Skip to main content

International Microbiology

Page 1

CONTENTS International Microbiology (2015) 18:203-272 ISSN (print): 1139-6709. e-ISSN: 1618-1095 www.im.microbios.org

Volume 18, Number 4, December 2015

EDITORIAL

Guerrero R

RESEARCH REVIEWS

Soyer-Gobillard M-O, Dolan MF Chromosomes of Protists: The crucible of evolution

RESEARCH ARTICLES

203 209

Stefanova K, Tomova I, Tomova A, Radchenkova N, Atanassov I, Kambourova M Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes

217

Yanatori I, Yasui Y, Ouchi K, Kishi F Chlamydia pneumoniae CPj0783 interaction with Huntingtin-protein 14

225

Suprayogui, Nguyen MT, Lertwattanasakul N, Rodrussamee N, Limtong S, Kosaka T, Yamada M A Kluyveromyces marxianus 2-deoxyglucose-resistant mutant with enhanced activity of xylose utilization

235

PERSPECTIVES

Martín N, Andradas C Interaction and cooperative effort among scientific societies. Twelve years of COSCE

245

Kamerlin CSL Hypercompetition in biomedical research evaluation and its impact on young scientist careers

253

BOOK REVIEWS

263

ANNUAL INDEXES

265

Journal Citations Reports 5-year Impact Factor of International Microbiology is 2,10. The journal is covered in several leading abstracting and indexing databases, including the following ones: Agricultural & Environmental Bio­­technology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS; Current Contents/Agriculture, Biology & Environmental Sciences; EBSCO; EMBASE/Elsevier Bibliographic Databases; Food Science & Technology Abstracts; ICYT/CINDOC; IBECS/ BNCS; ISI Alerting Services; MEDLINE/Index Medicus; Latindex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; SciSearch.

A1


Front cover legends Upper left. Electron micrograph showing the morphology of bacteriophages that infect Rhizobium etli. They were obtained from rhizosphere soil of bean plants from agricultural lands in Mexico using an enrichment method. Micrograph by Víctor González, Evolutive Genomics, Center of Genomic Sciences, UNAM, Cuernavaca, Morelos, Mexico. (Magnification, 200,000×) Upper right. Darkfield micrograph of the cyanobacterium Nostoc sp., isolated from a freshwater pond. Note the differentiated cells known as heterocysts that fix atmospheric nitrogen. Photo by Rubén Duro, Center for Microbiological Research (CIM), Barcelona. (Magnification, 1000×) Center. Course board of the syndinian mitosis drawn with pastels by Edouard Chatton (19041947), as described in his PhD Thesis “Les Péridiniens parasites: Morphologie, Reproduction, Etho­lo­gie”, Archives Zoologie Expérimentale et Générale, 59:1-475 (1920). © Arch. of the National Museum of Natural History, Paris. Donation of M-O. Soyer-Gobillard, bequest A. Lwoff. The original board is 110 cm × 160 cm. [See article by Soyer-Gobillard & Dolan, pp. 209-216 this issue.]

Lower right. Photonic micrograph of spores of the fungus Alternaria. This fungus is a major aeroallergen in many parts of the world. Sensitivity to Alternaria has been increasingly recognized as a risk factor for the development and persistence of asthma. It is most common as an outdoor mold, as it thrives on various types of plants–including the black rot commonly seen on tomato fruit. Photo by R. Duro, CIM, Barcelona. (Magnification, 1000×)

Lower left. Darkfield microsgraph of the unicellular cilliated Paramecium sp. Paramecia are widespread in freshwater, brackish and marine environments and are often very abundant in stagnant basins and ponds. Some species of Paramecium form mutualistic relationships with other organisms. Paramecium bursaria and P. chlorelligerum harbor endosymbiotic green algae, from which they obtain nutrients and protection from predators. Photo by R. Duro, CIM, Barcelona (Magnification, 1000×)

Back cover: Pioneers in Microbiology Enid de Rodaniche (1906-1988?), Panama Enid de Rodaniche (born Enid Cook) was the first professor of Parasitology and Microbiology at the University of Panama. Born in the United States in 1906, she graduated from Dunbar High School in Washington D.C., the first public high school for black students, and spent one year at Howard University also for black students. In 1927 she moved to Bryn Mawr College, in Pennsylvania, Philadelphia, which at those times was an all-white women’s institution. The President of the College had tried to convince her to give up from applying because of the discomfort she might experience due to white students’ and professors’ prejudices. She was aware of it but had already taken a decision and applied twice, the first time having not obtained a score in the entrance examination high enough to be on top of the list of applicant students. She

was finally admitted but was forced to live off campus with a local family. At Bryn Mawr, Enid majored in chemistry and biology, and graduated in 1931. In 1937 she earned a doctorate from the University of Chicago, and she was a lecturer at that university from 1937 to 1944, the year that she married Panaman physician Arcadio Rodaniche. The couple moved to Panama, where, from 1946 to 1954, she served as the chief of the Public Health Laboratory at the Instituto Conmemorativo Gorgas. She was in charge of the laboratory devoted to study diseases caused by viruses and rickettsias. When the first School of Medicine of the University of Panama was set up, in 1951, Enid became its first professor of Parasitology and Microbiology. She published 32 articles mainly on different rickettsiosis (Q fever, murine or endemic typhus, Rocky Mountain spotted fever), poliomyelitis, yellow fever and other diseases whose study she pioneered in Panama, such as Saint Louis encephalitis, Ilheus encephalitis, and those caused by arboviruses. She also studied parasitic diseases including toxoplasmosis, giardiasis and malaria. Enid de Rodaniche died in Panama in the late 1980s.

Front cover and back cover design by MBerlanga & RGuerrero

A2


EDITORIAL International Microbiology (2015) 18:203-208 doi:10.2436/20.1501.01.251. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Year’s comments for 2015 Ricardo Guerrero Coeditor-in-Chief, International Microbiology Academic Director, Barcelona Knowledge Hub, Academia Europaea, Barcelona. rguerrero@iec.cat

This year, as in previous ones, microbiology was a frequent them. After finding a phage fragment in one of the sequences, topic in the media’s scientific news. The journal Science chose Mojica hypothesized that CRISPR was a type of adaptive imthe genome-editing method CRISPR (“clustered regularly in- mune system for the cell. That assumption, which is now wideterspaced short palindromic repeat”) as the breakthrough of ly accepted, was initially met with skepticism by reviewers in 2015. The development of a genome-editing technique based 1994. But, after refusals by several journals, Mojica’s paper on CRISPR is a turning point in genetic engineering, similar to was finally published in Molecular Microbiology [Mojica FJM, PCR in the 1980s. Little known is the fact that it all started at et al., Mol Microbiol 17:85-93 (1995)]. the University of Alicante, around 1993, when Francisco J.M. It soon became clear to Mojica that CRISPR was an interMojica, a microbiologist and SEM member, then a PhD stu- ference system, although he did not know how it worked. In the dent, characterized what is now known as a CRISPR locus in meantime, many other scientists became interested on those the archaeum Haloferax sequences. In 2011, one of mediterranii, which grows them, Virginijus Siksnys, in nearby salterns. (Mojica from Vilnius University, coined the term CRISPR in Lithuania, cloned the 2002, together with the CRISPR/Cas system from Dutch researcher Ruud JanStreptococcus thermophisen, who was also working lus and expressed it in on this system). Mojica Escherichia coli, provid(Fig. 1) was studying the ing the latter with heterolgenetic modifications inogous protection against duced by salt on specific replasmid transformation gions of the archaean geand phage infection. In nome; these mo­difications 2012, Jennifer Doudna, altered the behavior of profrom the University of teins that cut DNA. One of California-Berkeley, and those regions contained sevEmmanuelle Charpentier, eral regularly spaced se- Fig. 1. Francisco J.M. Mojica, in his lab at the University of Alicante. (Photograph now at Umeå University quences. As those sequences from the University of Alicante website.) in Sweden, and the Max were very abundant, Mojica assumed that they must play a sig- Plank Institute for Infection Biology in Berlin, found that nificant role, given that all of the archaean genome is generally CRISPR sequences bound to Cas9, acts as a nuclease and cut useful for these microorganisms. He then learned that a Japa- specific DNA targets. Soon CRISPR/Cas9 was used to delete, nese group had previously described those same sequences in a suppress, add, or activate genes in various organisms, both prohuman intestinal bacterium. In the following years, the whole karyotes and eukaryotes. Sadly though, while in 2015 Doudna genome of many microorganisms was sequenced, and Mojica and Charpentier were awarded one of the highest Spanish prizand his collaborators identified CRISPR sequences in many of es for science, Mojica’s efforts went unrecognized. Indeed, “no


204

Int. Microbiol. Vol. 18, 2015

GUERRERO

Table 1. Nobel Prizes in Physiology or Medicine related to microbiology or immunology Year

Scientists

Work

Field*

1901

Emil von Behring

For his work on serum therapy, especially its application to diphtheria

I

1902

Ronald Ross

For his work on malaria, showing how the parasite enters its host

P

1905

Robert Koch

For his investigations and discoveries in relation to tuberculosis

B

1907

Alphonse Laveran

In recognition of his work on the role played by protozoa in causing diseases

P

1908

Paul Ehrlich, Ilya Mechnikov

In recognition of their work on immunity

I

1919

Jules Bordet

For his discoveries related to immunity

I

1926

Johannes Fibiger

For his discovery of Spiroptera carcinoma (a nematode) “causing cancer” (!)

P

1927

Julius Wagner-Jauregg

For his discovery of the therapeutic value of malaria inoculation in dementia paralytica

P

1928

Charles Nicolle

For his work on epidemic typhus

B

1939

Gerhard Domagk

For his discovery of the antibacterial effects of prontosil

A

1945

Ernst B. Chain, Alexander Fleming, Howard Florey

For their development of penicillin and its curative effects on various infectious diseases

A

1951

Max Theiler

For his discoveries related to yellow fever and how to combat it

V

1952

Selman A. Waksman

For his discovery of streptomycin, the first antibiotic effective against tuberculosis

A

1954

John F. Enders, Frederick C. Robbins, Thomas H. Weller

For their discovery of the ability of poliomyelitis viruses to grow in cultures of various types of cellular tissues

V

1958

George Wells Beadle, Lawrie Tatum, Joshua Lederberg

For the discovery of genetic properties of bacteria, especially their ability for recombination

B

1960

Frank Macfarlane Burnet, Peter Medawar

For the discovery of the acquired immunological tolerance

I

1966

Peyton Rous

For his discovery of tumor-inducing viruses (work done in 1912!)

V

1969

Max Delbrück, Alfred D. Hershey, Salvador E. Luria

For the discovery of the mechanisms of replication and genetic structure of viruses

V

1972

Gerald M. Edelman, Rodney R. Porter

For their discoveries concerning the chemical structure of antibodies

I

1975

David Baltimore, Renato Dulbecco, Howard M. Temin

For their discoveries concerning the interaction between tumor viruses and the genetic material of the cell

V

1976

Baruch S. Blumberg, D. Carleton Gajdusek

For their discoveries concerning new mechanisms for the origin and dissemination of infectious diseases

V-B-P

1997

Stanley B. Prusiner

For his discovery of prions, a new biological agent of infection

V

2005

Barry J. Marshall, J. Robin Warren

For their discovery of the bacterium Helicobacter pylori and its role in gastritis and peptic ulcer disease

B

2008

Harld zur Hausen, Françoise Barré-Sinoussi, Luc Montagnier

For the discovery of papilloma virus and its relation to cancer cervix For their discovery of the human immunodeficiency virus (HIV)

V

2015

Willian C. Campbell, Satoshi Omura, Youyou Tu

For their discovery of a therapy against diseases caused by nematodes

A

For her discovery of a new (but coming from Chinese traditional medicine) treatment of malaria

Adapted from: The Nobel Foundation [nobelprize.org/medicine/laureates/index.html] *Field (or related to): A, antibiotics/chemoterapics; B, bacteriology; I, immunology; P, parasitology and protistology; V, viruses and prions. (In some cases, the prize was shared with other persons working on fields not directly related to microbiology or immunology.)


YEAR'S COMMENTS

Int. Microbiol. Vol. 18, 2015

205

Fig. 2. From the left to right: William C. Campbell, from Drew University, NJ, USA; Satoshi Ōmura, from Kitasato University, Tokyo, Japan; Youyou Tu, the Academy of Traditional Chinese Medicine, Beijing, China. (From The Nobel Foundation website [nobelprize.org/medicine/laureates/index.html].)

one is a prophet in his own land.” Now, with Nobel Prize watchers betting on the future likely winners, it is certain that sooner or later they will include the scientists who developed CRISPR/Cas9. Will be Mojica unrecognized again? Will he be as influential as Alexander Fleming, who was awarded the Nobel Prize despite the fact that he did not work in the development of penicillin as a powerful curative molecule? Nevertheless, the applications of this powerful gene-editing technique has raised important ethical questions, especially about its use in humans. As for Mojica, he continues to work on the CRISPR system and now leads a research project on immunization in bacteria and the adaptation of the CRISP-Cas I-E of Escherichia coli and Salmonella enterica. Throughout the history of Nobel Prizes, roughly 25 have been directly related to microbiology or immunology (Table 1). The 2015 Nobel Prize in Physiology or Medicine recognized discoveries in the field of parasitic diseases. William C. Campbell, from Drew University, NJ, USA, and Satoshi Ōmura, from Kitasato University, Tokyo, Japan, divided one half of the prize “for their discoveries concerning a novel therapy against infections caused by roundworm parasites.” The other half went to Youyou Tu, from the Academy of Traditional Chinese Medicine, Beijing, China, “for her discoveries concerning a novel therapy against malaria” (Fig. 2). In December 1, 2015, the Pan American Health Organization/World Health Organization (PAHO/WHO) released an epidemiological alert regarding the public health implications of zika virus infection and its possible relation with congenital anomalies, Guillain-Barré syndrome, and other neurological

and autoimmune syndromes. The PAHO member states where the autochthonous circulation of zika virus has been confirmed are Brazil, Chile (Easter Island, in mid-Pacific), Colombia, El Salvador, Guatemala, Mexico, Paraguay, Surinam, and Venezuela. *** A basic knowledge of microbiology is crucial for citizens of all countries. The diffusion of this broad-ranging, important subject must be extended beyond the walls of schools and universities. With this objective in mind, museums can play an essential role in educating the public about microbes and their meaning for human life. However, until recently, microbes were for the most part ignored by museums, and, if they were ever mentioned, it was only as dreadful agents of terrible diseases able to decimate human populations. Their major role in the history of life and in present ecosystems was all but ignored. However, as John L. Ingraham wittily wrote [March of the Microbes, Harvard University Press, 2010]: “the percentage of disease-causing microorganism (pathogens) is far, far less than the percentage of humans that commit first-degree murder.” Maybe some day the presence of microorganisms in natural history museums will be as typical as now is the presence of animals or minerals. Fortunately, microbes have started to have the same recognition by museums that has long been granted to animals and minerals. Until recently, however, rarely were microbes shown in those museums in permanent exhibits. But that trend has made an inflection in the present decade and sveral museums have started to consider that microbes deserve their own spaces, and that their major role in the history of life and in


Int. Microbiol. Vol. 18, 2015

GUERRERO

Int Microbiol

206

Fig. 3. Planet Life, a permanent exhibit of the Natural History Museum of Barcelona (the Blue Museum), inaugurated in 2011, displays a comprehensive vision of the World of Microbes and the major role that microbes have played in the history of Earth and the biosphere. (Photographs by M. Berlanga.)

