas M Rico-Pérez G à Hernández SB Rozès N à Bordas M Rubio MB à Hermosa R Salazar R à Cardenas PA Sánchez-Fresneda R à Guirao-Abad JP Sanz JL à Rajhi H Sookprasert S à Suebwongsa N Struwe L à Molina MC Suebwongsa N à Cloning and expression of a codon-optimized gene encoding the influenza A virus nucleocapsid protein in Lactobacillus casei, 93 DOI: 10.2436/20.1501.01.184 Sweeney D à Finch J Sykes P à Finch J Tickell A à Finch J Toloza L à Guzmán K
Tortajada M à Second generation functionalized medium-chain-length polyhydroxyalkanoates: the gateway to highvalue bioplastic applications, 1 DOI: 10.2436/20.1501.01.175 Trueba G à Cardenas PA Tubau F à Cubero M Valentín E à Guirao-Abad JP van der Stelt W à Finch J Viñas M à Exteberria M Viñas M à Fusté E Wissenburg A à Finch J Wróbel B à Low virus to prokaryote ratios in the cold: benthic viruses and prokaryotes in a subpolar marine ecosystem (Hornsund, Svalbard), 45 DOI: 10.2436/20.1501.01.179 Yamamoto M à Hashimoto W Yasser M à Zahran HH Yoneyama F à Hashimoto W Zahran HH à Identification of rhizobial strains nodulating Egyptian grain legumes, 157 DOI: 10.2436/20.1501.01.190 Zhang N à Molina MC Zúñiga C à Ramírez-Fernández L
Authors Index · 2013 Abadal E à 199 Abdel-Fattah M à 157 Aguilar J à 165 Aguilera L à 165 Alarcón M à 81 Alegret JO à 113 Alippi AM à 27 Álvarez MA à 93 Araque I à 113 Ardanuy C à 227 Argüelles JC à 217 Ayala JA à 87 Ayats J à 227 Badia J à 165 Baldoma L à 165 Barquinero J à 253 Barros J à 191 Bedmar EJ à 157 Bell S à 125 Bellingan L à 125 Berenguer J à 211 Berlanga M à 67, 133 Bordas M à 113 Bordons A à 113 Borrego CM à 177 Calatayud L à 227 Campbell R à 125 Campos E à 165 Cardenas PA à 81 Cardoza RE à 69 Carú M à 243 Casadesús J à 87 Chahboune R à 157 Chica C à 261 Conthe M à 53 Cubero M à 227 Currie CR à 17 da Silva LF à 1 Díaz E à 53 Divakar PK à 145 Domínguez MA à 227 Donnelly P à 125 Egginton R à 125 El Khoury M à 113 Escuín T à 235 Espinel M à 81 Etxeberria M à 235 Falconí G à 81 Ferraz MP à 191 Ferreira C à 191 Filippini M à 45 Fillol M à 177
Finch J à 125 Fusté E à 205 García-del Portillo F à 87 Gardner R à 125 Gich F à 177 Giménez R à 165 González N à 145 González-Pastor JE à 103 Gorosito NB à 17 Grenho L à 191 Guerrero R à 65, 133, 259 Guirao-Abad JP à 217 Gutiérrez S à 69 Guzmán K à 165 Hall M à 125 Hall S à 125 Hashimoto W à 35 Hermosa R à 69 Hernández SB à 87 Jardón-Valadez E à 103 Jubb M à 125 Kędra M à 45 Kiley R à 125 Kuliński K à 45 Liñares J à 227 López AC à 27 López-Jiménez L à 235 López-Pérez M à 103 Lucas P à 113 Lulitanond V à 93 Mahmoud AM à 157 Manuel CM à 191 Margulis L à 133 Marsch SE à 17 Martín R à 227 Martínez-Esparza M à 217 Masiulionis VE à 17 Mayo B à 93 Melo LF à 191 Méndez MA à 243 Merlos A à 235 Middelboe M à 45 Minnaard J à 27 Mirete S à 103 Miyamoto Y à 35 Molina MC à 145 Monte E à 69 Monteiro FJ à 191 Moreno S à 157 Murata K à 35
Namwat W à 93 Narvaez I à 81 Nicolás C à 69 Nunes OC à 191 Orlando J à 243 Panya M à 93 Peña C à 227 Pérez PF à 27 Pinto-Tomás A à 17 Piwowarczyk J à 45 Plasencia A à 177 Poulsen M à 17 Prieto MA à 1 Puyol D à 53 Rajhi H à 53 Ramírez-Fernández L à 243 Redruello B à 93 Reguant C à 113 Rico-Pérez G à 87 Rozès N à 113 Rubio MB à 69 Salazar R à 81 Sánchez-Fresneda R à 217 Sanz JL à 53 Sookprasert S à 93 Struwe L à 145 Suebwongsa N à 93 Sweeney D à 125 Sykes P à 125 Tickell A à 125 Toloza L à 165 Tortajada Mà1 Trueba G à 81 Tubau F à 227 Valentín E à 217 van der Stelt W à 125 Vila J à 63 Viñas M à 205, 235 Wissenburg A à 125 Wróbel B à 45 Yamamoto M à 35 Yasser MM à 157 Yoneyama F à 35 Zahran HH à 157 Zhang N à 145 Zúñiga C à 243
