Skip to main content

International Microbiology

Page 1

CONTENTS International Microbiology (2016) 19:183-228 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Volume 19, Number 4, December 2016

RESEARCH REVIEW

Soyer-Gobillard M-O The Arago Laboratory of Banyuls and some of its Academicians

183

RESEARCH ARTICLES

Hernández-Robles MF, Álvarez-Contreras AK, Juárez-García P, Natividad-Bonifacio I, Curiel-Quesada E, Vázquez-Salinas C, Quiñones-Ramírez EI Virulence factors and antimicrobial resistance in environmental strains of Vibrio alginolyticus

191

Silva-Santana G, Lenzi-Almeida KC, Lopes VGS, Aguiar-Alves F Biofilm formation in catheter-related infections by Panton-Valentine leukocidin-producing Staphylococcus aureus

199

Hernández-Vergara JA, Martínez-Santos VI, Radilla-Vázquez RB, Silva-Sánchez J, Vences-Velásquez A, Castro-Alarcón N Characterization of Escherichia coli clinical isolates causing urinary tract infections in the community of Chilpancingo, Mexico

209

ANNUAL INDEXES PIONEERS IN MICROBIOLOGY: Paulina Beregoff (1902–1989), Colombia

217 A2

Journal Citations Reports 5-year Impact Factor of International Microbiology is 2,17. The journal is covered in several leading abstracting and indexing databases, including the following ones: Agricultural & Environmental Bio­­technology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents/Agriculture, Biology & Environmental Sciences; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science & Technology Abstracts; ICYT/CINDOC; IBECS/ BNCS; ISI Alerting Services; MEDLINE/Index Medicus; Latindex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; SciSearch.

A1


Front cover legends known species). Photos by Rubén Duro, Center for Microbiological Research (CIM), Barcelona. (Magnification, 500×) Upper left. Papillomavirus, the causal agent of several human diseases, some of them developing as cancers. Several Spanish groups perform outstanding research on this virus and on the illnesses that it causes. The definitive link between the presence of the papillomavirus and cervix cancer in women was established by Colombian physician and researcher Nubia Muñoz, in Lyon, France. (Magnification, 600,000×)

Center. Composition representing some of the marine protists studied by the researchers at the Arago Laboratory of Banyuls-sur-Mer, to which is devoted the Research Review by Marie-Odile Soyer-Gobillard in this issue (pp. 183-190). The image is composed by a foraminifer (possibly Glo­ bigerina), two species of dinoflagellates (Cera­­ tium and Ostreopsis), and a diatom (unknown species) over a backgroud of microflagellates (un-

Photo by Rubén Duro, Center for Microbiological Research (CIM), Barcelona. (Mag­­ni­fication, 300×) Lower right. Macrophotograph of a growing colony of the mold Aspergillus sp. The colony is growing in a Petri dish. Note the whitish, button -like structure formed by a drop of liquid secreted by the sector on the left. Photo by Rubén Duro, Center for Microbiological Research (CIM), Barcelona. (Magnification, 1.4×)

Upper right. Dark field micrograph of the cyanobacterium Chroococcus sp., isolated from a freshwater pond. Note the envelope surrounding the paired cells. Photo by Rubén Duro, Center for Microbiological Research (CIM), Barcelona. (Magnification, 1500×) Lower left. Dark field micrograph of the predator ciliate Pseudoprorodon sp., isolated from a freshwater lake. Note the pieces of food inside the large digestive vacuoles and the small ciliate being engulfed near the cytostome of the cell on the left.

Back cover: Pioneers in Microbiology Paulina Beregoff (1902–1989), Colombia Paulina Beregoff was the first woman to obtain a degree in medicine in Colombia. She was born in 1902 in Kiev—by then a city of the Russian Empire—, in an aristocratic family of Jewish descent. Due to the political situation in her country, she was educated in the United States, where, in 1921, she graduated in Bacteriology and Parasitology and Pharmacy and Chemistry at the University of Pennsylvania. She started working at the laboratory of Pathology of that university and became a member of the Rivas Bacteriological Society of the University of Pennsylvania. In 1922, the Dean of the School of Medicine of the University of Cartagena, Colombia, asked the University of Pennsylvania for an expert in tropical diseases, including yellow fever. This disease was a great concern in Cartagena due to the high mortality rates it caused and because of the implications on the image of the city, which was a major commercial and harbor center. The University needed a qualified advisor that could also train local physicians, and the University of Pennsylvania chose Beregoff for that task. Once in Cartagena, she had to identify an epidemic outbreak that had been causing many fatalities, mostly among indigenous peoples living in the Magdalena River shores. Colombian phys­ icians were not familiar with symptoms and causal agents of diseases such as yellow fever, typhoid fever and malaria, but thought that the epidemic outbreak could be due to one of them. Beregoff sent samples of cultures

from corpses of people killed by the disease to be analyzed at the University of Pennsylvania. The disease turned out to be fiebre tifomalárica and not simply malaria, as they first had considered. Beregoff thought that the infection depended mostly on the deficiencies or resistance of the immune system and proposed that physicians should work to prevent the disease. Once she had achieved her task, she intended to go back to Philadelphia to study medicine at Temple University, but she was asked to remain in Cartagena, where she could also study medicine. In 1922 she enrolled at the University of Cartagena under special conditions. Due to her previous studies and qualification, she could be waived the first two years of the studies of medicine. She set up the first laboratories of bacteriology and parasitology in Cartagena, with microscopes and other equipment donated by the University of Pennsylvania. Her thesis director recognized her great contribution, she having been able to differentiate the various species of Laveran’s haematozoa, to observe the treponema causing yaws, to find the Piroplasma Donovani, the parasite of KalaAzar (visceral leishmaniasis) in the blood, and having been the first to isolate the “typhoid bacillus”, confirming thus the presence of typhoid fever in town. She could also to properly perform the Wassermann technique on syphilis. The fact that she was a foreign woman and the she had had some privileges in her medicine studies was criticized by some people. In 1933 she married bacteriologist Arthur Stanley Gillow and they moved to Canada. Since then she signed her publications as Pauline Beregoff-Gillow. After her husband’s death, in 1964, she returned to Colombia and dedicated his husband’s legacy to set up a foundation under his name that should work on preventive medicine. She died on September 20, 1989 and left her fortune to the foundation.

Front cover and back cover design by MBerlanga & RGuerrero

A2


RESEARCH REVIEW International Microbiology 19(4):183-190 (2016) doi:10.2436/20.1501.01.Ϯϳϲ. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

The Arago Laboratory of Banyuls and some of its Academicians Marie-Odile Soyer-Gobillard Observatoire Océanologique, Université P. et M. Curie (Paris 6), Banyuls-sur-Mer, France Received 11 September 2016 · Accepted 3 October 2016

Summary. Since its founding in 1881 by Henri de Lacaze-Duthiers (1821–1901), the Arago Laboratory of Banyuls has been one of the three marine stations of the University Pierre and Marie Curie-Paris 6. It is located in Banyuls (Banyuls-sur-Mer) in Northern Catalonia. The center hosts researchers and students from all over the world. Some became famous, including four Nobel Prize winners: André Lwoff (1965), Pierre-Gilles de Gennes (1991), Albert Fert (2007) and Jules Hoffmann (2011). This article focuses on five scientists closely related to the center. The first three are Henri de Lacaze-Duthiers (1821–1901), the founder; Édouard Chatton (1883–1947), eminent director of the center; and André Lwoff (1902–1994), who before being known for his work in bacterial genetics and virology was an outstanding protozoologist under the direction of Chatton. Lynn Margulis (1938– 2011), a great friend of the Arago Laboratory and personal friend of the author, is also remembered. Finally, there is a mention of Walter J. Gehring (1939–2014), professor at the University of Basel, Switzerland. [Int Microbiol 19(4): 183-190 (2016)] Keywords: Arago Laboratory of Banyuls · Lacaze-Duthiers, Henri de (1821–1901) · Chatton, Édouard (1883–1947) · Lwoff, André (1902–1994) · Margulis, Lynn (1938–2011) · Gehring, Walter J. (1939–2014)

Introduction The Arago Laboratory, currently also known as the Oceanological Observatory at Banyuls-sur-Mer (the village of location), was founded in 1881 by Henri de Lacaze-Duthiers (1821–1901). It opened in 1882 under the French name of

Correspondence: M-O. Soyer-Gobillard E-mail: mog66@orange.fr

“Laboratoire Arago,” in honor of the French physicist, mathe­ matician, astronomer and politician François Arago. (François Jean Dominique Arago was born in Estagel, near Perpignan, in the Rousillon, Northern Catalonia, in 1786, and died in Paris in 1853, trying to return to his homeland). The location of the Arago Laboratory on the French Mediterranean coast was decided by Lacaze-Duthiers due to his own interest to study the diversity of organisms and habitats offered by the rocky shore surrounding the village of Banyuls (Banyuls-surMer) (Fig. 1). The original mission of the Laboratory, pre-

This article is an homage to my dearest friend Lynn Margulis (1938–2011) at the fifth anniversary of her death. A part of this article has been based on a publication in Vie et Milieu/Life and Environment 66(2):107-119 (2016), after a lecture given by the author at the Arago Laboratory (14 May 2016) on the occassion of the 350th Birthday of the French Academy of Sciences (1666–2016), by invitation of Dr. Michel Delseny, Academician of Science, Biology Integrative Section.


184

Int. Microbiol. Vol. 19, 2016

SOYER-GOBILLARD

Fig. 1. View of the Arago Laboratory of Banyuls (Banyuls-sur-Mer). (Photograph from http://www la-clau.net/).

served by its eleven directors throughout its 135 years of history (Table 1), was that of promoting education and research in marine sciences, and to allow the general public to discover the marine world. For this reason, in 1885 the public aquarium was opened as a part of the Arago Laboratory. Nowadays, the Arago Laboratory comprises several facilities and is one of the three marine stations managed by the Pierre et Marie Curie University (Paris 6) and the CNRS (the French National Center for Scientific Research). The Arago Laboratory is divided into four main research units: Integrative Biology of Marine Organisms (BIOM); the Laboratory of Microbial Biodiversity and Biotechnology (LBBM); the Benthic Ecogeochemistry Laboratory (LECOB), and the Microbial Oceanographic Laboratory (LOMIC). Some of the researchers and students hosted by the Arago Laboratory became famous, and this paper focuses on five scientists closely related to the center: Henri de Lacaze-Duthiers, founder of the Laboratory and master of experimental zoology [2]. Édouard Chatton (1883–1947), a great protozoologist, pioneer of cell biology, who became

director of the Arago Laboratory, and was the author of splendid painted courseboards passed down to his students. André Lwoff (1902–1994), Chatton’s favourite disciple, and winner of the 1965 Nobel Prize in Physiology or Medicine, who before being known for his work on bacterial genetics and virology was an eminent protozoologist. Lynn

Table 1. Directors of the Arago Laboratory of Banyuls 1882–1900

Henri de Lacaze-Duthiers

1900–1923

Georges Pruvot

1923–1937

Octavio Duboscq

1937–1947

Édouard Chatton

1947–1964

Georges Petit

1964–1976

Pierre Drach

1976–1989

Jacques Soyer

1989–1999

Alain Guille

2000–2005

Gilles Boeuf

2005–2015

Philippe Lebaron

2015–current

Vincent Laudet


THE ARAGO LABORATORY OF BANYULS

Int. Microbiol. Vol. 19, 2016

185

Margulis (1938–2011), evolutionary microbiologist, distinguished Member of the American National Academy of Sciences (1983), and American National Medal of Science winner (1999), who in 1967 proposed the endosymbiosis theory of the origin of the eukaryotic cell, and Walter J. Gehring (1939–2014), who every year came with his students from the University of Basel to the Arago Laboratory.

Henri de Lacaze-Duthiers (1821–1901) Félix Joseph Henri de Lacaze-Duthiers (Fig. 2), anatomist, biologist and zoologist, was born in the castle of Stiguederne, Montpezat (Lot-et-Garonne) and died in Las-Fons (Dordogne). He is regarded as a leading authority in malacology of his time. Second son of the baron Etienne de Lacaze-Duthiers (1791–1868), the young Henri faced opposition from his father when he informed him of his will to undertake studies of medicine and biology in Paris. To survive, he became the assistant of Henri Milne-Edwards (1800–1885), famous for his work on molluscs, crustaceans and anthozoans, and then became zootechnician at the Agronomic Institute of Versailles. In 1851, he defended his thesis in Medicine and, in 1853, his doctoral thesis in Science on “the genital frame of the insects”. In 1854, he obtained a position of Professor of Zoology and occupied the first chair of Biology of the Faculty of Science of Lille, whose Dean was Louis Pasteur (1822–1895). Four years later he initiated the study of corals in Corsica and in the Balearic Islands. In 1863 he was appointed lecturer at the École Normale Supérieure in Paris, and in 1864 Professor at the French National Museum of Natural History to occupy the Chair of molluscs, worms and zoophytes. As Professor of Zoology, Comparative anatomy and Physiology at the Sorbonne, he was the first to engage the field of zoology in experimental research and field studies. He coined the term "experimental zoology" and, in 1872, founded the journal Archives de zoologie expérimentale et générale, which played a major role in the orientation of zoological research at the time. Lacaze-Duthiers must be regarded as the true founder of marine micro-zoology. Author of more than 250 publications, related in particular to corals, molluscs and the tunicates, he was elected member to the French Academy of Sciences in 1871 (section of Anatomy and Zoology). Known worldwide for his discoveries, he was honored in many countries [24]. To offer his students a close proximity to the marine environment, and to facilitate experimentation on live material,

Fig. 2. Henri de Lacaze-Duthiers (1821–1901) in 1887, bearing the Grand Cross of the Legion of Honour and his Science Academy costume. (© Archives of Laboratoire Arago).

Lacaze-Duthiers founded two marine biology laboratories: the biological station of Roscoff in 1872 and the Arago Laboratory of Banyuls-sur-Mer in 1882.

Edouard Chatton (1883–1947) Édouard Pierre Léon Chatton was born in Romont, Switzerland and died in Banyuls-sur-Mer. His grandfather introduced him―at a very young age―to biological sciences and was at the origin of his scientific vocation. He completed his high school studies in the area of Belfort, Switzerland and then went to France to study at the Sorbonne, in Paris, with Yves Delage (1854–1920), former assistant of Lacaze-Duthiers and discoverer of artificial fecundation (chemical). In 1905, at the Arago Laboratory, Chatton discovered a group of protists, parasitic peridinians of the gut of pelagic crustacean copepods, named the blastodinides [3,23] (I had myself the honor to continue the work of Chatton during my Ph.D. thesis by studying the ultrastructure and cycle of these parasites with the modern tools of cell biology [7,11,25]). Maurice Caullery (1868–1958), great zoologist, specialized on invertebrates


186

Int. Microbiol. Vol. 19, 2016

SOYER-GOBILLARD

troops of Southern Tunisia. In 1918, once the war was over, he worked again at the Pasteur Institute in Tunis. During holidays, he went to the Arago Laboratory, where he achieved his doctoral thesis on the parasitic peridinians, which he defended in 1919 [4]. Also in 1919, Chatton was appointed lecturer at the General Biology Chair of the University of Strasbourg. In 1932, he was appointed Professor of Zoology and General Bio­logy at the University of Montpellier, a position that included the direction of the Marine Biology Station in Sète. In 1937, he was appointed Professor of Zoology and Biology at the Sorbonne in Paris and became director of the Laboratories of Banyuls-sur-Mer and Villefranche-sur-Mer. Some years before, in 1933, he had been elected Corresponding Member of the French National Academy of Sciences (now part of the Institut de France). Édouard Chatton was the first biologist to distinguish the fundamental differences between unicellular eukaryotes and prokaryotes, and made an enormous scientific production [5,24]. Some of his works were made in collaboration with his pupils, among them André Lwoff, who occupied a very special place in his life, both as a student and as a friend.

André Lwoff (1902–1994) Fig. 3. Edouard Chatton (1883–1947) and Marie Herre, the day of their wedding in Banyuls (1908). (© Archives of Laboratoire Arago).

and professor at the Faculty of Sciences of Paris, recommended Chatton to enter the Pasteur Institute in the Service of Protozoology and Colonial Microbiology, at that time directed by Felix Mesnil (1868–1938), microbiologist specialized on the sleeping sickness agent, the protozoan Trypanosoma. In 1908 Chatton married Marie Herre (Fig. 3), who later became his collaborator. In 1913, Charles Nicolle (1866–1936), director of the Pasteur Institute in Tunis, awarded with the 1928 Nobel Prize in Physiology or Medicine for his work on typhus, and expert on Leishmania (trypanosomid agent of the visceral leishmaniasis, also known as kala-azar), put him in charge of the study of the etiology of toxoplasmosis, a parasitic disease caused by Toxoplasma gondii. At the beginning of World War I, Chatton was mobilized and went back to France, where he was injured. In 1916, he returned to Tunisia where, in Gabes, he created and directed the Laboratory of bacteriology for the

André Michel Lwoff (Fig. 4) was born in Ainay-le-Chateau (Allier, Auvergne-Rhône-Alpes) where his father was a psychiatrist. He became a fellow at the Institut Pasteur in 1921, as

Fig. 4. André Lwoff (1902–1994) in 1971, when I met him as director of the Villejuif Cancer Research Institute. (Photograph from the personal collection of M–O. Soyer-Gobillard.)


THE ARAGO LABORATORY OF BANYULS

Int. Microbiol. Vol. 19, 2016

187

Fig. 5. Participants in the 5th Meeting of the International Society for Evolutionary Protistology (ISEP), held in the Laboratoire Arago on the Mediterranean seaside, at Banyuls-sur-Mer in June 4-6, 1983. The meeting was directed by Marie-Odile Soyer-Gobillard and hosted some 70 people representing twelve countries (Belgium, Canada, Denmark, England, France, Germany, the Netherlands, Poland, Scotland, Spain, and the USA). Lynn Margulis is the first woman at the right of the picture. Reproduced from [17a,25].

recipient of a grant for his own research [22] and that same year he met Édouard Chatton at the Zoological Station of Roscoff. Chatton was then thirty-eight (Lwoff nineteen) and was lecturer in general biology at the Faculty of Sciences of Strasbourg. This meeting was crucial for both of them. Out of the151 publications of André Lwoff on protozoology, 55 were carried out in collaboration with Chatton, particularly for major works, i.e., a monograph on apostomes, parasitic ciliates with two hosts, crustaceans and coelenterates, with remarkable metamorphoses of their cilia [6], and a monograph on thigmotrich ciliates in 1949 [13] (Fig. 4). In 1925, Lwoff became assistant lecturer at the Pasteur Institute, and in 1927 he defended his medical thesis before becoming the head of a laboratory at the Pasteur Institute in 1929. Chatton and Lwoff continued to publish on protozoology. In 1931, they wondered about the genetic continuity of ciliary systems in foettingeriid ciliates; indeed, kinetosome replication requires not only the reconstruction of a microtubule building in particular and stable geometry but also the conservation of its original polarity. The following year, 1932, Lwoff defended a brilliant science thesis entitled

“Biochemical research on the nutrition of Protozoa”. At that time he had already produced 76 publications on protozoology. In 1938 Lwoff was appointed director of the Department of Microbial Physiology, newly created for him at the Pasteur Institute in Paris, without definitively abandoning his dear protists. In fact, until Chatton’s death, during the summer they worked together on the study of ciliates and other protists either at Banyuls-sur-Mer, Roscoff, Wimereux or Séte. Most of their research on apostome ciliates was carried out in Banyuls [22]. From 1947 to 1950 he regularly taught in the United States at the Harvard Medical School on “Problems of morphogenesis in ciliates”. Many important prizes and honors rewarded his exceptional career and discoveries [24,26], among them the Nobel Prize in Physiology or Medicine, which he shared with Jacques Monod and François Jacob in 1965. Once retired, Lwoff used to spend several months a year in Banyuls. He often visited the Arago Laboratory and was interested in the research on the biology of dinoflagellates and other protists carried out there. André Lwoff died in Paris in 1994.