the present ecosystems must be explained to visitors. To our knowledge the first permanent exhibit to show the natural history (phylogeny and evolution, physiology, genetics and ecology) and emphasize the non-pathological importance of microorganisms is at the Natural History Museum of Barcelona (MHNB, the Blue Museum), inaugurated on 27 March, 2011. This exhibit is an essential part of the Planet Life section and offers visitors a comprehensive vision of the World of Microbes and their critical roles in the history of Earth and the biosphere. The MNHB occupies 9,000 m2 in an impressive building that architects Herzog & de Meuron made for the 2004 Barcelona’s Forum of Cultures. The new MHNB, which have a history of 135 years (!), have more than 2 million specimens of rocks, minerals, fossils, plants and animals. Planet Life has pioneered the task of presenting a Gaian view of our planet’s tangled history, by revealing how rocks, plants, fungi, animals, and, indeed, microbes interact and modify each other in the Earth (Fig. 3). In October 2014—and perhaps in keeping with the Netherlands as the cradle of microbiology—an impressive microbial “zoo,” named Micropia, was established in Amsterdam. Micropia is located next to the famous Artis Royal Zoo, one of the oldest zoos in Europe (Fig. 4). More recently, in November 2015, the New York City’s American Museum of Natural History inaugurated “The Secret World Inside You,” a temporary exhibit that will run until mid-August, 2016. The exhibit includes videos, 3-D models, interactive displays, and tutorial lectures taught by efficient and friendly university students in person. The “teacher” animates “pupils” to look at their own belly buttons, but not for a feeling of self-complacency but to investigate the microbes inhabiting there

(Fig. 5). Finally, another project to bring microbes to museums was recently announced. Roberto Kolter (former president of the American Society for Microbiology) and Scott Chimileski, a postdoctoral fellow in Kolter’s laboratory at the Harvard Medical School in Boston, are developing a project, with the support of the ASM, to exhibit the microbial world at the Harvard Museum of Natural History, an institution that attracts thousands of visitors each year. Hopefully, all natural history museums will soon follow the example of Barcelona, Amsterdam, New York, and Cambridge, MA (Harvard), and show the general public that life cannot be explained without taking into account the “Unseen World”—the tiniest living beings in nature—, and that the “macro-bios” (including ourselves) cannot live without the “micro-bios.” *** Let’s talk about International Microbiology in 2015. But, first, some background considerations must be offered: To the vast number of already existing scientific journals in all fields, many others are added almost daily. These are often announced in unsolicited emails inviting us to submit articles and/or to join their editorial boards. The first thing that comes to mind is that we are in front of a business intention, which would not be reprehensible, because business is one of the aims of publishing companies. Currently, most science and humanities journals are in the hands of a few very large international publishing houses, which, in general, offer excellent products. However, scandals related to the intentions of more recent emerging publications should serve as a reminder that


YEAR'S COMMENTS

Int. Microbiol. Vol. 18, 2015

207

Fig. 4. Micropia, a permanent large exibit of the world of microbes in the Amsterdam zoo inaugurated in 2014. (Photographs from the museum website.)

produce manuscripts at a not always justifiable rate and number (“salami papers”, as they are whimsically called). Consequently, the main objective of a scientific research paper—to communicate research results and discuss their significance with other experts—has become “secondary.” Presently, the technical process of the scientific publication has experienced many changes, both in rapidity and quality, but the most important factor is the possibility of reaching the whole world via internet. The management and publication (both online and in print) of International Microbiology is a complex task, depending on the efforts of a small

Int Microbiol

these new journals should be carefully evaluated by researchers looking for a place to publish their work. The majority of experienced researchers have a list of benchmark journals that they rely on to stay current in their fields. Such lists offer a way to manage the enormous number of scholarly publications available in print and, especially, via the internet. But whether we, as researchers, can and do benefit from this huge amount of information is unclear, as is the impact on science of this plethora of highly specialized journals and their dilution of potentially important knowledge. Today the motto of “publish or perish” still holds true and researchers continue to

Fig. 5. “The Secret World Inside You,” a temporal exhibit at the American Museum of Natural History of New York, inaugurated in December 2015. (Photographs by M. Berlanga.)


208

Int. Microbiol. Vol. 18, 2015

group of people working at one or more stages of the process. Although the printed journal has been overshadowed by the online version, there has been no change in our efforts, both from the scientific (content) and editorial (presentation) points of view, to publish good-quality manuscripts. The people responsible for the internal functioning of the journal meet regularly to discuss and decide the manuscript evaluation, editing, and preparation. The Publication Board consists of two Coeditors-in-Chief (located in Madrid and Barcelona), several Associate Editors, a General Secretary, a Managing Coordinator, a Digital Media Coordinator, and a Webmaster. Their names as well as those of the Editorial Board members (national and international) appear on page p. 2 of each issue. Manuscript management through ScholarOne system was initiated in 2013 for a term of 3 years (2013–2015). At the end of that period, the extremely high fees charged by that company for its services, together with the difficulty and cost of introducing the necessary adaptations led to our decision not to renew the contract for 2016. In addition, the system had the unwanted consequence that many manuscripts of very poor quality were submitted, most of which had to be rejected after the first general evaluation. At the other end, there was no increase in the dissemination of the journal’s articles. Currently, authors can submit their manuscripts through our own webpage [http://revistes.iec.cat/index.php/IM], hosted at the Institute for Catalan Studies, Barcelona, where the digital management of the journal is efficiently administered. Journals that serve as the official publication of a scientific society, as is the case for International Microbiology and the Spanish Society for Microbiology (SEM), typically have very limited economic resources. These journals need the support of all members of the professional society. The SEM’s membership currently numbers about 1800, with members coming from Spain and elsewhere. SEM members are asked to support the journal via efforts to enhance its scientific level, by submitting good-quality manuscripts. The main objective of International Microbiology is to diffuse the unity and diversity of the microbiological sciences (In pluribus unum), But, although the journal publishes articles from all over the world, also try (we think successfully) to promote research in microbiology and the dissemination of the obtained knowledge in Spain, Portugal, and Latin America. The quality of a journal and its international reputation reflect on the quality of the scientific society responsible for its publication. The team that has worked to produce the official SEM’s journal since

GUERRERO

1994 had little experience in science editing and publishing when they started. They “learned on the job,” through small and large successes as well as errors, but they have remained devoted in their efforts to achieve a product in which they and the SEM proudly stand behind. But all this is not sufficient. Publishing a scientific journal has an economic cost, and what cannot be covered with money is made through the effort and personal commitment of a team. The effort, however, is worthy when the product gets recognition. Suffice it to mention that due to these efforts and the contributions of the authors whose work has been published in the journal, the quality of International Microbiology has been acknowledged by the FECYT (Spanish Foundation for Science and Technology) in the two calls to which we applied (2012 and 2015, calls are launched every 3 years), consistently obtaining a score of 20 out of 20 criteria evaluated. But the most important recognition was the inclusion of the journal in ISI-Current Contents, which came in 2005 after being sought by the SEM since the early 1980s. In the following years, the journal was included in the major databases of international scientific journals, most importantly, PubMed and Scopus. Each year, in the December issue we publish information on the manuscripts received, accepted, and rejected, their origin, indexes of the authors, titles, and keywords, and a list of the reviewers active during that year (see pp. 265–270 in this issue). During 2015, 125 manuscripts were received through ScholarOne, with an additional 10 requested directly by the journal to experts (reviews, editorials, and perspectives). A total of 28 articles were published: 18 from ScholarOne and 10 directly received via the webpage of the journal. Among all articles received by ScholarOne, 107 were rejected. According to geographical origin, the published articles came from: Spain (12), the rest of Europe (5), Latin America (6), the USA (2), and Taiwan and Japan (3). International Microbiology staunchly try to explore and diffuses knowledge about microbiology. While it may not be as pervasive or as persistent as the microorganisms it covers, we do aspire to continue talking about them for as long as possible. To the SEM, its members, microbiologists in general, and friends, we, the members of the Publication Board, thank you for contributing to the continuity of the journal in the way that you best know how to and do: by submitting manuscripts that convey the quality and interest of your work and as devoted readers of the journal.


RESEARCH REVIEW International Microbiology (2015) 18:209-216 doi:10.2436/20.1501.01.252. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Chromosomes of Protists: The crucible of evolution Marie-Odile Soyer-Gobillard,1* Michael F. Dolan2 Observatoire Océanologique, UMR CNRS 7621, Université P. et M. Curie (Paris 6), Banyuls-sur-mer, France. 2 Department of Biology, University of Massachusetts-Amherst, Amherst, MA, USA

1

Received 15 September 2015 · Accepted 10 October 2015 Summary. As early as 1925, the great protozoologist Edouard Chatton classified microorganisms into two categories, the prokaryotic and the eukaryotic microbes, based on light microscopical observation of their nuclear organization. Now, by means of transmission electron microscopy, we know that prokaryotic microbes are characterized by the absence of nuclear envelope surrounding the bacterial chromosome, which is more or less condensed and whose chromatin is deprived of histone proteins but presents specific basic proteins. Eukaryotic microbes, the protists, have nuclei surrounded by a nuclear envelope and have chromosomes more or less condensed, with chromatin-containing histone proteins organized into nucleosomes. The extraordinary diversity of mitotic systems presented by the 36 phyla of protists (according to Margulis et al., Handbook of Protoctista, 1990) is in contrast to the relative homogeneity of their chromosome structure and chromatin components. Dinoflagellates are the exception to this pattern. The phylum is composed of around 2000 species, and characterized by unique features including their nucleus (dinokaryon), dinomitosis, chromosome organization and chromatin composition. Although their DNA synthesis is typically eukaryotic, dinoflagellates are the only eukaryotes in which the chromatin, organized into quasi-permanently condensed chromosomes, is in some species devoid of histones and nucleosomes. In these cases, their chromatin contains specific DNA-binding basic proteins. The permanent compaction of their chromosomes throughout the cell cycle raises the question of the modalities of their division and their transcription. Successful in vitro reconstitution of nucleosomes using dinoflagellate DNA and heterologous corn histones raises questions about dinoflagellate evolution and phylogeny. [Int Microbiol 18(4):209-216 (2015)] Keywords: dinoflagellates · protist chromosomes · dinokaryon · dinomitosis · eukaryotic nucleus

Introduction As early as 1925, Edouard Chatton (1904–1947), who had a profound knowledge of protists based on the work carried out by others over more than a century, distinguished for the Corresponding author: Marie-Odile Soyer-Gobillard 78 Av. Guynemer 66100 Perpignan, France E-mail: mog66@orange.fr *

first time the fundamental differences between prokaryotes and eukaryotes [36,]. In a long, accurate article devoted to Pansporella perplexa, an amoeboid parasite of Daphnia, he discussed the classification and phylogeny of Protozoa, trying to find a place for Pansporella. The article contains a simple table without any explanation, which is an attempt at protist classification, and differentiates between prokaryotes and eukaryotes [6]. In 1973, Roger Stannier and André Lwoff [42] resumed and simplified Chatton’s fundamental distinction, well demonstrated by modern cytology. They wrote that

This article is based on the lecture given by M.O.S-G at the Ramón Areces Foundation, Madrid, on 12 November 2012 for the International Symposium in the memory of Lynn Margulis (deceased on 22 November 2011). M.F.D. was one of the long-standing collaborators of Prof. Margulis, and her best support in her teaching duties in UMASS-Amherst.


Int. Microbiol. Vol. 18, 2015

SOYER-GOBILLARD, DOLAN

Int Microbiol

210

Fig. 1. Different light microscope preparations of dinoflagellate nucleus. (A) Semi-thin sectioned nuclei of Prorocentrum micans embedded in Epon. Note the chromosomal DNA contrasted with acriflavine (about 65 chromosomes per nucleus). Magnification 2000× (Preparation and image by the author). (B) Whole nucleus and chromosomes of P. micans prepared by squashing, stained with the intercalating bases fluorescent ethidium bromide, which contrasts DNA, and observed with a fluorescence light microscope. Chromosomes are totally unwounded. Magnification 3600×. From [38], with permission of Humana Press.

“protists represent an heterogeneous group including on one hand the prokaryotes (bacteria and cyanophyta) and on the other hand the eukaryotes (protists, algae and fungi).” Transmission electron microscopy (TEM) made it possible to know that a unique characteristic of prokaryotes is the absence of nuclear envelope surrounding bacterial chromosome (the nucleoid), which is more or less condensed. In addition prokaryotic chromatin lacks histone proteins but contains specific HU basic proteins (histone-like proteins that were first isolated from Escherichia coli strain U93 and were so called factor U [28]). Protists show an extraordinary diversity of morphology and mitotic systems throughout the 36 phyla recognized in 1990, as described by Margulis et al. in their impressive multi-authored Handbook of Protoctista, 1st edition [19b]. Never­ theless, their chromosome structure and chromatin components are relatively homogeneous. Dinoflagellates, however, are a distinctive group of protists that challenges that homogeneity. Their large nuclei have no nucleosomes and their chromosomes are permanently condensed. In addition, they have few histones. Due to these features, which might be primitive, and suggest that dinoflagellates could be intermediary between prokaryotes and eukaryotes, in 1965 Dodge coined the term “mesokaryotes” to call them [7], a term Raikov also used in 1982 [23].

Here we will briefly review some distinctive characteristics of the components of the dinoflagellate nucleus, and how it can be interpreted in terms of the evolution of this group, with several hypotheses suggested.

