Skip to main content

International Microbiology

Page 1

Volume 16 路 Number 2 路 June 2013 路 ISSN 1139-6709 路 e-ISSN 1618-1905

INTERNATIONAL MICROBIOLOGY www.im.microbios.org

16(2) 2013

Official journal of the Spanish Society for Microbiology


Publication Board

Editorial Board

Coeditors-in-Chief José Berenguer (Madrid), Autonomous University of Madrid Ricardo Guerrero (Barcelona), University of Barcelona

Ricardo Amils, Autonomous University of Madrid, Madrid, Spain Shimshon Belkin, The Hebrew University of Jerusalem, Jerusalem, Israel Albert Bordons, University Rovira i Virgili, Tarragona, Spain Albert Bosch, University of Barcelona, Barcelona, Spain Victoriano Campos, Pontificial Catholic University of Valparaíso, Chile Josep Casadesús, University of Sevilla, Sevilla, Spain Rita R. Colwell, Univ. of Maryland & Johns Hopkins Univ.., Baltimore, MD, USA Katerina Demnerova, Inst. of Chem. Technology, Prague, Czech Republic Esteban Domingo, CBM, CSIC-UAM, Cantoblanco, Spain Mariano Esteban, Natl. Center for Biotechnol., CSIC, Cantoblanco, Spain Mariano Gacto, University of Murcia, Murcia, Spain Juncal Garmendia, Institute of Agrobiotechnology, Pamplona, Spain Olga Genilloud, Medina Foundation, Granada, Spain Steven D. Goodwin, University of Massachusetts, Amherst, MA, USA Juan C. Gutiérrez, Complutense University of Madrid, Madrid, Spain Johannes F. Imhoff, University of Kiel, Kiel, Germany Juan Imperial, Technical University of Madrid, Madrid, Spain John L. Ingraham, University of California, Davis, CA, USA Juan Iriberri, University of the Basque Country, Bilbao, Spain Roberto Kolter, Harvard Medical School, Boston, MA, USA Germán Larriba, University of Extremadura, Badajoz, Spain Rubén López, Center for Biological Research, CSIC, Madrid, Spain Michael T. Madigan, Southern Illinois University, Carbondale, IL, USA Beatriz S. Méndez, University of Buenos Aires, Buenos Aires, Argentina Diego A. Moreno, Technical University of Madrid, Madrid, Spain Ignacio Moriyón, University of Navarra, Pamplona, Spain Juan A. Ordóñez, Complutense University of Madrid, Madrid, Spain José M. Peinado, Complutense University of Madrid, Madrid, Spain Antonio G. Pisabarro, Public University of Navarra, Pamplona, Spain Carmina Rodríguez, Complutense University of Madrid, Madrid, Spain Fernando Rojo, Natl. Center for Biotechnology, CSIC, Cantoblanco, Spain Manuel de la Rosa, Virgen de las Nieves Hospital, Granada, Spain Carmen Ruiz Roldán, University of Murcia, Murcia, Spain Claudio Scazzocchio, Imperial College, London, UK James A. Shapiro, University of Chicago, Chicago, IL, USA John Stolz, Duquesne University, Pittsburgh, PA, USA James Strick, Franklin & Marshall College, Lancaster, PA, USA Gary A. Toranzos, University of Puerto Rico, San Juan, Puerto Rico Antonio Torres, University of Sevilla, Sevilla, Spain José A. Vázquez-Boland, University of Edinburgh, Edinburgh, UK Antonio Ventosa, University of Sevilla, Sevilla, Spain Tomás G. Villa, Univ. of Santiago de Compostela, Santiago de C., Spain Miquel Viñas, University of Barcelona, Barcelona, Spain Dolors Xairó, Biomat, S.A., Grifols Group, Parets del Vallès, Spain

Associate Editors Mercedes Berlanga, University of Barcelona Mercè Piqueras, Catalan Association for Science Communication Wendy Ran, International Microbiology Secretary General Jordi Mas-Castellà, International Microbiology Webmasters Nicole Skinner, Institute for Catalan Studies Jordi Urmeneta, University of Barcelona Managing Coordinator Carmen Chica, International Microbiology Specialized editors Josefa Antón, University of Alicante Susana Campoy, Autonomous University of Barcelona Ramón Díaz, CIB-CSIC, Madrid Josep Guarro, University Rovira i Virgili Enrique Herrero, University of Lleida Emili Montesinos, University of Girona José R. Penadés, Institute of Mountain Livestock-CSIC, Castellon Jordi Vila, University of Barcelona

Addresses Editorial Office International Microbiology Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org www.im.microbios.org Spanish Society for Microbiology Vitruvio, 8 28006 Madrid, Spain Tel. +34-915613381. Fax +34-915613299 E-mail: sem@microbiologia.org www.semicrobiologia.org Publisher (electronic version) Institute for Catalan Studies Carme, 47 08001 Barcelona, Spain Tel. +34-932701620. Fax +34-932701180 E-mail: int.microbiol@microbios.org © 2013 Spanish Society for Microbiology & Institute for Catalan Studies. Printed in Spain ISSN (print): 1139-6709 e-ISSN (electronic): 1618-1095 D.L.: B.23341-2004

p2


CONTENTS International Microbiology (2013) 16:69-132 ISSN 1139-6709 www.im.microbios.org

Volume 16, Number 2, June 2013 RESEARCH REVIEW

Hermosa R, Rubio MB, Cardoza RE, Nicolás C, Monte E, Gutiérrez S The contribution of Trichoderma to balancing the costs of plant growth and defense

69

RESEARCH ARTICLES

Cardenas PA, Alarcón M, Narvaez I, Salazar R, Falconí G, Espinel M, Trueba G Staphylococcus aureus outbreak in the intensive care unit of the largest public hospital in Quito, Ecuador

81

Hernández SB, Ayala JA, Rico-Pérez G, García-del Portillo F, Casadesús J Increased bile resistance in Salmonella enterica mutants lacking Prc periplasmic protease

87

Suebwongsa N, Panya M, Namwat W, Sookprasert S, Redruello B, Mayo B, Álvarez MA, Lulitanond V Cloning and expression of a codon-optimized gene encoding the influenza A virus nucleocapsid protein in Lactobacillus casei

93

López-Pérez M, Mirete S, Jardón-Valadez E, González-Pastor J Identification and modeling of a novel cloramphenicol resistance protein detected by functional metagenomics in a wetland of Lerma, Mexico

103

Bordas M, Araque I, Alegret JO, El Khoury M, Lucas P, Rozès N, Reguant C, Bordons A Isolation, selection, and characterization of highly ethanol-tolerant strains of Oenococcus oeni from south Catalonia

113

PERSPECTIVES

Finch J, et al. Accessibility, sustainability, excellence: how to expand access to research publications. Executive Summary (Report of the Working Group on Expanding Access to Published Research Findings.)

125

A1


Spanish Society for Microbiology The Spanish Society for Microbiology (SEM) is a scientific society founded in 1946 at the Jaime Ferrán Institute of the Spanish National Research Council (CSIC), in Madrid. Its main objectives are to foster basic and applied microbiology, promote international relations, bring together the many professionals working in this science, and contribute to the dissemination of science in general and microbiology in particular, among society. It is an interdisciplinary society, with about 1800 members working in different fields of microbiology.

International Microbiology Aims and scope International Microbiology, the official journal of the SEM, is a peer-reviewed, open access journal whose aim is to advance and disseminate information in the fields of basic and applied microbiology among scientists around the world. The journal publishes research articles and complements (short papers dealing with microbiological subjects of broad interest such as editorials, perspectives, book reviews, etc.). A feature that distinguishes it from many other microbiology journals is a broadening of the term “microbiology” to include eukaryotic microorganisms (protists, yeasts, molds), as well as the publication of articles related to the history and sociology of microbiology. International Microbiology, offers high-quality, internationally-based information, short publication times (<3 months), complete copy-editing service, and online open access publication available prior to distribution of the printed journal.

The journal encourages submissions in the following areas:

• Microorganisms (prions, viruses, bacteria, archaea, protists, yeasts, molds) • Microbial biology (taxonomy, genetics, morphology, physiology, ecology, pathogenesis) • Microbial applications (environmental, soil, industrial, food and medical microbiology, biodeterioration, bioremediation, biotechnology) • Critical reviews of new books on microbiology and related sciences are also welcome.

Journal Citations Reports The 2012 Impact Factor of International Microbiology is 2,556. The journal is covered in several leading abstracting and indexing databases, including the following ones: AFSA Marine Biotechnology Abstracts; Biological Abstracts; Biotechnology Research Abstracts; BIOSIS Previews; CAB Abstracts; Chemical Abstracts; Current Contents – Agriculture, Biology & Environmental Sciences; EBSCO; Embase; Food Science and Technology Abstracts; Google Scholar; IEDCYT; IBECS; Latíndex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; Scopus.

Cover legends Front cover Center. Winter view of the marsh of Almoloya del Río, in the State of Mexico, where Lerma river, the second longest in Mexico, originates. It is one of the few wetlands left in central Mexico and thus an important wintering area for waterfowl; as such is a federally protected wildlife refuge (Refugio de Flora y Fauna Silvestre Ciénegas del Lerma). Bacteria, fungi and yeasts are part of the biological filter of the marshes, which by cleaning contaminated water provide a major ecological service to human communities. Photograph by Rurik List, Environmental Sciences, Metropolitan Autonomous University, Lerma de Villada, Mexico. (See article López-Pérez et al., pp 103-111, this issue). Upper left. Particles of the turnip mosaic virus, a Potyvirus that infects mainly cruciferous plants and is one of the most damaging viruses in plant crops. It causes chlorotic ringspots in young leaves; as the leaf ages, yellow or brownish spots surrounbded by circular or irregular necrotic rings appear. Micrograph by Fernando Ponz, CBGP, UPM-INIA, Madrid. (Magnification, ca. 100,000×) Upper right. Transmission electron micrograph of a group of cells of the polyhydroxyalcanoate-producing Halomonas venusta MAT-28. The cells are growing as a microcolony in an artificial biofilm of alginate beads. In this situation, cells maintain a metabolic state equivalent to that of the planktonic culture. Micrograph by M. Berlanga, Faculty of Pharmacy, University of Barcelona, and Carmen López, CCiT, University of Barcelona. [See article by Berlanga M., et al., Int Microbiol (2012) 15:191-199.] (Magnification, ca. 6,000×) Lower left. Scanning electron micrograph of Minorisa minuta, a bacterivorous protist described in 2012. With an average size of 1.4 mm, it is one of the smallest bacterial grazers known to date. It has a worldwide distribution and can account for 5 % of heterotrophic protists in coastal waters. Micrograph by Javier del Campo, Institute for Marine Sciences, CSIC, Barcelona, Spain. [For more information, see article by del Campo J, et al., ISME J (2013) 7:351-358] (Magnification, ca. 40,000×) Lower right. SEM micrograph of Saksenaea vasiformis (Saksenaeaceae, Mucorales, Mucoromycotina) sporangiophores isolated from human tissue. It is a filamentous fungus with characteristic flask-shaped sporangia that can cause severe human infections in both immunocompromised and immunocompetent hosts. Micrograph by José F. Cano, Univ. Rovira Virgili, Reus-Tarragona, Spain. (Magnification, ca. 1000×)

A2

Back cover Portrait of Rafael Rangel (1877–1909), born in Betijoque, Venezuela. Rangel is considered to be the founder of Venezuelan parasitology and biological analytics. He was born on April 25, 1877, to a single mother, Maria Teresa Estrada, who died when he was six-monthsold. His father, who had since married, claimed him, and his wife raised the child as if he was her own son. Rangel graduated from high school in Maracaibo and went to Caracas to study medicine. He was a brilliant student, but after his second year at university he abandoned his studies. Despite his failure to obtain an academic degree, he received good laboratory training and followed courses in bacteriology at the Pasteur Institute in Caracas. Over time, he became an expert in the use of the microtome and microscope, the staining of microorganisms, the preparation of culture media, and the inoculation of pathogens into laboratory animals. In 1902, he was appointed director of the new Laboratory of Histology and Bacteriology at the Vargas Hospital in Caracas. Even without a medical degree, he assisted students in their doctoral theses and carried out research in various fields. In 1908, when he was at the peak of his career, several cases of bubonic plague were reported in La Guaira, Venezuela. Rangel was commissioned to deal with this devastating disease. His first quick tests consistently yielded negative results. However, as more cases were reported, Rangel renewed his efforts, initiating a campaign to fight the plague that involved strong measures, including temporarily closing the harbor and ordering the burning of four buildings in which rats, the vectors of the pathogen, were known to dwell. The epidemic was soon controlled and Rangel was rewarded for his work. But there were also people envious of his success who blamed him for not having recognized the disease until it had widely spread, and for having spent large sums of money to fight it. These accusations, as well as the denial of a fellowship that would have allowed him to travel to Europe to complete his medical training, caused Rangel to sink into a deep depression. Sadly, he killed himself, by drinking mercury cyanide, on August 20, 1909. On the centenary of his birth, in 1977, Venezuela paid homage to Rangel and moved his remains to the National Pantheon. In 1999, he vas posthumously invested Doctor Honoris Causa by the Fermín Toro University at Barquisimeto, Venezuela.

Front cover and back cover design by MBerlanda & RGuerrero


RESEARCH REVIEW International Microbiology (2013) 16:69-80 doi:10.2436/20.1501.01.181 ISSN 1139-6709 www.im.microbios.org

The contribution of Trichoderma to balancing the costs of plant growth and defense Rosa Hermosa,1 M. Belén Rubio,1 Rosa E. Cardoza,2 Carlos Nicolás,3 Enrique Monte,1* Santiago Gutiérrez2 Spanish-Portuguese Centre for Agricultural Research (CIALE), Department of Microbiology and Genetics, University of Salamanca, Salamanca, Spain. 2Area of Microbiology, University School of Agricultural Engineers, University of Leon, Ponferrada Campus, Ponferrada, Spain. 3Spanish-Portuguese Centre for Agricultural Research (CIALE), Department of Plant Physiology, University of Salamanca, Salamanca, Spain 1

Received 25 March 2013 · Accepted 14 June 2013

Summary. Trichoderma is a fungal genus of cosmopolitan distribution and high biotechnological value, with several species currently used as biological control agents. Additionally, the enzyme systems of the fungus are widely applied in industry. Species of Trichoderma protect plants against the attack of soil-borne plant pathogens by competing for nutrients and inhibiting or killing plant pathogenic fungi and oomycetes, through the production of antibiotics and/or hydrolytic enzymes. In addition to the role of Trichoderma spp. as biocontrol agents, they have other beneficial effects on plants, including the stimulation of plant defenses and the promotion of plant growth. In this review, we focus on the complex plant defense signaling network that allows the recognition of fungi as non-hostile microbes, including microbial-associated molecular patterns (MAMPs), damageassociated molecular patterns (DAMPs) and secreted elicitors. We also examine how fungal interactions with plant receptors can activate induced resistance by priming and balancing plant defense and growth responses. Our observations are integrated into a model describing Trichoderma-plant hormone signaling network interactions. [Int Microbiol 2013; 16(2):69-80] Keywords: Trichoderma spp. · plant–Trichoderma symbiosis · Arabidopsis thaliana · phytohormone networking

Introduction Trichoderma spp. are non-pathogenic soil-borne (free-living) fungi that colonize the roots of many plants as opportunistic, avirulent plant symbionts [18]. In addition, these fungi have been exploited in biotechnological applications and provide important benefits to agriculture, such as their ability to protect crops against disease and increase crop yield under field conditions [29]. Most species of Trichoderma have

*Corresponding author: E. Monte Spanish-Portuguese Centre for Agricultural Research (CIALE) Department of Microbiology and Genetics, University of Salamanca 37185 Campus de Villamayor, Salamanca, Spain Tel: +34-923294500. Fax +34-923294399 E-mail: emv@usal.es

been linked to biocontrol against plant pathogenic fungi, oomycetes, and even nematodes [37]. The versatility of Trichoderma strains in suppressing pathogen-induced diseases and their broad environmental opportunism have been reported [4,15]. Several Trichoderma strains are included as active biofungicide matter in registered biological control substances, although many Trichoderma formulations for commercial use against plant pathogens are not registered as plant protection products. Instead, they may be marketed as plant inoculants or plant strengthening agents, which for the respective manufacturers circumvents the time and expense necessary for product registration [19]. Other beneficial effects of Trichoderma spp. in plants are their promotion of plant growth, their ability to elicit plant defenses against pathogen attack and environmental stress, and their use in the improvement or maintenance of soil productivity [20,57].


70

Int. Microbiol. Vol. 16, 2013

The mycotrophic lifestyle of Trichoderma, which includes mycoparasitism and saprophytic growth, has been reviewed in the context of a comparative analysis of the genomes available for this genus [15]. The genomes of Trichoderma virens and Trichoderma atroviride encode the highest number of chitinolytic enzymes of all fungi described. Furthermore, proteases are also expanded in these two genomes, supporting the hypothesis that protein degradation is a major trait of mycoparasites. Indeed, T. virens has the highest number of non-ribosomal peptide synthetases compared to other fungi; these enzymes are involved in the formation of secondary metabolites with antifungal activity. Moreover, the saprophytic behavior of Trichoderma is evidenced by its large set of carbohydrateactive enzymes, produced for the extracellular digestion of dead or decayed organic matter as a food source [25]. By contrast, Trichoderma genomes encode relatively few enzymes that catalyze the breakdown of pectin, the cement of plant cell walls, indicating a special relationship with living plants. As rhizosphere colonizers, Trichoderma spp. have developed opportunistic mechanisms for their adaptation to abiotic stresses as well as for nutrient uptake and solute transport. In the plant, these processes are facilitated by the induction of cell wall extension and expansion, secondary root development, lateral root hair production and a higher photosynthetic rate [10,52,57]. This cross-talk between Trichoderma and plants plays a role in phytohormone signaling [20]. Previous International Microbiology publications have described the biotechnological use of Trichoderma strains, proteins and genes [37] and have reviewed the biocontrol mechanisms of these fungi [4]. In this third Trichoderma article, we attempt to explain how the Trichodermaâ&#x20AC;&#x201C;plant interaction modifies the equilibrium between plant growth and defense against both pathogens and environmental damage.

Microbial recognition by plants Unlike many animals, plants lack mobile defender cells and an adaptive somatic immune system. Instead, they rely on the innate immunity of each cell and on systemic signals emanating from sites of infection [22]. However, plants have an amazing capacity to recognize pathogens through strategies involving both conserved and variable pathogen elicitors. These compounds are secreted by attackers as virulence effector molecules to manipulate plant defensive responses [14]. Conversely, a primary plant immune response has evolved that allows plants to recognize the common features of organisms that interact with them and to translate this recognition

hermosa et al.

into a defense response that is specifically directed against the invader encountered [22]. Like insects and vertebrates, plants have receptors for microbe-associated molecules and respond to many of the same molecules that animals respond to, including bacterial lipopolysaccharide, flagellin, and the translation elongation factor EF-Tu [2]. Plants are also responsive to a wide variety of molecules associated with fungi and oomycetes, including chitin, β-glucan and ergosterol [60]. Pathogenic and symbiotic microbes can produce signaling molecules that share several characteristics but induce contrasting responses in plants: either immunity (rejection) or symbiosis (acceptance). Perception of these molecules by the plant involves similar receptors, raising the question of how friends are distinguished from foes such that the response to these signals is the correct one. Plant immune responses to invading microbes comprise at least two recognition systems and sets of receptors. In innate plant immunity, early basal defenses to limit the attackerâ&#x20AC;&#x2122;s growth are initiated on the external face of the host cell, where conserved microbial elicitors, called microbial- or pathogen-associated molecular patterns (MAMPs or PAMPs), are recognized by pattern recognition receptors (PRRs) located in the plasma membrane [5]. PRRs are subdivided into two main groups: receptor kinases, which are also able to recognize abiotic stresses, and the less abundant receptor-like proteins [14]. Similarly, plants respond to endogenous molecules released by pathogen invasion, such as cell wall oligomers or cuticular fragments, referred to as damage-associated molecular patterns (DAMPs). Stimulation of PRRs leads to a signal transduction cascade and the activation of MAMP- or PAMP-triggered immunity (MTI or PTI). Along with their primary innate immune response, plants can activate another line of defense, referred to as induced resistance. This type of resistance often acts systemically throughout the plant and is typically effective against a broad spectrum of attackers. However, plants have to balance the costs and potential benefits of investing in defenses since these are ecologically costly. Indeed, natural selection is presumed to have favored the evolution of inducibility, meaning that these defenses are only produced in the presence of attackers [61]. Nonetheless, successful pathogens deliver virulence molecules (avr proteins, coronatine, gibberellins, etc.), called effectors, that suppress PTI responses, facilitating colonization and causing disease. In this so-called effector-triggered susceptibility (ETS) [22], pathogens manage to suppress defense responses through the deployment of effector molecules. Conversely, plants can sense these effectors by dominant intracellular plant resistance gene products. Of these, the most abundant are a


Trichoderma spp. opportunism

class of polymorphic intracellular receptors containing a nucleotide-binding site (NBS) and a leucine-rich repeat (LRR) domain, so-called nucleotide-binding domain leucine-rich (NBS-LRR) proteins [60]. Pathogen effectors from diverse kingdoms are recognized by NBS-LRR proteins and activate different signal transduction pathways, depending on the organism interacting with the plant. NBS-LRR plasticity can be explained by the fact that these proteins have the highest frequency of major effect mutations and differentially methylated regions, at least in the genome of Arabidopsis [53]. Thus, an epigenetic control may limit their expression until released from silencing by pathogen attack. NBS-LRR-mediated disease resistance is effective against pathogens that grow only on living host tissue (obligate biotrophs: e.g., Ustilago maydis, Cladosporium fulvum) or that are hemibiotrophic (e.g., Pseudomonas syringae, Colletotrichum acutatum) but not against pathogens that kill host tissue during colonization (necrotrophs: e.g., Botrytis cinerea, Sclerotinia sclerotiorum). This recognition induces effector-triggered immunity (ETI). The quantitative output of the plant immune system has been illustrated in a zigzag model [22], in which the final amplitude of disease resistance or susceptibility is proportional to [PTI â&#x20AC;&#x201C; ETS + ETI].

Plant defense signaling networks Generally, PTI/MTI and ETI give rise to similar responses: a rapid influx of calcium ions from external stores, a burst of reactive oxygen species (ROS), activation of mitogen-activated protein kinases (MAPKs), reprogramming of gene expression and the deposition of callosic cell wall appositions at sites of attempted infection [47]. However, ETI is qualitatively stronger and faster than PTI/MTI and often involves a form of localized cell death called the hypersensitive response, which arrests the growth of biotrophic fungi. PTI is generally effective against non-adapted pathogens, conferring so-called nonhost resistance, whereas ETI is active against adapted pathogens [14]. Through a phosphorelay mechanism, MAPK signaling cascades link upstream receptors to downstream targets and are involved in the regulation of plant development, growth, programmed cell death, and the responses to a diversity of environmental stimuli including cold, heat, ROS, UV light, drought, and pathogen attack. MAPK cascade activation by PTI/MTI or ETI culminates in the expression of defense genes and, as a result, in the synthesis of certain pathogenesisrelated proteins (glucanases, chitinases) and of the phytoa-

Int. Microbiol. Vol. 16, 2013

71

lexin camalexin, as well as cell wall fortification and stomatal closure [47]. Together, these modifications confer resistance to pathogens, as phytohormones regulate the production of downstream defense molecules. The importance of salicylic acid (SA), jasmonates (JA, jasmonic acid and the volatile methyl jasmonate) and ethylene (ET) as primary signals in the regulation of the plant immune response is well established [44]. Although there are exceptions, biotrophic pathogens are generally sensitive to the defense responses regulated by SA, which is required for local resistance and for a type of systemic resistance known as systemic acquired resistance (SAR). By contrast, pathogens with a necrotrophic lifestyle are commonly deterred by defenses controlled by JA and ET, which act as signal transduction molecules for a systemic resistance pathway that is referred as induced systemic resistance (ISR). ISR requires the ankyrin repeat-containing protein NPR1, a key regulator in SA signaling [45]. However, plants are often subjected to simultaneous or subsequent invasions by multiple attackers and beneficial microbes, which can influence the primary induced defense response of the host plant. Activation of different plant defense mechanisms implies costs in ecological fitness. Crosstalk between the SA-JA pathways often results in their reciprocal antagonism, which has been interpreted as an adaptive, cost-saving strategy because the different enemies are susceptible to different defense strategies [61]. SA-JA antagonism is widespread across plants but these have evolved mechanisms to respond in different ways or with different intensities to similar stimuli. For example, in Arabidopsis SA is typically prioritized over JA. Plants also use ET as a third component to fine-tune defenses by prioritizing JA over SA induction in response to multiple attackers [26].

Root signaling and beneficial microbes Beneficial relationships between plants and microbes often occur in the rhizosphere and improve plant growth or help the plant to overcome biotic or abiotic stresses [70]. For example, the roots of Arabidopsis respond to different MAMPs in a tissue-specific manner and MTI signaling in the roots is very similar to that observed in the leaves [36]. To establish mutualistic interactions with the host plant, beneficial microbes minimize stimulation of its immune system, which is triggered locally in the roots upon MAMP perception [70]. Beneficial interactions between the plantâ&#x20AC;&#x2122;s roots and microbes [rhizobia, plant-growth-promoting rhizobacteria (PGPR), mycorrhizae


72

Int. Microbiol. Vol. 16, 2013

and plant-growth-promoting fungi (PGPF)] initially elicit a MTI response, which is subsequently suppressed by the production of effector/elicitor molecules. A common feature of the resistance responses induced by beneficial microbes is priming, or the JA-dependent activation of plant defenses prior to contact with a challenging microbe, in which plants respond either faster, more strongly, or both to pathogen attack [9]. Priming may be initiated in response to an environmental cue that reliably indicates an increased probability of encountering a biotic stress or by the colonization of a beneficial microbe, but a primed state may also persist as a residual effect following an initial exposure to the stress. For example, the typical pathogen-induced hypersensitive response is often induced with greater efficiency in plants that have previously undergone pathogen attack or were subject to a beneficial microbe. Primed plants do not express costly defense responses; rather, since priming gives rise to defense activation only upon recognition of a potential intruder, it is also an ideal mechanism to control interactions with invading beneficial microbes [70]. Priming is the plantâ&#x20AC;&#x2122;s solution to the dilemma posed by the trade-off between disease protection and the costs involved in defense activation. Because beneficial microbes are also recognized as alien organisms, active interference with the plantâ&#x20AC;&#x2122;s immune signaling network is fundamental to the establishment of intimate mutual relationships. In many cases, SA, JA and ET have interconnected pathways and emerge as the dominant regulators in this process [44]. In Arabidopsis, SA mediates a change in the cellular redox potential that leads to SAR activation through the NPR1 regulator and TGA transcription factors [16]. Cytosolic NPR1 plays a key role in the crosstalk between SA and JA and is involved in JA/ET-dependent ISR [59]. The phytohormone ET is a gas recognized by plasma membrane receptors that negatively regulate ET responses. In response to ET perception, the receptors engage in downstream signaling of positive regulators that activate the expression of ET-responsive genes. ET and JA cooperate in inducing ET response factor 1, a transcription factor that drives the activation of defense-related genes and positively regulates the expression of JA-inducible genes involved in defense responses [28]. JA signaling is controlled by a complex formed by the E3 ubiquitin ligase SCFCOI1 complex and jasmonate ZIM-domain (JAZ) proteins. The latter act as JA receptors and, at low JA levels, are transcriptional repressors of JA-responsive gene expression. When the JA concentration is elevated, JAZ proteins are degraded in the 26S proteasome, leading to the rapid activation of a multitude of JA responses [23]. Upon JAZ de-

hermosa et al.

gradation, the versatile transcription factor MYC2 is released to promote JA-induced gene expression. MYC2 is repressed by JAZ proteins and positively regulates JA-responsive genes but negatively regulates JA/ET-responsive genes. MYC2 contributes to the repression of early MTI responses. Rhizobia are sensitive to SA-regulated defense responses [42], and SA signaling negatively affects root mycorrhization [27]. The colonization of Arabidopsis roots by the PGPF Piriformospora indica is also limited by SA-dependent defenses [21]. Accordingly, beneficial microbes have evolved mechanisms to efficiently suppress the SA-triggered responses of host plants and thus to establish successful infections. In contrast to pathogen-induced SAR, which is dependent upon SA signaling and associated with the enhanced expression of a large set of pathogenesis-related genes, PGPR- and PGPFtriggered ISR is often SA-independent and not associated with major changes in defense-related gene expression [63]. In its interactions with Arabidopsis, P. syringae, generally considered to be a leaf pathogen but also a root colonizer, and P. indica take on the JA signaling pathway to suppress both early- and late-activated defense responses, suggesting that JA pathway activation is a common strategy of bacteria and fungi that is designed to affect host immunity in the roots [36]. MYC2 has been proposed as a priming regulator for enhanced JA-responsive gene expression during PGPR-mediated ISR [48]. The early signaling steps of Trichoderma and PGPRmediated ISR also require activation of the transcription factor MYB72 in the roots [55], although the combined application of Trichoderma and PGPRs has not resulted in enhanced disease control [1]. Beneficial fungi and bacteria also have to suppress ET signaling, to avoid being recognized as uninvited guests. In this context, MYC2 also regulates crosstalk between JA signaling pathways and those of other phytohormones such as abscisic acid (ABA), gibberellins (GAs), and auxins (indole acetic acid, IAA), and is involved in JA-regulated plant growth and development [23]. Many PGPR and PGPF are able to produce IAA or GAs [10,17,58] that attenuate the relative strength of the interaction between SA signaling and phytohormone networking [44]. GAs also stimulate growth by promoting the destruction of a set of plant growth repressor proteins (DELLAs) that promote susceptibility to necrotrophs and resistance to virulent biotrophs [40]. DELLAs permit the flexible and appropriate modulation of plant growth in response to changes in the environment [23]. Lateral root and plant development are supported by IAA, although, at high concentrations, IAA inhibits growth. IAA is recognized by a SCF-type E3 ligase receptor similar to that of


Int. Microbiol. Vol. 16, 2013

73

Int Microbiol

Trichoderma spp. opportunism

Fig. 1. Structural and secreted Trichoderma microbial-associated molecular patterns (MAMPs) and damage-associated molecular patterns (DAMPs), resulting from the activity of the Trichoderma cell wall degrading enzyme (CWDE) on pathogens or plants, such that, in the latter, defense or growth responses are elicited.

Trichoderma and plant responses

ther positive interactions between Trichoderma and plants [15]. To establish a dialogue with plants (Fig. 1), Trichoderma releases DAMPs and expresses a collection of MAMPs and elicitors that, after recognition by NBS-LRR proteins—which are up-regulated in plants challenged with Trichoderma [33,56]—are able to induce different types of beneficial responses. In the following, we provide ten illustrative examples of these responses, induced by polygalacturonases, xylanases, cellulases, cerato-platanins, swollenins, avirulence proteins and lysin motif (LysM) domains, peptaibols, 6-pentyl pyrones, trichothecenes and phytohormones.

The capacities for Trichoderma opportunism have enabled species such as T. hamatum to live both as common components of the soil and rhizosphere and as endophytes. The presence of potential fungal prey and plant root-derived nutrients in the rhizosphere may have driven ancestral Trichoderma spp. to colonize plant roots, facilitating the evolution of fur-

Polygalacturonase ThPG1. The Thpg1 gene was detected in a transcriptome and subsequent proteome analysis using a three-component system (Trichoderma harzianum–tomato plantlets–pathogen [Rhizoctonia solani or Pythium ultimum]). The endopolygalacturonase ThPG1 is a plant cell-wall-degrading enzyme required for efficient root colonization by T. har-

JA and has a reciprocal antagonism with SA [44]. Beneficial microbes such as Azospirillum and Trichoderma produce IAA, facilitating root development and colonization and helping to overcome MTI. IAA and ET regulation of DELLA restraint are key steps in our Trichoderma-plant crosstalk model, described in a previous review [20], to explain the integrated plant development and immunity responses activated by this fungus.