188

Int. Microbiol. Vol. 19, 2016

SOYER-GOBILLARD

Fig. 6. Left: Lynn Margulis (1938–2011) and André Adoutte (1947–2002) at the 5th meeting of the International Society for Evolutionary Protistology (ISEP) in Banyuls (1983) [17a]. Right: Lynn Margulis (1938–2011) with Marie-Odile Soyer-Gobillard as jury members of the Doctorate Thesis of Toni Navarrete, a student of Prof. Ricardo Guerrero at the Faculty of Biology, University of Barcelona, in 1999. (Photograph from the personal collection of M-O. Soyer-Gobillard).

Lynn Margulis (1938–2011) Lynn Margulis (her maiden name was Lynn Petra Alexander) was born in Chicago, Illinois, USA on March 5, 1938 and died in Amherst, Massachusetts, USA on November 22, 2011. She attended the University of Chicago, obtained a Master’s degree from the University of Wisconsin at Madison and a Ph.D. from the University of California, Berkeley, where she defended her thesis entitled “An unusual pattern of incorporation of thymidine in Euglena,” under the direction of Max Alfert, in 1965. In 1966 she moved to Boston University, where she was professor for twenty-two years. While in Boston she wrote her famous work Classification and Evolution of Prokaryotes and Eukaryotes [14]. The issue that made her worldwide famous was her interest in the symbiotic origin of the components of the eukaryotic cell, nucleus, chloroplast, mitochondria, cytoskeleton. She was particularly interested in the study of spirochetes, especially those attached to the surface of the symbiont flagellates living in the gut of termites [16]. Symbiosis in Cell Evolution [15], where she explained the theory of the symbiotic origin of the eukaryotic cell, Handbook of Protoctista [17b], considered the “Bible” of protistologists, and Five Kingdoms [18], which became a bestseller, are three of her best known works. Later, with James Lovelock, she developed the Gaia concept, the Earth and its environment being considered as an entity having generated its own regulating system. In 1989, Margulis was appointed Commander of the Order

of Academic Palms of France. In 1999 she received the American National Medal of Science, awarded by US President William J. Clinton, followed by the Alexander von Humboldt Prize awarded in Berlin (2002–2005). She often visited the Arago Laboratory, and played a major role in the organization of the 5th Meeting of the International Society for Evolutionary Protistology (ISEP), which was held in Banyuls in 1983, and also in the preparation of the Proceedings of the meeting, for which she wrote a Foreword with a chronicle of the conference (Fig, 5). It was the first time that the ISEP had met in Europe [19]. Her personal and scientific relationship with Prof. Ricardo Guerrero from 1983 until her death made Margulis to stay for long periods in Barcelona, Spain, where she continued developing her work and collaborating with many Spanish researches and students [1,10]. Among them, Toni Navarrete, who defended his thesis [21] on the microbial mats of the Ebro Delta in 1999 (Fig. 6). In 2006 the Proceedings of the National Academy of Sciences published The last eukaryotic common ancestor (LECA): Acquisition of cytoskeletal motility from aerotolerant spirochetes in the Proterozoic Eon, a major paper signed by L. Margulis, M. Chapman, R. Guerrero & J. Hall [16]. More than 30 years of fighting were necessary to finally reach conclusions positively cited by W.F. Martin et al. (2015) in the paper Endosymbiotic theories for eukaryotic origin [20]. In spite of her sudden death on 22 November 2011, the continuity in the memory and development of her concepts is assured.


THE ARAGO LABORATORY OF BANYULS

Int. Microbiol. Vol. 19, 2016

189

Walter J. Gehring (1939–2014) Walter Jacob Gehring was a Swiss developmental biologist, Professor at the University of Basel, Switzerland (Fig. 7) that every year visited the Arago Laboratory with his students. Gehring was born in Zurich, Switzerland, and obtained his Ph.D. at the University of Zurich in 1965 with Professor Ernst Hadorn (1902–1976), a pioneer of developmental biology and genetics of Drosophila. After two years as an assistant to this geneticist, he joined the group of Alan Garen, Professor of Molecular Biophysics at Yale University in New Haven, Connecticut, USA, as a post-doctoral researcher. In 1969 he was appointed associate professor at the Yale Medical School and in 1972 returned to Switzerland, where he was appointed Professor of Developmental Biology and Genetics at the Basel Biozentrum, University of Basel, and continued to work on Drosophila. While preparing his doctorate, he discovered a new Drosophila mutant in which the antennas were replaced by legs and he named it Antennapedia. This mutant remained the focus of his work throughout the following thirty years. Once genetic engineering techniques were available, Walter Gehring cloned the gene responsible for the mutation in Antennapedia. He discovered that all homeotic genes had a common sequence of 180 nucleotides, to which he gave the name of Homeobox. He first demonstrated that Homeobox genes were conserved during the evolution of metazoans, in which they play a key role in the organization of the body plan. Along with Kurt Wuthrich, he then determined the dimensional structure of the protein domain encoded by the Homeobox and called it the Homeodomain. He showed that the Homeodomain binds to specific DNA sequences of a gene’s promoter, which implies that the Homeobox genes encode transcription factors capable of regulating the activity of other genes. It is on this basis that the Homeobox genes were called “Master genes of development” [8]. Walter J. Gehring made a second discovery of fundamental importance in developmental biology when he showed that the Pax6 gene (which also contains a Homeobox) is essential to the development of the eye [9]. This gene is necessary for the initiation of gene networks used to build the visual system in all animals, including humans. Mutations that lead to loss of function of Pax6 or its homologues (eyeless in Drosophila, Aniridia in humans) prevent the development of the eye in the earliest stages. He received the Kyoto Prize for Basic Research (2000)

Fig. 7. Walter J. Gehring (1939–2014). (Photograph from the collection of Elizabeth Gehring).

and the Balzan Prize for Developmental Biology in 2002 [12] for his fundamental contributions, that is, the discovery of the universal principle underlying the organization of the body plan and that of eye development. He was elected a foreign member of the French Academy of Sciences in 1998 (section Cell Biology, Molecular and Genomics) and of other Academies of Sciences (USA, UK, Sweden, and Germany) and was awarded honorary doctorates by many universities, including University Pierre and Marie Curie. Walter Gehring started visiting the Arago Laboratory in 1960, as a student, and returned later regularly with his own students, until his death, from a car accident, in Greece in 2014.

Acknowledgements. The author specially thanks Michael Dolan (University of Massachusetts-Amherst, USA), Ricardo Guerrero (University of Barcelona, Spain, and University of Massachusetts-Amherst), and Rubén Duro (International Microbiology), for helpful discussions and editing of the manuscript. She also thanks warmly Michel Delseny, Mercè Piqueras, Carmen Chica, Elizabeth Gehring and the Chatton family for their help and understanding.

Competing interests. None declared.


190

Int. Microbiol. Vol. 19, 2016

References 1. Berlanga M, Guerrero R (2016) The holobiont concept: the case of xylophagous termites and cockroaches. Symbiosis 68:49-60 2. Chappuis V (1992) Genèse d’une bibliothèque scientifique: Henri de Lacaze-Duthiers (1821–1901) et la bibliothèque du Laboratoire Arago à Banyuls-sur-Mer. Mémoire d’Etude, Ecole Nationale des Sciences de l’Information et des Bibliothèques. 3. Chatton E (1906) Les Blastodinides, ordre nouveau de dinoflagellés parasites. Comptes Rendus Hebdomadaires des Séances de l’Académie des Sciences 143:981-983 4. Chatton E (1919) Les Péridiniens parasites. Thèse à la Faculté des Sciences de l’Université de Paris. Archives de Zoologie Expérimentale et Générale 59:1-475 5. Chatton E (1938) Titres et Travaux scientifiques. E. Sottano (Ed) 6. Chatton E, Lwoff A (1935) Les Ciliés Apostomes. Morphologie, cytologie, éthologie, évolution, systématique. Première partie. Aperçu historique et général. Étude monographique des genres et des espèces. Archives de Zoologie Expérimentale et Générale 77:1-453 7. Chatton E, Soyer MO (1973) Le cycle évolutif du Paradinium pouchetii Chatton, flagellé parasite plasmodial des copépods. Les Paradinides. Ann Sci Nat Zool Sér.12, 5:27-60 8. Gehring W (2005) New perspectives on eye development and the evolution of eyes and photoreceptors. J Heredity 96:171-184 9. Gehring W, Ikeo K (1999) Pax 6: mastering eye morphogenesis and eye evolution. Trends Genet 15:371-377 10. Guerrero R, Margulis L, Berlanga M (2013) Symbiogenesis: the holobiont as a unit of evolution. Int Microbiol 16:133-143 11. Haapala OK, Soyer MO (1973) Structure of dinoflagellate chromosomes. Nature New Biol 244:195-197 12. http://www.balzan.org/fr/laureats/walter–gehring Balzan Prize 2002 13. Lwoff A, Chatton E (1949) Recherches sur les Ciliés Thigmotriches, Arch. Zool. Exp. 86:169-253 14. Margulis L (1974) Classification and evolution of prokaryotes and eukaryotes. In: Handbook of Genetics, vol.I. R.King, ed. Plenum Press, New York, pp. 1-41

SOYER-GOBILLARD

15. Margulis L (1981) Symbiosis in cell evolution. W.H. Freeman, New York 16. Margulis L, Chapman M, Guerrero R, Hall J (2006) The last eukaryotic common ancestor (LECA): Acquisition of cytoskeletal motility from aerotolerant spirochetes in the Proterozoic Eon. Proc Natl Acad Sci USA 103:13080-13085 17a.Margulis L, Soyer-Gobillard MO, Corliss JO (eds) (1990) Evolutionary Protistology. The Organism as Cell. D. Reidel, Dordrecht, Holland 17b.Margulis L, Corliss JO, Melkonian M, Chapman DJ (eds) (1990) Handbook of Protoctista, 1st ed. Jones and Bartlett, Burlington, MA, USA 18. Margulis L, Schwartz K (1982) Five Kingdoms: An illustrated guide to the Phyla of Life on earth. WH Freeman, New York 19. Margulis L, Soyer-Gobillard MO, Corliss J (eds) (1984) Evolutionary Protistology. The organism as a cell. Proceedings of the 5th Meeting of the International Society for Evolutionary Protistology, Reidel Publ Co, Dordrecht / Boston 20. Martin WF, Garg S, Zimorski V (2015) Endosymbiotic theories for eukaryote origin. Phil Trans R Soc B370:20140330 21. Navarrete A (1999) Caracterización bioquímica y ecofisiológica de los tapetes microbianos del delta del Ebro. Ph.D. thesis. Universitat de Barcelona, Barcelona (In Spanish) 22. Soyer-Gobillard MO (2002) Scientific research at the Laboratoire Arago (Banyuls, France) in the twentieth Century: Edouard Chatton, the “master”, and André Lwoff, the “pupil”. Int Microbiol 5:37-42 23. Soyer-Gobillard MO (2006) Edouard Chatton (1883–1947) and the dinoflagellate protists: concepts and models. Int Microbiol 9:173-177 24. Soyer-Gobillard MO (2017) The Arago Laboratory and its academicians or the magic of Banyuls. Vie et Milieu/Life and Environment, 2016, 66 (350th birthday of the French Academy of Sciences (1666–2016) 25. Soyer-Gobillard MO, Dolan M (2015) Chromosomes of Protists: The crucible of evolution. Int Microbiol 18:209-216 26. Soyer-Gobillard MO, Schrevel J (2003) André Lwoff (1902–1994), Nobel Prize of Medicine, as Protistologist. Protist 154:455-468

About the author. Marie-Odile Soyer-Gobillard, Director of Research Emeritus Honorary of French CNRS (National Center for the Scientific Research), was greatly aided by the Cell Biology Laboratory team she formed and led from 1974 until 2005 at the Oceanological Observatory, Arago Laboratory, Banyuls-surMer, University Paris 6 Pierre et Marie Curie, France. Until 2000, she was the head of the research team “Genome and cell cycle of the unicellular eukaryotes” and until 1995 the head of both the Department of Cell and Molecular Biology, and the Electron Microscopy Unit (1975–2000). Her research involved cell and molecular studies of protists, including dinoflagellates. She worked to identify and characterize the molecules that govern the cell cycle, including entry into mitosis, sexuality and meiosis, cytoskeletal structure and organization. These molecules, for the most part, were still unknown and the team demonstrated that some are conserved from dinoflagellates to humans. She elucidated the peculiar structure of dinoflagellate chromosomes, the composition of their chromatin and the maintenance of their chromosome structure by divalent cations and structural RNAs. She has published more than 130 publications mainly in peerreviewed international scientific journals and has contributed more than 100 communications in congresses.


RESEARCH ARTICLE International Microbiology 19(4):191-198 (2016) doi:10.2436/20.1501.01.277. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Virulence factors and antimicrobial resistance in environmental strains of Vibrio alginolyticus Marcos F. Hernández-Robles,1 Ana K. Álvarez-Contreras,1 Patricia Juárez-García,1 Iván Natividad-Bonifacio,1 Everardo Curiel-Quesada,2 Carlos Vázquez-Salinas,3 Elsa Irma Quiñones-Ramírez1* Department of Microbiology, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Mexico City, Mexico. Department of Biochemistry, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Mexico City, Mexico. 3 Department of Biotechnology, Division of Biological Sciences and of the Health, Universidad Autónoma Metropolitana-Iztapalapa, Mexico City, Mexico

1

2

Received 13 October 2016 · Accepted 15 November 2016

Summary. Vibrio alginolyticus has acquired increasing importance because this microorganism may be pathogenic to aquatic animals and humans. It has been reported that some V. alginolyticus strains carry virulence genes derived from pathogenic V. cholerae and V. parahaemolyticus strains. In this work V. alginolyticus was isolated from oyster samples acquired from a food-market in Mexico City. Thirty isolates were identified as V. alginolitycus. Strains showed β-haemolysis and proteolytic activity and produced a capsule. Strains displayed swimming and swarming motility and 93.3% of them produced siderophores. Several genes encoding virulence factors were detected using PCR amplification. These included proA, wza, vopD, vopB, hcp, vasH and vgrG genes, which were present in all strains. Other genes had a variable representation: tdh (86.6%), lafA (96.6%), pvsA (62%) and pvuA (16%). The trh gene could not be amplified from any of the strains. The antimicrobial resistance profile revealed that more than 90% of the strains were resistant to beta-lactams antibiotics, 60% to cephalotin, 45% to amikacin, 16% to cephotaxime, and 10% to pefloxacin, while 100% were susceptible to ceftriaxone. The V. alginolyticus strains isolated from oysters showed multiple resistance to antibiotics and several virulence factors described in well-characterized pathogenic vibrios. [Int Microbiol 19(4):191-198 (2016)] Keywords: Vibrio alginolyticus · secretion system · virulence factors · capsular polyssacharides · oysters

Introduction According to the Center for Disease Control and Prevention (CDC), in recent years the Vibrio genus has caused several

Corresponding author: E. I. Quiñones-Ramírez E-mail: elsairma46@yahoo.com.mx *

intestinal as well as extra intestinal disorders; twelve species have been described as pathogenic for humans, including Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio mimicus and Vibrio alginolyticus and some of these species have been also recognized as causing Vibriosis in marine vertebrates and invertebrates [36]. In 2014 several reports on Vibrio infections came from the coastal regions of the Gulf of Mexico with 34% of the cases [6].


192

Int. Microbiol. Vol. 19, 2016

The pathogenicity mechanism of V. alginolyticus is not yet fully understood, however several virulence factors have been described. Vibrio alginolyticus possesses polar and lateral flagella [7,20]. Flagella have been associated with adhesion to surfaces, formation of biofilm and swimming and swarming [17]. V. alginolyticus produces hydroxamate type siderophores and three hemolysins; Thermostable Direct Hemolysin (TDH), Thermostable Related Hemolysin (TRH) and Thermolabile Direct Hemolysin (TLH) [31,41,43,47]. Studies have shown that the vppC gene is a key virulence gene contributing to the pathogenicity of V. alginolyticus. This gene has been used to distinguish between Vibrio strains by PCR amplification [11,23,24]. Some reports about the pathogenicity of V. alginolyticus indicate that enzymes with proteolytic activity are important virulence factors; one of them is a serine protease, which has a lethal effect on fish [16,21]. The capsule is considered an important virulence factor in some species of genus Vibrio, acting as a shield against the complement and blocks phagocytosis [16,34]. The type III secretion system (T3SS) has not been fully described in environmental strains of V. alginolyticus. This is a Sec-independent pathway in which secretion occurs in one step from the cytosol to the outside of the cell, playing a central role in the pathogenicity of many Gram-negative bacteria [29,39]. In V. cholerae, the type VI secretion system (T6SS) plays an important function, allowing this organism to compete with other bacteria and escape from phagocytic cells, enabling it to persist in infected humans and in the environment [8,27]. Proteins Hcp and VgrG have been recognized as key components of an active T6SS [25]. Studies on the T6SS in V. cholerae suggest that the effector proteins VgrG and Hcp are important not just as secretion products but also as a structural part of the secretion apparatus [38]. Vibrio sp. isolated from environmental samples have shown resistance to amoxicillin, ampicillin, cefuroxime, rifampin, and streptomycin, chloramphenicol, tetracycline, trimethoprim and nalidixic acid, neomycin and amikacin [22]. It has been reported that strains of V. alginolyticus, V. vulnificus, V. parahaemolyticus and V. harveyi isolated from food showed ampicillin resistance almost 50% of the isolates [19,30]. Due to the scarce information existing for V. alginolyticus, this study aims to provide information about some virulence factors in strains isolated from bivalve mollusks.

HERNÁNDEZ-ROBLES ET AL.

