Skip to main content

International Microbiology

Page 1

Volume 20 路 Number 4 路 December 2017 路 ISSN 1139-6709 路 e-ISSN 1618-1905

INTERNATIONAL MICROBIOLOGY www.im.microbios.org

20(4) 2017

Official journal of the Spanish Society for Microbiology


Publication Board

Editorial Board

Editor in Chief José Berenguer, Universidad Autónoma de Madrid

Ricardo Amils, Universidad Autónoma de Madrid, Madrid, Spain Albert Bordons, Rovira i Virgili University, Tarragona, Spain Albert Bosch, University of Barcelona, Barcelona, Spain Josep Casadesús, University of Seville, Sevilla, Spain Yehuda Cohen, The Hebrew University of Jerusalem, Jerusalem, Israel Rita R. Colwell, Universityof Maryland & Johns Hopkins University, MD, USA Katerina Demnerova, Inst. of Chem. Technology, Prague, Czech Republic Esteban Domingo, CBM, CSIC-UAM, Cantoblanco, Spain Mariano Esteban, Natl.Center for Biotechnology, CSIC, Cantoblanco, Spain Steven D. Goodwin, University of Massachussets- Amherst, MA, USA Juan C. Gutiérrez, Complutense University of Madrid, Madrid, Spain Juan Imperial, Technical University of Madrid, Madrid, Spain John L. Ingraham, University of California-Davis, CA, USA Juan Iriberri, University of the Basque Country, Bilbao, Spain Roberto Kolter, Harvard Medical School, Boston, MA, USA Michael T.Madigan, Southern Illinois University, Carbondale, IL, USA Beatriz S. Méndez, University of Buenos Aires, Argentina Diego A. Moreno, Universidad Politécnica de Madrid, Madrid, Spain Ignacio Moriyón, University of Navarra, Pamplona, Spain Juan A. Ordónez, Complutense University of Madrid, Madrid, Spain José M. Peinado, Complutense University of Madrid, Madrid, Spain Antonio G. Pisabarro, Public University of Navarra, Pamplona, Spain Carmina Rodríguez, Complutense University of Madrid, Madrid, Spain James A. Shapiro, University of Chicago, IL, USA John Stolz, Duquesne University, Pittsburgh, PA, USA James Strick, Franklin & Marshall College, Lancaster, PA, USA Gary A.Toranzos, University of Puerto Rico, San Juan, Puerto Rico Antonio Torres, University of Seville, Sevilla, Spain José A. Vásquez-Boland, University of Edinburgh, Edinburgh, UK Antonio Ventosa, University of Seville, Sevilla, Spain Tomás G. Villa, University of Santiago de Compostela, Santiago de Compostela, Spain Miquel Viñas, University of Barcelona, Barcelona, Spain Dolors Xairó, Biomat S.A., Grifols Group, Parets del Vallès, Spain, Fernando Rojo, National Centro of Biotechnology, Madrid, Spain Juncal Garmendia, Institute of Agrobiotechnology, Pamplona, Spain Olga Genoilloud, MEDINA fundation, Granada, Spain. Mariano Gacto Fernández, University of Murcia, Spain Carmen Ruiz Roldán, University of Córdoba, Spain Gemma Reguera (Michigan State U.) Beatriz Diez. Catholic University of Chile, Santiago de Chile, Chile

Associate Editor Diego A. Moreno, Universidad Politécnica de Madrid Managing Editors Ana M. García, Universidad Politécnica de Madrid Digital Media Coordinator Andrés Núñez, Universidad Politécnica de Madrid Specialized Editors Josefa Antón, University of Alicante Susana Campoy, Universidad Autónoma de Barcelona Josep Guarro, University Rovira Virgili Enrique Herrero, University of Lleida Emili Montesinos, University of Girona José R. Penadés, University of Glagow Jordi Vila, University of Barcelona

Addresses Editorial Office C/Rodríguez San Pedro, 2, 210 28015 Madrid, Spain E-mail: international.microbiology@semicrobiología.org Spanish Society for Microbiology C/Rodríguez San Pedro, 2, 210 28015 Madrid, Spain Tel. +34-915613381; Fax: +34-915613299 E-mail: secretaria.sem@microbiologia.org http://www.semicrobiologia.org/ © 2017 Spanish Society for Microbiology, Madrid, & Institute for Catalan Studies, Barcelona. Printed in Spain ISSN (printed): 1139-6709 e-ISSN (electronic): 1618-1095 D.L.: B.23341-2004

The Spanish Society for Microbiology (SEM) is a scientific society founded in 1946 at the Jaime Ferrán Institute of the Spanish National Research Council (CSIC) in Madrid. Its main objectives are to foster basic and applied microbiology, promote international relationships, bring together the many professionals working in this science in Spain, and contribute to the dissemination of science in general and of microbiology in particular among society. It is and interdisciplinary society, with around 1800 members working in different fields of microbiology.


CONTENTS

Volume 20, Number 4, December 2017 IN MEMORIAM Nombela C Julio R. Villanueva, microbiologist, researcher, and mentor of generations of scientists

151

RESEARCH ARTICLES Caruso P, Biosca EG, Bertolini E, Marco-Noales E, Gorris MT, Licciardello C, LĂłpez MM Genetic diversity reflects geographical origin of Ralstonia solanacearum strains isolated from plant and water sources in Spain

155

Kovacic A, Music MS, Dekic S, Tonkic M, Novak A, Rubic Z, Hrenovic J, Goic-Barisic I Transmission and survival of carbapenem-resistant Acinetobacter baumannii outside hospital setting

165

Rolny IS, Racedo SM, PĂŠrez PF Fate of Bacillus cereus within phagocytic cells

170

Yadavalli R, Sam-Yellowe TY Developmental stages identified in the trophozoite of the free-living Alveolate flagellate Colpodella sp. (Apicomplexa)

178

RESEARCH REVIEW Marquez A, Djelouadji Z, Lattard V, Kodjo A Overview of laboratory methods to diagnose Leptospirosis and to identify and to type leptospirosis

184

Journal Citations Reports 5-year Impact Factor of International Microbiology is 1,598. The journal is covered in several leading abstracting and indexing databases, including the following ones: Agricultural & Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents/Agriculture, Biology & Environmental Sciences; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science & Technology Abstracts; ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services; MEDLINE/ Invdex Medicus; Latindex; MedBio World; PubMed; SciELO-Spain; Science Citation Index Expanded; SciSearch.


Front cover legends

Center. Experimental avocado plot number 16, allocated at the Experimental Station “La Mayora”, The Institute for Mediterranean and Subtropical Horticulture “La Mayora” (IHSM-UMA-CSIC; Málaga, Spain). At the left, a 40 years-old healthy avocado tree. At the right, an avocado tree with typical symptoms of avocado white root rot caused

by Rosellinia necatrix. Photograph by Francisco M. Cazorla. Upper left. Transmission electron micrograph of the marine phage H1 negatively stained. Phage was isolated from a strain of Pseudoalteromonas sp. from the Blanes Bay Microbial Observatory station (BBMO), a surface coastal site in the NW Mediterranean. Photo by Elena Lara, Marine Sciences Institute (ICM-CSIC) (Magnification, 330,000×) Upper right. Transmission electron micrograph of Sphingobacterium detergens during the process of cellular division. The bacterium was isolated from a soil sample from the Azorean Islands and was selected for its ability to reduce the surface tension of the culture medium. Photo by Ana M. Marqués and César Burgos-Díaz, Faculty of Pharmacy and Food Sciences, University of Barcelona. (Magnification, 10,000×) Lower left. Dark field micrograph of several individuals of the ciliate Vorticella sp. detached from its peduncles. Note the big and active macronucleus with the shape of a long and bluish band. Photo by Rubén Duro, Center for Microbiological Research, Barcelona. (Magnification, 1000×)

Lower right. Transmission electron micrograph of the plasmolized yeasts (“lias”) of Saccharomyces cerevisiae from the elaboration of sparkling wines according to the “cava” method after second fermentation in closed bottles. Photo by Montserrat Riu and Rebeca Tudela, Faculty of Pharmacy and Food Sciences, University of Barcelona. (Magnification, 10,000×)

Back cover: Pioneers in Microbiology A light in the fight against infectious diseases: Ferran’s cholera vaccine Doctor Jaime Ferrán y Clua was probably one of the most brilliant, brave and intuitive minds that, despite a very conservative and distrustful atmosphere, made remarkable advances in the history of medical and microbiological science. Jaime Ferrán was born in Corbera de Ebro (Cataluña, Spain) in 1851 and following in his father’s footsteps, studied medicine and worked as a physician, eventually becoming head of the City Hospital of Tortosa. Open-minded and empowered by great curiosity (he was a photography enthusiast, seeing it as a powerful tool to explore the beauty of nature), he embraced the early works of Louis Pasteur and quickly was attracted to the newborn field of bacteriology research. Starting a laboratory with chemist Inocente Paulí, he initiated an unexpected journey into microbiological research, specifically immunization against infectious diseases. Promptly, his research yielded the first vaccines in Spain against diverse epizootic diseases such as the red disease of pigs or carbuncle, and his Memory on bacterial parasitism was honored by the Real Academy of Medicine of Madrid. It was the end of the 19th century, a turbulent period for public health, when continuous outbreaks of cholera ravaged populations all over the world. Koch’s discovery of cholera’s etiological agent, thennamed Bacillus virgulans, sparked a race to develop efficient sanitation methods aimed at its eradication, attracting the attention of physicians, governments, and researchers including Pasteur and later Jaime Ferrán. Urged by fresh outbreaks of Asian cholera in Egypt spreading to the French coast, Spanish officials dispatched a commission including Jaime Ferrán to learn the way French researchers dealt with this fatal disease. Having thus acquired practice in isolation and identifica-

tion of the bacterium from infected patients, Jaime Ferrán returned to Spain to start development of a vaccine against cholera, based on the concept of microbial attenuation developed by Pasteur and Jenner’s smallpox vaccine. He observed that subcutaneous injection of attenuated B. virgulans isolated from cholera patients or propagated in vitro did not kill guinea pigs; rather they became protected against topical exposure of a lethal dose of the related virulent strain. Excited by this finding, he repeated the same “immunization” protocol on himself and later on other volunteers, which survived a lethal dose of the “bacillus Koch”. The effectiveness of his invention was illustrated in Alcira (Valencia, Spain) in 1885, where 50,000 civilians were successfully immunized against cholera, a milestone in the field of public health and prevention of infectious diseases. It is worth noting that Ferrán’s anti-cholera vaccination protocol was successfully employed to suppress a cholera epidemic in the armies fighting during the First World War. This remarkable deed in the history of medical science was initially controversial, but finally found acclaim in 1902 with the Breant Prize awarded by the Academy of Science of Paris. Dr. Ferrán is recognized as the first to describe lethality of the cholera bacillus, and to develop an immunization protocol in humans. His dedication to the fight against infectious diseases extended to rabies, diphtheria, tetanus, bubonic plague, and tuberculosis. Dr. Jaime Ferrán, warmly remembered as “El Cartujo de la Sagrera” because of his dedication and enthusiasm in the study of bacteriology, was a brave and intuitive scientist, a bright light in humankind’s fight against infectious diseases, and a world-class pioneer for all future immunization therapies. Diego Romero Universidad de Málaga


IN MEMORIAM International Microbiology 20(4):151-154 (2017) doi:10.2436/20.1501.01.297. ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Julio R. Villanueva, microbiologist, researcher, and mentor of generations of scientists César Nombela Faculty of Pharmacy, Universidad Complutense, Madrid Received 20 December 2017 · Accepted 30 December 2017

On November 21, 2017, Professor Julio R. Villanueva died in Salamanca. Born on April 27, 1928 in Villamayor, council of Piloña (Asturias), he lived almost to the age of 90. His was an accomplished life, full of endeavors and exciting works in the world of research and teaching, which earned him very broad recognition both in Spain and the international arena. Villanueva was undoubtedly the driving force of Fundamental Microbiology in Spain. His early steps came at a time when experimental biology was arriving at an important new age, using microbial systems for experimentation that lead to general conclusions about all living beings. The unveiling of the majority of biological phenomena came from the study of microbial systems. From this context Villanueva derived his motivation - he was always known for the energy he put into all his endeavors - to promote his research and create a scientific and academic school of thought. He tried to project his passion for research at the University at all costs, in a manner that was often timely, and other times not so much, and always proclaimed that only universities that research actively deserve their titles. To this purpose, he sought out the most highly qualified and motivated graduates to invite to join his group and pursue academic careers. We, his disciples, always felt the encouragement - and also the demand - to continually train in research, as an essential requirement of being a university professor. Few mentors have encouraged the lives of so many researchers, valuing above all else their virtues and motivation, with no interest other than for them to be the best. Committed to Spain reaching the highest scientific and academic levels, he also served in important positions, such as Corresponding author: César Nombela, Prof. of Microbiology Faculty of Pharmacy, Complutense University Ph. +34 913941743 cnombela@farm.ucm.es

the Rector of the University of Salamanca. In his laboratory, a critical resource for microbial studies was initiated, creating the Spanish Type Culture Collection (CECT), which continues today at the University of Valencia. His efforts in favor of promoting research were also developed in collaboration with outstanding organizations, especially the Ramón Areces Foundation. He was tireless when participating on the selection committees for diverse educational and scientific awards, highlighted by the “Premio Principe (Princesa) de Asturias” for scientific and technical research, which he chaired for several years. And finally, it is also necessary to remember his performance as “full academician” and President of the Royal National Academy of Pharmacy (Spain). Prof. Villanueva always showed special appreciation for the living world as a whole, with its immense diversity despite the unity of essential processes that occur in all living things. In taxonomy, his name was given to a biological species, not microbial but of insects: A few years ago, the INBio (an important center in global biodiversity in Costa Rica) described a new species of fly, assigning the name of Mesorhaga villanuevi. Given the name by the Australian researcher Bickel, it is a small insect collected in the foothills of the Guanacaste mountain range. Without a doubt, Prof. Villanueva appreciated this designation of the exotic species. To better understand the key aspects of his life and work, we put the different phases in context with the circumstances in which they happened. Early years. Microbial physiology In 1952, Prof. Villanueva finished a degree in Pharmacy at the Complutense University of Madrid, Spain. It can be said that these were years in which Spain was striving to survive scientific isolation, overcome a shortage of resources and achieve some presence in international forums.


152

NOMBELA

Int. Microbiol. Vol. 20, 2017

With regard to the field of microbiology in this era, we should note that the journal “Microbiología Española” represented a meritorious effort, but was insufficient given the pressing need to publish original research in English. Trying to glean relevant aspects of its publications, two are worthy of special mention. The first was the creation of the Bordetella genus by Moreno López, including the causative agent of pertussis (whooping cough), B. pertussis (leaving the genus Bacillus), a designation that was finally accepted into the Bergey Manual of bacterial systematics. The second was the description of the HO locus, which controls sexual type in Saccharomyces cerevisiae, by the agronomist and professor Santamaría Ledochowski. Scientific development during this period was limited, though the creation of antibiotics factories in León and Aranjuez in the early Fifties, although in the line of consolidating Spanish self-sufficiency, was important for the development of microbial scientific and technical industries. These were not easy times for the development of a scientific career in Spain, but always driven by who he considered to be his main mentor, Professor José María Albareda, Villanueva did not hesitate to travel to Portugal, performing experiments for his first doctoral thesis in the “Estación Agronómica de Sacavem” near Lisbon. With this work, in 1955 he defended his thesis entitled “Metabolic aspects of some fungi associated with Uredineas” for a doctorate in Pharmacy, a study of species that are still considered exotic such as Tuberculina persicina and Verticilium hemileiae. The thesis involved an exhaustive analysis of the physiology of these fungi in laboratory culture, based on their growth in different defined media, to establish the effects of different nutritional sources and physical characteristics of growth. With this, Villanueva delved into Eukaryotic Microbiology, unusual as most microbiologists work with prokaryotes or viruses as an experimental system. Undoubtedly, the use of fungal species in research served as the basis for his subsequent interest in eukaryotic microorganisms or bacterial species such as actinomycetes, which have served as the basis for many of the accomplishments of members of his school.

in a context of true leadership of global scientific activities. Those of us who worked with Prof. Villanueva were able to see how his fascination with that British academic environment, in which he cultivated cutting-edge science, was a true source of inspiration for him. Return to Spain. CSIC his first horizon Trained in Cambridge as a researcher, Villanueva returned to Spain in 1959 with the Spanish National Research Council (CSIC) as his first prospect. Together with Manuel Losada and Gonzalo Giménez Martín, he undertook the task of setting up the Institute of Cell Biology, within the Center for Biological Research (CIB), which for many years would be the focal point of the most advanced Life Sciences research in Spain. He worked as an independent researcher during an important era of growth for Spanish microbiology throughout the fifties and sixties. The study of microorganisms, a foundation of experimental biology, consolidated knowledge about the functionality and variations of genetic material.

Dazzled by Cambridge After his first Ph.D. in Spain, Prof. Villanueva had the opportunity to travel to the University of Cambridge. It was again the urging of his mentor Dr. Albareda, professor of soil science and his teacher in the Faculty of Pharmacy at the Complutense University of Madrid, which got him into the British university, at that time one of the most progressive centers of Life Sciences research. I never knew Albareda personally, but I always felt the appreciation and gratitude that Julio professed to him upon receiving this support and guidance. In Cambridge in the mid-fifties, Villanueva found an environment that would serve as the definitive drive for his scientific ambitions. Watson and Crick’s formulations on the double-helix model of DNA structure were recent, and everything was done

Fig. 1.  Prof. Julio R. Villanueva. XV National Congress of the Spanish Society of Microbiology. Madrid, 1995.


JULIO R. VILLANUEVA,MICROBIOLOGIST, RESEARCHER, AND MENTOR OF GENERATIONS OF SCIENTISTS

Molecular Biology emerged strongly thanks to microbial studies, while deciphering the universal genetic code and study of the genetic organization of bacteria and their viruses dominated the scene. In addition, the enormous practical impact of research into the “mode of action” of antibiotics and microbial biochemistry made them focal points, with the scale of industrial fermentation increasing accordingly. Microbes are not just pathogens or saprophytes, but above all they are living beings, and very convenient models to study essential biological phenomena. The world of microbes. Professor of Microbiology. Discovery of Salamanca It was 1965 when the Spanish version of a book that would become a flagship for the teaching of Microbiology around the world appeared, with guidelines for teaching that placed microbes as living beings, fundamental to understand vital processes. With the suggestive title of “The World of Microbes”, written by Roger Stanier, Michael Doudoroff and Edward Adelberg, the translation was in the charge of Julio Villanueva, Manuel Losada and Isabel García Acha, and was published by Editorial Aguilar. Villanueva, who had already been creating a remarkable group of researchers at CSIC, made the leap to the university setting, opting for a Chair of Microbiology in 1967 in the newly-created section of Biological Sciences in the Faculty of Sciences of the University of Salamanca, Spain. Achieving this position was a true culmination of the aspirations of the researcher Villanueva, who felt Salamanca to be the supreme goal of his academic and professional development. To Salamanca he dedicated his drive and experience, which was notable for his age of almost forty years. It wasn’t easy because the necessary infrastructure for his research work was yet to be developed. However, again applying all the energy he was able, he soon gathered a large group of Ph.D. students, and other scientists he had studied with in Madrid joined him in Salamanca after valuable experiences in research centers in Europe and the United States. The work at the University of Salamanca, in which the first classes of biologists graduated from the hand of Prof. Villanueva, continued in the direction chosen during his era in Madrid. Numerous students joined the Department of Microbiology to pursue their doctorates, with the clear idea that their future would be to graduate and migrate to prestigious foreign centers for a vital period of postdoctoral work. From there each one could consider reincorporation into Spanish institutions having gained the capacity to perform at the highest scientific levels. Focusing its research on complex microbial systems (yeast, fungi, actinomycetes), the Villanueva group developed works based on biochemical approaches, and also morphological and structural studies based on electron microscopy. This is how his approach became known as “the School of Villanueva”

Int. Microbiol. Vol. 20, 2017

153

or “the School of Salamanca”, characterized by the opening of cutting-edge questions that arose during microbial studies. Likewise, his involvement with societies of Microbiology and Biochemistry underscored the importance of collaboration to him, and despite the limited resources, the task of conservation of cell culture was taken on with determination, with the start of the CECT. Prof. Villanueva, always with encouragement and urging from Severo Ochoa, Alberto Sols and others, ascended to the presidency of the Spanish Society of Biochemistry (SEB) and from there to that of the Federation of European Biochemical Societies (FEBS). This led to his commission to organize the European Congress of Biochemistry in Madrid in 1968, a major event that was unheard of in Spain up to that point, with a scientific community already eager to make a real leap into internationalization. A radiant school of thought Starting from the aforementioned initial stages at CSIC, Villanueva knew how to motivate new generations of researchers, in a decisive bid for the lift-off of science in Spain. Numerous students, candidates for academic research careers, were surprised to receive an offer from a researcher who showed them an enormously attractive path for their future professional development. His generous dedication to his disciples was accompanied by notable demands, as the path to success is only passed with great effort. His career was therefore an example of what defines a university teacher: capable of stimulating his students, of selecting the most appropriate people and respecting their personality and ideas, of encouraging each one to reach the highest goals they are capable, of demanding dedication and performance. With students he was understanding of difficulties, facilitated solutions, built self-esteem in a realistic manner; in short, guiding each one of us on the path through which we could best travel. The echoes of his work as the teacher of several generations of professors and researchers are present today in many parts of Spain. The results ended up in the creation of a true scientific school that projects in a special way at the university level. Numerous students who trained with Villanueva have occupied positions in the scientific and academic staff of CSIC institutions in Madrid and Salamanca, and in departments in centers of higher education of Oviedo, León, Complutense, Alcalá de Henares, Extremadura, Valencia, Murcia, Santiago de Compostela, La Laguna (Tenerife), etc. as well as other centers in the international arena. More than two dozen full professors and many more teachers and researchers attest to the value of the teachings of Professor Villanueva, whose most important goal was to promote disciples capable of exceeding the accomplishments of their teacher. In addition to the prestigious Department of Microbiology of the Faculty of Sciences of Salamanca, two excellent research institutes, the Center of Functional Biology


154

NOMBELA

Int. Microbiol. Vol. 20, 2017

and Genomics and the Center for Cancer Research, both linked to the University of Salamanca and CSIC, have emerged from the efforts of Prof. Villanueva, established in the city of the river Tormes. Accepting the Rectorate. A Rector present in every aspect of Spanish life In 1972, another essential event in the career of Prof. Villanueva took place, which was his ascension to the position of Rector of the centuries-old University of Salamanca, thus succeeding outstanding personalities that are part of the history of Spain. His appointment, made by the Ministry of Education and Science in times of difficulty for the institution, was ratified shortly thereafter by an election by the academic staff. The echoes of his work materialized throughout Spain, his achievements keeping him at the forefront of social concerns in favor of education and training, during the several years of political transition that began in Spain in 1975. He was the founder and first President of the Conference of Rectors of Spain, involved in those years in a determined defense of the role of the university in Spanish society. Once again, his drive emerged to communicate publicly about what was at stake, nothing less than higher education as a commitment to the future. Nor were times easy, as nothing was during the political transition, in which Spain sought and found its way forward to shape a new political system based on democracy and freedom. Spain and Science It can be said that the life and work of Julio R. Villanueva were inspired by an idea that has continued in the minds of later generations of scientists and professors reaching to the present, a dissatisfaction with Spain’s contribution to the development of Science at certain times throughout history, including today. In line with Cajal, Ochoa, and also Villanueva’s mentor Albareda, he applied himself to the difficult but not impossible task: to put Spanish Science in the place it rightfully belongs. It is true that there are many ways to approach the problem, and they don’t always agree. But it can be said that Prof. Villanueva’s efforts focused much more on overcoming the challenge than on arguing about its scope. The above is a very limited summary of the work of Prof. Villanueva, always accompanied by his wife, Dr. García Acha, always guided by the friendship of other scientists and teachers.

Fig. 2. Prof. Julio R. Villanueva at his laboratory. Around 1980.

We mentioned also his involvement in scientific communication, managing scientific societies and organizing countless courses, conferences and other events, a responsibility that was also inherited by many of his disciples. In the sixties, he presided over the Spanish Society of Biochemistry (SEB) as well as the Federation of European Biochemistry Societies (FEBS), and thus the European Congress of Biochemistry was held in Spain in 1988. Chaired by Prof. Villanueva, with the assistance of Severo Ochoa and several Nobel prize winners, it was an event that triggered great advances for the Spanish scientific community in the Life Sciences. The additive effects exerted by all the groups emanating from the Villanueva School in Salamanca makes its influence more widespread in Spain and abroad. It is the best example of desirable academic mobility, which is a current topic for some politicians, but in reality, current regulations make it impossible nowadays in Spanish universities. Only with determination, effort, and confidence in our country can this be achieved. Julio Villanueva’s clairvoyant vision of the future, along with a great determination to face any challenge, explain his remarkable achievements in Spanish education. His name is undoubtedly part of a small group of pioneers, to whom we owe that our universities have the potential and capacities that fit the demands of modern Spain. As this remains a daunting task, it is necessary to carry on with examples like his because the road is long. It is the requirement that we have seen in those who have been able to set an example.