Dinoflagellates’ nuclear characteristics Dinoflagellates are a phylum of unicellular eukaryotic microorganisms among the protists, a paraphyletic group that comprises microorganisms that do not fit into the traditional kingdoms of Plants, Fungi and Animals. Protists are single celled organisms that, collectively, have developed all the known cellular functions including motility, reproduction (sexual or not), respiration, photosynthesis, secretion, nutrition, and vision—some having even an eyespot, sometimes a sophisticated photoreceptor [8]. More than 100,000 species of protists have been described and many thousands more await discovery. The number, in each phylum, might be even higher in extinct groups. The protists, like all eukaryotes, have the nucleus surrounded by a nuclear envelope and chromosomes more or less condensed during mitosis, with chromatin that includes histone proteins and is organized into nucleosomes. In most eukaryotic cells, cyclic chromatin compaction is linked to the


stages of the cell cycle, the maximum of compaction being reached during the mitosis. Dinoflagellates show a great ecological diversity. They can be either autotrophic, heterotrophic, mixotrophic, parasitic or symbiotic, and are widely distributed worldwide throughout the seas and freshwaters, playing major roles in trophic chains. The diversity of this group is also displayed in both their external morphology and the organization of their external thecal plates when present. In fact, thecal plates are the basis for the classification of approximately 2000 living species, 161 genera, 48 families and 17 orders described to date. Here we will review three models selected to study the structure and functioning of their chromosomes: Prorocentrum micans Ehr., which is an autotrophic, planktonic species, Noctiluca scintillans MC., a free-living species that can form extensive red tides in many parts of the world, and Crypthecodinium cohnii B., which is an heterotrophic marine species, with a complex cell cycling comprising both swimming cells and cysts, the latter accompanying cell division [3]. All specific techniques used to study and try to understand the dinoflagellate chromosome organization and functioning have been improved and are summarized in [38] (Fig. 1). Some remarkable aspects of the dinoflagellate nucleus are distinctive of this group. These include a persistent nuclear membrane during all the cell cycle, including during the mitosis, permanently condensed chromosomes (except for several rare species), no longitudinal chromosome differentiation as Q-, G-, C-banding [11] and, particularly, lack of telomeric heterochromatin. Nucleofilaments are coiled into a double helical [10,32], which explains their regular arch-shaped visualization in thin section (Fig. 2). Chromatids are coiled in an anorthospiral arrangement, and have a very regular pitch (Fig. 3A). This architecture is maintained by structural RNA [35] and by Ca2+ and Mg2+ divalent cations as demonstrated by divalent cation chelating agents ethylenediaminetetraacetic acid (EDTA) and ethylene glycol tetraacetic acid (EGTA) [14]. These observations have been later confirmed by high-resolution ion probe mass spectrometry [18]. Chromosomal fibers composed of circular chromatids [10,12] are compacted into a hierarchy of six organizational levels helically coiled (Fig. 3) as schematized in Fig. 3E, after TEM observations of isolated, squashed and shadowed chromosomes (Fig. 3A–D), level 6 being the chromosome itself. This organization allows a DNA content 5 to 10 times higher than in other eukaryotic nuclei to be compacted into chromosomes in the absence of DNA-binding histone proteins [13] and consequently of nucleosomes. For example,

Int. Microbiol. Vol. 18, 2015

211

Int Microbiol

CHROMOSOMES OF PROTISTS

Fig. 2. Micrograph of a prophase nucleus of Prorocentrum micans showing the well protected organization of the compact chromosomes which chromatin fibrils give an arch shaped aspect in ultrathin section. Magnification 18,000×. From [31].

in Prorocentrum micans, which has 65 chromosomes, the DNA amount per cell is 7.0 × 1010 nucleotide pairs for a nuclear volume of 3,450 µm3 and a chromosome volume of 20 µm3. In Crypthecodinium cohnii, which has 95−100 chromosomes, the DNA amount per cell is 1.4 × 1010 nucleotide pairs for a nuclear volume of 690 µm3 and a chromosome volume of 2.6 µm3 [10]. These measurements demonstrate the extraordinary compaction of DNA. Another distinctive feature of dinoflagellate chromosomes is the absence of diffuse chromatin during the interphase, except for some genera including Noctiluca. For example, in N. scintillans [30] chromatin of the vegetative nucleus is uncondensed. During mitosis dinoflagellates lack a “metaphase” plate, kinetochores and centrioles (except for some rare species as Syndinium sp., which undergo a very peculiar peridinian mitosis [37], and see cover. Dinoflagellates undergo longitudinal chromosome fissure (Fig. 4B), and segregation of daughter chromatids (Y- and V-shaped; Fig. 4A,C) [33] attached to the nuclear envelope (Fig. 4D). For a review see [39]. The presence of chromosomes in a permanently condensed state throughout the cell cycle raises the question of how such structures can transcribe and can be replicated. Fibrillar loops protruding from chromosomes have been described and evidenced by treating the cells with the proteolytic enzyme pronase, which removes the bulk of non fibrillar chromosome material [34]. Both right-handed double helix


Int. Microbiol. Vol. 18, 2015

SOYER-GOBILLARD, DOLAN

Int Microbiol

212

Fig. 3. Different preparations of whole mounted dinofla­gellate chromosomes. (A) Chromosome squashed on water and observed in transmission electron microscopy (TEM) after staining with uranyle acetate shows a figure-eight conformation of the chromatid bundles. Bar, 2 µm. Reproduced from [32]. (B) Details of TEM observations of chromosome fibers after squashing next rotary shadowing with platinum. Bar, 1 µm (Magnification 16,000×). (C) and (D) Details of TEM showing the organizational chromosome levels 3, 4, 5 (arrows) of the chromatin bundles. (Magnification 56,000×). Reproduced from [14]. (E) Schematic representation of the hierarchy of five organization levels of the supercoiled chromosomal fibers, level 6 being the whole chromosome itself. Reproduced from [16].

(B-DNA) and Z-DNA conformations in chromosomes of Prorocentrum micans (Fig. 5) were detected and located by immunoelectromicroscopy [40]. This was in agreement with the proposed model of a chromosome that, to allow transcription to occur, must allow local untwisting of supercoiling of these loops, where active chromatin is located [29]. The usual conformation of DNA is a right-handed double helix (B-DNA). DNA with stretches of alternating purinepyrimidine (G–C or A–T) can also form a left-handed helix (Z-DNA). In these species of dinoflagellates, the absence of histones, the stabilization of DNA supercoiling by divalent cations, the presence of rare bases, and the high G–C content [15] are factors known to facilitate local B to Z transitions of DNA [45]. The dinoflagellate chromosome has been a suitable model to study this dynamic phenomenon because it does not contain the nucleosomal system that would modulate local supercoiling necessary for transcription (Fig. 6) [9]. At the molecular level, dinoflagellate DNA is peculiar in terms of density and thermal denaturation due to the presence

of an unusual base, 5-hydroxymethyluracil (HOMedU), which replaces 16–28% of the thymines [15,24]. The occurrence of this pyrimidine base replacing thymine was described for the first time in a bacteriophage [17]. The presence of an unusual nucleotide containing the base HOMedU has been also detected in the heterotrophic, free-living Noctiluca miliaris (scintillans) DNA by in vitro labeling using Escherichia coli DNA polymerase I. Another characteristic of dinoflagellate DNA is its high G–C content [25] as well as a high proportion (55–60%) of repeated, interspersed DNA [2]. Low amounts of basic nuclear proteins (12,000−13,000 daltons) have been detected in several dinoflagellate species while the general absence of histones (basic nuclear proteins of eukaryotes) and nucleosomes has been confirmed. For a transcriptome-level analysis that suggests the presence of nucleosomes, see [20]. In fact, the amino acid composition of those basic proteins greatly differs from that of histones [13,26,27]. By in vitro reconstitution [16], it has been possible to form nucleosomes in the presence of foreign histones and


Int. Microbiol. Vol. 18, 2015

213

Int Microbiol

CHROMOSOMES OF PROTISTS

Fig. 4. Stages of dividing dinoflagellate chromosomes. (A) Ultrathin sectioned dividing Blastodinium sp. (Mag­nification 32,000×) and (B) Prorocentrum micans chromosomes: tips of this Y-shaped chromosome are attached to the nuclear envelope (arrow). (Magnification 21,900×). Reproduced from [34]. (C) Beginning of the longitudinal fissure of Noctiluca scintillans chromosomes. (Magnification 32,000×). Reproduced from [30]. (D) Model of the nuclear membrane-mediated dividing dinoflagellate circular chromatids. Reproduced from [34].

purified dinoflagellate DNA (Fig. 7), which confirms that the high amount of HOMedU in their DNA is not a hindrance to in vitro formation of nucleosomes by heterologous histones [16].

Dinoflagellates occupy a special place among protists, and many questions remain about their phylogeny. The absence of nucleosomes and histones in several species, and the permanently condensed and highly ordered supercoiled chromosomes bound to nuclear envelope during segregation, led Dodge to coin the “mesokaryote” concept [7]. He suggested the fact that dinoflagellates have prokaryotic traits conserved along with typical eukaryotic features. Later studies showed that dinoflagellates have also characters of true eukaryotes including distinct cell cycle phases and typical genomic organization. Different phylogenetic studies based on ribosomal gene sequences have shown that dinoflagellates emerged late in evolution and have a common ancestor with Apicomplexa and Ciliates, which group together into Alveolata [1,5,44]. In 1981, Cavalier-Smith suggested that dinoflagellates should be true eukaryotes that could have lost their histones and consequently their nucleosomes,

Int Microbiol

Taxonomic position and phylogeny of dinoflagellates

Fig. 5. Nucleus of Prorocentrum micans double-immunolabelled with antibodies against B- and Z-DNA coupled with 5 nm gold particles (B-DNA, black arrows) or 7 nm gold particles (Z-DNA, white arrows). (A) B-DNA is visible in the chromosome and the nucleoplasm where an extrachromosomal loop is visible. (Bar 0.5 µm). (B) Clusters of Z-DNA (left-handed) are located in the periphery of the chromosome. (Bar 0.1 µm). (C) Negative control. (Bar 0.5 µm). Reproduced from [7] by copyright permission of The Rockefeller University Press.


Int. Microbiol. Vol. 18, 2015

Int Microbiol

SOYER-GOBILLARD, DOLAN

Fig. 6. Schematic representation based on TEM observations of nucleolar chromosomes of Prorocentrum micans showing the unwinding of nucleofilaments located in either telomeric or lateral regions. (A) Several chromosomes are contributing to the formation of a new nucleolus. CCh condensed chromosome; UCh unwound chromosome region; NOR nucleolar organizing region; F fibrillar region; FG fibrillogranular region; G granular (preribosomal) region. Reproduced from [40] by copyright permission of the Company of Biologists Ltd. (B) Predicted molecular organization of the dinoflagellate transcriptionally active nucleolus deduced from TEM observation after in situ hybridization with a ribosomal biotinylated probe. The rDNA transcription is initiated at the periphery of the NOR and carried on in the proximal part of the fibrillo-granular (FG) compartment to generate the rRNA transcripts, whereas the distal FG region is devoted to rRNA processing and packaging of preribosomes of the granular G region. Reproduced from [9] by copyright permission from Elsevier Science.

leading to their peculiar condensed DNA structure [4]. A study of the parasitic dinoflagellate Amoebophrya suggested that dinoflagellates’ condensed chromosomes may be a relict trait of their primordially parasitic ancestor [21]. Geological analyses based on the examination of fossilized thecae have shown that the first unambiguous dinoflagellate fossils occurred in the Triassic and belong to Gymnodiniales. But biogeochemical analysis of early Cambrian sediments (520 million years ago) detected specific dinosterols [22]. Those sediment, however, are more recent than the period during which the first photosynthetic eukaryotes appeared, around 750 million years ago. This ambiguity could be resolved by a better knowledge of the very old Proterozoic fossils acritarchs, which would confirm whether dinoflagellates evolved earlier than other protists. The similarities of bacterial (circular) and dinoflagellate chromosomes in both chemical composition and structure

Int Microbiol

214

Fig. 7. In vitro reconstitution of nucleosomes using a mixture of purified corn histone (without Histone H1) and sonicated DNA. (A) and (B) From the dinoflagellate Prorocentrum micans (P.m.). (C) From calf thymus (Sigma). Histone to DNA ratio were respectively: 1:1, 2:1 and 2:1. This indicates that the presence of the unusual base hydroxymethyluracil (HOMedU) in dinoflagellate DNA does not impede accurate DNA-histone interactions. Reproduced from [16], with permission of Springer Science.


CHROMOSOMES OF PROTISTS

Int. Microbiol. Vol. 18, 2015

215

Fig. 8. Participants in the 5th Meeting of the International Society for Evolutionary Protistology (ISEP), held in the famed Laboratoire Arago on the Mediterranean Sea, at Banyuls-sur-Mer in Catalunya in June 4-6, 1983. The meeting was directed by Marie-Odile Soyer-Gobillard and hosted some 70 people representing a dozen nations (Belgium, Canada, Denmark, England, France, Germany, the Netherlands, Poland, Scotland, Spain, and the USA). Lynn Margulis is the first woman at the right of the picture. Reproduced from [19a].

imply common principles in the replication, segregation and functioning. The circular chromatid model described by Haapala and Soyer in 1973 [10] explained the segregation of two identical bundles of chromatids. The origin of the circular chromatid, present also in the bacterial chromosome, remains unexplained. One hypothesis is that the concatemeric structure―i.e., copies of the entire genome linked end to end―found in T7 and lambda phages could be an ancestor of the chromosome because it can produce a single circular chromosome [43]. Nevertheless, as there are still too few molecular data to resolve dinoflagellates phylogeny, morphological and cell biological analyses will continue to be crucial tools in studying this group.

Acnowledgements. We thank Prof. R. Guerrero, University of Barcelona and University of Massachusetts-Amherst, for his stimulus to write this paper, based (see note in p. 209) on the lecture given by M.O.S-G at the Ramón Areces Foundation, Madrid, on 12 Nov. 2012 for the International Symposium in the memory of Lynn Margulis, under the direction of Prof. Guerrero. Lynn Margulis (née Lynn Petra Alexander, Chicago, IL,1938– Amherst, MA, 2011), was an outstanding biologist whose ideas were of special significance for biology and evolution in the second half of the 20th century. Besides her pioneering “Serial Endosymbiotic Theory” to explain the origin of the eukaryotic cell, her contribution to the understanding of the complex world of protists was of special importance to recognize this huge group of organisms as the basis of eukaryotic evolution, and as the origin of fungi, plants and animals. Lynn Margulis helped one of us (M.O.S-G.)

to organize the 5th Meeting of the International Society for Evolutionary Protistology (ISEP), held in Banyuls-sur-Mer in June 4-6, 1983 (Fig. 8). The contributions of the meeting were published less than one year later by D. Reidel Pub. [19a] (Origins of Life 13, 1984), and were also the basis for the impressive Handbook of Protoctista, 1st ed., by Jones and Barlett Pub., in 1990 [19b].

Competing interests. None declared.