Materials and methods A total of 30 oysters samples were acquired at “La Nueva Viga” market in the Central de Abastos of Mexico City. Samples were transported frozen in individually labeled and sealed plastic bags to avoid contamination. The time between sample collection and analysis was approximately 24 h. Isolation and phenotypical identification of Vibrio alginolyticus. Vibrio alginolyticus strains were isolated as described in the Bacteriological Analytical Manual of the Food and Drug Administration [10]. Strain identification was done using The API 20E system (BioMerieux). Strains V. alginolyticus ATCC 29397 and V. parahaemolyticus ATCC 17803 were used as positive controls in all phenotypic tests. Determination of hemolytic activity and proteolytic activity. For the detection of hemolysis, strains were streaked on blood agar with 5% sheep erythrocytes. Plates were incubated for 24 h at 37 °C, and after this time, the appearance of hemolytic zones was registered [28]. For the proteolytic activity, V. alginolyticus strains were inoculated on BHI agar plates containing 3% NaCl and incubated at 37 °C during 24 h. Afterwards, a single colony was selected and streaked on 5% milk agar containing 3% NaCl and incubated at 37 °C during 24 h. Swimming and swarming motility. Swimming and swarming tests for the V. alginolyticus strains were done according to Böttcheret al. [3]. Siderophores production. To induce siderophore production, V. alginolyticus strains were grown in nutrient broth at 37 ���������������������� °��������������������� C during 24 h. Afterwards, strains were spread onto Cromo Azurol S Agar plates (CAS) [4] and incubated at 37 °C during 24 h. Capsule production. A colony of V. alginolyticus, which had been cultured on Glycerol Agar to enhance capsule production [1], was mixed with a drop of Congo Red in the center of a slide to make a smear, the slide was allowed to air dry and then it was covered with capsule mordent for one minute. The smear was washed with distilled water and dried, the smear was observed under the microscope with the immersion objective [34]. To observe the presence of capsule using transmission electron microscopy (TEM), the Hébert et al. [18] methodology was followed with a minor change. In this experiment 1 M sodium cacodylate buffer at pH 7.2 were used instead of 0.2 M s-Collidine Buffer at pH 7.4. Klebsiella pneumonie ATCC 700603 was used as a positive control. Genetic analysis. Strains were grown in Luria–Bertani broth containing 3% NaCl and incubated at 37 °C for 24 h. Chromosomal DNA from strains was extracted using the Wizard Genomic DNA Purification kit (Promega, Madison, WI, USA). The amplification mix was done with 12.5 μl of Master mix 2X (Thermo Scientific), 7.5 μl of water nuclease-free, 1 μl of reverse primer and forward primer (10 µm of each primer) and 100 ng of template DNA in a final volume of 25 μl. Amplifications were performed in a thermal cycler Techne (TC-3000G, Staffordshire, UK) with the primers shown in table 1. All amplifications included an initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 30 s (1 min for vppC, vopB and vopD), and extension for 1 min at 72 °C (30 s for vppC, vopB and vopD). Hybridization temperatures and the expected amplicon sizes are included in Table 2. Genomic DNA from V. alginolyticus ATCC 17749 was used as a positive control. Vibrio parahaemolyticus ATCC 17803 was used as a negative control for identification vppC gene and E. coli ATCC 25922 as a negative con-


Int. Microbiol. Vol. 19, 2016

ENVIRONMENTAL STRAINS OF V. ALGINOLYTICUS

trol for identification tdh, trh, proA, pvsA, pvuA, wza, lafA, vop D, vopB, hcp, vasH and vgrG genes. Fragments corresponding to T3SS and T6SS encoding genes were sequenced. Sequence analysis was carried out with software DNASTAR version 7.1 (Lasergene, Madison, WI, USA), Seaview 4.32, and the search for regions of local similarity between our sequences and those deposited in the GenBank were done using the BLAST algorithm at the NCBI webpage [http://blast.ncbi.nlm.nih.gov/Blast.cgi]. Transcriptional expression of vasH, vgrG and hcp genes. To demonstrate the expression of selected T6SS genes from V. alginolyticus, strains were inoculated in BHI broth containing 3% NaCl and incubated at 25 and 37 °C for 12 h with shaking. Subsequently, total RNA was obtained with the commercial kit RNeasy Bacteria Mini Kit (Qiagen), following the manufacturer recommendations. The concentration of the isolated RNA was measured using a Nanodrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). Finally, a reverse transcription-polymerase chain reaction assay (RT-PCR) was performed using the RT-PCR One step kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer recommendations. cDNA synthesis was carried out during 15 min at 50 ������������������������ °����������������������� C, followed by an incubation at 94 °C for 2 min; PCR primers and amplification conditions used are stated in Tables 1 and 2. Gene gyrB was used as a constitutive gene. PCR products were separated by 2% Agarose gel electrophoresis and stained with ethidium bromide (Merck, Darmstadt, Germany). Amplicons were visualized under UV light in a gel-doc system (BioRad, Münich, Germany). Antimicrobial resistance test. Antimicrobial susceptibility testing was made according to the Kirby-Bauer method [9]. Vibrio alginolyticus strains were grown in BHI broth with 3% NaCl, turbidity was adjusted at 0.5 of the McFarland nephelometer and were plated on Mueller Hinton agar with 3% NaCl, the pH was adjusted to 7.3 ± 0.1. The Multidiscs used were from Biorad cat. 7108280 and 7108180. The minimal inhibitory concentration was made by the macrodilution method using amikacin, cefotaxime, gentamicin, chloramphenicol, netilmicin, pefloxacin, ampicillin, dicloxacin, erythromycin and tetracycline. All strains was grown on BHI broth with 3% NaCl and Escherichia coli ATCC 25922 was used as control. Interpretation of the results was according to the document M45-A2 [9]. Statistical analysis. The correlation between antibiotic susceptibility and the presence of virulence genes was analyzed statistically using the ChiSquare test or Fisher’s exact test and P < 0.05 was considered statistically significant. All tests were performed using GraphPad Prism 7 software.

Results Vibrio alginolyticus isolation and identification. From the 30 analyzed samples, 13 were positive for V. alginolyticus. Seventy isolates from these samples were presumptively classified as V. alginolyticus in biochemical tests. The appearance of 425 bp amplicon derived from the vppC gene confirmed 30 of these isolates. These strains were used for the next experiments. All V. alginolyticus strains showed β-hemolysis and proteolytic activity under the conditions tested; 93.3% of the strains (28/30) showed siderophore pro-

193

Table 1. Primers used in this study Target

Primer (5′→3′)

Reference

vppC

F:GTCGGATTCAGAGTCGGTATTTAG R: GTTCCACTGCCCACCAAACA

[11]

trh

F:AGGCAATTGTGGAGGACTATTG R: CTCTGATTTTGTGAAGACCGTAG

This study

tdh

F: CCCGGTTCTGATGAGATATTG R: ACCGCTGCCATTGTATAGTC

This study

proA

F: CCGGAATTCGAGCAATTCAC R: CACGAGGATCAGAACGAAGAT

[24]

lafA

F: GCTTTATCAATGCACACTAACT R: CAAGGTCGTTCATACGGTAA

This study

pvsA

F: AGCCGCCTTACTTTATCG R: CGAGACAATCGAAATTCG

This study

pvuA

F: AATTGCCTACATCCGAGG R: CAACATTCATGCGTAACTTG

This study

wza

F: AGCGGGTAACTGGGTGCATTCG R: CAGTAAGGCTCATGCCGCTACGATC

This study

vopD

F: GATAAAAATGGTGGAACGGG R:CGTTCTTCGGCTTGGTTT

This study

vopB

F: AARGGCGCAACGGACAG R: CAGGACGGCTTAACACCG

This study

vgrG

F: GAAGACGAAGCGAACCAAG R: ATTGAACCATCACTGTTCATCAC

This study

hcp

F: CAAGAAGCTCACGTTGATG R: TTGATTGAGTAGTAGTGCTCTTG

This study

vasH

F: AGTAGCATTGGCATATCRCC R: TCTTTGGCTGATCGCAGC

This study

gyrB

F:TCAGAGAAAGTTGAGCTAACGATT R: CATCGTCGCCTGAAGTCGCTGT

[27]

duction and 100% of strains showed the presence of capsule with both the Congo Red staining. All studied strains displayed swimming motility, which is characterized by the spread of bacteria throughout the agar, resulting from a disordered migration throughout the agar surface. All strains were also positive for the swarming effect on agar plates. Amplification of genes tdh, trh, proA, pvsA, pvuA, wza, lafA, vop D, vopB, hcp, vasH and vgrG. Table 3 shows the PCR amplification results of all the genes examined in this study. Among the 30 strains tested, 26 showed the presence of the tdh gene (86.6%), however, in none of them the trh gene could be amplified (data not shown). The proA and wza genes were amplified in all working strains


194

Int. Microbiol. Vol. 19, 2016

HERNÁNDEZ-ROBLES ET AL.

Table 2. Conditions used for the detection of genes vppC

vopD, vopB

lafA, proA

1

1

2

2

51°C/ 30 s

Hybridization

53 °C/ 1 min

52 °C/ 1 min

Amplicon size (pb)

425

1

1

2

2

400 225

vgrG, vasH

hcp

54 °C/ 30 s 532 902

1

pvsA, pvuA

gyrB

trh

tdh

wza

55 °C/ 30 s

47 °C/ 30 s

58 °C/ 30 s

52.5 °C/ 30 s

47 °C/ 30 s

66 °C

248

1

467 545

568

202

220

425

1

2

283 1

2

1 2

2

of V. alginolyticus. Gene lafA was amplified in 96.6% of the strains. Genes pvsA and pvuA were amplified in 62% and 19% on strains of V. alginolyticus, respectively.The expected length of the gene fragment amplified was obtained in 100% of the strains tested for the vopD and vopB genes belonging to the T3SS and the same was true for vgrG, hcp and vasH genes of the T6SS. Amplicons were sequenced and the resulting sequences were deposited in the GenBank database under accession numbers KT971351 for Hcp, KT934265 for vgrG, KT971348 for vasH, KT971350 for vopB and KT971349 for vopD. Transcriptional expression of determinant genes for the T6SS function. For the expression analysis of genes vasH, vgrG and hcp, belonging to the T6SS, RNA from the V. alginolyticus strains grown at 25 or 37 °C was retrotranscribed and PCR amplified using primers shown in Table 1. The gyrB gene was used as an internal RT-PCR control. Figure 1 shows the RT-PCR products obtained by after growing the bacteria at 25 °C������������������������������� ��������������������������������� . Results indicate that expression of key genes of the T6SS takes place under this incubation temperature but it does not occur at 37 °C (data not shown). Antimicrobial resistance. All the strains tested were sensitive to ceftriaxone, but resistant to carbenicillin and dicloxacillin. The percentage of strains resistant to ampicillin was 96%, 60% of the strains was resistant to cefalotin, 45% to amikacin, 16% to cefotaxim, 10% to trimethoprim-sulfa-

methoxazole, 3% to chloramphenicol, 38% gentamicin and 84% to tetracycline. The strains that showed antimicrobial resistance by disc diffusion method were selected for the minimum inhibitory concentration assay. 100% of the strains (14/14 strains) showed a resistance to amikacin greater than 128 μg/ml, 80% (4/5 strains) were resistant to ≥ 32 μg/ml of cefotaxime, 47% (5/11 strains) were ≥ 16 μg/ml of Gentamicin, 100% (1/1) were ≥ 16 μg/ml of chloramphenicol, 63% (17/27 strains) were ≥ 32 μg/ ml of Netilmicin, 12.5% (1/8 strains) were ≥ 4 ������������ μ����������� g/ml of Pefloxacin, 96% ( 26/27) were resistant to ≥ 16 �������������� μ������������� g/ml of Ampicillin, 100% (29/29 strains) were ≥ 64 μg/ml of Dicloxacin, 72% (8/11 strains) were resistant to gentamicin ≥ 8 μg/ml and 92% (23/25 strains) were resistant to ≥ 16 μ���������������� ����������������� g/ml of tetracycline. In the present study, it was shown that the tdh virulence gene has a significant association with amikacin (P = 0.0445); the pvsA with tetracycline (P = 0.0455); pvuA with amikacin (P = 0.0104) and with gentamicin (P = 0.0372); and lafA with tetracycline (Table 4).

Discussion The vibriosis caused by V. alginolyticus on marine organisms is characterized by the appearance of hemorrhages, necrosis and ulcers on the injured skin, as well as sepsis. These clinical signs are caused by the virulence factors of the microorganisms, such as the production of multiple extracellular products (ECP), amongst them siderophores, hemolysins and proteases

Table 3. Detection and expression of genes in tested strains

Detection Expression

vvpC

tdh

trh

proA

pvsA

pvuA

wza

lafA

vopD

vopB

hcp

vasH

vgrG

30

26

0

30

18

6

30

29

30

30

30

30

30

30

30

30


Int. Microbiol. Vol. 19, 2016

[2]. In this study, all strains displayed β-hemolytic activity. Additionally, PCR was performed for the detection of the tdh and trh genes, coding for the TDH and TRH hemolysins respectively. TDH and TRH are the major recognized virulence factors in V. parahaemolyticus [5,40]. The presence of tdh gene is variable in V. alginolyticus. In the study reported by Weiet al. [46] it was not possible to amplify the tdh gene from any of the 72 V. alginolyticus strains tested, which contrasts with our results. On the other hand, Ren et al [35] detected in V. alginolyticus the tdh gene in 6 of nine pathogenic strains from a total of 31 strains (19.4%), the pathogenic strains caused the dead after the challenge in fish Orange-spotted grouper (Epinephelus coioides). It is important to indicated that foodborne infections caused by V. parahaemolyticus harboring the tdh+ or tdh+/trh+ genes are relatively more common than those produced by V. parahaemolyticus tdhâ&#x20AC;&#x201C;/trh+ strains [37]. On the qualitative assay of proteolytic activity, the 30 strains identified as V. alginolyticus produced extracellular proteases and all of them contained the proA gene coding for alkaline serine protease. Previous works have reported that the proteases produced by V. alginolyticus have a toxic effect on Ostrea edulis larvae [35,43] and a lethal effect on Penaeus japonicus [15]. A study reported that a mutation in the proA gene, leads to changes in motility, colony morphology and extracellular polysaccharide production in V. alginolyticus [15]. In this study, we demonstrated that the proA gene is widely distributed amongst V. alginolyticus strains from environmental origin, which suggests, according to the literature, that these strains have the ability to affect the health of the fish, and maybe humans too. Bacterial mobility, a shared mechanism among numerous microorganisms, is essential for pathogenic bacteria during their initial invasion and colonization process, in this case, swarming a coordinated rapid migration of bacterial cells

Fig. 1. RT-PCR detection of genes belonging to the SST6 of V. alginolyticus strains. Lane 1, 100 bp molecular weight marker; lane 2, gyrB (housekeeping gene); lane 3, vasH; lane 4, vgrG and lane 5, hcp.

across surfaces is an important but poorly understood aspect of bacterial [44]. In our work, all strains of V. alginolyticus showed swarming motility after inducing the expression of the lateral flagella by growth on solid medium. Lateral flagella allow microorganisms to travel on highly dense environments. Therefore, colonization by this microorganism when present on viscous tissues will be favored [7]. This kind of move has been associated with virulence for pathogens such as Proteus mirabilis, Salmonella typhimurium and Clostridium septicum. In other hand, swarming cells can also exhibit elevated antibiotic resistance compared with nonmotile populations [3]. Gene lafA was found in 96.6% of strains. This gene belongs to a lateral flagella gene system [32] and we can assume that lafA gene is expressed because all strains had swamming motility. V. alginolyticus was reported to be one of the most invasive and highly fatal fish pathogens in the South China

Table 4. Statistical analysis for determining possible relationship between antibiotic resistance and tdh, pvsA, pvuA and lafA genes in Vibrio alginolyticus strains Antimicrobial agents

tdh

pvsA

pvuA

lafA

Ampicillin

P = 0.6899

P = 0.4063

P = 0.6111

P = 0.8502

Tetracycline

P = 0.1143

P = 0.0455

P = 1.0000

P = 0.0229

Amikacin

P = 0.0445

P = 0.1138

P = 0.0104

P = 0.3091

Gentamicin

P = 0.1021

P = 0.5474

P = 0.0372

P = 0.4390

P: probability value based on Chi-square test.

195

Int Microbiol

ENVIRONMENTAL STRAINS OF V. ALGINOLYTICUS


196

Int. Microbiol. Vol. 19, 2016

Sea, possessing two types of unique flagellar systems [44]. The siderophores produced by the V. alginolyticus strains are of the hydroxamate type [45], which was evident from the yellow halo surrounding the colony. In order to corroborate the presence of siderophores on V. alginolyticus strains, pvsA and pvuA genes were amplified in 62% and 19% on strains of V. alginolyticus, respectively. One study demonstrated that pvsA and pvsD genes are involved in the siderophore biosynthesis. They also showed that PvuA protein participates in the siderophore utilization process in V. alginolyticus MVP01 strain [41]. Studies on the genetics of polysaccharide biogenesis for the genus Vibrio are scarce. In V. vulnificus the capsular polysaccharide is a major virulence factor that has been the target an intensive study [13].The presence of capsule and the amplification wza gene were seen in 100% of the strains of V. alginolyticus studied in this work. A role of the capsule is to form a hydrated gel structure around the bacterium, protecting the organism from desiccation effects [13], but the main role of capsule in pathogenesis is to help bacteria resist the action of the complement, acting as a barrier that masks structures that can potentially activate the alternative pathway [4,13]. To our knowledge this is the first report showing the presence of capsule in environmental strains of V. alginolyticus. Secretion systems. Genes vopB and vopD were amplified in all V. alginolyticus strains. These genes encode proteins involved in translocating effector proteins via the type III secretion system (T3SS), they are considered essential in the structure and performance of system. Several studies have demonstrated that T3SS is part of the mechanism of pathogenicity in many bacteria [12,29,39] and other studies have suggested that V. alginolyticus might carry out extensive gene exchange of these genes with environmental bacteria and thus serve as a reservoir of virulence genes from V. cholerae and V. parahaemolyticus [32,38]. The SSTIII has not been fully studied in V. alginolyticus but in other bacteria such as V. parahaemolyticus has been shown to be involved in toxicity towards cell cultures as well as in lethal activity in a mouse supplied intraperitoneally [42]. It has also been shown that this secretory system plays an important role in allowing it to escape from phagocytosis as well as being an interbacterial virulence factor that gives the ability to survive in certain ecosystems where there is greater competition interspecies [21]. Galan et al. [14] mention that the effector proteins of the

HERNÁNDEZ-ROBLES ET AL.