74

Int. Microbiol. Vol. 16, 2013

zianum [38]. ThPG1 hydrolyzes plant pectin and produces oligogalacturonides that act as DAMPs when they are recognized by the PRR receptor wall-associated kinase-1 [12]. Recognition results in the activated production in the plant of polygalacturonase inhibitor protein. However, ThPG1 is unaffected by an inhibitor from Arabidopsis and is counteracted only by doses of bean polygalacturonase inhibitor proteins higher than those active against polygalacturonases from phytopathogenic fungi [38]. The down regulation of: (i) genes encoding two glycine-rich proteins (GRP19 and ATA20), which regulate wall-associated kinase-1 function linked to a SA-dependent defense response [41], (ii) two SA-responsive genes (chs, Ltp) and (iii) five root-strength and root-hair development genes (xth9, xtr7, cys2, grp19 and ata20), detected in the aerial parts of Arabidopsis plants colonized with a Thpg1-silenced transformant, relates ThPG1 to SAR activation and the modification of cell wall structure and root architecture. The chs gene encodes a chalcone synthase that is an important type III polyketide synthase of the phenylpropanoid pathway, whose expression causes the accumulation of flavonoid and isoflavonoid phytoalexins. This pathway is also involved in the SA defense pathway. Lipid transfer proteins show some structural similarities to the small secreted cysteine-rich proteins (SSCPs) of fungi and oomycetes. In addition, they bind lipid molecules of plasma membrane receptors and play a role in long-distance signaling during SAR. Ltp gene expression is involved in the Trichoderma-induced defense against Phytophthora spp. in pepper [3] and against P. syringae in Arabidopsis [8]. The xth9 and xtr7genes encode a xyloglucan endotransglycosylase related to cell-wall loosening, the elongation of root tissue, and root hair initiation, and a xyloglucosyl transferase involved in root hair growth, respectively. The phytocystatin CYS2 is a membrane protein located in trichomes and in the guard cells of young leaves. As a potent inhibitor of cysteine proteases,CYS2 is expressed in roots after their physical damage, thus playing roles in plant development and stress responses. In addition, as a pathogenesisrelated protein, it is involved in programmed cell death and defense mechanisms against insects and pathogens. GRP19 and ATA20 are wall-associated kinase-1 interactors involved in cell elongation, secondary cell wall formation, lignin biosynthesis and/or the deposition and establishment of innate immunity. Xylanase Eix/Xyn2. The first recognized Trichoderma MAMP was an ET-inducing xylanase (Eix) produced by T. viride as a potent elicitor of the hypersensitive response and other plant defense mechanisms in some tobacco and tomato

hermosa et al.

cultivars; this effect was independent of its xylan degradation activity. ET-inducing xilanase is recognized by the tomato PRRs LeEix1 and LeEix2, which span the plasma membrane and have extracellular LRR domains [49]. It elicits ET biosynthesis and then ISR in leaves by inducing expression of the gene encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase [35]. A different xylanase, expressed by T. reesei, produces cell death in tobacco leaves, accompanied by typical defense responses that include an oxidative burst and the expression of defense genes following the activation of a specific cellular signal-transduction cascade. In the latter, an influx of extracellular Ca2+ ions is thought to be crucial for induction of the hypersensitive response [67]. Cellulases. A complex mixture of Trichoderma cellulases raises the level of endogenous JA after 30 min, followed by the transient emission of ET after 2â&#x20AC;&#x201C;3 h when applied to cut petioles of tobacco, lima bean and corn [43]. In a later study [34], infiltration of an active cellulase from T. longibrachiatum into melon cotyledons produced a rapid oxidative burst and the activation of early defense mechanisms associated with the ET and SA signaling pathways, leading to a strong increase in peroxidase and chitinase activities. However, the infiltration of heat-denatured cellulase also induced ET but without the accumulation of SA or the promotion of a hypersensitive-like response. In both studies, the ET pathway was activated, demonstrating the role of ET in fine-tuning plant defenses. Multiple systemic responses may derive from the action of several Trichoderma elicitors, inducing resistance via different parallel signaling pathways. Although rice root colonization by T. asperellum is associated with a clear SAR signaling cascade and suppression of the disease symptoms caused by P. syringae on leaves, application of culture filtrates of this fungus leads to the induction of both SA and JA/ET defense genes, probably because more than one elicitor triggers plant defenses [69]. The induction of plant responses by Trichoderma is a time- and concentration-dependent process. During the first hours of interaction, a reaction similar to SAR may occur as a result of Trichoderma colonization, when the fungus is applied to plant roots at high concentrations (107 conidia/ml). Although an increase in SA and JA occurs in the first hours of root colonization, SA and JA peak levels depend on the concentration of Trichoderma [54]. Cerato-platanins Sm1/Epl1. Cerato-platanins are hydrophobin-like SSCPs [Sm1 from T. virens and Epl1 from T. atroviride (Hypocrea atroviridis)] that accumulate in hyphae during


Trichoderma spp. opportunism

root colonization. These compounds act as elicitors of JA-induced ISR, but not SAR, in cotton and maize [20]. The abundance of SSCPs in the genomes of the biocontrol fungi T. virens and T. atroviride [25] is indicative of rhizosphere competence, although neither deletion nor overexpression of Sm1 alters the phenotypic traits of the fungus or its efficiency in colonizing maize roots [13]. In any case, there is a striking level of diversity between the three species of Trichoderma sequenced to date, suggesting the rapid evolution of SSCPs. Swollenin carbohydrate-binding domain. Swo1 was identified in T. reesei as a novel gene with sequence similarity to plant expansins. It encodes a swollenin protein whose N-terminal carbohydrate-binding domain has a cellulose-binding function and a C-terminal expansin-like domain. In T. asperellum, a role in the ability to colonize cucumber roots within 6 h after inoculation has been described for this protein. The carbohydrate-binding domain of swollenin does not seem to be involved in an increase in ISR defense but it does have MAMP activity, since a synthetic 36-mer carbohydratebinding domain peptide stimulates local defense responses in cucumber roots and leaves and affords local protection against Botrytis cinerea and Pseudomonas syringae infections [7]. The avr4 and avr9 avirulence protein homologues and LysM domains. In a proteome analysis of three-partner interactions between T. atroviride and the bean pathogens Rhizoctonia solani or B. cinerea, SSCP homologues of the avirulence proteins avr4 and avr9 from the tomato biotrophic fungus Cladosporium fulvum were identified in T. atroviride [33] and T. harzianum [18]. The binding of Avr4 to chitin has been confirmed experimentally. This avirulence protein is thought to shield the fungal cell wall from plant chitinases [60]. Avr9 is a PAMP with structural, but not functional, homology to carboxypeptidase inhibitors strongly induced under nitrogen limitation; it is not required for full virulence. The recognition of Avr4 and Avr9 leads to activation of the enhanced disease susceptibility 1 (EDS1) gene, encoding a NBS-LRR receptor, and to SA accumulation upon pathogen infection [60]. Through activation of SA, EDS1 represses JA/ET defenses. In Trichodermaâ&#x20AC;&#x201C;Arabidopsis interactions [39], there is a strong down-regulation of SA-related genes, such as EDS1, PR-1, chs and Ltp, in leaves after only 4 h of T. harzianum inoculation; this response persists at 24 h, with an increase in the expression of these plant genes after 48 h. The activated disease resistance 1 gene, encoding a NBSLRR receptor that regulates SA accumulation after an oxidative burst, is also down-regulated in leaves after 24 h of inte-

Int. Microbiol. Vol. 16, 2013

75

raction, indicating a reduction in SA-dependent MTI responses after Trichoderma colonization. Several JA-related genes are likewise down-regulated at 24 h post-inoculation of Trichoderma; their expression levels are similar to those determined in Arabidopsis plants not inoculated with this fungus at 48 h. This suggests that plant defenses mediated by JA and SA are transiently reduced. Since T. harzianum is not perceived as hostile by the host plant, it is able to colonize the plantâ&#x20AC;&#x2122;s roots. A cyclic behavior of SA and JA/ET responses induced by Trichoderma explains the different SAR or ISR responses described in the literature. It also supports the reduction in Arabidopsis leaf damage by the simultaneous accumulation of SA and JA/ET defense-related gene transcripts, detected at 96 h post-inoculation of Arabidopsis roots with T. atroviride [51]. Genes encoding chitin-binding LysM proteins are expanded in Trichoderma genomes [25]. These proteins suppress host defenses by sequestering chitin oligosaccharides, which act as elicitors of defense responses in plants subsequent to their recognition by the LysM-receptor kinases of the plasma membrane [11]. Scavenging of such oligomers is fundamental to the ability of the fungus to attack its hosts. As a mechanism for perceiving chitin, plants have likely evolved chitinases to release the active polymers from the cell walls of invading fungi, thereby triggering defense responses. LysM proteins most probably do not protect chitinous fungi against plant chitinases, but are more likely to be involved in the scavenging of chitin fragments that are released from fungal cell walls during infection, preventing them from acting as PAMPs that trigger PTI [6,11]. Trichoderma chitinases with LysM-binding modules are able to sequester chitin and thereby dampen plant defenses while facilitating root colonization. However, as biocontrol agents, if chitinous pathogens are present in the system, the mycotrophic activity of Trichoderma chitinases can also release chito-oligosaccharides from chitin substrates and the cell walls of their fungal targets, which contributes to the induction of defense. Peptaibols. Peptaibols are peptides 5â&#x20AC;&#x201C;20 amino-acids-long and composed of 2-aminoisobutyric acid and other non-proteinogenic amino acids. They are produced as secondary metabolites with antibiotic activity against fungi and bacteria. The 20-mer peptaibol alamethicin produced by Trichoderma induces the biosynthesis of volatile organic compounds in lima bean, principally via the JA-signaling pathway, but it also up-regulates SA biosynthesis [20]. This increase in SA reduces the production of JA-dependent volatile organic compounds, to not only modify plant defense strategies against


76

Int. Microbiol. Vol. 16, 2013

pathogens but also to control above-ground herbivorous insects and attract their natural enemies (parasitoids and predators) as well as pollinators [46]. Trichokonins are 20-mer peptaibols detected in Trichoderma pseudokoningii. They are able, locally and systemically, to induce ROS production and the accumulation of phenolic compounds at the application site in tobacco plants. Other activities include the induction of multiple systemic resistance against tobacco mosaic virus, through the up-regulation of SA, JA and ET signaling genes [30]. The 18-mer peptaibols of T. virens can elicit systemic defense responses in cucumber against the leaf pathogen P. syringae. The SA and JA pathways are induced after 48 h, although fungal or peptaibol challenge elicits a higher expression of the SA gene marker phenylalanine ammonia lyase and the JA gene marker hydroperoxide lyase, respectively [66]. In interactions with cucumber roots, T. asperellum induces both SAR and ISR responses to control P. syringae. In the former, phenylalanine ammonia lyase gene expression is detected in leaves 24Â h post-inoculation, with a maximum reached at 48 h. ISR responses are evidenced by hydroperoxide lyase gene expression in the leaves 24â&#x20AC;&#x201C;48 h after root inoculation [68]. Note that the lox1 gene, which encodes a lipoxygenase involved in JA biosynthesis, is also induced in cucumber 1 h after root elicitation with Trichoderma, indicating a rapid local activation of ISR defense that coincides with the start of callose deposition. 6-Pentyl pyrones. The volatile pyrone 6-pentyl-2Hpyran-2-one (6PP) is a common Trichoderma metabolite responsible for the coconut aroma and yellow pigmentation associated with strains of this fungus. 6PP also inhibits the growth of pathogens such as Fusarium oxysporum [50]. At low concentrations, it regulates plant growth, including the production of more extensive and developed root systems, significantly increases plant height and leaf area, and increases seed germination and seedling height. Together, these effects suggest that 6PP acts as an auxin-like compound and/ or as an auxin inducer [50]. A reduction in disease symptoms on tomato and canola seedlings treated with the purified metabolites 3 h before inoculation with, respectively, the pathogens B. cinerea and Leptosphaeria maculans is observed when 6PP is applied at 1 mg/l. Similar results have been obtained with higher concentrations of the butenolide harzianolide and the pyridine harzianopyridone. The PR-1 gene was induced by 6PP and harzianopyridone at 1 mg/l in canola cotyledons, indicating the activation of a SA-dependent SAR response. At the same time, a chitinase PR-3 gene related to

hermosa et al.

JA-dependent defense was induced by the same amount of 6PP, harzianopyridone or azaphilone [64]. These are further examples of the multiple systemic defense responses induced by Trichoderma. Trichothecenes. Sesquiterpenes are C15 terpene compounds that include trichothecenes, which are important mycotoxins known mainly for their phytotoxicity and for their toxic effects on animals and humans. T-2 mycotoxin, a biological weapon produced by Fusarium spp., is a problem in agriculture and animal feed because of its phytotoxicity. Trichothecenes are synthesized by Trichoderma species of the clade Brevicompactum. Thus, T. brevicompactum produces trichodermin, a phytotoxic compound that enables this species to be used as a biocontrol agent [62]. Trichoderma arundinaceum produces harzianum A, a trichothecene with antifungal activity against B. cinerea and R. solani [31] that elicits systemic defense and priming responses in tomato plants [32]. In the antagonistic interaction of T. arundianceum and B. cinerea, the former produces harzianum A while the latter inhibits the expression of genes in the trichothecene biosynthetic cluster. B. cinerea on tomato activates a typical JA response in the plant; T. arundianceum on tomato activates the expression of SA and JA signaling genes by the plant. In the interaction between T. arundianceum, B. cinerea and tomato, there is a dramatic increase in the expression of tomato plant defenserelated genes belonging to the SA and JA pathways, compared to a background of B. cinerea-tomato and T. arundianceum-tomato conditions [32]. Phytohormones. Trichoderma promotes growth responses in plants. In the colonization of cucumber roots by T. asperellum, the fungus enhances the availability of P and Fe to the plant, leading to significant increases in its dry weight, shoot length and leaf area [57]. The cysteine-rich cell wall protein QID74 of T. harzianum modifies root architecture, increasing the total absorptive surface and facilitating nutrient uptake and the translocation of nutrients in the shoots, resulting in increased plant biomass through an efficient use of N, P, K and micronutrients [52]. An association between plant growth-promoting activities and reduced ET production has been suggested, based on a decrease in its precursor ACC through the microbial degradation of IAA in the rhizosphere and/or through microbial ACC deaminase (ACCD) activity. Trichoderma produces IAA and ACCD [10,65] and thereby manipulates the phytohormone regulatory network. Support for our crosstalk model between the host plant and Trichoderma derives from the cross-communication between


Int. Microbiol. Vol. 16, 2013

77

Int Microbiol

Trichoderma spp. opportunism

Fig. 2. Hypothetical Trichoderma interactions with the complex hormone signaling network of its host plant. Trichoderma 1-aminocyclopropane-1-caboxylic acid (ACC) deaminase (ACCD) production reduces plant ethylene (ET) signaling, leading to a reduction of abscisic acid (ABA) and an increase of gibberellin acid (GA) levels. As a result, plant growth is promoted, by degradation of DELLA proteins in the 26S proteasome, and plant defenses are suppressed, through the repression of the transcriptional activity of MYC2 transcription factor by binding to jasmonate ZIM-domain (JAZ) proteins. Trichoderma indole-3-acetic acid (IAA) production stimulates ET biosynthesis via ACC synthase (ACCS) in the plant. In turn, an increase in ABA biosynthesis is triggered, together with a reduction of GA levels, leading to reduced targeting to DELLA proteins and the repression of plant growth. DELLAs compete with MYC2 for JAZ binding, contributing rapidly to the activation of jasmonic acid (JA) signaling and defenses. Trichoderma IAA also contributes to antagonizing salicylic acid (SA) signaling in the plant and to compensating for growth suppression by the induction of lateral root development.

SA, JA and ET, and IAA and the response pathways of other hormones (GA and ABA) [20]. Briefly, ACCD activity reduces the availability of the ACC necessary for ET biosynthesis, which in turn promotes plant growth and suppresses defenses via GA signaling by increasing the degradation of DELLA proteins. In roots, the biosynthesis of ET and IAA is reciprocally regulated. The IAA produced by Trichoderma contributes to plant growth, lateral root development and to exogenous auxinstimulated ET biosynthesis via ACC synthase. The latter in turn triggers an increase in ABA biosynthesis, commonly associated with plant development and abiotic stress defense, but also with callose priming and the regulation of defense gene expression through the activation of JA biosynthesis [44].

As noted above (Fig. 2), a model explaining the balance between defense and growth based on mutually antagonistic crosstalk between GA-JA signaling and DELLA-JAZ was recently proposed by Kazan and Manners [23]. In their model, growth promotion and defense suppression occur when, under suitable growth conditions, GA stimulates growth by promoting the destruction of DELLAs while defense is blocked through the repression of MYC2 transcriptional activity by (MYC2) binding to JAZ proteins. By contrast, there is growth suppression and defense activation when the plant is challenged by an attacker, e.g. a PGPF, and the JA-mediated degradation of JAZ proteins facilitates MYC2 transcriptional activity. This rapidly contributes to activating JA signaling, lea-


78

Int. Microbiol. Vol. 16, 2013

ding to further growth suppression by a reduction in DELLA degradation and tipping the balance towards defense. The DELLA-JAZ model [23] is also compatible with the Trichoderma-plant interaction model proposed in this review (Fig. 2). During the transient period of reduced defenses triggered by Trichoderma, colonization of the intercellular spaces of the epidermis and cortex is permitted, plants have not a need to reduce their growth (Trichoderma enhances growth in Arabidopsis regardless of ISR inducibility [20]), while several genes related to ABA, IAA and abiotic stress responses [39], and amino-acid biosynthesis [8] are up-regulated. Similarly, proteins involved in ROS scavenging, the stress response, terpene and ET biosynthesis, photosynthesis, photorespiration and carbohydrate metabolism are differentially regulated in cotyledons after cucumber root colonization by Trichoderma [54]. During a short colonization period, the GA-JA signaling interaction is likely to reach equilibrium, characterized by low levels of defense gene expression, because of the competition between DELLAs and MYC2 for JAZ binding (Fig. 2). Interestingly, the versatile MYC2 also regulates interactions between JA signaling and light, phytochrome signaling, and the circadian clock [24].

Final remarks Trichoderma spp. broad environmental opportunism has facilitated their activity in the rhizophere, with beneficial effects on plants, including the stimulation of plant defenses and plant growth. These abilities support the application of Trichoderma strains as plant inoculants or plant-strengthening agents in agriculture and forestry. Trichoderma has evolved to interact with plants such that it is not perceived as an enemy. Its structural and secreted proteins and secondary metabolites act as MAMPs, while its enzymes, by acting against other fungi and plant cell walls, generate DAMPs. MAMPs and DAMPs can be recognized by specific plant receptors that activate signaling cascades, leading to defense responses and the activation of a phytohormone networking that cross-communicates defense responses, against pathogen attack and environmental stress, as well as growth signaling pathways. Trichoderma uses a transient period in which plant defenses mediated by JA and SA are reduced to colonize the roots of its host. The plant, conversely, limits Trichoderma growth to the intercellular spaces of the cortex and epidermis. Expression of the defense-related genes of the JA/ ET and/or SA pathways may overlap, depending on many

hermosa et al.

factors [20], although Trichoderma can induce a faster and stronger JA-dependent systemic response (priming) in other parts of the plant. In addition to the contribution of Trichoderma to plant growth and defenses by producing the correct concentrations of ET and IAA, the mutually antagonistic crosstalk interactions between GA-JA signaling and the DELLA-JAZ balance, regulated by MYC2, have been proposed as switching elements to resolve the plant’s conflict between investing in defense or growth. Acknowledgements. The authors thank to all those working on Trichoderma-plant interactions for improving our knowledge of this complex system. Funding was obtained from the Junta de Castilla y León (SA260A11-2 and LE125A12-2), Junta de Andalucía (AGR 6082) and the Spanish Ministry of Science and Innovation (AGL2009-13431-C02 and AGL2012-40041-C02). Competing interest. None declared.

References 1. Alizadeh H, Behboudi K, Ahmadzadeh M, Javan-Nikkhah M, Zamioudis C, Pieterse CMJ, Bakker PAHM (2013) Induced systemic resistance in cucumber and Arabidopsis thaliana by the combination of Trichoderma harzianum Tr6 and Pseudomonas sp. Ps14. Biol Control 65:14-23 2. Ausubel FM (2005) Are innate immune signaling pathways in plants and animals conserved? Nat Immunol 6:973-979 3. Bae H, Roberts DP, Lim H-S, Strem MD, Park S-C, Ryu C-M, Melnick RL, Bailey BA (2011) Endophytic Trichoderma isolates from tropical environments delay disease onset and induce resistance against Phytophthora capsici in hot pepper using multiple mechanisms. Mol Plant Microbe Interact 24:336-351 4. Benítez T, Rincón AM, Limón MC, Codón AC (2004) Biocontrol mechanisms of Trichoderma strains. Int Microbiol 7:249-260 5. Boller T, Felix G (2009) A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by patternrecognition receptors. Annu Rev Plant Biol 60:379-406 6. Bolton MD, Van Esse HP, Vossen JH, et al. (2008) The novel Cladosporium fulvum lysin motif effectors Ecp6 is a virulence factor with orthologues in other fungal species. Mol Microbiol 69:119-136 7. Brotman Y, Briff E, Viterbo A, Chet I (2008) Role of swollenin, an expansin-like protein from Trichoderma, in plant root colonization. Plant Physiol 147:779-789 8. Brotman Y, Lisec J, Méret M, Chet I, Willmitzer L, Viterbo A (2012) Transcript and metabolite analysis of the Trichoderma-induced systemic resistance response to Pseudomonas syringae in Arabidopsis thaliana. Microbiology 158:139-146 9. Conrath U (2011) Molecular aspects of defence priming. Trends Plant Sci 16:524-531 10. Contreras-Cornejo HA, Macías-Rodríguez L, Cortés-Penagos C, LópezBucio J (2009) Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxindependent mechanism in Arabidopsis. Plant Physiol 149:1579-1592 11. De Jonge R, Van Esse HP, Kombrink A, et al. (2010) Conserved fungal LysM effector Ecp6 prevents chitin-triggered immunity in plants. Science 329:953-955


Trichoderma spp. opportunism

12. De Lorenzo G, Brutus A, Savatin DV, Sicilia F, Cervone F (2011) Engineering plant resistance by constructing chimeric receptors that recognize damage-associated molecular patterns (DAMPs). FEBS Lett 585:1521-1528 13. Djonovic S, Vargas WA, Kolomiets MV, Horndeski M, Wiest A, Kenerley CM (2007) A proteinaceus elicitor Sm1 from the beneficial fungus Trichoderma virens is required for induced systemic resistance in maize. Plant Physiol 145:875-889 14. Dodds PN, Rathjen JP (2010) Plant immunity: towards an integrated view of plant-pathogen interactions. Nat Rev Genet 11:539-548 15. Druzhinina IS, Seidl-Seiboth V, Herrera-Estrella A, et al. (2011) Trichoderma: the genomics of opportunistic success. Nat Rev Microbiol 9:749-759 16. Gatz C (2013) From pioneers to team players: TGA transcription factors provide molecular link between different stress pathways. Mol Plant Microb Interact 26:151-159 17. Hamayun M, Khan SA, Iqbal I, Ahmad B, Lee IJ (2010) Isolation of a gibberellin-producing fungus (Penicillium sp. MH7) and growth promotion of crown daisy (Chrysanthemum coronarium). J Microbiol Biotechnol 20:202-207 18. Harman GE, Howell CR, Viterbo A, Chet I, Lorito M (2004) Trichoderma species-opportunistic, a virulent plant symbionts. Nat Rev Microbiol 2:43-56 19. Harman GE, Obregón MA, Samuels GJ, Lorito M (2010) Changing models for commercialization and implementation of biocontrol in the developing and the developed world. Plant Dis 94:928-939 20. Hermosa R, Viterbo A, Chet I, Monte E (2012) Plant-beneficial effects of Trichoderma and of its genes. Microbiology 158:17-25 21. Jacobs S, Zechmann B, Molitor A, Trujillo M, Petutschnig E, Lipka V, Kogel KH, Schäfer P (2011) Broad-spectrum suppression of innate immunity is required for colonization of Arabidopsis roots by the fungus Piriformospora indica. Plant Physiol 156:726-740 22. Jones JDG, Dangl JL (2006) The plant immune system. Nature 444:323-329 23. Kazan K, Manners JM (2012) JAZ repressors and the orchestration of phytohormone crosstalk. Trends Plant Sci 17:22-31 24. Kazan K, Manners JM (2013) MYC2: The master in action. Mol Plant 6:686-703 25. Kubicek CP, Herrera-Estrella A, Seidl-Seiboth V, et al. (2011) Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma. Genome Biol 12:R40 26. Leon-Reyes A, Du Y, Koornneef A, Proietti S, Körbes AP, Memelink J, Pieterse CM, Ritsema T (2010) Ethylene signaling renders the jasmonate response of Arabidopsis insensitive to future suppression by salicylic acid. Mol Plant Microbe Interact 23:187-197 27. López-Ráez JA, Verhage A, Fernández I, García JM, Azcón-Aguilar C, Flors V, Pozo MJ (2010) Hormonal and transcriptional profiles highlight common and differential host responses to arbuscular mycorrhizal fungi and the regulation of the oxylipin pathway. J Exp Bot 61:2589-2601 28. Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) Ethylene response factor 1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15:165-178 29. Lorito M, Woo SL, Harman GE, Monte E (2010) Translational research on Trichoderma: from omics to the field. Annu Rev Phytopathol 48:395418 30. Luo Y, Zhang DD, Dong XW, et al. (2010) Antimicrobial peptaibols induce defense responses and systemic resistance in tobacco against tobacco mosaic virus. FEMS Microbiol Lett 313:120-126 31. Malmierca MG, Cardoza RE, Alexander NJ, McCormick SP, Collado IG, Hermosa R, Monte E, Gutiérrez S (2013) Relevance of trichothecenes in fungal physiology: disruption of tri5 in Trichoderma arundinaceum. Fungal Genet Biol 53:22-33

Int. Microbiol. Vol. 16, 2013

79

32. Malmierca MG, Cardoza RE, Alexander NJ, McCormick SP, Hermosa R, Monte E, Gutiérrez S (2012) Involvement of Trichoderma trichothecenes in the biocontrol activity and induction of plant defense-related genes. Appl Environ Microbiol 78:4856-4868 33. Marra R, Ambrosino P, Carbone V, et al. (2006) Study of the three-way interaction between Trichoderma atroviride, plant and fungal pathogens by using a proteomic approach. Curr Genet 50:307-321 34. Martinez C, Blanc F, Le Claire E, Besnard O, Nicole M, Baccou JC (2001) Salicylic acid and ethylene pathways are differentially activated in melon cotyledons by active or heat-denatured cellulase from Trichoderma longibrachiatum. Plant Physiol 127:334-344 35. Matarasso N, Schuster S, Avni A (2005) A novel plant cysteine protease has a dual function as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase gene expression. Plant Cell 17:1205-1216 36. Millet YA, Danna CH, Clay NK, Songnuan W, Simon MD, WerckReichhart D, Ausubel FM (2010) Innate immune responses activated in Arabidopsis roots by microbe-associated molecular patterns. Plant Cell 22:973-990 37. Monte E (2001) Understanding Trichoderma: between biotechnology and microbial ecology. Int Microbiol 4:1-4 38. Morán-Diez E, Hermosa R, Ambrosino P, Cardoza RE, Gutiérrez S, Lorito M, Monte E (2009) The ThPG1 endopolygalacturonase is required for the Trichoderma harzianum-plant beneficial interaction. Mol Plant Microbe Interact 22:1021-1031 39. Morán-Diez E, Rubio B, Domínguez S, Hermosa R, Monte E, Nicolás C (2012) Transcriptomic response of Arabidopsis thaliana after 24h incubation with the biocontrol fungus Trichoderma harzianum. J Plant Physiol 169:614-620 40. Navarro L, Bari R, Achard P, Lisón P, Nemri A, Harberd NP, Jones JD (2008) DELLAs control plant immune responses by modulating the balance and salicylic acid signaling. Curr Biol 18:650-655 41. Park AR, Cho SK, Yun UJ, Jin MY, Lee SH, Sachetto-Martins G, Park OK (2001) Interaction of the Arabidopsis receptor protein kinase Wak1 with a glycine-rich protein, AtGRP-3. J Biol Chem 276:26688-26693 42. Peleg-Grossman S, Golani Y, Kaye Y, Melamed-Book N, Levine A (2009) NPR1 protein regulates pathogenic and symbiotic interactions between Rhizobium and legumes and non-legumes. PLOS One 4:e8399 43. Piel J, Atzorn R, Gäbler R, Kühnemann F, Boland W (1997) Cellulysin from the plant parasitic fungus Trichoderma viride elicits volatile biosynthesis in higher plants via the octadecanoid signalling cascade. FEBS Lett 416:143-148 44. Pieterse CMJ, Leon-Reyes A, Van der Ent S, Van Wees SCM (2009) Networking by small-molecule hormones in plant immunity. Nat Chem Biol 5:308-316 45. Pieterse CMJ, Van Wees SCM, Van Pelt JA, Knoester M, Laan R, Gerrits H, Weisbeek PJ, Van Loon LC (1998) A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10:1571-1580 46. Pineda A, Zheng SJ, Van Loon JJA, Pieterse CMJ, Dicke M (2010) Helping plants to deal with insects: the beneficial soil-borne microbes. Trends Plant Sci 15:507-514 47. Pitzschke A, Schikora A, Hirt H (2009) MAPK cascade signalling networks in plant defence. Curr Opin Plant Biol 12:421-426 48. Pozo MJ, Van der Ent S, Van Loon LC, Pieterse CMJ (2008) Transcription factor MYC2 is involved in priming for enhanced defense during rhizobacteria-induced systemic resistance in Arabidopsis thaliana. New Phytol 180:511-523 49. Ron M, Avni A (2004) The receptor for the fungal elicitor ethyleneinducing xylanase is a member of a resistance-like gene family in tomato. Plant Cell 16:1604-1615 50. Rubio MB, Hermosa R, Reino JL, Collado IG, Monte E (2009) Thctf1 transcription factor of Trichoderma harzianum is involved in 6-pentyl-


80

Int. Microbiol. Vol. 16, 2013

2H-pyran-2-one production and antifungal activity. Fungal Genet Biol 46:17-27 51. Salas-Marina MA, Silva-Flores MA, Uresti-Rivera EE, Castro-Longoria E, Herrera-Estrella A, Casas-Flores S (2011) Colonization of Arabidopsis roots by Trichoderma atroviride promotes growth and enhances systemic disease resistance through jasmonic acid/ethylene and salicylic acid pathways. Eur J Plant Pathol 131:15-26 52. Samolski I, Rinc贸n AM, Pinz贸n LM, Viterbo A, Monte E (2012) The quid74 gene from Trichoderma harzianum has a role in root architecture and plant biofertilization. Microbiology 158:129-138 53. Schmitz RJ, Schultz MD, Urich MA, et al. (2013) Patterns of population epigenomic diversity. Nature 495:193-198 54. Segarra G, Casanova E, Bellido D, Odena MA, Oliveira E, Trillas I (2007) Proteome, salicylic acid, and jasmonic acid changes in cucumber plants inoculated with Trichoderma asperellum strain T34. Proteomics 7:3943-3952 55. Segarra G, Ent SD, Trillas I, Pieterse CMJ (2009) MYB72, a node of convergence in induced systemic resistance triggered by a fungal and a bacterial beneficial microbe. Plant Biol 11:90-96 56. Shoresh M, Harman GE (2008) The molecular basis of shoot responses of maize seedlings to Trichoderma harzianum T22 inoculation of the root: A proteomic approach. Plant Physiol 147:2147-2163 57. Shoresh M, Harman GE, Mastouri F (2010) Induced systemic resistance and plant responses to fungal biocontrol agents. Annu Rev Phytopathol 48:21-43 58. Spaepen S, Vanderleyden J (2011) Auxin and plant-microbe interactions. Cold Spring Harb Perspect Biol 3:a001438 59. Spoel SH, Johnson JS, Dong X (2007) Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proc Natl Acad Sci USA 104:18842-18847 60. Stergiopoulos I, De Wit PJGM (2009) Fungal effector proteins. Annu Rev Phytopathol 47:233-263

hermosa et al.