RESEARCH ARTICLE International Microbiology 20(4):155-164 (2017) doi:10.2436/20.1501.01.298. ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Genetic diversity reflects geographical origin of Ralstonia solanacearum strains isolated from plant and water sources in Spain Paola Caruso1*, Elena G. Biosca2, Edson Bertolini3, Ester Marco-Noales4, María Teresa Gorris4, Concetta Licciardello1 and María M. López4 Consiglio per la Ricerca in Agricoltura e l’Analisi dell’Economia Agraria, Centro di Ricerca Olivicoltuta, Frutticoltura e Agrumicoltura (CREA), Corso Savoia, 190 – 95024 Acireale (Catania) Italy. 2 Departamento de Microbiología y Ecología, Universitat de València, Av. Dr. Moliner 50, 46100-Burjassot, Valencia, Spain. 3 Departamento de Fitossanidade, Faculdade de Agronomia, Universidade Federal do Rio Grande do Sul (UFRGS), Avenida Bento Gonçalvez 7712, 91540-000 Porto Alegre, Brazil. 4 Centro de Protección Vegetal y Biotecnología, Instituto Valenciano de Investigaciones Agrarias (IVIA), Carretera Moncada-Náquera Km 4.5, 46113-Moncada, Valencia, Spain. 1

Received 22 November 2017 · Accepted 30 December 2017 Summary.  The characterization and intraspecific diversity of a collection of 45 Ralstonia solanacearum strains isolated in Spain from different sources and geographical origins is reported. To test the influence of the site and the host on strain diversity, phenotypic and genotypic analysis were performed by a polyphasic approach. Biochemical and metabolic profiles were compared. Serological relationship was evaluated by Indirect-ELISA using polyclonal and monoclonal antibodies. For genotypic analysis, hrpB and egl DNA sequence analysis, repetitive sequences (rep-PCR), amplified fragment length polymorphism (AFLP) profiles and macrorestriction with XbaI followed by pulsed field gel electrophoresis (PFGE) were performed. The biochemical and metabolic characterization, serological tests, rep-PCR typing and phylogenetic analysis showed that all analysed strains belonged to phylotype II sequevar 1 and shared homogeneous profiles. However, interesting differences among strains were found by AFLP and macrorestriction with XbaI followed by PFGE techniques, some profiles being related to the geographical origin of the strains. Diversity results obtained offer new insights into the biogeography of this quarantine organism and its possible sources and reservoirs in Spain and Mediterranean countries. Keywords:  Bacterial wilt · potato · soil · PFGE · AFLP

Introduction Ralstonia solanacearum (E. F. Smith) [45], responsible for potato brown rot and bacterial wilt of Solanaceae and other hosts, is one *Corresponding author: Paola Caruso. Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria, Centro di ricerca Olivicoltuta, Frutticoltura e Agrumicoltura (CREA), Corso Savoia, 190 – 95024 Acireale (Catania) Italy Phone + 39 0957653122 Fax + 39 0957653113 E-mail: paola.caruso@crea.gov.it

of the most harmful bacterial pathogens and a quarantine organism in the European Union (EU) [7]. It can persist, for varying periods in soil, water, rhizosphere, plant residues or inside host plants [3,4,5,12,42], reaching aquatic niches from infested plants. R. solanacearum has been long considered as a species complex [22] due to its high intraspecific variability. This bacterial species was traditionally subdivided in five races based on host range and six biovars based on the utilization of different sugars [23,25]. In 2005, Fegan and Prior [21] proposed a new classification scheme, based on the phylogenetic analysis of the sequences of the 16S-23S rRNA intergenic region and the endoglucanase (egl)


156

CARUSO ET AL.

Int. Microbiol. Vol. 20, 2017

and hrpB virulence genes, dividing R. solanacearum strains in four phylotypes that correlated with different geographic origins [21]. In Europe, R. solanacearum strains isolated from potato, tomato, soil, waterways and weeds have been classified, as phylotype II, historically known as biovar 2 race 3 (b2r3), except for some biovar 1 strains isolated in 2007 in a confined area of Portugal [3,12,14,15,33,38]. However, the R. solanacearum species complex has recently experienced a major taxonomic revision [36] and consequently, only phylotype II strains belong to the current R. solanacearum species. In the EU, since the first identification of R. solanacearum in Sweden in 1972 [31], several outbreaks have been reported in Northern and Western countries such as United Kingdom, The Netherlands, Belgium, France and Portugal [19] and in Mediterranean countries such as Italy, Greece and Spain [2,19,29,32]. In Spain, this pathogen was first isolated from potatoes cultivated in Canary Islands and later from the mainland [20,32]. Subsequent surveys also led to the detection of R. solanacearum from water in some rivers located in several regions, as well as on potato or tomato crops [12,32]. Eradication measures were taken in the detected foci following the European Directives 98/57/EC and 2006/63/EC to prevent the spread of the disease [6,8]. Typing methods that could discriminate R. solanacearum strains from different sources can be useful in tracing back bacterial wilt outbreaks, thereby allowing a better understanding of the epidemiology and ecology of this pathogen in Mediterranean countries and leading to the development of more effective prevention and eradication strategies [9,15,28]. Until now, only a few European studies have been focused on the characterization of the diversity within European strains of R. solanacearum [15,33,38,40,41]. In the first one, van der Wolf et al. [41], analysed 30 strains from Europe and 4 from outside Europe, showing that, using rep-PCR and XbaI digested genomic DNA followed by pulsed field gel electrophoresis (PFGE), it was possible to detect some variability among race 3 strains from France, The Netherlands and the United Kingdom. Thereafter, Timms-Wilson et al. [40] analysed 44 strains from Europe and 38 from the ‘rest of the world’. They proposed the possible selection of a R. solanacearum “European” variant, according to results of sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE), fatty acid methyl esters (FAME), exopolysaccharide (EPS) production, 16S rRNA, RFLP, amplified ribosomal DNA restriction analysis (ARDRA) and sequence analysis of 16S–23S rRNA gene. More recently, Stevens and van Elsas [38] found clear genomic differences among 44 Dutch strains from different sources, including water, sediment and bittersweet plants (Solanum dulcamara) by using PFGE analysis of XbaI restricted genomic DNA. Cruz et al. [15] used a polyphasic approach to analyze R. solanacearum strains isolated from plants and environmental sources in Portugal. They observed higher polymorphism levels with Rep-PCR and fluorescent amplified fragment length polymorphism (FAFLP) techniques. Instead Parkinson et al.

[33] used Variable-Number Tandem Repeat (VNTR) analysis for source tracing of R. solanacearum strains associated with English watercourses and bacterial wilt outbreaks. In our work, the diversity of representative strains of R. solanacearum isolated from different bacterial wilt outbreaks and waterways in Spain, was analysed by phenotypic and genotypic methods, including biochemical and serological tests, rep-PCR, PFGE, AFLP, and the sequence analysis of the endonuclease (egl) and the regulatory transcription regulator (hrpB) genes. Our goal was to study the molecular epidemiology of R. solanacerum in our environmental conditions, as a basis for designing more efficient eradication and/or control strategies for this pathogen in Spain and other countries. Materials and methods Bacterial identification.  A selection of 45 strains of R. solanacearum isolated in Spain from different sources, sampling points and geographical origins was used as well as three afluid variants that spontaneously appeared in Yeast Peptone Glucose Agar (YPGA) [27] plates and were named IVIA 1546af, IVIA 1632.2-af, and IVIA 1861-af. One reference strain, PD 2762 (or IPO 1609, from The Netherlands), was also included in some analyses for comparative purposes (Table 1). Bacterial strains were maintained at -80°C in 30% (v/v) glycerol and routinely cultured on YPGA at 29ºC for 72 h. The Spanish isolates were initially identified as R. solanacearum by their colonial morphology on modified SMSA agar [18] and YPGA after 48-72 h at 29ºC. Gram-staining, nutritional and enzymatic tests were performed for their identification as described in Commission Directive 2006/63/EC [8]. Presumptive R. solanacearum isolates were also identified by a DASI-ELISA detection kit (PlantPrint Diagnostics, Valencia, Spain) using the specific monoclonal antibody (MAb) IVIA-8B for this pathogen [11]. The isolates were further confirmed by a specific Co-PCR assay [10], phenotypic tests and by multiplex PCR [21,35]. Strains R. solanacearum PD 2762 and Chryseobacterium indologenes P 27 were included respectively as positive and negative controls. Pathogenicity on potted tomato plants (cv Roma, 3-4 weeks old) was tested according to Council Directive 98/57/EC [6], using the reference strain PD 2762 and sterile phosphate buffered saline (PBS) (10 mM, pH 7.2) as positive and negative controls, respectively. Wilting appearance was monitored every two days and symptoms severity was recorded as indicated in Table 1. All the tests were performed at least twice on separate assays. Phylotype determination.  R. solanacearum strains were classified into phylotypes by multiplex PCR [21] using phylotype and R. solanacearum specific primers (Table 2). Phylotypes were identified based on the reported phylotype-specific PCR amplicons.


DIVERSITY REFLECTS GEOGRAPHICAL ORIGIN OF R. SOLANACEARUM

Int. Microbiol. Vol. 20, 2017

157

Table 1. Characteristics of Ralstonia solanacearum strains used in this study. Strain

Geographic origin d

Source

Phylotype/ biovar

Pathogenicity test e

PFGE pattern (XbaI)

AFLP cluster

XbaI

Spanish a IVIA 1496.1a

g

Canary Islands (La Palma)

S. tuberosum

II/2

2

IVIA 1532.4

h

Galicia

S. tuberosum

II/2

3

X7

SP

IVIA 1546-f h

Castile and Leon (Burgos)

S. tuberosum

II/2

3

X10

SP

IVIA 1546-af b,h

Castile and Leon (Burgos)

S. tuberosum

II/2

1

IVIA 1600.4.1

Canary Islands (La Palma)

S. tuberosum

II/2

2

IVIA 1602.1

Canary Islands (La Palma)

S. tuberosum

II/2

2

Canary Islands (La Palma)

S. tuberosum

II/2

2

IVIA 1620.1.1

Castile and Leon (Soria)

S. tuberosum

II/2

2

X4

E

IVIA 1632.2-f

Castile and Leon (Soria)

S. tuberosum

II/2

2

X1

C

Castile and Leon (Soria)

S. tuberosum

II/2

5

C

Castile and Leon (Salamanca)

S. tuberosum

II/2

2

A

IVIA 1635

Castile and Leon (Soria)

S. tuberosum

II/2

3

IVIA 1671

Castile and Leon (Soria)

S. tuberosum

II/2

2

IVIA 1672 i

Castile and Leon (Burgos)

S. tuberosum

II/2

4

IVIA 1673

Castile and Leon (Burgos)

S. tuberosum

II/2

5

IVIA 1674

Unknown

S. lycopersicum

II/2

2

IVIA 1678 i

Castile and Leon (Soria)

S. tuberosum

II/2

4

IVIA 1692 a

Castile and Leon (Segovia)

S. tuberosum

II/2

2

Unknown

S. lycopersicum

II/2

2

Canary Islands (La Palma)

S. tuberosum

II/2

2

IVIA 1778.1.1

Unknown

S. lycopersicum

II/2

2

IVIA 1805.1 a

Canary Islands (La Palma)

S. tuberosum

II/2

3

IVIA 1861-f

Castile and Leon (Salamanca)

S. tuberosum

II/2

2

Castile and Leon (Salamanca)

S. tuberosum

II/2

5

IVIA 2068.58.a

Canary Islands (La Palma)

Potato roots

II/2

2

IVIA 2068.61.a

Canary Islands (La Palma)

Potato roots

II/2

3

IVIA 2093.3.1

Canary Islands (La Palma)

S. tuberosum

II/2

3

IVIA 2093.5.t1.a

Canary Islands (La Palma)

S. tuberosum

II/2

2

IVIA 2158.1b

Castile and Leon (Salamanca)

S. tuberosum

II/2

2

Castile and Leon (Salamanca)

S. tuberosum

II/2

Castile and Leon (Salamanca)

River water

Castile and Leon (Salamanca)

IVIA 1602.10

h g,h

IVIA 1632.2-af IVIA 1634

b,g

g

i

IVIA 1738.1 IVIA 1760.1.1b

IVIA 1861-af

g

b

IVIA 2158.3 IVIA 2167.1a

h

IVIA 2167.1b IVIA 2167.2b h IVIA 2297.4T2.a

g

B

SP

X9

SP SP

X1

A

X1

C

X2

A

X1

E

B

X2

D

X2

D

2

X3

A

II/2

2

nd

SP

River water

II/2

2

X3

nd

Castile and Leon (Salamanca)

River water

II/2

2

X5

SP

Canary Islands (La Palma)

Soil

II/2

2

B (Continue in the next page)


158

CARUSO ET AL.

Int. Microbiol. Vol. 20, 2017

Table 1 (Cont.). Characteristics of Ralstonia solanacearum strains used in this study. Strain

Geographic origin d

Source

Phylotype/ biovar

Pathogenicity test e

PFGE pattern

AFLP cluster

IVIA 2424 h

Basque country (Álava)

S. tuberosum

II/2

3

X8

SP

IVIA 2528.1.A3

Castile and Leon (Salamanca)

River water

II/2

3

IVIA 2528.3.A3

Castile and Leon (Salamanca)

River water

II/2

2

IVIA 2528.4.A1

Castile and Leon (Salamanca)

River water

II/2

3

IVIA 2528.54.A2

Castile and Leon (Salamanca)

River water

II/2

2

X6

A

IVIA 2533.1.1.A1

Castile and Leon (Salamanca)

River water

II/2

3

IVIA 2533.A2

g,h

Castile and Leon (Salamanca)

River water

II/2

2

IVIA 2533.7.1.A3

Castile and Leon (Salamanca)

River water

II/2

2

IVIA 2550.6.A2

Castile and Leon (Salamanca)

River water

II/2

2

IVIA 2550.10.A3

Castile and Leon (Salamanca)

River water

II/2

2

IVIA 2550.20.A4

Castile and Leon (Salamanca)

River water

II/2

2

IVIA 2550.A5

Castile and Leon (Salamanca)

River water

II/2

2

IVIA 2567.A3.3

Castile and Leon (Salamanca)

River water

II/2

3

IVIA 2581.A1.3

Castile and Leon (Salamanca)

River water

II/2

2

The Netherlands

S. tuberosum

II/2

2

SP

Reference c PD 2762 or IPO 1609

X8

nd

R. solanacearum strains from IVIA, Collection of Plant Pathogenic Bacteria, Instituto Valenciano de Investigaciones Agrarias (IVIA), Moncada (Valencia), Spain. b Afluidal variants of three fluidal Spanish R. solanacearum strains that spontaneously appeared in our laboratory after subculturing. c R. solanacearum reference strain from Collection of Plant Protection Service, Wageningen, Netherlands. d Unless otherwise indicated all the strains were isolated in Spain: the first term indicates the Spanish regions and the second one indicates the provinces where the pathogen was isolated. e Scale of symptom severity: 1= no symptoms, 2= wilted plants within two weeks, 3= wilted plants within three weeks, 4= wilted plants in more than three weeks; 5= atypical symptoms. g Strains analyzed by AFLP in addition to those marked in bold. h Strains analyzed by AFLP in addition to those marked in bold that showed a specific pattern (SP). i Strains afluid originally isolated as fluid. nd: not done. a

Biochemical and physiological characterization.  API 20 NE, API 50 CH, ATB G-5 and API ZYM systems (BioMèrieux, Marcy-l’Etoile, France) were used for the characterization of a selection of 17 R. solanacearum strains (in bold in Table 1). The manufacturer’s instructions were followed for all systems, with the exception of API 50 CH gallery for which the basal medium was replaced by an inorganic one [24], the incubation temperature was 29ºC and the readings were performed after 6 h for API ZYM and 48, 72 and 96 h for the remaining systems. The strains were further characterized by using the BIOLOG-Microlog System, version 4.0 (Biolog, Inc.), as recommended by the manufacturer, except for incubating plates at 29ºC. The metabolic profiles obtained were analysed by the MicroLog 2 program (Biolog, Inc.). Strains were tested twice

in separated assays using reference strain PD 2762 of R. solanacearum as positive control. PCR amplification and sequence analysis.  The hrpB and egl virulence-related genes were amplified based on Castillo and Greenberg [13] with primers indicated in Table 2. PCR products were purified using QIAquick PCR purification kit (Qiagen Inc.). Sequencing was performed on both strands with the same primers used for the amplification (Table 2). Base call disagreements were visually edited. Twenty-one R. solanacearum accessions from phylotype II strains (based on Safni et al. [36]) retrieved from the GeneBank together with sequences from this work were included in the phylogenetic analysis. It was performed with the Molecular Evolutionary Genetics Analysis (MEGA) software v.


DIVERSITY REFLECTS GEOGRAPHICAL ORIGIN OF R. SOLANACEARUM

Int. Microbiol. Vol. 20, 2017

159

Table 2. Primers used for amplifying, phylotyping and sequencing. Primer

Sequence of primer (5’-3’)

Reference

Concentration (µM)

Nmult:21:1F

CGTTGATGAGGCGCGCAATTT

Fegan and Prior 2005

0.24

Nmult:21:2F

CGTTGATGAGGCGCGCAATTT

Fegan and Prior 2005

0.24

Nmult:23:AF

ATTACSAGAGCAATCGAAAGATT

Fegan and Prior 2005

0.72

Nmult:22:InF

ATTGCCAAGACGAGAGAAGTA

Fegan and Prior 2005

0.24

Nmult:22:RR

TCGCTTGACCCTATAACGAGTA

Fegan and Prior 2005

0.24

Rs759

GTCGCCGTCAACTCACTTTCC

Opina et al. 1997

0.16

Rs760

GTCGCCGTCAGCAATGCGGAATCG

Opina et al. 1997

0.16

Endo F

ATGCATGCCGCTGGTCGCCGC

Castillo and Greenberg 2007

0.2

Endo R

GCGTTGCCCGGCACGAACACC

Castillo and Greenberg 2007

0.2

HrpB F

TGCCATGCTGGGAAACATCT

Castillo and Greenberg 2007

0.8

HrpB R

GGGGGCTTCGTTGAACTGC

Castillo and Greenberg 2007

0.8

6.0 [39], using neighbour joining (NJ) and maximum likelihood (ML) methods and the algorithm of Jukes and Cantor and Tamura-Nei [26], respectively, with 1000 bootstrap samplings. Serological relationship.  Four polyclonal antibodies (PAbs) and four monoclonal antibodies (MAbs) (Table 3), and an Indirect-Enzyme Linked Immunosorbent Assay (I-ELISA) were used according to Caruso et al. [11] in Polysorp Nunc microplates. Four wells were used per bacterial strain, assayed in duplicate. PAbs and MAbs work dilutions are indicated in Table 3 and homologous strain of each antisera were included as positive control, except for the IACR-PS-278 antiserum for which reference strain PD 2762 was used. C. indologenes was the negative control. The optical density (OD) of each strain was compared with the I-ELISA value of R. solanacearum homologous strains, or the strain PD 2762 (considered as 100%) and the percentage of Serological Relationship (SR) was calculated according to Alarcόn et al. [1]. Rep-PCR analysis.  The rep-PCR protocol employed was based on Louws et al. [30], using the primers ERIC1R, ERIC2 and BOXA1R. Products of PCR amplification were separated by 1.5% agarose gel electrophoresis on 0.5 TAE buffer for 2 h at 70 V, ethidium bromide stained and visualized under UV light. Each strain was assayed at least twice. AFLP analysis.  The AFLP analysis of 24 selected R. solanacearum Spanish strains (Table 1) was performed similar to Vos et al. [43] by Biopremier, Ltd. (Universidade da Lisboa, Portugal) using an AFLP Core Reagent commercial kit (Gibco BRL). DNA (250 ng) was digested with EcoRI and MseI enzymes (2

h at 20°C) and then ligated to the respective adapters. Selective amplification was done with two primers (EcoRI: GACTGCGTACCAATTC; and MseI–G: GATGAGTCCTGAGTAAG) complementary to the adapters, and the EcoRI and MseI restriction sites, respectively. Differential AFLP bands were used to construct a similarity matrix using the Dice Coefficient. Cluster analysis was performed with the BioNumerics v. 4.01. Analysis of macrorestriction fragments of genomic DNA by PFGE.  The 16 selected Spanish R. solanacearum strains (in bold in Table 1) and the strain PD 2762 were analysed by PFGE after digestion with XbaI restriction enzyme. Genomic DNA was obtained according to Donat et al. [17] and digested with 30 U of XbaI overnight. Restriction fragments were separated by electrophoresis with a CHEF DR III apparatus (BioRad) in 1% (wt/vol) PFGE agarose (Bio-Rad) gels with Hepes

Table 3. PAbs and MAbs used in I-ELISA and theirs work dilutions Antibody

Work dilution

PAbs IVIA-1632.2/WC

1/15000

PAbs IVIA-2762-Glu

1/30000

PAbs IVIA 1546-H

1/5000

IACR-PS-278

1/50000

MAbs IVIA 4D

1/2000

MAbs IVIA 8B

1/1500

MAbs IVIA 9G

1/4000

MAbs IVIA 9F

1/1500


160

Int. Microbiol. Vol. 20, 2017

buffer (3.5 mM HEPES, 3.5 mM sodium acetate, 0.35 mM EDTA [pH 8.3]) at 14ºC and 5 V/cm for 22 h as described before [17]. The molecular weight standard was Lambda DNA ladder (PFGE marker I from Bio-Rad). Each isolate was tested a minimum of two times from two DNA extractions. Results & Discussion All the putative R. solanacearum Spanish strains studied were accurately identified as belonging to this species by phenotypic tests, Co-PCR and phylotype-specific multiplex PCR while 90.9% of them were also identified by ELISA and pathogenicity tests. These discrepancies with different techniques were due to three afluid variants and three afluid R. solanacearum strains (Table 1). The 42 Spanish strains showing typical colonial morphology (fluid) were positive by DASI-ELISA (data not shown) and pathogenic on tomato (Table 1). However, afluid mutants were not recognized by the Mab IVIA-8B (data not shown) and not pathogenic on tomato or produced atypical symptoms (Table 1). Regarding the biochemical characterization of representative R. solanacearum Spanish strains (Table 1), all isolates were sensitive to all antibiotics assayed in the ATB G-5 gallery. In the API ZYM system, six activities were detected in all assayed strains (alkaline and acid phosphatase, estearase, estearase-lipase, leucine arylamidase and naphthol-AS-BI-phosphohydrolase). The Biolog system identified all isolates as R. solanacearum, which were positive for methyl-pyruvate, monomethyl succinate, cis aconitic acid, citric acid, D-galacturonic acid, D-glucuronic acid, β-hydroxybutyric acid, α-keto glutaric acid, quinic acid, D-saccharidic acid, succinic acid, bromo succinic acid, glucuronamide, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, L-proline and γ-aminobutyric acid. The remaining carbon sources were not used or gave variable results. The visualization of the same profile for all the R. solanacearum strains in each one of these phenotypic miniaturized systems suggest their limited value for variability studies. The results with the API 20NE were quite homogeneous, being only positive for nitrate reduction and growth in glucose, gluconate, malate and citrate. In the API 50CH gallery, isolates produced acid within 72-96 h only from galactose, glucose, cellobiose, sucrose and D-fucose, except for some of them that also produced acid from D-fructose and D-mannose. These results agree with previous studies [16,44] showing their value for a preliminary identification of R. solanacearum. A similar limited discriminatory capacity was shown by using PAbs for serological characterization since each of antisera reacted with all tested strains (data not shown). However, the reaction of the strains from the Canary Islands and those from South America was quite similar with PAb IACR-PS-278 (data not shown), suggesting a possible South American origin of strains from La Palma (Canary Islands), that could be due to the uncontrolled exchange of latently infected potato tubers in the past. Neverthe-

CARUSO ET AL.

less, the usefulness of MAb IVIA-8B [11] for specific serological detection of R. solanacearum was confirmed. Phylogenetic analysis of egl and hrpB genes, showed a very low genetic variability among analysed R. solanacearum strains with a NJ phylogenetic tree (congruent with MP tree) dividing them into 2 clusters with low polymorphism for both genes (Fig. 1A and B). Cluster 1 with both egl (Fig. 1A) and hrpB (Fig. 1B) genes gathered all Spanish strains, showing a high level of similarity with the majority of the R. solanacearum (phylotype II) strains from GenBank from different parts of the world. These findings confirm previous works reporting [9,13,33,38] that partial sequencing analysis of egl and hrpB genes is unable to detect differences among phylotype II (b2r3) strains. Attempts to differentiate R. solanacearum strains belonging to previous b2r3 by rep-PCR demonstrated that this is a highly homogenous biovar [37,41]. Nevertheless, these same authors discriminated two groups of biovar 2 strains from different origins. In this study, a high degree of homogeneity was observed within the Spanish strains, with only one BOX and one ERICPCR pattern (about 25 and 15 DNA bands, respectively) (data not shown), also shared by the Dutch strain PD 2762. AFLP using the primers combination reported by van der Wolf et al. [41] was suitable for analyzing the diversity of R. solanacearum European strains [3,12,14,15,33,38]. In this work, the Spanish strains generated, in several cases, AFLP fingerprints correlated with the geographical origin, regardless of the source of isolation (Fig. 2). Cluster A was formed by five strains three of which (IVIA 2528.54.A2, IVIA 2158.3, and IVIA 1634), that were isolated from the same region and province (Castile and Leon / Salamanca), while IVIA 1635 was isolated from the same region but different province (Castile and Leon / Soria) and the fifth one was of unknown origin. All the strains grouped in this cluster showed an identical pattern of 34 bands. Cluster B included three strains (IVIA 1496.1a, IVIA 1760.1.1b and IVIA 2297.4t.2a) all from La Palma (Canary Islands). These strains showed some slight differences among them. Strains IVIA 1760.1.1b and IVIA 1496.1a, both isolated from potatoes, showed a pattern of 33 bands but differed in the size of one band. Strain IVIA 2297.4t.2a, isolated from soil, showed one additional band of 122 bp that was not present in the other strains grouped in this cluster. Cluster C grouped two strains (IVIA 1672 and 1632.2-f and the afluid variant 1632.2-af) isolated from potato from the same region but different provinces (Castile and Leon – Burgos and Soria), which presented a pattern of 35 bands. Cluster D grouped two strains IVIA 2093.3.1 and IVIA 2068.58a, both isolated from potatoes in the Canary Islands (La Palma). Cluster E was also formed by two strains (IVIA 1620.1.1 and IVIA 1692.a), both isolated from potatoes in different provinces of the same region (Castile and Leon – Soria and Segovia). Strains IVIA 1602.10 and IVIA 1602.1, both isolated from potatoes in the Canary Islands (La Palma), presented a profile quite different from the rest of tested strains. Strain IVIA 1602.10 shared


DIVERSITY REFLECTS GEOGRAPHICAL ORIGIN OF R. SOLANACEARUM

37 bands with strain IVIA 1602.1 but showed one additional band of 579 bp. The remaining seven strains isolated from potatoes (IVIA 1532.4, IVIA 2424 and IVIA 1546-f with its variant IVIA 1546af) and river water (IVIA 2167.1a, IVIA 2167.2b and IVIA 2533.A2) each one constituted a group with a specific pattern (Fig. 4 and indicated as SP in Table 1). In the 5 clusters obtained after the analysis of AFLP profiles by UPGMA with the Dice coefficient (Fig. 2), some strains from Castile and Leon (clusters A, C and E) and some from the Canary Islands (clusters B and D) were grouped separated by their geographical origin, and in some cases also by the source. Interestingly, in cluster A there were strains isolated from potatoes as well as from river water a few years later from the same area (Fig. 2, Table 1), suggesting prolonged survival of the pathogen in natural water, which agrees with its the long-term survival and pathogenicity in water microcosms [5]. Similarly, in cluster B there were strains isolated from potatoes and one found in soil several years later (Fig. 2, Table 1), which points to long-term survival also in soil, in accordance to van Elsas et al. [42]. In clusters C and E two strains isolated from potato in Castile and Leon were grouped while in cluster D strains isolated from potatoes in the Canary Islands were grouped (Fig. 2, Table 1). The remaining strains isolated from potatoes and river water each one constituted a group with a specific pattern (Fig. 2 and indicated as SP in Table 1). Taken

Int. Microbiol. Vol. 20, 2017

161

as a whole AFLP results, we assume the occurrence of several introductions of R. solanacearum strains in Spain. The strains isolated from the mainland could have been introduced more recently from other European countries with imported potatoes. Strains from South America or Africa (Egypt) could have also been introduced in other European countries [41], and then from there they may have been imported with seeds or ware potatoes into Spain. However, the diversity observed by AFLP was relatively small according to Poussier et al. [34]. Van der Wolf et al. [41] showed that the phylotype II strains from South America were considerably more variable than those from other countries, probably due to the Andean origin of the potato and the disease [37], in contrast to Spain, where the pathogen has only been reported since relatively recent years. PFGE has been already demonstrated to be very useful for evaluating the genetic diversity of the bacterial wilt pathogen, including European strains [37,38,41]. In general, Spanish strains showed relatively similar patterns with XbaI (Fig. 3), although this enzyme yield at least ten distinct PFGE patterns (Table 1 and Fig. 3). The dominant XbaI profile comprised four strains isolated from potatoes in Castile and Leon, with 13 DNA fragments (pattern X1). Three strains from different sources, two of them from La Palma (Canary Islands), shared X1 pattern but with an additional fragment of approximately 100 kb (pattern X2). Two strains isolated in Salamanca (Castile and Leon) from different sources (potato and water) shared

Fig. 1. NJ phylogenetic tree based on the comparison of partial egl (A) and hrpB (B) gene sequences from R. solanacearum ‘Spanish strains’ and 21 R. solanacearum accession phylotype II (based on the taxonomic revision of Safni et al. [36] retrieved from the GeneBank. Values at the branches indicate percentage bootstrap support for 1000 resamplings. Due to the high degree of similarity among all Spanish sequences derived from different sources, we indicated the Spanish-type sequence representative for egl hrpB genes with the term ‘Spanish strains’.