SSTIII in V. parahaemolyticus are involved in the nuclear condensation and fragmentation of the DNA of the white cell, provoking cell death. So they are important not only as a secretion product, but also as a structural part of the SSTIII. On the other hand, the presence of orthologs of the 18 SSTIII genes in the three main vibrios (V. cholera, V. parahaemolyticus and V. mimicus) has been demonstrated. The common objective of SSTIII effectors include the actin cytoskeleton, innate immune signaling and autophagy, these systems can be regulated according to the specific needs of the pathogens [17]. Fragments of the hcp, vgrG y vasH genes were amplified in all the environmental strains of V. alginolyticus. These genes code for effector proteins essential for the structure and functioning of the secretion system type VI. Results indicate that the essential genes of the secretion system type VI are distributed in all environmental strains of V. alginolyticus and that it is likely that this virulence factor may be part of their pathogenicity mechanism. Results from the expression at the transcriptional level of the essential genes of the T6SS showed that the highest expression levels were clearly achieved at 25 °���������������������������������������������������������� C, which suggests that the type VI secretion system is expressed in bacteria in their ecological niche. This is consistent with the report by Salomon et al. [40] who evaluated the level of expression of the T6SS in V. parahaemolyticus at 25 °C, which is a similar condition to the one found at its ecological niche. To our knowledge, this is the first study showing that the temperature may contribute to control the expression of essential genes of the T6SS in environmental V. alginolyticus strains. However, we do not know what other environmental signals could control the expression of the T6SS system, especially during infection of the host, such as pH, concentration of bile salts and oxygen. It has been shown that at least six effector proteins can be translocated by the T6SS and that all have a bactericidal activity, allowing V. alginolyticus to persist in marine environments [40]. However, it will be important to demonstrate the activity of these effectors during the infection process. Antimicrobial resistance. All strains showed different antibiotic resistance patterns, but we weren’t able to correlate this data with the use of antibiotics in aquaculture in Mexico, mainly due to the fact that there is no official registry of its use. However, the results obtained in this study correlate to those obtained by other authors, where 95% of V. alginolyticus showed resistance to carbenicillin, ampicillin, penicillin,


ENVIRONMENTAL STRAINS OF V. ALGINOLYTICUS

and cefalotin [30]. V. alginolyticus is generally resistant to penicillin and vancomycin but sensitive to ciprofloxacin, chloramphenicol, aminoglycosides and beta-lactams [26]. It has been pointed out in other studies that V. alginolyticus is sensitive to trimethoprim-sulfamethoxazole, tetracycline, chloramphenicol, gentamicin, quinolones and first generation cephalosporin [26]. High levels of resistance were found on the minimum inhibitory concentration assay to some antibiotics like amikacin ( ≤ 128 μg/ml), cefotaxime (≤ 64 μg/ml) and netilmicin (≤32 μg/ml). While low levels of resistance were found on chloramphenicol (≤16 μg/ml) and gentamicin (≤μg/ ml). Similar results have been published by Ottaviani et al. [33] and Lajnef et al. [23] although there are no previous studies reporting high levels of resistance to amikacin and cefotaxime. There exists a correlation between the increase in antibiotic resistant bacteria and the indiscriminate use of them in fish farms which puts at risk, not only aquaculture but also human health since many of these products are consumed raw. In this work we documented the presence of several virulence factors in environmental V. alginolyticus. As shown for other pathogenic vibrios, these determinants may enable the microorganism to invade the host, cause tissue damage in order to access nutrient sources required for its growth and propagation. However, it is necessary to perform extensive studies on the virulence factors and the spread of antibiotic resistance genes on V. alginolyticus in order to find out more about its potential risk to public health. Competing interests. None declared.

References 1. Aucken HM, Wilkinson G, Pitt TL (1997) Identification of capsular antigens in Serratia marcescens. Clin Microbiol 35:59-63 2. Bluford J, Gauthier D, Colasanto M, Rhodes M, Vogelbein W, Haines A (2017) Identification of virulence genes in Vibrio spp. isolates from the 2009 Bermuda reef fish mortality event. J Fish Dis 40:597-600 3. Böttcher T, Elliott HL, Clardy J (2016) Dynamics of snake-like swarming behavior of Vibrio alginolyticus. Biophys J 23;110:981-992 4. Burbank L, Mohammadi M, Roper MC (2015) Siderophore-mediated iron acquisition influences motility and is required for full virulence of the xylem-dwelling bacterial phytopathogen Pantoea stewartii subsp. stewartii. Appl Environ Microbiol. 81:139-148 5. Ceccarelli D, Hasan NA, Huq A, Colwell RR (2013) Distribution and dynamics of epidemic and pandemic Vibrio parahaemolyticus virulence factors. Front Cell Infect Microbiol 3:1-9 6. Centers for Disease Control and Prevention (CDC) (2014) National Enteric Disease Surveillance: COVIS Annual Summary 2014. URL: https://

Int. Microbiol. Vol. 19, 2016

197

www.cdc.gov/nationalsurveillance/pdfs/covis-annual-summary2014-508c.pdf. 7. Chen M, Zhao Z, Yang J, Peng K, Baker MA, Bai F, Lo CJ (2017) Length-dependent flagellar growth of Vibrio alginolyticus revealed by real time fluorescent imaging. eLife, 6: e22140 8. Church SR, Lux T, Baker-Austin C, Buddington SP, Michell SL (2016) Vibrio vulnificus type 6 secretion system 1 contains anti-bacterial properties. PLoS One 31:11(10) 9. CLSI (2012). Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, approved standard, 9th ed., CLSI document M07-A9. Clinical and Laboratory Standards Institute, Wayne, Pennsylvania 19087, USA 10. DePaola A, Kaysner CA (2004) Vibrio, chapter 9. In Food and Drug Administration (ed.), Bacteriological analytical manual, 8th ed., revision A, 1998. U.S. Food and Drug. Online http://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm2006949.htm. Accessed on November 2016 11. Di Pinto A, Ciccarese G, Tantillo G, Catalano D, Forte T (2005) A collagenase-targeted Multiplex PCR assay for identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyticus. J Food Prot 68:150-153 12. Dietsche T, Tesfazgi Mebrhatu M, Brunner MJ, Abrusci P, Yan J, FranzWachtel M, Schärfe C, Zilkenat S, Grin I, Galán JE, Kohlbacher O, Lea S, Macek B, Marlovits TC, Robinson CV, Wagner S (2016) Structural and functional characterization of the bacterial type III secretion export apparatus. PLoS Pathog. 15;12(12) 13. Dunstan RA, Hay ID, Wilksch JJ, Schittenhelm RB, Purcell AW, Clark J, Costin A, Ramm G, Strugnell RA, Lithgow T (2015) Assembly of the secretion pores GspD, Wza and CsgG into bacterial outer membranes does not require the Omp85 proteins BamA or TamA. Mol Microbiol 97:616-629 14. Galán JE (2009). Common themes in the design and function of bacterial effectors. Cell Host & Microbe 5:571-579 15. Gu D, Guo M, Yang M, Zhang Y, Zhou X, Wang Q (2016) A σE-mediated temperature gauge controls a switch from LuxR-mediated virulence gene expression to thermal stress adaptation in Vibrio alginolyticus. PLoS Pathog 2:12(6) 16. Gu D, Liu H, Yang Z, Zhang Y, Wang Q (2016) Chromatin immunoprecipitation sequencing technology reveals global regulatory roles of loweell-censity quorum-sensing regulator AphA in the pathogen Vibrio alginolyticus. J Bacteriol 7:2985-2999 17. Haopeng R, Liu Q, Wang Q, Ma Y, Liu H, Cunbin S, Zhang Y. (2008). Role of alkaline serine protease, Asp, in Vibrio alginolyticus virulence and regulation of its expression by LuxO-LuxR regulatory system. J Microbiol Biotechnol 19:431-438 18. Hébert G, Callaway C, Ewing E (1984) Comparison of Legionella pneumophila, L. micdadei, L. bozemanii, and L. dumoffii by transmission electron microscopy. J Clin Microbiol 19:116-121 19. Kim HJ, Cho JC (2015) Genotypic diversity and population structure of Vibrio vulnificus strains isolated in Taiwan and Korea as determined by multilocus sequence yyping. PLoS One 23:10(11) 20. Kitaoka M, Nishigaki T, Ihara K, Nishioka N, Kojima S, Homma M (2013) A novel dnaJ family gene, sflA, encodes an inhibitor of flagellation in marine Vibrio species. J Bacteriol 195:816-822 21. Kustusch R, Kuehl C, Crosa J (2011) Power plays: iron transport and energy transduction in pathogenic vibrios. Biometals. 24:559-566 22. Krishnika A, Ramasamy P (2013) Antimicrobial resistance profile of vibrio species isolated from hatchery system of Macrobrachium rosenbergii (Deman). Indian J Fish 60:147-152


198

Int. Microbiol. Vol. 19, 2016

23. Lajnef R, Snoussi M, Romalde JL, Nozha C, Hassen A (2012) Comparative study on the antibiotic susceptibility and plasmid profiles of Vibrio alginolyticus strains isolated from four Tunisian marine biotopes. World J Microbiol Biotechnol 28:3345-3363 24. Lee KK, Yu SR, Liu PC (1997) Alkaline serine protease is an exotoxin of Vibrio alginolyticus in kuruma prawn, Penaeus japonicus. Curr Microbiol 34:110-107 25. Letchumanan V, Chan K-G, Lee L-H (2015) An insight of traditional plasmid curing in Vibrio species. Front Microbiol 6:735 26. Liu L, Ge M, Zheng X, Tao Z, Zhou S, Wang G. (2016). Investigation of Vibrio alginolyticus, V. harveyi, and V. parahaemolyticus in large yellow croaker, Pseudosciaena crocea (Richardson) reared in Xiangshan Bay, China. Aquaculture Reports 3:220-224 27. Luo P, Hu C (2008) Vibrio alginolyticus gyrB sequence analysis and gyrB-targeted PCR identification in environmental isolates. Dis Aquat Organ 82:209-216 28. Majerczyk C, Schneider E, Greenberg EP (2016) Quorum sensing control of Type VI secretion factors restricts the proliferation of quorumsensing mutants. eLife 16:5 29. Mechri B, Ben Salem I, Medhioub A, Medhioub M, Aouni M (2014) Isolation and genotyping of potentially pathogenic Vibrio alginolyticus associated with Ruditapes decussatus larva and juvenile mass mortalities. Aquaculture Internat 23:1033-1047 30. Miyata S, Unterweger D, Rudko S, Pukatzki S (2013) Dual expression profile of type VI secretion system immunity genes protects pandemic Vibrio cholerae. PLoS Pathogens 9:e1003752 31. Natividad-Bonifacio I, Fernández FJ, Quiñones-Ramírez EI, CurielQuesada E, Vázquez-Salinas C (2013) Presence of virulence markers in environmental Vibrio vulnificus strains. J Appl Microbiol 114:1539-1546 32. Notti RQ, Stebbins CE (2016). The structure and function of type III secretion systems. Microbiol Spectr 4(1) 33. Ottaviani D, Bacchiocchi I, Masini L, Leoni F, Carraturo A, Giammarioli M, Sbaraglia G (2001) Antimicrobial susceptibility of potentially pathogenic halophilic vibrios isolated from sea food. Int J Antimicrob Agents 18:135-140 34. Payne SM, Mey AR, Wyckoff EE (2015) Vibrio iron transport: evolutionary adaptation to life in multiple environments. Microbiol Mol Biol Rev 9:69-90 35. Ren C, Hu C, Jiang X, Sun H, Zhao Z, Chen C, Luo P (2013) Distribution and pathogenic relationship of virulence associated genes among from the mariculture systems. Mol Cell Probes 27:164-168 36. Rossez Y, Wolfson EB, Holmes A, Gally DL, Holden NJ (2015) Bacterial flagella: twist and stick, or dodge across the Kingdoms. Bliska JB, (ed.) PLoS Pathog 11:e1004483

HERNÁNDEZ-ROBLES ET AL.

37. Sachdeva S, Palur RV, Sudhakar KU, Rathinavelan T (2017) E. coli Group 1 capsular polysaccharide exportation nanomachinary as a plausible antivirulence target in the perspective of emerging antimicrobial resistance. Front Microbiol 31:8:70 38. Sadok K, Mejdi S, Nourhen S, Amina B (2012). Phenotypic characterization and RAPD fingerprinting of Vibrio parahaemolyticus and Vibrio alginolyticus isolated during Tunisian fish farm outbreaks. Folia Microbiologica 58:17-26 39. Saito S, Iwade Y, Tokuoka E, Nishio T, Otomo Y, Araki E, Konuma H, Nakagawa H, Tanaka H, Sugiyama K, Hasegawa A, Sugita-Konishi Y, Hara-Kudo Y (2015) Epidemiological evidence of lesser role of thermostable direct hemolysin (TDH)-related hemolysin (TRH) than TDH on Vibrio parahaemolyticus pathogenicity. Foodborne Pathog Dis 12:131138 40. Salomon D, Klimko JA, Trudgian DC, Kinch LN, Grishin NV, Mirzaei H, Orth K (2015) Type VI secretion system toxins horizontally shared between marine bacteria. PLoS Pathog. 25:11(8) 41. Sha J, Rosenzweig J, Kozlova E (2013) Evaluation of the roles played by Hcp and VgrG type 6 secretion system effectors in Aeromonas hydrophila SSU pathogenesis. Microbiology 159:1120-1135 42. Shimohata T, Mawatari K, Iba H, Hamano M, Negoro S, Asada S, Aihara M, Hirata A, Su Z, Takahashi A (2012) VopB1 and VopD1 are essential for translocation of type III secretion system 1 effectors of Vibrio parahaemolyticus. Can J Microbiol 58:1002-1007 43. Tanekhy M (2013) Some study on bacterial infection in some cultured marine fish. J Arabian Aquaculture Soc 8:163-178 44. Tian Y, Wang Q, Liu Q, Ma Y, Cao X, Guan L, Zhang Y (2008) Involvement of LuxS in the regulation of motility and flagella biogenesis in Vibrio alginolyticus. Biosci Biotechnol Biochem 72:1063-1071 45. Wang QY, Liu Q, Ma Y, Zhou LY, Zhang YX (2007) Isolation, ������������������� sequencing and characterization of cluster genes involved in the biosynthesis and utilization of the siderophore of marine fish pathogen Vibrio alginolyticus. Arch Microbiol 188:433-439 46. Wei S, Zhao H, Xian Y, Hussain MA, Wu X (2014) Multiplex PCR assays for the detection of Vibrio alginolyticus, Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae with an internal amplification control. Diagn Microbiol Infect Dis 79:115-118 47. Wong SK, Zhang XH, Woo NYS (2011) Vibrio alginolyticus thermolabile hemolysin (TLH) induces apoptosis, membrane vesiculation and necrosis in sea bream erythrocytes. Aquaculture 57:29-36


RESEARCH ARTICLE International Microbiology 19(4):199-207 (2016) doi:10.2436/20.1501.01.278. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Biofilm formation in catheter-related infections by Panton-Valentine leukocidin-producing Staphylococcus aureus Giorgio Silva-Santana,1,2* Kátia C. Lenzi-Almeida,1,3 Vânia G. S. Lopes,1 Fábio Aguiar-Alves1,2 Pathology Department, School of Medicine, Fluminense Federal University, Rio de Janeiro, Brazil. 2Pharmacy Department, Laboratory Academic Rodolfo Albino, Fluminense Federal University, Rio de Janeiro, Brazil. 3Environmental Science and Conservation Department, School of Medicine, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil

1

Received 10 Novemeber 2016 · Accepted 10 December 2016

Summary. The use of invasive techniques, such as intravascular catheter insertion, and the formation of biofilms in several devices by methicillin-resistant Staphylococcus aureus (MRSA) have contributed to the increased number of septic patients, morbidity and mortality. This study aimed to evaluate the virulence of strains through catheter colonization and identification of microbial biofilm, as well as pathological changes on the colonized skin. An experimental biofilm formation model utilized catheter fragments implanted subcutaneously in 25 Swiss mice. The technique consisted of inoculating a catheter fragment on the back of each animal, followed by intradermal inoculation of 50 µl of bacterial suspension at 1.0 × 107 colony forming units/ml. After 96 h, catheters were removed for macroscopic analysis and evaluated through culture. Local skin fragments were also extracted for histopathology analysis. Staphylococcus aureus can adhere to catheters, colonize and form biofilms. The high amount of viable bacterial cells colonizing catheters and virulence factors can lead to severe infections of skin and adjacent tissues. [Int Microbiol 19(4): 199-207 (2016)] Keywords: Staphylococcus aureus · biofilms · infections · MRSA · Panton-Valentine leukocidin

Introduction Staphylococcus aureus is commonly observed colonizing several parts of the body in healthy individuals, such as skin, nasal cavity, throat and intestine [5,9,10]. Depending on the carrier conditions, it can cause severe infections such as meningitis, endocarditis and sepsis. From primary colonization

Corresponding author: G. Silva-Santana E-mail: bio.sant@hotmail.com *

sites, it can reach other areas where natural defense barriers (skin and mucosa) are compromised by trauma or surgical procedures, thus causing infection [36,48]. Considering that these microorganisms belong to normal skin microbiota, they can cause a primary infection in the region where an intravascular catheter is inserted and then gain access to the bloodstream, consequently causing bacteremia. The infection may aggravate if the S. aureus strain is methicillin-resistant (MRSA) [20]. Different types of toxins produced by S. aureus, such as


200

Int. Microbiol. Vol. 19, 2016

SILVA-SANTANA ET AL

Panton-Valentine leukocidin (PVL), are responsible for specific inflammatory responses to infectious processes in different degrees of severity and systemic symptoms. PVL is widely associated with severe skin infections and necrotizing pneumonia [22]. This protein is encoded by the LukPV operon, which contains lukF-PV and lukS-PV genes inserted into temperate bacteriophages such as PhiSLT [7,15,19,27,44]. These phages carrying the genes for the production of PVL are more associated with strains containing the chromosomal cassette SCCmec type IV and represent a major virulence factor [50]. Increasingly, PVL-producing strains have been reported in hospital infections associated with intravascular and urinary catheters, thus colonizing and forming biofilms on these devices [12]. Another major factor in hospital infections is biofilm formation on surgical materials. The pathogenicity of S. aureus is defined as an association of microbial cells attached to biotic or abiotic surfaces involved in a complex extracellular polymeric matrix [1,43]. When a medical device is implanted, it is immediately covered with tissue matrix proteins, laminin, fibronectin, fibrinogen and collagen. The presence of S. aureus on medical devices prior to implementation may promote interactions with the host tissue, causing local and systemic infections through bacteremia. This is caused by the adhesion proteins covalently attached to the peptidoglycan cell wall, as well as FnBPA and FnBPB capable of binding to both fibronectin and fibrinogen, thus providing an interaction with the host tissue and causing local and systemic infection through bacteremia. These binding proteins are named as microbial surface components recognizing adhesive matrix molecules (MSCRAMMs) [2,14,18,23,34,40]. The expression of icaADBC gene in S. aureus promotes the synthesis of polysaccharide intercellular adhesin (PIA) re-

sponsible for the association and adhesion of microbial cells and formation of biofilms [33,40]. PIA structure is also responsible for the formation of a capsule around the bacterial colonies, preventing their recognition by the immune system [4,31,47]. The union of several species of bacteria in a biofilm provides a great advantage over the effectiveness of antibiotics, innate immune defense as antimicrobial peptides (AMPs) and phagocytosis by leukocytes [23,35,40]. When a biofilm reaches a boundary density the displacement of bacterial cells or small cell aggregates occurs [17] mediated by the agr gene (accessory gene regulator), which activates an intercellular communication system called quorum-sensing [6,40,41,47]. The agr gene expresses the production of peptides to break the cell junctions, allowing bacterial cells from the biofilm to remain suspended in the medium [8,24,42], and thus causing local infections [17], bacteremia, colonization of other tissues and organs, and consequently the production of more biofilms [8,24,42]. For these reasons, infections caused by bacteria forming biofilms are extremely difficult to eliminate and a great challenge for treatment [33]. The goal of this study was to evaluate the colonization and formation of biofilms in clinically isolated MRSA and PVLproducing MRSA clones through in vitro and in vivo studies. In addition, it aimed to quantify viable bacterial cells adhered to the catheter and perform anatomicopathological and histopathological analysis of the colonized skin.