61. Thaler JS, Humphrey PT, Whiteman NK (2012) Evolution of jasmonate and salicylate signal crosstalk. Trends Plant Sci 17:260-270 62. Tijerino A, Cardoza RE, Moraga J, et al. (2011) Overexpression of the trichodiene synthase gene tri5 increases trichodermin production and antimicrobial activity in Trichoderma brevicompactum. Fungal Genet Biol 48:285-296 63. Van der Ent, Van Wees SCM, Pieterse CMJ (2009) Jasmonate signaling in plant interactions with resistance-inducing beneficial microbes. Phytochemistry 70:1581-1588 64. Vinale F, Sivasithamparam K, Ghisalberti EL, Marra R, Barbetti MJ, Li H, Woo SL, Lorito M (2008) A novel role for Trichoderma secondary metabolites in the interactions with plants. Physiol Mol Plant Pathol 72:80-86 65. Viterbo A, Landau U, Kim S, Chernin L, Chet I (2010) Characterization of ACC deaminase from the biocontrol and plant growth-promoting agent Trichoderma asperellum T203. FEMS Microbiol Lett 305:42-48 66. Viterbo A, Wiest A, Brotman Y, Chet I, Kenerley C (2007) The 18mer peptaibols from Trichoderma virens elicit plant defence responses. Mol Plant Pathol 8:737-746 67. Yano S, Tokumitsu H, Soderling TR (1998) Calcium promotes cell survival through CaM-K kinase activation of the protein-kinase-B pathway. Nature 396:584-587 68. Yedidia I, Shoresh M, Kerem Z, Benhamou N, Kapulnik Y, Chet I (2003) Concomitant induction of systemic resistance to Pseudomonas siringae pv. lachrymans in cucumber by Trichoderma asperellum (T-203) and accumulation of phytoalexins. Appl Environ Microbiol 69:7343-7353 69. Yoshioka Y, Ichikawa H, Naznin HA, Kogure A, Hyakumachi M (2012) Systemic resistance induced in Arabidopsis thaliana by Trichoderma asperellum SKT-1, a microbial pesticide of seed borne diseases of rice. Pest Manag Sci 68:60-66 70. Zamioudis C, Pieterse CMJ (2012) Modulation of host immunity by beneficial microbes. Mol Plant Microbe Interact 25:139-150


RESEARCH ARTICLE International Microbiology (2013) 16:81-86 doi: 10.2436/20.1501.01.182 ISSN 1139-6709 www.im.microbios.org

Staphylococcus aureus outbreak in the intensive care unit of the largest public hospital in Quito, Ecuador Paul A. Cardenas,1,2 Marta Alarcón,3 Inés Narvaez,3 Ramiro Salazar,3 Guillermo Falconí,3 Mauricio Espinel,1 Gabriel Trueba1* 1 Institute of Microbiology, College of Biological and Environmental Sciences, University of San Francisco de Quito, Quito, Ecuador. 2National Heart and Lung Institute, Imperial College, London, UK. 3Carlos Andrade Marín Hospital, Quito, Ecuador

Received 18 April 2013 · Accepted 24 June 2013

Summary. Staphylococcus aureus is a frequent cause of nosocomial pneumonia and bacteremia worldwide. Classical and molecular epidemiology approaches were used to study a S. aureus outbreak in the intensive care unit (ICU) of one of the largest public hospitals in Quito. Staphylococcus aureus isolates from 17 patients and 19 potential carriers from the staff were collected from March 2007 to February 2008 and analyzed by pulsed-field gel electrophoresis (PFGE) to determine their clonal relationships. During this period the hospital reported 16 cases of hospital-acquired staphylococcal pneumonia and an apparent outbreak occurred from June to September 2007. DNA from these isolates formed six different PFGE patterns: four clonal groups, and two groups of clonally related isolates. Molecular typing failed to identify any staphylococcal reservoir among staff members. The current study suggested that a staphylococcal outbreak that occurred in the summer of 2007 was caused by different bacterial clones, although some clones were shared by two patients. Historical analysis of the staphylococcal infections in the ICU showed a higher incidence during the summer months, which coincided with the programmed personnel shift. This observation suggests that outbreaks might be produced by the introduction of improperly trained personnel. [Int Microbiol 2013; 16(2):81-86] Keywords: Staphylococcus aureus · staphylococal pneumonia · nosocomial outbreaks · MRSA

Introduction Nosocomial infections are serious public health problems especially in developing countries, where the rates are 3- to 20-times higher than in industrialized countries [25]. These

Corresponding author: G. Trueba College of Biological and Environmental Sciences Universidad San Francisco de Quito Via Interoceánica y Diego de Robles Cumbayá, Quito, Ecuador Tel. + 59-322971836. Fax + 59-322890070 E-mail: gtrueba@usfq.edu.ec

*

infections increase mortality, morbidity, and treatment costs [23]. Staphylococcus aureus, while a member of the normal microbiota of the nasopharynx, can also produce lower respiratory tract infections, bacteremia (the second most frequent infection), and sepsis [4,16]. Virulence and antibiotic resistance in S. aureus is enhanced by horizontal DNA transfer [8]. The presence of Staphylococcus aureus carriers among hospital staff in intensive care, dialysis, and surgical units increases the risk of nosocomial infections two- to three-fold [12,18]. The emergence of resistance to cephalosporins in different bacteria [7] and, especially, outbreaks of methicillin-resistant S. aureus (MRSA) have become increasingly widespread in hospitals [12]. There also has been an increasing number of


82

Int. Microbiol. Vol. 16, 2013

cardenas et al.

nosocomial and community-acquired MRSA infections that carry a high mortality. In fact, a report published in 2008 showed that, in the USA, mortality caused by MRSA infections was similar to the combined mortality associated with AIDS, tuberculosis, and viral hepatitis [3] Surveillance is critical in the fight against nosocomial infections because it allows an assessment of the true impact of these infections and their associated risk factors, thereby guiding decision-making regarding prevention and control measures [11,19]. Molecular typing is an important epidemiological tool for studying the genetic lineage of pathogens in order to establish their patterns of dissemination. Genotyping assays have traced nosocomial outbreaks of S. aureus to a limited number of bacterial clones [1,17,21]. These are endemically recognized bacteria with epidemic behaviors.

This report describes an outbreak of staphylococcal infections in the intensive care unit (ICU) of the largest public hospital in Quito, Ecuador. The main objective of the study was to determine the factors involved in the occurrence of a staphylococcal outbreak in this hospital.

Materials and methods Sample collection. The study was carried out in the Carlos Andrade MarĂ­n Hospital in Quito, a 300-bed tertiary care center. The 18-bed ICU admits critically ill patients. This study was reviewed and approved by the Bioethics Committee of the University of San Francisco de Quito and by the Bioethics Committee of the aforementioned hospital. During a 1-year period (March 2007 to February 2008), we analyzed 17 isolates collected from patients with hospital-acquired S. aureus pneumonia. Information about the cause of admission, co-morbidities, length of hospital stay, and bed location

Table 1. Electropherotype and antimicrobial profiles of Staphylococcus aureus isolates obtained from patients with pneumonia Isolatea

Date of Isolation

Type

Antibiotic patternb

PFGE patternc

P1

May-07

MRSA

A

I

P2

June-07

MSSA

B

II

P3

June -07

MSSA

C

III

P4

July-07

MRSA

D

IVa

P5

July -07

MRSA

D

V

P6

July -07

MRSA

D

V

P7

Aug-07

MSSA

E

VI

P8

Aug -07

MRSA

D

IVb

P9

Aug -07

MSSA

E

VII

P10

Aug -07

MRSA

D

IVa

P11

Aug -07

MSSA

F

VIII

P12

Aug -07

MSSA

E

IXa

P13

Sept-07

MSSA

G

IXb

P14

Oct-07

MSSA

H

IXb

P15

Nov-08

MRSA

D

X

P16

Dec-08

MRSA

D

X

P17

Feb-08

MSSA

C

IXb

All isolates were cultured from tracheal fluid exept for P9 and P16, which were cultured from blood. Most isolates were obtained from patients with mechanic ventilation except for P7, P10, P11, P12. All isolates originated from hospital- acquired pneumonia exept for P7, which was obtained from a community-acquired pneumonia. b Letters indicate antibiotic sensitivity profiles: (A) resistant to cefoxitin, erythromycin, norfloxacin, and penicillin; (B) no resistance to any of the antibiotics tested; (C) resistant to erythromycin; (D) resistant to cefoxitin, erythromycin, clindamycin, norfloxacin, and penicillin; (E) resistant to penicillin; (F) intermediate resistant to penicillin; (G) resistant to penicillin and norfloxacin; (H) resistant to erythromycin, clindamycin, and penicillin. c Roman numbers (I to X) indicate electropherotypes (see Fig. 2). a


Int. Microbiol. Vol. 16, 2013

S. aureus outbreak in Quito

was also obtained. In the same hospital and during the same period of time, we collected 51 nasal swabs from ICU healthcare workers (14 medical doctors, 15 nurses, 10 nursing assistants, 5 physiotherapists, 1 social worker, 1 administrative staff person, 3 cleaning staff, and 2 technical staff members). Bacterial isolates. Seventeen S. aureus isolates (one bacterial colony per patient) from in-patients with pneumonia were collected between March 2007 and February 2008 from the Carlos Andrade Marín Hospital in Quito. In addition, 19 strains were obtained from nasal samples of 51 healthcare workers employed in the ICU. The samples were cultivated in mannitol salt agar (MSA) and Baird-Parker agar, and were subjected to coagulase and DNase tests. The isolates were stored at –80 °C until analyzed. Isolates from patients were labeled P1 to P17 according to the chronological order of isolation. Additionally, S. aureus isolates were obtained from the nasopharynx (nasal swab) of the 51 ICU healthcare workers tested. Antimicrobial sensitivity tests. Antibiotic susceptibility tests were carried out by the disk diffusion method using Mueller-Hinton agar. The antimicrobial agents tested included cefoxitin 30-μg disk (FOX), erythromycin 15-μg disk (E), clindamycin 2-μg disk (DA), norfloxacin 10-μg disk (NOR), and penicillin (P) 10-IU disk. To determine the antimicrobial susceptibility profile to methicillin we used cefoxitin disks and a breakpoint of ≤19 mm as indicative of oxacillin resistance, following the standards of the Clinical and Laboratory Standards Institute (CLSI, formerly the National Committee for Clinical Laboratory Standards) [5]. Isolates displaying similar antibiotic sensitivity profiles were designated with a letter (A–H), as shown in Table 1.

plugs were prepared by mixing 200 µl of a bacterial suspension in 75 mM NaCl–25 mM EDTA (pH 7.5) buffer (optical density of 0.63 ± 002, measuring the absorbance at 610 nm) with 200 µl of a molten solution of 1 % BioRad PFGE agarose in TBE 0.5×, 1 % SDS solution containing 4 μg of lysostaphin (Sigma-Aldrich, Oakville, Ontario, Canada). Cells were lysed in situ at 37 °C for 4 h in lysis buffer (6 mM Tris-HCl [pH 8.0], 1 M NaCl, 100 mM EDTA, 0.5 % Brij-58, 8 μg of lysostaphin, 0.5 % sodium lauroylsarcosine). Cells in plugs were lysed overnight at 50 °C in 15 ml of lysis buffer (50 mM Tris, 50 mM EDTA, 1 % Sarkosyl) containing 0.8 mg of proteinase K (Bio-Rad Laboratories, Hercules, CA, USA). The plugs were washed with sterile water and TE and each plug was digested overnight at 30 °C in 100 µl of React 4 Buffer containing 0.1 mg/ml BSA and 10 U of the restriction enzyme SmaI. The slices were loaded into a 1 % agarose gel, and DNA was separated by PFGE using a CHEF DRII system (Bio-Rad) and TBE 0.5× buffer with pulse times of 5–40 s at 6 V/cm for 21 h at 14 °C. Concatameric bacteriophage lambda DNA molecules (New England Biolabs, Ipswich, USA ) were used as the molecular weight standard [15]. The PFGE patterns of the clinical isolates were compared and clonal relatedness was established based on the recommendations of Tenover et al. [22], followed by a clustering analysis using the UPGMA algorithm with the DICE coefficient.

Results Bacterial isolates. Seventeen S. aureus strains (eight methicillin-resistant S. aureus, MRSA, and nine methicillinsensitive) were isolated from patients during the 1-year study

Int Microbiol

Pulsed-field gel electrophoresis. Isolates were analyzed by pulsedfield gel electrophoresis (PFGE). A sample of each S. aureus isolate was plated on brain-heart infusion agar and incubated overnight at 37 °C. Agarose

83

Fig. 1. UPGMA tree constructed with the PFGE profiles obtained from the staphylococcal isolates collected from 17 patients (P1–P17). Distances indicate the number of differences between bands. The DICE coefficient was used; P7, a strain isolated from a patient with community-acquired pneumonia, was regarded as an unrelated isolate. (See Table 1.)


Int. Microbiol. Vol. 16, 2013

cardenas et al.

Int Microbiol

84

Fig. 2. Time distribution of Staphyloccocus aureus PFGE patterns. The vertical axes indicate the number of staphyloccal infections. Roman numbers indicate electropherotypes. (See Table 1 and Fig. 1.)

period. The characteristics of the strains are summarized in Table 1. During the 12-month investigation, the most common nosocomial infection was S. aureus ventilator-associated pneumonia (14 patients). The most common cause of admission of patients suffering pneumonia was severe traumatic brain injury (9 patients). An apparent outbreak, consisting of 11 cases of hospital-acquired pneumonia, occurred from July to September 2007 (Fig. 2). Nineteen S. aureus isolates were obtained from the 51 ICU healthcare workers from the same hospital. Clonal analysis of isolates. The isolates associated with infections belonged to six PFGE profiles; four groups of isolates had identical PFGE patterns, and two isolates had similar but not identical profiles. The isolates with identical PFGE patterns were as follows: P4 and P10, belonging to PFGE pattern IVa (isolated in July and August 2007); P5 and P6, belonging to PFGE pattern V (isolated in July 2007); P15

and P16, belonging to PFGE pattern X (isolated in November and December 2007); and isolates P13, P14, and P17, belonging to PFGE pattern IXb (isolated in September, October 2007 and February 2008, respectively) (Fig. 1). The profile of P8 was similar but not identical to PFGE pattern IVa and the profile of P12 was similar but not identical to PFGE pattern IXb (Fig. 1). Isolates P13, P14, and P17 had identical PFGE patterns (IXb) but their antimicrobial sensitivity profiles differed (Table 1). An isolate from community-acquired pneumonia (isolate P7) was used as the unrelated isolate (Fig. 1). In the phylogenetic analysis, all relationships were supported by the UPGMA algorithm with the DICE coefficient (Fig. 1). The distribution of PFGE patterns over time is consistent with the circulation of a variety of clones during the outbreak occurring between July 2007 and February 2008 (Fig. 2). Although staff members carried S. aureus, none of their PFGE patterns was found in the pneumonia outbreak.


Int. Microbiol. Vol. 16, 2013

S. aureus outbreak in Quito

Discussion This report analyzes an outbreak of S. aureus that took place from July to September 2007 in the ICU of the largest public hospital in Quito. During this period, most cases of ventilatorassociated pneumonia detected in the hospital were caused by S. aureus. The bacterium is a common cause of infections on ICUs in other parts of the world [10]. Molecular characterization of the isolates from patients showed that six different clonal groups circulated among ICU patients during this period and that some of the patients were infected with isolates with identical PFGE profiles (Figs. 1,2). However, there was no apparent relationship between the S. aureus isolates from patients and those from the personnel (data not shown). By contrast, previous studies had reported that healthcare workers carried bacteria infecting patients [2,13,14,20,24] and that outbreaks are usually caused by a limited number of clones [1,6,17,21]. Our data suggest that, in the Quito hospital, bacteria were transferred between patients, although the small number of samples from healthcare workers in this study may have hampered detection of the same clones in healthy carriers. The summer outbreak coincided with a personnel rotation. Hospital records indicated that an outbreak of S. aureus had occurred during the same period in 2006. From the genotyping data and the time frame during which most of the cases occurred, we speculate that the cause of the outbreaks could have been the presence in the ICU of improperly trained personnel, who might have facilitated the cross-contamination of ventilation equipment. One clone (PFGE pattern IXb) was isolated from cases occurring from September 2007 to February 2008, suggesting that some strains would be carried by other patients or even personnel during this time. However, we failed to identify carriers among staff personnel (we were only able to sample 80 % of the staff, once). Additionally, inconsistencies between PFGE patterns and antibiotic resistance profiles suggest that this clone was subject to horizontal gene transfer during that period. According to the recommendations of the World Health Organization (WHO), nosocomial infections can be prevented by appropriate isolation, sterilization, staff training, and epidemiologic surveillance [9]. In Carlos Andrade Marín Hospital, however, nosocomial infections were not reported periodically to the infection control committee. Antibiotic prophylaxis was administered to 15 of the 17 patients with acquired staphylococcal pneumonia, which indicates that therapy was unsuccessful. In addition, due to the increase in the number of cases during the summer, the personnel work-

85

ing on the ICU during those months should be adequately trained to prevent the dissemination of infections. Acknowledgements. We thank the personnel of the ICU and the Microbiology Laboratory of Carlos Andrade Marín Hospital. Financial support was granted by the University of San Francisco de Quito, Ecuador. Competing interests. None declared.

References 1. Amorim ML, Faria NA, Oliveira DC, Vasconcelos C, Cabeda JC, Mendes AC, Calado, E, Castro, AP, Ramos MH, Amorim JM, de Lencastre H (2007) Changes in the clonal nature and antibiotic resistance profiles of methicillin-resistant Staphylococcus aureus isolates associated with spread of the EMRSA-15 clone in a tertiary care Portuguese hospital. J Clin Microbiol 45:2881-2888 2. Ben-David D, Mermel LA, Parenteau S (2008) Methicillin-resistant Staphylococcus aureus transmission: the possible importance of unrecognized health care worker carriage. Am J Infect Control 36:93-97 3. Boucher HW, Corey GR (2008). Epidemiology of methicillin-resistant Staphylococcus aureus. Clin Infect Dis 46: S344-S349. 4. Chambers HF (2001) The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis 7:178-182 5. CLSI (2007) Performance standards for antimicrobial susceptibility testing. Seventeenth informational supplement Vol 27. Clinical and Laboratory Standards Institute, Wayne, PA, USA 6. Cookson BD, Robinson DA, Monk AB, Murchan S, Deplano A, de Ryck R, Struelens MJ, Scheel C, Fussing V, Salmenlinna S, Vuopio-Varkila J, Cuny C, Witte W, Tassios PT, Legakis NJ, van Leeuwen W, van Belkum A, Vindel A, Garaizar J, Haeggman S, Olsson-Liljequist B, Ransjo U, Muller-Premru M, Hryniewicz W, Rossney A, O’Connell B, Short BD, Thomas J, O’Hanlon S, Enright MC (2007) Evaluation of molecular typing methods in characterizing a European collection of epidemic methicillin-resistant Staphylococcus aureus strains: the HARMONY collection. J Clin Microbiol 45:1830-1837 7. de Toro M, Sáenz Y, Cercenado E, Rojo-Bezares B, García-Campello M, Undabeitia E, Torres C (2011) Genetic characterization of the mechanisms of resistance to amoxicllin/clavulanate and third-generation cephalosporins in Salmonella enterica from three Spanish hospitals. Int Microbiol 14:173-181 8. Donate-Correa J, Alcoba-Flórez J, Méndez-Álvarez S (2011) New Staphylococcus aureus genetic cluster associated with infectious osteomyelitis. Int Microbiol 14:33-39 9. Ducel G, Fabry J, Nicolle L (2002) Prevention of hospital-acquired infections a practical guide. 2nd ed. World Health Organization (WHO), Malta 10. Fagon JY, Maillet JM, Novara A (1998) Hospital-acquired pneumonia: methicillin resistance and intensive care unit admission. Am J Med 104:17S-23S 11. Gerberding JL (2002) Hospital-onset infections: a patient safety issue. Ann Intern Med 137:665-670 12. Gould IM (2006) Costs of hospital-acquired methicillin-resistant Staphylococcus aureus (MRSA) and its control. Int J Antimicrob Ag 28:379-384 13. Lin YC, Lauderdale TL, Lin HM, Chen PC, Cheng MF, Hsieh KS, Liu YC (2007) An outbreak of methicillin-resistant Staphylococcus aureus infec-


86

Int. Microbiol. Vol. 16, 2013

tion in patients of a pediatric intensive care unit and high carriage rate among health care workers. J Microbiol Immunol Infect 40:325-334 14. Lu PL, Tsai JC, Chiu YW, Chang FY, Chen YW, Hsiao CF, Siu LK (2008) Methicillin-resistant Staphylococcus aureus carriage, infection and transmission in dialysis patients, healthcare workers and their family members. Nephrol Dial Transplant 23:1659-1665 15. McDougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK,Tenover FC (2003) Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol 41:5113-5120 16. Menichetti F (2005) Current and emerging serious Gram-positive infections. Clin Microbiol Infect 11 Suppl 3:22-28 17. Norazah A, Lim VK, Rohani MY, Alfizah H, Koh YT, Kamel AG (2003) A major methicillin-resistant Staphylococcus aureus clone predominates in Malaysian hospitals. Epidemiol Infect 130:407-411 18. Perl TM, Golub JE (1998) New approaches to reduce Staphylococcus aureus nosocomial infection rates: treating S. aureus nasal carriage. Ann Pharmacother 32:S7-16 19. Singh A, Goering RV, Simjee S, Foley SL, Zervos MJ (2006) Application of molecular techniques to the study of hospital infection. Clin Microbiol Rev 19:512-530 20. Snyder GM, Thom KA, Furuno JP, Perencevich EN, Roghmann MC, Strauss SM, Netzer G, Harris AD (2008) Detection of methicillin-resis-

cardenas et al.

tant Staphylococcus aureus and vancomycin-resistant enterococci on the gowns and gloves of healthcare workers. Infect Control Hosp Epidemiol 29:583-589 21. Sola C, Gribaudo G, C贸rdoba MRSA Collaborative Study Group, Vindel A, Patrito L, Bocco JL (2002) Identification of a novel methicillin-resistant Staphylococcus aureus epidemic clone in Cordoba, Argentina, involved in nosocomial infections. J Clin Microbiol 40:1427-1435 22. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B (1995) Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33:2233-2239 23. Weinstein RA (1998) Nosocomial infection update. Emerg Infect Dis 4:416-420 24. Wernitz MH, Swidsinski S, Weist K, Sohr D, Witte W, Franke KP, Roloff D, Ruden H,Veit SK (2005) Effectiveness of a hospital-wide selective screening programme for methicillin-resistant Staphylococcus aureus (MRSA) carriers at hospital admission to prevent hospital-acquired MRSA infections. Clin Microbiol Infect 11:457-465 25. Zaidi AK, Huskins WC, Thaver D, Bhutta ZA, Abbas Z, Goldmann DA (2005), Hospital-acquired neonatal infections in developing countries. Lancet 365:1175-1188


RESEARCH ARTICLE International Microbiology (2013) 16:87-92 doi: 10.2436/20.1501.01.183 ISSN 1139-6709 www.im.microbios.org

Increased bile resistance in Salmonella enterica mutants lacking Prc periplasmic protease Sara B. Hernández,1 Juan A. Ayala,2 Gadea Rico-Pérez,3 Francisco García-del Portillo,3 Josep Casadesús1* 1 Department of Genetics, School of Biology, University of Sevilla, Sevilla, Spain. Center of Molecular Biology Severo Ochoa, CSIC-Autonomous University of Madrid, Cantoblanco, Spain. 3 National Center of Biotechnology (CNB)-CSIC, Madrid, Spain

2

Received 29 May 2013 · Accepted 26 June 2013

Summary. Prc is a periplasmic protease involved in processing of penicillin-binding protein 3 (PBP3). Lack of Prc suppresses bile sensitivity in Dam–, Wec–, PhoP–, DamX–, and SeqA– mutants of Salmonella enterica, and increases bile resistance in the wild type. Changes in the activity of penicillin binding proteins PBP3, PBP4, PBP5/6 and PBP7 are detected in a Prc– background, suggesting that peptidoglycan remodeling might contribute to bile resistance. [Int Microbiol 2013; 16(2):87-92] Keywords: Salmonella · bile · Prc protease · peptidoglycan · penicillin-binding proteins

Introduction Salmonella enterica is a bacterial pathogen that infects humans and livestock animals causing intestinal, systemic, and chronic infections [9]. In the intestine and in the hepatobiliary tract, Salmonella is exposed to bile, a fluid containing cholesterol, bile salts, phospholipids, proteins, bilirubin, and electrolytes [15]. About two thirds of bile (dry weight) are made of bile salts, a family of amphipathic molecules derived from cholesterol [16]. The relationship between intestinal bacteria and bile salts is complex. On one hand, bile salts control the Corresponding author: J. Casadesús Departamento de Genética, Facultad de Biología Universidad de Sevilla Apartado 1095 41080 Sevilla, Spain Tel. +34-95459756. Fax +34-954557104 E-mail: casadesus@us.es

*

expression of certain genes, and can be considered environmental signals used by the bacterium to identify the intestinal milieu [3]. On the other hand, bile salts are antibacterial compounds that disrupt membranes, denature proteins, and damage DNA [3,10]. Enteric bacteria are able to resist the antibacterial activities of bile salts, and an extreme example is Salmonella enterica which colonizes the bile-laden gall bladder during systemic and chronic infections [7,10]. In asymptomatic human carriers of Salmonella Typhi, persistence in the gall bladder can last for decades or even for a lifetime [7]. The mechanisms that permit Salmonella survival in the presence of bile are partially understood. Envelope structures such as the lipopolysaccharide and the enterobacterial common antigen serve as barriers that reduce intake of bile salts [3]. However, the protection provided by these barriers is incomplete, making other mechanisms necessary. Intake of bile salts induces the RpoS general stress response and other stress responses that facilitate survival [14]. In turn, activation of the


88

Int. Microbiol. Vol. 16, 2013

hernández et al.

SOS system helps to cope with bile-induced DNA injuries [26]. In addition, the intracellular concentration of bile salts is reduced by active transport of bile from the cytoplasm, especially by the AcrAB efflux pump [22]. Genetic analysis has proven useful for the identification of bile resistance functions. Isolation of bile-sensitive mutants has permitted the identification of cellular functions necessary for bile resistance, and searches for suppressors of bile sensitivity have helped to outline the responses or “pathways” involved. Especially productive has been the use of Salmonella Dam– mutants, which are extremely sensitive to bile [28]. Certain suppressors of bile sensitivity in the Dam– background have been found to suppress bile sensitivity caused by mutations other than dam [24,26,27]. Broad suppressor capacity usually indicates that a cellular defense response has been activated by the suppressor mutation, thus permitting the identification of bile defense responses [24]. Below, we describe a novel class of suppressors of bile sensitivity in Salmonella Dam– mutants. Loss of function in the S. enterica prc gene restores bile resistance in Dam– mutants and in other bile-sensitive mutants, and increases bile resistance in the wild type. Penicillin-binding proteins PBP3, PBP4, PBP5/6, and PBP7 show altered activity in S. enterica Prc– mutants, suggesting that changes in PBP activity can modulate bile resistance, perhaps by modification of peptidoglycan structure.

lates were lysed with P22 HT, and the lysates were used to transduce SV6100, selecting Tcr transductants. A 100 % linkage between tetracycline resistance and DOC resistance confirmed the existence of a suppressor mutation generated by T-POP insertion. Chromosomal DNA from bile resistant mutants carrying T-POP insertions was digested with PstI, which does not cleave within the T-POP element, and ligated to the PstI site of plasmid pBlueScript II. Ligation mixtures were electroporated into E. coli DH5a, and transformants were selected on LB plates supplemented with 100 µg/ml Ap. Upon plasmid DNA purification, T-POP boundaries were sequenced with primers 5´ GAT CAC CAA GGT GCA GAG CC 3´, and 5´ TCT TGA TAA CCC AAG AGG GC 3´.

Materials and methods

Microscopic observation of cells. Cultures were grown at 37 °C to exponential phase. For DNA staining, samples suspended in 100 µl of phosphate-buffer saline (PBS) were mixed with 2 µl of Hoechst 33342 (500 µg µg/ml), incubated 20–30 min at 37°C, and washed with PBS. About 2-3 µl of the culture samples were placed on a microscope slide. Images were acquired with a Leica DMR fluorescence microscope using the 100× oil-objective lens, and were analyzed with the Leica IM50 software.

Bacterial strains, bacteriophages, media and growth conditions. The strains of Salmonella enterica used in this study belong to serovar Typhimurium, and derive from the mouse-virulent strain SL1344 (His+). An exception is TH3468 (proAB47/F’128 [pro-lac] zzf3834::Tn10dTc[del-20 del-25] [T-POP3]), an LT2 derivative provided by K.T. Hughes, University of Utah, Salt Lake City. Escherichia coli DH5a [11] was used as the host of plasmids. Transductional crosses using phage P22 HT 105/1 int201 [33] were used for strain construction in S. enterica. The P22 HT transduction protocol was described elsewhere [6]. To obtain phage-free isolates, transductants were purified by streaking on green plates, prepared according to Chan et al. [4] except that methyl blue (Sigma, St. Louis, MO, USA) substituted for aniline blue. Phage sensitivity was tested by crossstreaking with the clear-plaque mutant P22 H5. Luria-Bertani broth (LB) was used as standard rich medium. Liquid cultures were grown with aeration by shaking in an orbital incubator. Solid LB contained agar 1.5 % final concentration. When specified, sodium deoxycholate (DOC) (Sigma) was added. Mutagenesis with T-POP and characterization of T-POP insertions. Pools of random T-POP3 [30] insertion mutants were generated using a P22 lysate grown on TH3468. The pools were then used to transduce strain SV6100 (∆dam-231). Transductants were selected on LB plates supplemented with 20 µg/ml Tc and 2.5 % DOC. Putative suppressor-carrying iso-

Construction of a Prc– mutant by site-directed mutagenesis. The S. enterica prc gene was disrupted by lambda Red recombination using plasmid pKD4 [5] and oligonucleotides 5´ CAC CTG GTG TTC TGA AAC GGA GGC CAG GCC TGG CAT GAA CTG TAG GCT GGA GCT GCT TCG 3´ and 5´ CCT GTT TAG CGT TAC TTA TTG GCT GCC GCC TGC TCC GCT GCA TAT GAA TAT CCT CCT TAG 3´. The external primers 5´ GTA GCG CGT CGT AAA GAA GG 3´and 5´ CCA TGA TCA GCA AGC CTT GC 3´ were used for allele verification. The antibiotic resistance cassette introduced during strain construction was excised by recombination with plasmid pCP20 [5]. Determination of the minimal inhibitory concentration [MIC]. An aliquot from an exponential culture, containing approx. 3 ×103 colony-forming-units/ml, was transferred to a polypropylene microtiter plate (Greiner, Frickenhausen, Germany) containing increasing concentrations of the antibacterial substance to be tested (DOC, antibiotic). After overnight incubation at 37°C, the MIC was determined by visual inspection. Growth curves. To monitor growth rate, 200 µl from an overnight culture grown in LB was diluted in 20 ml of salt-free LB (0 % NaCl) or LB (0.5 % NaCl), and grown at 30 ºC or 37 ºC with aeration by shaking. Growth was monitored by measuring the OD600 at 1 hour intervals. Experiments were performed in triplicate.