162

Int. Microbiol. Vol. 20, 2017

CARUSO ET AL.

Fig. 2. Dendrogram showing the relationship between R. solanacearum Spanish strains based on AFLP analysis using EcoRI/MseI enzymes, and the pair of primers EcoRI/MseI-G. Correlation coefficients were calculated and cluster analysis was achieved by UPGMA.

the pattern X2 except for missing one fragment of about 72 kb (pattern X3). The rest of the patterns were different for each of the remaining strains and were named X4 to X10 (Table 1) but shared about ten DNA fragments with the dominant profile. Then, in some cases, the intraspecific diversity detected was related to the Spanish region. It is interesting that one Spanish strain IVIA 2424 isolated from potatoes in Ă lava (Northeastern Spain) exhibited the same pattern (X8) as the reference strain from The Netherlands (data not shown) also isolated from potatoes but some years before. Moreover, this pattern and another one (X10) from a potato strain from Burgos (Northern Spain) are very similar to two profiles previously described in other R. solanaceraum biovar 2 Dutch strains [38,41]. Other patterns were new for the European strains, one of them (X2) observed in one strain from potatoes isolated in La Palma (Canary Islands) was very similar to a pattern previously reported for a R. solanaceraum strain from Kenya [37]. Our main conclusion is that some of the Spanish foci of bacterial wilt, at least in the North of Spain, could be related with the import of contaminated potatoes from other European countries where the pathogen was detected earlier than in Spain. The R. solanacearum groups obtained after the PFGE analysis were different to those obtained by AFLP, but these discrepancies could be due to the different molecular basis of the two techniques. However, both PFGE and AFLP were able to discriminate several clonal lines among Spanish strains of R. solanacearum and some were related to the geographical origin of strains. Our results support the hypothesis that several clones

Fig. 3. PFGE banding patterns of Spanish R. solanacearum strains digested with XbaI: patterns of 14 Spanish isolates. Lanes: A, IVIA 1532.4 (X7); B, IVIA 1546f (X10); C, IVIA1602.1 (X9); D, IVIA 1620.1.1 (X4); E, IVIA 1632.2-f (X1); F, IVIA 1635 (X1); G, IVIA 1672 (X1); H, IVIA 1674 (X2); I, IVIA 1692.a (X1); J, IVIA 2093.3.1 (X2); K, IVIA 2158.3 (X3); L, IVIA 2167.2b (X5); M, IVIA 2424 (X8); N, IVIA 2528.54.A2 (X6) and O, PFGE marker I from Bio-Rad.

of the pathogen have been introduced into Spain as previously suggested by van der Wolf et al. [41] for other European strains. Diversity results obtained in this work offer new insights into the biogeography of this quarantine organism and its possible sources and reservoirs in Spain and probably in other Mediter-


DIVERSITY REFLECTS GEOGRAPHICAL ORIGIN OF R. SOLANACEARUM

ranean countries and improves the knowledge on its ecology and epidemiology that are the bases for designing more effective preventative measures and eradication strategies. Acknowledgements.  The authors thank the Spanish Ministry of Agriculture and Spanish Laboratories of Diagnostic from several regions for sending Spanish samples and/or strains, the EUPHRESCO project RALSTO- ID and RTA201500087-C02 project (Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria INIA, Ministerio de Economía, Industria y Competitividad, Spain), J. D. van Elsas for sending the Dutch reference strain and J.M. van der Wolf and J. Smith for sending PFGE pictures. We also thank B. Vicedo, D.R. Arahal and M. Cambra for critical reading of the manuscript. P. Caruso thanks the Instituto Valenciano de Investigaciones Agrarias for a PhD grant, E. G. Biosca the Ministerio de Ciencia y Tecnología of Spain for a contract within the Ramón y Cajal program, E. Bertolini the Consellería de Cultura, Educación y Deporte of the Generalidad Valenciana for a fellowship grant and E. Marco-Noales the Ministerio de Educación y Ciencia of Spain for a contract from within the INIA/CC.AA programme. Competing interests.  None declared. Authors’contribution.  Paola Caruso and Elena G. Biosca contributed equally to this work and are regarded as joint first authors.

References 1.

2.

3.

4. 5.

6. 7.

8.

9.

Alarcón B, Gorris MT, Cambra M, López MM (1995) Serological characterization of potato isolates of Erwinia carotovora subsp. atroseptica and subsp. carotovora using polyclonal and monoclonal antibodies. J Appl Bacteriol 79: 592-602 Alivizatos AS, Glynos PE, Karafla C, Ziaziari C, Stathopoulos F (2006) Host plants of Ralstonia solanacearum in the Kalavryta area. Abtracts of presentations given at the 11th Hellenic Phytopathological Congress Preveza, GR, 2002-04-01 Phytopathologia Mediterranea 45: 74 Álvarez B, Biosca EG, López MM (2010) On the life of Ralstonia solanacearum, a destructive bacterial plant pathogen. In: Mendez Vilas A (ed), Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology. Singapur: World Scientific Publishing, pp. 267-279 Álvarez B, López MM, Biosca EG (2007) Influence of native microbiota on survival of Ralstonia solanacearum phylotype II in river water microcosms. Appl Environ Microbiol 73: 7210-7217 Álvarez B, López MM, Biosca EG (2008) Survival strategies and pathogenicity of Ralstonia solanacearum phylotype II subjected to prolonged starvation in environmental water microcosms. Microbiology 154: 35903598 Anonymous: Council Directive 98/57/EC of 20 July (1998) on the control of Ralstonia solanacearum (Smith) Yabuuchi et al. Off J Eur Communities L235/1, 21.08.98. Anonymous: Council Directive 2000/29/EC of 8 May (2000) on protective measures against the introduction into the community of organisms harmful to plants or plant products and against their spread within the community. Off J Eur Communities L169: 1-112 Anonymous: Commission Directive 2006/63/EC of 14 July (2006): amending annexes II to VII to Council Directive 98/57/EC on the control of Ralstonia solanacearum (Smith) Yabuuchi et al. Off J Eur Communities L206: 36-106. Abdurahman A, Griffinb D, Elphinstone J, Struika PC, Schulzd S, Schulte-Geldermannef E, Sharma K (2017) Molecular characterization of Ralstonia solanacearum strains from Ethiopia and tracing potential source of bacterial wilt disease outbreak in seed potatoes. Plant Pathol 66: 826-834

Int. Microbiol. Vol. 20, 2017

163

10. Caruso P, Bertolini E, Cambra M, López MM (2003) A new and sensitive Co-operational Polymerase Chain Reaction (Co-PCR) for a rapid detection of Ralstonia solanacearum in water. J Microbiol Methods 55: 257-272 11. Caruso P, Gorris MT, Cambra M, Palomo JL, Collar J, López MM (2002) Enrichment-DASI-ELISA for sensitive detection of Ralstonia solanacearum in asymptomatic potato tubers using a specific monoclonal antibody. Appl Environ Microbiol 68: 3634-3638 12. Caruso P, Palomo JL, Bertolini E, Álvarez B, López MM, Biosca EG (2005) Seasonal variation of Ralstonia solanacearum biovar 2 populations in a Spanish river: recovery of stressed cells at low temperature. Appl Environ Microbiol 71: 140-148 13. Castillo JA, Greenberg JT (2007) Evolutionary dynamics of Ralstonia solanacearum. Appl Environ Microbiol 73: 1225–1238 14. Cellier G, Prior P (2010) Deciphering phenotypic diversity of Ralstonia solanacearum strains pathogenic to potato. Phytopathology 1001: 250–261 15. Cruz L, Eloy M, Quirino F, Oliveira H, Tenreiro R (2012) Molecular epidemiology of Ralstonia solanacearum strains from plants and environmental sources in Portugal. Eur J Plant Pathol 133: 687-706 16. Digat B, Gardan L (1987) Caractérisation, variabilité et sélection des souches bénéfiques de Pseudomonas fluorescens et P. putida. EPPO Bull 17: 559–68 17. Donat V, Biosca EG, Peñalver J, Lόpez MM (2007) Exploring diversity among Spanish strains of Erwinia amylovora and possible infection sources. J Appl Microbiol 103: 1639-1649 18. Elphinstone JG, Hennessy J, Wilson JK, Stead DE (1996) Sensitivity of different methods for the detection of Ralstonia solanacearum in potato tuber extracts. EPPO Bull 26: 663-678 19. Elphinstone JG (2005) The current bacterial wilt situation: a global overview. In: Allen Prior P Hayward C (eds). Bacterial Wilt Disease and the Ralstonia solanacearum species complex. St. Paul, USA: Aps Press, pp. 9-28 20. EPPO (2017) PQR - EPPO database on quarantine pests (available online). http://www.eppo.int 21. Fegan M, Prior P (2005) How complex is the Ralstonia solanacearum species complex? In: Allen C, Prior P, Hayward C (eds). Bacterial wilt disease and the Ralstonia solanacearum species complex. St. Paul, USA: Aps Press, pp. 449-462 22. Gillings M, Fahy P (1994) Genomic fingerprinting towards a unified view of the Pseudomonas solanacearum species complex. In: Hayward AC, Hartman GL (eds). Bacterial Wilt: the disease and its causative agent, Pseudomonas solanacearum. Wallingford, UK: C.A.B. International, pp. 95-112 23. Hayward AC (1964) Characteristics of Pseudomonas solanacearum. J Appl Bacteriol 27: 265-277 24. Hayward AC, El-Nashaar HM, De Lindo L, Nydegger U (1989) The use of microtiter plates in the phenotypic characterization of phytopathogenic Pseudomonads. Proc. 7th. Int. Conf. Plant Pathog. Bact Budapest, Hungary pp. 593-598 25. Hayward AC, El-Nashaar HM, Nydegger U, Lindo L (1990) Variation in nitrate metabolism in biovars of Pseudomonas solanacearum. J Appl Bacteriol 69: 269-280 26. Jukes TH, Cantor CR (1969) Evolution of protein molecules. In: Munro HN (ed). Mammalian Protein Metabolism. New York: Academic Press, pp. 121-132 27. Lelliot RA, Stead DE (1987) Methods for the diagnosis of bacterial diseases of plants. In: Preece TF (ed). Methods in plant pathology Vol. 2. Oxford: Blackwell Scientific Publications, p. 216 28. Lewis Ivey ML, Mcspadden Gardener BB, Opina N, Miller SA (2007) Diversity of Ralstonia solanacearum infecting eggplant in the Philippines. Phytopathology 97: 1467–1475 29. Loreti S, Fiori M, De Simone D, Falchi G, Gallelli A, Schiaffino A, Ena S (2008) Bacterial wilt, caused by Ralstonia solanacearum, on tomato in Italy. Plant Pathol 57: 368


164

Int. Microbiol. Vol. 20, 2017

30. Louws FJ, Fulbright DW, Stephens CT, De Bruijn FJ (1994) Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR. Appl Environ Microb 60: 2286-2295 31. Olson K (1976) Experiences of brown rot caused by Pseudomonas solanacearum (Smith) Smith in Sweden. EPPO Bull 6: 199-207 32. Palomo JL, Caruso P, Gorris MT, López MM, García-Benavides P (2000) Comparación de métodos de detección de Ralstonia solanacearum en aguas superficiales. X Congreso de la Sociedad Española de Fitopatología. p. 120 33. Parkinson N, Bryant R, Bew J, Conyers C, Stones R, Alcock M, Elphinstone J (2013) Application of variable-number tandem-repeat typing to discriminate Ralstonia solanacearum strains associated with English watercourses and disease outbreaks. Appl Environ Microbiol 19: 60166022 34. Poussier S, Trigalet-Demery D, Vandewalle P, Goffinet B, Luisetti J, Trigalet A (2000) Genetic diversity of Ralstonia solanacearum as assessed by PCR-RFLP of the hrp gene region, AFLP and 16s rRNA sequence analysis, and identification of an African subdivision. Microbiology 146: 1679-1692 35. Prior P, Fegan M (2005) Diversity and molecular detection of Ralstonia solanacearum race 2 strains by multiplex PCR. In: Allen C, Prior P, Hayward C (eds). Bacterial Wilt Disease and the Ralstonia solanacearum species complex. St. Paul, USA: Aps Press, pp. 405-414 36. Safni I, Cleenwerck I, De Vos P, Fegan M, Sly L, Kappler U (2014) Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. Syzygii strains as Ralstonia syzygii subsp. syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., Banana Blood Disease Bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov. Int J Syst Evol Micr 64: 3087–3103

CARUSO ET AL. 37. Smith JJ, Offord, LC, Holderness M, Saddler GS (1995) Genetic diversity of Burkholderia solanacearum (Synonym Pseudomonas solanacearum) race 3 in Kenia. Appl Environ Microbiol 61: 4263-4268 38. Stevens P, van Elsas JD (2010) Genetic and phenotypic diversity of Ralstonia solanacearum biovar 2 strains obtained from Dutch waterways. Anton Leeuw 97: 171–188 39. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) Mega6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30: 2725-2729 40. Timms-Wilson TM, Bryant K, Bailey MJ (2001) Strain characterization and 16s-23s probe development for differentiating geographically dispersed isolates of the phytopathogen Ralstonia solanacearum. Environ Microbiol 3: 785-797 41. Van Der Wolf JM, Bonants PJM, Smith JJ, Hagenaar M, Nijhuis E, Van Beckhoven JRC M, Saddler GS, Trigalet A et al.(1998) Genetic diversity of Ralstonia solanacearum race 3 in Western Europe determined by AFLP, RC-PFGE and Rep-PCR. In: Prior P, Allen C, Elphinstone J (eds). Bacterial Wilt Disease. Molecular and ecological aspects. Heidelberg, Germany: Springer Verlag Editions, pp. 146-152 42. Van Elsas JD, Kastelein P, van Bekkum P, van der Wolf JM, de Vries PM, van Overbeek LS (2000) Survival of Ralstonia solanacearum biovar 2, the causative agent of Potato Brown Rot, in field and microcosm soils in temperate climates. Phytopathology 90: 1358–1366 43. Vos P, Hogers R, Bleeker M, Reijans M, Van de Lee T, Hornes M, Frijters A, Pot J et al.(1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 21: 4407-4414 44. Wiedmann M, Weilmeier D, Dineen SS, Ralyea R, Boor KJ (2000) Molecular and phenotypic characterization of Pseudomonas spp. isolated from milk. Appl Environ Microbiol 66: 2085–2095. 45. Yabuuchi E, Kosako Y, Yano I, Hotta H, Nishiuchi Y (1995) Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. nov. proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) comb nov.: Ralstonia solanacearum (Smith 1896) comb. nov. and Ralstonia eutropha (Davis 1969) comb. nov. Microbiol Immunol 39: 897-904.


RESEARCH ARTICLE International Microbiology 20(4):165-169 (2017) doi:10.2436/20.1501.01.299. ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Transmission and survival of carbapenemresistant Acinetobacter baumannii outside hospital setting Ana Kovacic1, Martina Seruga Music2, Svjetlana Dekic2, Marija Tonkic3, Anita Novak3, Zana Rubic3, Jasna Hrenovic2, Ivana Goic-Barisic3* Institute of Public Health of Split and Dalmatia Country, Split, Croatia Department of Biology, Faculty of Science, University of Zagreb, Zagreb, Croatia 3 University Hospital of Split and School of Medicine University of Split, Split, Croatia 1

2

Received 11 July 2017 · Accepted 20 November 2017 Summary.  Acinetobacter baumannii origin and its epidemiology is under a great concern worldwide since this microorganism has become a leading nosocomial pathogen of the 21th century among the “ESKAPE“ group of microorganisms. The aim of the study was to monitor and explore the epidemiology of this important hospital pathogen in the second largest clinical university hospital in Croatia. The presence of A. baumannii in hospital wastewater, as a route for possible transmission outside of the hospital setting, as well as its survival in environmental conditions including seawater, was investigated. During the examination period, ten both carbapenem and multidrug-resistant isolates of A. baumannii were recovered from hospital wastewater and compared to the clinical isolates originating from the same monitoring period. Multiplex PCR confirmed that four wastewater isolates harboured blaOXA-23-like, while five wastewater isolates harboured blaOXA-40-like genes sharing 100% sequence identity with blaOXA-72 sequence described in the same hospital in 2009, confirming the presence of an endemic cluster. Survival of A. baumannii in natural seawater was examined during 50 days of monitoring and to the best of our knowledge, was performed for the first time. Keywords:  Acinetobacter baumannii · hospital wastewater · transmission · seawater.

Introduction Among the “ESKAPE” pathogens, Acinetobacter baumannii is the most frequently encountered microorganism in the hospital setting causing serious infections, especially in the intensive care units. As a leading nosocomial pathogen of the 21st century, having the ability to acquire resistance to almost all antimicrobial agents, origin and epidemiology of this emerging hospital pathogen is under a great concern worldwide [15].

*Corresponding author: Ivana Goic-Barisic, MD, PhD University Hospital of Split and School of Medicine University of Split, Spinciceva 1, 21000 Split, Croatia Tel:+38521 556196; Fax:+38521 547901; e-mail: igoic@kbsplit.hr

A. baumannii can cause various infections like nosocomial pneumonia, bacteraemia, meningitis, skin and soft tissue, and urinary tract infections. The incidence of serious infections (blood steam infections and ventilator-associated pneumonia) caused by multidrug-resistant A. baumannii ranges between 47% and 93%, with mortality rates between 30% and 70% [2]. University Hospital of Split (UHS) is the leading medical centre with 1400 beds in the Southern Croatia and is situated on two locations (500 m distance) in the middle of Adriatic coast. Hospital wastewaters are discharged without any pre-treatment into the combined urban sewage system. The urban sewage undergoes the mechanical treatment through the coarse screens and is afterwards discharged into the Adriatic Sea. Since 2009, UHS has a growing problem in the number of infections caused by carbapenem-resistant isolates of A. baumannii, which is now almost endemically present in most of the intensive care units inside the hospital [7,8]. The coop-


166

KOVACIC ET AL.

Int. Microbiol. Vol. 20, 2017

eration with Croatian Committee for Antibiotic Resistance Surveillance (CARS) of the Croatian Academy of Medical Sciences (CAMS) for the monitoring of sensitivity and resistance of clinical isolates of A. baumannii was established in the last decade. According to recently published data, during the last three months in 2015, a total of 120 clinical isolates of A. baumannii were isolated from hospitalized patients in UHS, mainly from respiratory samples in intensive care units [16]. In the last decade, the resistance rates of A. baumannii to carbapenems in UHS have increased significantly, from 10 % in the 2006 to almost 97% in 2016 [16]. Besides hospital-acquired infections, community-acquired A. baumannii infections, particularly pneumonia in tropical regions of the world, have been recently described [4,1]. Therefore, the aim of the study was to monitor and explore the epidemiology of this important hospital pathogen in Croatia. The presence of A. baumannii in hospital wastewater as a route for possible transmission outside of the hospital setting, as well as survival of this pathogen outside the hospital environment was investigated. Material and methods Isolation and characterization of A. baumannii isolates.  Samples of wastewater were collected from the University Hospital of Split (UHS), situated at two locations (A and B) in the town of Split. Wastewater was sampled for five times, in the period from October 2014 until April 2015, on both locations. The samples were taken in 500 ml sterile bottles and processed within two hours. They were diluted in sterile peptone water and filtered through membrane filters of pore size 0.45 µm. The filters were placed on CHROMagar Acinetobacter supplemented with CR102 (CHROMagar) and 15 mg/L of cefsulodin sodium salt hydrate (Sigma-Aldrich) [13]. The plates were incubated at 42°C/48 h. Presumptive colonies of A. baumannii were recultivated (42°C/24 h) on the same selective plates and afterwards on nutrient agar. Identification of A. baumannii was performed by routine bacteriological techniques and confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry - MALDI-TOF MS (software version 3.0, Microflex LT, Bruker Daltonics) on cell extracts [18]. Antibiotic susceptibility was assessed by disk diffusion method. The MICs values were confirmed by Vitek2 system or gradient E-tests (AB Biodisk), and interpreted according to the EUCAST criteria, except for ampicillin/sulbactam and tigecycline [3,5]. Molecular characterization of A. baumannii isolates.  The relatedness of isolated A. baumannii to clinical isolates was assessed by using pulsed-field gel electrophoresis (PFGE). The PFGE results of A. baumannii isolates recovered from the wastewater were compared to four clinical isolates collected from routine surveillance cultures and respiratory samples (tracheal aspirates) of patients in Intensive Care Units (ICUs) of

UHS during October 2015 and April 2016. PFGE analysis was performed using CHEF-DRII/III system (Bio-Rad) with ApaI (New England BioLabs) and Salmonella serotype Braenderup strain H9812 as marker. The images of gel-electrophoresed restriction products were processed using Gel-Doc 1000 system (Bio-Rad) and Compar software. PFGE profiles were analysed and compared using Molecular Analyst Software for Fingerprinting (Bio-Rad). Dendogram was created with the unweighted pair group method with arithmetic averages analysis (UPGMA) using Dice similarity coefficient with optimisation and a position tolerance of 1.5%. The isolates were classified into clusters based on their genetic similarity (cut-off of ≥ 90%). The presence of genes of blaOXA lineage, which encode OXA-type carbapenemases, was further confirmed in selected A. baumannii strains, based on PFGE patterns and antibiotic susceptibility profiles. Multiplex PCR was used to amplify blaOXA-51-like, blaOXA-40-like, blaOXAand blaOXA-58-likegenes, according to Woodford et al [22]. In 23-like the same PCR reaction, primers for blaOXA-143-like were added, according to Higgins [12]. All obtained amplicons of blaOXA genes were sequenced on both strands (commercial service Macrogen Europe, the Netherlands). Raw nucleotide sequences were assembly and manual editing using SequencherTM 4.7 software (http://www.genecodes.com/). Together with available sequences retrieved from the Genbank, blaOXA sequences obtained in the scope of this study were aligned with ClustalX 2.0 [19]. Subsequent phylogenetic analyses were performed by using MEGA 7 software [14], with neighbour-joining method and number of differences model. In order to estimate the stability of nodes and to support the inferred clades, bootstrap analyses of 500 replicates were performed. Survival of Acinetobacter baumannii in seawater.  Survival of A. baumannii in natural seawater was followed for three isolates (2, 8, and 16). Overnight bacterial cultures were suspended in 100 mL of autoclaved natural seawater. Bacterial suspensions were incubated at 20°C with 170 rpm during 50 days of monitoring. After specified period of time, bottles were shaken, sub-samples were diluted in sterile saline solution, inoculated onto Nutrient agar plates, and bacterial colonies were counted after incubation at 42°C/24h. Number of viable bacteria was determined as colony forming units (CFU), logarithmically transformed, and expressed as log CFU per 1 mL of seawater. Experiments were performed in technical triplicate with mean values presented. Survival of bacteria was calculated as ((logCFU/mLtime : logCFU/mLstart)*100), where log CFU/mLtime represents the number of bacteria on a day of measurement and log CFU/mLstart the initial number of bacteria. Results During the examination period, 10 isolates of A. baumannii were recovered from hospital wastewater and 4 from hospital-


TRANSMISSION AND SURVIVAL OF A. BAUMANNII OUTSIDE HOSPITALS

ized patients. MALDI-TOF MS analysis of all isolates gave the reliable score values above 2.0, identifying them as A. baumannii. All 14 isolates displayed a high level of resistance (Table 1) to both carbapenems (imipenem and meropenem) with MICs >64 mg/L, and susceptibility to colistin (MIC<0.5 mg/L) and some of them to ampicillin/sulbactam (MIC 8-16 mg/L). The resistance phenotype was very similar for all isolates (resistant to carbapenems and the majority of tested antibiotics). According to the PFGE analysis (Fig. 1) 9 isolates were grouped in 4 clusters with a similarity of at least 95% and they were selected for further molecular characterization. We also chose strain 2A for further analysis since it turned out that it was not in the same cluster with isolate 2. Four clinical isolates (c.i.13-16) from respiratory samples (BAL and tracheal aspirates) from patients in intensive care units of UHS were molecular analysed by PFGE

Int. Microbiol. Vol. 20, 2017

167

and multiplex PCR together with wastewater isolates. Phenotypic and genotyping characteristics of carbapenem-resistant isolates of A. baumannii recovered from hospital wastewater and clinical isolates from patients hospitalised in the University Hospital of Split are presented in Table1. Multiplex PCR confirmed that besides from the fact that all isolates were positive for OXA-51-like genes, wastewater isolates 2, 4, 7 and 9 harboured blaOXA-23-like , while wastewater isolates 3, 6, 8, 11 and 12 harboured blaOXA-40-like genes (Fig. 2). Clinical isolates 13-15 harboured blaOXA-40-like and clinical isolate 16 blaOXAgene. Phylogenetic analyses of all ampliďŹ ed and sequenced 23-like blaOXA fragments clearly supported the afďŹ liation of detected blaOXA genes to two different clusters identical as those from clinical isolates (c.i.13-16) and available in GenBank (Fig. 3). Clinical (13-15) and wastewater isolates 3, 6, 8, 11 and 12 shared 100%

Table 1. Phenotypic and genotyping characteristics of carbapenem-resistant isolates of A. baumannii recovered from hospital wastewater and clinical isolates from patients hospitalised in the University Hospital of Split Number of Isolate (all)

Resistance phenotipe

Genotype

Sampling

2,4,7,9 c.i.16

AB, IP, MP, AK, TB, GM, CP, LV, SXT

bla OXA-51, bla OXA-23

OCT-15 JAN-16

3,6,8,11,12 c.i. 13,14,15

IP, MP, AK, GN, CP, LV, SXT

bla OXA-51, bla OXA-40

OCT-15, FEB-16 DEC-15, MAR-16

AB, ampicillin-sulbactam; AK, amikacin; IP, imipenem; MP, meropenem; GM, gentamicin; TB, tobramicin; CP, ciprofloxacin; LV, levofloxacin; SXT, trimethoprim/sulfamethoxazole; JAN, January; FEB, February; MAR, March; OCT, October; DEC, December; 15, 2015; 16, 2016; c.i. clinical isolate

Fig. 1. Results of genotyping by pulsed-field gel electrophoresis (PFGE) from wastewater isolates (1-12) and clinical isolates (13-16) of Acinetobacter baumannii. The majority of isolates (9/10) were grouped in 4 clusters with a similarity of at least 95%.