References 1. Adl SM, et al. (2012) The revised classification of Eukaryotes. J Eukaryot Microbiol 59:429-493 doi:10.1111/j.1550-7408.2012.00644.x 2. Allen JR, Roberts TM, Loeblich AR III, Klotz JC (1975) Charac­ terization of the DNA from the Dinoflagellate Crypthecodinium cohnii and implication for the nuclear organization. Cell 6:161-169 doi:10.1016/0092-8674(75)90006-9 3. Bhaud Y, Salmon JM, Soyer-Gobillard MO (1991) The complex cycle of the dinoflagellate Crypthecodinium cohnii as studied in vivo and by cytofluorimetry. J Cell Sci 100:675-682 4. Cavalier-Smith T (1981) The origin and early evolution of the eukaryotic cell. In: Carlile, Collins and Moseley (eds) Molecular and cellular aspects of the microbial evolution. Cambridge Univ. Press, Cambridge, UK, pp 33-84 5. Cavalier-Smith T (1993) Kingdom Protozoa and its 18 phyla. Microbial Revue 57:953-994 6. Chatton E (1925) Pansporella perplexa: Réflexions sur la biologie et la phylogénie des protozoaires. Ann Sci Nat Zool 8:5-84


216

Int. Microbiol. Vol. 18, 2015

7. Dodge JD (1965) Chromosome structure in the dinoflagellates and the problem of the mesocaryotic cell. In: Progress in Protozoology (Abstr. II Internat. Conf. Protozool.):264-265 Excerpta Medica, London, UK 8. Gehring WJ (2005) New perspectives on eye development and the evolution of eyes and photoreceptors. J Hered 96:171-184 doi:10.1093/ jhered/esi027 9. Géraud ML, Herzog M, Soyer-Gobillard MO (1991) Nucleolar organization of rRNA coding sequences in Prorocentrum micans Ehr. (Dinomastigote, Kingdom Protoctist) by in situ hybridization. BioSystems 26:61-74 doi:10.1016/0303-2647(91)90038-M 10. Haapala OK, Soyer MO (1973) Structure of Dinoflagellate chromosomes. Nature New Biol 244:195-197 doi:10.1038/newbio2495a0 11. Haapala OK, Soyer MO (1974) Absence of longitudinal differentiation of dinoflagellate (Prorocentrum micans) chromosomes. Hereditas 78:1145 doi:10.1111/j.1601-5223.1974.tb01436.x 12. Haapala OK, Soyer MO (1974) Size of circular chromatids and DNA amount in the dinoflagellates Gyrodinium (Crypthecodinium) cohnii and Prorocentrum micans. Hereditas 76:83-90 13. Herzog M, Soyer MO (1981) Distinctive features of dinoflagellate chromatin. Absence of nucleosomes in a primitive species Prorocentrum micans Ehr. Eur J Cell Biol 23:295-302 15. Herzog M, Soyer MO (1983) The native structure of dinoflagellate chromosomes and their stabilization by Ca2+ and Mg2+ cations. Eur J Cell Biol 30:3 15b. Herzog M, Soyer MO, de Marcillac GD (1982) A high level of thymine replacement by 5-hydroxymethyluracil in nuclear DNA of the primitive dinoflagellate Prorocentrum micans E. Eur J Cell Biol 27:151-155 16. Herzog M, Von Boletzky S, Soyer-Gobillard MO (1984) Ultrastructural and biochemical nuclear aspects of eukaryote classification: independent evolution of the dinoflagellates as a sister group of the actual eukaryotes? Origins of Life 13:205-215 In: Margulis L, Soyer-Gobillard MO, Corliss J (eds) Evolutionary Protistology: The organism as cell. Reidel D, Boston, MA 17. Kallen RG, Simon M, Marmur J (1962) The occurrence of a new pyrimidine base replacing thymine in a bacteriophage DNA: 5-hydroxymethyluracil. J Mol Biol 5:248-250 18. Levi-Setti R, Gavrilov KL, Rizzo PJ (2008) Divalent cation distribution in dinoflagellate chromosomes imaged by high-resolution ion probe mass spectrometry. Eur J Cell Biol 87:963-976 doi:10.1016/j.ejcb.2008.06.002 19a Margulis L, Soyer-Gobillard MO, Corliss JO (eds) (1984) Evolutionary Protistology. The Organism as Cell. D. Reidel, Dordrecht, Holland, xii + 188 pp 19b Margulis L, Corliss JO, Melkonian M, Chapman DJ (eds) (1990) Handbook of Protoctista, 1st ed. Jones and Bartlett, Burlington, MA, USA, 914 pp 20. Marinov GK, Lynch M (2016) Diversity and divergence of dinoflagellate histone proteins. G3 Genes Genomics Genetics 6:397-422 doi:10.1534/ g3.115.023275 21. Miller JJ, Delwiche CF, Coats DW (2012) Ultrastructure of Amoebophrya sp. and its changes during the course of infection. Protist 163:720-745 doi:10.1016/j.protis.2011.11.007 22. Moldowan JM, Talyzina N (1998) Biogeochemical evidence for dinoflagellate ancestors in the early Cambrian. Science 281:1168-1170 doi:10.1126/science.281.5380.1168 23. Raikov IB (1982) Nuclear apparatus of Mesokaryotic Protozoa. In: The Protozoan Nucleus. Morphology and Evolution. Cell Biology Monographs 9:1-174 Springer Verlag, New York, USA, 474 pp 24. Ray PMM (1973) 5-Hydroxymethyluracil in the DNA of a dinoflagellate. Proc Natl Acad Sci USA 70:1114-1125

SOYER-GOBILLARD, DOLAN

25. Ray PMM, Steele RE (1978) Modified bases in the DNAs of unicellular eukaryotes: an examination of distributions and possible roles, with emphasis on hydroxymethyluracil in dinoflagellates. BioSystems 10:37-53 26. Rizzo PJ, Nooden LD (1974) Partial characterization of Dinoflagellate chromosomal proteins. Biochem Biophys Acta 349:5-427 27. Rizzo PJ, Burghard RC (1982) Histone-like protein and chromatin structure in the wall-less Dinoflagellate Gymnodinium nelsoni. BioSystems 15:27-34 28. Rouvière-Yaniv J, Gros F (1975) Characterization of a novel lowmolecular-weight DNA-binding protein from Escherichia coli. Proc Natl Acad Sci USA 72:3428-3432 29. Sigee DC (1983) Structural DNA in genetically active DNA in dinoflagellate chromosomes. BioSystems 16:203-210 30. Soyer MO (1972) Les ultrastructures nucléaires de la Noctiluque (Dinoflagellé libre) au cours de la sporogenèse. Chromosoma 39:9-4 31. Soyer MO (1977) Une modification de la technique de Karnovsky pour la preservation optimale des structures nucléaires chez les dinoflagellés. Biol Cellulaire 30:297-300 32. Soyer MO, Haapala OK (1973) Filaments extra-chromosomiques: variations et relations avec l’enveloppe nucléaire pendant la division chez les dinoflagellés. Journal de Microscopie 18:267-270 33. Soyer MO, Haapala OK (1974) Division and function of dinoflagellate chromosomes. Journal de Microscopie 19:137-146 34. Soyer MO, Haapala OK (1974) Structural changes of dinoflagellate chromosomes by pronase and ribonuclease. Chromosoma 47:179-192 35. Soyer MO, Herzog M (1985) The native structure of dinoflagellate chromosomes. Involvement of structural RNA. Eur J Cell Biol 36:334-342 36. Soyer-Gobillard MO (2002) Scientific research at the Laboratoire Arago (Banyuls, France) in the twentieth Century: Edouard Chatton, the “master”, and André Lwoff, the “pupil”. Int Microbiol 5:37-42 37. Soyer-Gobillard MO (2006) Edouard Chatton (1883–1947) and the dinoflagellate protists: concepts and models. Int Microbiol 9:173-177 38. Soyer-Gobillard MO (2007) Methods for studying the nuclei and chromosomes of Dinoflagellates. In: The Nucleus Vol 1: Nuclei and subnuclear components. Ronald Hancock (ed). Humana Press, NY, USA, pp 93-108 39. Soyer-Gobillard MO (2011) Dinoflagellates. In: Schaechter M (ed) Eukaryotic microbes. Elsevier, Amsterdam, Netherlands, pp 263-277 40. Soyer-Gobillard MO, Géraud ML (1992) Nucleolus behaviour during the cell cycle of a primitive dinoflagellate eukaryote, Prorocentrum micans Ehr., seen by light microscopy and electron microscopy. J Cell Sci 102:475-485 41. Soyer-Gobillard MO, Geraud ML, Coulaud D, Barray M, Théveny B, Révet B, Delain E (1990) Location of B- and Z-DNA in the chromosomes of a primitive eukaryote dinoflagellate. J Cell Biol 111:293-304 doi:10.1083/jcb.111.2.293 42. Stanier R, Lwoff A (1973) Le concept de microbe de Pasteur à nos jours. La Nouvelle Presse Médicale 2:1191-1198 43. Thomas Jr CA (1971) The genetic organization of chromosomes. Annu Rev Genet 5:237-256 44. Van de Peer Y, Van der Auweva G, De Wachter R (1996) The evolution of stramenopiles and alveolates as derived by substitution rate calibration of small ribosomal subunit RNA. J Mol Evol 42:201-210 45. Zarling DA, Arndt-Jovin DJ, Robert-Nicoud M, McIntosh LP, Thomae R, Jovin TM (1984) Immunoglobulin recognition of synthetic and natural left-handed Z-DNA conformations and sequences. J Mol Biol 176:369-415 doi:10.1016/0022-2836(84)90495-9


RESEARCH ARTICLE International Microbiology (2015) 18:217-223 doi:10.2436/20.1501.01.253. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes Katerina Stefanova,1 Iva Tomova,2 Anna Tomova,2 Nadja Radchenkova,2 Ivan Atanassov,1 Margarita Kambourova2*

AgroBioInstitute, Sofia, Bulgaria. 2Institute of Microbiology, Bulgarian Academy of Sciences, Sofia, Bulgaria

1

Received 16 September 2015 · Accepted 3 November 2016

Summary. Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)] Keywords: Archaea · hot spring · phylogenetic analysis · 16S rRNA gene · GH-57 gene

Introduction It is commonly accepted that microorganisms isolated by conventional approaches are less than 1% of microorganisms in any given environment [9] and this value is even lower in Corresponding author: M. Kambourova Institute of Microbiology Bulgarian Academy of Science Acad. G. Bonchev str. 26 1113 Sofia, Bulgaria Tel. +359-29793183. Fax +359-28700109 *

E-mail: margikam@microbio.bas.bg

extreme niches. The application of molecular-based methods is the only way for revealing the amazing microbial diversity in environmental niches. Terrestrial hot springs and oceanic hydrothermal vents are unique places to study microbial diversity under the pressure of one or more extreme factors. Many of the inhabitants identified in such niches refer to still unknown phylogenetic units and even groups, especially among archaea representatives. Most of the so far reported molecular analyses of microbial biodiversity are based on 16S rRNA gene. However, the expanding of analyses including additional metabolic genes have become increasingly popular. According to Xu [26], the characterization of


218

Int. Microbiol. Vol. 18, 2015

biodiversity through more than one marker gene provides additional advantages including: (i) draws more convincing conclusions based on the extended information; (ii) the results are more representative for the whole genome as more genes are included; (iii) horizontal gene transfer could be ignored by analysis of more genes. Such studies usually involve simultaneous comparative analysis of 16S rRNA and enzyme genes including: amoA (ammonia monooxygenase gene) for characterization of ammonia-oxidizing bacteria and archaea [4]; mcrA (methyl coenzyme-M reductase) for methanogen diversity [11]; chitinase and glycoside hydrolase family 4 genes for heterotrophic microorganisms [2]. Accelerated genome sequencing over the last two decades has made it possible the comparative analysis of larger sets of homologous genes from wide range of cultured bacteria and archaea and metagenome sequencing assemblies [17], thus facilitating the application of the gene-specific characterization of microbial biodiversity and enhancing the efficiency of isolation of novel genes from uncultivated microorganisms growing at specific environmental conditions. Glycoside hydrolase-57 (GH-57) family of proteins has been relatively recent described, and the number of its members has grown and now includes more than 1100 bacterial and archaeal proteins [http://www.cazyorg/GlycosideHydrolases.html]. Generally, five enzyme activities have been experimentally associated to the GH-57 proteins. All of them are of industrial interest, especially α-amylase, amylopullulanase, branching enzymes, 4-α-glucanotransferase and α-galactosidase. The members of the GH-57 family have been subject of several extensive bioinformatics studies pointing out the main conservative regions and sub-family clustering [5,8]. However, apart from the great interest in identification of novel enzymes with amylolytic activities and characterization and utilization of GH-57 members among them, only a very small part (less than 2%) of this protein family has been biochemically characterized. Here we report the characterization of microbial biodiversity of two hot springs based on 16S rDNA and GH57 sequences. The results are analyzed comparatively trying to elucidate the impact of each gene for revealing the real diversity in studied hot springs.

Materials and methods Description of the study sites. Bulgarian hot springs investigated in this study are located in geographically different areas. The spring Levunovo (LV) is located in South-West Bulgaria (N 41°28′59.988′′, E 23°18′0′′), in Struma fault zone formed in Precambrian age. The spring Vetren Dol (VD)

STEFANOVA ET AL.

is located in Maritsa fault zone (N 42°08′60.0′′, E 24°08′60.0′′) along the northern margin of the Rhodope Mountains formed in the Paleozoic and Cretaceous-Paleogene. The mineral composition of water in LV spring was determined as containing (mg/l): Na+ (89), K+ (23.5), Ca2+ (10), Mg2+ (0.9), HCO3– (66), F– (3.6), Cl– (1.0), SO42– (33), SiO32– (1.6), pH around neutral (7.6); water for VD contained higher ion concentrations: Na+ (97.8), K+ (45.6), Ca2+ (0), Mg2+ (1.08), F– (4.2), Cl– (20.59), SO42– (259), HCO3– (179.96), SiO32– (18.74), pH around neutral (6.8). 16S rDNA and GH57 clone libraries. Effluent water samples were collected aseptically from the spring outlet on the ground surface, transported to the lab in thermostat bags and used for isolation of a total DNA. Five-liter water samples were concentrated by cross-flow filtration through sterile hollow fiber cartridges (1.2 μm pore-size glass fiber prefilter and 0.2 μm membrane filter; Millipore). Environmental DNA was isolated from environmental samples according to a previously described procedure [7]. Bacterial 16S rDNA were amplified by two universal primers: 8F (EUB008) and 1492R (EUB1492). Archaeal 16S rDNA were amplified using two universal archaeal primers, 21F and 958R. The 16S rDNA fragments were PCR amplified using DreamTaq PCR master mix (Thermo Scientific) and PCR conditions: denaturation at 94°C for 3 min, followed by 30 cycles at 94°C for 30 s, 55°C for 30 s and 72°C for 90 s, and final extension at 72°C for 5 min. The degenerated primers pairs used for PCR amplification of fragment of GH-57 genes were: AMBF (5′- TTYGAASTNCAYCARCC) × AMBR (5′- TGYTCNCCRAANGTYTCRTARTC) and AMBF × ABDRI3 (5′- CACATATAATARAAATGRTC). The 16S rDNA fragments were PCR amplified using Phusion High-Fidelity DNA Polymerase master mix (Thermo Scientific) and PCR conditions: 30 s denaturation at 98°C, followed by 35 cycles at 98°C for 10 s, 46°C for 30 s and 72°C for 45 s and final extension at 72°C for 7 min. The obtained PCR products were subject of agarose gel electrophoresis and purification using NucleoSpin Extract II Kit (MachereyNagel). The purified 16S rDNA and GH-57 fragments were cloned into a pJET 1.2 vector of a CloneJet PCR Cloning kit (Thermo Scientific). The DNA fragments cloned into the pJET 1.2 vector were PCR amplified using vector primers and digested separately by the Msp I and Hae III endonucleases. The products from each digestion were separated following electrophoresis in 2% agarose gel. The analyzed clones were grouped according to their restriction profiles. Representative clones of each group were sequenced at both ends using the pJET forward and reverse primers by the Macrogen Sequencing Service. Sequence analysis. The obtained sequences were assembled and manually edited using Vector NTI v. 10 software package (Life Technologies). The obtained 16S rDNA sequences were first checked for chimera sequences by ‘DECIPHER Find Chimeras’ web tool [25] and those detected ones were not used for further study. The clones containing correct inserts were compared to the known sequences by using BLAST search [1] and Ribosomal Database Project resources [12] to determine their close relatives and approximate phylogenetic affiliations. The putative amino acid sequence for each GH-57 clone was determine based on the GH-57 nucleotide sequences using AMBF primer sequence as starting point of the reading frame. The generated GH-57 sequences were used to search sequences in GenBank database using blastp, DELTA-BLAST and Tblastn search tools. The 16S rDNA and GH-57 sequences together with selected pools of retrieved sequences were subject of phylogenetic analyses using MEGA software [20]. The sequences obtained in this study were deposited in the GenBank database under accession numbers KJ465919 to KJ465965 (bacterial 16S rDNA clones), HF922629 to HF922668 (archaeal 16S rDNA clones), and KJ465966 to KJ465987 (GH-57 clones).