265
Keywords Index · 2013 Acinetobacter 81 Actinobacteria 17 Adhesion 27 Alginate 35 Allantoate amidohydrolase 165 Allantoate metabolism 165 Ammonia-monooxygenase alpha subunit (omoA) 177 Ammonia-oxidizing archaea and bacteria 177 Amphotericin B 217 Aphotecia 145 Arabidopsis thaliana 69 Arsenic 103 Atta leaf-cutter ants 17 Azotobacter vinelandii 35 Bacillus megaterium 27 Bacterial adhesion 235 Bacteriobenthos 45 Bile 87 Biofilm formation 191 Biomaterials 191, 235 Bleb-dependent export 35 Caco-2 cells 27 Candida albicans 217 Cellular necrosis 27 Chloramphenicol 103 Clostridium spp. 53 Codon usage 93 Coevolution 133 Continuous flow 191 Dark fermentation 53 Escherichia coli 103 Fermentation pathways 53 Functional metagenomics 103 Functionalization of polymers 1 Gene 16S rRNA 157 Gene blaOXA-1 227 Genetic diversity 243 Germination 145 Glass fiber 235 Heterologous expression 93 Hipersaline environments 65 Holobiome 133 Holobiont 133 Homology models 103 Honey 27 Horizontal transfer 67 Hydrogen production 53
266
Implant abutments 235 Influenza A virus 93 Integrons 227 Kinetic glucose degradation 53 Klebsiella pneumoniae 165, 227 Lactic acid bacteria 93 Lactobacillus casei 93 Lake Kivu 177 Legumes 157 Lichens 243 Limits of life 261 Low-cost substrates 1 Major facilitator superfamily 103 Malolactic fermentation 113 Marine sediment 45 Medical microbiology 259 Medium-chain-length (mcl)-PHAs 1 Membrane proteins 103 Mesorhizobium 157 Metabolism 1 Microbiome 133 Microbiota 133 Microcosm 177 Mixed species 145 Modular reactors 191 MRSA 81 Multi-color CARD-FISH 177 Multilocus sequence typing (MLST) 113 Mutualism 17 Nano-roughness 235 Nitrogen stress 35 Nosocomial outbreaks 81, 227 Nostoc 243 Oenococcus oeni 113 Ontogenetic development 145 Open access 199, 253 Open access policies 199 Orthopedic conditions 191 Orthopedic materials 191 Outer membrane vesicles 35 Peltigera 243 Penicillin-binding proteins 87 Peptidoglycan 87 pH and temperature optimization 53 Phylogenetic trees 157 Physconia spp. 145 Phytohormone networking 69
Plant–Trichoderma symbiosis 69 Polyhydroxyalkanoates (PHAs) 1 Prc protease 87 Pseudomonas spp. 1 Pseudonocardia 17 Purine catabolism 165 Repositories 199, 253 Rhizobium 157 Rhizoctonia solani 217 RpiR-type repressor 165 Salmonella 87 Scientific communication 199 Scientific journals 199 Sequence type ST14 227 Sexual reproduction 145 Southern Chile 243 Spent culture supernatant 27 Stable isotopes 45 Staphylococcal pneumonia 81 Staphylococcus aureus 81 Strain selection 113 Subpolar ecosystems 45 Svalbard archipelago (Norway) 45 Symbiogenesis 133 Symbiosis 17,133 Trehalose 217 Trichoderma spp. 69 Validamycin A 217 Viral nucleocapsid proteins 93 Viriobenthos 45 Wettability 235 Wine production 113 Year 2013 comments 211