Material and methods Animals used in the study. This study was approved by the Ethics Committee on Animal Research from Federal Fluminense University under the registration number 439/2013. A total of 25 Swiss inbred mice, males and six-week-old were used in this study. They weighed approximately 34 g

Table 1. Distribution and source of bacterial samples in different experimental groups Genes mecA

lukF-PV; lukS-PV

N

Sample isolated from nasal colonization

(−)

(−)

5

pvl (+) MSSA

Sample isolated from nasal colonization

(−)

(+)

5

pvl (+) MRSA

Sample isolated from venous blood of patient with severe pulmonary infection

(+)

(+)

5

pvl (+) MRSA USA300 WT

Sample isolated from venous blood of septic patient

(+)

(+)

5

Control

Physiological saline (0.9% NaCl)

Groups

Inoculum 1.0 × 10 CFU/ml

pvl (–) MSSA

7

Absence of microorganisms

Note: pvl (+) MRSA USA300 WT samples were donate by Prof. BinhAn Diep, University of California, San Francisco, CA, USA.

5


BIOFILM IN CATHETER-RELATED INFECTIONS

each, were specific-pathogens-free (SPF) and divided in five animals per group (Table 1). The animals were kept in individual cages and received standard chow diet and filtered water ad libitum, maintained in light-dark cycles at 21°C (± 2). All procedures that could result in anxiety and/or pain were conducted under anesthesia by isoflurane FORANE (2-chlorine-2-[difluorometoxy]1.1.1-trifluor-ethane) [24,26]. Identification of Staphylococcus aureus and the genes of virulence and resistance. Bacterial samples belonged to the Laboratory of Molecular Epidemiology and Biotechnology, Rodolpho Albino University Laboratory from the Federal Fluminense University. Samples were conserved in brain heart infusion (BHI) plus 10% glycerol and frozen at −80°C. Staphylococcus aureus was identified by standard microbiological procedures: Gram staining, colonial morphology, fermentation of mannitolsalt [16], catalase production [30] and coagulase production [29]. Separately, the species was confirmed by polymerase chain reaction (PCR) for 442-bp chromosomal DNA fragment, according to Martineau et al. [28]. Methicillin resistance was identified using PCR for mecA gene according to the protocol of Oliveira and Lencastre [32], and the virulence genes lukF-PV and lukS-PV, responsible for the production of PVL, were identified according to the protocol established by Lina et al. [27]. Bacterial samples selected for this study had the following characteristics: methicillin-susceptible and non-PVL-producing strains isolated from nasal colonization, pvl (−) MSSA; methicillin-susceptible and PVL-producing strains isolated from nasal colonization, pvl (+) MSSA; methicillinresistant and PVL-producing strains isolated from peripheral blood of a patient with severe pulmonary infection, pvl (+) MRSA; methicillin-resistant and PVL-producing strains isolated from peripheral blood of patient with bacteremia, pvl (+) MRSA USA300 WT. Biofilm formation and in vitro cell viability assay. Bacterial suspensions of each sample were prepared at 0.5 McFarland turbidity scale 108 colony forming units/ml (CFU/ml) in tryptic soy broth (TSB) with 1% glucose using mild stirring (1800 rpm) at 37 °C for 24 h. Subsequently, 200 μl of each inoculum was deposited in a 96-well polystyrene plate with flat bottom and incubated at 37°C for 24 h along with the negative control, sterile TSB. The resulted biofilm was stained with 3% crystal violet for 15 minutes. The optical density of biofilm (DOB) was performed using Optima fluorimeter Elisa Fluostart BMG Labtech at 590 nm and Optima start software, as described by Hassan et al. [21]. The reduction of tetrazolium salt XTT (2.3-bis [2-methyloxy-4-nitro5-sulfophenyl]-2H-tetrazolium-5 carboxyanilide) was performed in order to determine the metabolic activity of cells composing biofilm. The analysis, performed in triplicate, was conducted at 492 nm, as described by Chaieb et al. [11]. Preparation of the bacterial inoculum. Bacterial samples were obtained from infected tissues asymptomatic or nasal colonization, preserved in brain heart infusion (BHI) containing 10% glycerol, frozen at −80°C and thawed 2 h prior to inoculum preparation. Twenty-four hours before the study, bacterial samples were cultivated in tryptic soy agar (TSA). Colonies were suspended in sterile test tube containing 1000 µl of sterile saline (0.9% NaCl) and then serial dilutions were made up to the density of 1.0 × 107 CFU/ml. Catheter insertion procedure. Animals were anesthetized and had the dorsolateral region of their neck shaved and decontaminated with 70%

Int. Microbiol. Vol. 19, 2016

201

ethanol. A subcutaneous air pouch measuring about 1.5 cm was made through an incision. Thereafter, a peripheral intravenous catheter (Becton Dickinson, Argentina S.R.L) measuring 5.0 mm and 2.5 mm of diameter was introduced into the pouch under aseptic conditions [3,4,26]. The incision was closed with synthetic surgical glue Glubran2 (GEM S.r.I, Italy). After 24 h of observation and confirmation that catheters were neither infected nor rejected, the animals were manually restrained and intradermally inoculated with bacterial suspension. The procedure kept a limit distance of 1 cm from the insertion of the catheter fragment and used disposable insulin syringe BD Ultra-FineTM (0.3 ml/30UI, needle 8 mm (5/16”) × 0.3 mm (30 G). Each animal was inoculated with 50 µl of bacterial suspension with a density of 1.0 × 107 CFU/ml in sterile saline [26], except the control group, which received only sterile saline. Macroscopic examination of the backs of mice. After 96 h, the estimated time for consolidation of the infection and colonization of the catheter, animals were euthanized with Isoflurane FORANE through inhalation in closed campanula. Death was confirmed by cardiac and respiratory arrest, absence of corneal reflex and fall of body temperature < 25°C [26]. The backs were comparatively analyzed using the control group as standard, seeking for any morphological alteration, as well as the presence of infection and edema. Macroscopic examination of catheter. Catheter fragments were removed from the backs of mice through incision and the adhered material was preserved. It was observed if the material adhered to the inner or outer surface of the catheter and its aspect, if viscous or liquid, with vitreous luster or opaque and the color. Colonization and biofilm formation on catheter. The explanted catheters were separately placed in test tubes containing 1 ml of sterile saline solution (0.9% NaCl) for quantitative culture and subsequently vortexed during one minute (1800 rpm), an aliquot of 100 µl was cultivated in blood agar 5% Merckoplate (pH 6.5–7.5) using aerobic conditions at 37°C and daily examined up to 48 h. The calculation of the number of CFU was correlated with the initial dilution. The quantitative culture was reported as CFU/ml and growth ≥ 103 CFU/ml (≥ 1000 colonies) confirmed the catheter colonization [4,38]. Five bacterial colonies obtained from blood agar culture were isolated to confirm the presence of S. aureus using the methods: Gram staining, fermentation of mannitolsalt agar, catalase production and coagulase production, as reported previously. Histological analysis of dorsal tissue. One dorsal skin fragment measuring about 1 cm wide and 1 cm long was extracted for the preparation of histological slides. Tissue samples were stored in 10% formaldehyde with pH between 0.6 and 0.7 during 48 h and then submitted to dehydration, diafanization and inclusion in paraffin. Fragments were 3 µm thick and stained with hematoxylin and eosin (H&E). The slides were observed in optical microscope (LX 500 model) and photographed using IVM 5000 camera and ProgRes Capture Pro 2.7 software for the description of the histopathology inflammatory processes. Statistical analysis. Statistical analysis evaluated the quantification of solutions obtained from the colonization of catheters 96 h after explanation. Multiple comparison test used graphic column. The SPSS software version 10.0 was utilized with statistical significance level α ≤ 0.05.


202

Int. Microbiol. Vol. 19, 2016

Results Biofilm formation and in vitro cell viability assay. All the bacterial samples had high potential to adhere to the surface of the plates, as confirmed by biofilm formation through staining with violet crystal and Elisa Fluostar Optima-BMG Labtech fluorimeter. A large amount of metabolically active bacterial cells in biofilms were also observed by the XTT reduction in all groups in comparison with the control group (Fig. 1).

In the control groups, pvl (â&#x2C6;&#x2019;) MSSA and pvl (+) MRSA USA300 WT, no evidence of infection were observed and the skin remained with normal appearance (Fig. 2A, B and E). Swelling and redness were observed at the site of catheter insertion in the group pvl (+) MSSA (Fig. 2C), as well as erythematous lesions where the bacterial suspension was injected. The pvl (+) MRSA group presented severe edema causing suture detachment (Fig. 2D). Macroscopic observations of catheters. After 96 hour, a yellowish film was observed adhered to both the inner and outer surfaces of catheters in the groups pvl (+) MSSA and pvl (+) MRSA, confirming biofilm formation (Fig. 2H and 2K). Adhered materials were not observed in the control groups and pvl (+) MRSA USA300 WT (Fig. 2F and 2J), but

Int Microbiol

Macroscopic examination of the backs of mice. None of the animals died or presented signs of anorexia, diarrhea and behavioral changes 96 h prior to the study.

SILVA-SANTANA ET AL

Fig. 1. (A) All bacterial samples were able to colonize and form biofilms through crystal violet staining method, pvl (â&#x2C6;&#x2019;) MRSA with similar concentration values of pvl (+) MRSA, and pvl (+) MRSA with similar values of pvl (+) MRSA USA300 WT. (B) All bacterial samples presented similar amount of metabolically active cells in the biofilm: values were expressed by XTT reduction method.


Int. Microbiol. Vol. 19, 2016

203

Int Microbiol

BIOFILM IN CATHETER-RELATED INFECTIONS

Fig. 2. The mice dorsal region, the site of insertion of the catheter. (A) control group; (B) pvl (−) MSSA and (E) pvl (+) MRSA USA300 WT: absence of local infection and morphological changes in skin; (C) pvl (+) MSSA: infection with edema and hyperemia in the skin (arrow), erythematosus lesion at inoculation site (dotted arrow); (D) pvl (+) MRSA: intense edema and hyperemia (arrow). Catheter fragments extracted after 96 h: (H) pvl (+) MSSA and (I) pvl (+) MRSA: yellowish material adhered to inner and outer surface of the catheter; (G) pvl (−) MSSA: reddish material adhered to inner surface of the catheter; (F) control group and (J) pvl (+) MRSA USA300 WT: absence of material adhered to catheter surfaces. Bacterial culture obtained from material adhered to catheter: (M) pvl (+) MSSA and (N) pvl (+) MRSA: cell cultures showing bacterial colonization higher than 1000 CFU/cm2; (L) pvl (–) MSSA: 523 CFU/cm2 colonizing the catheter; (K) control group and (O) pvl (+) MRSA USA300 WT: absence of bacterial colonies.

the group pvl (−) MSSA had a reddish material adhered to the inner surface (Fig. 2E). Colonization and biofilm formation on catheters. Quantitative culture revealed the absence of bacterial colonies in control and pvl (+) MRSA USA300 WT groups (Fig. 2K, O and Fig. 3). The pvl (−) MSSA group showed only one catheter with 523 CFU/cm2 (Fig. 2L and Fig. 3). Colonies counting were higher than 1000 CFU/cm2 in all catheters from the groups pvl (+) MSSA and pvl (+) MRSA (Fig. 2M, N and Fig. 3). All colonies isolated from blood agar culture were S. aureus. Histopathological analysis of dorsal tissue. Histopathological analysis of catheter fragments in the con-

trol group revealed an intact epidermis with corneal layer. Dermis had normal cellularity and conjunctive tissues with its attachments (Fig. 4A). The pvl (–) MSSA group preserved the epidermis and dermis. However, adipocytes in hypodermis showed increased cellularity in the inflammatory infiltrate composed of polynuclear/mononuclear leukocytes (Fig. 4B and C). The pvl (+) MSSA group showed intact dermis and epidermis. The hypodermis presented reduced adipocytes and intense inflammatory infiltrate composed of polynuclear/ mononuclear leukocytes, fibrin and red blood cells (Fig. 4D and E). The pvl (+) MRSA group had normal dermis and epidermis, but the hypodermis presented edema and capillary congestion amongst adipocytes. A necrotic area was observed below the hypodermis with mixed inflammatory cell infiltrate containing polynuclear/mononuclear leukocytes and fibrin


Int. Microbiol. Vol. 19, 2016

SILVA-SANTANA ET AL

Int Microbiol

204

Fig. 3. The comparative colonization of catheter fragments. None of the catheters in the control group and pvl (+) MRSA USA300 WT showed bacterial colonies. The pvl (−) MSSA group showed only 523 CFU/cm2 while the pvl (+) MSSA and pvl (+) MRSA groups presented more than 1000 CFU/ cm2 in all catheters.

(Fig. 4F and G). Finally, the histopathological examination of skins from the pvl (+) MRSA USA300 WT group showed preserved epidermis and dermis. A lower number of adipocytes in hypodermis was also observed, as well as mixed inflammatory cell infiltrate evolving to the dermis and capillary congestion (Fig. 4H and I).

Discussion Approximately 45% of hospital infections are associated with contaminated materials or implanted medical devices. MRSArelated infections in catheters have been a severe complication in vascular surgery, increasing morbidity and mortality in hospitalized patients [46]. Intravascular grafts are usually susceptible to colonization by microorganisms, causing infection through direct contamination during implantation or bacteremia after surgical procedures. The diagnosis of catheter-relat-

ed infections is difficult because there is no relationship between clinical and microbiological laboratory findings. Furthermore, positive cultures may be related to both catheter colonization and contamination. Prevention of this type of infection is essential because it may result in graft excision, morbidity and mortality [26,42]. The contamination of a catheter is confirmed by removing it from the site of insertion in the patient and cultivation of its distal tips. The isolation of a same microorganism from both an intravascular catheter tip and patient’s blood with systemic infection suggests that the colonizing microorganism could be the cause of the disease [42]. Several methods are used for catheter tip culture, the gold standard being quantitative or semi-quantitative analysis [42] with 80% of sensitivity [39]. In the present study, the quantitative method was chosen based on sonication of catheter fragments in order to obtain the adhered microorganisms. The absence of behavioral and physiological changes and mortality in our study indicates that the inoculation method did not cause systemic infection. The insertion of subcutaneous catheter induces local skin infection; however, in a hospital environment, microorganisms from an intravenous catheter can reach the bloodstream, causing bacteremia and systemic infection. In groups inoculated with pvl (+) MSSA and pvl (+) MRSA strains, the infection presented severe localized edema in early inflammatory processes. Different aspects reported by Santana et al, such as the change of red skin color to cyanotic and epidermal skin detachment, suggested necrosis. These evidences suggest that the production of PVL could be associated with increased infections of skin and soft tissues [37]. Despite the fact that the USA300 strain is commonly associated with epidemic infections of skin in USA communities [25,45], no macroscopic lesions were observed in the groups pvl (−) MSSA and pvl (+) MRSA USA300 WT. A yellowish film adhered to internal and external surfaces of explanted catheter fragments in the groups pvl (+) MSSA and pvl (+) MRSA suggested biofilm formation. Similar results were obtained by Santana et al. [37] in S. aureus strains susceptible and resistant to methicillin. The cultivation of the material adhered to the catheter fragment in pvl (−) MSSA group presented only 523 CFU/cm2 and did not confirm the formation of biofilm, according to the criteria established by Atahan et al. [4] and Schaechter and Marangoni [38]. Nevertheless, it is still a potential site for infection, and biofilm might not have been formed in this group because it does not


Int. Microbiol. Vol. 19, 2016

205

Int Microbiol

BIOFILM IN CATHETER-RELATED INFECTIONS

Fig. 4. Microscopy of back skin. Control group (stained with H&E): (A) intact epidermis (asterisk) and corneal layer (arrow), dermis with attachments (tip arrow). The pvl (−) MSSA group: (B) increased cellularity in the subcutaneous adipocytes with inflammatory infiltrate (asterisk), necrotic area (tip arrow); (C) large number of red blood cells (arrow), mixed inflammatory infiltrate composed of mononuclear/polynuclear cells (asterisk). The pvl (+) MSSA group: (D) inflammatory afflux (asterisk); (E) reduced number of adipocytes in hypodermis (arrow), mixed inflammatory influx (asterisk) and fibrin (tip arrow). The pvl (+) MRSA group: (F) subcutaneous necrotic area (asterisk); (G) capillary congestion (arrow), edema (tip of hollow arrow), fibrin (tip arrow), necrotic area with inflammatory infiltrate (asterisk). The pvl (+) MRSA USA300 WT group: (H) low number of adipocytes in hypodermis (tip arrow), capillary congestion (arrow), edema with inflammatory influx (asterisk); (I) low number of adipocytes with inflammatory influx and perfusion in the dermis (arrow).

express specific genes responsible for the production of surface proteins that recognize adhesins. pvl (+) MSSA and pvl (+) MRSA groups had a yellowish film. The culture of 100 µl solution confirmed catheter colonization in a concentration exceeding 1000 CFU/cm2 and the formation of biofilms. The colonies isolated from bacterial cultures were confirmed as S. aureus, which may migrate to other sites, adhere to medical devices, and thus form biofilm and cause infections. Similar results were observed by Atahan et al. in groups without antimicrobial prophylaxis. Another study by Santana et al. using a method of scrolling also found that a film around a catheter in MSSA and MRSA groups was constituted by microorganisms at a density higher than 1000 CFU/cm2 [37]. PVL-producing strains have caused severe skin infections associated with colonization and biofilm production, thus suggesting the expression of icaC gene. The association of biofilm production in catheter fragments and production of PVL through in vivo studies of S. aureus has not been described in the literature. There was no association of resistance to β-lactams and higher or lower production of biofilm in our study. The examination of the dorsal skin of animals in the control group revealed intact and preserved structures, thus we considered them as standard for comparison with other groups. The origin of inflammatory processes in the in-

fected groups was below the hypodermis, where the catheter fragment was introduced. Although non-PVL-producing strains did not form biofilm with the same intensity as PVLproducing strains, the inflammatory processes presented similar intensities. These results corroborate that pvl (+) S. aureus tend to be more virulent than pvl (−) S. aureus and therefore associated with infections of skin and soft tissues [13]. Wardenburg et al. have utilized subcutaneous injections in the right flank of mice using bacterial suspensions of S. aureus at a density of 1.0 × 107 CFU/ml. The LAC and LACΔpvl strains demonstrated skin abscess with dermonecrotics after 96 h of infection [49]. Similar aspects were also observed in all groups of our study. Storti et al. [42] analyzed 118 tips of central venous catheters in adult patients by quantitative culture and correlated colony counting with initial dilution. They observed growth ≥ 103 CFU/ml and confirmed that 50% of catheter-related infections were caused by S. aureus, including four cases of bacteremia, and that the most frequently isolated microorganisms were MRSA [42]. Staphylococcus spp. proved to be most frequently isolated microorganism in catheter tips. The source of infection may be the patient’s skin because through material handling by medical staff during surgical procedures. Therefore, data demonstrate the high level of virulence of these mi-


206

Int. Microbiol. Vol. 19, 2016

croorganisms and the importance of prevention and treatment [42]. Staphylococcus aureus can adhere to catheters, colonize and form biofilms. The amount of bacterial cells (colony forming units) is deeply related to higher or lower degrees of infection, including adjacent tissues. Intravascular catheter colonization by S. aureus can gain access to the bloodstream and cause bacteremia. PVL-producing strains had higher performance in biofilm production. However, the group pvl (+) MRSA USA300 WT, the most virulent, did not present in vivo colonization in this study, even having in vitro potential to form biofilms.