Results and Discussion Archaeal diversity based on 16S rRNA gene. 16S rRNA gene clone libraries were successfully constructed using environmental DNA from two Bulgarian hot springs and almost the same number of clones was analyzed (86 for LV and 84 for VD,Fig. 1A). The comparison of biodiversity in the two springs, LV (temperature of water 82°C) and VD (temperature of water 64°C), confirmed the observation of increasing archaeal diversity in thermal environments with temperature rising [16]. On the basis of the gene analysis, significantly higher archaeal diversity was observed in LV hot spring and high abundance of phylotypes was established. The analyzed clones were realated to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A strong domination of two groups was observed―the group I.1b (40.6% of the clones, 11 sequence types) and Methanosarcinales (35.4% of the clones, 9 sequence types). Less frequent were the groups

Fig. 1. Relative abundance of 16S rDNA archaeal and bacterial clone groups retrieved from Levunovo and Vetren Dol hot springs. (A) Archaea; (B) Bacteria.

Int. Microbiol. Vol. 18, 2015

219

MCG (8.3%, 3 sequence types), Methanobacteriales (3.1%, 2 sequence types) and I.3b (2.1%, 2 sequence types). Most of the clones (81) from VD were related to HWCG (96.4%, 12 sequence types). Similarly to other investigations of the archaeal diversity, the retrieved clones grouped together with environmental uncultured clones confirmed the common acceptation that archaea are much more versatile than it is represented by validly recognized and Candidate types. Even in both recognized phyla Crenarchaeota and Euryarchaeota, most archaeal groups are still unculturable; they are formed on the basis of environmental clones and comprised putative taxons [34]. Most of the sequences from LV libraries are affiliated with soil group I.1b, resigned to Candidate Thaumarchaeota [19]. Clustering of the sequences from thermal environment with sequences from nonthermophilic I.1b have been reported by several authors and widening of the group I.1b to comprise thermophilic members has been suggested [13]. Domination of the sequences related to the moderate thermophiles from the genus Nitrososphaera in archaeal communities has been observed by other authors [4,7].

Int Microbiol

ARCHAEAL AND BACTERIAL DIVERSITY


220

Int. Microbiol. Vol. 18, 2015

Relatively small numbers of the sequences retrieved from LV were affiliated with the Miscellaneous Crenarchaeotal Group (MCG). Although MCG has only been defined by 16S rRNA sequences, it appears widespread and characterized by a large MCG intragroup diversity with 16S rRNA gene similarity values as low as 76% [45]. The diversity within most of our subgroups was in the proposed cutoff of 87.7% minimum level for family boundaries [46]. The sequences affiliated with the order Methanosarcinales represented the second dominant group in the archaeal community from LV. Although LV-108 grouped close to an uncultured clone related to the genus Methanomethylovorans, 16S rDNA sequence similarity for both clones was lower than 89%. The deep branching of the sequences retrieved from the investigated hot spring with a temperature of water higher than 80°C in the group of moderate thermophiles suggests the possibility for the formation of a group of obligate and/ or extreme thermophiles in the order Methanosarcinales as it has been suggested for the order Methanobacteriales [24]. This idea is supported by the low similarity of the retrieved sequences with the closest neighbors. Out of 10 novel sequences (less than 97% similarity), six grouped in the clade of Methanosarcinales and, for 3 of them, the phylogenetic distance was more than 10%. One of the clones, LV-128, showed 84% similarity with the phylogenetic neighbor, a value lower than the proposed cutoff of 85% minimum level for phylum boundary [6]. Representatives of the order Methanobacteriales are commonly accepted as mesophiles and thermophilic strains from the genus Methanobacterium are included in the genus Methanothermobacter [24]. The LV-39 and LV-75 sequences, identified from LV sample, were close to the 16S rRNA gene of Methanothermobacter defuvii. Most of the sequence types from VD were grouped around the 16S rRNA gene of Candidatus Nitrosocaldus yellowstonii, suggesting an active participation of archaea in ammonia-oxidation in this spring. Despite the fact that they represented 12 different sequence types, most of them (11) showed phylogenetic distances lower than 3% with the phylogenetic neighbors. Bacterial diversity based on 16S rRNA gene. The characterization of the bacterial 16S rDNA libraries derived from the two studied hot springs also revealed a high abundance of phylotypes, totally 73 groups with different restriction profiles. The sequencing and chimera analysis of represented rDNA clones from each phylotype identified 26 chimeric sequences, which have been omitted from the subsequent microbial diversity analysis. The remaining

STEFANOVA ET AL.

47 rDNA sequences branched among 10 bacterial phyla demonstrating unusual high bacterial diversity in the studied springs (Fig. 1B). Four of those sequences involved rDNAs common in both springs. Correspondingly, the number of the rDNA clones affiliated to these four phyla dominated in the studied rDNA pools of the springs, namely Bacteroidetes 29.2% (25% for LV and 32.5% for VD), Proteobacteria 23.5% (39.2% for LV and 13.8% for VD), Cyanobacteria 15.3% (7.1% for LV and 20.9% for VD), and Chloroflexi 13.9% (7.1% for LV and 18.6% for VD). The phylogeny for the dominant phyla revealed considerable diversity among phylotypes. Additionally, sequences of Firmicutes and Actinobacteria representatives were retrieved in LV, and Deinococcus–Thermus, Acidobacteria, Nitrospirae and Planctomycetes in VD. Proteobacteria, Bacteroidetes, Cyanobacteria, Chloroflexi, and Firmicutes have been found to be widely distributed in both terrrestial and aquatic environments [14,15,21]. Meiothermus is established to dominate among the sequences affiliated to the phylum Deinococcus–Thermus. The genera Thermus and Meiothermus are commonly present in global hot springs; however, they are not dominant in terrestrial hot springs, except for a few springs in Iceland [22] and Bulgaria [23]. Planctomycetes, Acidobacteria and Nitrospirae account for only about 1% each of phylotype abundance. The sequences phylogenetically affiliated with as-yet-uncultured Planctomycetes lineages are identified. The retrieved Acidobacteria sequence (KJ465963) shows less than 90% similarity to its phylogenetic neighbors. Acidobacteria is a vast group of organisms virtually unknown prior to rDNA sequence-based surveys and now its diversity and wide spreading are commonly accepted [3]. Actinobacteria (4.2%) are often considered as soil-borne bacteria and although various studies have focused on microbial ecology of this phylum data for the presence of its representatives in hot waters are scant. Its unexpected capability of adapting to hot spring environments was reported for the first time by Song et al. [18]. Closest phylogenetic affiliations found with a number of physiological groups suggested possible mode of metabolism or thermophily of inhabitants of LV and VD, although conclusions based on environmental sequences are only hypothetical. The presence of the autotrophic Cyanobacteria and Chloroflexus suggested the probable importance of primary production in providing nutrients to other taxa via photoexcretion. Chemolithoautotrophic nitrite-oxidizing bacteria affiliated with the genus Nitrospira are widespread in environments with elevated temperatures [10]. Organotrophic organisms probably were common in the investigated springs, supported by the primary productivity of the hydrogen metabolizers.


Int. Microbiol. Vol. 18, 2015

221

Int Microbiol

ARCHAEAL AND BACTERIAL DIVERSITY

Fig. 2. Neighbor joining phylogenetic tree of GH-57 amino acid sequences constructed from GH-57 clone sequences from Levunovo and Vetren Dol hot springs and their closest homologous sequences from the archaea and bacteria taxonomic groups retrieved after BLAST search. Bootstrap values greater than 30% confidences are shown at branching points (percentage of 1000 resamplings). Sequences from the Levonovo and Vetren Dol hot springs are designated with the abbreviation ‘L’ and ‘V’. All phylogroups without studied hot spring phylotypes are presented as subtree triangles.

About one third of the phylotypes (10) showed high to very high database matches (≥97% identity) and clustered well with their closest relatives. Half of the phylotypes (14) displayed very low identity scores (≤90%), and their respective identification remain only putative. These results suggests a presence of unknown taxa in the investigated springs.

Microbial diversity based on GH-57 gene. Among the combinations of the tested degenerated primers only two primer pairs produced abundant single band PCR products at expected sizes of approximately 700 bp for AMBF × AMBR pair and 1050 bp for AMBF × ABDRI3 pair. The AMBF forward primer matched the FExHQP sequence


222

Int. Microbiol. Vol. 18, 2015

corresponding to the ‘conserved sequence region 1’ (CSR-1) of GH-57 family [11,16]. Accordingly, the reverse primer AMBR matched DYETFGE sequence of the CSR-4 and ABDRI3 primer matched DHFYYM sequence of the CSR-5. The initial sequence characterization of the GH-57 clone libraries shows that all sequences of the shorter GH-57 clones derived from the PCR amplification with AMBF × AMBR primer pair overlaped with part of the longer GH-57 clones from AMBF × ABDRI3 primer pair and the last was used further in the study. The characterization of the entire AMBF × ABDRI3 clone libraries from the two hot springs showed higher diversity in hotter spring, totally 22 phylotypes, 15 from LV and 7 from VD. The analysis of the nucleotide sequences of representatives of each phylotype demonstrated that 20 clones contained the primer sequences at both ends and 2 clones were truncated and contained AMBF, but not the ABDRI3 primer sequence. The nucleotide sequences were further used to generate putative GH-57 amino acid sequences using the AMBF primer sequence as a starting point. The alignment of the obtained GH-57 amino acid sequences showed they shared from 43% to 98% sequence identity and 65% to 100% similarity. The BLAST search retrieved totally 448 bacterial and 116 archaeal sequences showing above 50% of amino acid sequence similarity at full length (>90%) coverage of the analyzed sequence query. The retrieved sequences have been designated as members of GH-57 protein family. Most of the retrieved GH-57 sequences originated from genome sequences of cultured bacteria and archaea, as the rest came from sequence assemblies of uncultured microorganisms following next generation sequencing of metagenomic DNA or sequencing of metagenomic clones. The main part of the retrieved homologous GH-57 sequences were originated in the phylum Bacteroidetes and were spread among its three main classes. On the contrary, all homologous sequences identified in the well characterized phylum Proteobacteria (44,046 genomes) were related only to the class of Deltaproteobacteria. A distinct result of the performed BLAST search was that homologous GH-57 sequences were abundant among the sequence assemblies from sequencing of metagenomic DNAs related to representatives from recently coined and still poorly characterized bacterial phylum Candidatus Saccharibacteria, as well as unclassified members of archaeal phylum Crenarchaeota and unclassified archaea. The last supports the expectations that genomes reconstruction from metagenome sequencing would increasingly serve as rich data source for complex characterization of biodiversity and phylogenetic distribution of specific metabolic gene families, employing cultivation-independent approach. The

STEFANOVA ET AL.

phylogenetic distribution of the retrieved GH-57 homologous sequences among the archaeal phylum was more uniform, although no homologous sequences were retrieved from some of the better genomically characterized orders of the phylum Euryarchaeota, including the orders Halobacteria, Methanobacteria and Thermococcus. The phylogenetic tree, constructed from the analyzed GH-57 sequences and homologous representatives of different phylogenetic groups, further demonstrates the complexity of the isolated GH-57 pool (Fig. 2). Two sequences (V1, V3) are allocated among the archaeal, and three (L2, L3, L6) among the Deltaproteo­ bacteria GH-57 sequences. The affiliation of five analyzed sequences (L1, L4, L14, L15 and V2) is not fully resolved. Together with the GH-57 sequences of two unclassified archael clones, they have been allocated among the bacterial GH-57 sequences and entered into a group of sequences originated from the recently metagenomically characterized groundwater microorganisms―unclassified archaea, uncultured bacterium and members of phylum Candidatus Saccharibacteria. The complexity of the isolated GH-57 clones demonstrated by the phylogenetic analysis suggested that the AMBF × ABDRI3 degenerate primer pair allowed efficient PCR amplification of GH-57 sequences, containing FExHQP and DHFYYM conserved sequence regions, from phylogenetically diverse bacteria and archaea. The comparison of the results from 16S rDNA and GH57 analyses of the microbial diversity of the studied hot springs showed that biodiversity based on GH-57 analysis was only a fraction of the 16S rDNA biodiversity, due to the probable lack of target GH-57 sequences in the genomes of the auxotrophic members of several bacterial and archaeal phyla and lower taxonomic groups. From the other side, the lack of the 16S rDNA clones affiliated to the Candidatus Saccharibacteria and the identification of relatively larger set of GH-57 clones clustered with known GH-57 sequences related to this phylum demonstrated that metabolic genes analysis would allow an increased resolution of the bio­ diversity assessment and in-depth analysis of specific taxonomic groups. The lower bootstrap affiliation of part of the isolated GH-57 clones to unclassified archaeal GH-57 sequences originated from metagenomic sequence assemblies suggested that despite the large and steady growing number of sequenced microbial genomes, the currently available genomic sequence data are still insufficient to resolve fully the phylogenetic distribution of the isolated GH-57 pool and to cover the range of GH-57 diversity.


ARCHAEAL AND BACTERIAL DIVERSITY

Acknowledgements. This work was supported by a grant from Bulgarian National Fund for Scientific Research, Project DID02-24/09 and the Ministry of Education and Science, as well as EEA Grant Bulgaria D03-100. Competing interests. None declared.

References 1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403-410 2. Atanassov I, Dimitrova D, Stefanova K, et al. (2010) Molecular characterization of the archaeal diversity in Vlasa hot spring, Bulgaria, by using 16S rRNA and glycoside hydrolase family 4 genes. Biotechnol Biotechnol Equip 24:1979-1985 doi:10.2478/V10133-010-0065-8 3. Barns SM, Takala SL, Kuske CR (1999) Wide distribution and diversity of members of the bacterial kingdom Acidobacterium in the environment. Appl Environ Microbiol 65:1731-1737 4. Bartossek R, Spang A, Weidler G, Lanzen A, Schleper C (2012) Metagenomic analysis of ammonia-oxidizing archaea affiliated with the soil group. Front Microbiol 3:208 doi:10.3389/fmicb.2012.00208 5. Blesák K, Janeček Š (2012) Sequence fingerprints of enzyme specificities from the glycoside hydrolase family GH57. Extremophiles 16:497-506 doi:10.1007/s00792-012-0449-9 6. Harris JK, Kelley ST, Pace NR (2004) New perspective on uncultured bacterial phylogenetic division OP11. Appl Environ Microbiol 70:845849 doi:10.1128/AEM.70.2.845-849.2004 7. Ivanova I, Atanassov I, Lyutskanova D, Stoilova‐Disheva M, Dimitrova D, Tomova I, Derekova A, Radeva G et al. (2011) High Archaea diversity in Varvara hot spring, Bulgaria. J Basic Microbiol 51:163-172 doi:10.1002/jobm.201000160 8. Janeček Š, Blesák K (2011) Sequence-structural features and evolutionary relationships of family GH57 α-amylases and their putative α-amylaselike homologues. Protein J 30:429-435 doi:10.1007/s10930-011-9348-7 9. Kennedy J, Marchesi JR, Dobson AD (2008) Marine metagenomics: strategies for the discovery of novel enzymes with biotechnological applications from marine environments. Microb Cell Fact 7 doi:10.1186/1475-2859-7-27 10. Lebedeva EV, Off S, Zumbrägel S, Kruse M, Shagzhina A, Lücker S, Maixner F, Lipski A et al. (2011) Isolation and characterization of a moderately thermophilic nitrite-oxidizing bacterium from a geothermal spring. FEMS Microbiol Ecol 75:195-204 doi:10.1111/j.15746941.2010.01006.x 11. Lwin KO, Matsui H (2014) Comparative analysis of the methanogen diversity in horse and pony by using mcrA gene and archaeal 16S rRNA gene clone libraries. Archaea doi:10.1155/2014/483574 12. Maidak BL, Larsen N, McCaughey MJ, Overbeek R, Olsen GJ, Fogel K, Blandy J, Woese CR (1994) The ribosomal database project. Nucleic Acids Res 22:3485-3487 13. Marteinsson VT, Hauksdottir S, Hobel CF, Kristmannsdottir H, Hreggvidsson G, Kristjansson JK (2001) Phylogenetic diversity analysis of subterranean hot springs in Iceland. Appl Environ Microbiol 67:42424248 doi:10.1128/AEM.67.9.4242-4248.2001