List of reviewers · 2013 The editorial staff of International Microbiology thanks the following persons for their invaluable assistance in reviewing manuscripts from January hrough December 2013. The names of several reviewers have been omitted at their request. Aguirre, Juan. Univ. of Prince Edward Island,Charlottetown, PE, Canada Alcami, Antonio. Autonomous University of Madrid, Madrid, Spain Allerberger, Franz. Austrian Agency for H&Food Safety,Wien, Austria Auguet, Jean-Christophe. University of Pau, Pau, France Baldoma, Laura. University of Barcelona, Barcelona, Spain Barreiro, Carlos. University of Leon, León, Spain Barros, Marlene. Portuguese Catholic University, Coimbra, Portugal Berenguer, José. Autonomous University of Madrid, Madrid, Spain Berlanga, Mercedes. University of Barcelona, Barcelona, Spain Besse-Hoggan, Pascale. University Blaise Pascal, Aubiere, France Beuzón, Carmen R. University of Malaga, Málaga, Spain Bonaterra, Anna. University of Girona, Girona, Spain Bordons, Albert. University Rovira Virgili, Tarragona, Spain Camacho, Antonio. University of Valencia, Valencia, Spain Campoy, Susana. Autonomous Univ of Barcelona, Bellaterra, Spain Casadesús, Josep. University of Sevilla, Sevilla, Spain Casanova, Manuel. University of Valencia, Valencia, Spain Collado, M. Carmen. IATA-CSIC, Valencia, Spain Compant, Stephane. University of Toulouse, Castanet-Tolosan, France Coppola, Raffaele. University of Molise, Molise, Italy de Pedro, Miguel A. Center for Molec. Biol., CSIC-UAM, Madrid, Spain Delgado, Susana. Inst. for Dairy Products, IPLA-CSIC, Villaviciosa, Spain Delort, A-Marie. Clermont University, Clermont-Ferrand, France Domenech, Mirian. Center for Biological Research, CSIC, Madrid, Spain Donadio, Stefano. CEO-NAICONS, Milano, Italy Eptstein, Susanne L. FDA, Rockville, MD, USA Ertesvåg, Helga. Norwegian Univ. Sci. &Technology, Trondheim, Norway Estrada de los Santos, Paulina. Natl. School Biol. Sc., México DF, Mexico Galand, Pierre. Oceanographic Observatory of Banyuls, Banyuls, France García-del Portillo, Francisco. CNB, CSIC, Madrid, Spain García, Ernesto. Center for Biological Research, CSIC, Madrid, Spain Gómez-Escribano, Juan Pablo. John Innes Centre, Norwich, UK González-Zorn, Bruno. Complutense University of Madrid, Madrid, Spain Guarro, Josep. University Rovira Virgili, Reus, Spain Guertin, Claude. INRS-Inst. Armand-Frappier, Laval, Québec, Canada Hausseneder, Claudia. Lousiana State University, Baton Rouge, LA, USA Herrero, Enric. University of Lleida, Lleida, Spain Hesham, Abd El-Latif. Assiut University, Assiut, Egypt Hirsch, Ann M. University of California, Los Angeles, CA, USA Hsiang, Chien-Yun. China Medical University, Taiwan, China Jacquet, Stéphan. INRA, France James, Euan K. The James Hutton Institute, Invergowrie, Dundee, UK Jiang, Xiaoxu. University of California-LA, Los Angles, USA Kaasalainen, Ulla. University of Helsinki, Helsinki, Finland
Kolter, Roberto. Harvard University, Cambridge, MA, USA Kong, Wing-Pui. NIH/VRC, Bethesda, MD, USA Lai, Chih-Ho. China Medical University, Taiwan, China Landete, José María. INIA, Madrid, Spain Lasa, Iñigo. Public University of Navarra, Pamplona, Spain Leavitt, Steven. Field Museum of Natural History, Chicago, IL, USA Llirós, Marc. Autonomous University of Barcelona, Bellaterra, Spain López, Francisco. University Rovira Virgili, Tarragona, Spain López López, José. University of Barcelona, Barcelona, Spain Lorito, Matteo. University of Napoli, Napoli, Italia Martínez, Rafael C.R. University of Sao Paulo, Sao Paulo, Brazil Matioli, Graciette. State University of Maringa, Maringá, Brazil Méndez, Beatriz. University of Buenos Aires, Buenos Aires, Argentina Miadlikowska, Jolanta. Duke University, Durham, NC, USA Monte, Enrique. University of