Fig. 2. Multiplex PCR results from wastewater isolates (2-12) and clinical isolates (13-16) with positive controls (K1-3). In wastewater isolate 1 only bla OXA-51-like gen was detected.

Fig. 3. Neighbour-joining phylogenetic tree inferred on blaOXA genes fragments amplified from wastewater isolates (2-12) and clinical isolates (13-16) of Acinetobacter baumannii. GenBank accession numbers are given next to the name of each strain.


168

KOVACIC ET AL.

INT. MICROBIOL. Vol. 20, 2017

sequence identity with blaOXA-72 sequence described in the same hospital in 2009, confirming the presence of an endemic cluster. Three isolates of A. baumannii survived in seawater during 50 days of monitoring (Fig.4). No multiplication of bacteria was observed as compared to initial numbers. After 7 days of contact, a decrease in bacterial numbers was observed up to 28 days, but there was no further sharp decrease up to 50 days of contact. After 50 days in seawater, survival of A. baumannii isolates ranged from 55-67%, corresponding to 3.8-4.5 log CFU/mL. Discussion The epidemiology of emerging hospital pathogen A. baumannii still remains unclear even though numerous studies have investigated nosocomial outbreaks during the last two decades [1, 20]. Unfortunately together with unclear epidemiology, the overuse of carbapenems has rapidly resulted in the worldwide dissemination of carbapenem resistant A. baumannii strain, including Croatia. In the last decade, drastic increase in resistance rate of carbapenem-resistant A. baumannii isolates is not isolated problem in only one hospital, but is already a leading national health problem requiring wider attention. Once endemic in the hospital setting, A. baumannii has become extremely difficult to eradicate [20]. Carbapenem resistant A. baumannii carrying OXA-72 oxacillinase spread in the UHS after transfer of a patient colonized by international clonal lineage II (IC II) strain from General Hospital Mostar (Bosnia and Herzegovina) to the UHS at the beginning of 2009 [8, 9]. Clinical isolates 13-15 in this study shared 100% sequence identity with the blaOXA-72 sequence described in the same hospital in 2009, confirming the presence of an endemic cluster. Since OXA-72 within OXA-40-like group was described as dominant

Fig. 4. Survival of A. baumannii wastewater isolates 2 and 8, and clinical isolate16 in seawater during 50 days of monitoring. Initial log CFU/mL: 6.7±0.1 isolate 2; 7.3±0.1 isolate 8; 6.8±0.1 isolate 16. Survival of bacteria was calculated as ((logCFU/mLtime : logCFU/mLstart)*100), where log CFU/mLtime is number of bacteria on day of measurement and log CFU/mLstart is initial number of bacteria. Mean values and standard deviations are presented.

mechanism of resistance in clinical isolates of A. baumannii in 2009 inside UHS, this investigation also revealed oxacillinase belonging to OXA-23-like group (c.i.16) which contributed to the resistance rate to carbapenems of 90% in the last two years in UHS. Carbapenem resistance in A. baumannii has rapidly spread throughout Croatia since 2008 and high rates of non-susceptibility to imipenem (87%) and meropenem (88%) are unfortunately not unexpected [16]. The mechanism of carbapenem resistance in other hospitals in Croatia was similar as previously described in UHS from 2002 to 2008, and during 2009 [21]. The observation of multiresistant A. baumannii in hospital wastewater has also been previously reported in Brazil, China and Zagreb in Croatia [6, 22, 23]. In Croatia, carbapenem resistant isolates of A. baumannii were detected in municipal wastewater treatment plant in capital city of Zagreb during 2014 [13]. This finding has prompted several more researches including this one, focused on transmission of carbapenem resistant clinical isolates through the hospital wastewater into natural environment [10, 17]. In addition, the first pan drug-resistant environmental isolate of A. baumannii was recovered from the effluent of secondary treated municipal wastewater of the capital city of Zagreb in Croatia in 2015, harbouring plasmid-located bla OXA-23-like gene [11]. This knowledge reveals municipal wastewater as a potential epidemiological reservoir of carbapenem resistant genes. The situation with wastewaters of UHS is even more complex since they are being released to the Adriatic Sea, without any pre-treatment. Although three isolates of A. baumannii selected in this study did not multiply in seawater, they successfully survived in vitro investigation which lasted 50 days. The absence of bacterial multiplication could be explained by low nutrient concentration in natural seawater. In case that MDR A. baumannii reaches the seawater, it could be disseminated by sea current through the large area of the seawater ecosystem, which poses a serious public health concern. In Croatia, but also in great number of European countries, it is not legally required to treat hospital wastewater before discharging into the sewage system. Survival in the environmental conditions, including seawater especially in the warm period of the year up to 50 days, may also pose a potential epidemiological reservoir of carbapenem resistant genes. To the best of our knowledge, this is the first description of transmission of carbapenem-resistant A. baumannii trough the hospital wastewater in this geographic area and monitoring of its survival in natural seawater. Our results suggest that the nosocomial pathogen A. baumannii is well adapted to different environments, not only to the hospital setting. Acknowledgements. This work has been supported by the Croatian Science Foundation (project no. IP-2014-09-5656). We thank to S. Kazazic, Rudjer Boskovic Institute for MALDI-TOF MS identification. Some results from this study were partially presented as an e-poster presentation 2254 at the 27th European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) Vienna 2017. Competing interests. None declared.


TRANSMISSION AND SURVIVAL OF A. BAUMANNII OUTSIDE HOSPITALS

References Antunes LC, Visca P, Towner KJ (2014) Acinetobacter baumannii: evolution of a global pathogen. Pathog Dis 71: 292-301 2. Clark NM, Zhanel GG, Lynch JP (2016) Emergence of antimicrobial resistance among Acinetobacter species: a global threat. Curr Opin Crit Care 22: 491-499 3. Clinical and Laboratory Standards Institute. 2015. Performance Standards for Antimicrobial Susceptibility Testing: 23rd Informational Supplement, M100-S25. Clinical and Laboratory Standards Institute, Wayne 4. Dexter C, Murray GL, Paulsen IT, Peleg AY (2015) Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis. Expert Rev Anti Infect Ther 13: 567-573 5. European Committee on Antimicrobial Susceptibility Testing. 2017. Clinical breakpoint tables. EUCAST Reading guide. Version 7.0. 6. Ferreira AE, Marchetti DP, De Oliveira LM, Gusatti CS, Fuentefria DB, Corção G (2011) Presence of OXA-23-producing isolates of Acinetobacter baumannii in wastewater from hospitals in southern Brazil. Microb Drug Resist 17: 221-227 7. Goic-Barisic I, Bedenic B, Tonkic M, Katic S, Kalenic S, Punda-Polic V (2007) First report of molecular characterization of carbapenem-resistant Acinetobacter baumannii in different intensive care units in University Hospital Split, Croatia. J Chemother 19: 462–464 8. Goic-Barisic I, Towner KJ, Kovacic A, Sisko-Kraljevic K, Tonkic M, Novak A, Punda-Polic V (2011) Outbreak in Croatia caused by a new carbapenem-resistant clone of Acinetobacter baumannii producing OXA72 carbapenemase. J Hosp Infect 77: 368–369 9. Goic-Barisic I, Kaliterna V (2011) Multidrug-resistant Acinetobacter baumannii-the pathogen with no borders? Med Glas 8: 312-313 10. Goic-Barisic I, Hrenovic J, Kovacic A, Musić Šeruga M (2016) Emergence of oxacillinases in environmental carbapenem-resistant Acinetobacter baumannii associated with clinical isolates. Microb Drug Resist 22: 559-563 11. Goic-Barisic I, Seruga Music M, Kovacic A, Tonkic M, Hrenovic J (2017) Pan drug-resistant environmental isolate of Acinetobacter baumannii from Croatia. Microb Drug Resist 23: 494-496 12. Higgins PG, Lehmann M, Seifert H (2010). Inclusion of OXA-143 primers in a multiplex polymerase chain reaction (PCR) for genes encoding 1.

13.

14. 15. 16. 17.

18. 19.

20. 21.

22. 23.

Int. Microbiol. Vol. 20, 2017

169

prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 35: 305-314 Hrenovic J, Goic-Barisic I, Kazazic S, Kovacic A, Ganjto M, Tonkic M (2016) Carbapenem- resistant isolates of Acinetobacter baumannii in a municipal wastewater treatment plant, Croatia, 2014. Euro Surveill 14: 21(15) Kumar S, Stecher G, and Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol and Evol 33: 1870-1874 Potron A, Poirel L, NordmannP (2015) Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: Mechanisms and epidemiology. Int J Antimicrob Agents 45: 568-585 Public Health Collegium Committee for Antibiotic Resistance Surveillance in Croatia. (2016). Antibiotic Resistance in Croatia, 2015. Croatian Academy of Medical Sciences, Zagreb Seruga Music M, Hrenovic J, Goic-Barisic I, Hunjak B, Skoric D, Ivankovic T (2017) Emission of extensively-drug-resistant Acinetobacter baumannii from hospital settings to the natural environment. J Hosp Infect 96: 323-327 Sousa C, Botelho J, Silva L, et al. (2014) MALDI-TOF MS and chemometric based identification of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex species. Int J Med Microbiol 304: 669-767 Thompson JD, Gibbson TJ, Plewniak F, Jeanmougin F, Higgins, DG (1995) The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl Acids Res 25: 4876-4882 Towner KJ. (2009) Acinetobacter: an old friend, but a new enemy. J Hosp Infect 73: 355–363 Vranić-Ladavac M, Bedenić B, Minandri F, et al. (2014) Carbapenem resistance and acquired class D beta-lactamases in Acinetobacter baumannii from Croatia 2009-2010. Eur J Clin Microbiol Infect Dis 33: 471-478 Woodford N, Ellington MJ, Coelho JM, et al. ( 2006) Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 27: 351–353 Zhang C, Qiu S, Wang Y, et al. (2013) Higher isolation of NDM-1 producing Acinetobacter baumannii from the sewage of the hospitals in Beijing. PLoS One 8: e64857


RESEARCH ARTICLE International Microbiology 20(4):170-177 (2017) doi:10.2436/20.1501.01.300. ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Fate of Bacillus cereus within phagocytic cells Ivanna S. Rolny1, Silvia M. Racedo2 and Pablo F. Pérez1* Centro de Investigación y Desarrollo en Criotecnología de Alimentos (CCT-La Plata, CONICET), Cátedra de Microbiología, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, Calle 47 y 116 (s/n)- CP: B1900AJI, La Plata, Argentina. 2 Current address: Laboratory of Experimental and Molecular Hepatology, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Medical University of Graz, Graz Austria

1

Received 13 June 2017 · Accepted 20 November 2017 Summary.  In this study we assessed the interaction of different strains of Bacillus cereus with murine peritoneal macrophages and cultured phagocytic cells (Raw 264.7 cells). Association, internalization, intracellular survival, routing of bacteria to different compartments and expression of MHCII were assessed in cells infected with different strains of B. cereus in vegetative form. Association values (adhering + internalized bacteria) and phagocytosis were higher for strain B10502 than those for strains 2 and M2. However, after 90 min interaction, intracellular survival was higher for strain 2 than for strains M2 and B10502. Acquisition of lysosomal markers by B. cereus containing vacuoles (BcCV), assessed by LAMP1 and Lysotracker labelling occurred shortly after internalization. The highest ratio of LAMP1(+)-BcCV was found for strain M2. This strain was able to survive longer than strain B10502 which routes to LAMP1 containing vacuoles to a lesser extent. In addition, strain M2 stimulated expression of MHCII by infected cells. Confocal analyses 60 or 90 min post-infection showed different percentages of co-localization of bacteria with Lysotracker. Results suggest strain-dependent interaction and intracellular killing of B. cereus by phagocytic cells. These findings could be relevant for the pathogenic potential of Bacillus cereus strains. Keywords:  Bacillus cereus · LAMP1 · phagocytosis · virulence · endocytic pathway · intracellular trafficking.

Introduction Bacillus cereus is a Gram-positive spore forming bacterium that leads to intestinal and non-intestinal pathologies [4, 31]. Bacillus cereus spores gain access to the digestive tract by oral ingestion and after germination, vegetative cells produce different extracellular factors with biological activity [2, 3, 24, 36]. In addition, it has been suggested that direct bacteria-cell interactions also play a role in B. cereus virulence [29] and it has been demonstrated that diversity of biological activity is related to the presence of specific sequences in the bacterial genome [27]. Macrophages are crucial players of the immune response through internalization of microorganisms and further antigen *Corresponding author: Dr. Pablo F. Pérez Centro de Investigación y Desarrollo en Criotecnología de Alimentos Cátedra de Microbiología. Facultad de Ciencias Exactas Universidad Nacional de La Plata. Argentina Tel/fax: +54 221 424 92 87; e-mail: pfp@biol.unlp.edu.ar

presentation [26]. Phagocytosis starts with attachment of bacteria to cell surface receptors. Next, a series of events determine the fate of the microorganism after internalization. Key steps include invagination of the host cell membrane, engulfment of the microorganism and maturation of the phagosome along the endocytic pathway that involves changes in the lipid and protein composition of its membrane [9, 26]. A hallmark in phagosome maturation is the acquisition of specific markers such as Lysosomal Associated Membrane Proteins (LAMP) that are related to the maintenance of a low intralysosomal pH as well as with the protection of lysosomes against autodigestion [9, 10]. Pathogens have evolved a variety of strategies to avoid uptake and/or processing by professional phagocytic cells [1, 18, 19]. These mechanisms could involve blockade of phagolysosome biogenesis, escape from the phagosome or survival in the intralysosomal milieu [20–22]. It is known that Bacillus cereus is able to produce several extracellular factors with biological activity on eukaryotic cells [2, 24, 27–29]. In addition, it has been demonstrated that vegetative cells of some strains, can invade cultured human entero-


FATE OF BACILLUS CEREUS WITHIN PHAGOCYTIC CELLS

Int. Microbiol. Vol. 20, 2017

171

cytes [29, 30]. However, studies on the interaction between vegetative B. cereus and professional phagocytic cells are seldom found in scientific literature although the role of this interaction on virulence has been proposed [32, 38]. In the present work, we examine the interaction and intracellular lifestyle of different strains of B. cereus in two experimental models: freshly isolated resident murine peritoneal macrophages and cultured macrophage-like Raw 264.7 cells

further incubated at 32ºC for 3 h to obtain mid-log cultures. Bacterial concentration was evaluated by optical density (OD) readings at 600 nm (Spectronic Helios Spectrophotometer UV-Vis, Thermo Electron Corporation, England). The correlation between plate counts and OD600 was previously established. Bacteria were harvested by centrifugation for 10 min at 900 x g. Pellets were washed twice with PBS and suspended in PBS before infection of macrophages.

Materials and Methods

Fluorescent labelling of B. cereus strains.  B. cereus strains were labelled with carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes, Eugene, Oregon, USA). Microorganisms, grown as described above, were washed 3 times with PBS and suspended in RPMI-1640 medium. Afterwards CFSE was added to a final concentration of 5 µmol l-1 [39]. Microorganisms were incubated for 30 min at 37°C in the dark, and then they were washed twice with PBS to eliminate CFSE excess. Labelling was evaluated by fluorescent microscopy (Leica Microscopy Systems Ltd., Microsystems, Germany) and flow cytometry by using bluegreen excitation light (488 nm argon-ion laser, FACSCaliburTM, CellQuestTM software). Unlabelled B. cereus was used as negative control.

Isolation of murine peritoneal macrophages.  Specific pathogen free BALB/c mice (6-8 weeks old) were purchased from the Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata (Argentina). Mice were provided water and balanced diet ad libitum. All the experimental procedures were performed in accordance with the international guidelines for animal experimentation and approved by the Comité Institucional para el Cuidado y Uso de Animales de Laboratorio (CICUAL) of the Facultad de Ciencias Exactas, Universidad Nacional de La Plata (Argentina); (Protocol number 022-05-15). Mice were euthanatized by CO2 inhalation and resident macrophages were recovered by peritoneal washing with 10 ml of ice-cold RPMI-1640 (Life Technologies, Cergy, France) tissue culture medium, supplemented with heparin (Rivero L.A.C.E. S.R.L., Argentina) (10 U ml-1) and bovine serum albumin 0.1% (w/v) (PAA Laboratories, GmbH, Pasching, Austria). Cells were washed with phosphate buffered saline (PBS) containing 2% (v/v) fetal bovine serum (FBS) (PAA Laboratories, GmbH, Pasching, Austria), centrifuged at 600xg for 10 min (4°C) and suspended in PBS. Culture of RAW 264.7 cells.  RAW 264.7 cells (ATCC TIB-71), a macrophage-like Abelson leukaemia virus- transformed cell line derived from BALB/c mice, were maintained in RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated FBS, 2 g l-1 NaHCO3, 10 mg l-1 streptomycin and 10 IU ml-1 penicillin G. Incubations were performed at 37°C in a 5% (v/v) CO2 - 95% (v/v) air atmosphere. Bacterial strains and growth conditions.  Strains of B. cereus were selected on the basis of previous studies. They have different genetic backgrounds related to virulence markers and lead to different biological responses when tested on cultured cells [27–30]. B. cereus strains M2 and 2 were isolated from skim milk powder and infant formula respectively [28] whereas strain B10502 was isolated from a food poisoning outbreak [29]. Microorganisms were grown in BHI broth (BIOKAR Diagnostics, Beauvais, France) supplemented with 0.1% (w/v) glucose (BHIG) at 32ºC for 16 h under agitation. Next, bacteria were inoculated (4% v/v) in fresh BHIG and

Fluorescence microscopy.  Peritoneal macrophages (3 x 105 cells), suspended in RPMI 1640 medium, were infected with B. cereus strains at a multiplicity of infection (MOI) of 20 and incubated for 30 min at 37°C in a 5% (v/v) CO2 – 95% (v/v) air atmosphere. After incubation, samples were put on ice and non-attached bacteria were removed by careful washing with cold PBS. Infected cells were spun onto cover glasses by centrifugation. Cells were fixed in ice cold ethanol for 5 min and washed with PBS. Staining was performed with acridine orange (Aldrich CHEM. Co., USA) at a final concentration of 0.5 µg ml-1 for 5 min at 0ºC. After being washed three times with PBS, slides were mounted in PBS containing 50% (v/v) glycerol. A minimum of 100 cells per sample were analyzed by fluorescence microscopy using a Leica DMLB microscope coupled to a Leica DC 100 camera (Leica Microscopy Systems Ltd., Microsystems, Germany). Three independent experiments were performed. Cells associated to at least one microorganism were considered in the calculation of the percentage of association. Flow cytometry.  Infection of peritoneal macrophages was conducted as described above with CFSE-labelled bacteria. After incubation for 30 min at 37°C, samples were put on ice and non-attached bacteria were removed by carefully washing with cold PBS. Evaluation of cells with internalized bacteria was conducted after quenching of exocellular bacteria with 0.2 % trypan blue solution (GIBCO Invitrogen Corporation, USA) for 2 min and further washing with PBS [39]. After quenching, cells


172

Int. Microbiol. Vol. 20, 2017

with internalized bacteria were found in region R2 of the scatter plot as indicated in Figure 2. Macrophage population (region R1 in Figure 2) was localized by labelling with biotin conjugated anti-mouse F4/80 and PE-streptavidin (eBioscience, USA). Survival of B. cereus within murine peritoneal macrophages.  Peritoneal macrophages were infected with bacteria as described above. After 30 min incubation, cells were washed twice with warm PBS, and then incubated for different times in the presence of gentamicin 100 µg ml-1 (Parafarm, Argentina) to kill exocellular bacteria. After different incubation times (up to 180 min reckoned from the beginning of the infection), macrophages were washed twice with PBS, lysed by addition of sterile distilled water and homogenized by 3-6 passages through a 22G needle. Appropriate dilutions were plated on nutrient agar (BIOKAR Diagnostics, Beauvais, France) and incubated at 37°C to determine viable counts. Analysis of B. cereus-containing vacuoles (BcCV). RAW 264.7 cells (2 x 105 ml-1) were seeded in 75 cm2 tissue culture flasks (Greiner Bio One, Frickenhausen, Germany) and incubated at 37°C for 72 h (80% confluence). Macrophages were infected with CFSE-labelled B. cereus (strains 2, B10502 or M2) at MOI 20 and incubated at 37°C in a 5% (v/v) CO2 - 95% (v/v) air atmosphere for 30 min. Afterwards, cells were washed twice with warm PBS, and then incubated for 1h at 37°C in a 5% (v/v) CO2 - 95% (v/v) air atmosphere. Chloramphenicol (100 µg ml-1) (Parafarm, Argentina) was added to prevent bacterial growth. Next, cells were exhaustively washed with PBS containing 0.2% (v/v) FBS and centrifuged at 100 xg for 5 min. Infected cells were suspended in 2 ml of homogenization buffer (HB: 250 mM sucrose, 0.1% (v/v) gelatin, 0.5 mM EGTA, 1:1000 protease inhibitor cocktail pH 7.4 (Sigma-Aldrich Co. St Louis, USA) and then centrifuged at 1800xg for 5 min. Pellets were suspended in 400 µl of HB and gently homogenized by 3-6 passages through a 22G needle. Homogenates were diluted to 2 ml with HB and vacuoles were obtained from the supernatants after 3 centrifugations at 100 x g for 5 min. This fraction constitutes the post-nuclear supernatant (PNS) and contains the BcCV. Afterwards, samples were incubated with 100 µl of mAb PE anti-mouse LAMP1 (Santa Cruz Biotechnology, Santa Cruz, CA) diluted in PBS containing 10 % (v/v) FBS and incubated for 30 min on ice. Samples were analysed by flow cytometry (FACSCalibur and Cellquest software Becton Dickinson). Double labelled particles were considered as LAMP (+) vacuoles containing bacteria. Analysis was performed, after appropriate gating on 300000 events per sample [39]. Immunofluorescence labelling. To determine the intracellular localization of the different strains of B. cereus in acidic compartments, labelling with Lysotracker DND-99 (Molecular Probes, Eugene, OR) was conducted. This compound selectively accumulates in cellular compartments of low pH (e. g. late phagolysosome). RAW 264.7 cells were seeded in 24-well tissue culture plates (Greiner Bio One, Frickenhausen, Germany) on round glass coverslips (Assistant, Sondheim, Germany).

ROLNY ET AL.

After 30 minutes of incubation with CFSE-labelled B. cereus strains (MOI 20), macrophages were washed to remove non-attached bacteria, and then incubated for 30 or 60 minutes at 37°C in a 5% (v/v) CO2 - 95% (v/v) air atmosphere. Chloramphenicol (100 µg ml-1) was added to prevent bacterial growth. Cells were washed twice with cold PBS and then incubated for 5 minutes at 37ºC with 200 nM Lysotracker [21]. Afterwards, macrophages were washed twice and fixed with 3% (v/v) PFA for 1 h at 4ºC in the dark. Mounting medium (DakoCytomation, USA) was used as antifading reagent. Microscopic analyses were performed using confocal laser-scanning microscope (Leica TCS SP5 Leica Microsystems, Germany) (see below). To assess trafficking to non lysosomal compartments, transferrin uptake was determined. After the phagocytosis experiment (30, 45, 60 and 90 min), macrophages were depleted of transferrin by incubation in RPMI containing 1 % (w/v) BSA (RPMIBSA) for 1 h at 37 ºC. Next, cells were incubated for 10 min at 4 ºC with 10 μg/mL of transferrin Alexa Fluor-594 conjugate (Molecular Probes, Oregon, USA) in RPMI-BSA to saturate non-specific endocytosis. Following, incubation for 5 min at 37 ºC was performed to allow transferrin internalization and then cells were washed with RPMI-BSA and incubated in RPMI-BSA for 45 min at 37 ºC. Finally cells were fixed with 3% (v/v) paraformaldehyde for 1 h at 4ºC in the dark. Mounting medium (DakoCytomation, USA) was used as antifading reagent. Image analysis. Microscopy images were captured using a Leica TCS SP5 confocal laser-scanning microscope (Leica Microsystems, Germany) at excitation wavelengths of 488 nm (argon laser) and 594 nm (helium-neon laser). A HCX PL APO CS 63.0x1.40 OIL UV objective (Leica Microsystems, Germany) was used. The resolution of the resulting images was 8 bits (1024 x 1024 pixels). For each microscope image of a random region, 25 Z-section images were collected and stacked to form a 2D image by using the accompanying software LAS AF Lite (Leica Microsystems, Germany). The interval between each Z-section was 0.3 µm. All experiments were performed at room temperature. For quantification and analysis of internalized bacteria and co-localization with Lysotracker three independent experiments were performed (see below). For bacteria smaller than B. cereus (Bordetella spp, Salmonella spp, etc) co-localization is evidenced as yellow spots (merge of red and green fluorescence channels). However, because of the size of Bacillus cereus (around 1 x 4 µm) a conventional image analysis is not appropriate. Hence, co-localization was considered as positive when CFSE-labelled bacteria were in close contact with a red-labelled region situated around the bacteria (Fig 4B). Different focal planes (XY, XZ, YZ) on 50-100 intracellular compartments containing bacteria were analysed for co-localization with Lysotracker. Expression of MHCII and CD86 in macrophages. RAW 264.7 cells were seeded in 24-well tissue culture plates (Greiner Bio One, Frickenhausen, Germany). Cells were infected with B. cereus strains at MOI 20 and incubated 24 or 48 h at 37°C in a 5% (v/v) CO2 - 95% (v/v) air atmosphere. E. coli lipopol-


FATE OF BACILLUS CEREUS WITHIN PHAGOCYTIC CELLS

ysaccharide (LPS) (1 µg ml-1) (Escherichia coli 0111:B4, Sigma-Aldrich, Saint Louis, Missouri, USA) was used as a positive control. Phagocytosis assay was performed in the presence of chloramphenicol (100 µg ml-1) to prevent bacterial growth. Next, cells were washed twice with PBS containing 2% (v/v) FBS and incubated with the antibody 30 min at 4ºC in the dark. The expression of CD86 and MHCII was assessed by using a PE-conjugated Anti-mouse MHC class II, PE-conjugated Anti-mouse CD86 (B7-2) according to the manufacturer´s instructions (eBioscience, San Diego, USA). Appropriate isotype controls were used. After staining, cells were washed and analyzed by flow cytometry as described above. The expression of surface antigens was calculated as follows: Expression Index (EI): percent of positive cells x mean fluorescence intensity. Data analysis. Results were analysed by means of two-tail Student’s t test using the InfoStat software (InfoStat, Version 2008, Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina). In order to show an overall picture of the behaviour of each strain, a radial graph (Fig. 6) was constructed. To this end, normalized values (Nv) were calculated as follows: Nv=(Xi-Xmax)/(Xmax-Xmin); where Xi: value of the variable for a given strain; Xmin: minimum value for the variable; Xmax: maximal value for the variable.