Preparation of cell envelopes. Envelopes were prepared as described elsewhere [28]. Briefly, ca. 1010 cells were rapidly cooled in an icesalt mix and harvested by low-speed centrifugation (15 min,15,000 ×g, 4 ºC). Bacterial pellets were resuspended in 1 ml of PBS pH 8.0. Cell suspensions (0.5 ml, approx.) were subjected to three bursts of sonication (30 s pulses) with a Branson sonifier, mod. 250 (Branson Ultrasonics Co., Danbury, CT, USA). Unbroken cells were discarded by centrifugation at 5000 ×g, 10 min, 4 ºC. Cell envelopes were recovered by high speed centrifugation (200,000 ×g, 20 min, 4ºC) and resuspended in 100 µl of PBS pH 8.0. In vitro assays of PBP activity. The assays were performed upon modification of previously described procedures [8]. Envelope fractions were prepared from exponential and stationary cultures grown in LB and LB without NaCl. The protein concentration was determined with a D-C protein assay kit (Bio-Rad, Hercules, California) and adjusted to 6 mg/ml in PBS, pH 8.0. Samples for binding assay were diluted 1/10 with PBS, pH 8.0, and 3 µl of bocillin FL (Molecular Probes, Eugene, Oregon) was added (10 µM final


Int. Microbiol. Vol. 16, 2013

Bile resistance in S. enterica

To ascertain whether the ability of a prc mutation to suppress bile sensitivity was specific for Dam– mutants or broader, Prc– derivatives were constructed in other bile-sensitive mutants of S. enterica such as PhoP– [36], WecD– [29], DamX– – [20] and SeqA­ [25]. MIC determinations unambiguously showed that a prc mutation suppressed bile sensitivity in all genetic backgrounds under study (Table 1). We interpret broad suppression capacity as an indication that the prc mutation causes some structural or physiological change that increases bile resistance. This view is supported by an additional observation: introduction of a null prc allele in the wild type increased the MIC of DOC from 7 % to 12 % (Table 1).

concentration) in a final volume of 75 µl. The mixtures were incubated for 30 min at 37°C. Twenty five µl of NUPAGE sample buffer 4X (Life Technologies, Alcobendas, Spain) was added and samples were boiled for 10 min. Insoluble materials were removed by centrifugation at an Eppendorf centrifuge (14,500 rpm, 10 min, 20°C). Proteins in the sample (50 µl) were separated by SDSPAGE in a NUPAGE 10 % BIS-TRIS acrylamide gel run in MOPS 1X buffer at a constant voltage of 75 V. The gel was washed in distilled water and fluorescence was detected directly on the gels using a Thyphon 9410 variablemode imager (General Electric, Madrid, Spain) with an excitation wavelength of 588 nm and a 520BP40 emission filter.

Results Increased bile resistance in Salmonella enterica Prc– mutants. A genetic screen with the T-POP3 transposon [30] was used to search for supressors of bile sensitivity in a S. enterica Dam– mutant. Cloning and sequencing of T-POP3 boundaries provided eight independent candidates in which T-POP3 had inserted at the S. enterica prc gene [2]. In E. coli, prc encodes a periplasmic protease also known as tailspecific protease [13,35]. Additional confirmation that loss of Prc function suppressed bile sensitivity in a Dam– mutant was obtained by disrupting the prc gene with the lambda Red recombination procedure, and introducing the mutant allele into the Dam− background. MIC analysis confirmed that bile sensitivity was suppressed by the prc mutation (data not shown). Further work was carried out with the prc deletion allele constructed by site-directed mutagenesis (strain SV6278).

Other phenotypes of Salmonella enterica Prc– mutants. Growth curves of the S. enterica wild type strain and a Prc­– derivative (SV6278) were monitored under various osmolarity and temperature conditions. The Prc­– mutant showed a growth defect at low osmolarity, irrespective of the incubation temperature (Fig. 1). Similar observations were made when a Prc­– mutant was streaked for single colonies on a salt-free LB plate (data not shown). Unlike their E. coli counterparts [13], S. enterica Prc­– mutants appeared to be sensitive to low osmolarity in a temperature-independent fashion. Growth in low osmolarity medium results in the formation of cell filaments, a morphological alteration previously described in E. coli [13]. Filament formation was observed in a fraction of cells only, and typically produced filaments of 3–6 cells (Fig. 1). Like sensitivity to low osmolarity,

Table 1. MICs of sodium deoxycholate Strain

Genotype

MIC of DOC (%)*

SL1344

Wild type

7

SV6100

∆dam

0.2

SV6278

∆prc

SV6946

∆prc ∆dam::Km

6

SV6934

∆phoP::MudJ

0.5

SV6940

∆prc ∆phoP::MudJ

6

SV6947

∆damX::Km

0.5

SV6953

∆prc ∆damX::Km

6

SV6954

∆wecD::MudJ

2

SV6960

∆prc ∆wecD::MudJ

6

SV6961

∆seqA::Tn10

0.5

SV6967

∆prc ∆seqA::Tn10

7

12 r

r r

Median of >5 independent experiments.

*

89


Int. Microbiol. Vol. 16, 2013

hernández et al.

Int Microbiol

90

filament formation turned out to be temperature-independent in S. enterica. To investigate whether inactivation of the prc gene altered the susceptibility of S. enterica to antibiotics, the MICs of selected drugs were determined for the wild type and for SV6278 (Prc–). The Prc– mutant showed increased sensitivity to nalidixic acid and chloramphenicol, as previously described in E. coli [34]. Increased sensitivity to malachite green and polymixin B (not tested in the E. coli study) was also detected. However, unlike E. coli, the levels of resistance to ampicillin and kanamycin remained unaltered in the S. enterica Prc– mutant (data not shown). Analysis of penicillin-binding proteins in Prc– strains. Cell envelopes were prepared from the wild type and from a Prc– mutant (SV6278). Bacteria were grown in LB and salt-free LB. The activity of PBPs was analyzed by detecting their capacity to bind bocillin FL [8]. A representative experiment is shown in Fig. 2. Under low osmolarity, differences were found between the wild type and the Prc– mutant: (i) Bocillin binding bands corresponding to PBP3, PBP4, and PBP7 were detected in

Fig. 1. Top: Growth of the wild type strain and its Prc– derivative SV6278 in LB and salt-free LB. Bottom: Microscopic photographs of wild type (SL1344, left) and Prc– (SV6278, right) S. enterica cells grown in salt-free LB.

stationary cultures of Prc– mutant but not in the wild type when grown in low osmolarity media; (ii) subtle differences in the PBP5/PB6 levels were also observed, and PBP5 was found to increase in stationary cultures of the Prc– strain under low osmolarity conditions; and (iii) PBP7 activity increased in the Prc– mutant in both exponential and stationary cultures.

Discussion Mutations that increase the wild type level of bile resistance in Salmonella enterica have been described previously [14,24], and this study adds prc to the list. In E. coli, the prc gene encodes a periplasmic protease (also known as Tsp protease, for tail-specific protease) [35]. Prc/Tsp is involved in C-terminal processing of PBP 3 [13], in the degradation of abnormal proteins [17,18], and perhaps in fatty acid transport [1]. It seems likely that Prc may play similar roles in S. enterica, as the predicted gene product shows a 94 % identity in amino acid sequence with its E. coli counterpart. Furthermore, the phenotypes of the S. enterica Prc– mutants described in


Bile resistance in S. enterica

Int. Microbiol. Vol. 16, 2013

this study resemble those previously described in E. coli [13], with minor variations (Fig. 1). The capacity of prc mutations to act as enhancers of bile resistance in the wild type and as general suppressors of bile sensitivity in a variety of mutant backgrounds (Table 1) suggests that bile resistance may result from a response triggered by Prc absence. One possibility is that enhanced bile resistance may be the consequence of the changes in activity of several PBPs such as PBP3, PBP4 and PBP7 that were detected in Prc– mutants (Fig. 2). PBPs are membrane enzymes involved in polymerization and restructuring of peptidoglycan in the final steps of peptidoglycan biosynthesis [32]. PBP3 is an essential transpeptidase that catalyzes crosslink of the peptidoglycan strands during formation of the cell division septum [21]. PBP3 processing by Prc is not required for cell viability [12]. In turn, PBP7 and PBP4 are DDendopeptidases that break the peptide cross-bridges between glycan chains in high-molecular-mass murein sacculi [31]. This study does not prove that the bile resistance phenotype of Prc– mutants is a consequence of peptidoglycan remodeling. However, the increase in PBP7 and PBP4 activities observed in Prc– mutants fits well in the view that these PBPs may produce a peptidoglycan structure necessary for cell survival under certain adverse conditions such as starving or exposure to oxidative damaging agents [19]. In fact, one of the antibacterial actions of bile salts is DNA oxidative damage [27].

Int Microbiol

Fig. 2. Binding of bocillin FL to cell envelopes of stationary (st) and exponential (exp) cultures from wild-type S. enterica (wt) and from the Prc– mutant SV6278 (∆prc) grown in LB and saltfree LB (LB – NaCl).

91

Prc– mutants are unlikely to be found in nature: during Salmonella infection, the potential advantage of acquiring a prc mutation would be compensated by its negative consequences, which include sensitivity to low osmolarity and impaired cell division. In fact, S. enterica Prc– mutants show reduced survival within macrophages [2]. A parallel case is found in S. enterica AsmA– mutants, which are hyperesistant to bile but show impaired capacity to invade epithelial cells [24]. However, hyperesistant mutants should not be merely viewed as laboratory curiosities as their physiological defects can unveil mechanisms that operate in the wild type. In the case of Prc– mutants, their defects raise the possibility that alterations in the machinery for peptidoglycan synthesis may contribute to bile resistance. In support of this hypothesis, other components of the cell envelope are known to play roles in bile resistance [3,10]. A reason to overlook the cell wall in previous studies may have been the essential nature of most functions involved in cell wall biogenesis, which makes classical genetic analysis difficult. Acknowledgements. This study was supported by the Spanish Government and the European Regional Fund (grants BIO2010-15023, BIO2010-18885, and BFU2009-09200) and by the Consejería de Innovación, Ciencia y Empresa, Junta de Andalucía (grant CVI-5879). G.R. is supported by a fellowship from the Programa de Formación de Personal Universitario (FPU) of the Spanish Ministry of Education and Culture. Competing interests. None declared.


92

Int. Microbiol. Vol. 16, 2013

References 1. Azizan A, Black PN (1994) Use of transposon Tn phoA to identify genes for cell envelope proteins of Escherichia coli required for long-chain fatty acid transport: the periplasmic protein Tsp potentiates long-chain fatty acid transport. J Bacteriol 176:6653-6662 2. Bäumler AJ, Kusters JG, Stojiljkovic I, Heffron F (1994) Salmonella typhimurium loci involved in survival within macrophages. Infect Immun 62:1623-1630 3. Begley M, Gahan CG, Hill C (2005) The interaction between bacteria and bile. FEMS Microbiol Rev 29:625-651 4. Chan RK, Botstein D, Watanabe T, Ogata Y (1972) Specialized transduction of tetracycline resistance by phage P22 in Salmonella typhimurium. II. Properties of a high-frequency-transducing lysate. Virology 50:883-898 5. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97:6640-6645 6. Garzón A, Cano DA, Casadesús J (1995) Role of Erf recombinase in P22-mediated plasmid transduction. Genetics 140:427-434 7. González-Escobedo G, Marshall JM, Gunn JS (2011) Chronic and acute infection of the gall bladder by Salmonella Typhi: understanding the carrier state. Nat Rev Microbiol 9:9-14 8. González-Leiza SM, de Pedro MA, Ayala JA (2011) AmpH, a bifunctional dd-endopeptidase and dd-carboxypeptidase of Escherichia coli. J Bacteriol 193:6887-6894 9. Grassl GA, Finlay BB (2008) Pathogenesis of enteric Salmonella infections. Curr Opin Gastroenterol 24:22-26 10. Gunn JS (2000) Mechanisms of bacterial resistance and response to bile. Microbes Infect 2:907-913 11. Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166:557-580 12. Hara H, Nishimura Y, Kato J, Suzuki H, Nagasawa H, Suzuki A, Hirota Y (1989) Genetic analyses of processing involving C-terminal cleavage in penicillin-binding protein 3 of Escherichia coli. J Bacteriol 171:5882-5889 13. Hara H, Yamamoto Y, Higashitani A, Suzuki H, Nishimura Y (1991) Cloning, mapping, and characterization of the Escherichia coli prc gene, which is involved in C-terminal processing of penicillin-binding protein 3. J Bacteriol 173:4799-4813 14. Hernández SB, Cota I, Ducret A, Aussel L, Casadesús J (2012) Adaptation and preadaptation of Salmonella enterica to bile. PLoS Genet 8:e1002459 15. Hofmann AF (2001) Bile secretion in mice and men. Hepatology 34:848-850 16. Hofmann AF, Hagey LR (2008) Bile acids: chemistry, pathochemistry, biology, pathobiology, and therapeutics. Cell Mol Life Sci 65:2461-2483 17. Karzai AW, Roche ED, Sauer RT (2000) The SsrA-SmpB system for protein tagging, directed degradation and ribosome rescue. Nat Struct Biol 7:449-455 18. Keiler KC, Waller PR, Sauer RT (1996) Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. Science 271:990-993

hernández et al.

19. Kenyon WJ, Nicholson KL, Rezuchova B, Homerova D, García-del Portillo F, Finlay BB, Pallen MJ, Kormanec J, Spector, MP (2007) Sigma(s)-Dependent carbon-starvation induction of pbpG (PBP 7) is required for the starvation-stress response in Salmonella enterica serovar Typhimurium. Microbiology 153:2148-2158 20. López-Garrido J, Cheng N, Garcia-Quintanilla F, García-del Portillo F, Casadesús J (2010) Identification of the Salmonella enterica damX gene product, an inner membrane protein involved in bile resistance. J Bacteriol 192:893-895 21. Nguyen-Disteche M, Fraipont C, Buddelmeijer N, Nanninga, N (1998) The structure and function of Escherichia coli penicillin-binding protein 3. Cell Mol Life Sci 54:309-316 22. Nishino K, Latifi T, Groisman EA (2006) Virulence and drug resistance roles of multidrug efflux systems of Salmonella enterica serovar Typhimurium. Mol Microbiol 59:126-141 23. Pisabarro AG, Prats R, Váquez D, Rodríguez-Tébar A (1986) Activity of penicillin-binding protein 3 from Escherichia coli. J Bacteriol 168:199-206 24. Prieto AI, Hernández SB, Cota I, Pucciarelli MG, Orlov Y, RamosMorales F, García-del Portillo F, Casadesús J (2009) Roles of the outer membrane protein AsmA of Salmonella enterica in the control of marRAB expression and invasion of epithelial cells. J Bacteriol 191:3615-3622 25. Prieto AI, Jakomin M, Segura I, Pucciarelli MG, Ramos-Morales F, García-del Portillo F, Casadesús J (2007) The GATC-binding protein SeqA is required for bile resistance and virulence in Salmonella enterica serovar Typhimurium. J Bacteriol 189:8496-8502 26. Prieto AI, Ramos-Morales F, Casadesús J (2004) Bile-induced DNA damage in Salmonella enterica. Genetics 168:1787-1794 27. Prieto AI,. Ramos-Morales F, Casadesús J (2006) Repair of DNA damage induced by bile salts in Salmonella enterica. Genetics 174:575-584 28. Pucciarelli MG, Prieto AI, Casadesús J, García-del Portillo F (2002) Envelope instability in DNA adenine methylase mutants of Salmonella enterica. Microbiology 148:1171-1182 29. Ramos-Morales F, Prieto AI, Beuzón CR, Holden DW, Casadesús J (2003) Role for Salmonella enterica enterobacterial common antigen in bile resistance and virulence. J Bacteriol 185:5328-5332 30. Rappleye CA, Roth JR (1997) A Tn10 derivative (T-POP) for isolation of insertions with conditional (tetracycline-dependent) phenotypes. J Bacteriol 179:5827-5834 31. Romeis T, Höltje JV (1994) Penicillin-binding protein 7/8 of Escherichia coli is a DD-endopeptidase. Eur J Biochem 224:597-604 32. Scheffers DJ, Pinho MG (2005) Bacterial cell wall synthesis: new insights from localization studies. Microbiol Mol Biol Rev 69:585-607 33. Schmieger H (1972) Phage P22 mutants with increased or decreased transduction abilities. Mol Gen Genet 119:75-88 34. Seoane A, Sabbaj A, McMurry LM, Levy SB (1992) Multiple antibiotic susceptibility associated with inactivation of the prc gene. J Bacteriol 174:7844-7847 35. Silber KR, Keiler KC, Sauer RT (1992) Tsp: a tail-specific protease that selectively degrades proteins with nonpolar C termini. Proc Natl Acad Sci USA 89:295-299 36. van Velkinburgh JC, Gunn JS (1999) PhoP-PhoQ-regulated loci are required for enhanced bile resistance in Salmonella spp. Infect Immun 67:1614-1622


RESEARCH ARTICLE International Microbiology (2013) 16:93-101 doi: 10.2436/20.1501.01.184 ISSN 1139-6709 www.im.microbios.org

Cloning and expression of a codon-optimized gene encoding the influenza A virus nucleocapsid protein in Lactobacillus casei Namfon Suebwongsa,1 Marutpong Panya,2 Wises Namwat,1 Saovaluk Sookprasert,1 Begoña Redruello,3 Baltasar Mayo,3 Miguel A. Álvarez,3 Viraphong Lulitanond1* Department of Microbiology and Research and Diagnostic Center for Emerging Infectious Diseases (RCEID), Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand. 2College of Medicine and Public Health, Ubon Ratchathani University, Ubon Ratchathani, Thailand. 3Dairy Institute of Asturias (IPLA-CSIC), Villaviciosa, Spain 1

Received 6 June 2013 · Accepted 15 July 2013 Summary. Lactic acid bacteria (LAB) species are envisioned as promising vehicles for the mucosal delivery of therapeutic and prophylactic molecules, including the development of oral vaccines. In this study, we report on the expression of a synthetic nucleocapsid (NP) gene of influenza A virus in Lactobacillus casei. The NP gene was re-designed based on the tRNA pool and the codon usage preference of L. casei BL23. The codon-optimized NP gene was then cloned and expressed in L. casei RCEID02 under the control of a constitutive promoter, that of the lactate dehydrogenase (ldh) gene. The synthetic NP gene was further expressed in L. casei EM116 under the control of an inducible promoter, that of the structural gene of nisin (nisA) from Lactococcus lactis. Based on Western blot analysis, the specific protein band of NP, with a molecular mass of 56.0 kDa, was clearly detected in both expression systems. Thus, our study demonstrates the success of expressing a codon-optimized influenza A viral gene in L. casei. The suitability of the recombinant LAB strains for immunization purposes is currently under evaluation. [Int Microbiol 2013; 16(2):93-101] Keywords: Lactobacillus casei · lactic acid bacteria · influenza A virus · viral nucleocapsid proteins · heterologous expression · codon usage

Introduction There are numerous immunological benefits associated with vaccine administration by the mucosal route [20]. Moreover, because of economic, logistic, and safety reasons, the use of Corresponding author: V. Lulitanond Department of Microbiology and Research and Diagnostic Center for Emerging Infectious Diseases Faculty of Medicine, Khon Kaen University Khon Kaen 40002, Thailand Tel. +66-43202858. Fax +66-43202858 E-mail: viraphng@kku.ac.th

*

oral vaccines for large-scale immunization programs is an explicit objective of the World Health Organization (WHO) [30]. Among the different strategies for mucosal inmunization, lactic acid bacteria (LAB) as live delivery vehicles of vaccine antigens have important advantages [31]. LAB, especially Lactobacillus and Lactococcus species, have been successfully engineered to express antigenic proteins that could serve as live oral vaccines against various infectious diseases [3]. Several genes derived from bacterial [15], viral [14,19, 22], parasitic [9], eukaryotic origin [32], and allergic proteins [24] have been cloned and expressed in these bacteria. However, the low level of production of the heterologous proteins is


94

Int. Microbiol. Vol. 16, 2013

one of the major drawbacks and might be a crucial limitation using LAB as an alternative vaccine system. Several strategies have been examined to improve the yield of the expressed proteins, including the use of strong promoters (of both constitutive and inducible classes), high-copy-number plasmid vectors, and efficient Shine–Dalgarno sequences [12]. Codon usage biases in LAB, including that in Lactobacillus casei, were shown to be an important factor affecting the translational efficiency of heterologous proteins [8]. The capability of heterologous protein expression is known to depend on the ability of bacterial tRNA to recognize the codon(s) of newly introduced genes [23]. Some codons not frequently present in L. casei genes (rare codons), such as AGG and AGA, both of which code for arginine (Arg), occur frequently in human genes [27]. This finding suggests the need to modify the coding sequence of the introduced gene according to the sequences frequently used by the bacterial host. For instance, the expression yield of a heterologous protein in Escherichia coli was increased up to 70 % compared to that of wild-type DNA sequence by using a codon-optimized gene [16]. Several complete genomes of LAB have now been sequenced, of which 59 are from the genus Lactobacillus [http:// www.ncbi.nlm.nih.gov/genome/browse/]. Genome sequence sizes range from the 1.26 megabase pairs (Mbp) of Lactobacillus florum to the 3.43 Mbp of Lactobacillus plantarum. Comparative analysis and gene annotation of LAB genomes has allowed the prediction of tRNA in Lactobacillus species [17], which may help in codon optimization and therefore the success of heterologous protein expression in these bacteria. The influenza virus is a major health problem throughout the world. Although presently available influenza vaccines stimulate the synthesis of neutralizing antibodies against the viral hemagglutinin (HA) and neuraminidase (NA) [2] proteins, they only confer subtype-specific protection immunity. This is a major drawback, as the influenza virus undergoes continuous antigenic changes, which in turn requires continuous influenza surveillance and an annual vaccination program to update protection against the circulating subtype [4]. Consequently, there is an important need to develop a universal influenza vaccine containing conserved viral component(s) eliciting broad-spectrum immunity against all viral subtypes. One of the most conserved influenza components among the different subtypes is the nucleocapsid (NP) protein. Studies on vaccines obtained by expressing the influenza NP gene have shown that cross-protective immune responses are possible [7]. Therefore, influenza vaccines based on the conserved NP protein offer an alternative to confer protection against many, if not all, subtypes of influenza viruses.

Suebwongsa et al.

In this study, we constructed two recombinant L. casei strains expressing a synthetic NP gene of the influenza A virus. The NP coding sequence was optimized based on the tRNA pool and the codon used by L. casei BL23. The codonoptimized NP gene was cloned and expressed in L. casei under the control of both constitutive and inducible promoters. The product of the synthetic gene in both cases was revealed by using commercial antibodies and Western blot, proving the success of our approach.

Materials and methods Bacterial strains, culture media, and growth conditions. Table 1 lists the bacterial strains, cloning vectors, and primers used in this study. Escherichia coli strains were grown in Luria-Bertani (LB) broth (Difco, Franklin Lakes, NJ, USA) at 37 °C with shaking. Lactobacillus casei strains were cultured statically in de Man Rogosa and Sharpe (MRS) medium (Difco) at 37 °C. When needed, 15 g of biological grade agar (Difco)/l was added to the corresponding medium. Ampicillin (100 µg/ml) and erythromycin (2.5 µg/ml) (Sigma-Aldrich, St. Louis, MO, USA) were added as needed to the media for the selection of transformants in E. coli and L. casei, respectively. White/blue colony screening was performed for E. coli XL1-blue on LB plates supplemented with the appropriate antibiotic, 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (20 mg/ml; X-Gal, Sigma-Aldrich), and isopropyl β-d-thiogalactopyranoside (0.5 M; IPTG, Sigma-Aldrich). Isolation of plasmid DNA. Plasmid DNA from L. casei was isolated and purified as previously described [25]. Plasmid DNA from E. coli was isolated and purified using the HiYield plasmid mini kit according to the manufacturer’s instructions (RBC Bioscience, Taiwan). PCR amplification. The Taq DNA polymerase-based amplification was performed in 50 µl of PCR mixture, containing 50 mM KCl, 75 mM Tris-HCl (pH 9.0), 20 mM (NH4)2SO4, 1.5 mM MgCl2, 200 µM of each dNTP (dATP, dCTP, dGTP, and dTTP), 0.2 µM of each primer, and 1 U of Taq DNA polymerase. All reagents were molecular grade and were purchased from Invitrogen, Carlsbad, CA, USA. The 576-bp of nisA, the multiple cloning site (MCS), and the transcription terminator (TT) were PCR-amplified under the following conditions: pre-denaturation (94 °C), denaturation (94 °C), annealing (60 °C), extension (72 °C) and final extension (72 °C) for 3 min, 30 s, 30 s, 40 s, and 7 min respectively. The 1842-bp fusion gene consisting of the nucleocapsid gene and the transcription terminator (NP:TT) was amplified under the following conditions: pre-denaturation (94 °C), denaturation (94 °C), annealing (60 °C), extension (68 °C) and final extension (68 °C) for 5 min, 30 s, 30 s, 1.30 min,c and 7 min, respectively. DNA handling and transformation. The PCR products derived from PCR amplification, or DNA fragments embedded in agarose gels, were purified by using the HiYield Gel PCR DNA Fragments Extraction Kit (RBC). Electroporation of E. coli and L. casei were carried out as described by [6] and [5], respectively. All other DNA manipulations were essentially performed as described [28]. Verification of the constructs. The correct nucleotide sequence and orientation of the cloned genes were confirmed by DNA sequencing with a MegaBACE 1000 sequencer (Biodesign, Bangkok, Thailand) using specific primers (Table1).


Expression of an influenza A gene in L. casei

Int. Microbiol. Vol. 16, 2013

95

Table 1. Bacterial strains, plasmids, and oligonucleotide primers used in this study Materials

Relevant characteristics

Source or reference

Bacterial strains Escherichia coli XL-1blue

Electroporation host

Stratagene

Lactobacillus casei RCEID02

Plasmid-free strain

[26]

L. casei EM116

L. casei ATCC 393 derivative containing a chromosomal nisRK gene

[18]

Plasmids

Cloning vector

pGEM-T Easy vector

Apr, vector harboring synthetic NP gene

Promega

pIDTSMART-AMP-NP gene

Apr and Emr, E. coli/L. casei cloning vector

IDT

pRCEID-LC13.9 shuttle vector

Apr, Plasmid containing LdhL promoter and GFPuv gene

[26]

pGEM:LdhL:GFPuv

Apr, Plasmid containing LdhL promoter and GFPuv gene

[26]

pLC13.9:LdhL:NP:TT

pRCEID-LC13.9 containg NP gene downstream of LdhL promoter

This study

pLC13.9:NisA:NP:TT

pRCEID-LC13.9 containg NP gene downstream of NisA promoter

This study

pNZ8048

Inducible expression vector carrying NisA promoter, Cmr

[13]

Oligonucleotides

Sequence (5′–3′)

M13 (–40) forward

gttttcccagtcacgac

Promega

M13 (–48) reverse

agcggataacaatttcacacagga

Promega

p13.9F

agggaataagggcgacac

This study

p13.9R

ccgcaggttcactagtagg

This study

p13.9-F1

caccgaagcttcagctgaggttc (HindIII)

[26]

pRep13.9-R

gtaaaagcttaaacagctggagacaccc (HindIII)

[26]

NPsynF1

acccacgtatgtgctcattg

This study

synNPseq

aataggtaccaatggcctcacaaggca (KpnI)

This study

pnisAatII

ccgagacgtcagtcttataactatactg (AatII)

This study

pnisNdeI

attacatatgaagctcgcgttatcggtc (NdeI)

This study

Underlined nucleotides show the introduced restriction enzyme site, indicated in parentheses. Apr, Emr, and Cmr indicate the ampicillin, erythromycin, and chloramphenicol resistance gene, respectively.

Codon optimization of the NP gene for expression in Lactobacillus casei. The native NP gene sequence of influenza A virus [A/ NewYork/31/2004(H3N2)] (GenBank accession no. CY000372) was retrieved from the NCBI database [http://www.ncbi.nlm.nih.gov/nuccore/ CY000372]. The codon usage of the NP gene was compared with that of L. casei BL23 using a reference codon usage database [http://gib.genes.nig. ac.jp/single/codon/main.php?spid=Lcas_BL23]. The codon-optimized NP gene was synthesized (Integrated DNA Technologies, San Diego, CA, USA)

with 5′ and 3′ ends having NcoI (CCATGG) and XbaI (TCTAGA) sites, respectively. The synthetic gene was supplied as a clone in pUC19, designated pIDTSMART-AMP-NP. The nucleotide sequence of the codon-optimized NP gene was deposited in NCBI database under accession number KC496021. Determination of NP expression in Lactobacillus casei under the nisA and ldhL promoters. Both the recombinant L. casei EM116 containing pLC13.9:NisA:NP:TT, designated as L. casei EM116:NP, and the


96

Int. Microbiol. Vol. 16, 2013

Suebwongsa et al.

recombinant L. casei RCEID02 containing pLC13.9:LdhL:NP:TT, designated as L. casei RCEID02:NP, were examined for the production of NP protein. For the nisA-based inducible expression system, recombinant EM116:NP was cultured in MRS medium supplemented with 2.5 µg erythromycin/ml at 37 °C. After the OD600 reached 0.3, nisin inducer was added to the culture at a final concentration of 10 ng/ml. NP expression was monitored by sampling the bacterial cultures 1, 3, 5, 7, and 9 h after induction. The bacterial samples were washed twice with phosphate buffer saline (PBS, pH 7.0), and suspended in 300 µl of lysis buffer (0.5 M Na2HPO4, 5 M NaCl, 1 M imidazole [Qiagen, Hilden, Germany]), 100 mg lysozyme (Amresco, Salon, OH, USA)/ ml, 1× protease inhibitor cocktail (Amresco), and 1 M dithiothreitol [Amresco]). The bacterial cells were further broken by sonication with 10 pulses of 30 s each with intermittent cooling. The whole-cell lysate was subjected to SDS-PAGE using 10 % polyacrylamide gels, followed by Western blot. The expressed NP was immunodetected by the sequential addition of mouse monoclonal anti-H1N1 influenza A virus nucleocapsid protein (Abcam, Cambridge, UK) at a dilution of 1/3000, goat anti-mouse IgG conjugated to horseradish peroxidase (HRP) (Abcam) at a dilution of 1/15,000), and chemiluminescence substrate (SuperSignal West Pico Substrate; Thermo Fisher Scientific, Rockford, IL, USA.). The crude cell lysate derived from MDCK cells (kindly provided by Dr. Parvapan Bhattarakosol, Faculty of Medicine, Chulalongkorn University, Thailand) infected with influenza A virus H1N1 and the whole-cell lysates of L. casei strains EM 116 and RCEID02, containing the pRCEID-LC-13.9 empty vector, were used as positive and negative control, respectively. For the ldhL-based constitutive expression system, recombinant RCEID02:NP was cultured in MRS media supplemented with 2.5 μg erythromycin/ml at 37 °C for 18 h. After incubation, the cells were harvested and the processes for sample preparation and detection of the expressed NP were followed as described above.