Salamanca, Salamanca, Spain Montesinos, Emili. University of Girona, Girona, Spain Muñoz, Rosario. ICTAN-CSIC, Madrid, Spain Nogales, Balbina. Univ. of the Balearic Islands, Palma de Mallorca, Spain Parés, Dolors. University of Girona, Girona, Spain Parra, Francisco. University of Oviedo, Oviedo, Spain Phillips, Alan. New University of Lisbon, Lisbon, Portugal Piqueras, Mercè. Catalan Assoc. Science Comm., Barcelona, Spain Pisabarro, Gerardo. Public University of Navarra, Pamplona, Spain Pucciarelli, Graciela. Autonomous University of Madrid, Madrid, Spain Ramos, Juan Luis. EEZ-CSIC, Granada, Spain Rodríguez, Miguel A. Autonomous University of Madrid, Madrid, Spain Ros, Joaquim. University of Lleida, Lleida, Spain Ross, Tom. University of Tasmania, Hobart, Tasmania Scazzocchio, Claudio. Imperial College, London, UK Schaefer, Frank. Qiagen, Germantown, MD, USA Segura, Ana. EEZ-CSIC, Granada, Spain Singh, Garima. Goethe University Frankfurt, Frankfurt, Germany Suárez, Evaristo. University of Oviedo, Oviedo, Spain Todorov, Svetoslav. University of Sao Paulo, Sao Paulo, Brazil Torriani, Sandra. Università degli Studi di Verona, Verona, Italy Urmeneta, Jordi. University of Barcelona, Barcelona, Spain Valla, Svein. Norwegian Univ. Sci. & Technology, Trondheim, Norway Vila, Jordi. University of Barcelona, Barcelona, Spain Villa, Tomás G. Univ. of Santiago de Compostela, Stgo. Compostela, Spain Vinuesa, Teresa. University of Barcelona, Barcelona, Spain Viñas, Miquel. University of Barcelona, Barcelona, Spain Wang, Changlu. Rutgers, New Brunswick, NJ, USA Yebra, María Jesús. IATA, CSIC, Paterna, Spain Zinn, Manfred. Institute of Life Technologies, Sion, Switzerland
267
Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686
268
Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter. SI units should be used throughout. For Nomenclature of organisms genus and species names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.
General Information International Microbiology is a quarterly, open-access, peer-reviewed
journal in the fields of basic and applied microbiology. It publishes two kinds of papers: research articles and complements (editorials, perspectives, books, reviews, etc.). Submission Manuscripts must be submitted by one of the authors of the manuscript by e-mail to int.microbiol@microbios.org. As part of the submission process, authors are required to comply with the following items, and submissions may be returned if they do not adhere to these guidelines: 1. The work described has not been published before, including publication on the World Wide Web (except in the form of an Abstract or as part of a published lecture, review, or thesis), nor is it under consideration for publication elsewhere. 2. All the authors have agreed to its publication. The corresponding author signs for and accepts responsibility for releasing this material and will act on behalf of any and all coauthors regarding the editorial review and publication process. 2. The submission file is in Microsoft Word, RTF, or OpenOffice document file format. 3. The manuscript has been prepared in accordance with the journal’s accepted practice, form, and content, and it adheres to the stylistic and bibliographic requirements outlined in “Preparation of manuscripts.” 4. Illustrations and figures are placed separately in another document. Large files should be compressed.