Int. Microbiol. Vol. 20, 2017

173

Fig. 1. Association of B. cereus to murine peritoneal macrophages. Peritoneal macrophages isolated from mice were inoculated with B. cereus B10502, 2 or M2 (MOI 20) and stained with orange acridine. Percentage of macrophages containing both attached and internalized microorganisms were determined. Different letters indicate significant differences (P<0.05).

Results Association of B. cereus to peritoneal macrophages.  In order to determine the interaction of B. cereus with peritoneal macrophages, association (adhered plus internalized bacteria) was assessed by fluorescence microscopy. When the percentage of macrophages associated to bacteria was analysed a strain depended behaviour was observed (Fig. 1). Indeed, higher association values were found for strain B10502 (50.9 ± 0.8 %) whereas strains M2 and 2 showed significantly lower (P<0.05) association values (24.4 ± 2.7 % and 31.9 ± 4.3 % respectively) (Fig. 1). Phagocytosis assays.  Phagocytic activity of peritoneal macrophages was analysed by flow cytometry after incubation of cells with CFSE-labelled bacteria. Percentage of phagocytes interacting with bacteria was analysed in cells gated in R1 (Fig. 2A) that corresponds to F4/80 (+) cells (data not shown). Fig 2B is a representative scatterplot for cells incubated without bacteria whereas results for cells incubated with CFSE-labelled bacteria (Fig. 2C, D, E) and quenched with Trypan blue are shown in Fig 2C, D and E. Percentages of CFSE (+) cells are shown in the upper right corner of the figures. The highest percentage of cells with internalized bacteria was found for strain B10502 (36.3 ± 3.8; Fig. 2C). This value was significantly higher (P<0.05) than that found for strain 2 (15.0 ± 2.9; Fig. 2E) whereas values for strain M2 (22.0 ± 7.0) were between those of strains B10502 and 2 (Fig. 2D).

Fig. 2. Flow cytometry analysis of the interaction between B. cereus and murine peritoneal macrophages. Assays were conducted with CFSE-labelled B. cereus strains B10502, 2 or M2. A. FSC vs SSC plot of peritoneal macrophages showing selected R1 region corresponding to F4/80 (+) cells. B. Non-infected macrophages gated in R1. C. D. E. Macrophages infected with CFSE-labelled B. cereus strains. Cells interacting with bacteria are shown in R2 (FL1+). Percentages of FL1(+) cells in the R1 population are shown in the upper right corner. Fluorescence of exocellular bacteria was quenched with Trypan blue. Results are representative from three independent experiments and are expressed as means ± standard error. Asterisks indicate significant differences as compared with B. cereus B10502 (P<0.05).

Survival of B. cereus in peritoneal macrophages.  Results of association above mentioned prompted us to assess intracellular survival of microorganisms. As shown in Figure 3, intracellular survival of B. cereus after 90 min infection (30 min infection + 60 min gentamicin) was strain-dependent. Values of viable counts for strain 2 were sig-


174

ROLNY ET AL.

Int. Microbiol. Vol. 20, 2017

nificantly higher (9.7 ± 0.3 x 102 cfu/ml; P<0.05) than those for strains B10502 (2.5 ± 3.5 x 101 cfu/ml) and M2 (2.8 ± 0.2 x 102 cfu/ml). When survival was evaluated at longer incubation periods, viable counts were under detection limits (data not shown). It was not possible to evaluate survival at times shorter than 90 min since we had to perform 1 h incubation with gentamycin in order to kill exocellular bacteria. During this period, changes in intracellular compartments cannot be ruled out. Fate of internalized bacteria.  Flow cytometry was used to analyse large numbers of individual vacuola isolated from infected cells [34]. At 90 min post-infection (Table 1), BcCV acquired lysosomal associated membrane protein LAMP1 in a strain-dependent manner. Percentages of LAMP1 (+) vacuoles containing strain M2 (25.3 ± 1.2) were significantly higher (P<0.05) as compared with LAMP1 (+) vacuoles containing either strain B10502 or strain 2 (11.6 ± 1.4 and 10.9 ± 5.4 respectively).

Localization of bacteria in acidic compartments was assessed by confocal microscopy. Figure 4B shows representative confocal fluorescence image of Lysotracker (red) co-localization with CFSE-labelled B. cereus strain B10502 (green). Lysosomal compartments were evidenced as well defined corpuscular regions within the cytoplasm. When bacteria were within a lysosome, red label (Lysotracker) was in close contact with green-labelled bacteria. In order to properly analyse confocal images, quantitative image analysis was performed. At 60 min post-infection, values of co-localization with Lysotracker were significantly higher (P<0.05) for strains B10502 (72.0 ± 7.4 %) and M2 (70.0 ± 7.0 %) as compared with strain 2 (53.5 ± 4.9 %). At 90 min post-infection, values for strains B10502 (75.8 ± 5.8%) and M2 (85.2 ± 8.7 %) were significantly higher (P<0.005) than for strain 2 (66.8 ± 7.6 %). Only for strain 2, co-localization with Lysotracker was higher at 90 min as compared with values obtained at 60 min post-infection (P<0.05; Fig. 4A). Interestingly at early stages of the interaction (30 and 45 min post infection), no co-localization of bacteria with Lysotracker was found (data not shown). In order to assess routing to recycling endosomes, co-localization with transferrin was monitored by laser confocal microscopy. No co-localization of bacteria with transferrin was found at any of the timepoints assayed (data not shown). Expression of MHCII and CD86 after infection.  The expression of MHCII and co-stimulatory molecules, such as CD86, was assessed in infected and uninfected RAW 264.7 cells. The expression index (EI) of MHCII significantly increases after 48 h of incubation with strain M2 (EI: 377.0 ± 89.1) as compared with strains B10502 and 2 that lead to low expression of this marker (EI: 104.2 ± 41.9 and 96.5 ± 50.8 respectively) (Fig. 5 **P< 0.005). No changes in the expression of CD86 were detected (data not shown).

Fig. 3. Survival of B. cereus in peritoneal macrophages. Macrophages isolated from peritoneal cavity of BALB/c mice were infected with B. cereus B10502, 2 or M2 (MOI 20) and incubated for 90 min at 37°C. Viable bacteria in cell lysates were determined by plate counts. Results were expressed as means of CFU ml-1 ± standard error. Different letters indicate significant differences (P<0.05).

Table 1. Analysis of B. cereus containing vacuoles (BcCV) in Raw 264.7 cells incubated with different CFSE-labelled strains1 Strain

Percentage of LAMP1 (+) vacuola2, 3

B10502

11.6 ± 1.4a

M2

25.3 ± 1.2b

2

10.9 ± 5.4a

Results are expressed as means ± standard error from three independent experiments. Different letters indicate significant differences (p<0.05). 3 Percentage of LAMP1 (+) was calculated as: double labelled events (FL1(+)-FL2(+))/total FL1 (+) events. 2

Multivariate analysis.  In order to analyse together the studied variables, a multivariate analysis was conducted by means of a radial graph after data normalization as indicated in the Materials and Methods section (Fig. 6). Strain B10502 showed the highest values of association/ internalization. However, strain M2, that is internalized in a lower extent, route more efficiently to acidic and LAMP (+) intracellular compartments. Strain 2, on the other hand, showed lowest association and internalization values as well as lower values of routing to degradative compartments as compared with both B10502 and M2 strains. Discussion It is known that B. cereus sensu stricto belongs to a group of microorganisms that share many common characteristics but


FATE OF BACILLUS CEREUS WITHIN PHAGOCYTIC CELLS

INT. MICROBIOL. Vol. 20, 2017

175

Fig. 5. Expression of MHCII in Raw 264.7 cells infected with B. cereus strains (MOI 20) after 48 h incubation. The expression of MHCII was assessed by using a PE-conjugated Anti-mouse MHC class II. LPS was used as a positive control. Expression index was calculated as EI = percentage of positive cells x mean fluorescence intensity. Different letters indicate significant differences (P< 0.005). Data were processed using the CellQuest software (BD Biosciences). Results are representative of three independent experiments.

Fig. 4. A. Co-localization of CFSE-labelled B. cereus with Lysotracker in Raw 264.7 cells. After 60 (white bars) or 90 (grey bars) min infection, cells were labelled with Lysotracker and co-localization was analysed by confocal microscopy. Results were expressed as means Âą standard error of the percentage of bacteria co-localizing with Lysotracker referred to the total of bacteria analysed. Different letters indicate significant differences (P<0.05). B. Macrophages incubated with B. cereus (MOI 20) at 37 ÂşC for 90 min. Confocal image showing CFSE-labelled B. cereus B10502 within acidic compartment (Lysotracker; red) in Raw 264.7 cells. Z-section images were collected and stacked to form a 2D image (XY). In the inset, there is an enlarged image of the selected region. Figure shows a representative image from three independent experiments (Logical size 1024 x 1024)

show a wide range of virulence potential. This so-called B. cereus sensu lato group includes B. cereus sensu stricto, B. anthracis, B. mycoides, B. thuringiensis, B. pseudomycoides, B. weihenstephanensis and B. cytotoxicus [12, 13, 23]. This group show a very homogeneous genetic background and it has been proposed that some members (i. e. B. cereus, B. anthracis and B. thuringiensis) constitute single species [15]. Certainly, B.

Fig. 6. Multivariate analysis of the interaction of strains 2, M2 and B10502 with phagocytic cells. Values were normalized as indicated in the Materials and Methods section.

anthracis has the highest pathogenic potential and its ability for surviving within phagocytic cells is one of the hallmarks of the pathogenesis of this microorganism. Indeed, it has been demonstrated that spores of B. anthracis survive intracellular, germinate and scape from phagocytic cells. This ability, related to the transactivator AtxA located on the pXO1 plasmid, is a key event for systemic spreading [7]. Even though invasiveness of B. cereus is limited, there are reports on systemic dissemination in severe cases [14, 32, 37]. Macrophages are key players of the first line of defence against most bacterial pathogens. Concerning elimination of spore forming microorganisms such as B. cereus, it has been


176

Int. Microbiol. Vol. 20, 2017

demonstrated that macrophages can promote germination of intracellular spores that in turn determines killing of intracellular bacteria. These features correlate with the proposed protective role of macrophages in the infection with Bacillus spores [33]. In the present study we explore the ability of vegetative cells of different B. cereus strains to interact with professional phagocytic cells in an in vitro infection model in non-opsonic conditions. Our data reveal different patterns of association between macrophages and B. cereus strains. Values of association and phagocytosis indicate that phagocytic cells efficiently interact with strain B10502 and, to a lesser extent, with strains 2 and M2 (Fig. 6). In addition, strain B10502 showed the lowest values of intracellular survival. Strain 2, on the other hand, showed the highest survival values although this strain routed to vesicles LAMP1(+) at similar levels of those for strain B10502. Even though results showed in table 1 are a snapshot of the distribution of bacteria within intracellular compartments after 90 min incubation, it is evident that there is a strain-dependent kinetics of routing to lysosomal compartments. Quantitative analysis by flow cytometry of phagosomal markers provides a basis for investigating phagosome maturation [16]. Therefore, we applied this experimental procedure to examine the co-localization of B. cereus with the late endosomal/lysosomal glycoprotein LAMP1 which is a distinctive marker of late endosomal and lysosomal compartments. Its concentration has shown to increase in the phagosoma membranes during progression from early to late phagosome and phagolysosomal stages [17]. The highest values of co-localization in LAMP1(+) compartments were found for strain M2. Labelling with Lysotracker also demonstrated that routing to intracellular acidic compartments was higher for strain M2. These findings correlate with the high MHCII expression by cells infected with strain M2 and low intracellular survival (high antigen processing and presentation). Interestingly, strain M2 is the sole strain of this study that is positive for sequences or the piplC gene that encodes for phospholipase C [27]. This correlation could be relevant given the role of phosphorylated lipids in phagosome maturation [35]. Strains B10502 and 2 showed a particular behaviour, i. e. strain 2 lead to the highest values of intracellular survival and low values of MHCII expression. In contrast, with similar values of trafficking to LAMP1(+) compartments and induction of MHCII expression, strain B10502 showed the lowest ability to survive in intracellular compartments. It is worth to note that strains under study have demonstrated different levels of virulence in vitro. Whereas strains 2 and M2 were able to internalize in cultured human enterocytes [27, 29, 30] strain B10502 was not. Furthermore, in a multivariate analysis it has been demonstrated that these strains have different background related to the presence of virulence genes [27]. These characteristics probably impact on the kinetics of acidification of intracellular compartments as well as on the acquisition of lysosomal markers [9]. Interestingly, strains 2 and B10502 differ in genetic background related to virulence traits. Strain 2 is positive for the sequences of nheB and nheC genes (non-haemolytic enterotox-

ROLNY ET AL.

in) as well as for the sph gene (sphyngomielinase) [27]. These factors have demonstrated synergistic effect for cytotoxicity in vitro [8]. Concerning B. cereus, there is scientific evidence on the ability of spores to survive, germinate and escape from macrophages. This ability is related to InhA metalloproteases associated with both vegetative and sporulated forms [5, 33] that is a major component of the B. cereus exosporium [6] and it is also secreted during vegetative growth [11]. In the present work we demonstrate for the first time that vegetative B. cereus routed to phagolysosome shortly after internalization in a strain-dependent manner. We found that there are viable intracellular microorganisms after 90 min co-incubation bacteria-macrophages in non-opsonic conditions. After 2 h incubation, no viable microorganisms were found. These findings could be due to complete killing of intracellular microorganisms or to the escape from macrophages and subsequent killing by gentamycin. However, the lack of microorganisms co-localizing with transferrin is compatible with routing to lysosomal compartments. It is worth noting that, intracellular survival is not only relevant for spreading of infections but also to shape host´s immune response by carrying intestinal bacteria to adjacent mesenteric lymph nodes [25]. Our results suggest strain-dependent kinetics of processing of B. cereus by professional phagocytic cells. Even though B. cereus is not an intracellular pathogen, some strains seem able to route slower than others to degradative compartments thus leading to both differential intracellular survival and stimulation of phagocytes. We hypothesize that cell response (e. g. MHC II and CD86 expression) depends on the different kinetics of routing to intracellular compartments. As far as we know, our report is the first contribution on the relevance of a transient intracellular lifestyle of B. cereus. It has been previously demonstrated [27] that biological effects in vitro correlate with the presence of sequences of virulence genes. We are obviously aware that correlation does not indicate causation but our findings could give a clue for further research to elucidate the mechanisms involved in the virulence of B. cereus. Even though the mechanisms involved in the differential processing of B. cereus strains by macrophages remain unknown, our findings suggest that the course of B. cereus infection could also depends on the kinetics of the routing of ingested microorganisms to lysosomal compartments. Further investigation is needed to elucidate the mechanisms behind differential intracellular fate of B. cereus in macrophages.

Acknowledgements.  Strain B10502 was kindly provided by the Laboratorio Central de Salud Pública de la Provincia de Buenos Aires, Argentina. Current filiation for Ivanna Rolny is IIFP. Instituto de Estudios Inmunológicos y Fisiopatológicos.(CONICET-UNLP). Facultad de Ciencias Exactas Universidad Nacional de La Plata. Pablo F. Pérez is a member of the Carrera de Investigador Científico y Tecnológico of the CONICET. This work was supported by the Agencia Nacional de Investigaciones Científicas y Tecnológicas (ANPCyT), CONICET and Universidad Nacional de La Plata.


FATE OF BACILLUS CEREUS WITHIN PHAGOCYTIC CELLS Competing interests.  None declared

References 1. 2. 3. 4. 5.

6. 7. 8. 9. 10. 11. 12.

13.

14.

15.

16.

17.

Aderem A, Underhill DM (1999) Mechanisms of phagocytosis in macrophages. Annu Rev Immunol 17: 593–623 Beecher DJ, Schoeni JL, Lee Wong AC (1995) Enterotoxic activity of hemolysin BL from Bacillus cereus. Infect Immun 63:4423–4428 Beecher DJ, Wong ACL (2000) Tripartite haemolysin BL: Isolation and characterization of two distinct homologous sets of components from a single Bacillus cereus isolate. Microbiology 146: 1371–1380 Bottone EJ (2010) Bacillus cereus, a volatile human pathogen. Clin Microbiol Rev 23: 382–398 Cadot C, Tran SL, Vignaud ML, De Buyser ML, Kolsto AB, Brisabois A, Nguyen-The C, Lereclus D, Guinebretire MH, Ramarao N (2010) InhA1, NprA, and HlyII as candidates for markers to differentiate pathogenic from nonpathogenic Bacillus cereus strains. J Clin Microbiol 48:1358–1365 Charlton S, Moir AJG, Baillie L, Moir A (1999) Characterization of the exosporium of Bacillus cereus. J Appl Microbiol 87: 241–245 Dixon TC, Fadl AA, Koehler TM, Swanson JA, Hanna PC (2000) Early Bacillus anthracis-macrophage interactions: intracellular survival and escape. Cell Microbiol 2: 453–463 Doll VM, Ehling-Schulz M, Vogelmann R (2013) Concerted action of sphingomyelinase and non-hemolytic enterotoxin in pathogenic Bacillus cereus. PLoS One. doi: 10.1371/journal.pone.0061404 Flannagan RS, Jaumouillé V, Grinstein S (2012) The cell biology of phagocytosis. Annu Rev Pathol 7: 61–98 Griffiths G (1996) On vesicles and membrane compartments. Protoplasma 195: 37–58 Guillemet E, Cadot C, Tran SL, Guinebretière MH, Lereclus D, Ramarao N (2010) The InhA metalloproteases of Bacillus cereus contribute concomitantly to virulence. J Bacteriol 192: 286–294 Guinebretière MH, Auger S, Galleron N, Contzen M, de Sarrau B, de Buyser ML, Lamberet G, Fagerlund A, Granum PE, Lereclus D, de Vos P, Nguyen-The C, Sorokin A (2013) Bacillus cytotoxicus sp. nov. is a novel thermotolerant species of the Bacillus cereus group occasionally associated with food poisoning. Int J Syst Evol Microbiol 63: 31–40 Guinebretière MH, Velge P, Couvert O, Carlin F, Debuyser ML, NguyenThe C (2010) Ability of Bacillus cereus group strains to cause food poisoning varies according to phylogenetic affiliation (groups I to VII) rather than species affiliation. J Clin Microbiol 48: 3388–3391 Hansford JR, Phillips M, Cole C, Francis J, Blyth CC, Gottardo NG (2014) Bacillus cereus bacteremia and multiple brain abscesses during acute lymphoblastic leukemia induction therapy. J Pediatr Hematol Oncol 36: e197-201 Helgason E, Økstad OA, Dominique a, Johansen H a, Fouet A, Hegna I, Kolstø A, Økstad OLEA, Caugant D a, Mock LE, Hegna ID a (2000) Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis −− One Species on the Basis of Genetic Evidence One Species on the Basis of Genetic Evidence. Appl Environ Microbiol 66: 2627–2630 Hmama Z, Sendide K, Talal A, Garcia R, Dobos K, Reiner NE (2004) Quantitative analysis of phagolysosome fusion in intact cells: inhibition by mycobacterial lipoarabinomannan and rescue by an 1alpha,25-dihydroxyvitamin D3-phosphoinositide 3-kinase pathway. J Cell Sci 117: 2131–2140 Hostetter J, Steadham E, Haynes J, Bailey T, Cheville N (2003) Phagosomal maturation and intracellular survival of Mycobacterium avium subspecies paratuberculosis in J774 cells. Comp Immunol Microbiol Infect Dis 26: 269–283

Int. Microbiol. Vol. 20, 2017

177

18. Hume DA (2006) The mononuclear phagocyte system. Curr Opin Immunol 18: 49–53 19. Hume DA, Ross IL, Himes SR, Sasmono RT, Wells CA, Ravasi T (2002) The mononuclear phagocyte system revisited. J Leukoc Biol 72: 621–627 20. Kumar Y, Valdivia RH (2009) Leading a Sheltered Life: Intracellular pathogens and maintenance of vacuolar compartments. Cell Host Microbe 5: 593–601 21. Lamberti YA, Hayes JA, Perez Vidakovics ML, Harvill ET, Rodriguez ME (2010) Intracellular trafficking of Bordetella pertussis in human macrophages. Infect Immun 78: 907–913 22. Liehl P, Zuzarte-Luis V, Mota MM (2015) Unveiling the pathogen behind the vacuole. Nat Rev Microbiol 13: 1–10 23. Lund T, De Buyser ML, Granum PE (2000) A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol 38: 254–261 24. Lund T, Granum PE (1997) Comparison of biological effect of the two different enterotoxin complexes isolated from three different strains of Bacillus cereus. Microbiology 143: 3329–3336 25. Macpherson AJ, Geuking MB, McCoy KD (2012) Homeland Security: IgA immunity at the frontiers of the body. Trends Immunol 33: 160–166 26. Martin CJ, Peters KN, Behar SM (2014) Macrophages clean up: Efferocytosis and microbial control. Curr Opin Microbiol 17: 17–23 27. Minnaard J, Delfederico L, Vasseur V, Hollmann A, Rolny I, Semorile L, Pérez PF (2007) Virulence of Bacillus cereus: A multivariate analysis. Int J Food Microbiol 116: 197–206 28. Minnaard J, Humen M, Pérez- PF (2001) Effect of Bacillus cereus exocellular factors on human intestinal epithelial cells. J Food Prot 64: 1535–41 29. Minnaard J, Lievin-Le Moal V, Coconnier MH, Servin AL, Pérez PF (2004) Disassembly of F-actin cytoskeleton after interaction of Bacillus cereus with fully differentiated human intestinal Caco-2 cells. Infect Immun 72: 3106–3112 30. Minnaard J, Rolny IS, Pérez PF (2013) Interaction between Bacillus cereus and cultured human enterocytes: Effect of calcium, cell differentiation, and bacterial extracellular factors. J Food Prot 76: 820–6 31. Økstad OA, Hegna I, Lindba T, Kolstø A (1999) Genome organization is not conserved between Bacillus cereus and Bacillus subtilis. Microbiology 145: 621-631 32. Ramarao N, Belotti L, Deboscker S, Ennahar-Vuillemin M, De Launay J, Lavigne T, Koebel C, Escande B, Guinebretière MH (2014) Two unrelated episodes of Bacillus cereus bacteremia in a neonatal intensive care unit. Am J Infect Control 42: 694–695 33. Ramarao N, Lereclus D (2005) The InhA 1 metalloprotease allows spores of the Bacillus cereus group to escape macrophages. Cell Microbiol 7: 1357–1364 34. Steele-Mortimer O, Meresse S, Gorvel JP, Toh BH, Finlay BB (1999) Biogenesis of Salmonella typhimurium-containing vacuoles in epithelial cells involves interactions with the early endocytic pathway. Cell Microbiol 1: 33–49. 35. Steinberg BE, Grinstein S (2008) Pathogen destruction versus intracellular survival: The role of lipids as phagosomal fate determinants. J Clin Invest 118: 2002–2011 36. Stenfors Arnesen LP, Fagerlund A, Granum PE (2008) From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol Rev 32: 579–606 37. Tatara R, Nagai T, Suzuki M, Oh I, Fujiwara S, Norizuki M, Muroi K, Ozawa K (2013) Sepsis and meningoencephalitis caused by Bacillus cereus in a patient with myelodysplastic syndrome. Intern Med 52: 1987–1990 38. Tran SL, Ramarao N (2013) Bacillus cereus immune escape: A journey within macrophages. FEMS Microbiol Lett 347: 1–6 39. Tuominen-Gustafsson H, Penttinen M, Hytönen J, Viljanen MK (2006) Use of CFSE staining of Borreliae in studies on the interaction between Borreliae and human neutrophils. BMC Microbiol 6: 92


RESEARCH ARTICLE International Microbiology 20(4):178-183 (2017) doi:10.2436/20.1501.01.301. ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Developmental stages identified in the trophozoite of the free-living Alveolate flagellate Colpodella sp. (Apicomplexa) Raghavendra Yadavalli and Tobili Y. Sam-Yellowe* Department of Biological, Geological and Environmental Sciences, Cleveland State University, 2121 Euclid Avenue, SI 219 Cleveland, Ohio 44115 Received 18 November 2017 · Accepted 30 December 2017 Summary.  In this study we performed light, immunofluorescent and transmission electron microscopy of Colpodella trophozoites to characterize trophozoite morphology and protein distribution. The use of Giemsa staining and antibodies to distinguish Colpodella life cycle stages has not been performed previously. Rhoptry and β-tubulin antibodies were used in immunofluorescent assays (IFA) to identify protein localization and distribution in the trophozoite stage of Colpodella (ATCC 50594). We report novel data identifying “doughnut-shaped” vesicles in the cytoplasm and apical end of Colpodella trophozoites reactive with antibodies specific to Plasmodium merozoite rhoptry proteins. Giemsa staining and immunofluorescent microscopy identified different developmental stages of Colpodella trophozoites, with the presence or absence of vesicles corresponding to maturity of the trophozoite. These data demonstrate for the first time evidence of rhoptry protein conservation between Plasmodium and Colpodella and provide further evidence that Colpodella trophozoites can be used as a heterologous model to investigate rhoptry biogenesis and function. Staining and antibody reactivity will facilitate phylogenetic, biochemical and molecular investigations of Colpodella sp. Developmental stages can be distinguished by Giemsa staining and antibody reactivity. Keywords:  Colpodella · Rhoptries · Trichocysts · Apical complex · Plasmodium RhopH3.