Int. Microbiol. Vol. 18, 2015

223

14. Nishiyama M, Yamamoto S, Kurosawa N (2013) Microbial community analysis of a coastal hot spring in Kagoshima, Japan, using molecularand culture-based approaches. J Microbiol 51:413-422 doi:10.1007/ s12275-013-2419-z 15. Otaki H, Everroa RC, Matsuura K, Haruta S (2012) Production and consumption of hydrogen in hot spring microbial mats dominated by a filamentous anoxygenic photosynthetic bacterium. Microbes Environ 27:293-299 doi:10.1264/jsme2.ME11348 16. Schleper C, Jurgens G, Jonuscheit M (2005) Genomic studies of uncultivated archaea. Nat Rev Microbiol 3:479-488 doi:10.1038/ nrmicro1159 17. Shestakov SV (2012) Impact of metagenomics on biotechnological development. Appl Biochem Microbiol 48:705-715 doi:10.1134/ S0003683812090050 18. Song Z, Zhi X, Li W, Jiang H, Zhang C, Dong H (2009) Actinobacterial diversity in hot springs in Tengchong (China), Kamchatka (Russia), and Nevada (USA). Geomicrobiol J 26:256-263 doi:10.1080/01490450902892373 19. Spang A, Hatzenpichler R, Brochier-Armanet C, et al. (2010) Distinct gene set in two different lineages of ammonia-oxidizing archaea supports the phylum Thaumarchaeota. Trends Microbiol 18:331-340 doi:10.1016/j.tim.2010.06.003 20. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596-1599 doi:10.1093/molbev/msm092 21. Tekere M, Lötter A, Olivier J, Jonker N, Venter S (2013) Metagenomic analysis of bacterial diversity of Siloam hot water spring, Limpopo, South Africa. Afr J Biotechnol 10:18005-18012 doi:10.5897/AJB11.899 22. Tobler DJ, Benning LG (2011) Bacterial diversity in five Icelandic geothermal waters: temperature and sinter growth rate effects. Extremophiles 15:473-485 doi:10.1007/s00792-011-0378-z 23. Tomova I, Stoilova-Disheva M, Lyutskanova D, Pascual J, Petrov P, Kambourova M (2010) Phylogenetic analysis of the bacterial community in a geothermal spring, Rupi basin, Bulgaria. World J Microb Biot 26:2019-2028 doi:10.1007/s11274-010-0386-7 24. Wasserfallen A, Nölling J, Pfister P, Reeve J, De Macario EC (2000) Phylogenetic analysis of 18 thermophilic Methanobacterium isolates supports the proposals to create a new genus, Methano­ ther­mobacter gen. nov., and to reclassify several isolates in three species, Methanothermobacter thermautotrophicus comb. nov., Metha­no­thermobacter wolfeii comb. nov., and Methanothermobacter marburgensis sp. nov. Int J Syst Evol Microbiol 50:43-53 doi:10.1099/ 00207713-50-1-43 25. Wright ES, Yilmaz LS, Noguera DR (2012) DECIPHER, a searchbased approach to chimera identification for 16S rRNA sequences. Appl Environ Microbiol 78:717-725 doi:10.1128/AEM.06516-11 26. Xu J (2006) Invited review: microbial ecology in the age of genomics and metagenomics: concepts, tools, and recent advances. Mol Ecol 15:17131731 doi:10.1111/j.1365-294X.2006.02882.x


RESEARCH ARTICLE International Microbiology (2015) 18:225-233 doi:10.2436/20.1501.01.254. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Chlamydia pneumoniae CPj0783 interaction with Huntingtin-protein14 Izumi Yanatori,1 Yumiko Yasui,1 Kazunobu Ouchi,2 Fumio Kishi1*

Department of Molecular Genetics, Kawasaki Medical School, Kurashiki, Okayama, Japan. 2Department of Pediatrics, Kawasaki Medical School, Kurashiki, Okayama, Japan

1

Received 8 September 2015 · Accepted 1 December 2015

Summary. Chlamydia pneumoniae is a Gram-negative, obligate intracellular pathogen that causes community-acquired respiratory infections. After C. pneumoniae invades host cells, it disturbs the vesicle transport system to escape host lysosomal or autophagosomal degradation. By using a yeast mis-sorting assay, we found 10 C. pneumoniae candidate genes involved in aberrant vesicular trafficking in host cells. One of the candidate genes, CPj0783, was recognized by antibodies from C. pneumo­ niae-infected patients. The expression of CPj0783 was detected at mid to late-cycle time points and increased during the inclusion maturation. Two-hybrid screening in yeast cells revealed that CPj0783 interacted with Huntingtin-interacting protein 14 (HIP14). The specific interaction between CPj0783 and HIP14 could be demonstrated by an in vivo co-immunoprecipitation assay and an in vitro GST pull-down assay. It was also demonstrated that HIP14 was localized in the Golgi apparatus and colocalized with CPj0783. HIP14 has a palmitoyl transferase activity that is involved in the palmitoylation-dependent vesicular trafficking of several acylated proteins. These findings suggest that CPj0783 might cause abnormal vesicle-mediated transport by interacting with HIP14. [Int Microbiol 18(4):225-233 (2015)] Keywords: Chlamydia pneumoniae · intracellular pathogens · yeast two-hybrid screening CPj0783–HIP14 · protein mis-sorting · vesicle transport

Introduction Chlamydia pneumoniae is an obligate intracellular pathogen that causes acute and chronic respiratory infections in humans. Almost all humans face the possibility of contracting C. pneumoniae infections at least once in their lifetime [9]. Chlamydia species have a unique biphasic life cycle initiated by the attachment of the elementary body (EB) to the host

Corresponding author: Fumio Kishi Department of Molecular Genetics Kawasaki Medical School 577 Matsushima, Kurashiki Okayama 701-0192, Japan Tel. +81-864621111. Fax +81-86462-1199 *

E-mail: fkishi-ygc@umin.ac.jp

cell. Then, the EB is endocytosed by the cell and is contained within a plasma membrane-derived vesicle, which is quickly modified by the pathogen to establish a replicative form, termed the inclusion [9]. The pathogen remains within the inclusion for the duration of its intracellular development and is transformed into the reticulate body (RB) [11]. While Chlamydia grows in the inclusion, the pathogen should escape from phagosomal degradation in host cells. It is thus currently thought to achieve such purposes by expressing certain molecules that inhibit phagosomal maturation and modulate the host-vesicle trafficking pathways. Previously, we reported the functional high-throughput screening system in yeast cells [20]. It has been found that the carboxypeptidase Y-invertase (CPY-Inv) reporter system is a powerful tool to identify the molecules that alter eukaryotic vesicle trafficking pathways. By using a similar expression screening system,


226

Int. Microbiol. Vol. 18, 2015

it has been reported that several molecules expressed by intracellular pathogens such as Legionella pneumoniae inhibit the maturation of the phagosome and/or exit the endocytic pathway [4,17]. We have determined the sequence of the whole genome of C. pneumoniae J138 strain [16] and found that this strain features a putative protein coded by its 1069 open reading frames (ORFs). A comprehensive bioinformatics approach has been applied for annotation taxonomy, and approximately half of the predicted ORFs have been found to encode proteins without any known functions. To identify novel C. pneumoniae molecules that determine virulence and pathogenicity, we screened 455 ORFs without any known functions in a yeast expression system. Here, we address the newly identified C. pneumoniae CPj0783 gene that causes mis-sorting in yeast cells. CPj0783 was found to interact with Huntingtin-interacting protein 14 (HIP14) in vivo and in vitro. HIP14 is classified in both the palmitoyl acyl transferase protein family (PAT family) and ankyrin repeat superfamily (ANK superfamily) [15,18]. HIP14 is most notably involved in the palmitoylation and trafficking of multiple proteins and has been localized to the Golgi apparatus [12,18]. The expression of HIP14 has been detected ubiquitously in human tissues and one of the most essential target proteins is huntingtin (HTT) [15]. Our study suggests that a novel C. pneumoniae molecule, CPj0783, would interact with HIP14 and could cause aberrant vesicle trafficking.

Materials and methods Cell culture and infection. Chlamydia pneumoniae J138 was pro­pagated in HEp-2 cells maintained in Dulbecco’s Modified Eagle Medium (SigmaAldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum. Mis-sorting assay in yeast cells. We previously developed a carboxypeptidase Y (CPY)-invertase (Inv) reporter system in yeast cells [20]. The mis-sorting assay was performed using this system, as previously described [20]. Yeast cultures were spotted on SC-Ura/fructose with and without 20 µg/ml of doxycycline and grown for 2 days at 30°C. In the invertase overlay assay, the plates were overlaid with a 0.75% agarose solution containing 125 mM sucrose, 100 mM sodium acetate buffer (pH 5.5), 0.5 mM N-ethylmaleimide, 10 µg/ml of horseradish peroxidase, 8 units/ml of glucose oxidase and 2 mM O-dianisidine. After 5–15 min, photographs were taken with a Nikon D70 digital single-lens reflex camera. Image contrast was adjusted using Adobe Photoshop CS6 (Adobe Systems, San Jose, CA, USA) Protein expression and purification. For the purification of the glutathione S-transferase (GST)-tagged CPj0783 (25–262 amino acids) fusion protein, E. coli JM109 cells transformed with protein-expression plasmids were grown in Luria broth with 100 μg/ml ampicillin at 37°C to an OD600 of 0.8; then, recombinant GST gene expression was induced by the addition of isopropyl-1-thio-β-d-galactopyranoside to a final concentration

YANATORI ET AL.

of 0.3 mM at 37°C for 3 h. Cells were pelleted, resuspended in TNE buffer containing 10 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA, 2% NP40 and 1 mM phenylmethylsulfonyl fluoride and disrupted by sonication. Lysates were cleared by centrifugation at 20,000 ×g for 15 min at 4°C, and GST-tagged proteins were purified from the supernatant using glutathioneSepharose 4B beads. After incubation with Sepharose beads for 2 h, the beads were washed five times with TNE buffer, and then the recombinant fusion proteins were eluted with 10 mM reduced glutathione and 50 mM Tris-HCl at pH 9.0. Antibodies. Antibody generation was performed as previously described [19]. Briefly, maltose-binding protein-tagged CPj0783 was purified on amylose resin and used to immunize Japanese white rabbits. The affinitypurified anti-CPj0783 polyclonal antibody (pAb) was purified from antiserum on a HiTrap N-hydroxysuccinimide activated column (GE Healthcare Japan) coupled with GST-tagged CPj0783. HRP-conjugated goat antihuman IgA (Monosan, Netherland), anti-human IgG and anti-human IgM (Invitrogen, CA) immunoglobulins were used as the secondary antibodies. HRP-conjugated anti-mouse and anti-rabbit IgGs were purchased from Cell Signaling technology (Danvers, MA, USA). Most other general reagents were purchased from Wako Chemicals, Nacalai Tesque and Sigma. Immunofluorescence microscopy. Cells grown on glass coverslips were fixed with 4% paraformaldehyde and permeabilized with 0.05% Triton X-100 in PBS. Cells were incubated with primary antibodies overnight at 4°C. Secondary antibodies coupled to Alexa 594 were incubated at room temperature. on cells for 60 min. The coverslips were washed and mounted on slides with VECTASHIELD (Vector Laboratories). Images were obtained using a Zeiss LSM 700 confocal laser-scanning microscope system or an Olympus BX53 fluorescence microscope. Yeast two-hybrid assays and α-galactosidase activation assays. The yeast two-hybrid assay was performed as described in the Matchmaker protocol (Takara Bio Co., Japan). As a bait plasmid, the amino acids 25–262 of CPj0783 were cloned into the GAL4 DNA-binding domain expression vector. As a prey, the Mate & Plate Library-HeLa S3 (normalized) cDNA library was used. To assess α-galactosidase activity in isolated yeast transformants, colorimetric assays were performed as described in the manuscript provided by Takara Bio Co. GST pull-down assay. GST-CPj0783 was incubated with the protein extract from GFP-HIP14 expressing HEp-2 cells at 4°C for 2 h. The suspension of glutathione-Sepharose 4B beads was added, and the incubation was continued for an additional 30 min. The beads were washed five times, and extracted proteins were analyzed by immunoblotting.

Results Chlamydia pneumoniae molecules and protein mis-sorting in yeast cells. It was found that the CPYInv reporter system is a powerful tool to identify molecules that alter eukaryotic vesicle trafficking pathways [17]. Vacuole protein sorting gene 4 (Vps4) is one of the core proteins which form multivesicular bodies. When Vps4E233Q was expressed in yeast cells, normal endosomal function was perturbed and the CPY-Inv fusion protein was exported out of the cells to the cell surface [17,20]. Then, the media color changed to brown


Fig. 1. Chlamydia pneumoniae molecular screening using a yeast mis-sorting assay. (A) 455 function-unknown C. pneumoniae genes were cloned into a CEN PTet-off vector and then expressed in yeast cells. The yeast was spotted on the induction media. The detail method of mis-sorting assay is described in the section of materials and methods. Ten C. pneumoniae molecules that caused mis-sorting in yeast cells were obtained from this screening. The candidate genes were analyzed in three independent experiments. (B) Ten C. pneumoniae molecules. Nine of these molecules have C. trachomatis orthologs, and CPj1027 was specific to C. pneu­ moniae.

as invertase reacted with its substrate in the overlaid agarose and subsequently formed brown precipitates. By using this system, 455 C. pneumoniae ORFs were screened and we consequently obtained 10 positive clones (Fig. 1). When each one of the CPj0186, 0572 and 1027 was expressed in yeast cells, they showed strong colorimetric changes in the overlay by the mis-sorting of CPY-Inv. When one of the other seven C. pneu­moniae ORFs, CPj0783, 0938, 0939, 0995, 0996, 1003 and 1005, was expressed in yeast cells, it showed moderate colorimetric change in the overlay. We summarized the ORF names, predicted amino acid length, and their orthologs in the C. trachomatis genome in Fig. 1B. CPj1027 did not have any counterpart in the C. trachomatis genome and was one of the C. pneumoniae specific ORFs. Chlamydia pneumoniae molecule expression in infected patients. We made a genomic screening system for C. pneumoniae-specific antigen molecules in the previous study [21] and adapted it to these candidate ORFs in the present study. GFP-tagged ORFs encoded by the ten candidates were expressed in yeast cells as described [21]. Serum samples were collected from eight patients (age range 4–11 years) who had been clinically diagnosed with primary acute C. pneumoniae infection. These samples were applied to immunoblot analyses as primary antibodies. Three

Int. Microbiol. Vol. 18, 2015

227

Int Microbiol

C. PNEUOMONIAE INTERACTION WITH PROTEIN 14

different classes of immunoglobulins (HRP-conjugated anti-human IgA, IgG and IgM) were used as the secondary antibodies. The serum samples from these patients did not contain significant anti-Saccharomyces cerevisiae antibodies, which would have produced a high level background on the immunoblots (Fig. 2). Therefore, we were able to specifically detect the C. pneumoniae antigens under conditions of lowlevel background. Then, it was revealed that CPj0783 was recognized by all classes of immunoglobulins examined in this study (Fig. 2). When antisera obtained from babies without C. pneumoniae infection who were diagnosed by commercially available serologic ELISA test kits were used for immunoblot analysis, we could not obtain any specific signals on the blots (data not shown). These results provide the evidence that CPj0783 had been definitely produced in patients with primary C. pneumoniae-infection and was recognized by the host immune systems. CPj0783 was no longer the candidate ORF but a gene undoubtedly working in its genome. Thus, we investigated CPj0783 in details. Expression of Chlamydia pneumoniae CPj0783 dur­ing inclusion maturation. Chlamydia pneumoniae has a unique life cycle and two developmental stages, the elementary body (EB) and the reticulate body (RB). EB is the infectious form of Chlamydia. After invading the host


228

Int. Microbiol. Vol. 18, 2015

YANATORI ET AL.