Results Codon optimization of the influenza A virus NP gene for expression in Lactobacillus casei. We previously cloned and expressed a native NP gene of influenza A virus in L. casei under the control of expression cassettes cloned into the pRCEID-LC13.9 cloning vector (Panya et al., unpublished). The expression cassette included promoter and transcription termination sequences of the L. casei lactate dehydrogenase gene. Despite attempts to optimize heterologous protein expression in this species, Western blot analysis failed to show expression of the native NP gene. A literature survey suggested that heterologous gene expression could be enhanced by replacing native codons of the introduced gene with those naturally used by the host for its own highly expressed genes. Thus, in this study, the native codons of the NP gene were replaced with those preferentially used by L. casei BL23, as shown in Table 2. The complete NP gene of influenza A virus is 1497 bp long, with 499 codons that are translated into 498 amino acids. Bioinformatics analysis of the viral NP codons showed that 44 codons are rare codons in L. casei: 22 AGA, 14 AGG,

Table 2. Native- and codon-optimized nucleocapsid protein gene Codon Amino acid Arg (R)

Native* AGA (22); AGG (14); CGA (4); CGC (3);

Codon Optimized

Amino acid

CGT

Ser (S)

AGC (8); AGT (8); TCA (3); TCC (6); TCG (2); TCT (12)

TCA

CGG (5); CGT (1)

Native*

Optimized

Gly (G)

GGA (18); GGC (7); GGG (11); GGT (6)

GGC

Val (V)

GTA (4); GTC (5); GTG (9); GTT (4)

GTT

Leu (L)

CTA (4); CTC (11); CTG (6); CTT (6); TTA (2); TTG (4)

TTG

Ala (A)

GCA (18); GCC (7); GCG (4); GCT (10)

GCC

Pro (P)

CCA (5); CCC (2); CCG (1); CCU (9)

CCA

Ile (I)

ATA (8); ATC (13); ATT (6)

ATC

Cys (C)

TGC (5); TGT (1)

TGC

Gln (Q)

CAA (15); CAG (6)

CAA

Thr (T)

ACA (8); ACC (7); ACG (3); ACT (10); ACT (10)

ACC

Asn (N)

AAC (7); AAT (20)

AAC

Lys (K)

AAA (14); AAG (7)

AAA

Asp (D)

GAC (11); GAT (11)

GAT

Phe (F)

TTC (11); TTT (7)

TTC

His (H)

CAC (3); CAT (3)

CAT

Tyr (Y)

TAC (9); TAT (6)

TAT

Glu (E)

GAA (23); GAG (13)

GAA

Met (M)

ATG (25)

ATG

Trp (W)

TGG (6)

TGG

*In parentheses, the number of each codon found in the native NP sequence. Rare codons found in the native NP gene are shown in bold.


Fig. 1. Schematic diagram of the construction of the recombinant plasmid pLC13.9:NisA:NP:TT. Positions amp, ery, ori, and repA1 indicate ampicillin resistance gene, erythromycin resistance gene, origin of replication, and replicon A1, respectively.

and 8 ATA codons (Table 2). For codon optimization of the NP gene, the AGA and AGG, which code for arginine (R), were replaced with CGT; ATA, which codes for isoleucine (I), was replaced with ATC. In addition, some of the remaining native NP codons were replaced with the corresponding codons predicted to be highly used by L. casei BL23. For example, all codons that code for arginine, i.e. CGA, CGC, CGG, including two rare codons (AGA and AGG), were replaced with the optimized codon CGT. With this approach, a total of 321 codons were changed, as shown in Table 2. Some restriction endonuclease sites in the native NP gene, including four

Int. Microbiol. Vol. 16, 2013

97

Int Microbiol

Expression of an influenza A gene in L. casei

PstI, three HindIII, two BamHI and a single EcoRV site, were removed by this replacement. To facilitate cloning of the optimized NP gene into the expression vector, the gene was synthesized with the addition of the NcoI (CCATGG), overlapping the initial ATG codon, and XbaI (TCTAGA) recognition sequences at the 5â&#x20AC;˛- and 3â&#x20AC;˛-end, respectively. This optimized NP gene, with a total length of 1505 base pairs, was cloned into pUC19 digested with both NcoI and XbaI, and the resulting construct was designated pIDTSMART-AMP-NP. The synthesis was externally constructed (Integrated DNA Technologies, San Diego, CA, USA).


Int. Microbiol. Vol. 16, 2013

Suebwongsa et al.

Int Microbiol

98

Construction of recombinant expression plasmids containing the codon-optimized NP gene. In this study, two NP-expression systems were constructed, one based on the nisin gene (nisA)-inducible promoter and the other on the constitutive promoter of the lactate dehydrogenase gene (ldhL). For the NisA-based expression system (Fig. 1), the PCR product containing the nisA gene promoter, the multiple cloning site (MCS), and the transcription terminator signals (TT) from pNZ8048 were amplified with the primer pair pnisAatII and pnisNdeI (Table 1) and the obtained amplicons were cloned

Fig. 2. Schematic diagram of the construction of the recombinant plasmid pLC13.9:LdhL: NP:TT. Positions amp, ery, ori, and repA1 indicate ampicillin resistance gene, erythromycin resistance gene, origin of replication and replicon A1, respectively.

into the pGEM-T-Easy vector to generate pNisA. The codonoptimized NP gene was released from pIDTSMART-AMP-NP by NcoI and XbaI digestion and the fragment was isolated and purified from an agarose gel. The DNA segment was cloned into pNisA digested with the same restriction enzymes; the resulting construct was named pNisA:NP:TT. A DNA fragment from this construct digested with AatII and NdeI was isolated from a gel and subcloned into the E. coli/L. casei shuttle vector pRCEID-LC13.9 (Table 1) digested with the same enzymes. The new construct was designated pLC13.9:NisA:NP:TT.


Expression of an influenza A gene in L. casei

99

Int Microbiol

Int. Microbiol. Vol. 16, 2013

Fig. 3. (A) Immunodetection of the expressed NP in crude cell lysates of Lactobacillus casei EM116, as revealed with mouse anti-NP monoclonal antibodies at different times of nisin induction. Lane 1, crude cell lysate from influenza A virus (H1N1)-infected cells. Lanes 2, 3, 4, 5, and 6, nisin-induced EM116:NP cell lysates at 1, 3, 5, 7, and 9 h after nisin induction, respectively. Lane 7, L. casei EM116 harboring the pRCEID-LC13.9 shuttle cloning vector. The arrow points to the NP band, with a molecular mass of 56 kDa. (B) Immunodetection of the expressed NP in crude cell lysates of RCEID02:NP and XL1:NP using mouse anti-NP monoclonal antibodies. Lane 1, Escherichia coli cells containing the pRCEID-LC13.9 shuttle cloning vector. Lane 2, crude cell lysate from influenza A virus (H1N1)-infected cells. Lane 3, XL1:NP. Lane 4, RCEID02:NP. Lane 5, L. casei RCEID02 containing pRCEID-LC13.9. The arrow points to the NP band, with a molecular mass of 56 kDa.

For the construction of the ldhL-based expression system (Fig. 2), the NP:TT fragment was amplified from pNisA:NP:TT using the primer pair NPsynF1 and pnisNdeI (Table1) and then inserted into KpnI/NdeI-digested pGEM:LdhL:GFPuv (Table 1) to generate pLdhL:NP:TT. The LdhL:NP:TT fragment was isolated and purified from pLdhL:NP:TT after digestion with AatII and NdeI and cloned into the pRCEIDLC13.9 vector. The final construct, designated pLC13.9: LdhL:NP:TT, and pLC13.9:NisA:NP:TT were verified by DNA sequencing and analysis. Purified plasmids from these verified constructs were transformed into L. casei EM116 and RCEID02, respectively, to generate the recombinant lactobacilli strains L. casei EM116:NP and L. casei RCEID:NP, carrying the former and the latter construct, respectively. As the negative control, the empty plasmid vector, pRCEIDLC13.9, was also transformed into both EM116 and RCEID02. Expression of NP protein in Lactobacillus casei under different expression systems. Western blotting using a specific antibody against NP showed that both L. casei EM116:NP and RCEID:NP expressed NP (Fig. 3A,B). The expression of NP in the nisin inducible system was confirmed by the detection of a protein with the expected size of 56 kDa 3 and 5 h after nisin induction (10 ng nisin/ml). Expression declined slightly at 7 h and was completely absent at 9 h (Fig. 3A). Figure 3B shows NP expression by L. casei strain RCEID02:NP. Taken together, our results indicated that

codon-optimization is a successful strategy for the expression of the NP gene in L. casei, both under the nisA and the ldhL promoters. Using the same constructs, we further analyzed the expression of codon-optimized NP gene in E. coli XL1. As shown in Fig. 3B, recombinant E. coli cells containing pLC13.9:LdhL:NP:TT (XL1:NP) synthesized the 56-kDa NP protein under the ldhL promoter, whereas expression was not observed in E. coli under the control of the nisA-inducible expression system (data not shown).

Discussion Currently, heterologous gene expression is being actively investigated in LAB as live vehicles for the mucosal delivery of therapeutic and prophylactic proteins. However, the lowlevel expression of heterologous genes in these bacteria is an important drawback that limits their application for such purposes. Codon usage bias in LAB has been shown to reduce translational efficiency and, thus, the total amount of protein synthesized [8]. The expression level of genes containing codons matching those of the bacterial hosts is higher than that of genes containing native codons [16]. In L. casei, three codons (AGG and AGA, coding for arginine, and ATA, coding for isoleucine) present in the wild-type NP gene are rare codons


100

Int. Microbiol. Vol. 16, 2013

[27]. Bioinformatic analysis showed that the influenza A virus NP gene contains 22 AGA, 14 AGG, and 8 ATA codons. All these rare codons were replaced by the codons used by L. casei BL23. To obtain more effective translation, additional codon replacement was achieved with codons that are frequently used by L. casei BL23 (Table 2). Codon optimization thus resulted in the removal of four PstI, three HindIII, two BamHI, and a single EcoRV site from the optimized NP gene. The loss of these restriction sites allowed for greater flexibility in the choice of restriction sites used for cloning the NP gene in the cloning vector. In a previous study, we were unable to obtained the expression of the native NP coding sequence as protein in L. casei, although expression was not quantitatively determined (data not shown). As reported previously by other authors, the translation of heterologous genes containing a high percentage of rare codons is generally stalled or prematurely terminated, which results in a low level of expression [1]. Since the stability (both segregational and structural) of a plasmid in a bacterial host is a necessary requirement in the generation of live vaccines. in this study we used the pRCEID-LC13.9 E. coli/L. casei shuttle vector, which is highly stable in lactobacilli, as the backbone plasmid [26]. Codonoptimized NP was cloned under the control of the lactate dehydrogenase (ldhL) gene promoter and under the nisA promoter in L. casei RCEID02 and EM116, respectively. Further stability was assured by the presence of a rho-independent terminator at the 3′N-terminal of the NP gene. Note that the growth rate of transformants containing recombinant plasmids was similar to that of wild-type lactobacilli. Furthermore, the constructs were highly stable, without appreciable gene rearrangements (structural stability) or plasmid loss during bacterial growth (segregational stability), even after 80 generations (data not shown). The ldhL promoter is a constitutive gene expression system that does not require an inducer, and it has been successfully used for both homologous and heterologous gene expression in many lactobacilli species [10,11,29]. The nisAbased expression system, by contrast, is a regulated gene expression system that is often used to prevent the toxicity of the expressed proteins [21]. Thus, the expression of a given gene can be modulated by the use of a convenient expression system. Western blot assays showed that the specific protein band of NP, with a molecular mass of 56.0 kDa, was clearly detected when expressed in either system. However, higher levels of expression were obtained with the nisA expression system in L. casei EM116. Our study therefore clearly demonstrates

Suebwongsa et al.

the cloning and expression of an influenza A gene in L. casei. Similar results were previously reported for the expression in L. casei of the VP60 protein of Norwalk virus [19]. In conclusion, in this study we describe the use of codonoptimization in the NP gene of influenza A virus, which allowed its successful cloning and expression in L. casei strains, using the E. coli/L. casei shuttle vector pRCEID-LC13.9. Expression of the NP gene in L. casei would facilitate the use of this bacterium in the immunization against influenza A virus. Acknowledgement. This study was supported by the Higher Education Research Promotion and the National Research University Project of Thailand, Office of the Higher Education Commission, and by The National Center for Genetic Engineering and Biotechnology, Thailand. Competing interests. None declared.

References 1. Baca AM, Hol WG (2000) Overcoming codon bias: a method for highlevel overexpression of Plasmodium and other AT-rich parasite genes in Escherichia coli. Int J Parasitol 30:113-118 2. Belshe RB, Edwards KM, Vesikari T, Black SV, Walker RE, Hultquist M, Kemble G, Connor EM, for the CAIV-T Comparative Efficacy Study Group (2007) Live attenuated versus inactivated influenza vaccine in infants and young children. N Engl J Med 356:685-696 3. Bermúdez-Humarán LG, Kharrat P, Chatel JM, Langella P (2011) Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Microb Cell Fact 10 (Suppl 1):S4 4. Bridges CB, Thompson WW, Meltzer MI, Reeve GR, Talamonti WJ, Cox NJ, Lilac HA, Hall H, Klimov A, Fukuda K (2000) Effectiveness and cost-benefit of influenza vaccination of healthy working adults: A randomized controlled trial. JAMA 284:1655-1663 5. Chassy BM, Flickinger JL (1987) Transformation of Lactobacillus casei by electroporation. FEMS Microbiol Lett 44:173-177 6. Dower WJ, Miller JF, Ragsdale CW (1988) High efficiency of transformation of Escherichia coli by high voltage electroporation. Nucleic Acids Res 16:6127-6145 7. Epstein SL, Kong WP, Misplon JA, Lo CY, Tumpey TM, Xu L, Nabel GJ (2005) Protection against multiple influenza A subtypes by vaccination with highly conserved nucleoprotein. Vaccine 23:5404-5410 8. Fuglsang A (2003) Lactic acid bacteria as prime candidates for codon optimization. Biochem Biophys Res Commun 312:285-291 9. Geriletu, Xu R, Jia H, Terkawi MA, Xuan X, Zhang H (2011) Immunogenicity of orally administrated recombinant Lactobacillus casei Zhang expressing Cryptosporidium parvum surface adhesion protein P23 in mice. Curr Microbiol 62:1573-1580 10. Gory L, Montel MC, Zagorec M (2001) Use of green fluorescent protein to monitor Lactobacillus sakei in fermented meat products. FEMS Microbiol Lett 194:127-133 11. Ho PS, Kwang J, Lee YK (2005) Intragastric administration of Lactobacillus casei expressing transmissible gastroentritis coronavirus spike glycoprotein induced specific antibody production. Vaccine 23:1335-1342 12. Jana S, Deb JK (2005) Strategies for efficient production of heterologous proteins in Escherichia coli. Appl Microbiol Biotechnol 67:289-298


Expression of an influenza A gene in L. casei

13. Kuipers OP, Beerthuyzen MM, de Ruyter PG, Luesink EJ, de Vos WM (1995) Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem 270:27299-27304 14. Lagenaur LA, Sanders-Beer BE, Brichacek B, Pal R, Liu X, Liu Y, Yu R, Venzon D, Lee PP, Hamer DH (2011) Prevention of vaginal SHIV transmission in macaques by a live recombinant Lactobacillus. Mucosal Immunol 4:648-657 15. Maassen CB, Laman JD, den Bak-Glashouwer MJ, Tielen FJ, van Holten-Neelen JC, Hoogteijling L, Antonissen C, Leer RJ, Pouwels PH, Boersma WJ, Shaw DM (1999) Instruments for oral disease-intervention strategies: recombinant Lactobacillus casei expressing tetanus toxin fragment C for vaccination or myelin proteins for oral tolerance induction in multiple sclerosis. Vaccine 17:2117-2128 16. Maertens B, Spriestersbach A, von Groll U, Roth U, Kubicek J, Gerrits M, Graf M, Liss M, Daubert D, Wagner R, Schäfer F (2010) Gene optimization mechanisms: a multi-gene study reveals a high success rate of full-length human proteins expressed in Escherichia coli. Protein Sci 19:1312-1326 17. Makarova K, Slesarev A, Wolf Y, et al. (2006) Comparative genomics of the lactic acid bacteria. Proc Natl Acad Sci USA 103:15611-15616 18. Martín MC, Alonso JC, Suárez JE, Álvarez MA (2000) Generation of food-grade recombinant lactic acid bacterium strains by site-specific recombination. Appl Environ Microbiol 66:2599-2604 19. Martín MC, Fernández M, Martin-Alonso JM, Parra F, Boga JA, Álvarez MA (2004) Nisin-controlled expression of Norwalk virus VP60 protein in Lactobacillus casei. FEMS Microbiol Lett 237:385-391 20. Medina E, Guzmán CA (2001) Use of live bacterial vaccine vectors for antigen delivery: potential and limitations. Vaccine 19:1573-1580 21. Mierau I, Kleerebezem M (2005) 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl Microbiol Biotechnol 68:705-717 22. Min L, Li-Li Z, Jun-Wei G, Xin-Yuan Q, Yi-Jing L, Di-Qiu L (2012) Immunogenicity of Lactobacillus-expressing VP2 and VP3 of the infectious pancreatic necrosis virus (IPNV) in rainbow trout. Fish Shellfish Immunol 32:196-203

Int. Microbiol. Vol. 16, 2013

101

23. Nakamura Y,Gojobori T,Ikemura T (2000) Codon usage tabulated from international DNA sequence databases: status for the year 2000. Nucleic Acids Res 28:292 24. Ohkouchi K, Kawamoto S, Tatsugawa K, Yoshikawa N, Takaoka Y, Miyauchi S, Aki T, Yamashita M, Murooka Y, Ono K (2012) Prophylactic effect of Lactobacillus oral vaccine expressing a Japanese cedar pollen allergen. J Biosci Bioeng 113:536-541 25. O’Sullivan DJ, Klaenhammer TR (1993) Rapid mini-prep isolation of high-quality plasmid DNA from Lactococcus and Lactobacillus spp. Appl Environ Microbiol 59:2730-2733 26. Panya M, Lulitanond V, Tangphatsornruang S, Namwat W, Wannasutta R, Suebwongsa N, Mayo B (2012) Sequencing and analysis of three plasmids from Lactobacillus casei TISTR1341 and development of plasmid-derived Escherichia coli-L. casei shuttle vectors. Appl Microbiol Biotechnol 93:261-272 27. Pouwels PH and Leunissen JA (1994) Divergence in codon usage of Lactobacillus species. Nucleic Acids Res 22:929-936 28. Sambrook J, Russell DW (2001) Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA 29. Stephenson DP, Moore RJ, Allison GE (2011) Transformation of, and heterologous protein expression in, Lactobacillus agilis and Lactobacillus vaginalis isolates from the chicken gastrointestinal tract. Appl Environ Microbiol 77:220-228 30. Wells JM (2011) Mucosal vaccination and therapy with genetically modified lactic acid bacteria. Annu Rev Food Sci Technol 2:423-445 31. Wells JM, Mercenier A (2008) Mucosal delivery of therapeutic and prophylactic molecules using lactic acid bacteria. Nature Rev Microbiol 6:349-362 32. Yao XY, Wang HM, Li DJ, Yuan MM, Wang XL, Yu M, Wang MY, Zhu Y, Meng Y (2004) Inoculation of Lactobacillus expressing hCG beta in the vagina induces an anti-hCG beta antibody response in murine vaginal mucosa. J Reprod Immunol 63:111-122


RESEARCH ARTICLE International Microbiology (2013) 16:103-111 doi: 10.2436/20.1501.01.xx ISSN 1139-6709 www.im.microbios.org

Identification and modeling of a novel chloramphenicol resistance protein detected by functional metagenomics in a wetland of Lerma, Mexico Marcos López-Pérez,1 † Salvador Mirete,2 † Eduardo Jardón-Valadez,3 José E. González-Pastor2* 1 Environmental Sciences Department, Metropolitan Autononous University (Lerma Unit), Lerma de Villada, Mexico. Department of Molecular Evolution, Center of Astrobiology (CSIC-INTA), Torrejón de Ardoz, Spain. 3Earth Resources Department, Metropolitan Autononous University (Lerma Unit), Lerma de Villada, Mexico

2

Received 14 June 2013 · Accepted 10 July 2013 Summary. The exploration of novel antibiotic resistance determinants in a particular environment may be limited because of the presence of uncultured microorganisms. In this work, a culture-independent approach based on functional metagenomics was applied to search for chloramphenicol resistance genes in agro-industrial wastewater in Lerma de Villada, Mexico. To this end, a metagenomic library was generated in Escherichia coli DH10B containing DNA isolated from environmental samples of the residual arsenic-enriched (10 mg/ml) effluent. One resistant clone was detected in this library and further analyzed. An open reading frame similar to a multidrug resistance protein from Aeromonas salmonicida and responsible for chloramphenicol resistance was identified, sequenced, and found to encode a member of the major facilitator superfamily (MFS). Our results also showed that the expression of this gene restored streptomycin sensitivity in E. coli DH10B cells. To gain further insight into the phenotype of this MFS family member, we developed a model of the membrane protein multiporter that, in addition, may serve as a template for developing new antibiotics. [Int Microbiol 2013; 16(2):103-111] Keywords: Escherichia coli · chloramphenicol · functional metagenomics · major facilitator superfamily · homology models · membrane proteins · arsenic

Introduction The emergence of strains resistant to antibiotics and thus to significant public health problems in many countries is mainly related to the improper management, use, and distribution of these drugs [22,40]. In Mexico, antibiotic resistance is of particular concern because of the lack of national policies regulating the use of antibiotics [3]. An understanding of the Corresponding author: J.E. González-Pastor Department of Molecular Evolution Centro de Astrobiología (CSIC-INTA), Carr. de Ajalvir, km 4 28850 Torrejón de Ardoz, Madrid, Spain Tel. +34-915206434. Fax +34-915201074 E-mail: gonzalezpje@cab.inta-csic.es *

†Equal contributors.

mechanisms by which uncultured and cultured microorganisms develop antibiotic resistance in particular environments is of utmost importance [4] to improve current therapeutic strategies and design alternative agents. Metagenomics is a useful approach to characterize emerging pathogens [20]. It also sheds light on the persistence and dissemination of the genetic mechanisms underlying antibiotic resistance [19]. Metagenomics techniques are best suited for DNA analysis in situ, since DNA can be extracted directly from the environment and subsequently cloned into commercial vectors. One of the most significant advantages of using functional metagenomics to study antibiotic resistance is that specific phenotypes can be isolated and thousands of clones can be analyzed in a single screening [25]. At the same time, the analysis allows the study of genes involved in resistance whose function


Int. Microbiol. Vol. 16, 2013

may not be obvious, by the extrapolation routine included in the annotation process [19]. Furthermore, the use of new methods to isolate DNA from different substrates has enabled the analysis of larger fractions of microorganisms, both culturable and non-culturable [33]. Chloramphenicol is widely used in the treatment of acute diarrhea [21], even though it is now less frequently prescribed in developed countries. Although simple storage conditions and accessibility make this antibiotic attractive, its overuse has promoted the appearance of resistant strains [11]. In studies of chloramphenicol resistance, novel chloramphenicol resistance genes have been retrieved from diverse environmental samples by using functional metagenomics approaches. These genes, which encode proteins similar to the efflux pumps of the major facilitator superfamily (MFS) have been isolated from Alaskan soil samples [19]. MFS proteins are classified into 17 families, and are ubiquitous among all forms of life [28]. Another class of newly identified genes includes those encoding drug resistance transporters of the Bcr/CflA family, isolated from agricultural soil samples [41]. In this work, functional screening of a metagenomic library prepared

lópez-pérez et al.

from an arsenic-enriched water sample obtained from a wetland near to Lerma de Villada, Mexico, led to the retrieval of a gene conferring chloramphenicol resistance. Sequence analysis of the resistant clone revealed the presence of a complete open reading frame (ORF) highly similar to an MFS protein from an environmental clone of Aeromonas salmonicida. The resistance of this clone to other antibiotics was assessed. Finally, a model of the retrieved MFS protein was developed, which yielded new insights into the molecular mechanisms leading to the resistance phenotype.

Materials and methods Sample collection and metal determination. The water sample used in this study was recovered from an irrigation canal in Lerma de Villada, State of Mexico, Mexico, in January 2013. This canal crosses crop fields and leads to one of the wetlands that constitute the ecosystem of the swamps of Lerma (19° 17′ 28″ N 99° 30′ 08″ W; altitude 2577). Lerma de Villada is a municipality located east of Toluca and 54 km west of Mexico City (Fig. 1). To obtain a representative profile of the microbial diversity from this area, water samples of 50 ml were obtained from 20 different points of the canal. These samples were homogenized and stored at –20 °C until needed.

Int Microbiol

104

Fig. 1. Ciénegas (swamps) of the Lerma River, located about 2 km from the municipality of Lerma de Villada, State of Mexico, Mexico. This ecosystem stretches along a line of 8 km in the south direction, mixing cultivation areas with protected areas. Wetlands are usually shallow, but there are some areas that have deeper water. Emergent aquatic vegetation is abundant, mainly common bulrush (Typha latifolia) and giant bulrush (Schoenoplectus californicus).


Novel chloramphenicol resistance protein

The concentrations of metal ions present in the sample were determined by using total reflection X-ray fluorescence (TXRF), an X-ray spectrometry method that derives from the classic technique of X-ray fluorescence for the dispersal of energy (EDXRF) [18]. Bacterial strains, media, and culture conditions. Escherichia coli DH10B was routinely grown in Luria-Bertani (LB) medium at 37 °C. The growth medium for transformed E. coli strains was supplemented with 50 mg ampicillin (Ap)/ml in order to maintain the pBluescript SKII(+) plasmid (pSKII+). Library construction and amplification. A metagenomic library was generated using DNA isolated from the above-described water sample recovered in Lerma de Villada. Biomass was collected by filtration of the sample through a 0.22-mm-pore-size membrane filter (Nalgene, Rochester, NY, USA). Metagenomic DNA was isolated from the water sample by using the BIO101 FastDNA spin kit for soil (Qbiogene, Carslbad, CA, USA) according to the manufacturer’s recommendations, with no further treatment. Approximately 12.5 mg of DNA per liter of water sample was obtained. The metagenomic DNA was partially digested using Sau3AI. The resulting fragments, ranging from 1 to 4 kb, were collected directly from a 0.8 % lowmelting-point agarose gel with the QIA quick gel extraction kit (Qiagen, Hilden, Germany) and ligated into the dephosphorylated and BamHI-digested pSKII+ vector, at a molar ratio of 1:1, using T4 DNA ligase (Roche, Mannheim, Germany). The ligation mixtures were incubated overnight at 16 °C and used to transform E. coli DH10B cells (Invitrogen, Carlsbad, CA, USA) by electroporation, using a Micropulser (Bio-Rad, Hemel Hempstead, UK) according to the manufacturer’s instructions. The plasmids of 16 random clones were isolated and digested using XbaI and XhoI (Roche) to determine the average insert size of the library. To increase the number of recombinant clones, the library was amplified as previously described [13]. Briefly, transformed cells were grown on LB agar plates containing Ap and incubated at 37 °C for 24 h. Cells from each plate were mixed with 3.5 ml LB and 10 % (wt/vol) glycerol, pooled in a flask with cells from the same library, mixed again, and stored at –80 °C. Screening for chloramphenicol resistance genes and sequence analysis. To screen for genes conferring chloramphenicol resistance, aliquots of approximately 1.4 × 105 bacteria/ml from the amplified library were plated onto LB-Ap agar plates containing a final concentration of 5 mg chloramphenicol/ml and incubated at 37 ºC for 72 h. Plasmid DNA was isolated from individual resistant clones and used to again transform E. coli DH10B cells to confirm that the plasmid was responsible for the resistance phenotype. Plasmid DNA isolated from a resistant, retransformed clone was sequenced on both strands by primer walking using the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Foster City, CA, USA) and an ABI PRISM 377 sequencer (Perkin-Elmer) according to the manufacturer’s instructions. Sequences were analyzed with the Editseq, Megalign, and Seqman programs from the DNAStar package. Putative ORFs were identified using ORF Finder, available at the NCBI website [http://www.ncbi.nlm.nih.gov/gorf/ gorf.html]. Sequences with significant matches were further analyzed with rpsBlast, and their putative functions were annotated based on similarities to sequences in the COG (Clusters of Orthologous Groups) and Pfam (Protein Families) databases. Antibiotic susceptibility test and minimal inhibitory concentration determination. A disc diffusion test was used to assess the antibiotic susceptibility of clone pLM2, by comparing pLM2-transformed cells with the host strain E. coli DH10B transformed with pBluescriptSKII+. Bacterial cultures grown overnight were adjusted to an OD600 of 0.5 and 200 ml of each culture was plated on 90-mm Petri dishes containing LB agar.

Int. Microbiol. Vol. 16, 2013

105

Filter discs (6 mm diameter) were placed on the LB agar plates and impregnated with 10 ml of the following antibiotics solutions: tetracycline (50 mg), kanamycin (500 mg), streptomycin (2500 mg), gentamicin (100 mg), spectinomycin (500 mg), trimethoprim (500 mg), chloramphenicol (50 mg), and nalidixic acid (100 mg). The plates were incubated at 37ºC for 24 h. Antibiotic susceptibility was assessed by measuring the diameters of inhibition zones around the filter discs. All tests were carried out in triplicate. Minimal inhibitory concentration (MIC), defined as the lowest concentration of chloramphenicol that prevented the growth of pLM2, was determined in LB liquid medium in cultures incubated at 37 °C overnight with agitation at 150 rpm. Bioinformatic screening. Alignments were calculated by the BLAST engine for both nucleotide and amino acid sequences (http://blast.ncbi.nlm. nih.gov). The Pfam database server [http://blast.ncbi.nlm.nih.gov/Blast.cgi] was used to identify the protein family related to the new query; i.e., the major facilitator superfamily (MFS) matched with the amino acid sequence. Protein transmembrane (TM) domains were identified based on hydropathy properties along the amino acid sequence, on the octanol as well as the translocon scales [37]. The protein model was generated using the standalone version of the Modeller 9.11 package [35]. Multiple templates and sequence alignments were performed to generate the atomic coordinates for the N-term and C-term domains. As described below, a protein model was developed by binding these two domains. Protein modeling. Our approach to generate the protein model was based on a structural analysis of MFS proteins [45]. The domains identified by consensus in these proteins were the N-term and the C-term, each consisting of two symmetric TM bundles of three helical repeats, for a total of 12 TM helices. For the C-term domain, the PDB:2CFQ LacY structure, corresponding to a lactose permease without substrate [26], was used as template. Identity determined after alignment of the amino acid sequences was 20 %. Alignment of the N-term domain was improved by using the E. coli multidrug transporter PDB:2GFP [46] as template. By aligning only a fragment of the query sequence, from Leu9 to Leu149, we obtained an identity of 37 %. The fragment included the first three helical repeats of the N-term domain (TM1–TM3). Protein coordinates were generated for the C-term and N-term separately using the corresponding alignments; both structural fragments were fitted on the LacY template, which had been previously aligned along the bilayer normal. To complete the protein structure, we designed the following procedure: (i) the first repeat of the N-term, helices TM1–TM3, was inverted by rotating it 180° along an axis parallel to the bilayer normal; (ii) the first repeat was fitted on the second repeat (helices TM4–TM6) of the N-term domain; (iii) the coordinates for the TM4–TM6 backbone atoms were defined by the fitted fragment; the symmetry of N-term model was accordingly satisfied [45]; and (iv) the backbone atoms of the C-term domain (including helices TM7–TM12) showed no distortions from the helical fold and were not further adjusted. By means of the PSFGEN plugin of the VMD 1.9 package [15], the coordinates for the missing atoms were generated using the internal coordinates defined in the topology file of the CHARMM22 parameter set [23]. Molecular dynamics. The protein model was relaxed from the initial configuration to correct any geometry distortion attributable to the initial model setting. The NAMD 2.8 [30] program was used to minimize the potential energy for the protein, in vacuum, based on the all-atom CHARMM22 force field parameter set [23]. The first stage consisted of 8000 steps of energy minimization using the conjugate-gradient; in a second stage, 10,000 time steps of molecular dynamics simulation in the NVT ensemble were carried out according to the following protocol: All backbone atoms were fixed in the relaxation process to preserve protein folding. For the side-chain atoms, bonding and non-bonding interactions were calculated to evaluate the


106

Int. Microbiol. Vol. 16, 2013

lópez-pérez et al.

intermolecular forces [23]. Motion equations were solved using a time step of 1 fs, and electrostatic interactions were calculated using the smooth particle mesh Ewald [9]. All bonds involving hydrogen atoms were constrained using the SHAKE [34] and SATTLE algorithms [27]. Temperature was controlled by means of Langevin dynamics [30]. Analysis scripts and graphics were prepared with the VMD 1.9 package [17].