Introduction Colpodella species possess an apical complex with rhoptries, micronemes, a conoid and in some species polar rings [2, 4, 8]. Most species of Colpodella are free-living and feed on protist prey. The life cycle, phylogeny, morphology and ultrastructure of several Colpodella species (C. pugnax, C. perforans, C. gonderi, C. edax, C. vorax, C angusta C. turpis [2, 8], C. pseudoedax, C. unguis, C. tetrahymenae and C. pontica [4] have been described and include trophozoite and cyst stages. Colpodella proteins with a role in life cycle transformation and myzocyto*Corresponding author: Tobili Y. Sam-Yellowe Department of Biological, Geological and Environmental Sciences Cleveland State University. 2121 Euclid Avenue, SI 219 Cleveland, Ohio 44115 +1 216-687-2068; FAX: + 216-687-6972; e-mail: t.sam-yellowe@csuohio.edu

sis have not been identified. Colpodella species (ATCC 50594) maintained by the American Type Culture Collection (ATCC), has been used for phylogenetic analyses with data showing Colpodella branching closest to the apicomplexan clade [3]. Colpodella gonderi and C. tetrahymenae are ectoparasites of cilates [5]. In addition to the rhoptries, trichocysts are also present in several Colpodella species [4]. However, it is unclear what role trichocysts play in prey attacks and what type of proteins define Colpodella trichocysts. Knowledge of Colpodella biology and predatory behavior is crucial for understanding the development of intracellular parasitism among apicomplexans. The use of dyes and antibodies for routine morphological characterization and differentiation of Colpodella species has not been performed previously. To our knowledge, there are no antibodies to Colpodella rhoptry proteins. The purpose of this study was to investigate protein localization and distribution in Colpodella trophozoites and to characterize the different development stages identified by Giemsa staining. The fine structure


DEVELOPMENTAL STAGES OF COLPODELLA SP.

of Colpodella sp. has been described in detail, showing the presence of apical complex organelles, cellular structures and life cycle stages [2, 4, 8]. However, proteins associated with the apical complex organelles, life cycle transformations and myzocytosis have not been identified. In this study we used antibodies prepared against whole rhoptries and the 110 kDa RhopH3 rhoptry protein of Plasmodium merozoites in immunofluorescence assay. The rhoptry specific antibodies are cross reactive among different Plasmodium species. RhopH3 has a role in nutrient uptake in Plasmodium species [7]. We employed the Plasmodium antibodies in the current study with the hypothesis that the antibodies would react with Colpodella rhoptry proteins. We report novel data showing anti-Plasmodium rhoptry antibody reactivity with Colpodella proteins in distinct organelles, providing further evidence in support of conservation of Plasmodium rhoptry proteins in Colpodella sp. The data further shows different developmental stages of trophozoites in Colpodella sp. and identifies the RhopH3 protein as a new marker to aid phylogenetic analyses. Materials and Methods Diprotist culture conditions.  Colpodella sp. (ATCC 50594) (Manassas, Virginia, USA) was cultured with prey species Bodo caudatus in Enterobacter aerogenes bacterized Hay medium (Wards Scientific) (Rochester, New York, USA). The diprotist culture was maintained in tissue culture flasks (Corning) containing 10 ml to 30 ml cultures. Cultures were incubated at 22-24ºC. Cells in tissue culture flasks were observed using an inverted microscope (Nikon TMS, Type 104) under phase microscopy to monitor cell density. Cultures were maintained aseptically. Staining and light microscopy.  For light microscopy, cells were fixed in absolute methanol for 1 min or fixed in 5% formalin (Sigma-Aldrich, St. Louis, MO, USA) for 10 min at room temperature. Formalin fixed cells were smeared on glass slides, air-dried and stained with Giemsa stain (0.4% stock in buffered methanol, pH 6.8 diluted 1:20 in distilled water) (Sigma-Aldrich) for 1-2 min. Slides were rinsed with distilled water, air dried and the cell images were captured using an Olympus CX31 microscope with an Olympus SPOT IDEA U-TVO.5XC-3 camera attachment and analysis performed using SPOT imaging BASIC version 5.3, 2014 Software. Immunofluorescence and confocal microscopy.  Immunofluorescence and confocal microscopy was performed on Colpodella and B. caudatus diprotist cultures fixed in absolute methanol or 5 % formalin as described previously and incubated with rabbit and mouse polyclonal antibodies or mouse monoclonal antibodies; either individually or together in colocalization experiments [9]. Formalin fixed cells were per-

Int. Microbiol. Vol. 20, 2017

179

meabilized with 0.5% Triton X-100 before antibody incubation. Plasmodium falciparum infected human erythrocytes were used as a positive control for the antibodies. Antibodies specific for the 110 kDa high molecular weight P. falciparum and P. berghei RhopH3 protein and antibodies prepared against isolated whole rhoptries of P. falciparum and P. yoelii merozoites were used. The following antibodies were used: Plasmodium whole rhoptry specific antibodies were rabbit antiserum 676 (P. falciparum) and mouse antiserum PYSDS (P. yoelii); Plasmodium RhopH3 specific antibodies were rabbit antiserum 686 (recombinant P. falciparum RhopH3), mouse antiserum His-FLPbRhop-3 [FL] (recombinant P. berghei RhopH3), mouse monoclonal antibody 1B9 (native P. falciparum RhopH3); anti-β-tubulin mouse monoclonal antibody KMX-1 of Physarum polycephalum was also used in IFA. Secondary mouse or rabbit antibodies conjugated to Alexa 488, Alexa 633 and Alexa 647 diluted 1:1000 (Molecular Probes, ThermoFischer Scientific) were used. Normal (preimmune) mouse or rabbit serum (NMS and NRS, respectively), were used as negative controls for IFA. DAPI (4′, 6-diamidino-2-phenylindole) Fluoromount-G (Southern Biotech, Birmingham, AL, USA) was used to mount the slides. Images were collected using a Leica TCS-SP5II upright laser scanning confocal microscope (Leica Microsystems, GmbH, Wetzlar, Germany). SP8 True Scanning Confocal (TCS) on a DMI8 inverted microscope was used to generate differential interference contrast (DIC) images. Giemsa stained and confocal images were adjusted to 300 dpi using the CYMK color mode and RGB color mode on Adobe photo shop (CC). ImageJ was used to change the channel from magenta to red in the IFA images. Confocal microscopy was performed at the Cleveland Clinic, Lerner Research Institute Imaging Core, Cleveland, OH, USA. Transmission Electron Microscopy.  Diprotist culture containing Colpodella was centrifuged and the pellet was fixed in quarter strength Karnovsky fixative solution for 2 hours at room temperature. After washing, the specimen was post fixed for 2 hours in an unbuffered 1:1 mixture of 2% osmium tetroxide and 3% potassium ferrocyanide. After rinsing with distilled water, the specimen was soaked overnight in an acidified solution of 0.25% uranyl acetate. After another rinse in distilled water, they were dehydrated in ascending concentrations of ethanol, passed through propylene oxide, and embedded in a Poly/Bed 812 embedding media (Polysciences, Warrington, PA, USA). Thin sections (70 nm) were cut on a RMC MT6000-XL ultramicrotome. These were mounted on Gilder square 300 mesh nickel grids (Electron Microscopy Sciences, PA, USA) and then sequentially stained with acidified methanolic uranyl acetate and stable lead staining solution. These were coated on a Denton DV-401 carbon coater (Denton Vacuum LLC, NJ), and examined in an FEI Tecnai Spirit (T12) with a Gatan US4000 4kx4k CCD. Electron microscopy was performed at Case Western Reserve University, Electron Microscopy Core, Cleveland, OH, USA.


180

Int. Microbiol. Vol. 20, 2017

Results and Discussion Rhoptry protein identity and distribution in Colpodella sp. trophozoites is unknown. Investigations of the fine structure of Colpodella trophozoites using transmission electron microscopy has revealed the presence of apical complex organelles known as rhoptries, micronemes, conoid and polar rings at the apical end of Colpodella sp. similar to the organelles found in apicomplexan invasive stages [2, 4, 8]. In addition, wet mounts of Colpodella cultures observed with DIC [8] and phase contrast light microscopy [2, 4] allowed construction of the life cycle of Colpodella sp. However, specific proteins associated with the organelles of Colpodella and the transformation of the life cycle stages have not been identified, a necessity for biochemical and molecular investigations aimed at understanding cell development, cellular trafficking, biogenesis of the organelles and their role in myzocytosis. A major goal of this study was to identify Colpodella rhoptry proteins using antibodies specific to Plasmodium merozoite rhoptry proteins. A second goal was to investigate the distribution of rhoptry proteins among the different morphological stages observed by Giemsa staining. In this study, Giemsa staining of Colpodella cultures revealed additional developmental stages associated with the “swimming-feeding-dividing” stages of the trophozoite [2, 4, 8]. There are currently no antibodies specific for Colpodella rhoptry proteins. We therefore used antibodies against Plasmodium rhoptry proteins in IFA to identify trophozoites in the life cycle of Colpodella. Knowledge of specific proteins conserved between apicomplexans and Colpodella species provides additional markers for phylogenetic analyses and organelle isolation. Giemsa staining of the diprotist culture to distinguish Colpodella from B. caudatus revealed additional morphological stages not described previously [2, 4, 8]. Similarly, antibody reactivity with cells in the diprotist culture detected proteins distributed differently among morphological stages and among different cellular structures. We therefore investigated the identity of the morphological forms using antibodies against whole rhoptries of P. falciparum (antiserum 676), P. yoelii (antiserum PYSDS), the RhopH3 protein of P. falciparum (antiserum 686 and Mab 1B9) and P. berghei (His-FLPbRhop-3 [FL]) in IFA. These antibodies are cross reactive with rhoptry proteins among different Plasmodium species. Figure 1A-F shows representative Giemsa stained cells that were observed to have a pale pink cytoplasm, light blue nucleus with very few cytoplasmic inclusions. Additional cells that appeared to be mature forms showed more inclusions and increasingly darker cytoplasm with the presence of two flagella. Anti-Plasmodium rhoptry antibody reactivity with the different types of cells detected distinct “doughnut-shaped” vesicles that defined the apical end of the mature trophozoite. The vesicles were not detected in the “immature” stages (Figure 1, panels A and B, i-iv) following antibody reactivity with 676 (anti-P. falciparum rhoptries/ green) and FL (anti-P. berghei RhopH3 protein/red). Initially, vesicles appeared in small numbers in the cells as shown in

YADAVALLI AND SAM-YELLOWE

panel C, i-iv (FL/red and 676/green) and progressively accumulated at the apical end in mature cells as shown in panels D, i-iv (PYSDS/red and 686/green), E, i-iv (tightly colocalized 676/green and FL/red) and F, i-iv (tightly colocalized 686/green and FL/red). Antiserum 676 has antibody specificities to more than one protein and is therefore reactive with other proteins in addition to RhopH3. This accounts for the additional reactivity observed around the nucleus (Figure 1 A & B, iv) and in the

Fig. 1. Panels A and B; Giemsa stained immature Colpodella trophozoites; C-F, Giemsa stained Colpodella trophozoites showing the development of cytoplasmic structures and flagella. G, Giemsa stained Colpodella cyst. Immunofluorescence staining of Colpodella diprotist culture using antiserum 686 specific for P. falciparum RhopH3 [11], antiserum 676 specific for whole rhoptries of P. falciparum [6], antiserum PYSDS specific for whole rhoptries of P. yoelii treated with SDS and recombinant His-FLPbRhop-3 (FL) protein of P. berghei [10]. Cells were fixed with methanol alone or fixed with 5% formalin followed by permeabilization with 0.5% TritonX-100. Cells were incubated with antiserum 686 (1:100), 676 (1:100), PYSDS (1:200) and His-FLPbRhop-3 (1:200) followed by incubation with ALEXA-488 Goat anti-rabbit antibody (1:1000) and ALEXA 633 Goat anti-mouse antibody (1:1000). Smears were mounted with DAPI Fluoromount-G (Southern Biotech) for nuclear staining. Panels A-C, i-iv colocalization of 676 (green) and FL (red) antibodies; D, i-iv colocalization of PYSDS (red) and 686 (green) antibodies; E, i-iv 676 (green) and FL (red) antibodies; F and G, i-iv 686 (green) and FL (red).


DEVELOPMENTAL STAGES OF COLPODELLA SP.

cytoplasm (Figure 1C & E, iv). The observation of different morphological forms was suggestive of a sequence of trophozoite development in the Colpodella life cycle and we propose that the vesicles develop and become functional as the trophozoites mature. Our rationale for the selection of images representing stage development in Colpodella sp. life cycle was based on the appearance of the nucleus in the different stages observed and the appearance of the “doughnut-shaped” vesicles and flagella as the cells matured in later stages. We also based our rationale for stage development and differentiation in the trophozoite on knowledge of trophozoite stages among apicomplexans. Young blood stage trophozoites of Plasmodium do not possess rhoptries until the mature schizont stage when rhoptries develop in the invasive merozoite stage within schizonts. The images in Figure 1 were selected and organized to show the proposed developmental sequence based on the morphological forms observed in both Giemsa stained and IFA images. Antibodies against Plasmodium rhoptries were strongly colocalized with RhopH3 specific antibodies and reacted with Colpodella proteins. Giemsa stained cysts were also observed in the diprotist culture and the corresponding cysts also reacted with rhoptry specific antibodies by IFA (panel G). In Figure 2A-D, the doughnut-shaped vesicles were distributed throughout the cytoplasm in mature active Colpodella sp. trophozoites observed in close proximity. The vesicle distribution throughout the cytoplasm was typical of active cultures with increased predatory behavior in Colpodella. Negative control normal rabbit and mouse serum showed no reactivity with Colpodella proteins (Figure 2E-H). Antibody reactivity (686 and Mab 1B9) with

Fig. 2. Imunofluorescence staining of Colpodella and P. falciparum schizont infected erythrocytes with antiserum 686, 676, His-FLPbRhop-3 and monoclonal antibody 1B9 specific for P. falciparum RhopH3. A-D, Cytoplasmic “doughnut” shaped vesicles in trophozoites of Colpodella; E-H, No reactivity was observed on Colpodella with normal mouse and rabbit serum negative controls. I-L, Segmented P. falciparum schizont and trophzoite infected erythrocytes reacted with antiserum 686 and Mab 1B9.

Int. Microbiol. Vol. 20, 2017

181

trophozoites (white dashed circles) and schizonts of P. falciparum 3D7 strain are shown (Figure 2I-L) as a positive control for the rhoptry antibodies used. Anti-RhopH3 (686) and anti-β tubulin antibodies were reacted with diprotist culture samples containing actively feeding Colpodella trophozoites. Intense RhopH3 antibody reactivity (green) was observed around the anterior ends of Colpodella trophozoites containing ingested prey. In Figure 3A-D, Colpodella flagella were detected with anti-β tubulin antibody (red) (white arrow heads). Rhoptry specific antibody (green) also reacted with the flagella (Figure 3D). Three Colpodella cells were observed attached to one B. caudatus (Figure 3E-H). The red arrowhead shows the position of B. caudatus with no reactivity observed with the rhoptry antibody (green). Two Colpodella were observed attached to one B. caudatus (Figure 3I-L). The red arrowhead shows the position of B. caudatus sandwiched between two predators, with no reactivity observed with rhoptry protein specific antibodies. The location of B. caudatus was identified by the nucleus and kinetoplast stained by DAPI. Very faint anti-β-tubulin reactivity was observed with B. caudatus (Figure 3K, red). Cells shown in Figure 3 E-H and 3I-L were formalin fixed and permeabilized

Fig. 3. Immunofluorescence staining of Colpodella diprotist culture with antiserum 686 (1:100 green) and anti-β-tubulin monoclonal antibody KMX-1 of Physarum polycephalum (1:1000, red) [1] followed by incubation with secondary antibodies as described. A-D, merge of antiserum 686, KMX-1 and DAPI showing cell body and flagella reactivity; E-H, merge of antiserum 686, KMX-1 and DAPI. B. caudatus (red arrowhead) surrounded by three Colpodella. DAPI staining identified nuclei; I-L, merge of antiserum 686, KMX-1 and DAPI. B. caudatus (red arrowhead) with two Colpodella attached; M-P, merge of 686 and His-FLPbRhop-3 (FL), “doughnut” shaped vesicles discharged at the apical region of a Colpodella trophozoite in tubular extensions projecting from the apical tip of the cell (yellow arrowhead).


182

Int. Microbiol. Vol. 20, 2017

for IFA and showed slight rounding of the cells following fixation. Cells shown in Figures 3A-D and 3M-P were fixed in absolute methanol for IFA. A doughnut-shaped vesicle appeared to be discharged at the apical tip of Colpodella trophozoites (Figure 3M-P, yellow arrowhead). Based on the observations of vesicles in the process of being discharged or extruded, it is unclear whether the vesicles represent rhoptries or trichocysts. Investigations of other Colpodella species using antibodies to rhoptries and other apical complex organelles will identify and confirm additional conserved proteins and the structures associated with the proteins. Immunofluorescence of Colpodella in diprotist culture was also observed with DIC microscopy. Two Colpodella trophozoites with ingested B. caudatus prey were observed in close proximity (Figure 4). RhopH3 antibody reactivity with vesicles was observed in the cytoplasm and both flagella were stained with anti-β-tubulin (Figure 4, A-E). A single Colpodella trophozoite completing the process of myzocytosis is shown in Figure 4, F-J. The remnant of B. caudatus is indicated by the red arrowhead (Figure 4 F, G and J) showing the nucleus of B. caudatus. Negative controls for IFA reactivity are shown with normal rabbit and mouse serum showing no protein reactivity with cells (Figure 4, K-O) and RhopH3 reactivity is shown with antiserum 686 and β-tubulin reactivity with KMX-1 (Figure 4, P-T) on P. falciparum schizont-infected human erythrocyte as positive control for the antibodies. A longitudinal section of a Colpodella trophozoite with cytoplasmic features is shown in Figure 5. The conoid (C), nucleus (NU), large food vacuole (FV), mitochondria (M) and Golgi (G) were observed. The pellicle (Pe), flagella (FL) and anterior flagella (aF) were also observed. The structural features were similar to those described for other Colpodella sp. [2, 4, 8]. Electron lucent and electron dense spherical vesicles at the apical end were observed and may represent the rhoptries (RH) (Figure 5). Immunoelectron microscopy will be used to confirm the trophozoite stages and structures reactive with antibodies at the apical end of Colpodella sp. Giemsa staining and antibody detection of Colpodella trophozoite proteins will facilitate routine identification of cells in diprotist cultures as well as differentiation of structures present in developmental stages of trophozoites and cysts. Identification of cell stages possessing apical complex organelles will also allow for enrichment of those stages for biochemical and molecular investigations. Important insights regarding the development of intracellular parasitism will be gained by continued biochemical analysis of Colpodella and related Colpodellid species. Plasmodium RhopH3 has a dual role in merozoite invasion and nutrient uptake [7]. Future studies will be aimed at investigations of RhopH3 involvement in myzocytosis. The novel data reported in this study represents the first use of Giemsa staining and antibodies to distinguish stages in the life cycle of Colpodella, and conservation of the 110 kDa RhopH3 protein in Colpodella sp. This data paves the way for biochemical and molecular analysis of Colpodella with the identification of additional molecules to aid phylogenetic analysis of Colpodella sp.

YADAVALLI AND SAM-YELLOWE

Fig. 4. Immunofluorescence staining of Colpodella diprotist culture and P. falciparum schizont-infected erythrocyte using RhopH3 and β-tubulin specific antibodies. DIC (A, F, K, P), DIC plus DAPI merge (B, G, L, Q), RhopH3 antibody reactivity (C, H, M, R), β-tubulin reactivity (D, I, N, S) and merge of both antibody signals with DAPI (E, J, O, T). A-E; Two Colpodella in close proximity, both with ingested prey. F-J; Single Colpodella in attack of single B. caudatus prey with cytoplasmic contents almost completely ingested (red arrowheads F, J and J). Vesicles are stained with anti-RhopH3 antibody and flagella with anti-β-tubulin. K-O; Negative control with normal rabbit and mouse serum showing no protein reactivity with cells. P-T; Positive control for P. falciparum specific antibody showing reactivity with P. falciparum schizont-infected human erythrocyte.

Fig.5. Transmission electron micrograph of longitudinal section of Colpodella (ATCC 50594) showing cytoplasmic organization. Conoid (C) in the rostrum, anterior flagellum (aF), flagella (FL), electron lucent and dense spherical vesicles (rhoptries, RH), mitochondria (M), Golgi (G), food vacuole (FV), nucleus (NU) and pellicle (Pe).


DEVELOPMENTAL STAGES OF COLPODELLA SP. Acknowledgments.  This study was supported by funds from the Cleveland State University Undergraduate Summer Research Award 2017. We acknowledge L. Dulik for technical assistance. Support for L. D. was provided by Cleveland State University Undergraduate Summer Research Award 2017. We thank Drs. J. Drazba and J. Peterson for helpful advice and confocal microscopy at the Lerner Research Institute, Imaging Core of Cleveland Clinic, Cleveland, Ohio. We also thank Dr. H. Fujioka, for advice and help with transmission electron microscopy, Case Western Reserve University, Electron Microscopy Core, Cleveland, Ohio. We are grateful to Dr. B. Li, Cleveland State University for providing anti-β tubulin monoclonal antibody KMX-1. This work utilized a confocal microscope that was acquired with National Institutes of Health SIG grant 1S10OD019972-01. Competing interests.  None declared.

References 1. 2. 3.

Birkett CR, Foster, KE, Johnson, L, Gull, K (1985) Use of monoclonal antibodies to analyze the expression of a multi-tubulin family. FEBS (Fed. Eur. Biochem.Soc.) Lett. 187: 211-218 Brugerolle G (2002) Colpodella vorax: ultrastructure, predation, life-cycle, mitosis, and phylogenetic relationships. Europ J Protistol 38: 113-125 Kuvardina ON, Leander BS, Aleshin VV, Myl’Nikov AP, Keeling PJ, Simdyanov TG (2002) The phylogeny of Colpodellids (Alveolata) using small subunit rRNA gene sequences suggests they are the free-living sister group to apicomplexans. J Eukar Microbiol 49: 498-504

Int. Microbiol. Vol. 20, 2017 4.

183

Mylnikov AP (2009) Ultrastructure and Phylogeny of Colpodellids (Colpodellida, Alveolata). Biology Bulletin, 36: 582-590 5. Olmo JL, Esteban GF, Finlay B J (2011) New records of the ectoparasitic flagellate Colpodella gonderi on non-Copoda ciliates. Int Microbiol 14: 207-211 6. Sam-Yellowe TY, Fujioka H, Aikawa M, Messineo, DG (1995) Plasmodium falciparum rhoptry proteins of 140/130/110 kd (Rhop-H) are located in an electron lucent compartment in the neck of the rhoptries. J Euk Microbiol 42: 224-231. 7. Sherling ES, Knuepfer E, Brzostowski JA, Miller LH, Blackman MJ, van Ooij C (2017) The Plasmodium falciparum rhoptry protein RhopH3 plays essential roles in host cell invasion and nutrient uptake. Elife 2: 6. pii:e23239. Doi:10.7554/eLife.23239 8. Simpson AGB, Patterson DJ (1996) Ultrastructure and identification of the predatory flagellate Colpodella pugnax Cienkowski (Apicomplexa) with a description of Colpodella turpis n. sp. and a review of the genus. Sys Parasitol, 33: 187-198 9. Tsarukyanova I, Drazba JA, Fujioka H, Yadav S P, Sam-Yellowe TY (2009) Proteins of the Plasmodium falciparum two transmembrane Maurer’s cleft protein family, PfMC-2TM, and the 130 kDa Maurer’s cleft protein define different domains of the infected erythrocyte intramembranous network. Parasitol Res 104: 875-891 10. Wang T, Fujioka H, Drazba JA, Sam-Yellowe TY (2006) Rhop-3 protein conservation among Plasmodium species and induced protection against lethal P. yoelii and P. berghei challenge. Parasitol Res 99: 238-252. 11. Yang J-C, Blanton, RE, King CL, Fujioka H, Aikawa M, Sam-Yellowe TY (1996) Seroprevalence and specificity of human responses to the Plasmodium falciparum rhoptry protein Rhop-3 determined by using a C-terminal recombinant protein. Infect Immun 9: 3584-3591.


RESEARCH REVIEW International Microbiology 20(4):184-193 (2017) doi:10.2436/20.1501.01.302. ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Overview of laboratory methods to diagnose Leptospirosis and to identify and to type leptospires Aurélie Marquez1, Zoheira Djelouadji2,Virginie Lattard3 and Angéli Kodjo2* USC 1233 INRA/VAS, Établissement Vetagro Sup, Campus de Lyon, Marcy l’Étoile, France 2 USC 1233 INRA/VAS, Équipe Leptospires, Campus de Lyon, Marcy L’Étoile 3 USC 1233 INRA/VAS, Équipe Anticoagulants, Campus de Lyon, Marcy L’Étoile

1

Received 13 July 2017 · Accepted 20 November 2017 Summary.  Leptospirosis is a virulent zoonosis with a global distribution. Pathogenic spirochetes of the genus Leptospira are responsible for this disease, and the primary animal reservoirs are rodentvvvs. Direct and indirect contact with infected urine constitutes the main route of transmission. Renal failure and advanced abortions are frequently observed in animals affected by leptospirosis, causing serious problems for farms. In humans, there is a high rate of mortality (10 percent), and farmers and persons in contact with water are frequently exposed. However, vaccines and strict prevention measures confer protection against leptospirosis. Serological tests facilitate the detection and identification of leptospire strains. Such tests are based on specific surface antigen recognition and are used for clinical analyses. To determine which serovars circulate in the environment, leptospires must be typed. Molecular methods, such as restriction enzyme-based techniques and the sequencing of specific regions, permit serovar identification. Unfortunately, although there are numerous techniques, they are not very efficient, and thus, new methods must be developed. With the advent of genomic sequencing, a substantial amount of information regarding leptospire genomes is now available, facilitating the selection of regions to discriminate between strains. Typing is important for both epidemiologic purposes and clinical analyses. Keywords: Leptospirosis · zoonosis · methods · diagnosis

Introduction Leptospirosis is a worldwide zoonosis [28] and is considered a re-emerging disease [9]. Leptospirosis affects a large variety of animal species, including humans [9, 28], and is caused by leptospires [2, 28], which are bacteria that belong to the order Spirochaetae. The primary reservoirs are rodents, particularly rats [2, 28, 38, 54]. Generally, these pathogens are carried asymptomatically in the kidney or liver. However, leptospires cause internal injuries to rats, such as lymphoplasmocytic inflammatory infiltration and cell Corresponding author: Angéli Kodjo USC 1233 – Rongeurs Sauvages Vetagro Sup Campus vétérinaire. 1, avenue Bourgelat. 69280 Marcy L’Etoile 0478872555 angeli.kodjo@vetagro-sup.fr

hyperplasia, which have been observed in kidney tubules [5, 33, 49]. Various wildlife species, such as coypus and small mammals (hedgehogs, badgers, etc.), [58] contribute to the environmental persistence and dissemination of leptospires. Many studies have investigated the leptospire carrier status of small mammals [45, 50]. Animal reservoirs accumulate leptospires in their kidneys before excreting them into urine. Contamination-sensitive animals and humans primarily acquire leptospires via indirect contact with infected urine in water and in the environment [9]. However, direct contamination may also occur. The most frequently exposed people are farmers and those who professionally practise aquatic leisure activities. In other populations, the incidence of acquired leptospirosis has begun to decrease. Leptospirosis presents a wide array of symptoms [28], ranging from benign to major disorders and infections. In animals, leptospires provoke symptoms such as abortion or milk-drop syndrome, which result in significant economic losses for


DIAGNOSIS OF LEPTOSPIROSIS AND TYPING OF LEPTOSPIRES

breeders. Human infections are characterised by fever, renal failure or hepatic failure. In some cases, meningitis and pulmonary haemorrhages occur. Overall, the global mortality rate is estimated at approximately 10%, with a maximum of up to 25% in developing countries. Outbreaks are frequently observed in tropical regions, particularly in India [25] and Brazil [32]. Furthermore, the incidence of this disease is increasing in certain tropical regions, such as Malaysia [8]. The World Health Organisation (WHO) estimates the number of severe human cases at approximately 1,000,000 per year [14, 21]. Among European countries, France is the most heavily affected with 600 cases per year, which is the highest number in overseas territories. The control of leptospirosis is complicated due to the large number of serovars, infection sources and variable transmission conditions. Furthermore, control is dependent on local environmental conditions (moisture, temperature, etc.). Control is achieved by regulating reservoirs or reducing infection in animal reservoir populations, such as in dogs or livestock, in addition to human vaccination. To achieve vaccine efficiency, the serovars circulating in a particular region must be identified. Currently, there are only 2 commercially available inactivated human vaccines. The Cuban vaccine (Vax Spiral®) contains whole bacterial cells of the Canicola, Icterohaemorrhagiae and Mozdok serovars, whereas the French vaccine (Spiroleptc®) contains only inactivated Icterohaemorrhagiae cells. In animals, vaccination is available for livestock and dogs, and the composition of commercially available vaccines depends on locally circulating serogroups and regulatory administration. In Europe, the available formulations for livestock contain the unique serovar Hardjo. In the United States, vaccines used on pig farms contain either the single serovar Hardjo or five serovars including Canicola, Grippotyphosa, Icterohaemorrhagiae and Hardjo. In New Zealand, vaccines are composed of 2 serovars, Hardjo and Pomona, or 3 serovars, comprising Hardjo and Pomona as well as Copenhageni. Dog vaccination includes 2 (Canicola and Icterohaemorrhagiae), 3 (Canicola, Icterohaemorrhagiae, and Grippotyphosa), or 4 serovars (Canicola, Icterohaemorrhagiae, Grippotyphosa, and Pomona or Australis depending on the continent). A recently manufactured horse vaccine derived from Pomona bacterin is currently available in the United States. Generally, Bratislava, Pomona and/or Tarassovi are included in commercially available swine vaccines, which are part of the recommended vaccination programmes for pig farms in the United States, Australia and New Zealand. In both humans and dogs, penicillin and doxycycline are used to treat leptospirosis, but their efficacy is low if administered late during disease. Streptomycin is recommended by the World Organisation for Animal Health (OIE) for the treatment of leptospirosis in horses, cattle and other farm animals. Leptospires must be detected quickly due to the risks of infection and for epidemiologic studies. However, there is no rapid detection method for leptospires. It is possible to perform serologic tests on blood samples obtained during the first week of infection, but testing rarely occurs. Thus, the number of infections induced by leptospires is likely underestimated.