Acknowledgements. We would like to thank FAPERJ, FOPESQ - UFF, Pathology Program (Fluminense Federal University) and Coordination for the Improvement of Higher Level Personnel (CAPES) for the financial support to this study. Competing interests. None declared.

References 1. Allison DG (2003) The biofilm matrix. Biofouling 19:139-150 2. Antonios VS, Noel AA, Steckelberg JM, Wilson WR, Baddour LM (2006) Prosthetic vascular graft infection: a risk factor analysis using a case-control study. J Infect 53:49-55 3. Archer NK, Mazaitis MJ, Costerton JW, Leid JG, Powers ME, Shirtliff ME (2011) Staphylococcus aureus biofilms: properties, regulation, and roles in human disease. Virulence 2:445-459 4. Atahan E, Katrancioglu N, Oztop Y, Tuncer E, Ozer H, Sinasi M, Engin A, Yalta TD, et al. (2009) Vascular graft infection by Staphylococcus aureus: efficacy of linezolid, teicoplanin and vancomycin systemic prophylaxis protocols in a rat model. Cardiovasc J Afr 20:122-125 5. Bannerman TL, Peacock SJ (2006) Staphylococcus, Micrococcus, and other catalase-positive cocci that grow aerobically. In: Murray PR et al. (eds) Man Clin Microbiol, 8th ed. ASM Press, Washington, DC, pp. 384-404 6. Begun J, Gaiani JM, Rohde H, Mack D, Calderwood SB, Ausubel FM, Sifri CD (2007) Staphylococcal biofilm exopolysaccharide protects against Caenorhabditis elegans immune defenses. PLoS Pathog 3:57 7. Boyle-Vavra S, Daum RS (2007) Community-acquired methicillinresistant Staphylococcus aureus: the role of Panton-Valentine leukocidin. Lab Invest 87:3-9 8. Carmo JS, Caixeta AM, Abizaid A, Arnoni AS, Paulista PP, de Sousa LC, Magalhães HM, Piegas LS, et al. (1994) Infective endocarditis in children and adolescents. Arq Bras Cardiol 63:173-177 9. Carvalho CE, Berezin EN, Pistelli IP, Mímica L,Cardoso MRA (2005) Sequential microbiological monitoring of tracheal aspirates

SILVA-SANTANA ET AL

in intubated patients admitted to a pediatric intensive care unit. J Pediatr 81:29-33 10. Cavalcanti SMM, França ER, Cabral C, Vilela MA, Montenegro F, Menezes D, Medeiros ACR (2005) Prevalence of Staphylococcus aureus introduced into intensive care units of a university hospital. Braz J Infect Dis 9:56-63 11. Chaieb K, Zmantar T, Souiden Y, Mahdouani K, Bakhrouf A (2011) XTT assay for evaluating the effect of alcohols, hydrogen peroxide and benzalkonium chloride on biofilm formation of Staphylococcus epidermidis. Microb Pathog 50:1-5 12. Correal JCD, Marques EA, Werneck LG, Leão RS, Damasco PV (2013) Staphylococcus aureus infections: change in epidemiology at Pedro Ernesto University Hospital. J HUPE 12:31-46 13. Costerton JW, Stewart PS, Greenberg EP (1999) Bacterial biofilms: a common cause of persistent infections. Science 284:1318-1322 14. Davis JS (2005) Management of bone and joint infections due to Staphylococcus aureus. Int J Med 35:79S-96S 15. Diep BA, Gill SR, Chang RF, HaiVan PT, Chen JH, Davidson MG, Lin F, Lin J (2006) Complete genome sequence of USA300, an epidemic clone of community-acquired methicillin-resistant Staphylococcus aureus. Lancet 367:731-739 16. Difco & BBL Manual: Manual of microbiological culture media, 2nd ed. (2003). Becton, Dickinson & Co, Sparks, Maryland 17. Foster TJ (2005) Immune evasion by staphylococci. Nat Rev Microbiol 3:948-958 18. Fox PM, Lampen RJ, Stumpf KS, Archer GL, Climo MW (2006) Successful therapy of experimental endocarditis caused by vancomycin-resistant Staphylococcus aureus with a combination of vancomycin and β-lactam antibiotics. Antimicrob Agents Chemother 50:2951-2956 19. Gillet Y, Issartel B, Vanhems P, Fournet JC, Lina G, Bes M, Vandenesch F, Piémont Y, et al. (2002) Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet 359:753-759 20. Gosbell IB (2005) Diagnosis and management of cateter-related bloodstream infections due to Staphylococcus aureus. Intern Med J 35:45S-62S. 21. Hassan A, Usman J, Kaleem F, Omair M, Khalid A, Igbal M (2011) Evaluation of different detection methods of biofilm formation in the clinical isolates. Braz J Infect Dis 15:305-311 22. Iwatsuki K, Yamasaki O, Morizane S, Oono T (2006) Staphylococcal cutaneous infections: invasion, evasion and aggression. J Dermatol Sci 42:203-214 23. Jefferson KK (2004) What drives bacteria to produce a biofilm? FEMS Microbiol Lett 236:163-173 24. Kiedrowski MR, Horswill AR (2011) New approaches for treating staphylococcal biofilm infections. Ann N Y Acad Sci 124:104-121 25. Kim HK, Missiakas D, Schneewind O (2014) Mouse models for infectious diseases caused by Staphylococcus aureus. J Immunol Methods 410:88-99 26. Lima JBA, Skare TL, Malafaia O, Ribas-Filho JM, Michaelis T, Ribas FM, Macedo RAC (2011) Sepsis inducing syndrome of multiple organ dysfunction: an experimental study in rats. Arq Bras Cir Dig 24:95-102 27. Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter M-O, Gauduchon


BIOFILM IN CATHETER-RELATED INFECTIONS

V, Vandenesch F, Etienne J (1999) Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 29:1128-1132 28. Martineau F, Picard FJ, Roy PH, Ouellette M, Bergeron MG (1998) Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus. J Clin Microbiol 36:618-623 29. McDonald CL, Chapin K (1995) Rapid Identification of Staphylococcus aureus from blood culture bottles by a classic 2-hour tube coagulase test. J Clin Microbiol 33:50-52 30. Murray PR, Baron EJ (eds) (2007) Manual of clinical microbiology, 9th ed. ASM, Washington D.C. 31. O’Gara JP (2007) ica and beyond: biofilm mechanisms and regulation in Staphylococcus epidermidis and Staphylococcus aureus. FEMS Microbiol Lett 270:179-188 32. Oliveira DC, Lencastre H (2002) Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 46:2155-2161 33. Oliveira GA, Okada SS, Guenta RS, Mamizuka EM (2001) Evaluation of the tolerance to vancomycin in 395 oxacillin-resistant Staphylococcus aureus strains isolated from Brazilian hospitals. J Bras Patol 37:239-46 34. O’Riordan K, Lee JC (2004) Staphylococcus aureus capsular polysaccharides. Clin Microbiol Rev 17:218-234 35. Otto M (2006) Bacterial evasion of antimicrobial peptides by biofilm formation. Curr Top Microbiol Immunol 306:251-258 36. Robert S, Chambers S (2005) Diagnosis and management of Staphylococcus aureus infections of the skin and soft tissue. Intern Med J 35:97S-105S 37. Santana GS, Dip EC, Aguiar-Alves F (2015) Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-susceptible Staphylococcus aureus (MSSA) cause dermonecrosis and bacteremia in rats. Int Res J Microbiol 6:6-11 38. Schaechter M, Marangoni DV (1998) Infectious diseases: conduct, diagnosis and therapy, 2nd ed. Guanabara Koogan, Rio de Janeiro, Brazil 39. Sherertz RJ, Raad II, Belani A, Koo LC, Rand KH, Pickett DL, Straub SA, Fauerbach LL (1990) Three-year experience with soni-

Int. Microbiol. Vol. 19, 2016

207

cated vascular catheter cultures in a clinical microbiology laboratory. J Clin Microbiol 28:76-82 40. Silva-Santana G, Castro HC, Ferreira BLA, Aguiar-Alves F (2015) Staphylococcus aureus biofilm development: the urgent need for treatment alternatives. J Global Biosci 4:2092-2107 41. Srinivasan A, Dick JD, Perl TM (2002) Vancomycin resistance in staphylococci. Clin Microbiol Rev 15:430-438 42. Storti A, Pizzolitto AC, Stein RA, Pizzolitto EL (2007) Biofilm detection on central venous catheter using a quantitative culture method. Braz J Clin Analys 39:183-187 43. Sutherland IW (2001) Biofilm exopolysaccharides: a strong and sticky framework. Microbiology 147:3-9 44. Szmigielski S, Prévost G, Monteil H, Colin DA, Jeljaszewicz J (1999) Leukocidal toxins of staphylococci. Zentralbl Bakteriol 289:185-201 45. Talan DA, Krishnadasan A, Gorwitz RJ, Fosheim GE, Limbago B, Albrecht V, Moran GJ (2011) Comparison of Staphylococcus aureus from skin and soft-tissue infections in US emergency department patients, 2004 and 2008. Clin Infect Dis 53:144-149 46. Taro M, Shiro J, Takuto O, Yuki N, Hamamoto K, Mamishin K, Yahiro T, Hara S, et al. (2015) Infection mechanism of biofilm-forming Staphylococcus aureus on indwelling foreign materials in mice. Int Wound J 12:122-131 47. Thoendel M, Kavanaugh JS, Flack CE, Horswill AR (2011) Peptide signaling in the staphylococci. Chem Rev 111:117-151 48. Velázquez-Meza ME (2005) Staphylococcus aureus methicillin-resistant: emergence and dissemination. Salud Publica Mex 47:381-387 49. Wardenburg JB, Palazzolo-Ballance AM, Otto M, Schneewind O, DeLeo FR (2008) Panton-Valentine leukocidin is not a virulence determinant in murine models of community-associated methicillinresistant Staphylococcus aureus disease. J Infect Dis 198:1166-1170 50. Zheng-Ming W, Chao L, Roman D (2000) Chemokines are the main proinflammatory mediators in human monocytes activated by Staphylococcus aureus peptidoglycan and endotoxin. J Biol Chem 275:20260-20267


RESEARCH ARTICLE International Microbiology 19(4):209-215 (2016) doi:10.2436/20.1501.01.279. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Characterization of Escherichia coli clinical isolates causing urinary tract infections in the community of Chilpancingo, Mexico Jesús A. Hernández-Vergara,1 Verónica I. Martínez-Santos,2 Romina B. Radilla-Vázquez,1 Jesús Silva-Sánchez,3 Amalia Vences-Velásquez,1 Natividad Castro-Alarcón1 1 School of Chemical-Biological Sciences, Autonomous University of Guerrero, Chilpancingo, Guerrero, Mexico. CONACyT-UAGro, Autonomous University of Guerrero, Chilpancingo, Guerrero, Mexico. 3National Institute of Public Health, Center for Research on Infectious Diseases (CISEI), Bacterial Resistance Group, Cuernavaca, Morelos, Mexico

2

Received 15 November 2016 · Accepted 15 December 2016

Summary. Escherichia coli is the main cause of urinary tract infections (UTI) in ambulatory patients, especially strains belonging to the B2 phylogenetic group and ST131 clonal group. Antibiotic treatment is usually administered empirically; however, it is not always effective due to bacterial multidrug resistance and the production of extended spectrum β-lactamases (ESBLs). The aim of this study was to characterize E. coli clinical isolates from patients with UTI in a community of the State of Guerrero, Mexico. From January to August 2014, 134 clinical isolates of E. coli were recovered. Strain identification and antibiotic susceptibility were performed using the Vitek automated system. Phylogenetic and O25b-ST13 groups were determined by multiple PCR. Identification of the blaCTX-M, blaTEM, and blaSHV genes was performed by conventional PCR. We found that over 50% of the isolates were resistant to betalactams and quinolones, while 0 to 33% were resistant to aminoglycosides and nitrofurans, and 56.49% of the strains were ESBL producers. B2 phylogenetic group was the most predominant (43%) compared to the other groups. The prevalence of bla genes was: blaCTX-M 64.3%, blaSHV 41.4%, and blaTEM 54.3%. These results show a high percentage (55%) of multidrug-resistant strains isolated from UTI patients from the community in the city of Chilpancingo, Guerrero, Mexico. [Int Microbiol 19(4): 209-215 (2016)] Keywords: Escherichia coli · urinary tract infections · β-lactamases · multidrug resistance · Chilpancingo (Mexico)

Introduction Urinary tract infections (UTIs) are defined by the presence of bacterial pathogens in the urinary tract. They are the second most prevalent infectious disease, comprising around one Corresponding author: N. Castro-Alarcón E-mail: natividadcastro24@gmail.com *

fourth of all infections [13]. In Mexico, they are the first cause of medical outpatient consultation of women in reproductive age, and in 2010 they were the third cause of morbidity [4]. UTIs are classified according to the site of infection, in uncomplicated and complicated [25]. In most cases, uncomplicated UTIs are treated effectively by empirical antibiotic therapy, without performing urine culture unless the empirical therapy fails. This empirical therapy, coupled with the high


210

Int. Microbiol. Vol. 19, 2016

rate of infections per year worldwide, and the indiscriminate use of antibiotics, has led to an increase in antibiotic resistance in UTI-causing bacteria [1]. Thus, treatments have become more complex, since there has been an increase in antibiotic resistance along with the occurrence of extended-spectrum β-lactamases (ESBLs) [21]. ESBLs are plasmid-encoded enzymes produced by many Gram-negative bacteria. They confer resistance to penicillins, broad-spectrum cephalosporins (e.g., cefotaxime, ceftriaxone, ceftazidime) and monobactams (e.g., aztreonam), but not to cephamycins (e.g., cefoxitin and cefotetan) and carbapenems (e.g., imipenem, meropenem, and ertapenem). They are usually located on large plasmids, which also carry genes for resistance to other antibiotics, including fluoroquinolones, aminoglycosides, and cotrimoxazole. These β-lacta­ mases, unlike AmpC β-lactamases, are inhibited by clavulanic acid, tazobactam or sulbactam [19,29]. ESBL-producing strains also show co-resistance to aminoglycosides, fluoroquinolones, tetracyclines, nitrofurantoin, and trimetho­ prim-sulfamethoxazole [30]. The most common β-lact­mases are the TEM and SHV types, which are mainly expressed in Escherichia coli and Klebsiella pneumoniae, respectively, and also the CTX-M, which was described later [3]. Escherichia coli is the leading cause of urinary tract infections, it being responsible for 75−90% of UTIs in ambulatory patients [24]. This bacterium has been classified into seven main phylogenetic groups (A, B1, B2, C, D, E, and F), and one Escherichia cryptic clade I, based on the combination of four genetic markers: arpA, chuA, yjaA, and the DNA fragment TspE4.C2 [7]. Uropathogenic strains usually belong to groups B2 and to a lesser extent to group D, whereas commensal strains belong to groups A and B1 [2,27]. Among B2 pathogenic strains, E. coli sequence type 131 (ST131) is considered an emerging important pathogen. Strains belonging to this group are resistant not only to most β-lactam antibiotics, but also to aminoglycosides and fluoroquinolones [17]. Most ST131 strains belong to the O25:H4 serotype, they having the specific O25b type. However, ST131 strains with serotype O16:H5 have been recently identified, as well as some others that are non typeable for O and H antigens [11,20]. The aim of this work was to analyze a total of 134 E. coli clinical isolates from ambulatory patients with UTI from the community in the city of Chilpancingo, Guerrero, Mexico in order to determine their antibiotic susceptibility, ESBLs production and phylogenetic group.

HERNÁNDEZ-VERGARA ET AL.

Material and methods Escherichia coli isolates and antibiotic susceptibility testing. Clinical urine samples from 131 ambulatory patients from the ISSSTE clinic in Chilpancingo, Guerrero, Mexico where analyzed. Samples were collected from January to August of 2014 and only one isolate per patient was examined. Identification of isolates and antimicrobial susceptibility testing was performed by Vitek automated system. Antibiotics assayed were: ampicillin, ampicillin/sulbactam, cefazolin, ceftriaxone, cefepime, aztreonam, amikacin, gentamicin, tobramycin, ciprofloxacin, moxifloxacin, nitrofurantoin, and trimethoprim/sulfamethoxazole. Isolates resistant to antibiotics of three or more different classes were classified as multidrug-resistant (MDR). ESBLs production. ESBLs production was confirmed by the doubledisk synergy test (DDST) following the CLSI guidelines [Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing, 16th informational supplements. CLSI Document M2A9, Wayne PA: 2006]. Disks containing ceftazidime (30 µg) or cefotaxime (30 µg) with or without 10 µg clavulanic acid were used. The plates were incubated at 37 °C for 18 h. Escherichia coli strain ATCC 25922 was used as negative control, and K. pneumoniae strain ATCC 700603 was used as positive control. Conventional phylogenetic grouping. Extraction of total bacterial DNA from isolated E. coli colonies was performed by heat shock, boiling 2 to 3 colonies resuspended in 100 µl of distilled water for 5 min. Samples were cooled in ice for 5 min, boiled again, and centrifuged at 10,000 rpm for 2 min. The supernatant was recovered and stored at −20 °C until use. Assignment of E. coli phylogenetic groups was performed using the quadruplex phylo-group assignment PCR assay described by Clermont et al. [7] using primers for genes arpA, chuA and yjaA, and the TspE4.C2 DNA fragment. PCR was performed in a final volume of 20 µl using 2.5 U of Taq polymerase, 2 mM dNTP’s, 25 mM MgCl2, 2 µl 10X buffer, 20 pmol of each primer, and 200 ng of DNA. The conditions used were: 5 min at 94 °C (1 cycle), 30 s at 94 °C, 30 s at 55 °C, 30 s at 72 °C (30 cycles), 7 min at 72 °C. The amplicons were analyzed by 2% agarose gel electrophoresis. The detection of O25b/ST131 clonal group was done only with isolates belonging to the B2 phylogenetic group by multiplex PCR using primers O25pabBspe.F (5´-TCCAGCAGGTGCTGGATCGT-3´) and O25pabBspe.R (5´-GCGAAATTTTTCGCCGTACTGT-3´) [8] , and rfb1bis.f (5´-ATACCGACGACGCCGATC-3´) and rfbO25b.r (5´-TGCTATTCATTATGCGCAGC-3´) [9]. PCR was performed as follows: 2 min at 94 °C (1 cycle), 30 s at 94 °C, 10 s at 60 °C, 30 s at 72 °C (30 cycles), 2 min at 72 °C. The amplicons were analyzed by 2% agarose gel electrophoresis. Identification of bla genes. The identification of bla genes was performed by PCR using specific primers for TEM, SHV and CTX-M types: TEMF (5´-CCTTCCTGTTTTTGCTCACCCA-3´), TEMR (5´-TACGATACGGGAGGGCTTAC-3´) [16], SHVF (5´-ATGCGTTATATTCGCCTGTG-3´), SHVR (5´-TTAGCGTTGCCAGTGCTCGAT-3´) [18] CTX-M/F´ (5´-TTTGCGATGTGCAGTACCAGTAA-3´), and CTX-M/R´ (5´-CGATATCGTTG GTGGTGCCATA-3´) [12]. PCR was performed in a final volume of 25 µl using 5 U of Taq polymerase, 10 mM dNTPs, 25 mM MgCl2, 10X buffer, 10 pmol of each primer and 5 µl of DNA. The amplicons were analyzed by 2% agarose gel electrophoresis. Escherichia coli strain ATCC 25922 was used as negative control, ESBLs-producing E. coli strains carrying genes SHV-2, TEM-1 and CTX-M-15 were used as positive controls.