Int Microbiol

Nucleotide sequence accession number. The nucleotide sequence obtained for the plasmid insert of the pLM2 sequence has been deposited in the GenBank database under the accession number KF169941.

Results Identification of a chloramphenicol resistant clone. Microbial DNA from a water sample enriched in arsenic (10 mg/l) was isolated and used to construct a metagenomic library in E. coli. A total of 200,000 recombinant clones, with an average insert size of 2.5 kb, were obtained and screened for recombinant clones allowing E. coli to grow in the presence of chloramphenicol. One resistant clone (pLM2) was thus identified and further analyzed. Sequence analysis revealed that pLM2 harbored a 1859-bp insert with a G+C content of 60.89 %, one complete (orf2), and two incomplete heterologous ORFs (orf1 and orf3), as shown in Fig. 2. These ORFs had high similarity to sequenced genes from the Aeromonas genus (Table 1) and displayed the same arrangement observed in A. salmonicida. Among the three ORFs, orf2 encoded an amino acid sequence almost identical (99 % amino acid identity) to a putative multidrug resistance protein of the Bcr/CflA subfamily from the fish pathogen A. salmonicida [31]. This ORF also shared homology with EmrD-3 (57 % amino acid identity), a multidrug efflux pump of the Bcr/CflA subfamily identified in Vibrio cholerae O395, which is resistant to several antimicrobials tested including chloramphenicol [36]. The other two ORFs, orf1 and orf3, encoded amino acid sequences similar to an oxidoreductase (98 % amino acid identity) and a HAM1 protein (96 % amino acid identity), respectively. The slightly

Fig. 2. Schematic organization of the ORFs identified in pLM2. The arrows indicate the locations of the ORFs in the plasmid and the direction of transcription. The ORF similar to the gene encoding a multidrug resistance protein involved in chloramphenicol resistance is indicated in gray. Asterisks indicate incomplete ORFs.

lower similarities between these ORFs and the sequenced genes of several Aeromonas species suggested the environmental origin of this clone. MIC determination and susceptibility test for pLM2. The strain carrying pLM2 was selected at 5 mg chloramphenicol/ml. As determined from its MIC, this strain was unable to survive in LB medium containing up to 25 mg chloramphenicol/ml. To better characterize the resistance profile of pLM2 in the presence of other antimicrobials, considering its similarity to a multidrug resistance protein, the respective strain was subjected to an antibiotic resistance susceptibility test using a wide range of antimicrobials representing different antibiotic classes, including tetracycline, aminoglycosides (kanamycin, gentamicin and streptomycin), phenicols (chloramphenicol), dihydrofolate reductase inhibitors (trimethoprim) and quinolones (nalidixic acid). Inhibition haloes of the pLM2-bearing strain were compared with those of the host strain E. coli DH10B transformed with pBluescriptSKII+ (DH10B-pSK) (Fig. 3A). As expected, the resistance of the pLM2 strain to chloramphenicol was higher, as shown by an

Table 1. Sequence similarities of the ORFs identified in pLM2 Amino acid ORF

Length (aa)

Nucleotide

Closest similar protein

Organism

E value

Identity (%)

E value

Identity (%)

4E-21

98

4E-60

99

orf1

45

Oxidoreductase

Aeromonas salmonicida

orf2

387

Multidrug resistance protein

A. salmonicida

0.0

99

0.0

98

orf3

115

HAM1 protein

A. salmonicida

2E-72

96

1E-169

98


Int. Microbiol. Vol. 16, 2013

Int Microbiol

Novel chloramphenicol resistance protein

inhibition halo smaller than that of the host strain (16 ± 1 and 32 ±1 mm, respectively), as shown in Fig. 3B. By contrast, a much larger inhibition halo was obtained with pLM2 than with DH10B-pSK in the presence of either streptomycin (31 ± 1.7 and 0 mm, respectively) or gentamicin (8.67 ± 0.58 and 0 mm, respectively). Thus, the pLM2 clone was more sensitive to these two antibiotics than to chloramphenicol. With the remaining antibiotics, the resistance profiles were similar, with the pLM2 strain showing slightly higher resistances to tetracycline, trimethoprim, and nalidixic acid. Chloramphenicol resistance protein model. To gain further insight into the phenotype conferred by pLM2, we developed a model for the chloramphenicol resistance protein encoded by orf2. According to a hydropathy analysis, TM helical domains were predicted for the following fragments: TM1 Pro2-

107

Fig. 3. (A) Disc diffusion test for evaluating the antibiotic susceptibility of pLM2 and Escherichia coli DH10B cells with pBluescriptpSKII+ (DH10B-pSK). (B) Size of the inhibition zone formed around diffusion discs impregnated with different antibiotics. Tet, tetracycline; Km, kanamycin; Sm, streptomycin; Gm, gentamicin; Spc, spectinomycin; Tp, trimethoprim; Cm, chloramphenicol; Nal, nalidixic acid. Values are the averages of three independent tests. Error bars indicate standard deviation.

Leu22, TM2 Gly41-Ala61, TM3 Val74-Ala96, TM4 Tyr130Ala151, TM5 Phe159-Met177, TM6 Phe206-Ala227, TM7 Tyr244-Arg266, TM8 Arg270-Val290, TM9 Val303-Ala323, TM10 Ala333-Met355, and TM11 Leu362-Leu384 (Figs. 4, 5). The translocon hydropathy scale takes into account the bilayer partitioning of TM helices recognized by the translocon machinery, hence it is more efficient in identifying helical folding than the portioning of short peptides in n-octanol [37,44]. The hydropathy analysis identified up to 11 putative helical domains. The query sequence, however, did not yield any TM sequences already deposited in the database. Thus, this sequence displayed novel hydropathic properties. In relation to the structural data available for members of the MFS superfamily, the hydropathic analysis was consistent with that of the helical bundles of other MFS members, which fold in a bundle comprising12 TM helices. The two halves of the struc-


Int. Microbiol. Vol. 16, 2013

lópez-pérez et al.

Int Microbiol

108

Int Microbiol

Fig. 5. Hydropathy analysis of the novel chloramphenicol resistance protein. Putative TM helical domains are identified along the amino acid sequence. Helical folds detected by the translocon machinery define the translocon scale, and the partitioning of short peptides in n-octanol defines the n-octanol scale.

Fig. 4. Sequences alignment used to generate the chloramphenicol resistance protein model. Numbering corresponds to the novel membrane protein sequence. (A) Alignment for the N-term domain using the Escherichia coli multidrug transporter (upper sequence) as template. (B) Alignment for the C-term domain using the E. coli lactose permease LacY (upper sequence) as template. The overall sequence identity was 25 %. Helical domains along the amino acid sequence are indicated by the bars beneath the protein sequences. Eleven helical domains were predicted (TM1–TM11).

ture correspond to the N-term and C-term domains, with six TM bundles each. The structural features revealed by the chloramphenicol resistance protein model were similar to those of the MFS members (Fig. 6). Table 2 summarizes the main structural motifs of the resolved structures of the MFS members and of those obtained in the MFS model.

Discussion In this study, a functional metagenomics approach was used to search for novel chloramphenicol resistance genes. Because of the large fraction of uncultured microorganisms that may

thrive in a particular environment, culture-independent methods based on metagenomics techniques have proven to be advantageous in the identification and sequencing of antibiotic resistance genes from diverse environments [2,10,29,41], in addition to providing useful tools for identifying genes and proteins in situ [8]. The water sample used to construct the metagenomic library contained higher concentrations of arsenic than of the other heavy metals detected. Arsenic enrichment likely reflected poor manure management by the surrounding farms close to the irrigation canal. Moreover, it might be indicative of the co-occurrence of antibiotic resistance genes in this particular environment. In fact, a correlation between high concentrations of heavy metals, including arsenic, and the abundance of antibiotic resistance determinants had been previously reported [48]. By screening for chloramphenicol resistance genes, we identified one positive clone, denoted as pLM2. Further analysis of pLM2 revealed a complete ORF that encoded an amino acid sequence identical to a multidrug resistance protein of A. salmonicida. This putative protein was subsequently determined to be a member of the MFS. The amino acid and nucleotide sequences of the other two ORFs of pLM2 differed slightly from the sequences of A. salmonicida, in which the same gene arrangement is found. This result suggested that


Int. Microbiol. Vol. 16, 2013

109

Int Microbiol

Novel chloramphenicol resistance protein

Fig. 6. Three-dimensional overlay between the chloramphenicol resistance protein model (yellow ribbons) and the LacY template. The N-term and C-term of LacY are depicted as ribbons using red-pink-white and white-light blue-blue gradients, respectively. (A) Periplasmic view of the membrane according to the protein model and the templates. The N-term consists of helical repeats TM1–TM3 and TM4–TM6, and the C-term TM7–TM9 and TM10–TM12. (B) Side view of the 12 TM segments. (C) Cytoplasmic view of the N-term and C-term domains.

pLM2 was retrieved from an environmental clone of this species, in agreement with the high intra-specific diversity found within other species of Aeromonas [1]. Previous studies described a relationship between members of the MFS and multiple antibiotic resistances [19,24,43]. MFS proteins are involved not only in the assimilation of different nutrients but also in the excretion of potentially toxic

compounds in the cell [32]. Sequence analysis has shown that pLM2 shares homology with members of the Bcr/CflA MFS subfamily, a group of antiporters with known chloramphenicol resistance, such as EmrD-3 in V. cholerae [36]. Note that a great variety of proteins confer resistance to chloramphenicol, such as the Mdr multidrug transporters [6] and the florfenicol exporter, fexA [17]. Thus, nowadays, the clinical use

Table 2. Motifs verified in the proposed MFS model Structural motiff

MFS Protein

Function

Reference

TM1, TM4, TM7, and TM10 form the central core domain

LacY, GlpT, EmrD, FucP, PepTso, PepTst, XylE

Residues essential for substrate coordination and co-transport coupling. TM domains involved in interactions between N and C domains of the transporter

[45]

TM2, TM5, TM8, and TM11 form shield the central core domain

LacY, GlpT, EmrD, FucP, PepTso, PepTst, XylE

Mediate inter-domain interactions. Also involved in substrate binding and co-transport

[47]

Short cytoplasmic loops at the TM2 and TM3, and TM8 and TM9 junctions

LacY, GlpT, EmrD, FucP, PepTso, PepTst, XylE

Restrain to the relative motions of the connected TM domains on the cytoplasmic side

[45]

Single substrate-binding cavity enclosed by the N and C domains located halfway into the membrane

LacY, GlpT, EmrD, FucP, PepTso, PepTst, XylE

Gating of molecules to the periplasmic side

[16,39]

LacY: Lactose proton symporter; GlpT: glycerol 3 phosphate:Pi antiporter; EmrD: multidrug transporter; FucP: l-fucose proton symporter; PepT50: peptide proton symporter; PepTst: peptide proton symporter; XylE: d-xylose proton symporter.


110

Int. Microbiol. Vol. 16, 2013

of many antibiotics may be compromised by a wide range of bacterial drug efflux pumps [12]. In this work we also found that pLM2 restored the streptomycin sensitivity of E. coli DH10B cells, which because of a rpsL mutation display streptomycin resistance. Although the precise mechanism underlying the sensitivity phenotype remains to be elucidated, the overproduction of MFS proteins may facilitate the uptake of antibiotics and thus increase their intracellular concentration to one that is effective [7]. A model for the multiporter membrane protein expressed by A. salmonicida and responsible for chloramphenicol resistance was developed to allow us to gain insights into its mode of action. This closer look into the structure and possible mechanisms of action of MFS proteins provided evidence of their importance with respect to multiple processes that influence the physiology of bacteria in their different environments [28]. The proposed MFS structure, based on the information deposited in databases and previously resolved structures [14,16,39,42,47], sheds light on non-specific transport mechanism and can be used as an initial configuration to generate a set of protein configurations in a lipid bilayer membrane in the presence of explicit solvent molecules, or as template to host antibiotic molecules in the substrate binding site. Structural data as well as molecular dynamics studies suggested that the large scale motions for the inward/outward gating of the A. salmonicida multiporter are triggered by the protonation of Glu135 in the fucose co-transporter [38] and the deprotonation of Glu325 in the galactopyranoside symporter [5]. The absence of acidic residues in key positions of the chloramphenicol resistance multiporter described herein may therefore point to an alternative triggering mechanism of inward/outward symport gating in MFS membrane proteins. Future work building on these findings will include characterization of the mechanism by which MFS proteins expel chloramphenicol. Elucidation of this mechanism could guide the development of new antibiotics that are less likely to generate bacterial resistance. Acknowledgements. We thank Carolina González de Figueras (Center of Astrobiology, CSIC-INTA) for technical assistance and Marina Postigo (Center of Astrobiology, CSIC-INTA) for DNA sequencing. This work was funded by two grants from the Spanish Ministry of Science and Innovation: CONSOLIDER Ingenio 2010 (“The Metagenome of the Iberian Peninsula” CE-CSD2007-0005) and CGL-2009-10756/BOS. We also thank COMECYT (Mexican Council of Science and Technology) for financial support. Competing interests. None declared.

lópez-pérez et al.

References 1. Aguilera MG, Hernández C, Zúñiga G, Figueras MJ, Castro G (2005) Aeromonas hydrophila clinical and environmental ecotypes as revealed by genetic diversity and virulence genes. FEMS Microbiol Lett 242:231-240 2. Allen HK, Moe LA, Rodbumrer J, Gaarder A, Handelsman J (2009) Functional metagenomics reveals diverse β-lactamases in a remote Alaskan soil. ISME J 3:243-251 3. Amábile-Cuevas CF (2010) Antibiotic resistance in Mexico: a brief overview of the current status and its causes. J Infect Dev Ctries 4:126-131 4. Aminov RI, Mackie RI (2007) Evolution and ecology of antibiotic resistance genes. FEMS Microbiol Lett 271:147-161 5. Andersson M, Bondar AN, Freites JA, Tobias DJ, Kaback HR, White SH (2012) Proton-coupled dynamics in lactose permease. Structure 20:1893-1904 6. Bibi E, Adler J, Lewinson O, Edgar R (2001) MdfA, an interesting model protein for studying multidrug transport. J Mol Microbiol Biotechnol 3:171-177 7. Bohn C, Bouloc P (1998) The Escherichia coli cmlA gene encodes the multidrug efflux pump Cmr/MdfA and is responsible for isopropyl-betad-thiogalactopyranoside exclusion and spectinomycin sensitivity. J Bacteriol 180:6072-6075 8. Chistoserdovai L (2010) Functional metagenomics: recent advances and future challenges. Biotechnol Genet Eng Rev 26:335-352 9. Darden T, York D, Pedersen L (1993) Particle mesh Ewald: An N·log(N) method for Ewald sums in large systems. J Chem Phys 98:10089-10092 10. Donato JJ, Moe LA, Converse BJ, et al. (2010) Metagenomic analysis of apple orchard soil reveals antibiotic resistance genes encoding predicted bifunctional proteins. Appl Environ Microbiol 76:4396-4401 11. Fabricant SJ, Hirschhorn N (1987) Deranged distribution, perverse prescription, unprotected use: the irrationality of pharmaceuticals in the developing world. Health Policy Planning 2:204-213 12. Gilbert P, McBain AJ (2003) Potential impact of increased use of biocides in consumer products on prevalence of antibiotic resistance. Clin Microbiol Rev 16:189-208 13. González-Pastor JE, Mirete S (2010) Novel metal resistance genes from microorganisms: a functional metagenomic approach. Methods Mol Biol 668:273-285. 14. Huang Y, Lemieux MJ, Song J, Auer M, Wang DN (2003) Structure and mechanism of the glycerol-3-phosphate transporter from Escherichia coli. Science 301:616-620 15. HumphreyW, Dalke W, Schulten K (1996) VMD: Visual molecular dynamics. J Mol Graphics 14:33-38 16. Kaback HR, Miklós ST, Weinglass AB (2001) The kamikaze approach to membrane transport. Nat Rev Mol Cell Biol 2:610-620 17. Kehrenberg C, Schwarz S (2006) Distribution of florfenicol resistance genes fexA and cfr among chloramphenicol-resistant Staphylococcus isolates. Antimicrob Agents Chemother 50:1156-1163 18. Klockenkemper R (1996) Total reflection X-ray fluorescence analysis. (Chemical analysis: a series of monographs on analytical chemistry and its applications). Wiley- Interscience, New York, NY, USA 19. Lang KS, Anderson JM, Schwarz S, Williamson L, Handelsman J, Singer RS (2010) Novel florfenicol and chloramphenicol resistance gene discovered in Alaskan soil by using functional metagenomics. Appl Environ Microbiol 76:5321-5326 20. Levin BR, Antia R, Berliner E, et al. (1998) Resistance to antimicrobial chemotherapy: a prescription for research and action. Am J Med Sci 315:87-94


Novel chloramphenicol resistance protein

21. Levy SB (1992) The antibiotic paradox: how miracle drugs are destroying the miracle. Plenum Press, New York, USA, 300 pp 22. Levy SB, O’Brien TF (2005) Global antimicrobial resistance alerts and implications. Clin Infect Dis 41:S219-S220 23. Mackerell AD, Bashford JR, Bellott D, et al. (1998) All-atom empirical potential for molecular modeling and dynamics studies of proteins. J Phys Chem B 102:3586-3616 24. McGarvey KM, Queitsch K, Fields S (2012) Wide variation in antibiotic resistance proteins identified by functional metagenomic screening of a soil DNA library. Appl Environ Microbiol 78:1708-1714 25. Mirete S, de Figueras CG, González-Pastor JE (2007) Novel nickel resistance genes from the rhizosphere metagenome of plants adapted to acid mine drainage. Appl Environ Microb 73:6001-6011 26. Mirza O, Guan L, Verner G, Iwata S, Kaback HR (2006) Structural evidence for induced fit and a mechanism for sugar/H+ symport in LacY. EMBO J 25:1177-1183 27. Miyamoto S, Kollman P (1992) An analytical version of the SHAKE and RATTLE algorithm for rigid water models. J Comput Chem 13:952-962 28. Pao SS, Paulsen IT, Saier MH (1998) Major facilitator superfamily. Microbiol Mol Biol Rev 62:1-34 29. Parsley LC, Consuegra EJ, Kakirde KS, Land AM, Harper WF Jr, Liles MR (2010) Identification of diverse antimicrobial resistance determinants carried on bacterial, plasmid, or viral metagenomes from an activated sludge microbial assemblage. Appl Environ Microbiol 76:3753-3757 30. Phillips JC, Braun B, Wang W, Gumbart J, Tajkhorshid E, Villa E, Chipot C, Skeel R, Kalé L, Schulten K (2005) Scalable molecular dynamics with NAMD. J Comput Chem 26:1781-1802 31. Reith ME, Singh RK, Curtis B, et al.(2008) The genome of Aeromonas salmonicida subsp. salmonicida A449: insights into the evolution of a fish pathogen. BMC Genomics 9:427 32. Reddy VS, Shlykov MA, Castillo R, Sun EI, Saier MH (2012) The major facilitator superfamily (MFS) revisited. FEBS J 279:2022-2035 33. Riesenfeld CS, Schloss PD, Handelsman J (2004) Metagenomics: genomic analysis of microbial communities. Annu Rev Genet 38:525552 34. Ryckaert JP, Ciccotti G, Berendsen HJ (1977) Numerical integration of the Cartesian equations of motion of a system with constraints: Molecular dynamics of n-alkanes. J Comput Phys 23:327-341 35. Sali A, Blundell TL (1993) Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol 234:779-815

Int. Microbiol. Vol. 16, 2013

111

36. Smith KP, Kumar S, Varela MF (2009) Identification, cloning, and functional characterization of EmrD-3, a putative multidrug efflux pump of the major facilitator superfamily from Vibrio cholerae O395. Arch Microbiol 191:903-911 37. Snider C, Jayasinghe S, Hristova K, White SH (2009) MPEx: A tool for exploring membrane proteins. Protein Sci 18:2624-2628 38. Sun DS, Huang L, Lu F, Liu Y, Gong H, Wang J, Yan N (2010) Structure of a fucose transporter in an outward-open conformation. Nature 467:734-738 39. Sun L,Yan C, Sun X, Gong X, RaoY, Yan N(2012) Crystal structure of a bacterial homologue of glucose transporters GLUT1-4. Nature 490:361366 40. Tomasz A (1994) Multiple-antibiotic-resistant pathogenic bacteria. N Engl J Med 330:1247-1251 41. Torres-Cortés G, Millán V, Ramírez-Saad HC, Nisa-Martínez R, Toro N, Martínez-Abarca F (2011) Characterization of novel antibiotic resistance genes identified by functional metagenomics on soil samples. Environ Microbiol 13:1101-1114 42. Vardy E, Arkin IT, Gottschalk KE, Kaback HR, Schuldiner S (2004) Structural conservation in the major facilitator superfamily as revealed by comparative modeling. Protein Sci 13:1832-1840 43. Vecchione JJ, Alexander B, Sello JK (2009) Two distinct major facilitator superfamily drug efflux pumps mediate chloramphenicol resistance in Streptomyces coelicolor. Antimicrob Agents Chemother 53:4673-4677 44. White SH, von Heijne G (2008). How translocons select transmembrane helices. Annu Rev Biophys Chem 37:23-42 45. Yan N (2013) Structural advances for the major facilitator superfamily (MFS) transporters. Trends Biochem Sci 38:151-159 46. Yin Y, Jensen MØ, Tajkhorshid E, Schulten K (2006) Sugar binding and protein conformational changes in lactose permease. Biophys J 91:39723985 47. Zhou Y, Jiang X, Kaback HR (2012) Role of the irreplaceable residues in the LacY alternating access mechanism. Proc Nat Acad Sci USA 109:12438-12442 48. Zhu YG, Johnson TA, Su JQ, Qiao M, Guo GX, Stedtfeld RD, Hashsham SA, Tiedje JM (2013).Diverse and abundant antibiotic resistance genes in Chinese swine farms. Proc Nat Acad Sci USA 110:3435-3441


RESEARCH ARTICLE International Microbiology (2013) 16:113-123 doi: 10.2436/20.1501.01.186 ISSN 1139-6709 www.im.microbios.org

Isolation, selection, and characterization of highly ethanol-tolerant strains of Oenococcus oeni from south Catalonia Meritxell Bordas,1 Isabel Araque,1 Joan O. Alegret,1 Mariette El Khoury,2 Patrick Lucas,2 Nicolas Rozès,1 Cristina Reguant,1 Albert Bordons1* Department of Biochemistry and Biotechnology, Faculty of Oenology, University Rovira i Virgili, Tarragona, Spain. 2 University of Bordeaux, Institute of Vines and Wine Sciences (ISVV), Villenave d’Ornon, France

1

Received 30 June 2013 · Accepted 20 July 2013

Summary. Twenty-one strains of Oenococcus oeni were isolated during the malolactic fermentation of wines from south Catalonia. Due to their high ethanol tolerance (14 %, or more), these strains may serve as promising starters. The strains were screened by assays in a wine-like medium and by their co-inoculation in wine, resulting in the selection of well-performing strains, subsequently shown not to produce the main biogenic amines and lacking the genes involved in their synthesis. The genetic diversity of the isolates was studied by multilocus sequence typing (MLST), in which seven housekeeping genes were sequenced. Although the concatenated allelic profile of some strains was the same, the profiles obtained by random amplification of polymorphic DNA together with the variable number of tandem repeats at several loci showed that none of the strains were identical. A phylogenetic tree was constructed based on MLST with the seven genes and clearly showed two phylogroups, in accordance with previous studies. The best-performing strains occurred in members of both subgroups, suggesting that the grouping of housekeeping genes is not directly related to adaptation and ethanol tolerance. [Int Microbiol 2013; 16(2):113-123] Keywords: Oenococcus oeni · malolactic fermentation · wine production · multilocus sequence typing (MLST) · strain selection

Introduction Oenococcus oeni is the major species among lactic acid bacteria (LAB) involved in the malolactic fermentation (MLF) of wine [17,35]. MLF, in which l-malic acid is decarboxylated to l-lactic acid, is a crucial step in winemaking as it provides enhanced organoleptic qualities and microbial stabilization of the wine [1,13,19,21]. However, bacterial development and Corresponding author: A. Bordons Department of Biochemistry and Biotechnology Faculty of Oenology, Campus Sescelades N4 University Rovira i Virgili 43007 Tarragona, Spain Tel. +34-977558043. Fax +34-977558232 E-mail: albert.bordons@urv.cat

*

MLF are not always successful as they are limited under the harsh environmental conditions of wine [32], mainly the presence of ethanol. Ethanol resistance is a unique characteristic of O. oeni; however, at concentrations >12 % (v/v), ethanol can affect growth and malolactic activity [6,37]. Moreover, the other typical harsh conditions of wine (few nutrients, phenolics, low pH) restrict cell growth such that MLF is sluggish or even fails [7]. To survive and adapt to this harsh environment, O. oeni has developed various strategies, including the production of ATP by consuming organic acids (mainly l-malic, but also citric acid), the synthesis of stress proteins [2], and modifications in the composition of its membranes [30]. Currently, climate change poses a major additional problem for MLF. Over the last 10–30 years, observations in various winemaking regions of the world have provided evidence


114

Int. Microbiol. Vol. 16, 2013

bordas et al.

of earlier fruit maturation patterns and, consequently, modified vine development, both of which have been attributed to rising temperatures worldwide [18]. Faster ripening of the grapes leads to a higher sugar content and thus a higher ethanol content of the wines [23,34]. In the prestigious qualified appellation of Priorat, in south Catalonia (north-eastern Spain), wines easily reach an ethanol content of 14 % and sometimes higher [14]. Moreover, the low acidity of these wines together with the above-described stress factors has lowered their l-malic acid content, thus restricting the growth of O. oeni. An understanding of the molecular mechanisms of adaptation of O. oeni is crucial to obtaining starter strains that are

better adapted to the harsh conditions that occur in wine during its production [1]. The intraspecific genomic diversity in O. oeni is well established and is related to the geographical origin of the isolates [22], and thus to the particular conditions of the wines from these regions. The aim of this study was to use wines produced in south Catalonia to isolate and select strains of O. oeni that are able to tolerate high ethanol concentrations, as potential candidates for MLF starter cultures. These strains were also tested for their genetic ability to produce biogenic amines in an attempt to find non-producer strains and thus prevent related health problems in wine consumers. Finally, the selected strains were genetically charac-

Table 1. Strains of Oenococcus oeni used in this study and the wines from which they were isolated. For each wine, the different RAPD-PCR profiles obtained are signalled alphabetically, and the assigned strain names are in parentheses Cellar

Wine appellation

C1

DOQ Priorat

C2

C3

DOQ Priorat

DOQ Priorat

Variety

Wine

Profiles (strains)

Grenache

1P

A (1P1)

B (1P2)

C (1P3)

Cabernet Sauvignon

2P

C

D (2P2)

E (2P10)

Cabernet Sauvignon

3P

F (3P1)

G (3P2)

Cabernet Sauvignon

4P

F

Cabernet Sauvignon

5P

F

Carignan

6P

A

F

Grenache

7P

F

G

Cabernet Sauvignon

8P

H (8P4)

I (8P7)

Grenache

9P

I

Grenache

10P

J (10P2)

K (10P4)

Syrah

11P

H

I

Grenache

12P

I

K

Carignan

13P

L (13P1)

M (13P5)

Cabernet Sauvignon

14P

L

Syrah

15P

L

Merlot

16P

L

C4

DOQ Priorat

Grenache

17P

M

C5

DOQ Priorat

Grenache

18P

N (18P7)

Carignan

19P

N

Grenache

1T

P (1T1)

Grenache

2T

P

Q (2T1)

Grenache

3T

S (3T1)

T (3T7)

Grenache

4T

P

Grenache

5T

U (5T8)

C6

DO Tarragona

G

J

O (19P2)

R (2T2)


Int. Microbiol. Vol. 16, 2013

Highly ethanol-tolerant O. oeni

terized by multilocus sequence typing (MLST) in order to determine their phylogenetic relationships.

Materials and methods Oenococcus oeni strains. Most strains used in this study were isolated from 24 red wines from south Catalonia (Table 1) of the 2008 vintage. The wines, all of which had an ethanol content of around 14 % (v/v), were taken from six different cellars and two different appellations of origin: DOQ Priorat and DO Tarragona. Other strains used were CH11 (Chr. Hansen, Hoersholm, Denmark), CECT 217T (= ATCC 23279T, from the Spanish Type Culture Collection, Valencia, Spain), and the sequenced strain PSU-1 (= ATCC BAA-331). Isolation and growth conditions. Wine samples taken during MLF were inoculated (100 µl) on plates of MRS agar [15] supplemented with dlmalic acid (6 g/l), fructose (5 g/l), l-cysteine (0.5 g/l), nystatin (100 mg/l), and sodium azide (25 mg/l). These plates of MRSmf medium (pH 5.0) were incubated at 27 ºC in a CO2 incubator until the colonies had grown. Ten colonies were collected from each plate. Each one was inoculated into MRSmf broth medium and incubated until the end of the exponential phase (ca. OD600 1.4), usually 7 days. Identification and typification of strains. Cells were incubated with lysozyme (50 mg/ml) for 30 min at 37 ºC, after which their genomic DNA was extracted using a High Pure PCR template kit (Roche, Mannheim, Germany) following the manufacturer’s instructions. Total DNA concentrations were calculated by measuring absorbance at 260 nm using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Bremen, Germany). To identify O. oeni, species-specific PCR [36], which amplifies a fragment of the malolactic enzyme gene of O. oeni, was performed using 2 ng of the DNA. Isolates identified as O. oeni were typed using multiplex random amplification of polymorphic DNA (RAPD)-PCR [26], with two primers, Coc and On2, developed by Cocconcelli et al. [10] and Zapparoli et al. [36], respectively. The amplification products were resolved by electrophoresis in 1.4 % (w/v) agarose gels run at 100 V for 2 h 45 min and stained with ethidium bromide. DNA molecular weight markers II and VI (proportion 1:2) from Roche Diagnostics (Basel, Switzerland) were used for reference purposes.