Int. Microbiol. Vol. 20, 2017

185

Leptospires, the causative agents of Leptospirosis.  Weil described leptospirosis as severe jaundice in 1886; Weil’s disease was characterised by renal failure and sever haemorrhage [4, 41]. However, he did not isolate or identify the causative agent. Several years later, in 1914, Inada and Ido were the first scientists to identify leptospires after they inoculated a guinea pig liver with the blood of a patient suffering from jaundice and observed a spirochete, naming it Leptospira haemorrhagae. In 1915, they published a paper describing their discovery and suggested this spirochete as the causative agent of Weil’s disease [26]. Leptospires are long and motile bacteria. They have a diameter of 0.1 µm and are 6 to 20 µm in length. The ends of the bacteria are hooked. In the periplasmic space, two flagella are responsible for motility. The flagella are composed of the FlaA and FlaB proteins [2]. Additionally, leptospires have a double membrane structure: an outer membrane that envelops the cytoplasmic membrane and a peptidoglycan cell wall [15]. The outer membrane is composed of lipopolysaccharides (LPS), which are the primary leptospire antigen. Many of the structural and functional proteins found in this membrane are lipoproteins (LipL32, LipL21 and LipL41), integral membrane proteins and the type two secretion system (T2SS) protein secretin. Leptospires are obligate aerobes and grow optimally at 30°C in medium containing vitamins B1 and B12, ammonium salts and long-chain fatty acids as the sole carbon source. These acids are metabolised via beta-oxidation [18]. Ellinghausen-McCullough-Johnson-Harris (EMJH) medium containing oleic acid, bovine serum and polysorbate is often used in culture. One-percent sodium hypochlorite solutions, 70% ethanol, iodine-based and quaternary ammonium disinfectants, 10% formaldehyde, detergents and acids are used to disinfect and inactivate leptospires. Leptospires are sensitive to moist heat (121°C for a minimum of 15 minutes) and are killed by Pasteurisation according to a guideline from the Centre for Food Security and Public Health (CFSPH). Leptospires are detectable in urine and tissues using culture, dark field microscopy (DFM), immuno-staining or PCR techniques [9, 18, 28]. However, leptospirosis diagnosis is difficult due to the wide diversity of symptoms associated with the disease. The quality of diagnosis depends on the analytical parameters. The degree of precision of specific antibody detection tests such as immuno-specific enzymatic assays (ELISAs) or micro-agglutination tests (MATs) represents an important bias because greater or diminished sensitivity determines the relevance of the results; therefore, the choice of test is an important parameter that must be considered. PCR assays to detect the 16S rRNA gene are efficient during early infection [31]. Classifications: nomenclature.  In 1907, Stimson discovered a spirochete in the kidney of a patient that died from yellow fever. He named the bacteria Spirochaeta interrogans. Until 1989, leptospires were classified as one of two species: saprophytic (Leptospira biflexa) and pathogenic (Leptospira


186

MARQUEZ ET AL.

Int. Microbiol. Vol. 20, 2017

interrogans) [28]. These 2 species were distinguished by serological classification based on their LPS structure and strain reactivity against antibodies; LPS carbohydrate fragments give rise to antigenic diversity. A serogroup includes serovars with overlapping antigenic factors [17]. Cross agglutination absorption test (CAAT) analysis, which involves the recognition of antibodies with associated antigens, facilitates the identification of a strain serovar or the comparison of two or more strains. Two strains with more than 10% heterogeneity are considered associated with different serovars. More than 300 serovars have been identified to date [53]. The serovar Icterohaemorrhagiae is most frequently implicated in human infections. Serovars have been grouped into 24 leptospire serogroups. Both serogroups and serovars are determined using a serology reference test and a MAT. These methods will be discussed in detail in this article. To identify circulating serovars in different regions, different typing methods are employed. It is important to characterise serovar distribution for epidemiologic purposes and vaccine design.

Leptospire genomic classification is based on DNA-DNA hybridisation and has permitted the separation of the two previously described species into 22 distinct genomospecies. The genus Leptospira is composed of 10 pathogenic species, 5 potentially pathogenic species (also called intermediate) and 7 saprophytic species [2, 11] (Table 1). Leptospire species are geographically distributed. For example, in metropolitan France, leptospirosis in both humans and animals is attributable to strains belonging either to Leptospira interrogans, Leptospira kirschneri or Leptospira borgpetersenii. Genomic and serological classifications are independent and uncorrelated, but a species name and serovar name must be given for a characterised strain. A large variety of methods have been used characterise the serologic and genomic diversity of leptospire strains. These methods are useful for epidemiologic purposes and to track outbreaks. The first techniques were developed to identify and type leptospiral isolates because the information provided by serological classification was insufficient. This review will list and

Table 1.â&#x20AC;&#x201A; Genomic species of genus Leptospira and associated reference strains Categories

Pathogenic

Intermediate

Saprophyte

Species

Serogroup

Serovar

Type strain

L. interrogans

Icterohaemorrhagiae

Copenhageni

Fiocruz LI-130

L. kirschneri

Grippotyphosa

Grippotyphosa

Moskva V

L. noguchii

Panama

Panama

CZ 214 K

L. borgpetersenii

Sejroe

Sejroe

M84

L. weilii

Celledoni

Celledoni

Celledoni

L. santarosai

Tarassovi

Atlantae

LT81

L. alexanderi

Manhao

Manhao 3

L60

L. alstonii

ND

Sichuan

79,601

L. kmetyi

ND

ND

Bejo-Iso 9

L. mayottensis

-

-

200901116T

L. wolffii

ND

ND

Korat-H2

L. licerasiae

ND

Varillal

VAR010

L. inadai

Tarassovi

Kaup

LT64-68

L. fanei

Hurstbridge

Hurstbridge

BUT6

L. broomii

Undesignated

ND

5399

L. wolbachii

Codice

Codice

CDC

L. meyeri

Semaranga

Semaranga

Veldrat

L. biflexa

Semaranga

Patoc

Patoc I

L. vanthielii

Holland

Holland

WaZ Holland

L. terpstrae

ND

ND

LT 11-33

L. yanagawae

Semaranga

Saopaulo

Sao Paulo

L. idonii

-

-

Eri-1 (T)


DIAGNOSIS OF LEPTOSPIROSIS AND TYPING OF LEPTOSPIRES

explain the diagnostic and typing methods used for leptospiral analysis and serovar discrimination because serovars are the taxonomic reference units. Laboratory diagnosis of Leptospirosis Direct observation.  When leptospirosis is suspected due to symptoms such as renal insufficiency, patient blood, cerebrospinal fluid and urine samples are observed under a microscope to detect the presence of bacteria. Leptospires are easily and quickly detected, allowing serologic tests to be avoided. Furthermore, it is possible to administer specific treatments to patients in a short period of time. However, if the bacterial numbers are low, bacteria may not be detected in the samples, and thus, other test are required (culture, PCR, and serology). Notably, the direct observation of leptospires requires technical skill. Therefore, this method is not routinely employed. Culture in specific medium.  Leptospires replicate in media enriched with B1 and B12 vitamins, long-chain fatty acids and ammonium salts [2]. Usually, cultures in EMJH medium are performed to detect leptospires in fresh tissues, blood or urine, but leptospires must be cultured before antibiotic treatment is applied. Some contaminants are inhibited by 5-fluorouracil [24, 37], although its limited antibacterial spectrum permits other contaminants to grow [52, 59, 65]. Other antimicrobial agents are also applicable [18, 28]. Cultures are incubated for up to 13 weeks at 30°C and regularly examined by DFM to determine if a sample is negative for leptospires. As such, cultures are not useful as a routine diagnostic test for individual patients, but they allow strains to be isolated and analysed for epidemiological studies.

Int. Microbiol. Vol. 20, 2017

187

Serology.  MATs for routine analyses.  To detect leptospirosis, specialised laboratories perform MATs on patient sera. MATs involve the detection of leptospire-specific patient antibodies that recognise antigens from known strains. This recognition results in agglutination that is observable by DFM. Several serogroups are routinely tested. The MAT test determines the serogroup but is not sufficiently precise to identify serovars because cross-reactivity frequently occurs between serovars within a given serogroup as well as between serogroups. As a serological reference test, the MAT test is highly sensitive and specific but requires live cultures of different serovars from specific geographical areas as controls. Furthermore, this technique does not discriminate between antibodies derived from infection or vaccination, and thus, it is important to know the vaccination history of the patient, including for the veterinary diagnosis of animal leptospirosis because vaccination is widely spread, particularly in dogs. Certain quality assurance programmes, such as th e International Leptospirosis MAT, are endorsed by the International Leptospirosis Society (ILS) to ensure reliability and standardisation between laboratories. ELISA.  ELISA tests involve the detection of leptospire-specific IgM and/or IgG in patient sera. This test is advantageous in that it does not require the maintenance of live cultures. Although ELISA tests detect leptospire-specific antibodies, results must be confirmed by MAT tests. Therefore, ELISA tests alone do not assure a definitive diagnosis. ELISAs have been developed for numerous antigen preparations and for leptospiral recombinant lipoproteins, such as LipL32 or LigA. IgM is detectable 5 to 7 days after infection; thus, ELISA assays must be performed at the proper time, resulting in a certain degree of difficulty [1, 7, 44, 47] (Table 2).

Table 2. Comparison of MAT, ELISA and Immunomigration sensitivity and specificity values in percentages

Sensitivity

Days

MAT

ELISA

1-7

41

71,1

8-30

82

88,2

>30

96

76,2

Reference Days

Specificity MAT

/

ELISA

MAT

ELISA

86,4

/

86,5

85,8

48,7

48,7

95,5

93,8

75

ELISA

MAT

ELISA

1-7 8-30

65,6 and 54,9

83 and 85,7

97,7 and 97,3

>30 Reference

[47]

Specificity

Sensitivity

Specificity

MAT

ELISA

Immunomigration

Immunomigration

97,3

97

98

93,5

[7]and the performance of each was compared with that of the current standard, the microscopic agglutination test (MAT

[48] MAT

Sensitivity

98,5 and 99,1

MAT

ELISA

MAT

ELISA

30

52

99

95

63

89

98

98

76

93

97

94

[16]

[28]


188

Int. Microbiol. Vol. 20, 2017

MARQUEZ ET AL.

Immunofluorescence to detect leptospires.  The principle underlying immunofluorescence is the recognition of a leptospiral surface protein, such as OmpL54 [40], by specific antibodies. Secondary antibodies coupled to a fluorescent stain then bind host-specific antibodies. When samples are observed under a fluorescence microscope, bacterial profiles are detectable. This assay facilitates the rapid identification of leptospires and requires the availability of leptospiral OmpL54-specific antibodies, which recognise surface-exposed protein epitopes. However, these antibodies may not recognise surface protein epitopes in the context of recombinant proteins. Immunomigration.  Rapid immunomigration tests permit the detection of IgM antibodies against pathogenic leptospires in dogs with suspected leptospirosis [27]. This test is performed on blood, plasma and serum samples. The samples and chase buffer are deposited on a test strip and migrate to a line where their antigens are impregnated. If there is sufficient anti-leptospira IgM present in the sample, antibody-antigen complexes accumulate, and a visible coloured band appears. The results are read in ten minutes. Clinical signs exhibited by a dog in association with test positivity indicate clinical leptospirosis. Notably, this test does not detect vaccine-induced antibodies. Furthermore, the test is advantageous in that it may be performed in vet clinics. However, the test may be negative during the very early stage of infection due to low antibody levels. Additional serological tests should then be performed. Importantly, immunomigration tests do not provide information on infecting serovars. Therefore, this test has no epidemiological value and should be reserved only for in-clinic utilisation.

which is problematic if rapid diagnosis is required. Medical and veterinary practitioners must be informed early in the case of infection. Thus, real-time PCR assays are specialised to target different genes to distinguish between pathogenic or non-pathogenic leptospires via simple curve interpretation. SYBR Green fluorescence assays utilising the lipL32 gene, which encodes the outer membrane LipL32 protein, employ a target sequence of 423 base pairs [22] due to gene conservation among pathogenic serovars. Analytical tests are performed on human serum and urine [29] and animal urine, blood, serum and kidney samples. Assays employing the secY gene have also been performed; all 56 strains tested were amplified. The advantages of this method include its speed, quantitative results, minimal sample contamination, high sensitivity and specificity and standardisation. However, it is expensive and requires specific materials [34].

PCR methods.

Restriction fragment length polymorphism (RFLP) techniques.  The restriction endonuclease analysis (REA) method has been extensively used as a molecular typing method to differentiate between bacterial strains [19, 46]. Restriction enzyme methods allow the direct comparison of strain profiles in agarose or acrylamide gels. Briefly, total bacterial DNA undergoes endonuclease restriction by endonucleases followed by fragment separation on gels. It is difficult to detect polymorphisms in total genomes, and therefore, alternative methods, such as PCR amplification followed by restriction enzyme adjunction, have been developed. For example, EcoRI and Hlal have been used to type Leptospira interrogans [63]. DNA fragments are separated in an agarose gel, facilitating the detection of several zones associated with polymorphisms. The method is able to differentiate between 29 serovars [16, 43]; there are no differences between two strains belonging to the same serovar [63]. Furthermore, this method is used to characterise pathogenic species but not saprophytes. Advantageously, DNA sequences are not required, costs are lower than MAT, and results are easily reproducible [16]. RFLP analysis of rRNA genes is used for to identify and characterise leptospire species in sample isolates [23, 39], a

Classic PCR.  A PCR assay involving the amplification of an rrs gene fragment has been developed, permitting the identification of bacterial strains from the genus Leptospira; DNA from other spirochetes, such as Borrelia, is not amplified. This method is applicable for blood, urine and tissue samples [31]. The PCR amplification of ribosomal RNA 16S subunit sequences identified by Mérien et al. in 1992 provides highly significant results for leptospire detection and species identification but not for serovar classification. To distinguish between pathogenic and non-pathogenic strains, the amplified DNA should be sequenced. It is feasible to sequence a whole bacterial genome and compare it to a database to determine whether it is a leptospire, but this test is not used routinely. Detection of leptospires by real-time PCR.  Currently, it is possible to diagnose leptospirosis from paired serum samples by detecting seroconversion in conjunction with the MAT test. PCR assays were developed due to the need for a rapid and precise molecular diagnostic to detect pathogenic leptospires. Classic PCR analyses, particularly sequencing, are time consuming,

Serotyping.  Serotyping is important in epidemiology because it allows the identification of the serogroup or serovar carried by an animal reservoir [11]. MAT is used for epidemiologic purposes to identify unknown strains. In this test, a panel of serovar-specific antibodies produced in rabbit serum is tested against a sample to observe any agglutination. The strain in a sample belongs to the serovar demonstrating agglutination; if there is more than one agglutination reaction, the sample belongs to the serogroup demonstrating the highest antibody titres. This method requires the growth of bacteria to obtain sufficient concentrations for testing. Molecular methods to type leptospires.


DIAGNOSIS OF LEPTOSPIROSIS AND TYPING OF LEPTOSPIRES

technique called ribotyping. Ribotyping permits determination at the species level but not the subspecies level, e.g., serovars [51]. Extracted DNA is digested by one or more restriction enzymes. Fragments are separated on an agarose gel, and the denatured DNA is hybridised to a membrane with a 16 rRNA probe. Variations are introduced by alternating the restriction enzymes, resulting in a bank of profiles for each enzyme. Ribotyping correlates well with the phylogenetic classification of 11 leptospire species. The use of three restrictions enzymes with PCR products generates patterns that permit serovar discrimination. However, this method does not distinguish between the Icterohaemorrhagiae and Copenhageni serovars, which is problematic in epidemiologic investigations [23]. Additionally, designed primers do not discriminate between pathogenic and non-pathogenic species of leptospires. Therefore, this assay does not detect sample contamination by saprophytic bacteria. The primers designed by Gravekamp et al. in 1991 do not amplify Leptospira kirschneri serovars. Therefore, two pairs of primers must be used to detect all leptospire serovars [12]. rRNA RFLP is performed to generate bacterial phylogenetic trees. It is possible to PCR amplify fragments of interest before performing RFLP to ensure protocol optimisation, thus permitting readable bands to be obtained. Amplification fragment length polymorphism (AFLP) involves the PCR amplification of restriction fragments selected from total genomic DNA [55]. The protocol consists of three steps. First, DNA matrix restriction and adapter ligation are performed. Second, restriction fragment sets are amplified. Finally, amplified fragments are analysed on a gel to read the results. The adapter and restriction site sequences are target sites for primer annealing at the end of PCR amplification of restriction fragments, at which point the primers amplify only nucleotides in close proximity to restriction sites. Using this method, it is possible to study restriction fragments without knowing their nucleotide sequences. Many fragments undergo co-amplification, and approximately 50 to 100 restriction fragments may be analysed simultaneously on polyacrylamide gels depending on the capacity of the detection system. Samples are grouped by computers for analysis, although this approach requires large amounts of purified DNA. Additionally, this technique permits the study of DNA of various origins. Pulsed-field gel electrophoresis (PFGE).  PFGE is the standard method for molecular typing and involves the in-gel enzymatic digestion and electrophoretic separation of different DNA fragments. Both DNA liberation after cell lysis and DNA digestion are performed in a gel after embedding bacteria in agarose. Enzymes such as NotI cut rare DNA sequences, generating high-molecular-weight fragments, which are further separated by pulsed-field electrophoresis. This facilitates the simple comparison of profiles and therefore it is the reference method for typing. PFGE is a powerful method for species identification. To increase the efficiency of this technique, scientists have developed gel analysis software to compare strain profiles between laboratories using dendrograms [20]. However, this

Int. Microbiol. Vol. 20, 2017

189

method does not work when there are fewer than 3 generated fragments. Additionally, approximately 10 percent of serovars cannot be identified [20]. Leptospires are difficult to culture, causing difficulty when an environmental strain must be isolated and cultured for PFGE. Furthermore, PFGE requires a whole bacterial genome to identify the serovar of a strain. Insertion sequence (IS) typing methods.  IS elements are useful for typing, particularly for epidemiologic purposes. The first element identified for pathogenic Leptospira interrogans was IS1500, which has been found in two closed serovars. Nucleotide sequence revealed a 1236-bp element surrounded by a 1159-bp region containing four open reading frames (orfA-orfD). This sequence has been found in all pathogenic strains but not in saprophytes such as Leptospira biflexa [10]. Therefore, it is valuable for the identification of pathogenic Leptospira. The second IS, IS1502, contains 19 ORFs [64]. IS1502 is found only in some strains. Additionally, IS1533 was identified in Leptospira borgpetersenii [61] and is used to identify leptospire serovars. Arbitrarily primed PCR (AP PCR) [56] and randomly amplified polymorphic DNA (RAPD) [57].  These two methods are based on hazard priming PCR and allow the rapid identification of species as well as serovar comparison [13]. These techniques were used for epidemiologic studies in India [36]. Briefly, primers with arbitrary sequences that have few chances of undergoing auto-amplification and variable G-C percentages (between 40 and 80%) are chosen. For AP PCR, bacterial DNA is amplified by performing low stringency PCR, which, in contrast to high stringency PCR, consists of decreasing hybridisation temperatures and increasing concentrations of MgCl2 in the reaction mix. After the amplification of sequence targets by PCR with these primers, the results are read on an agarose or polyacrylamide gel. Forty-eight reference leptospiral strains have been classified using AP PCR [42]. For the RAPD method, one pair of primers is used to amplify random DNA fragments. Although they are highly efficient, these tools demonstrate weak value for serovar typing because of their low reproducibility. Variable number tandem repeat (VNTR).  The VNTR method was developed for epidemiologic studies to speculate on strain circulation between animal species in the environment. VNTR describes the profiles of 94 serovars based on the repetition of short sequences located in three to five genomic regions (Figure 1). These genomic regions consist of short patterns repeated different numbers of times depending on the locus, and the number of repetitions is serovar-specific. DNA extracted from samples is amplified by PCR with specific primer pairs for each locus. Then, the samples are run on an agarose gel using low voltage for four hours to ensure maximum precision. The profiles are read using UV and compared with known profiles in a database to deduce the infecting serovar. VNTR was used to define a new and unique group of Leptospira interrogans serovars, called Pomona, in California sea lions [62]. VNTR is reproducible, easily standardised, and permits the identification


190

Int. Microbiol. Vol. 20, 2017

MARQUEZ ET AL.

Fig. 1. Schema of Variable Number Tandem Repeat (VNTR).

of strains from three species, specifically Leptospira interrogans, Leptospira borgpetersenii and Leptospira kirschneri, which are the only species present in France according to a recent study of 28 wild species [6]. Multi-locus VNTR analysis (MLVA).  MLVA was initially developed to study strains from the Leptospira interrogans serovar Australis in Australia. Scientists searched for tandem repeat sequences in the genome of the strain Leptospira interrogans serovar Copenhageni strain Fiocruz L1-130 [35] and evaluated them for diversity. They selected six loci for analysis and identified thirty-nine distinct patterns within thirty-nine reference strains. When applied to serovar Australis, three clusters were distinguished from different animal and human hosts. MLVA was further applied in Argentina to analyse the relationships between leptospire infections over 45 years. Researchers studied genetic diversity in a collection of 16 strains of Leptospira interrogans serovar Pomona and analysed 7 loci using VNTR as described by Majed et al. [30]. The VNTR4 locus presented four different alleles that demonstrated the highest diversity within the tested group of loci. Clustering analysis permitted four new MLVA genotypes to be distinguished, one of which dominated over the other three. Like VNTR, this method is useful for both diagnostic and epidemiological analyses. Multi-locus sequence typing (MLST).  MLST is a method based on the PCR amplification of DNA sequences to study the allelic diversity of selected genes. There are two types

of MLST. MLST was first developed to genotype leptospires based on the DNA sequences of 4 housekeeping genes and two gene candidates: adk, icdA, lipL32, lipL41, rrs and secY. Scientists analysed a set of 120 strains and 41 references from different locations and found the six most variable genes included adk, icdA and secY [3]. Another study identified pntA, sucA, pfkB, tpiA, mreA, glmU and fadD [48]. This method, which is used to identify clusters among outbreak isolates, does not require much purified DNA, offering an advantage. However, MLST does not differentiate between serovars Copenhageni and Icterohaemorrhagiae. Despite this shortcoming, it is useful as a routine technique to easily obtain and interpret results. Multi-spacer typing (MST).  MST was developed to type strains from the genomic species Leptospira interrogans and has been employed to identify four dominant serovars in France, specifically, Icterohaemorrhagiae, Australis, Canicola and Grippotyphosa [60]. This technique involves the sequencing of 3 intergenic regions with low selection pressure but with punctual mutations (Figure 2). A genotype number is assigned to the sequence for each region, and a profile is generated for each strain. MST can differentiate between the serovars Copenhageni and Icterohaemorrhagiae. Furthermore, it has been developed for 33 strains that each have been assigned a specific number for each genotype by region and is thus useful for epidemiologic analyses.


DIAGNOSIS OF LEPTOSPIROSIS AND TYPING OF LEPTOSPIRES

Int. Microbiol. Vol. 20, 2017

191

Fig. 2. Schema of Multi Spacer Typing.