Int Microbiol

We investigated CPj0783 expression by immunostaining at 48 h post-infection (Fig. 3C). Chlamydia pneumoniaeinfected cells were analyzed by staining with DAPI and an antibody against CPj0783. DAPI staining clearly showed host cell nuclei and a chlamydial inclusion in the host-cell cytoplasm. Some immunoreactive punctate patterns of CPj0783 expression on a chlamydial inclusion were visualized by staining with the antibody.

Fig. 2. CPj0783 expression in C. pneumoniae-infected patients. Serum samples were collected from eight patients (age range 4–11 years) who had been clinically diagnosed with a primary acute C. pneumoniae infection. Yeast cells were transformed with the amino acids 25–262 of CPj0783 C-terminally fused to GFP (CPj0783-GFP), and then the protein was extracted. The predicted molecular mass of CPj0783-GFP was 56 kDa (arrowhead). Immunoblot analysis was performed using serum samples as the primary antibodies and three different classes of immunoglobulins (HRPconjugated anti-human IgA, IgG, IgM) as the secondary antibodies. The arrowheads indicate the specific band of CPj0783-GFP that was detected by patient sera or anti-GFP pAb (α-GFP).

cells (infection time: 0–2 h), C. pneumoniae makes inclusion bodies and changes its morphology from EB to RB (2–18 h). RBs are the non-infectious intracellular form, yet they are the metabolically active replicating form. They can then replicate themselves through binary fission (18–48 h). After division, the RBs become EBs (48–72 h). We investigated at which stage of the chlamydial developmental cycle CPj0783 was expressed in C. pneumoniae-infected cells. mRNA and protein expression were examined in C. pneumoniae-infected cells. Figure 3A shows that the mRNAs of C. pneumoniae major outer membrane protein (MOMP) and CPj0783 were detected by RT-PCR in C. pneumoniae-infected cells at 48 h post-infection. Then we investigated at which stage of the chlamydial developmental cycle CPj0783 was expressed in C. pneumoniae-infected cells. The protein expression of MOMP was detected at 12 h post-infection, and its expression level increased during the developmental cycle (Fig. 3B). According to the MOMP expression levels, bacteria proliferated with the longer incubation period, whereas the protein expression of CPj0783 was detected at 24 h to 66 h post-infection, and a rapid decrease in the CPj0783 expression after 60 h post-infection was observed.

CPj0783-HIP14 interaction in yeast twohybrid screening. To identify protein(s) that interact with CPj0783, a two-hybrid screening system in yeast cells was used in the present study. According to the predicted structure of CPj0783, CPj0783 might contain a putative transmembrane region in its N-terminus (Fig. 4A). Therefore, we used amino acids 25–262 of CPj0783 as a bait protein for yeast two-hybrid screening. Two of the positive clones were sequenced, and these clones were identified as part of HIP14 and encompassed amino acids 8–182 which contained the ankyrin repeat domain (Fig. 4A). To confirm the results of a yeast two-hybrid screening, CPj0783 and the cDNA in the bait and prey in the initial screening were exchanged with each other (Fig. 4B), and then an interaction between the bait amino acids 8–182 of HIP14 and the prey amino acids 25–262 of CPj0783 was detected as well (Fig. 4B). HIP14 has five ankyrin repeats in its N-terminal half and six transmembrane domains in its C-terminal half [15]. The clones obtained from the initial screening contained three ankyrin repeats, and therefore we used amino acids 1–303 of HIP14 that corresponded to the entire cytoplasmic region as prey. The resulting plasmid DNAs were transformed into haploid yeast to detect protein-protein interactions. An interaction between CPj0783 and amino acids 1–303 of HIP14, as well as an interaction between CPj0783 and amino acids 1–182 of HIP14, was detected (Fig. 4C). These results suggest that an interaction between CPj0783 and HIP14 in yeast cells could be demonstrated in this way. It was therefore important to clarify the interaction between CPj0783 and HIP14 in other ways, as described below. CPj0783 interaction with HIP14 in vivo. To reveal the interaction between CPj0783 and HIP14 in mammalian cells, we made mCherry-tagged CPj0783 and GFP-tagged HIP14 and co-transfected them into HEp-2 cells. The cell lysates were precipitated with anti-mCherry pAb-protein G beads and analyzed by immunoblotting with anti-GFP pAb. HIP14-GFP was specifically detected in the immunoprecipitate from HEp-2 cells expressing mCherry-CPj0783 (Fig. 5A).


C. PNEUOMONIAE INTERACTION WITH PROTEIN 14

Int. Microbiol. Vol. 18, 2015

We observed the multiple mCherry-CPj0783 bands on the immunoblot. These multiple bands were detected not only by the anti-mCherry pAb but also by the anti-CPj0783 pAb. mCherry-CPj0783 might be an unstable protein and was cleaved by an unknown mechanism. CPj0783 colocalization with HIP14 in the Golgi apparatus. We analyzed the subcellular localization of CPj0783 in HEp-2 cells. mCherry-CPj0783 and HIP14-GFP were co-transfected in HEp-2 cells. HIP14-GFP completely colocalized with a Golgi marker (Fig. 5B), as previously reported [7]. The location of CPj0783 clearly corresponded with that of HIP14-GFP. These results suggested that CPj0783 and HIP14 might interact with each other in the Golgi apparatus of mammalian cells. CPj0783 interaction with HIP14 in vitro. To confirm the results of the co-immunoprecipitation assay (Fig. 5A) and the immunostaining study (Fig. 5B), a GST pull-

Int Microbiol

Fig. 3. CPj0783 mRNA and protein expression in C. pneumoniae-infected cells. (A) HEp-2 cells were infected with C. pneumoniae and incubated at 37°C for 48 h. Cells were lysed in Sepasol-RNA I Super for the extraction of total RNA. RNA was treated with DNase I to remove DNA contamination. RNA was reverse-transcribed in three independent experiments. cDNA was amplified using primers specific for CPj0783, MOMP or α-tubulin. (B) HEp2 cells were infected with C. pneumoniae and incubated at 37°C for the indicated time. Cells were lysed in TNE buffer for the extraction of proteins. CPj0783 or MOMP protein expression was analyzed by immunoblotting with specific antibodies. The experiments were performed in triplicate. (C) HEp-2 cells grown on glass coverslips were infected with C. pneumoniae and incubated at 37°C for 48 h. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.05% Triton X-100 in PBS. Cells were incubated with α-CPj0783 pAb overnight at 4°C. A secondary antibody coupled to Alexa 594 was incubated on cells for 60 min at room temperature. Images were obtained using an Olympus BX53 fluorescence microscope.

229

down assay was performed. We made GST fusion proteins including the amino acids 25–262 of CPj0783 and purified these recombinant proteins from Escherichia coli. When the protein from HEp-2 cells expressing HIP14-GFP was mixed with GST-CPj0783, HIP14 was pulled down by CPj0783 and was specifically detected on the immunoblots (Fig. 5C). These results demonstrated that CPj0783 specifically interacted with HIP14 in vitro.

Discussion Chlamydia pneumoniae is an obligate intracellular pathogen. It is necessary for C. pneumoniae to escape the host immune response. Upon infection, the nascent inclusion membrane surrounding the infectious EB is plasma membrane-derived, but within a few hours, chlamydial translocated proteins modify the inclusion membrane. These modifications result in inclusion trafficking to the microtubule organizing center and


Int. Microbiol. Vol. 18, 2015

YANATORI ET AL.

Int Microbiol

230

the separation of the inclusion from the classical endosomal/ lysosomal pathway [10]. However, the detailed mechanism of how Chlamydia could disturb vesicle trafficking in host cells remained unclear. We used the properties of a hybrid protein resulting from a fusion (CPY-Inv) between carboxypeptidase Y (CPY) and invertase (Inv), both of which are originally encoded by the yeast genome in nature. The CPY gene encodes a vacuolar hydrolase that undergoes posttranslational modifications in the Golgi apparatus, followed by trafficking to the late endosome and sorting to the vacuole, which functions as the lysosome in yeast cells. The CPY-Inv fusion protein is normally translocated from the endoplasmic reticulum to the Golgi apparatus and subsequently to the vacuole via the late endosome. The fusion protein is strictly sequestered in the vacuole and cannot reach the yeast cell surface at all. Thus, the cell cannot hydrolyze exogenously

Fig. 4. Identification of CPj0783-binding proteins by a yeast two-hybrid screen. (A) The predicted structures of CPj0783 and HIP14. The schematic presentation of HIP14 shows its five ankyrin repeats, six transmembrane regions and one DHHC palmitoyl acyl transferase domain. Amino acids 25–262 of CPj0783 were cloned into the vector containing the GAL4 DNA-binding domain (bait vector). As prey, Mate & Plate Library-HeLa S3 (normalized) cDNA library was used. After mating, yeast were grown on both SD/-Trp/-Leu and SD/-Trp/Leu/-His/-Ade + X-gal selection medium and incubated at 30°C for 48 h. The vector served as a negative control, and p53 and T7 served as positive controls, as suggested in the instruction manual. (B) To confirm the yeast two-hybrid screening results, the cDNAs in the baits and preys used in the screening were exchanged. Amino acids 8–182 of HIP14 were cloned into the bait vector and amino acids 25–262 of CPj0783 were cloned into the prey vector. The expression of recombinant HIP14 (amino acids 8–182) in the bait vector and CPj0783 (amino acids 25–262) in the prey vector was confirmed by immunoblotting. (C) The interaction between CPj0783 and the total cytoplasmic region of HIP14 was examined. Amino acids 1–303 of HIP14 were cloned into a prey vector. Expression of recombinant HIP14 (amino acids 1–303) in the prey vector and CPj0783 (amino acids 25–262) in the bait vector were confirmed by immunoblotting.

provided sucrose in this screening system. Once the normal trafficking becomes perturbed, cargo vesicles are blocked from getting to the vacuole and then mis-sorting of the fusion protein is induced. As a consequence, spillover of the fusion proteins is evoked, and they are translocated into vesicles destined for the yeast cell surface. When abnormal secretion of the fusion protein occurs in yeast cells, it allows the cell to hydrolyze exogenous sucrose [17,20]. In this study, we found ten C. pneumoniae candidate molecules that caused the mis-sorting of the CPY-Inv fusion protein in yeast cells. One of these candidates, CPj0186, showed relatively strong colorimetric changes in the assay system for the mis-sorting phenotype. It had been previously reported that CPj0186 is inclusion membrane protein A (IncA) and has similarity to CT119 in the C. trachomatis genome [2]. The IncA protein of C. trachomatis has been well studied, and it has been reported


Fig. 5. CPj0783 interaction with HIP14 in vivo and in vitro. (A) mCherry-CPj0783 and HIP14-GFP were expressed in HEp-2 cells. The proteins were extracted in TNE buffer. The samples were incubated with a protein G-Sepharose slurry to preclear the sample of nonspecific binding to proteins. Co-immunoprecipitation studies were carried out with these samples. The precipitates were analyzed by immunoblotting with anti-GFP pAb. Similar results were obtained from at least three independent experiments. (B) mCherry-CPj0783 and HIP14-GFP were transfected in HEp-2 cells and incubated at 37°C for 48 h. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.05% Triton X-100 in PBS. Cells were incubated with anti-P230 or GM130 mAb 594 was incubated at room temperature for 60 min. A secondary antibody coupled to Alexa 594 was incubated on cells at room temperature for 60 min. Images were obtained using a Zeiss LSM 700 confocal laser-scanning microscope system. (C) GST pull-down assay. GST-CPj0783 was expressed in E. coli JM109. Purified GSTCPj0783 was mixed with the crude extract obtained from HEp-2 cells expressing HIP14-GFP and precipitated with glutathione-Sepharose 4B beads. Eluates from the beads were subjected to SDS-PAGE and analyzed by immunoblotting with anti-GFP pAb. Similar results were obtained from at least three independent researchers.

that IncA interacts with eukaryotic proteins called SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) that catalyze membrane fusion during intracellular vesicular transport [14]. We have previously reported that CPj0572 is recognized by three types of immunoglobulins, IgA, IgM and IgG, derived from hosts who suffer from primary acute C. pneumoniae infection [21]. In the present study, CPj0572 showed relatively strong colorimetric changes in this screening system and could be one of the candidates.