For a final comparison of the typing profiles of the strains obtained in this study, the RAPD-PCR method with only the Coc primer was used [10], under the same electrophoretic conditions as described above. Strain typing was also verified by the multilocus variable number of tandem repeat (VNTR) method, following the protocol of Claisse and Lonvaud [9]. Screening of strains by MLF assays in wine-like medium and previous optimization of conditions. The wine-like medium contained ethanol (10, 12, or 14 %, v/v) added aseptically to the following sterilized base medium: 2 g fructose/l, 2 g tartaric acid/l, 0.5 g citric acid/l, 0.6 g l-malic acid/l, 5 g yeast extract/l, 0.1 g acetic acid/l, and 5 g glycerol/l, adjusted to pH 3.4 with 1 N NaOH. Growth conditions were optimized by testing different inoculants of different sizes (1, 2.5, 5 and 10 %, v/v) and different ethanol concentrations. The optimal conditions, once identified, were then used in all subsequent experiments. MLF assays were carried out in wine-like medium with every strain and were run in duplicate. Each isolated and typed strain was cultured in tubes containing 5 ml of MRSmf broth medium until an OD600 of approximately 1.4, equivalent to 109 cells per ml, was reached. After centrifugation of 1.25 ml of cultured cells, the pellet was inoculated in 50 ml of wine-like medium and cultured at 20 ºC. For comparison, the type culture strain CECT 217T was included in these assays. The changes of MLF was followed by analyzing l-malic acid formation using a commercial kit (Roche, Darmstadt, Germany). The strains were first selected on the basis of their total consumption (%) of l-malate and their malolactic efficiency or consumption rate, calculated as the amount of l-malate (mg/l) consumed per hour of fermentation, during the period in which malolactic activity was detected. These values, for both 12 and 14 % ethanol, were analyzed statistically by grouping the strains in hierarchical clusters by Euclidean distance mapping, using SPSS version 19.0 (SPSS Inc., Chicago, IL, USA). Strain selection according to performance in a co-inoculation assay in real wines. The selected strains of O. oeni were grown in MRSmf broth medium at pH 5.0 at 27 ºC. Cells of seven strains were collected in the exponential phase (ca. OD600 1.4) and, after centrifugation, coinoculated to a final concentration of 2 × 106 colony-forming units (CFU)/ml per strain in 500-ml flasks containing two different red wines in which alcoholic fermentation was recently completed (Table 2). The wines were from two wine appellations of south Catalonia: DOQ Priorat and DO Terra Alta (near DO Tarragona). They had a high ethanol content (15.5 % in wine W1 and 13.6 % in wine W2) and a low l-malic acid content. These characteristics

Table 2. Main characteristics of the wines (after alcoholic fermentation) used in the co-inoculation study Wine

W1

W2

Wine appellation

DOQ Priorat

DO Terra Alta

Grape variety

Grenache

Cabernet Sauvignon

Ethanol (% v/v)

15.5

13.6

pH

3.4

3.3

0.43

1.20

Acetic acid (g/l)

0.52

0.49

Citric acid (mg/l)

65

226

l-Malic

acid (g/l)

115


116

Int. Microbiol. Vol. 16, 2013

are representative of wines from this area. The incubation temperature was 20 °C. MLF was monitored by analyzing l-malic acid and cell viability in culture samples until l-malic acid had been fully consumed. Acetic acid and citric acid were also analyzed at the end of MLF, using a Boehringer (Mannheim, Germany) enzymatic kit. Thirty colonies from the last sample of each wine were picked, identified, and typed as explained above. Quantification of biogenic amines. Decarboxylase activity was activated according to the method of Bover-Cid and Holzapfel [4], subculturing the bacteria three times in modified MRS broth containing 0.1 g of the precursor amino acids l-histidine HCl, tyrosine di-sodium salt, l-ornithine HCl, and l-lysine HCl/100 ml and supplemented with 0.005 g of pyridoxal5-phosphate/100 ml. The cultures were grown at 28 ºC to the late exponential phase after which duplicate aliquots of 0.1 ml were removed and inoculated into 100 ml of screening decarboxylase medium with and without precursor amino acids (0.2 g/100 ml). These cultures were incubated at 28 ºC, centrifuged, and the pellet was discarded. The biogenic amine content of the supernatants was determined by high-performance liquid chromatography (HPLC) with a Agilent 1100 (Agilent Technologies, Böblingen, Germany), following the method of Gómez-Alonso et al. [16]. Detection of genes that encode for biogenic amines. The presence of genes for biogenic amines was studied in the selected strains by a specific multiplex PCR method [11,12], designed to detect the four genes involved in the production of histamine (histidine decarboxylase, hdc), tyramine (tyrosine decarboxylase, tdc), and putrescine, via either ornithine decarboxylase (odc) or putrescine transcarbamylase (ptc). Gene fragments were PCR-amplified with Taq polymerase (Invitrogen) using 100 ng of bacterial DNA and the following oligonucleotides: HDC3 (5′-GATGGTATTGTTTCKTATGA-3′) and HDC2 (5′- CCCGTGTTTCTTTGTCACCT-3′) for hdc; TD2 (5′-ACATAGTCAACCATRTTGAA-3′) and TD5 (5′-CAAATGAAGAAGA AGTAGG-3′) for tdc; ODC1 (5′-NCAYAARCAACAAGYNGG-3′) and ODC2 (5’-GRTANGGNTNNGCACCTTC-3′) for odc [12]; and the degenerate primers PTC1 (5′-GGWCAAATTCAIYTIGG-3′), and PTC2 (5′-CCRTA CCAWACATGIGTRTA-3′) for ptc. The amplification program, following that of Coton et al. [12], was 95 ºC for 5 min, 35 cycles of 1 min at 95 ºC, 52 ºC for 1 min, 72 ºC for 90 s, with a final extension at 72 ºC for 5 min. Besides the selected strains, control positive strains were included: Lactobacillus brevis IOEB 9809 (from the Institut d’Oenologie, Bordeaux, France) for tdc and ptc, O. oeni IOEB 9204 for hdc, and Lactobacillus saerimneri 30A (ATCC 33222) for hdc and odc. Aliquots of 18 ml of each PCR sample were analyzed on 1 % (w/v) agarose gels (Invitrogen) in 1× TBE buffer, run at 100 V for 45 min, and the resulting bands then visualized by ethidium bromide staining on a GelDoc2000 (BioRad, Ivry sur Seine, France). Multilocus sequence typing (MLST) and bioinformatic analysis. Bacterial genomic DNA was extracted, amplified and sequenced following the method of Bilhère et al. [3] and Bridier et al. [5]. Briefly, PCR was carried out in a 50-ml reaction volume containing a DNAzyme PCR master mix (Finnzymes), 10 ng of template DNA, and 10 pmol of each primer associated with one of the seven target genes. The seven targeted housekeeping genes (gyrB, g6pd, pgm, dnaE, purK, rpoB and recP) were amplified using the primers described by Bilhère et al. [3]. The PCR program was as follows: 95 °C for 3 min, 30 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min. To better amplify some loci, the annealing temperature was lowered to 45 °C and the number of cycles increased to 35. To amplify the transposon sequence in the purK locus, the elongation time was increased to 1 min. PCR fragment amplification was verified by electrophoresis of the PCR products in 1 % agarose gels containing 10 ml of GelRed (Biotium)/100 ml agarose. The PCR products were then sequenced by Eurofins Medigenomix GmbH.

bordas et al.

For each locus, the sequences obtained for the different strains were compared and assigned with allele numbers. The sequences obtained for the seven genes of the MLST were analyzed, edited and compared using Bionumerics 5.1. The phylogenetic tree derived from these sequences and from publicly available data [3,5] was constructed by the neighbor-joining method with a Kimura two-parameter distance model, using MEGA 4 [33]. Most of the nucleotide sequences of the MLST loci were the same as reported by Bilhère et al. [3] and Bridier et al. [5]. The new sequence types found for strain 8P7 were deposited in GenBank under accession numbers KC923244 (purK) and KC923245 (recP).

Results Diversity of Oenococcus oeni strain profiles in wines. For all wine samples (Table 1), the LAB populations accounted for 104–107 CFU/ml. From these plates, 190 colonies were taken from the DOQ Priorat wines and 50 colonies from the DO Tarragona wines. Almost all of the isolated colonies (99.6 %) were identified as O. oeni by species-specific PCR [36], with 21 strain profiles (A to U), differentiated using multiplex RAPD-PCR [26], some of them found in different cellars. From the electrophoresis gels, six different profiles of strains that grew in wines from DO Tarragona (shown in Table 1 as strain profiles P–U) and 15 different profiles of strains that grew in wines from DOQ Priorat (shown in Table 1 as strain profiles A–O) were constructed. Optimization of strain screening conditions in wine-like medium. Among these 21 strains, four (1P2, 10P4, 3T1 and 5T8) were randomly chosen, grown in MRSmf broth medium (reaching 109 cells/ml), and inoculated at 1, 2.5, 5, and 10 % (v/v) into wine-like medium containing 10, 12, or 14 % (v/v) ethanol. With 10 % inoculation and 10 % ethanol, MLF was completed in less than 24 h for all strains. The results obtained for one of the strains (5T8) inoculated in different proportions in 12 and 14 % ethanol are shown in Fig. 1. The results for the other strains were similar. A bacterial inoculant of 5 % carried out MLF quickly, while, at the other extreme, an inoculant of 1 % resulted in no MLF after 20 days of incubation. MLF carried out with an inoculant of 2.5 % was, as expected, faster when less ethanol was present. Accordingly, 2.5 % was considered to be the most appropriate inoculant size for screening strains in medium or wine containing 12 % or 14 % ethanol. Screening of strains in wine-like medium. All 21 isolated strains (profiles in Table 1) and the type culture strain CECT 217T were tested in wine-like medium under the optimized conditions described above. In the presence of 12 %


Int. Microbiol. Vol. 16, 2013

117

Int Microbiol

Highly ethanol-tolerant O. oeni

Fig. 1. Consumption of l-malic acid in wine-like medium containing ethanol (12 % and 14 %, v/v), by strain 5T8 inoculated in proportions of 1, 2.5, and 5 %.

containing 12 % or 14 % ethanol and included strain CECT 217T. As expected, in the presence of 12 % ethanol, the malolactic efficiencies were generally higher, around 6 mg/l per h, and were two to three times higher than those obtained with 14 % ethanol. These data on l-malic acid consumption were analyzed statistically by grouping the strains in clusters (Fig. 3) and us-

Int Microbiol

ethanol, most of the l-malic acid was consumed by almost all of the strains (Fig. 2) whereas in the presence of 14 % ethanol, only one strain, 3P2, consumed almost all of the malic acid. Other strains identified as good malic acid consumers were 8P7, 10P4, 18P7, 19P2, and 1T1. Strains that consumed less malic acid were more or less the same in wine-like medium

Fig. 2. Consumption of l-malic acid (initial 0.6 g/l) by the different strains of Oenococcus oeni when growing in wine-like-medium containing 12 % ethanol (white columns) or 14 % (grey columns), at pH 3.4 and 20 ÂşC. Data are the mean ÂąSD values for duplicate assays.


Int. Microbiol. Vol. 16, 2013

bordas et al.

Int Microbiol

118

ing the data from both 12 % and 14 % ethanol. When the strains were grouped in four clusters depending on their consumption of l-malic acid (Fig. 3, top) and their consumption rate (Fig. 3, bottom), the correlation was good. The strains in cluster 1 were 3P2, 8P7, 10P4, 18P7, 19P2 and 1T1, whereas strain CECT 217T, among others, belonged to cluster 4. Co-inoculation assay in real wines. In this assay, the selected strains in cluster 1 (3P2, 8P7, 10P4, 18P7, 19P2, and 1T1) were used and co-inoculated. In addition, commercial strain CH11 was added to allow its comparison with these strains and because it is the strain usually used by the cellar of wine W1 to promote MLF. Since W1 and W2 were different, malolactic performance differed as well, but for both wines malic consumption was complete around day 37 (Fig. 4). The population of bacteria in W2 remained stable at 107 CFU/ml, but in W1 at the end of MLF the population had decreased from 2.1×107 CFU/ml to 5 ×104 CFU/ml. Citrate consumption was highest (82 %) by cultures in W2 and at the end of MLF was 38 mg/l (Table 2). Citrate levels in

Fig. 3. Consumption of l-malic acid (A), and malolactic efficiency or consumption rate (B), by typed strains of Oenococcus oeni, grouped in statistical clusters, when grown in wine-like medium containing 12 or 14 % ethanol.

wine W1 did not change significantly throughout the assay. In W2, acetate was not produced during MLF, while in W1 production was 0.1 g acetate/l. All 30 colonies isolated from each wine at the end of MLF were identified as O. oeni. The main RAPD-PCR typing profiles of colonies from W1, in which population viability was low (5 ×104 CFU/ml), were the same as the profile of strain CH11 strain (results not shown), identifying this strain as predominant in W1. For W2, in which population viability was high (1.6 × 107 CFU/ml), three different profiles were obtained, corresponding to strains 3P2 (70 % of total isolates), CH11 (15 %), and 1T1 (15 %). Absence of biogenic amines and the genes encoding their synthesis in selected strains. None of the strains identified as the best performers in the MLF assays (3P2, 8P7, 19P2, 1T1) produced biogenic amines. Electrophoresis of the PCR products of the genes hdc, tdc, odc, and ptc showed bands corresponding to genes involved in amine production in the positive control strains (see Materials and meth-


Int. Microbiol. Vol. 16, 2013

Highly ethanol-tolerant O. oeni

Int Microbiol

Fig. 4. Comsumption of l-malic acid (A), and bacterial population (B) in wines W1 and W2 (see Table 2) coinoculated with seven strains of Oenococcus oeni (3P2, 8P7, 10P4, 18P7, 19P2, 1T1 and CH11). Data are the mean ÂąSD values for triplicate assays.

119

ods): 2300 base pairs (bp) for hdc, 1133 bp for tdc, 900 bp for odc, and 500 bp for ptc. However, none of these bands were detected for the strains tested in this study (results not shown). Genetic diversity of selected Oenococcus oeni strains. The four strains selected in the microvinifications (3P2, 8P7, 19P2, 1T1) and the two strains that did not perform

well in that experiment (2T2 and CECT 217T) were analyzed by MLST to evaluate their phylogenetic relationships. The seven genes targeted by MLST were successfully amplified and sequenced for all strains. The combination of alleles obtained at each locus defined four distinct allelic profiles or sequence types (STs) (Table 3). The STs of strains CECT 217T and 8P7 (designated ST 200 and ST 201, respectively) were

Table 3. Alleles of seven housekeeping genes in Oenococcus oeni strains determined by multilocus sequence typing (MLST) Strain

gyrB

g6pd

pgm

dnaE

purK

rpoB

recP

Sequence types*

PSU-1

1

1

1

1

1

1

1

1

1T1

8

11

5

9

8

3

1

82

2T2

8

11

5

9

8

3

1

82

3P2

8

11

5

9

8

3

1

82

8P7

4

1

5

2

30

1

38

201

new ST

19P2

5

1

4

2

2

1

1

11

same ST as in [3]

CECT 217T

4

1

5

2

2

1

1

200

new ST (with known allele but in a new order)

same ST as in [3] same ST as in [5]

*Sequence types (STs) were deduced from the allelic profiles obtained for each strain and were attributed according to the findings of Bilhère et al. [3] and Bridier et al. [5].


120

Int. Microbiol. Vol. 16, 2013

bordas et al.

unique, as they had not been detected in previous studies. By contrast, the ST of strain 19P2 (ST 11) was the same as that of a strain reported in [3], and the STs of strains 3P2, 1T1, and 2T2 (ST 82) were the same as that of a strain described in [5]. To evaluate the phylogenetic distribution of the six strains, a 4055-bp sequence was produced for each one by concatenating the sequences of all seven loci analyzed. The concatenated sequences were compared with one another and with 45 similar, previously reported sequences representing the genetic diversity of O. oeni [3,5]. A phylogenetic tree derived from the aligned sequences was produced by the neighborjoining method (Fig. 5). As anticipated from previous studies [3,38], O. oeni strains formed two major phylogroups (A and B),

strongly supported by the bootstrap values. The three strains with unique STs were in phylogroup A. Strains CECT 217T and 8P7 were closely related to each other but more distantly related to strain 19P2. The three other strains grouped in phylogroup B. To determine whether the strains that grouped with this MLST were different, they were analyzed again by RAPD-PCR using the Coc primer. The results showed that all strains used in this study had different profiles (Fig. 6). This finding was confirmed by the typing method based VNTR at several loci [9], which likewise showed the different profiles of the analyzed strains (data not shown). Note that the distribution of the six strains in MLST did not correlate with their malolactic performance. In fact, efficient and inefficient strains were equally distributed in the two phylogroups. Moreover, a poorly performing strain (2T2) had the same MLST profile (and therefore the same phylogenetic grouping) as the efficient strains 1T1 and 3P2.

Discussion

Int Microbiol

The isolation of 240 LAB colonies from wines with an ethanol content of 14 % and undergoing MLF demonstrates the high ethanol tolerance of the isolates from these wines, suggesting that they are good candidates for use as starters in these kinds of wine. Typing of the isolates yielded the same multiplex RAPD-PCR profiles in several colonies, which allowed us to reduce the number of strains to a total of 21 (Table 1). The same profile, indicative of the same strain, was found in different wines produced in the same cellar. For instance, profile F appeared in five different wines (three Cabernet-Sauvignon, one Carignan, and one Grenache) vinified in cellar C1. This suggests the adaptation of some strains to their environment. By contrast, one only strain, profile M, appeared in wines from cellars C3 and C4, perhaps because these two cellars are located relatively close to each other. Four of the best MLF strains, chosen for their technological properties, and two others, chosen for purposes of comparison, were also typed by MLST. This analysis revealed only four different se-

Fig. 5. Phylogenetic distribution of Oenococcus oeni strains. The neighborjoining phylogenetic tree was constructed from the concatenated sequence deduced from the MLST data for each strain. The six strains in this study are indicated in bold and compared with 45 representative strains of the O. oeni species characterized in previous studies. The plus and minus symbols in parentheses indicate the efficient and less efficient strains, respectively, as determined by phenotypic characterization. The two major phylogroups (A and B) are indicated.


Int. Microbiol. Vol. 16, 2013

121

Int Microbiol

Highly ethanol-tolerant O. oeni

Fig. 6. RAPD-PCR with primer Coc of Oenococcus oeni strains used in this study. MW: molecular weight markers.

quence types, but failed to discriminate three strains. This was unusual because it is generally assumed that MLST discriminates bacterial strains better than methods based on banding patterns, such as RAPD or pulse field gel electrophoresis [3]. By applying a typing method based on the VNTR at several loci [9], we found that the strains were indeed different, based on their different profiles (data not shown). An examination of the RAPD-PCR profiles obtained with the Coc primer verified that these strains differed from each other (Fig. 6). Our findings support the use of MLST with these seven loci as a good technique for studying phylogenetic relationships, although, at least for differentiating O. oeni strains, it is not as discriminative as RAPD-PCR [22,26] or VNTR methods. To screen strains in wine-like medium, we optimized the inoculant size and the ethanol content, with the aim of obtaining MLF assay times that were not too short or too long, and which discriminated among strains. After analyzing the results obtained for some strains (Fig. 1), we chose an inoculant size of 2.5 %. Bearing in mind that growth of the inocula in MRSmf broth medium yielded a population size of 109 per ml (with a 2.5 % inoculant), the initial population in wine-like medium assays was about 2.5 × 107 per ml, a reasonable number of viable cells to initiate MLF. This level of inoculation is similar to that reported in previous studies [27,29]. As expected, there were significant differences in MLF effectiveness

depending on the ethanol content, from eight days for 12 % ethanol to more than 20 days for 14 % ethanol. Screening of the strains in wine-like medium containing 14 % ethanol showed important differences, although the observed trends in malic acid consumption among strains were similar at the two ethanol concentrations. On the basis of both malic acid consumption and its efficiency (consumption of malic acid per unit time), the strains were grouped statistically into four groups, and the six strains of cluster 1 were selected. These six strains were representative of different cellars (1 from C1, 2 from C2, 2 from C5, and 1 from C6), varieties (2 from Cabernet-Sauvignon, 3 from Grenache, and 1 from Carignan) and appellations (5 from DOQ Priorat and 1 from DO Tarragona). l-Malic acid consumption by the best-performing strains in the presence of 12 % and 14 % ethanol (Fig. 3, bottom) was around 6 and 2 mg/l·h, respectively. These efficiencies were higher than those previously obtained in wine-like medium [28,31]. Another step in selecting the best strains was the co-inoculation of the six selected strains and a commercial strain into two wines. This procedure of co-inoculating different strains simulates real conditions in the cellar, where several LAB strains can be found in each wine, one of which usually predominates at the end of the MLF [8]. In our study, two wines were inoculated with a mixture of seven strains that completed


122

Int. Microbiol. Vol. 16, 2013

MLF in 37 days (Fig. 4). Nevertheless, in wine W1 the number of viable LAB cells decreased considerably. This wine had a very high ethanol content (15.5 %) and a low l-malic acid content (0.43 g/l), which made it especially difficult for bacteria to grow and to carry out MLF. Despite the relatively small viable population in W1, MLF was completed at the same time as in wine W2. As pointed out by other authors [6], ethanol level has a more important effect on growth than does malolactic acid activity. The citrate content did not change in W1, whereas in W2 most of the citrate was consumed (from 226 to 38 mg/l); however, there was no increase in the amount of acetate. This quantity of citrate was low (near 1 mmol/l), sufficient to produce just 1 mmol/l acetate (0.06 g/l), which is very low with respect to the initial 0.49 g/l. The difference in citrate consumption between W1 and W2 can be explained by differences in the consumption ability of the predominant strains, with the predominant strain in W1, CH11, as non-citrate consuming. The isolates of O. oeni at the end of MLF in wine W1, which had a very low and decreasing population of bacteria, were mainly typed as the commercial strain CH11, which is known to perform well. In W2, however, in which MLF was higher because of an initially higher malic acid content and a sustainable viable LAB population, the predominant isolates were typed as strain 3P2. This strain performed better than all the others, including the commercial strain CH11, and it was therefore selected for further studies. One of the considerations in the selection of MLF strains is that they should not produce biogenic amines [20]. Although most Oenococcus strains produce few or no amines [24], the optimal strains would be those lacking the genes encoding enzymes involved in amino acid decarboxylation [25]. For this reason, the strains selected in this study were tested for amine production and for the presence of four genes essential to the production of the main amines (histamine, tyramine, and putrescine). The results showed that none of these strains produced these amines nor did they contain the corresponding genes. These strains are therefore good candidates for MLF as their presence in wine does not pose any risk to human health. The phylogenetic distribution of the six strains selected was determined by comparing their MLST data with those from previously characterized O. oeni strains. The six strains were equally distributed in the two phylogroups, A and B (Fig. 5), distinguished by other authors in their analyses of several dozen O. oeni strains [3,5]. In the study of Bilhère et al. [3], most of the commercial strains, which are assumed to

bordas et al.

be those best adapted for MLF, were grouped in subpopulation A, suggesting that their genotypic traits are related to their phenotypic traits with respect to MLF performance and adaptation to wine. However, our strains could be assigned to both subgroups, with the best-performing strain (3P2) placed in subgroup B. This suggests that phenotypic grouping is not related to the sequences of the housekeeping genes used in the analysis and that other genes are more closely related to adaptation and ethanol tolerance. This becomes even more apparent by considering the low performing strain 2T2, as its MLST profile was exactly the same as the profiles of the efficient strains 1T1 and 3P2. Bridier et al. [5] showed that O. oeni strains from a given geographic zone group together to form a well-defined subgroup amongst the strains of phylogroups A or B. This was not the case, however, for the strains described in this study, isolated from cellars in the Priorat and Tarragona DOs. Not only were those strains scattered amongst the two major phylogroups, so were the strains from the same DOQ Priorat. It is still unclear whether this dispersion means that strains from the DOQ Priorat and DO Tarragona are extremely divergent from a genetic point of view. These findings point to the need to analyze many more strains before this question could be answered. However, our results showed that strains belonging to phylogroups A and B could be encountered in these regions, and that strains within both types differed in their MLF efficiencies. This suggests that strains adapted to given regions should be selected on the basis of geographic origin as well as on their behavior, as determined in winemaking trials, rather than on phylogenetic criteria. In conclusion, in this study some strains that could carry out MLF in high ethanol wines were selected for their performance in wine-like media and by co-inoculation assay with different strains in real wine. The genetic diversity of these strains was studied by multi-locus sequence typing, and they grouped in two phylogroups, as in previous studies, but this grouping was not related to their ability to adapt and perform an efficient MLF. The absence of genes for biogenic amines in these strains was confirmed, which suggests that they would be good candidates as starter cultures. Acknowledgements. This work was supported by project DemeterCenit from CDTI, Spain, and AGL2009-07369 from the Spanish Ministry of Science and Innovation. Meritxell Bordas is grateful to the project DemeterCenit for her predoctoral fellowship. We thank Olivier Claisse for help in MLST analysis, C. Miot-Sertier for technical assistance, and the Genotyping and Sequencing facility of Bordeaux for performing the sequencing reactions. Competing interests. None declared.


Highly ethanol-tolerant O. oeni

References 1. Bartowsky EJ (2005) Oenococcus oeni and malolactic fermentation– moving into the molecular arena. Aust J Grape Wine Res 11:174-187 2. Beltramo C, Grandvalet C, Pierre F, Guzzo J (2004) Evidence for multiple levels of regulation of Oenococcus oeni clpP–clpL locus expression in response to stress. J Bacteriol 186:2200-2205 3. Bilhère E, Lucas PM, Claisse O, Lonvaud-Funel A (2009) Multilocus sequence typing of Oenococcus oeni: detection of two subpopulations shaped by intergenic recombination. Appl Environ Microbiol 75:1291-1300 4. Bover-Cid S, Holzapfel WH (1999) Improved screening procedure for biogenic amine production by lactic acid bacteria. Int J Food Microbiol 53:33-41 5. Bridier J, Claisse O, Coton M, Coton E, Lonvaud-Funel A (2010) Evidence of distinct populations and specific subpopulations within the species Oenococcus oeni. Appl Environ Microbiol 76:7754-7764 6. Capucho I, San Romão MV (1994) Effect of ethanol and fatty acids on malolactic activity of Leuconostoc oenos. Appl Microbiol Biotechnol 42:391-395 7. Carreté R, Vidal MT, Bordons A, Constantí M (2002) Inhibitory effect of sulfur dioxide and other stress compounds in wine on the ATPase activity of Oenococcus oeni. FEMS Microbiol Lett 211:155-159 8. Carreté R, Reguant C, Rozès N, Constantí M, Bordons A (2006) Analysis of Oenococcus oeni strains in simulated microvinifications with some stress compounds. Am J Enol Vitic 57:356-362 9. Claisse O, Lonvaud-Funel A (2012) Development of a multilocus variable number of tandem repeat typing method for Oenococcus oeni. Food Microbiol 30:304-307 10. Cocconcelli PS, Porro D, Galandini S, Senini L (1995) Development of RAPD protocol for typing of strains of lactic acid bacteria and enterococci. Lett Appl Microbiol 21:376-379 11. Coton E, Coton M (2005) Multiplex PCR for colony direct detection of Gram-positive histamine- and tyramine-producing bacteria. J Microbiol Meth 63:296-304 12. Coton M, Romano A, Spano G, Ziegler K, Vetrana C, Desmarais C, Lonvaud-Funel A, Lucas P, Coton E (2010) Occurrence of biogenic amine-forming lactic acid bacteria in wine and cider. Food Microbiol 27:1078-1085 13. Davis CR, Wibowo D, Lee TH, Fleet GH (1988) Properties of wine lactic acid bacteria: Their potential enological significance. Amer J Enol Vitic 39:137-142 14. De Herralde F, Savé R, Nadal M, Pla E, Lopez-Bustins JA (2012) Global change influence on wine quality in Priorat and Montsant (NE Spain). Acta Hort (ISHS) 931:39-46 15. De Man JC, Rogosa M, Sharpe ME (1960) A medium for the cultivation of lactobacilli. J Appl Bacteriol 23:130-135 16. Gómez-Alonso S, Hermosín-Gutiérrez I, García-Romero E (2007) Simultaneous HPLC analysis of biogenic amines, amino acids, and ammonium ion as aminoenone derivatives in wine and beer samples. J Agric Food Chem 55:608-613 17. Henick-Kling T (1993) Malolactic fermentation. In: Fleet GH (ed) Wine microbiology and biotechnology. Harwood Academic, Chur, Switzerland, pp 289-326 18. Jones GV, White MA, Cooper OR, Storchmann K (2005) Climate change and global wine quality. Climatic Change 73:319-334 19. Lonvaud-Funel A (1999) Lactic acid bacteria in the quality improvement and depreciation of wine. Antonie van Leeuwenhoek 76:317-331

Int. Microbiol. Vol. 16, 2013

123

20. Lonvaud-Funel A (2001) Biogenic amines in wines: role of lactic acid bacteria. FEMS Microbiol Lett 199:9-13 21. Liu SQ (2002) Malolactic fermentation in wine—beyond deacidification. J Appl Microbiol 92:589-601 22. Marques AP, Duarte AJ, Chambel L, Teixeira MF, San Romão MV, Tenreiro R (2011) Genomic diversity of Oenococcus oeni from different winemaking regions of Portugal. Int Microbiol 14:155-162 23. Mira de Orduña R (2010) Climate change associated effects on grape and wine quality and production. Food Res Int 43:1844-1855 24. Moreno-Arribas MV, Polo MC, Jorganes F, Muñoz R (2003) Screening of biogenic amine production by lactic acid bacteria isolated from grape must and wine. Int J Food Microbiol 84:117-123 25. Nannelli F, Claisse O, Gindreau E, de Revel G, Lonvaud-Funel A, Lucas PM (2008) Determination of lactic acid bacteria producing biogenic amines in wine by quantitative PCR methods. Lett Appl Microbiol 47:594-599 26. Reguant C, Bordons A (2003) Typification of Oenococcus oeni strains by multiplex RAPD-PCR and study of population dynamics during malolactic fermentation. J Appl Bacteriol 95:344-353 27. Reguant C, Carreté R, Ferrer N, Bordons A (2005) Molecular analysis of Oenococcus oeni population dynamics and the effect of aeration and temperature during alcoholic fermentation on malolactic fermentation. Int J Food Sci Technol 40:451-460 28. Reguant C, Carreté R, Constantí M, Bordons A (2005) Population dynamics of Oenococcus oeni strains in a new winery and the effect of SO2 and yeast strain. FEMS Microbiol Lett 246:111-117 29. Rosi I, Fia G, Canuti V (2003) Influence of different pH values and inoculation time on the growth and malolactic activity of a strain of Oenococcus oeni. Austr J Grape Wine Res 9:194-199 30. Silveira MG, Baumgärtner M, Rombouts FM, Abee T (2004) Effect of adaptation to ethanol on cytoplasmic and membrane protein profiles of Oenococcus oeni. Appl Environ Microbiol 70:2748-2755 31. Solieri L, Genova F, de Paola M, Giudici P (2010) Characterization and technological properties of Oenococcus oeni strains from wine spontaneous malolactic fermentations: a framework for selection of new starter cultures. J Appl Microbiol 108:285-298 32. Spano G, Massa S (2006) Environmental stress response in wine lactic acid bacteria: beyond Bacillus subtilis. Crit Rev Microbiol 32:77-86 33. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596-1599 34. Webb LB, Whetton PH, Barlow EWR (2011) Observed trends in winegrape maturity in Australia. Global Change Biology 17:2707-2719 35. Wibowo D, Eschenbruch R, Davis CR, Fleet GH, Lee TH (1985) Occurrence and growth of lactic acid bacteria in wine: a review. Amer J Enol Vitic 36:302-312 36. Zapparoli G, Torriani S, Pesente P, Dellaglio F (1998) Design and evaluation of malolactic enzyme gene targeted primers for rapid identification and detection of Oenococcus oeni in wine. Lett Appl Microbiol 27:243-246 37. Zapparoli G, Tosi E, Azzolini M, Vagnoli P, Krieger S (2009) Bacterial inoculation strategies for the achievement of malolactic fermentation in high-alcohol wines. South Afr J Enol Vitic 30:49-55 38. Zé-Zé L, Chelo IM, Tenreiro R (2008) Genome organization in Oenococcus oeni strains studied by comparison of physical and genetic maps. Int Microbiol 11:237-244


PERSPECTIVES International Microbiology (2013) 16:125-132 doi: 10.2436/20.1501.01.187 ISSN 1139-6709 www.im.microbios.org

Accessibility, sustainability, excellence: how to expand access to research publications. Executive summary Janet Finch,* Simon Bell, Laura Bellingan, Robert Campbell, Peter Donnelly, Rita Gardner, Martin Hall, Steven Hall, Robert Kiley, Wim van der Stelt, David Sweeney, Phil Sykes, Adam Tickell, Astrid Wissenburg, Ron Egginton, Michael Jubb Working Group on Expanding Access to Published Research Findings

This report tackles the important question of how to achieve better, faster access to research publications for anyone who wants to read or use them. It has been produced by an independent working group made up of representatives of universities, research funders, learned societies, publishers, and libraries. The groupâ&#x20AC;&#x2122;s remit has been to examine how to expand access to the peer-reviewed publications that arise from research undertaken both in the UK and in the rest of the world; and to propose a programme of action to that end. We have concentrated on journals which publish research results and findings. Virtually all are now published online, and they increasingly include sophisticated navigation, linking and interactive services. Making them freely accessible at the point of use, with minimal if any limitations on how they can be used, offers the potential to reap the full social, economic and cultural benefits that can come from research. Our aim has been to identify key goals and guiding principles in a period of transition towards wider access. We have

sought ways both to accelerate that transition and also to sustain what is valuable in a complex ecology with many different agents and stakeholders. The future development of an effective research communications system is too important to leave to chance. Shifts to enable more people to have ready access to more of the results of research will bring many benefits. But realising those benefits in a sustainable way will require co-ordinated action by funders, universities, researchers, libraries, publishers and others involved in the publication and dissemination of quality-assured research finding.