Open access publishing provides immediate, permanent, free online access to the full texts of all the journal’s peer-reviewed research articles. It allows all interested readers to view, download, print, and/or redistribute any article without requiring a subscription on the principle that making research freely available to the public supports a greater global exchange of knowledge. International Microbiology’s open access policy enables a far greater distribution and impact of an author’s work and is in the interest of the scientific community worldwide. The journal’s expenses for providing immediate, permanent, free online access to the full text of research articles are recovered partly from article-processing charges (APC). Currently many research funding agencies not only allow these expenses to be paid from their grants, but also encourage open access publication. The journal’s APC (Open Access Charges, or Fees) is 800.00 €. If a manuscript requires extensive editorial work, an extra charge may be requested. The acceptance of a paper, however, will not depend on the authors’ ability to pay these charges. Individual waiver requests must be done during the submission process and will be considered on a case-to-case basis. Information for Subscribers
The journal is published under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International.
International Microbiology is published quarterly (March, June, September and December). Recommended annual subscription is 300.00 €, plus shipping and handling. Single-issue prices are available upon request. Cancellations must be received by 30 September to take effect at the end of the same year. Change of address: allow six weeks for all changes to become effective. Please contact int.microbiol@microbios.org if you have any questions regarding your subscription.
Information for advertisers
Creative Commons
http://creativecommons.org/licenses/by-nc-nd/4.0/
For advertising inquiries, please contact us at int.microbiol@microbios. org. All advertisements are subject to the publisher’s approval. Disclaimer All articles in International Microbiology will be available on the Internet to any reader at no cost. The journal allows users to freely download, copy, print, distribute, search, and link to the full text of any article provided the authorship and source of the published article is cited, it is not used for commercial purposes and it is not remixed, transformed, or built upon. We recommend authors read about the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License before submitting their paper. Open access and article processing charges
While the contents of this journal are believed to be true and accurate at the date of its publication, neither the authors and editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no guarantee, expressed or implied, with regard to the material contained therein.
p3
INTERNATIONAL MICROBIOLOGY Official journal of the Spanish Society for Microbiology Volume 16 · Number 4 · December 2013 EDITORIAL
Berenguer J Year’s comments for 2013
211
RESEARCH ARTICLES
Guirao-Abad JP, Sánchez-Fresneda R, Valentín E, Martínez-Esparza M, Argüelles JC Analysis of validamycin as a potential antifungal compound against Candida albicans
Ramírez-Fernández L, Zúñiga C, Méndez MA, Carú M, Orlando J Genetic diversity of terricolous Peltigera cyanolichen communities in different conservation states of native forest from southern Chile
243
PERSPECTIVES
217
Cubero M, Calatayud L, Tubau F, Ayats J, Peña C, Martín R, Liñares J, Domínguez MA, Ardanuy C Clonal spread of Klebsiella pneumoniae producing OXA-1 betalactamase in a Spanish hospital
227
Etxeberria M, López-Jiménez L, Merlos A, Escuín T, Viñas M Bacterial adhesion efficiency on implant abutments: A comparative study
235
Barquinero J Next-generation scholarly communication: A researcher’s perspective
253
BOOK REVIEWS
259
ANNUAL INDEXES
263
INDEXED IN
Agricultural and Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents®/Agriculture, Biology & Environmental Sciences®; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science and Technology Abstracts; ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services®; MEDLINE®/Index Medicus®; Latindex; MedBioWorldTM; SciELO-Spain; Science Citation Index Expanded®/SciSearch®