URINARY TRACT INFECTIONS BY E. COLI

Int. Microbiol. Vol. 19, 2016

Conjugation experiments and plasmid isolation. A resistance transfer experiment using a conjugation assay based on the method described by Miller (1992) was performed for 5 strains carrying ESBLs genes. Sodium azide-resistant E. coli J53 was used as the recipient strain. Transconjugants were selected in selective media containing sodium azide (150 µg/ml) (Sigma) plus ampicillin (AMP) or ceftazidime (CAZ), and replicated afterwards in media M9 and MM. Plasmid DNA was extracted from clinical isolates and transconjugants by the method described by Kieser [15]. Purification of the 6-kb plasmids was performed with the Zymo Plasmid Miniprep kit according to the manufacturer’s instructions. DNA was visualized after electrophoresis in 1% agarose gels stained with ethidium bromide.

Minimum inhibitory concentration (MIC). The isolates that were positive for ESBLs production were confirmed by the MIC reduction test using the broth dilution method according to the CLSI guidelines. The ranges of concentrations tested were 256–0.03 µg/ml for CAZ, and 256–0.015 µg/ml for CTX in Mueller-Hinton broth. Cut points: CTX-S (sensitive): ≤8; I (intermediate): 10–32; R (resistant): ≥64; CAZ-S: ≤8; I: 16; R: ≥32. Plates were incubated at 35 °C for 18 h. The E. coli ATCC 25922 strain was used as a control to validate susceptibility tests. Statistical analysis. All statistical analyses were performed using the Stata-Transfer V.12.0 software. Correlation between ESBLs production and antibiotic susceptibility was analyzed with the Chi-squared test. Phylogenetic

Table 1. Correlation between antibiotic susceptibility patterns and ESBL production of isolated Escherichia coli strains ESBL– n (%)

ESBL+ n (%)

Total %

P value

Susceptible

19 (15.2)

0 (0)

15.2

< 0.001*

Resistant

36 (28.8)

70 (56)

84.8

Susceptible

21 (16.8)

21 (16.8)

33.6

Resistant

34 (27.2)

49 (39.2)

66.4

Susceptible

48 (38.4)

1 (0.8)

39.2

Resistant

7 (5.6)

69 (55.2)

60.8

Susceptible

53 (42.4)

1 (0.8)

43.2

Resistant

2 (1.6)

69 (55.2)

56.8

Susceptible

52 (41.6)

1 (0.8)

42.4

Resistant

3 (2.4)

69 (55.2)

57.6

Susceptible

52 (41.6)

2 (1.6)

43.2

Resistant

3 (2.4)

68 (54.4)

56.8

Susceptible

48 (38.4)

36 (28.8)

67.2

Resistant

7 (5.6)

34 (27.2)

32.8

Susceptible

51 (40.8)

34 (27.2)

68

Resistant

4 (3.2)

36 (28.8)

32

Susceptible

41 (32.8)

14 (11.2)

44

Resistant

14 (11.2)

56 (44.8)

56

Susceptible

42 (33.6)

14 (11.2)

44.8

Resistant

13 (10.4)

56 (44.8)

55.2

Susceptible

49 (39.2)

64 (51.2)

90.4

Resistant

6 (4.8)

6 (4.8)

9.6

Susceptible

26 (20.8)

17 (13.6)

34.4

Resistant

29 (23.2)

53 (42.4)

65.6

No MDR

42 (33.6)

14 (11.2)

44.8

MDR

13 (10.4)

56 (44.8)

55.2

Antibiotic resistance Ampicillin

Ampicillin/Sulbactam

Cefazolin

Ceftriaxone

Cefepime

Aztreonam

Gentamicin

Tobramycin

Ciprofloxacin

Moxifloxacin

Nitrofurantoin

Trimethoprim/Sulfamethoxazole

Multiresistant

* P value < 0.05, statistically significant.

211

0.522

<0.001*

<0.001*

<0.001*

<0.001*

<0.001*

<0.001*

<0.001*

<0.001*

0.634

0.008*

<0.001*


212

Int. Microbiol. Vol. 19, 2016

HERNÁNDEZ-VERGARA ET AL.

groups and bla genes were compared using Fisher’s exact test. All P values > 0.05 were considered statistically significant.

Table 3. Escherichia coli phylogenetic groups and bla genes prevalence Phylogenetic group

Results Identification and susceptibility patterns. Of the 131 isolates tested, 4 were identified as Escherichia fergusonii and 2 as E. albertii, leaving us with 125 E. coli strains. Of the 125 strains isolated, 84.8% were resistant to ampicillin, 66.4% to ampicillin/sulbactam, 60.8% to cefazolin, 56.8% to ceftriaxone, 57.6% to cefepime, 56.8% to aztreonam, 32.8% to gentamycin, 32% to tobramycin, 56% to ciprofloxacin, 55.2% to moxifloxacin, and 65.6% to trimethoprim/sulfamethoxazole. Note that all of the isolates were sensitive to amikacin and carbapenems, while 90.4% were sensitive to nitrofurantoin. More than half of the isolates (55.2%) were classified as MDR, since they were resistant to 3 or more classes of antibiotics. To determine if the isolated strains produced ESBLs, a DDST assay was performed. Of the 125 isolated strains, 70 (56%) were positive for ESBLs production. The correlation between susceptibility rates of the isolated strains and ESBLs production are shown in Table 1. MDR is related to ESBLs production, obtaining statistically significant P values. Phylogenetic grouping. Of the 125 clinical isolates ,12.8% belonged to group A, 6.4% to group B1, 43.2% to group B2, 10.4% to group C, 10.4% to group D, 2.4% to

Table 2. Correlation between Escherichia coli phylogenetic groups and ESBLs production ESBL

Phylogenetic group (n = 125) *

Positive [n (%)]

Negative [n (%)]

Total (n)

A

8 (11.4)

8 (14.5)

16

B1

2 (2.8)

6 (10.9)

8

B2

37 (52.8)

17 (30.9)

54

C

6 (8.5)

7 (12.7)

13

D

5 (7.1)

8 (14.5)

13

E

0 (0)

3 (5.4)

3

F

7 (10.0)

2 (3.6)

9

Clade I

5 (7.1)

4 (7.2)

9

Total

70 (100)

55 (100)

125

* P value = 0.042, calculated with Fisher’s exact test.

TEMa [n (%)]

SHVb [n (%)]

CTX-M* [n (%)]

A

4 (10.5)

4 (13.8)

4 (8.9)

B1

1 (2.6)

2 (6.9)

0

B2

19 (50)

12 (41.4)

27 (60)

C

3 (7.9)

1 (3.4)

6 (13.3)

D

4 (10.5)

2 (6.9)

4 (8.9)

F

5 (13.2)

6 (20.7)

1 (2.2)

Clade I

2 (5.3)

2 (6.9)

3 (6.7)

Total

38 (100)

29 (100)

45 (100)

P value = 0.005 (statistically significant), calculated with Fisher’s exact test. a (P = 0.513), b (P = 1.00). *

group E, 7.2% to group F, and 7.2% to clade I, group B2 being the most prevalent. We then analyzed strains in group B2 to determine if they belonged to the O25b-ST131 group. PCR results showed amplified products with both pairs of primers in 37% of the clinical isolates, meaning that they belonged to the O25b-ST131 group; 59.3% showed products only with primers O25pabBspe, meaning that they belonged to the sequence type ST131, and 3.7% were positive only for serogroup O25b. ESBLs identification and horizontal transfer. As shown in Table 2, 52.8% of ESBLs-producing strains belonged to group B2, while the rest were distributed among the other groups, except group E. The PCR was performed for the 70 positive strains to detect the bla gene blaCTX-M. This gene was present in 64.3% of the isolated strains. The bla genes blaTEM and blaSHV were also detected, they being present in 54.3% and 41.4%, respectively. After identifying the bla genes, we correlated them with the phylogenetic groups (Table 3). Our results showed that none of the two strains identified as B1 were positive for blaCTX-M, while it was the most prevalent in strains from group B2. Group B2 also had the most strains with blaTEM and blaSHV. Of the strains belonging to group O25b-ST131, 75% contained the blaCTX-M gene. As most ESBLs genes have been shown to be encoded in plasmids [26], we performed conjugation assays with 5 ESBL-producing strains. As shown in Table 4, two strains (2890 and 3361) could transfer large-sized plasmids, although strain 2890 only transferred one, while the rest of the strains trans-


URINARY TRACT INFECTIONS BY E. COLI

Int. Microbiol. Vol. 19, 2016

213

Table 4. Genotypic and phenotypic characteristics of Escherichia coli isolates and their transconjugants MIC (µg/ml) CAZ

CTX

Transconjugant

CTX-M, SHV, TEM

64

>256

T3332

6

110, 6

CTX-M, TEM

>256

>256

T2806

B2

130, 6

CTX-M, SHV, TEM

128

>256

2890

C

100, 90

CTX-M, SHV, TEM

>256

3361

D

130, 100

CTX-M, SHV

>256

Strain

Phylog. group

Plasmid (kb)

ESBL

3332

B2

130, 6

2806

B2

2136

Plasmid (kb)

ESBL

MIC (µg/ml) CAZ

CTX

CTX-M, SHV, TEM

128

>256

6

CTX-M, TEM

128

>256

T2136

6

SHV, TEM

0.06

0.25

>256

T2890

90

SHV, TEM

0.5

0.25

>256

T3361

130, 100

CTX-M, SHV

>256

>256

MIC: minimum inhibitory concentration. CAZ: ceftazidime. CTX: cefotaxime.

ferred only a 6-kb plasmid. To determine which bla genes were transferred, we performed PCR with purified plasmids from the transconjugants. Three strains received all the bla genes from the donor strains (T3332, T2806 and T3361), while the other two did not receive the blaCTX-M gene. The two strains that did not receive the blaCTX-M gene were sensitive to CAZ and CTX, suggesting that CTX-M should be the functional ESBLs.

Discussion Escherichia coli is the most common cause of uncomplicated and community acquired UTIs. Our results showed that multidrug resistance strains of E. coli were present in UTI patients from Chilpacingo, Guerrero, and that those strains belonged mainly to the phylogenetic group B2, specifically the sequence type ST131, which has been identified as the main etiological agent of community-acquired UTI, with resistance conferred by CTX-M-type β-lactamase enzymes [10]. Of the 94.54% of strains positive for ST131, only 36.36% belonged to serogroup O25b. The group O25b-ST131 is well recognized as an international pandemic clonal group [28], and in 2011 was identified in Mexico City [23] and Chilpancingo, Guerrero [22]. The strains that were positive for ST131 but negative for O25b might belong to serogroup O16, which has also been associated with the clonal group B2-ST131, and can

also be detected with the Clermont pabB PCR test, because the O16-ST131 group carries the same pabB allele (pabB74) [20]. We also observed that 56.7% of the isolated strains were MDR, and of these, 45.5% produced ESBLs. However, to determine which ESBLs-type enzyme is involved in this phenotype, it would be necessary to sequence all the bla genes identified, since this is essential to discriminate between the nonESBLs enzymes (e.g., TEM-1 or SHV-1) from the different variants of TEM and SHV ESBLs (e.g. TEM-3, SHV-2, etc.) [3], especially in the case of the transconjugants that, despite being positive for TEM and SHV bla genes, were sensitive to CAZ and CTX. Consistently with the fact that the group O25b-ST131 has been associated with the presence of the ESBLs type CTXM-15, it appears to be a correlation between O25b-ST131 strains (36.36%) and the presence of the CTX-M enzyme (38.2%). However, the sequencing of the blaCTX-M genes is necessary to determine that they effectively belong to the CTX-M-15 type. Note that the prevalence of the CTX-M-type ESBLs reported in this work is the lowest found in this region since 2003, when Castro et al. [5] found this gene with a prevalence of 43%, and by 2010 it had increased to 50% [6]. Regarding antibiotic resistance, our results are consistent with previous reports that show that Mexican strains have the highest rates of ampicillin-resistant bacteria (almost 80%), and trimethoprim (61%) [14]. In fact, 85% of the strains we


214

Int. Microbiol. Vol. 19, 2016

analyzed were ampicillin resistant and 68% were trimethoprim/sulfamethoxazole resistant. ESBL-producing strains are known to be resistant to all cephalosporins, broad-spectrum penicillins and aztreonam, as were our isolated strains, which showed between 57% and 66% resistance to these antibiotics. In addition, resistance to trimethoprim/sulfamethoxazole and aminoglycosides is generally transferred in the same plasmid, which makes therapeutic options limited. This seems to be the case for trimethoprim/sulfamethoxazole, for which we detected a high percentage of resistant strains, of which 43.3% were ESBLs positive. However, the resistance to aminoglycosides was low, ranging from around 30% for gentamycin and tobramycin to 0% for amikacin. These results indicate that in Chilpancingo, Guerrero, Mexico, it is still possible to use aminoglycosides to treat UTIs (especially amikacin), along with nitrofurantoin, for which only 10% of our strains were resistant. Note that, in 3 of 5 transconjugants, only a 6-kb plasmid was transferred, not the high molecular weight plasmids. Apparently, 2 of these 3 plasmids were R-plasmids, since they transferred bla genes, and the recipient strains became CAZ and CTX resistant. Although the third plasmid transferred the blaTEM and blaSHV genes, it did not transfer blaCTX-M, and thus the recipient strain was not resistant. Actually, the blaCTX-M gene was the only one that was not transferred in 100% of the cases, it being present in only 60% of the transconjugants. However, our results suggest that in our study population the CTX-M-type was the main ESBL.

Acknowledgements. This work was supported by the Fondo FOMIXCONACYT, Gobierno del Estado de Guerrero, México, Convocatoria M0008 2014-01 (No. 249671).

Competing interests. None declared.

References 1. Alos JI, Serrano MG, Gomez-Garces JL, Perianes J (2005) Antibiotic resistance of Escherichia coli from community-acquired urinary tract infections in relation to demographic and clinical data. Clin Microbiol Infect 11:199-203 2. Boyd EF, Hartl DL (1998) Chromosomal regions specific to pathogenic isolates of Escherichia coli have a phylogenetically clustered distribution. J Bacteriol 180:1159-1165 3. Bradford PA (2001) Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev 14:933-951

HERNÁNDEZ-VERGARA ET AL.

4. Calderón-Jaimes E, Casanova-Román G, Galindo-Fraga A, Gutiérrez-Escoto P, Landa-Juárez S, Moreno-Espinosa S, Rodríguez-Covarrubias F, Simón-Pereira L, et al. (2013) Diagnosis and treatment of urinary tract infections: a multidisciplinary approach for uncomplicated cases. Bol Med Hosp Infant Mex 70:3-10 5. Castro-Alarcón N, Carreón-Valle ED, Moreno-Godínez ME, Alarcón-Romero LdC (2008) Molecular characterization of extended spectrum β-lactamases-producing Escherichia coli. Enf Inf Microbiol 28:114-120 6. Castro-Alarcón N, Salgado-González JF, Ocampo-Sarabia RL, Silva-Sánchez J, Ruiz-Rosas M (2014) Caracterización de β-lactamasas de espectro extendido producidas por Escherichia coli de infecciones del tracto urinario adquiridas en la comunidad de Chilpancingo, Guerrero, Mexico. Tlamati Sabiduría 1:14-23 [In Spanish] 7. Clermont O, Christenson JK, Denamur E, Gordon DM (2013) The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep 5:58-65 8. Clermont O, Dhanji H, Upton M, Gibreel T, Fox A, Boyd D, Mulvey MR, Nordmann P, et al. (2009) Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J Antimicrob Chemother 64:274-277 9. Clermont O, Lavollay M, Vimont S, Deschamps C, Forestier C, Branger C, Denamur E, Arlet G (2008) The CTX-M-15-producing Escherichia coli diffusing clone belongs to a highly virulent B2 phylogenetic subgroup. J Antimicrob Chemother 61:1024-1028 10. Coqe TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, Baquero F, Canton R, et al. (2008) Dissemination of clonally related Escherichia coli strains expressing extended-spectrum betalactamase CTX-M-15. Emerg Infect Dis 14:195-200 11. Dahbi G, Mora A, López C, Alonso MP, Mamani R, Marzoa J, Coira A, García-Garrote F, et al. (2013) Emergence of new variants of ST131 clonal group among extraintestinal pathogenic Escherichia coli producing extended-spectrum beta-lactamases. Int J Antimicrob Agents 42:347-351 12. Edelstein M, Pimkin M, Palagin I, Edelstein I, Stratchounski L (2003) Prevalence and molecular epidemiology of CTX-M extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob Agents Chemother 47:3724-3732 13. Foxman B (2003) Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Dis Mon 49:53-70 14. Foxman B (2010) The epidemiology of urinary tract infection. Nat Rev Urol 7:653-660 15. Kieser T (1984) Factors affecting the isolation of CCC DNA from Streptomyces lividans and Escherichia coli. Plasmid 12:19-36 16. Lal P, Kapil A, Das BK, Sood S (2007) Occurrence of TEM & SHV gene in extended spectrum β-lactamases (ESBLs) producing Klebsiella sp. isolated from a tertiary care hospital. Indian J Med Res 125:173-178 17. Lau SH, Reddy S, Cheesbrough J, Bolton FJ, Willshaw G, Cheasty T, Fox AJ, Upton M (2008) Major uropathogenic Escherichia coli strain isolated in the northwest of England identified by multilocus sequence typing. J Clin Microbiol 46:1076-1080 18. Liu CP, Wang NY, Lee CM, Weng LC, Tseng HK, Liu CW, Chiang CS, Huang FY (2004) Nosocomial and community-acquired Enterobacter cloacae bloodstream infection: risk factors for and prevalence of SHV-12 in multiresistant isolates in a medical centre. J Hosp Infect 58:63-77


URINARY TRACT INFECTIONS BY E. COLI

19. Livermore DM (2008) Defining an extended-spectrum β-lactamase. Clin Microbiol Infect 14 Suppl 1:3-10 20. Matsumura Y, Yamamoto M, Nagao M, Hotta G, Matsushima A, Ito Y, Takakura S, Ichiyama S (2012) Emergence and spread of B2ST131-O25b, B2-ST131-O16 and D-ST405 clonal groups among extended-spectrum-β-lactamase-producing Escherichia coli in Japan. J Antimicrob Chemother 67:2612-2620 21. Meier S, Weber R, Zbinden R, Ruef C, Hasse B (2011) Extendedspectrum beta-lactamase-producing Gram-negative pathogens in community-acquired urinary tract infections: an increasing challenge for antimicrobial therapy. Infection 39:333-340 22. Miranda-Estrada LI, Ruíz-Rosas M, Molina-López J, Parra-Rojas I, González-Villalobos E, Castro-Alarcón N (2016) Relationship between virulence factors, resistance to antibiotics and phylogenetic groups of uropathogenic Escherichia coli in two locations in Mexico. Enferm Infecc Microbiol Clin (in Spanish) doi:10.1016/j. eimc.2016.02.021 23. Molina-López J, Aparicio-Ozores G, Ribas-Aparicio RM, GavilanesParra S, Chávez-Berrocal ME, Hernández-Castro R, ManjarrezHernández HA (2011) Drug resistance, serotypes, and phylogenetic groups among uropathogenic Escherichia coli including O25-ST131 in Mexico City. J Infect Dev Ctries 5:840-849 24. Nicolle LE (2002) Epidemiology of urinary tract infections. Clinical Microbiology Newsletter 24:135-140