1. The issue Communicating research findings through journals and other publications has for over 350 years been at the heart of the scientific and broader research enterprise. Such publications have been remarkably successful in enabling researchers to

* This article is a summary, by the authors, of a 140-page report prepared in 2012 by the UK Working Group on Expanding Access to Published Research Findings, chaired by British sociologist and academic administrator Janet Finch, DBE. The Working Group was charged with recommending how to develop a model that would be effective and sustainable over time, for expanding access to the published findings of research. The whole report, which can be accessed at http://www.researchinfonet.org/wp-content/uploads/2012/06/Finch-Group-report-FINAL-VERSION.pdf [http://tinyurl. com/d2lxqks], has been published under a Creative Commons License Attribution 3.0 Unported. This is the first of a series of Perspectives articles devoted to the Open Access Initiative that will be published in International Microbiology. Our journal already published an Editorial on the topic in 2004 (Guerrero R & Piqueras M, Int Microbiol 7:157-161), and strongly supports open access. [Int Microbiol 2013; 16(2):125-132]


126

Int. Microbiol. Vol. 16, 2013

build on the work of others, to scrutinise and refine their results, to contribute additional ideas and observations, and to formulate new questions and theories. They play a key role in the complex ecology of research, both for researchers themselves and for all those in society at large who have a stake or an interest in the results of their work. The internet has brought profound change across all sectors of society and the economy, transforming interactions and relationships, reducing costs, sparking innovation, and overturning established modes of business. Researchers and journal publishers were quick to embrace the digital and online revolutions. But there is a widespread perception, in the UK and across the world, that the full benefits of advances in technologies and services in the online environment have yet to be realised. Most researchers in the higher education (HE) and related sectors and in large research-intensive companies have access to a larger number of journals than ever before, at any time of day, and wherever they can connect to the internet. But in the rapidly-developing online environment they want more: online access free at the point of use to all the nearly two million articles that are produced each year, as well as the publications produced in the past; and the ability to use the latest tools and services to analyse, organise and manipulate the content they find, so that they can work more effectively in their search for new knowledge. Better, faster communication can bring better research. Most people outside the HE sector and large research-intensive companies - in public services, in the voluntary sector, in business and the professions, and members of the public at large - have yet to see the benefits that the online environment could bring in providing access to research and its results. For many of them, the only way in which they can gain access to quality-assured research publications is to pay up to £20 or more as a ‘payper-view’ (PPV) fee in order to read a single journal article. The issue we are addressing, therefore, is how to expand and improve access to research publications for the benefit of all who have a stake or an interest in research and its results. Barriers to access – particularly when the research is publiclyfunded – are increasingly unacceptable in an online world: for such barriers restrict the innovation, growth and other benefits which can flow from research. The principle that the results of research that has been publicly funded should be freely accessible in the public domain is a compelling one, and fundamentally unanswerable. Effective publication and dissemination is essential to realising that principle, especially for communicating to non-specialists. Improving the flows of the information and knowledge that researchers produce will promote.

finch et al.

□ enhanced transparency, openness and accountability, and public engagement with research; □ closer linkages between research and innovation, with benefits for public policy and services, and for economic growth; □ improved efficiency in the research process itself, through increases in the amount of information that is readily accessible, reductions in the time spent in finding it, and greater use of the latest tools and services to organise, manipulate and analyse it; and □ increased returns on the investments made in research, especially the investments from public funds. These are the motivations behind the growth of the worldwide open access movement. For it is clear that many benefits could result if we were to move world-wide to an open access regime, complete with peer review and with effective search, navigation and other value-added services currently provided by publishers, libraries and others. Moves towards open access have achieved a momentum that we believe will continue. The key policy questions are how to promote and manage the shift in an ordered way which delivers the benefits but minimises the risks. These are particularly important issues for the UK, whose researchers are world-leading in the quality as well as the quantity of the research they produce.

2. The current environment Research publishing already shows the influence of open access. There are now three principal interlocking channels for publishing, disseminating and gaining access to research findings. □ Subscription-based journals predominate, published by a wide range of commercial and not-for-profit publishers, including many learned societies. These include the most prestigious and highly-ranked journals, others that play a major role within the disciplines they cover, and yet others that have a more niche market. Many publishers provide ‘big deals’ under which institutions can subscribe to most if not all of their publications on discounted terms. But no single organisation can afford licences for all the 25,000 peer-reviewed journals currently being published; and people who do not belong to an organisation that can afford large packages of licences have at best very limited access through this channel.


open access

□ Open access journals turn the subscription-based model on its head: instead of relying on subscription revenues provided by or on behalf of readers, most of them charge a fee to authors, generally known as an article processing or publishing charge (APC)*, before an article is published. Access for readers is then free of charge, immediately on publication, and with very few restrictions on use and re-use. The number of journals operating in this way has grown fast in recent years, albeit from a low base. □ Repositories do not act as publishers themselves. Rather, they provide access to some version of papers either before they are submitted for publication in a journal or at some point after they have been published, usually subject to an embargo period. Most universities in the UK, and in many other countries, have established repositories, but the rates at which published papers have been deposited in them so far has been disappointing. In a few areas such as physics, however, subject-based repositories have become an important element in the daily workflow for researchers. The variations within and the relationships between these three channels are complex. Some subscription-based journals, for instance, operate a hybrid model under which they also offer an open access option for individual articles; and subscriptionbased journals have developed relationships with some repositories. But the pace of the transition to open access has not been as rapid as many had hoped, for a number of reasons. First, there are tensions between the interests of key stakeholders in the research communications system. Publishers, whether commercial or not-for-profit, wish to sustain highquality services, and the revenues that enable them to do so. Funders wish to secure maximum impact for the research they fund, plus value for money. Universities wish to maximise their research income and performance, while bearing down on costs. Researchers themselves wish to see speedy and effective publication and dissemination of research results, but also to secure high impact and credit for the work they have done. Second, there are potential risks to each of the key groups of players in the transition to open access: rising costs or shrinking revenues, and inability to sustain high-quality ser-

* Other terms are used, including article publication charge and publication fee. We use the abbreviation APC throughout this report.

Int. Microbiol. Vol. 16, 2013

127

vices to authors and readers. Most important, there are risks to the intricate ecology of research and communication, and the support that is provided to researchers, enabling them to perform to best standards, under established publishing regimes. Concern about these risks may restrain the development of wider access if it is not managed in a measured way. Third, research and its communication is a global endeavour. Measures to promote open access need to be similarly international in scope if they are to deliver their full potential. The UK has played a leading role in promoting open access, but there are limits to what the UK can achieve alone. Although researchers in the UK are among the best and most productive in the world, they produce only 6% of the research papers published in journals each year. Fourth, is the question of cost. Current funding regimes focus on providing access to research literature through libraries, via payments for subscription-based journals. Arrangements to meet the costs of APCs for open access publishing tend to be ad hoc and unsystematic. In the period of transition there are bound to be additional costs as both systems exist side by side. All four groups of issues need to be tackled if the transition to open access is to be accelerated in an ordered way.

3. Our recommendations Our view is that the UK should embrace the transition to open access, and accelerate the process in a measured way which promotes innovation but also what is most valuable in the research communications ecosystem. The process itself will be complex, since as the transition develops over the next few years, no single channel can on its own maximise access to research publications for the greatest number of people. We therefore recommend that: i. a clear policy direction should be set towards support for publication in open access or hybrid journals, funded by APCs, as the main vehicle for the publication of research, especially when it is publicly funded; ii. the Research Councils and other public sector bodies funding research in the UK should – following the Wellcome Trust’s initiative in this area but recognizing the specific natures of different funding streams - establish more effective and flexible arrangements to


128

Int. Microbiol. Vol. 16, 2013

meet the costs of publishing in open access and hybrid journals; iii. support for open access publication should be accompanied by policies to minimise restrictions on the rights of use and re-use, especially for non-commercial purposes, and on the ability to use the latest tools and services to organise and manipulate text and other content; iv. during the period of transition to open access publishing worldwide, in order to maximise access in the HE and health sectors to journals and articles produced by authors in the UK and from across the world that are not accessible on open access terms, funds should be found to extend and rationalise current licences to cover all the institutions in those sectors; v. the current discussions on how to implement the proposal for walk-in access to the majority of journals to be provided in public libraries across the UK should be pursued with vigour, along with an effective publicity and marketing campaign; vi. representative bodies for key sectors including central and local Government, voluntary organisations, and businesses, should work together with publishers, learned societies, libraries and others with relevant expertise to consider the terms and costs of licences to provide access to a broad range of relevant content for the benefit of consortia of organisations within their sectors; and how such licences might be funded; vii. future discussions and negotiations between universities and publishers (including learned societies) on the pricing of big deals and other subscriptions should take into account the financial implications of the shift to publication in open access and hybrid journals, of extensions to licensing, and the resultant changes in revenues provided to publishers; viii. universities, funders, publishers, and learned societies should continue to work together to promote further experimentation in open access publishing for scholarly monographs; ix. the infrastructure of subject and institutional repositories should be developed so that they play a valuable role complementary to formal publishing, particularly

finch et al.

in providing access to research data and to grey literature, and in digital preservation; x. fundersâ&#x20AC;&#x2122; limitations on the length of embargo periods, and on any other restrictions on access to content not published on open access terms, should be considered carefully, to avoid undue risk to valuable journals that are not funded in the main by APCs. Rules should be kept under review in the light of the available evidence as to their likely impact on such journals.

4. What needs to be done Implementing our recommendations will require changes in policy and practice by all stakeholders. More broadly, what we propose implies cultural change: a fundamental shift in how research is published and disseminated. A new shared understanding needs to develop of the interlocking roles of the various parties: researchers, policy-makers, funders, university managers, librarians, publishers and other intermediaries. Our recommendations are presented as a balanced package, so it is critical that they are implemented in a balanced and sustainable way, with continuing close contact and dialogue between representatives of each of the key groups, and regular assessment of key indicators of progress. In the list of key actions below, we indicate where we believe primary responsibility lies. Key actions: overall policy and funding arrangements i. Make a clear commitment to support the costs of an innovative and sustainable research communications system , with a clear preference for publication in open access or hybrid journals. (Government, Research Councils, Funding Councils, universities) ii. Consider how best to fund increases in access during a transition period through all three channels â&#x20AC;&#x201C; open access publications, subscriptions, and repositories â&#x20AC;&#x201C; and the balance of funding to be provided through additional money from the public purse, by diversion of funds from support of other features of the research process, and by seeking efficiency savings and other reductions in costs from publishers and other intermediaries. (Government, Research Councils, Funding Councils, universities)


Int. Microbiol. Vol. 16, 2013

open access

iii. Put in place arrangements to gather and analyse reliable, high-quality and agreed indicators of key features of the changing research communications landscape, and to review those indicators and the lessons to be drawn from them. (Government, Research Councils, Funding Councils, universities, publishers) iv. Keep under review the position of learned societies that rely on publishing revenues to fund their core activities, the speed with which they can change their publishing business models, and the impact on the services they provide to the UK research community. (Government, Funding Councils, Research Councils, learned societies, publishers) v. Renew efforts to sustain and enhance the UKâ&#x20AC;&#x2122;s role in international discussions on measures to accelerate moves towards open access. (Government, Research Councils, Funding Councils, universities, publishers) Key actions: public ation in open access and hybrid journals vi. Establish effective and flexible mechanisms to enable universities and other research institutions to meet the costs of APCs (Government, funders); and efficient arrangements for payment, minimising transaction costs while providing proper accountability (universities, publishers). vii. Discuss with other funders in the commercial and charitable sectors how best to fund and promote publication in open access and hybrid journals (Government) viii. Establish publication funds within individual universities to meet the costs of APCs, making use of dedicated moneys provided by funders for that purpose, as well as other available resources. (universities) ix. Develop in consultation with academic staff policies and procedures relating to open access publishing and how it is funded. (universities) The issues to be considered should include a. whether to promote open access publishing as the principal channel for all research publications

129

b. how much funding should be provided to support the payment of APCs each year, the sources of that funding, and how the funds are to be administered c. how to work together with researchers, and in line with the principles of academic freedom, in making judgements about the potential for publication in journals with different levels not only of status, but of APCs d. how support for publication should be integrated with other aspects of research management, for example the development of research capacity, and support for early-career researchers e. policies relating to payment of APCs when articles are published in collaboration with researchers from other institutions. x. Extend the range of open access and hybrid journals, with minimal if any restrictions on rights of use and re-use for non-commercial purposes; and ensure that the metadata relating makes clear articles are accessible on open access terms.(publishers, learned societies) xi. Provide clear information about the balance between the revenues provided in APCs and in subscriptions. (publishers, learned societies) Key actions: licensing xii. Rationalise and extend current licence arrangements for the HE and health sectors, so that as many journals as possible are accessible to everyone working or studying in those sectors. (Government, Funding Councils, universities, publishers, learned societies) xiii. Work together to find ways to reduce the VAT burden on e-journals. (Government, universities) xiv. Discuss with representative bodies in the public, business and voluntary sectors the feasibility of developing licence agreements that provide access to relevant journals and other content across key parts of those sectors; and possible ways of funding such agreements. (Government, publishers).


130

Int. Microbiol. Vol. 16, 2013

xv. Examine the feasibility of providing licensed access to journals for small research-intensive enterprises with which universities have close relationships. (universities, publishers, JISC Collections) xvi. Continue to work with representatives of public libraries to implement the proposal to provide walk-in access to the majority of journals in public libraries across the UK, and to ensure that the initiative has the maximum impact. (publishers, British Library) Key actions: repositories xvii. Continue to develop the infrastructure of repositories and enhance their interoperability so that they provide effective routes to access for research publications including reports, working papers and other grey literature, as well as theses and dissertations; a mechanism for enhancing the links between publications and associated research data; and an effective preservation service. (funders, universities, JISC, publishers) xviii. Consider carefully the balance between the aims of, on the one hand, increasing access, and on the other of avoiding undue risks to the sustainability of subscription-based journals during what is likely to be a lengthy transition to open access. Particular care should be taken about rules relating to embargo periods. Where an appropriate level of dedicated funding is not provided to meet the costs of open access publishing, we believe that it would be unreasonable to require embargo periods of less than twelve months. (Government, funders, universities).

5. Costs There will be additional costs during a period of transition which may last for several years; but we cannot be certain about the total costs of all the measures we recommend, particularly with regard to open access publishing. Our estimates are best available evidence at present, including average levels of APCs currently being paid by the Wellcome Trust. But any calculations as to costs for the future depend on a series of assumptions as to □ the pace of change towards open access publishing, and in particular the extent to which the UK is on aver-

finch et al.

age ahead of the rest of the world □ the average level of APCs as more journals adopt the open access model □ the number and proportion of articles with overseas as well as UK authors for which UK funders and institutions would be required to pay a full APC □ the extent to which during the transition universities and other organisations are able to reduce their expenditure on subscriptions even as their expenditure on APCs rises. We recognise that there is considerable room for debate about assumptions on all these issues; and that variations in them could bring significant changes in our estimates, both upwards and downwards. Much depends on how quickly the rest of the world moves towards open access. There are good reasons to believe that there is international momentum in this direction, but it is difficult to predict how fast or comprehensive it will be. It is clearly in the interests of the UK to enhance its role in international discussions on these issues. Much also depends on levels of APCs and also of the amounts that continue to be paid to publishers in subscriptions, and it is important that in the context of the mixed model we recommend for the medium term, both should be looked at together. Hence the importance of publishers’ providing clear information about the balance between the revenues provided in APCs and in subscriptions. But one of the advantages of open access publishing is that it brings greater transparency about the costs, and the price, of publication and dissemination. The measures we recommend will bring greater competition on price as well as the status of the journals in which researchers wish to publish. We therefore expect market competition to intensify, and that universities and funders should be able to use their power as purchasers to bear down on the costs to them both of APCs and of subscriptions. Taking all these factors into account, our best estimate is that achieving a significant and sustainable increase in access, making best use of all three mechanisms, would require an additional £50-60m a year in expenditure from the HE sector: £38m on publishing in open access journals, £10m on extensions to licences for the HE and health sectors and £3-5m on repositories, plus one-off transition costs of £5m. The uncertainties we have outlined clearly mean that there is a risk that the costs could be higher than we estimate. But that risk can be managed by slowing the pace of transition. Moreover, the costs are modest in relation to total public expenditure on research (£5.5bn from the Research Councils


open access

and Funding Councils alone). Indeed, we believe meeting the costs of transition is essential in order to manage in an ordered way the move from a research communications system which is becoming increasingly unsustainable as a result of the economic, technological and social changes we have highlighted. While any estimates of the benefits that will accrue to the UK economy and society are similarly subject to much uncertainty, it is clear that the benefits will be real and substantial. In short, we believe that the investments necessary to improve the current research communications system will yield significant returns in improving the efficiency of research, and in enhancing its impact for the benefit of everyone in the UK.

6. What will change The measures we recommend should begin to make a difference quickly but the whole transition process will come to fruition over a number of years. Open access publication Our recommendations and the establishment of systematic and flexible arrangements for the payment of APCs will stimulate publishers to provide an open access option in more journals. Most universities will establish funds for the payment of APCs, along with policies and procedures which will in some cases moves towards open access as the default mode of publication. That will give universities a greater role in helping researchers to make judgements, in line with academic freedom, about how they publish their work. Different universities may develop different ways of handling this in consultation with their staff. The result will be that a much higher proportion of the publications produced by researchers in the UK will be freely accessible to everyone in the world, with minimal restrictions on their use and re-use. Subscriptions and licences Subscription-based journals will remain a key channel for the publication of research results from across the world for some years to come. Implementation of our recommendations will mean that staff and students in universities and in the health sector will enjoy a much more integrated information environment. Access to the great majority of journals and articles for walk-in users of public libraries across the UK will make a

Int. Microbiol. Vol. 16, 2013

131

real and substantial difference to many people and organisations, especially if it is accompanied by effective marketing, training for librarians, and guidance for users. It will also bring a significant enhancement of the role of public libraries in their local communities. For people and organisations in the public, business and voluntary sectors, exploration of the scope for extensions to licensing for online access will be a step towards wider availability, providing evidence of its value. We hope that some testbeds will be established by consortia of organisations in specific sectors. Repositories The further development of repositories will make them better integrated and interoperable, and higher standards of accessibility will bring greater use by both authors and readers. Institutional repositories will develop the roles they perform for their universities, both in providing a showcase for their research and in supporting research information management systems. In the wider scholarly communications sphere, repositories will develop their roles in preserving and providing access to research data, to theses, and to grey literature. Subject-based repositories will continue to develop refine their roles alongside publishers and their platforms, especially in those areas where such repositories operate effectively already, and have an established position in researchersâ&#x20AC;&#x2122; regular workflows. Overall Implementation of the balanced programme we recommend will mean that more people and organisations in the UK have access to more of the published findings of research than ever before. More research will be accessible immediately upon publication, and free at the point of use. Our recommended programme will accelerate the progress towards a fully open access environment in the UK, and we hope that it will contribute to similar acceleration in the rest of the world. We believe that such movement will bring substantial benefits in transparency and accountability, engagement with research and its findings, closer linkages between research and innovation, and improved efficiency in the research process itself. Our work has shown how representatives of the different stakeholder groups can work together to find ways to achieve those ends.


132

Int. Microbiol. Vol. 16, 2013

finch et al.

Working Group Members Dame Janet Finch, DBE (Chair) Professor of Sociology, University of Manchester Simon Bell Head of Strategic Partnerships and Licensing, British Library Dr Laura Bellingan, FSB Head of Science Policy, Society of Biology Robert Campbell Senior Publisher, Wiley Blackwell Professor Peter Donnelly, FRS Professor of Statistical Science, University of Oxford and Director of the Wellcome Trust Centre for Human Genetics Dr Rita Gardner, CBE Director, Royal Geographical Society Professor Martin Hall Vice Chancellor, University of Salford and Chair, Open Access Implementation Group Steven Hall Managing Director, IoP Publishing Robert Kiley Head of Digital Services, Wellcome Trust Wim van der Stelt Executive Vice President Corporate Strategy, Springer David Sweeney Director, Research Innovation and Skills, HEFCE Phil Sykes Librarian, University of Liverpool and Chair, Research Libraries UK Professor Adam Tickell Pro-Vice-Chancellor (Research and Knowledge Transfer), University of Birmingham Drs Astrid Wissenburg Partnerships & Communication and Deputy CEO, ESRC, and chair of the RCUK Knowledge Transfer and Economic Impact Group Ron Egginton, OBE (Observer) Research Base Directorate, Department for Business Innovation and Skills Secretary Dr Michael Jubb

Director, Research Information Network 114 Sub-group on Licensing


Volume 16(2) JUNE 2013

Acknowledgement of Institutional Subscriptions International Microbiology staunchly supports the policy of open access (Open Access Initiative, see Int. Microbiol. 7:157161). Thus, the journal recognizes the help received from the many institutions and centers that pay for a subscription—in spite of the possibility to download complete and current issues of the journal free of charge. We would therefore like to thank those entities. Their generous contribution, together with the efforts of the many individuals involved in preparing each issue of International Microbiology, makes publication of the journal possible and plays an important role in improving and expanding the field of microbiology in the world. Some of those institutions and centers are: Area de Microbiología. Departamento de Biología Aplicada. Universidad de Almería / Biblioteca. Institut Químic de Sarrià. Universitat Ramon Llull. Barcelona / Biblioteca. Instituto Nacional de Seguridad e Higiene en el Trabajo-Ministerio de Trabajo y Asuntos Sociales. Barcelona / Ecologia microbiana. Departament de Genètica i de Microbiologia. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Biblioteca. Institut de Biotecnologia i Biomedicina. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Laboratori d’Ecogenètica. Departament de Microbiologia. Universitat de Barcelona / Departament de Microbiologia i Parasitologia Sanitàries. Facultat de Farmàcia. Universitat de Barcelona / Societat Catalana de Biologia Institut d’Estudis Catalans. Barcelona / Departamento de Microbiologia. Universidade Federal de Minas Gerais. Belo Horizonte. Brasil / Departamento de Inmunología, Microbiología y Parasitología, Universidad del País Vasco, UPV-EHU. Bilbao / Biblioteca. Universidad de Buenos Aires. Argentina / Biblioteca. Facultad de Ciencias. Universidad de Burgos / Biblioteca. Departamento de Producción Animal CIAMCentro Mabegondo. Abegondo (Coruña) / Laboratorio de Microbioloxia. Universidade da Coruña. Coruña / Biblioteca.

Divisió Alimentària del IRTA-Centre de Tecnologia de la Carn. Generalitat de Catalunya. Monells (Girona) / Biblioteca Montilivi. Facultat de Ciències. Universitat de Girona / Área de Microbiología. Departamento de Ciencias de la Salud. Universidad de Jaén / Microbiologia. Departament de Ciències Mèdiques Bàsiques. Facultat de Medicina. Universitat de Lleida / Laboratorio de Microbiología Aplicada. Centro de Biología Molecular. Universidad Autónoma de Madrid-CSIC. Cantoblanco (Madrid) / Laboratorio de Patógenos Bacterianos Intracelulares. Centro Nacional de Biotecnología-CSIC. Cantoblanco (Madrid) / Grupo de Investigación de Bioingeniería y Materiales (BIOMAT). Escuela Técnica Superior de Ingenieros Industriales. Universidad Politécnica de Madrid / Biblioteca. Centro de Investigaciones Biológicas, CSIC. Madrid / Merck Sharp & Dohme de España, Madrid / Departamento de Microbiología. Facultad de Ciencias. Universidad de Málaga / Grupo de Fisiología Microbiana. Depto. de Genética y Microbiología. Universidad de Murcia. Espinardo (Murcia) / Library. Department of Geosciences. University of MassachusettsAmherst. USA / Biblioteca de Ciencias. Universidad de Navarra. Pamplona / Grupo de Genética y Microbiología. Departamento de Producción Agraria. Universidad Pública de Navarra. Pamplona / Microbiología Ambiental. Departamento de Biología. Universidad de Puerto Rico. Río Piedras. Puerto Rico / Biblioteca General. Universidad San Francisco de Quito. Ecuador / Biblioteca. Facultat de Medicina. Universitat Rovira Virgili. Reus / Instituto de Microbiología Bioquímica-Departamento de Microbiología y Genética. CSIC-Universidad de Salamanca / Departamento de Microbiología y Parasitología. Universidad de Santiago de Compostela. Santiago / Laboratorio de Referencia de E. coli (LREC). Facultad de Veterinaria. Universidad de Santiago de Compostela. Lugo / Departamento de Genética. Universidad de Sevilla / Tecnología de los Alimentos. Facultad de Ciencias. Universidad de Vigo / General Library. Marine Biological Laboratory. Woods Hole, Massachusetts, USA.

A3


Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz

S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686 Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter.SI units should be used throughout. For Nomenclature of organisms genus and species names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.

A4


General Information International Microbiology is a quarterly, open-access, peer-reviewed

journal in the fields of basic and applied microbiology. It publishes two kinds of papers: research articles and complements (editorials, perspectives, books reviews, etc.). Submission Manuscripts must be submitted by one of the authors of the manuscript by e-mail to int.microbiol@microbios.org. As part of the submission process, authors are required to comply with the following items, and submissions may be returned if they do not adhere to these guidelines: 1. The work described has not been published before, including publication on the World Wide Web (except in the form of an Abstract or as part of a published lecture, review, or thesis), nor is it under consideration for publication elsewhere. 2. All the authors have agreed to its publication. The corresponding author signs for and accepts responsibility for releasing this material and will act on behalf of any and all coauthors regarding the editorial review and publication process. 2. The submission file is in Microsoft Word, RTF, or OpenOffice document file format. 3. The manuscript has been prepared in accordance with the journal’s accepted practice, form, and content, and it adheres to the stylistic and bibliographic requirements outlined in “Preparation of manuscripts.” 4. Illustrations and figures are placed separately in another document. Large files should be compressed. Copyright and license If an article is accepted for publication in International Microbiology, the authors (or other copyright holders) must transfer the copyright to the journal, which covers the right—not exclusive—to reproduce and distribute the article including reprints, translations, photographic reproductions, microforms, electronic form (offline, online) or any other reproduction of similar nature. Creative Commons The journal is published under a Creative Commons Attribution-NonComercial-ShareAlike 3.0 Unported License. http://creativecommons.org/licenses/by-nc-sa/3.0/

Open access publishing provides immediate, permanent, free online access to the full texts of all the journal’s peer-reviewed research articles. It allows all interested readers to view, download, print, and/or redistribute any article without requiring a subscription on the principle that making research freely available to the public supports a greater global exchange of knowledge. International Microbiology’s open access policy enables a far greater distribution and impact of an author’s work and is in the interest of the scientific community worldwide. The journal’s expenses for providing immediate, permanent, free online access to the full text of research articles are recovered partly from article-processing charges. Currently many research funding agencies not only allow these expenses to be paid from their grants, but also encourage open access publication. The journal’s standard processing fee is 800.00 €. If a manuscript requires extensive editorial work, an extra charge may be requested. The acceptance of a paper, however, will not depend on the authors’ ability to pay these charges. Individual waiver requests must be done during the submission process and will be considered on a case-to-case basis. Information for Subscribers International Microbiology is published quarterly. Volume 16 will consist of 4 issues—March, June, September and December—and will be published during 2013. Recommended annual subscription is 300.00 € plus shipping and handling. Single-issue prices are available upon request. SAL (Surface Air Lifted) delivery is mandatory for Japan, Northeast and Southeast Asia, India, Australia and New Zealand. Airmail delivery to all other countries is available upon request. Orders or claims can be sent directly to: International Microbiology Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org Cancellations must be received by 30 September to take effect at the end of the same year. Change of address: allow six weeks for all changes to become effective. Please contact int.microbiol@ microbios.org if you have any questions regarding your subscription. Information for advertisers For advertising inquiries, please contact us at int.microbiol@microbios. org. All advertisements are subject to the publisher’s approval.

All articles in International Microbiology will be available on the Internet to any reader at no cost. The journal allows users to freely download, copy, print, distribute, search, and link to the full text of any article provided the authorship and source of the published article is cited and it is not used for commercial purposes. We recommend authors read about the Creative Commons Attribution-NonComercial-ShareAlike 3.0 Unported License before submitting their paper. Open access and article processing charges

Disclaimer While the contents of this journal are believe to be true and accurate at the date of its publication, neither the authors and editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no guarantee, expressed or implied, with regard to the material contained therein. p3


INTERNATIONAL MICROBIOLOGY Official journal of the Spanish Society for Microbiology Volume 16 · Number 2 · June 2013 RESEARCH REVIEW

Hermosa R, Rubio MB, Cardoza RE, Nicolás C, Monte E, Gutiérrez S The contribution of Trichoderma to balancing the costs of plant growth and defense

69

RESEARCH ARTICLES

Cardenas PA, Alarcón M, Narvaez I, Salazar R, Falconí G, Espinel M, Trueba G Staphylococcus aureus outbreak in the intensive care unit of the largest public hospital in Quito, Ecuador

81

Hernández SB, Ayala JA, Rico-Pérez G, García-del Portillo F, Casadesús J Increased bile resistance in Salmonella enterica mutants lacking Prc periplasmic protease

87

Suebwongsa N, Panya M, Namwat W, Sookprasert S, Redruello B, Mayo B, Álvarez MA, Lulitanond V Cloning and expression of a codon-optimized gene encoding the influenza A virus nucleocapsid protein in Lactobacillus casei

93

López-Pérez M, Mirete S, Jardón-Valadez E, González-Pastor J Identification and modeling of a novel cloramphenicol resistance protein detected by functional metagenomics in a wetland of Lerma, Mexico

103

Bordas M, Araque I, Alegret JO, El Khoury M, Lucas P, Rozès N, Reguant C, Bordons A Isolation, selection, and characterization of highly ethanol-tolerant strains of Oenococcus oeni from south Catalonia

113

PERSPECTIVES

Finch J, et al. Accessibility, sustainability, excellence: how to expand access to research publications. Executive Summary (Report of the Working Group on Expanding Access to Published Research Findings.)

INDEXED IN

Agricultural and Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents®/Agriculture, Biology & Environmental Sciences®; EBSCO; EMBASE/Elservier Bibliographic Databases; Food Science and Technology Abstracts; ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services®; MEDLINE®/Index Medicus®; Latíndex; MedBioWorldTM; SciELO-Spain; Science Citation Index Expanded®/SciSearch®

125


Turn static files into dynamic content formats.

Create a flipbook
International Microbiology by Institut d'Estudis Catalans - Issuu