Conclusions Leptospirosis is an underestimated disease. With current global warming and climate change conditions, the expansion of leptospires appears more favourable. Infections by these bacteria are highly virulent, particularly in poor countries. Indeed, the development of suburbs and sanitary measures has brought rodents, such as rats, into close contact with humans. The subsequent exposure of populations to leptospirosis agents increases the risk of contamination. Wet weather and contact with puddles promote the cycle of contamination. As mentioned above, wildlife are important maintaining and contaminating of domestic animals, and studies have been conducted to elucidate their role in the leptospirosis cycle. Overall, this pathogen is of great concern and threatens all populations around the world. However, it is unclear whether we possess the tools to combat and prevent leptospirosis. Typing is very important for epidemiologic studies. Knowledge of the serovars circulating in different regions allows us to adapt prevention measures. It is essential to obtain this information to develop efficient vaccines. To prevent leptospirosis, vaccines are available for humans and domestic dogs, cattle and horses. Clinically, these vaccines hold no real value because antibiotics are used to treat all serovars. However, not all serovars possess equivalent virulence, and thus, it is important to characterise the pathogenicity of different serovars. In conclusion, leptospirosis is an important pathological disease caused by a virulent bacterium. Leptospires colonise many animal species, and there is a large variety of potential hosts in which they can proliferate. Additionally, these bacteria can survive for long periods of time in water and affect many organisms over time. Infections are becoming more severe and are responsible for serious adverse outcomes, affecting persons and

animals all over the world. In poor countries, humans come into contact with rats and are readily exposed to leptospirosis due to a lack of hygiene and proximity to waste. The diagnosis of the disease represents a significant problem because bacterial isolation is often required. This step presents real difficulties because leptospires are very fragile, and cultures derived from biological specimens, particularly from animals, may be contaminated. Therefore, molecular methods have attracted great interest in the past decade. However, all typing methods possess certain limitations, specifically the requirement for a large quantity of purified DNA, which is usually difficult to obtain from field samples. Thus, we must continue to develop the sensitivity of these tools. Acknowledgements.  We would like to thank support programme of USC 1233 INRA/VAS and all members of this unit. We would like to thank American Journal Experts for their expertise in english correcting and editing. Competing interests.  None declared.

References 1. 2. 3.

4. 5.

Adler B, Murphy AM, Locarnini SA, Faine S (1980) Detection of specific anti-leptospiral immunoglobulins M and G in human serum by solid-phase enzyme-linked immunosorbent assay. J Clin Microbiol 11: 452–457 Adler B, de la Peña Moctezuma A (2010) Leptospira and leptospirosis. Vet Microbiol 140: 287–296 Ahmed N, Devi SM, Valverde M de los A, Vijayachari P, Machang’u RS, Ellis WA, Hartskeerl RA (2006) Multilocus sequence typing method for identification and genotypic classification of pathogenic Leptospira species. Ann Clin Microbiol Antimicrob 5: 28 Arean VM (1962) The pathologic anatomy and pathogenesis of fatal human leptospirosis (Weil’s disease). Am J Pathol 40: 393-423 Athanazio DA, Silva EF, Santos CS, Rocha GM, Vannier-Santos MA,


192

6.

7.

8. 9.

10. 11. 12. 13. 14.

15. 16.

17. 18. 19. 20. 21.

22.

23. 24. 25.

MARQUEZ ET AL.

Int. Microbiol. Vol. 20, 2017 McBride AJA, Ko AI, Reis MG (2008) Rattus norvegicus as a model for persistent renal colonization by pathogenic Leptospira interrogans. Acta Trop 105: 176–180 Ayral F, Djelouadji Z, Raton V, Zilber A-L, Gasqui P, Faure E, Baurier F, Vourc’h G, Kodjo A, Combes B (2016) Hedgehogs and Mustelid species: Major carriers of pathogenic Leptospira, a survey in 28 animal apecies in France (20122015). PloS One 11: e0162549 Bajani MD, Ashford DA, Bragg SL, Woods CW, Aye T, Spiegel RA, Plikaytis BD, Perkins BA, Phelan M, Levett PN, Weyant RS (2003) Evaluation of four commercially available rapid serologic tests for diagnosis of leptospirosis. J Clin Microbiol 41: 803–809 Benacer D, Thong KL, Min NC, Verasahib KB, Galloway RL, Hartskeerl RA, Souris M, Zain SNM (2016) Epidemiology of human leptospirosis in Malaysia, 2004–2012. Acta Trop 157: 162–168 Bharti AR, Nally JE, Ricaldi JN, Matthias MA, Diaz MM, Lovett MA, Levett PN, Gilman RH, Willig MR, Gotuzzo E, Vinetz JM (2003) Leptospirosis: a zoonotic disease of global importance. Lancet Infect Dis 3: 757–771 Boursaux-Eude C, Saint Girons I, Zuerner R (1995) IS1500, an IS3-like element from Leptospira interrogans. Microbiol Read Engl 141 ( Pt 9): 2165–2173 Cerqueira GM, Picardeau M (2009) A century of Leptospira strain typing. Infect Genet Evol 9: 760–768 C Gravekamp HV de K (1993) Detection of seven species of pathogenic leptospires by PCR using two sets of primers. J Gen Microbiol 139: 1691–700 Corney BG, Colley J, Djordjevic SP, Whittington R, Graham GC (1993) Rapid identification of some Leptospira isolates from cattle by random amplified polymorphic DNA fingerprinting. J Clin Microbiol 31: 2927–2932 Cosson J-F, Picardeau M, Mielcarek M, Tatard C, Chaval Y, Suputtamongkol Y, Buchy P, Jittapalapong S, Herbreteau V, Morand S (2014) Epidemiology of leptospira transmitted by rodents in southeast Asia. PLoS Negl Trop Dis 8: e2902 Cullen PA, Haake DA, Adler B (2004) Outer membrane proteins of pathogenic spirochetes. FEMS Microbiol Rev 28: 291–318 Ellis WA, Montgomery JM, Thiermann AB (1991) Restriction endonuclease analysis as a taxonomic tool in the study of pig isolates belonging to the Australis serogroup of Leptospira interrogans. J Clin Microbiol 29: 957–961 Evangelista KV, Coburn J (2010) Leptospira as an emerging pathogen: a review of its biology, pathogenesis and host immune responses. Future Microbiol 5: 1413–1425 Faine S (1999) Leptospira and leptospirosis. MediSci, Melbourne, Australia Feresu SB, Bolin CA, Korver H, Van de Kemp H (1995) Identification of leptospires of the Pomona and Grippotyphosa serogroups isolated from cattle in Zimbabwe. Res Vet Sci 59: 92–94 Galloway RL, Levett PN (2008) Evaluation of a Modified Pulsed-Field Gel Electrophoresis Approach for the Identification of Leptospira serovars. Am J Trop Med Hyg 78: 628–632 Gouveia EL, Metcalfe J, de Carvalho ALF, Aires TSF, Villasboas-Bisneto JC, Queirroz A, Santos AC, Salgado K, Reis MG, Ko AI (2008) Leptospirosis-associated severe pulmonary hemorrhagic syndrome, Salvador, Brazil. Emerg Infect Dis 14: 505–508 Haake DA, Chao G, Zuerner RL, Barnett JK, Barnett D, Mazel M, Matsunaga J, Levett PN, Bolin CA (2000) The Leptospiral major outer membrane protein LipL32 is a lipoprotein expressed during Mammalian infection. Infect Immun 68: 2276–2285 Hookey JV (1993) Characterization of Leptospiraceae by 16S DNA restriction fragment length polymorphisms. J Gen Microbiol 139: 1681– 1689 Johnson RC, Rogers P (1964) 5-Fluorouracil as a selective agent for growth of Leptospirae. J Bacteriol 87: 422–426 Kanagavel M, Princy Margreat AA, Arunkumar M, Prabhakaran SG, Shanmughapriya S, Natarajaseenivasan K (2016) Multilocus sequence

26. 27. 28. 29. 30. 31. 32.

33. 34. 35.

36.

37. 38. 39. 40. 41. 42.

43. 44.

45.

typing (MLST) of leptospiral strains isolated from two geographic locations of Tamil Nadu, India. Infect Genet Evol 37: 123–128 Kobayashi Y (2001) Discovery of the causative organism of Weil’s disease: historical view. J Infect Chemother 7: 10–15 Kodjo A, Calleja C, Loenser M, Lin D, Lizer J (2016) A Rapid In-Clinic Test Detects Acute Leptospirosis in Dogs with High Sensitivity and Specificity. BioMed Res Int 2016: e3760191 Levett PN (2001) Leptospirosis. Clin Microbiol Rev 14: 296–326 Levett PN, Morey RE, Galloway RL, Turner DE, Steigerwalt AG, Mayer LW (2005) Detection of pathogenic leptospires by real-time quantitative PCR. J Med Microbiol 54: 45–49 Majed Z, Bellenger E, Postic D, Pourcel C, Baranton G, Picardeau M (2005) Identification of variable-number tandem-repeat loci in Leptospira interrogans sensu stricto. J Clin Microbiol 43: 539–545 Mérien F, Amouriaux P, Perolat P, Baranton G, Saint Girons I (1992) Polymerase chain reaction for detection of Leptospira spp. in clinical samples. J Clin Microbiol 30: 2219–2224 Miraglia F, Matsuo M, Morais ZM, Dellagostin OA, Seixas FK, Freitas JC, Hartskeerl R, Moreno LZ, Costa BL, Souza GO, Vasconcellos SA, Moreno AM (2013) Molecular characterization, serotyping, and antibiotic susceptibility profile of Leptospira interrogans serovar Copenhageni isolates from Brazil. Diagn Microbiol Infect Dis 77: 195–199 Monahan AM, Callanan JJ, Nally JE (2009) Review paper: Host-pathogen interactions in the kidney during chronic leptospirosis. Vet Pathol Online 46: 792–799 Musso D, Lascola B (2013) Diagnostic biologique de la leptospirose. Rev Francoph Lab 2013: 39–46 Nascimento ALTO, Ko AI, Martins E a. L, Monteiro-Vitorello CB, et al. (2004) Comparative genomics of two Leptospira interrogans serovars reveals novel insights into physiology and pathogenesis. J Bacteriol 186: 2164–2172 Natarajaseenivasan K, Vijayachari P, Sharma S, Roy S, Sugunan AP, Biswas D, Sehgal SC (2005) Phylogenetic relatedness among leptospiral strains belonging to same serovar recovered from patients with different clinical syndromes. Infect Genet Evol J Mol Epidemiol Evol Genet Infect Dis 5: 185–191 Oie S, Koshiro A, Konishi H, Yoshii Z (1986) In vitro evaluation of combined usage of fosfomycin and 5-fluorouracil for selective isolation of Leptospira species. J Clin Microbiol 23: 1084–1087 Perez J, Brescia F, Becam J, Mauron C, Goarant C (2011) Rodent abundance dynamics and Leptospirosis carriage in an area of hyper-endemicity in New Caledonia. PLoS Negl Trop Dis 5: e1361 Perolat P, Lecuyer I, Postic D, Baranton G (1993) Diversity of ribosomal DNA fingerprints of Leptospira serovars provides a database for subtyping and species assignation. Res Microbiol 144: 5–15 Pinne M, Haake D (2011) Immuno-fluorescence assay of Leptospiral surface-exposed proteins. J Vis Exp JoVE. doi: 10.3791/2805 Plank R, Dean D (2000) Overview of the epidemiology, microbiology, and pathogenesis of Leptospira spp. in humans. Microbes Infect 2: 1265–1276 Ralph D, McClelland M, Welsh J, Baranton G, Perolat P (1993) Leptospira species categorized by arbitrarily primed polymerase chain reaction (PCR) and by mapped restriction polymorphisms in PCR-amplified rRNA genes. J Bacteriol 175: 973–981 Savio ML, Rossi C, Fusi P, Tagliabue S, Pacciarini ML (1994) Detection and identification of Leptospira interrogans serovars by PCR coupled with restriction endonuclease analysis of amplified DNA. J Clin Microbiol 32: 935–941 Smits HL, Ananyina YV, Chereshsky A, Dancel L et al. (1999) International multicenter evaluation of the clinical utility of a dipstick assay for detection of Leptospira-specific immunoglobulin M antibodies in human serum specimens. J Clin Microbiol 37: 2904–2909 Stritof Majetic Z, Galloway R, Ruzic Sabljic E, Milas Z, Mojcec Perko V, Habus J, Margaletic J, Pernar R, Turk N (2014) Epizootiological survey of small mammals as Leptospira spp. reservoirs in Eastern Croatia. Acta Trop 131: 111–116


DIAGNOSIS OF LEPTOSPIROSIS AND TYPING OF LEPTOSPIRES 46. Terpstra WJ, Korver H, Schoone GJ, Leeuwen J v., Schönemann CE, De Jonge-Aglibut S, Kolk AHJ (1987) Comparative classification of Leptospira serovars of the Pomona group by monoclonal antibodies and restriction-endonuclease analysis. Zentralblatt Für Bakteriol Mikrobiol Hyg Ser Med Microbiol Infect Dis Virol Parasitol 266: 412–421 47. Terpstra WJ, Ligthart GS, Schoone GJ (1985) ELISA for the detection of specific IgM and IgG in human leptospirosis. J Gen Microbiol 131: 377–385 48. Thaipadungpanit J, Wuthiekanun V, Chierakul W, Smythe LD, Petkanchanapong W, Limpaiboon R, Apiwatanaporn A, Slack AT, Suputtamongkol Y, White NJ, Feil EJ, Day NPJ, Peacock SJ (2007) A dominant clone of Leptospira interrogans associated with an outbreak of human Leptospirosis in Thailand. PLoS Negl Trop Dis. doi: 10.1371/journal. pntd.0000056 49. Torres-Castro M, Guillermo-Cordero L, Hernández-Betancourt S, Gutiérrez-Ruíz E, Agudelo-Flórez P, Peláez-Sánchez R, Zavala-Castro J, Puerto FI First histopathological study in kidneys of rodents naturally infected with Leptospira pathogenic species from Yucatan, Mexico. Asian Pac J Trop Med. doi: 10.1016/j.apjtm.2016.01.018 50. Turk N, Milas Z, Margaletic J, Staresina V, Slavica A, Riquelme-Sertour N, Bellenger E, Baranton G, Postic D (2003) Molecular characterization of Leptospira spp. strains isolated from small rodents in Croatia. Epidemiol Infect 130: 159–166 51. Turk N, Milas Z, Mojcec V, Ruzic-Sabljic E, Staresina V, Stritof Z, Habus J, Postic D (2009) Molecular analysis of Leptospira spp. isolated from humans by restriction fragment length polymorphism, real-time PCR and pulsed-field gel electrophoresis. FEMS Microbiol Lett 300: 174–179 52. Turner LH (1970) Leptospirosis III Maintenance, isolation and demonstration of leptospires. Trans R Soc Trop Med Hyg 64: 623–646 53. Victoriano AFB, Smythe LD, Gloriani-Barzaga N, Cavinta LL, Kasai T, Limpakarnjanarat K, Ong BL, Gongal G, Hall J, Coulombe CA, Yanagihara Y, Yoshida S, Adler B (2009) Leptospirosis in the Asia Pacific region. BMC Infect Dis 9: 147

Int. Microbiol. Vol. 20, 2017

193

54. Vinetz JM (2001) Leptospirosis. Curr Opin Infect Dis 14: 527–538 55. Vos P, Hogers R, Bleeker M, Reijans M, Lee T van de, Hornes M, Friters A, Pot J, Paleman J, Kuiper M, Zabeau M (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23: 4407–4414 56. Welsh J, McClelland M (1990) Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res 18: 7213–7218 57. Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 18: 6531–6535 58. Wong M, Katz AR, Li D, Wilcox BA (2012) Leptospira infection prevalence in small mammal host populations on three hawaiian islands. Am J Trop Med Hyg 87: 337–341 59. Yasuda Y, Togo T, Unemi N, Watanabe S, Harima K, Suzue T (1973) Distribution, excretion and metabolism of N-(2-Tetrahydrofuryl)-5-Fluorouracil (ft-207) by a Bioassay Method. Chemotherapy 21: 1171–1178 60. Zilber A-L, Picardeau M, Ayral F, Artois M, Demont P, Kodjo A, Djelouadji Z (2014) High-Resolution typing of Leptospira interrogans strains by multispacer sequence typing. J Clin Microbiol 52: 564–571 61. Zuerner RL (1994) Nucleotide sequence analysis of IS1533 from Leptospira borgpetersenii: identification and expression of two IS-encoded proteins. Plasmid 31: 1–11 62. Zuerner RL, Alt DP (2009) Variable nucleotide tandem-repeat analysis revealing a unique group of Leptospira interrogans serovar pomona isolates associated with California sea lions. J Clin Microbiol 47: 1202–1205 63. Zuerner RL, Bolin CA (1990) Nucleic acid probe characterizes Leptospira interrogans serovars by restriction fragment length polymorphisms. Vet Microbiol 24: 355–366 64. Zuerner R l., Huang W m. (2002) Analysis of a Leptospira interrogans locus containing DNA replication genes and a new IS, IS1502. FEMS Microbiol Lett 215: 175–182 65. (1967) Current problems in leptospirosis research. Report of a WHO Expert Group. World Health Organ Tech Rep Ser 380: 1–32


FROM 2018 INTERNATIONAL MICROBIOLOGY WILL BE PUBLISHED BY SPRINGER http://www.springer.com/life+sciences/microbiology/journal/10123

International

MICROBIOLOGY Official journal of the Spanish Society for Microbiology

123


List of reviewers The editorial staff of International Microbiology wants to thank the following persons for their invaluable assistance in reviewing manuscripts. •  Ainsa, Jose Antonio   University of Zaragoza; Zaragoza, Spain; ainsa@unizar.es •  Akhtar, Parvez   University of Pittsburgh; Pittsburgh, PA, USA; paa13@pitt.edu •  Antón, Josefa   University of Alicante; Alicante, Spain; anton@ua.es •  Bedmar, Eulogio   Biological station of El Zaidín; Granada, Spain; eulogio.bedmar@eez.csic.es •  Berenguer, Jose   Autonomous University of Madrid; Madrid, Spain; jjberenguer@cbm.csic.es •  Berlanga, Mercedes   Unversity of Barcelona; Barcelona, Spain; mberlanga@ub.edu •  Bordons, Albert   University Rovira Virgili; Tarragona, Spain; albert.bordons@urv.cat •  Calvio, Cinzia   Università degli Studi di Pavia; Pavia, Italy; cinzia.calvio@unipv.it •  Campoy, Susana   Autonomous University of Barcelona; Barcelona, Spain; Susana.Campoy@uab.cat •  Carli,Tayfun K.   Uludag University; Bursa, Turkey; tayfun@uludag.edu.tr •  Cerri, Domenico   University of Pisa; Pisa, Italy; domenico.cerri@unipi.it •  Chapman, Matthew   University of Michigan; Ann Arbor, MI, USA; chapmanm@umich.edu •  Charles, An Susan   Lousiana State University; Baton Rouge, LA, USA; anu.charles@gmail.com •  Chu, Justin J. Hann   National University of Singapore; Singapore; miccjh@nus.edu.sg •  Daffonchio, Daniele   King Abdullah Univer of Science and Technology; Thuwal, King of Saudi Arabia; daniele.daffonchio@kaust.edu.sa •  Dangi, Anil   Northwestern University; Evanston, IL, USA; anil.dangi@northwestern.edu •  del Rey, M.a Teresa   Agencia de Medio ambiente y Agua de Andalucía; Huelva, Spain; mteresa.rey.wamba@juntadeandalucia.es •  Fang, Wenwen   BartelLab; Cambridge, MA, USA; fang.wenwen@gmail.com •  Garmendia, Juncal   Biomedical Research Centre, CSIC; Pamplona, Spain; juncal.garmendia@unavarra.es •  Gil, José Antonio   University of Leon; Leon, Spain; jagils@unileon.es •  Gola, Susanne   National Center for Biotechnology; Madrid, Spain; sgola@cnb.csic.es •  González Pastor, Eduardo   Centro de Astrobiología, CSIC.; Torrejón Ardoz, Madrid; gonzalezpje@cab.inta-csic.es

•  Guarro, Josep   University Rovira Virgili.; Reus, Spain; josep.guarro@urv.cat •  Guillamon, Jose Manuel   IATA, CSIC.; Paterna, Spain; guillamon@iata.csic.es •  Herrero, Enric   University of Lleida.; Lleida, Spain; enric.herrero@cmb.udl.cat •  Hu, Yi   Drexel University ; Philadelphia, PA, USA; yihu.bnu@gmail.com •  La Ragione, Robert   Veterinary Laboratories Agency; Surrey, England; r.laragione@surrey.ac.uk •  Llamas, Inmaculada   University of Granada; Granada, Spain; illamas@ugr.es •  López García, Paloma   Center for Biological Research; Madrid, Spain; plg@cib.csic.es •  López, Guillermo   Instituto de Biología de la Conservación; guiloza@gmail.com •  Magni, Christian   Inst of Molecular and Cellular Biology; Rosario, Argentina; magni@ibr-conicet.gov.ar •  Martínez, Jose Luis   National Center for Biotechnology; Madrid, Spain; jlmtnez@cnb.csic.es •  Montesinos, Emili   University of Girona; Girona, Spain; emonte@intea.udg.edu •  Nikel, Pablo   Technical University of Denmark; Lyngby, Denmark; pablo.nikel@cnb.csic.es •  Nozhevnikova, Alla   Russian Academy of Sciences; Moscow, Russian Federation; nozhevni@mail.ru •  Quindós, Guillermo   University of Basque Country.; Bilbao, Spain; guillermo.quindos@ehu.es •  Requena, José María   Autonomous University of Madrid; Madrid, Spain; jmrequena@cbm.csic.es •  Rivilla Palma, Rafael   Autonomous University of Madrid; Madrid, Spain; rafael.rivilla@uam.es •  Rocha, Javier   Institute of Catalyis and Petrochemistry ; Madrid, Spain; javirocha@icp.csic.es •  Rosselló Mora, Ramon   University of Balearic Island; Palma de Mallorca, Spain; rossello-mora@uib.es •  Rua, Marisa   University of Vigo; Vigo, Spain; mlrua@uvigo.es •  Smani, Younes   University of Sevilla; Sevilla, Spain; y_smani@hotmail.com •  Van Dillewijn, Pieter   Experimental Station El Zaidín, CSIC.; Granada, Spain; pieter.vandillewijn@eez.csic.es •  Vila, Jordi   University of Barcelona ; Barcelona, Spain; jvila@ub.edu •  Wei, Sean   University of Technology; Auckland, New Zealand; sean.wei@aut.ac.nz


General Information International Microbiology is a quarterly, open-access, peer-reviewed journal in the fields of basic and applied microbiology. It publishes research articles, reviews and complements (editorials, perspectives, books, reviews, etc.).

Creative Commons The journal is published under a Creative Commons AttributionNonCommercial-ShareAlike 4.0 International.

Aims and scope International Microbiology, the official journal of the SEM, is a peer-reviewed, open access journal whose aim is to advance and disseminate information in the fields of basic and applied microbiology among scientists around the world. The journal publishes research articles, reviews and complements (editorials, perspectives, books, reviews, etc.). A feature that distinguishes it from many other microbiology journals is a broadening of the term “Microbiology” to include eukaryotic microorganisms (protists, yeasts, molds), as well as the publication of articles related to the history and sociology of microbiology. International Microbiology, offers high-quality, internationally-based information, short publication times, complete copy-editing service, and online open access publication available prior to distribution of the printed journal. The journal encourages submissions in the following areas: – Microorganisms (prions, viruses, bacteria, archaea, protists, yeasts, molds) – Microbial biology (taxonomy, genetics, morphology, physiology, ecology, pathogenesis) – Microbial applications (environmental, soil, industrial, food and medical microbiology, biodeterioration, bioremediation, biotechnology) – Critical reviews of new books on microbiology and related sciences are also welcome. Submission Manuscripts must be submitted by the corresponding author to the new managing system http://www.springer.com/life+sciences/microbiology/journal/10123. As part of the submission process, authors are required to comply with the following items, and submissions may be returned if they do not adhere to these guidelines: 1. The work described has not been published before, including publication on the World Wide Web (except in the form of an Abstract or as part of a published lecture, review, or thesis), nor is it under consideration for publication elsewhere. 2. All the authors have agreed to its publication. The corresponding author signs for and accepts responsibility for releasing this material and will act on behalf of any and all coauthors regarding the editorial review and publication process. 3. The manuscript has been prepared in accordance with the journal’s accepted practice, form, and content, and it adheres to the stylistic and bibliographic requirements outlined in the web page

http://creativecommons.org/licenses/by-nc-nd/4.0/

Until 2017, all articles in International Microbiology will be available on the Internet to any reader as Open Access. The journal allows users to freely download, copy, print, distribute, search, and link to the full text of any article provided the authorship and source of the published article is cited, it is not used for commercial purposes and it is not remixed, transformed, or built upon. We recommend authors read about the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License before submitting their paper. Throughout 2018, the International Microbiology will be published by Springer, with specific policies described in http://www.springer.com/life+sciences/ microbiology/journal/10123 Open Access and Article-Processing Charges Open Access publishing provides immediate, permanent, free online access to the full texts of all the journal’s peer-reviewed research articles. It allows all interested readers to view, download, print, and/or redistribute any article without requiring a subscription on the principle that making research freely available to the public supports a greater global exchange of knowledge. Until the end of 2017, the journal’s expenses per article is 900.00 €. If a manuscript requires extensive editorial work or English edition, an extra charge may be requested. Individual waiver requests must be done during the submission process and will be considered on a case-to-case basis. Information for Subscribers

Disclaimer While the contents of this journal are believed to be true and accurate at the date of its publication, neither the authors and editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no guarantee, expressed or implied, with regard to the material contained therein.

International Microbiology is published quarterly (March, June, September and December). Recommended annual subscription is 350.00 €, plus shipping and handling. Single-issue prices are available upon request. Cancellations must be received by 30 September to take effect at the end of the same year. Change of address: allow six weeks for all changes to become effective. Please contact s.org if you have any questions regarding your subscription.


INTERNATIONAL MICROBIOLOGY OFFICIAL JOURNAL OF THE SPANISH SOCIETY FOR MICROBIOLOGY

Volume 20 · Number 4 · December 2017 · pp. 151-193

IN MEMORIAM Nombela C Julio R. Villanueva, microbiologist, researcher, and mentor of generations of scientists

151

RESEARCH ARTICLES Caruso P, Biosca EG, Bertolini E, Marco-Noales E, Gorris MT, Licciardello C, López MM Genetic diversity reflects geographical origin of Ralstonia solanacearum strains isolated from plant and water sources in Spain Kovacic A, Music MS, Dekic S, Tonkic M, Novak A, Rubic Z, Hrenovic J, Goic-Barisic I Transmission and survival of carbapenem-resistant Acinetobacter baumannii outside hospital setting

155

165

Rolny IS, Racedo SM, Pérez PF Fate of Bacillus cereus within phagocytic cells

170

Yadavalli R, Sam-Yellowe TY Developmental stages identified in the trophozoite of the free-living Alveolate flagellate Colpodella sp. (Apicomplexa)

178

RESEARCH REVIEW Marquez A, Djelouadji Z, Lattard V, Kodjo A Overview of laboratory methods to diagnose Leptospirosis and to identify and to type leptospires

184

INDEXED IN

Agricultural and Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents®/Agriculture, Biology & Environmental Sciences®; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science and Technology Abstracts; ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services®; MEDLINE®/Index Medicus®; Latindex; MedBioWorldTM; SciELO-Spain; Science Citation Index Expanded®/SciSearch®


Turn static files into dynamic content formats.

Create a flipbook