Int. Microbiol. Vol. 19, 2016

215

25. Noormandi A, Dabaghzadeh F (2015) Effects of green tea on Escherichia coli as a uropathogen. J Tradit Complement Med 5:15-20 26. Paterson DL (2000) Recommendation for treatment of severe infections caused by Enterobacteriaceae producing extended-spectrum β-lactamases (ESBLs). Clin Microbiol Infect 6:460-463 27. Picard B, García JS, Gouriou S, Duriez P, Brahimi N, Bingen E, Elion J, Denamur E (1999) The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun 67:546-553 28. Rogers BA, Sidjabat HE, Paterson DL (2011) Escherichia coli O25b-ST131: a pandemic, multiresistant, community-associated strain. J Antimicrob Chemother 66:1-14 29. Rupp ME, Fey PD (2003) Extended spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae: considerations for diagnosis, prevention and drug treatment. Drugs 63:353-365 30. Winokur PL, Canton R, Casellas JM, Legakis N (2001) Variations in the prevalence of strains expressing an extended-spectrum beta-lactamase phenotype and characterization of isolates from Europe, the Americas, and the Western Pacific region. Clin Infect Dis 32 Suppl 2:S94-103


INDEX VOLUME 19 International Microbiology (2016) www.im.microbios.org

Contents Volume 19 · 2016 Aguiar-Alves F à Silva-Santana G Alansari AS à Yaish MW Alcamí A à Núñez A Al-Harrasi I à Yaish, MW Allan Green TG à FernándezMartínez MA Almarza O à A functional ferric uptake regulator (Fur) protein in the fish pathogen Piscirickettsia salmonis, 49 doi: 10.2436/20.1501.01.263 Álvarez-Contreras AK à HernándezRobles MF Al-Yahyai R à Yaish MW Amo de Paz G à Núñez A Arróniz-Crespo M à FernándezMartínez MA Avilés-Reyes RX à Mora FX Ayala M à Almarza O Belda-Ferre P à Lasa A Bru S à Jiménez J Camacho-López MA à Lara-Severino Camelo-Castillo A à Lasa A Casanova-González E à LaraSeverino RC Castro-Alarcón N à HernándezVergara JA Chan YS à Investigation of twenty selected medicinal plants from Malaysia for anti-Chikungunya virus activity, 175 doi: 10.2436/20.1501.01.275 Clotet J à Jiménez J Contreras-Cordero JF à Genetic and serologic surveillance of rotavirus with P(8) and P(4) genotypes in feces from children in the city of Chihuahua, northern Mexico, 27 doi: 10.2436/20.1501.01.260

Curiel-Quesada E à HernándezRobles MF De los Ríos, A à Fernández-Martínez MA Dec M à Antimicrobial activity of Lactobacillus strains of chicken origin against bacterial pathogens, 57 doi: 10.2436/20.1501.01.264 Delvenne P à Thellin O Devi A à Prevalence of Campylobacter spp. in diarrhea samples from patients in New South Wales, Australia, 33 doi: 10.2436/20.1501.01.261 ElMoualij B à Thellin O Fernández Moreira, E à Mora FX Fernández-Martínez MA à Functional ecology of soil microbial communities along a glacier forefield in Tierra del Fuego (Chile), 161 doi: 10.2436/20.1501.01.274 García AM à Núñez A Glick BR à Yaish MW Gómez-Oliván LM à Lara-Severino RC Grossart H-P à Srivastava A Guerrero-Latorre L à Mora FX Gunjilac AS à Devi A Gutiérrez Bustillo AM à Núñez A Heinen E à Thellin O Hernández-Luna CE à ContrerasCordero JF

Hernández-Robles MF à Virulence factors and antimicrobial resistance in environmental strains of Vibrio alginolyticus, 191 doi: 10.2436/20.1501.01.277 Hernández-Vergara JA à Characterization of Escherichia coli clinical isolates causing urinary tract infections in the community of Chilpancingo, Mexico, 209 doi: 10.2436/20.1501.01.279 Infante-Ramírez R à ContrerasCordero JF Isaac-Olivé K à Lara-Severino RC Jiménez J à Phosphate: from stardust to eukaryotic cell cycle control, 133 doi: 10.2436/20.1501.01.271 Juárez-García P à Hernández-Robles MF Keuter S à Spatial homogeneity of bacterial and archaeal communities in the deep eastern Mediterranean Sea surface sediments, 109 doi: 10.2436/20.1501.01.269 Khoo KS à Chan YS Kongthai P à Thummeepak R Lara-Severino RC à Haloalkatolerant Actinobacteria with capacity for anthracene degradation isolated from soils close to areas with oil activity in the State of Veracruz, Mexico, 15 doi: 10.2436/20.1501.01.259

217


Lasa A à Characterization of the microbiota associated to Pecten maximus gonads using 454 pyrosequencing, 93 doi: 10.2436/20.1501.01.267 Lenzi-Almeida KC à Silva-Santana G Leungtongkam U à Thummeepak R Lopes VGS à Silva-Santana G Mahony TJ à Devi A Martínez-Santos VI à HernándezVergara JA McMahon KD à Srivastava A Menchaca-Rodríguez GE à ContrerasCordero JF Mira A à Lasa A Mora FX à Atypical enteropathogenic Escherichia coli (aEPEC) in children under five years old with diarrhea in Quito (Ecuador), 157 doi: 10.2436/20.1501.01.273 Moreno DA à Núñez A Natividad-Bonifacio I à HernándezRobles MF Nowaczek A à Dec M Núñez A à Monitoring of the airborne biological particles in outdoor atmosphere. Part 1: Importance, variability and ratios, 1 doi: 10.2436/20.1501.01.258 Núñez A à Monitoring of the airborne biological particles in outdoor atmosphere. Part 2: Importance, variability and ratios, 69 doi: 10.2436/20.1501.01.265 Pérez-Ortega S à Fernández-Martínez MA Pointing SB à Fernández-Martínez MA Puchalski A à Dec M

218

Quatresooz P à Thellin O Quiñones-Ramírez EI à HernándezRobles MF Radilla-Vázquez RB à HernándezVergara JA Ramírez-Durán N à Lara-Severino Rastrojo A à Núñez A Ribeiro MPC à Jiménez J Rinkevich B à Keuter S Rodríguez-Padilla C à ContrerasCordero JF Romalde JL à Lasa A Romero D à Unicellular but not asocial. Life in community of a bacterium, 81 doi: 10.2436/20.1501.01.266 Romo-Sáenz CI à Contreras-Cordero JF Rozzi R à Fernández-Martínez MA Sancho LG à Fernández-Martínez MA Sandoval-Trujillo AH à Lara-Severino RC Santander J à Almarza O Segovia C à Almarza O Silva-Sánchez J à Hernández-Vergara JA Silva-Santana G à Biofilm formation in catheter-related infections by Panton-Valentine leukocidinproducing Staphylococcus aureus, 199 doi: 10.2436/20.1501.01.278 Sit NW à Chan YS Sitthisak S à Thummeepak R Soyer-Gobillard M-O à The Arago Laboratory of Banyuls and some of its Academicians, 183 doi: 10.2436/20.1501.01.276 Srivastava A à De novo synthesis and functional analysis of the phosphatase-encoding gene acI-B

of uncultured Actinobacteria from Lake Stechlin (NE Germany), 39 doi: 10.2436/20.1501.01.262 Stepanauskas R à Srivastava A Tamez-Guerra RS à ContrerasCordero JF Thellin O à Lysozyme as a cotreatment during antibiotics use against vaginal infections: An in vitro study on Gardnerella vaginalis biofilm models, 101 doi: 10.2436/20.1501.01.268 Thummeepak R à Distribution of virulence genes involved in biofilm formation in multi-drug resistant Acinetobacter baumannii isolates, 121 doi: 10.2436/20.1501.01.270 Valderrama K à Almarza O Vanniasinkam T à Devi A Vázquez-Salinas C à HernándezRobles MF Vences-Velásquez A à HernándezVergara JA Villarreal-Treviño L à ContrerasCordero JF Wernicki A à Dec M Wilkinson JM à Devi A Yaish MW à The use of high throughput DNA sequence analysis to assess the endophytic microbiome of date palm roots grown under different levels of salt stress, 143 doi: 10.2436/20.1501.01.272 Zorzi D à Thellin O Zorzi W à Thellin O


Authors Index · 2016 Aguiar-Alves F à 199 Alansari AS à 143 Alcamí A à 1, 69 Al-Harrasi I à 143 Allan Green TG à 161 Almarza O à 49 Álvarez-Contreras AK à 191 Al-Yahyai R à 143 Amo de Paz G à 1, 69 Arroniz-Crespo M à 161 Avilés-Reyes RX à 157 Ayala M à 49

Belda-Ferre P à 93 Berlanga M à 131 Bru S à 133

Camacho-López MA à 15 Camelo-Castillo A à 93 Casanova-González E à 15 Castro-Alarcón N à 209 Chan YS à 175 Clotet J à 133 Contreras-Cordero JF à 27 Curiel-Quesada E à 191

De los Ríos A à 161 Dec M à 57 Delvenne P à 101 Devi A à 33

Einen E à 101 ElMoualij B à 101

Fernández-Martínez MA à 161 Fernández-Moreira E à 157

García AM à 1, 69 Glick BR à 143 Gómez-Oliván LM à 15 Grossart HP à 39 Guerrero-Latorre L à 157 Gunjilac AS à 33 Gutiérrez-Bustillo AM à 1, 69

Hernández-Luna CE à 27 Hernández-Robles MF à 191 Hernández-Vergara JA à 209

Infante-Ramírez R à 27 Isaac-Olivé K à 15

Jiménez J à 133 Juárez-García P à 191

Keuter S à 109 Khoo KS à 175 Kongthai P à 121

Lara-Severino RC à 15 Lasa A à 93 Lenzi-Almeida KC à 199 Leungtongkam U à 121 Lopes VGS à 199

Mahony TJ à 33 MaMahon KD à 39 Martínez-Santos VI à 209 Menchaca-Rodríguez GE à 27 Mira A à 93 Mora FX à 157 Moreno DA à 1, 69

Natividad-Bonifacio I à 191 Nowaczek à 57 Núñez A à 1, 69

Pérez-Ortega S à 161 Pointing SB à 161 Puchalski A à 57

Quatresooz P à 101 Quiñones-Ramírez EI à 191

Radilla-Vázquez RB à 209 Ramírez-Durán N à 15 Rastrojo A à 1, 69 Ribeiro MPC à 133 Rinkevich B à 109 Rodríguez-Padilla C à 27 Romalde JL à 93 Romero D à 81 Romo-Sáenz CI à 27 Rozzi R à 161

Sancho LG à 161 Sandoval-Trujillo AH à 15 Santander J à 49

219


Silva-Sánchez J à 209 Silva-Santana G à 199 Sitn NW à 175 Sitthisak S à 121 Soyer-Gobillard M-O à 183 Srivastava A à 39 Stepanauskas R à 39

220

Tamez-Guerra RS à 27 Thellin O à 101 Thummeepak R à 121

Wernicki A à 57 Wilkinson JM à 33

Yaish MW à 143 Valderrama K à 49 Vanniasinkam T à 33 Vázquez-Salinas C à 191 Vences-Velásquez A à 209 Villarreal –Treviño L à 27

Zorzi D à 101 Zorzi W à 101


Keywords Index · 2016 acI-B in Actinobacteria à 39 Acinetobacter baumannii à 121 Air biomonitoring à 69 Airbiota à 1 Airborne biological particles à 19, 69 Air-genome ratios à 1 Ammonia Oxidizing Archaea (AOS) à 109 Anthracene degradation à 15 Antibiotic resistance à 161 Antimicrobial activity à 57 Antivirals à 175 Aquaculture à 93 Arago Laboratory of Banyuls à 183 Atypical EPEC à 157 Avian lactobacilli à 57

Bioaerosols à 1 Biofilm infection à 191 Biofilms in pathogens à 101 Biofilms à 121 β-lactamases à 209

Campylobacter species à 33 Campylobacteriosis à 33 Capsular polysaccharides à 191 Cell cycle à 133 Chatton, Édouard (1883–1947) à 183 Chihuahua (Mexico) à 27 Chikungunya virus à 175 Chilpancingo (Mexico) à 209 Chronosequence à 161 Climate change à 131 Clindamycin à 101 Cyclin à 133 Cytotoxicity à 175

Deep sea sediments à 109 Diarrhea in children à 157

Eastern Mediterranean à 109 Endophyte à 143 Epitopes à 27 Escherichia coli à 157, 209 Evolution à 81

Ferric uptake regulator protein (Fur) à 49 Fish pathogens à 49 Foodborne diseases à 33 Functional genes à 161

Gardnerella vaginalis à 101 Gehring, Walter J. (1939–2014) à 183 Genes eae and bfp à 157 GeoChip microarray à 161 Global responses à 81 Gonads macrobiota à 93 Gut health à 57

Lake Stechlin à 39 Lineages of virus à 27 Lwoff, André (1902–1994) à 183

Margulis, Lynn (1938–2011) à 183 Medicinal plants à 175 Metanogenomics à 69 Meteorological factors à 1 Metronidazole à 101 Microbacterium à 15 Microbial communities à 109 Microbial ecology à 131 Molecular machinery à 81 Molluscs pathogens à 93 MRSA à 191 Multicellular community à 81 Multidrug resistance à 209

NE Germany à 39 New South Wales, Australia à 33 Next-generation sequencing (NGS) à 69, 93

Oysters à 191 Haloalkatolerant Actinobacteria à 15

Iron acquisition à 49 Israel à 109

Kocuria à 15

Lacaze-Duthiers, Henri de (1821– 1901) à 183 Lactobacillus spp. à 57

Panton-Valentine leukocidin à 191 Pecten maximus à 93 Pho85 à 133 Phoenix dactylifera L. à 143 Phosphatases à 39 Phosphate limitation à 39 Piscirickettsia salmonis à 49 Polyphosphate à 133 Poultry pathogens à 57 Prevalence of pathogens à 33 Primary succession à 161 Prokaryotic cells à 81 221


Quito (Ecuador) à 157

Recombinant human lysozome à 101 Rotavirus à 27

Saccharomyces cerevisiae à 133 Salt stress à 143 Secretion system à 191

222

Sequential extraction à 175 Single cell genomics à 39 Staphylococcus aureus à 191 State of Veracruz, Mexico à 15 Transcriptional regulatory element à 49

Urban aerobiology à 69 Urinary tract infections à 209

Vibrio alginolyticus à 191 Viral genotypes à 27 Virulence factors à 191 Virulence genes à 121


List of reviewers · 2016 The editorial staff of International Microbiology thanks the following persons for their invaluable assistance in reviewing manuscripts from January through December 2016. The names of several reviewers have been omitted at their request. Akhtar, Parvez. University of Pittsburgh,Pittsburgh, PA, USA Antón, Josefa. University of Alicante, Alicante, Spain Beauregard, Pascale B. University of Sherbrooke, Sherbrooke, Canada Berenguer, José. Autonomous University of Madrid, Madrid, Spain Berlanga, Mercedes. University of Barcelona, Barcelona, Spain Bordons, Albert. University Rovira Virgili, Tarragona, Spain Calvio, Cinzia. Università degli Studi di Pavia, Pavia, Italy Campoy, Susana. Autonomous University of Barcelona, Bellaterra, Spain Carli,Tayfun K. Uludag University, Bursa, Turkey Cerri, Domenico. University of Pisa, Pisa, Italy Chapman, Matthew. University of Michigan, Ann Arbor, MI, USA Charles, An Susan. Lousiana State University, Baton Rouge, LA, USA Chu, Justin J. Hann. National University of Singapore, Singapore Daffonchio, Daniele. King Abdullah Univer of Science and Technology, Thuwal, Saudi Arabia Dangi, Anil. Northwestern University, Evanston, IL, USA Dolan, Michael. University of Massachusetts, Amherst, MA, USA Esteve, Isabel. Autonomous University of Barcelona, Bellaterra, Spain Fang, Wenwen. Bartel Lab., Cambridge, MA, USA Gaju, Núria. Autonomous University of Barcelona, Bellaterra, Spain Garmendia, Juncal. Biomedical Research Centre, CSIC, Pamplona, Spain Gil, José Antonio. University of Leon, Leon, Spain González Pastor, Eduardo. Centro de Astrobiología, CSIC, Torrejón Ardoz, Madrid Guarro, Josep. University Rovira Virgili, Reus, Spain

Guerrero, Ricardo. University of Barcelona, Barcelona, Spain Guillamon, Jose Manuel. IATA, CSIC, Paterna, Spain Herrero, Enric. University of Lleida, Lleida, Spain Hu, Yi. Drexel University, Philadelphia, PA, USA La Ragione, Robert. Veterinary Laboratories Agency, Surrey, England Llamas, Inmaculada. University of Granada, Granada, Spain López García, Paloma. Center for Biological Research, Madrid, Spain Magni, Christian. Institute of Molecular and Cellular Biology, Rosario, Argentina Mas-Castellà, Jordi. Autonomous University of Barcelona, Bellaterra, Spain Miñana, David. University of Barcelona, Barcelona, Spain Montesinos, Emilio. University of Girona, Girona, Spain Nikel, Pablo. National Centre for Biotechnology, CSIC, Madrid, Spain Pedrós-Alió, Carlos. National Centre for Biotechnology, CSIC, Madrid, Spain Piqueras, Mercè. International Microbiology, Barcelona, Spain Quindós, Guillermo. University of the Basque Country, Bilbo, Spain Rocha, Javier. ICP, CSIC, Madrid, Spain Rodríguez-Nava, Verónica. Claude Bernard UniversityLyon, Villeurbanne, France Rosselló Mora, Ramon. University of the Balearic Island, Palma de Mallorca, Spain Rua, Marisa. University of Vigo, Vigo, Spain Smani, Younes. University of Sevilla, Sevilla, Spain Toledo, Héctor. University of Chile, Santiago de Chile, Chile Van Dillewijn, Pieter. Experimental Station El Zaidín, CSIC, Granada, Spain Vila, Jordi. University of Barcelona, Barcelona, Spain Wei, Sean. University of Technology, Auckland, New Zealand 223


225


227


Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686 228

Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter.SI units should be used throughout. For Nomenclature of organisms genus and species scientific names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.


Turn static files into dynamic content formats.

Create a flipbook
International Microbiology by Institut d'Estudis Catalans - Issuu