Int. Microbiol. Vol. 18, 2015

231

Int Microbiol

C. PNEUOMONIAE INTERACTION WITH PROTEIN 14

It has been reported that CPj0572 is an ortholog molecule of C. trachomatis translocated actin recruiting phosphoprotein (Tarp), containing the alpha helix structure that is associated with host actin, and could actually induce actin nucleation [3,8]. Therefore we could accurately detect CPj0186/IncA and CPj0572/Tarp as molecules that caused the CPY missorting in this screening system, and this indicated that the system itself was functioning extremely well to identify the molecules altering vesicle trafficking pathways. Another


232

Int. Microbiol. Vol. 18, 2015

candidate molecule, CPj1027, which showed a strong colorimetric change in this assay system, has been reported to be a newly identified inclusion membrane protein unique to C. pneumoniae [5]. The CPj1027 protein was detected as early as 12 h after C. pneumoniae infection and remained in the inclusion membrane throughout the infection cycle. The function of CPj1027 has not yet been clarified. CPj1027 might interact with some proteins that are related to vesicle trafficking. It is thus necessary to investigate the function of this molecule in future studies. CPj0783 showed a moderate colorimetric change for the mis-sorting phenotype. The C. trachomatis ortholog of CPj0783 is CT598; the functions of CPj0783 and CT598 are completely unknown. The amino acid sequence similarity between CPj0783 and CT598 is merely 35%, and both molecules might have the similar function. CT598 is a hypothetical protein and its expression in C. trachomatis has not been proved yet. Analysis of CT598 would be necessary and we plan to investigate this issue. We have previously reported that 58 clones expressing C. pneumoniae ORFs are antigens using serum samples obtained from C. pneumoniaeinfected patients as the primary antibodies [21]. Thus, we examined the immunoreactivities of CPj0783 and revealed that C. pneumoniae definitely produced CPj0783 during infection; this molecule was recognized by three types of immunoglobulins, IgA, IgM and IgG, derived from hosts who suffered from primary acute C. pneumoniae infection. These results suggest that CPj0783 could be secreted out of the infected cells or released from the extruded inclusion and/or lysis of the host cell, and then the host immune system could recognize CPj0783 and produce specific antibodies. Based on these data, we chose CPj0783 and investigated it in detail. It is thought that C. pneumoniae exchanges its morphology from RB to EB at approximately 48 h post-infection. The MOMP expression level increased depending on the number of C. pneumoniae cells without being affected by the C. pneu­ moniae cell cycle. The protein expression of CPj0783 was detected during the period of 24 h to 66 h post-infection and its peak expression occurred in 48 h post-infection. Then it rapidly decreased. Immunostaining of C. pneumoniaeinfected cells showed the presence of CPj0783 on chlamydial inclusions. These data suggest that CPj0783 might be generated in RBs, but not EBs, and would be necessary for growth in the inclusion body. To investigate the function of CPj0783, we performed yeast two-hybrid screening and identified the CPj0783interacting protein. Using amino acids 25–262 of CPj0783 as bait, we found positive clones containing amino acids 8–182

YANATORI ET AL.

of HIP14. To confirm the interaction between CPj0783 and HIP14 in yeast cells, we exchanged the DNAs in the bait and prey used in the initial screening and found a positive interaction between the two. In addition, we used the total HIP14 cytoplasmic region (amino acids 1–303) as prey and still obtained a positive interaction with CPj0783 in yeast cells. By using an in vivo co-immunoprecipitation assay, we investigated the interaction between CPj0783 and HIP14. It was reported that HIP14 localized to the Golgi apparatus and cytoplasmic vesicles [6,7]. We made four types of HIP14 constructs; N-terminal GFP- or mCherry-tagged HIP14 and C-terminal GFP- or mCherry-tagged HIP14. We found that all four types of HIP14 recombinants localized to the Golgi apparatus without any influence from the tagging molecules (data not shown). Then, subcellular localizations of Cpj0783 and HIP14 were examined by immunostaining, both of which were confirmed to be present in the Golgi apparatus. It was also demonstrated that HIP14 could be co-immunoprecipitated with CPj0783 in vivo (Fig. 5A) and the interaction between CPj0783 and HIP14 was also found by an in vitro GST-pull down assay (Fig. 5C). These results demonstrably indicate that CPj0783 interacted with HIP14. Recently, it has been reported that the palmitoylation and distribution of HTT are regulated by the palmitoyl transferase of HIP14 [1,12,18]. There are multiple key functional domains identified: the ankyrin repeat domain in its N-terminal half (amino acids 1–303) and the DHHC-palmitoyl acyl transferase domain and six transmembrane regions in its C-terminal half (amino acids 304–632) [15]. According to the results obtained from the yeast two-hybrid screening and the in vivo and in vitro binding assays, CPj0783 can interact with a part of the HIP14 ankyrin repeat. In this study, we focused on one of the C. pneumoniae proteins, CPj0783, which caused an intracellular trafficking abnormality in yeast cells. CPj0783 was detected by immunoglobulins derived from C. pneumoniae-infected patients and was certainly recognized by human immune cells. After the infection, CPj0783 might be generated in RBs and then transported in host cells to the Golgi apparatus where CPj0783 interacted with HIP14. The immunostaining assay could not reveal the existence of CPj0783 in the Golgi apparatus in C. pneumoniae-infected cells but did find CPj0783 on the inclusion bodies. As shown in the case of CPj0186/IncA, the molecule on the inclusion could interact with SNAREs localized to various intracellular organelles and membranes in human cells, and it caused the CPY mis-sorting in yeast cells [14]. In the case of C. trachomatis infection, the bacteria hijack the conserved oligomeric Golgi (COG)


C. PNEUOMONIAE INTERACTION WITH PROTEIN 14

complex, which is orchestrating the vesicular trafficking in the Golgi apparatus. Interaction of COG complex with chlamydial inclusion has been observed with C. trachomatis and this interaction was maintained throughout the entire development cycle [13]. It has not been yet clarified what molecules on the inclusion could recruit COG complex. After recruitment of COG complex to the inclusion, CPj0783, expressed on the inclusion, could contact with HIP14. In the C. pneumoniae-infected patients, CPj0783 might be translocated from the inclusion into host cells and subsequently induce the immunological response in human body [21]. It can be speculated that all molecules of CPj0783 expressed in RB do not translocate into host cells and that the translocated CPj0783 cannot be detected by immunostaining. Future work will be needed to further define the subcellular localization by more sensitive means of detection. Further studies on the function of CPj0783 in the C. pneumoniae infected cells are warranted, especially with regards to its function in the vesicle sorting machinery, which includes HIP14.

Acknowledgements. We thank Yumiko Noguchi for her technical assistance. This work was supported by JSPS KAKENHI Grant Number 26860223 and Research Project Grants from Kawasaki Medical School. Competing interests. None declared.

References 1. Aicart-Ramos C, Valero RA, RodrĂ­guez-Crespo I (2011) Protein palmitoylation and subcellular trafficking. Biochim Biophys Acta 1808:2981-2994 doi:10.1016/j.bbamem.2011.07.009 2. Bannantine JP, Griffiths RS, Viratyosin W, Brown WJ, Rockey DD (2000) A secondary structure motif predictive of protein localization to the chlamydial inclusion membrane. Cell Microbiol 2:35-47 doi:10.1046/ j.1462-5822.2000.00029.x 3. Clifton DR, Dooley CA, Grieshaber SS, Carabeo RA, Fields KA, Hackstadt T (2005) Tyrosine phosphorylation of chlamydial Tarp is species specific and not required for the recruitment of actin. Infect Immun 73:3860-3868 doi:10.1128/IAI.73.7.3860-3868.2005 4. de Felipe KS, Glover RT, Charpentier X, Anderson OR, Reyes M, Pericone CD, Shuman HA (2008) Legionella eukaryotic-like type IV substrates interfere with organelle trafficking. PLoS Pathog 4:e1000117 doi:10.1371/journal.ppat.1000117 5. Flores R, Luo J, Chen D, Sturgeon G, Shivshankar P, Zhong Y, Zhong G (2007) Characterization of the hypothetical protein Cpn1027, a newly identified inclusion membrane protein unique to Chlamydia pneumoniae. Microbiology 153:777-786 doi:10.1099/mic.0.2006/002956-0 6. Goytain A, Hines RM, Quamme GA (2008) Huntingtin-interacting proteins, HIP14 and HIP14L, mediate dual functions, palmitoyl acyltransferase and Mg2+ transport. J Biol Chem 283:33365-33374 doi:10.1074/jbc.M801469200 7. Huang K, Yanai A, Kang R, Arstikaitis P, Singaraja RR, Metzler M, Mullard A, Haigh B, Gauthier-Campbell C, Gutekunst CA, Hayden MR,

Int. Microbiol. Vol. 18, 2015

233

El-Husseini A (2004) Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins. Neuron 44:977-986 doi:10.1016/j.neuron.2004.11.027 8. Jewett TJ, Miller NJ, Dooley CA, Hackstadt T (2010) The conserved tarp actin binding domain is important for Chlamydial invasion. PLoS Pathog 6:e1000997 doi:10.1371/journal.ppat.1000997 9. Kuo CC, Jackson LA, Campbell LA, Grayston JT (1995) Chlamydia pneumoniae (TWAR). Clin Microbiol Rev 8:451-461 10. Moore ER, Mead DJ, Dooley CA, Sager J, Hackstadt T (2011) The trans-Golgi SNARE syntaxin 6 is recruited to the chlamydial inclusion membrane. Microbiology 157:830-838 doi:10.1099/mic.0.045856-0 11. Moulder JW (1991) Interaction of Chlamydiae and host cells in vitro. Microbiol Rev 55:143-190 12. Ohyama T, Verstreken P, Ly CV, Rosenmund T, Rajan A, Tien AC, Haueter C, Schulze KL, Bellen HJ (2007) Huntingtin-interacting protein 14, a palmitoyl transferase required for exocytosis and targeting of CSP to synaptic vesicles. J Cell Biol 179:1481-1496 doi:10.1083/jcb.200710061 13. Pokrovskaya ID, Szwedo JW, Goodwin A, Lupashina TV, Nagarajan UM, Lupashin VV (2012) Chlamydia trachomatis hijacks intra-Golgi COG complex-dependent vesicle trafficking pathway. Cell Microbiol 14:656–668 doi:10.1111/j.1462-5822.2012.01747.x 14. Saka HA, Valdivia RH (2010) Acquisition of nutrients by Chlamydiae: unique challenges of living in an intracellular compartment. Curr Opin Microbiol 13:4-10 doi:10.1016/j.mib.2009.11.002 15. Sanders SS, Hayden MR (2015) Aberrant palmitoylation in Huntington disease. Biochem Soc Trans 43:205-210 doi:10.1042/BST20140242. 16. Shirai M, Hirakawa H, Ouchi K, Tabuchi M, Kishi F, Kimoto M, Takeuchi H, Nishida J, Shibata K, Fujinaga R, Yoneda H, Matsushima H, Tanaka C, Furukawa S, Miura K, Nakazawa A, Ishii K, Shiba T, Hattori M, Kuhara S, Nakazawa T (2000) Comparison of outer membrane protein genes omp and pmp in the whole genome sequences of Chlamydia pneumoniae isolates from Japan and the United States. J Infect Dis 181 Suppl 3:S524-527 doi:10.1086/315616 17. Shohdy N, Efe JA, Emr SD, Shuman HA (2005) Pathogen effector protein screening in yeast identifies Legionella factors that interfere with membrane trafficking. Proc Natl Acad Sci USA 102:4866-4871 doi:10.1073/pnas.0501315102 18. Singaraja RR, Hadano S, Metzler M, Givan S, Wellington CL, Warby S, Yanai A, Gutekunst CA, Leavitt BR, Yi H, Fichter K, Gan L, McCutcheon K, Chopra V, Michel J, Hersch SM, Ikeda JE, Hayden MR (2002) HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis. Hum Mol Genet 11:2815-2828 doi:10.1093/hmg/11.23.2815 19. Tabuchi M, Yoshimori T, Yamaguchi K, Yoshida T, Kishi F (2000) Human NRAMP2/DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in HEp-2 cells. J Biol Chem 275:22220-22228 doi:10.1074/jbc.M001478200 20. Tabuchi M, Kawai Y, Nishie-Fujita M, Akada R, Izumi T, Yanatori I, Miyashita N, Ouchi K, Kishi F (2009) Development of a novel functional high-throughput screening system for pathogen effectors in the yeast Saccharomyces cerevisiae. Biosci Biotechnol Biochem 73:2261-2267 doi:10.1271/bbb.90360 21. Yasui Y, Yanatori I, Kawai Y, Miura K, Suminami Y, Hirota T, Tamari M, Ouchi K, Kishi F (2012) Genomic screening for Chlamydophila pneumoniae-specific antigens using serum samples from patients with primary infection. FEMS Microbiol Lett 329:168-176 doi:10.1111/ j.1574-6968.2012.02520.x


RESEARCH ARTICLE International Microbiology (2015) 18:235-244 doi:10.2436/20.1501.01.255. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

A Kluyveromyces marxianus 2-deoxyglucoseresistant mutant with enhanced activity of xylose utilization Suprayogi,1,2 Minh T. Nguyen,1,3 Noppon Lertwattanasakul,4 Nadchanok Rodrussamee,5 Savitree Limtong,4 Tomoyuki Kosaka,6 MamoruYamada1,6* 1 Applied Molecular Bioscience, Graduate School of Medicine, Yamaguchi Univ., Ube, Japan. Dept. of Agroindustrial Technology, Fac. of Agriculture Technology, Brawijaya Univ., Malang, Indonesia. 3 Dept. of Microbiology, Fac. of Environment, Vietnam National Univ. of Agriculture, Hanoi, Vietnam. 4Dept. of Microbiology, Fac. of Science, Kasetsart Univ., Bangkok, Thailand. 5Dept. of Biology, Fac. of Science, Chiang Mai Univ., Chiang Mai, Thailand. 6Dept. of Biological Chemistry, Fac. of Agriculture, Yamaguchi Univ., Yamaguchi, Japan 2

Received 15 October 2015 · Accepted 22 December 2015 Summary. Thermotolerant ethanologenic yeast Kluyveromyces marxianus is capable of fermenting various sugars including xylose but glucose represses to hamper the utilization of other sugars. To acquire glucose repression-defective strains, 33 isolates as 2-deoxyglucose (2-DOG)-resistant mutants were acquired from about 100 colonies grown on plates containing 2-DOG, which were derived from an efficient strain DMKU 3-1042. According to the characteristics of sugar consumption abilities and cell growth and ethanol accumulation along with cultivation time, they were classified into three groups. The first group (3 isolates) utilized glucose and xylose in similar patterns along with cultivation to those of the parental strain, presumably due to reduction of the uptake of 2-DOG or enhancement of its export. The second group (29 isolates) showed greatly delayed utilization of glucose, presumably by reduction of the uptake or initial catabolism of glucose. The last group, only one isolate, showed enhanced utilization ability of xylose in the presence of glucose. Further analysis revealed that the isolate had a single nucleotide mutation to cause amino acid substitution (G270S) in RAG5 encoding hexokinase and exhibited very low activity of the enzyme. The possible mechanism of defectiveness of glucose repression in the mutant is discussed in this paper. [Int Microbiol 18(4):235-244 (2015)] Keywords: Kluyveromyces marxianus · glucose repression · 2-deoxyglucose-resistant mutants · ethanol fermentation on xylose · thermotolerant yeast

Introduction Compared to Saccharomyces cerevisiae, which is used for ethanol fermentation industries, Kluyveromyces marxianus has advantageous potentials in application for ethanol production. First, K. marxianus is thermotolerant and is able Corresponding author: M. Yamada Applied Molecular Bioscience Graduate School of Medicine Yamaguchi University Ube, 753-8515 Japan Tel. +81-839335869. Fax +81-839335869 *

E-mail: m-yamada@yamaguchi-u.ac.jp

to efficiently produce ethanol at around 40°C [9,10,18]. It is thus applicable for high-temperature fermentation as an economical fermentation, enabling reduction in cooling cost, efficient simultaneous saccharification and fermentation, reduction in contamination, and stable fermentation even in tropical countries [2,3,18]. Second, the yeast can assimilate various sugars, including xylose, arabinose, sucrose, raffinose and inulin, in addition to several hexoses [16,28]. This broad spectrum in sugar assimilation capability is beneficial for the conversion to ethanol of biomass including various sugars. Third, the yeast has relatively weak glucose repression of the utilization of sucrose [16] and thus is highly preferable to biomass such as sugar cane juice, which contains glucose,


236

Int. Microbiol. Vol. 18, 2015

fructose and sucrose as main sugars. Despite such beneficial properties, some crucial problems in the use of K. marxianus remain to be solved. One problem is glucose repression of the utilization of other sugars including xylose [28], which is a principal constituent in hemicellulose for second-generation biofuels [21]. 2-Deoxyglucose (2-DOG) is a convenient reagent for screening of mutants defective in glucose repression [22,33]. It is a stable glucose analogue that is taken up into cells by hexose transporters and phosphorylated but cannot be fully metabolized. Accumulation of 2-deoxyglucose-6-phosphate in cells interferes with carbohydrate metabolism by inhibiting the activities of glycolytic enzymes including phosphoglucose isomerase and hexokinase [7,32,38]. In general, it is assumed that the biological effects of 2-DOG are the consequence of a block in carbohydrate catalysis, implying that 2-DOG-treated cells are unable to metabolize glucose and stop growing as a result of a lack of energy and metabolic intermediates [26]. In order to acquire glucose repression-defective strains, isolation and characterization of 2-DOG-resistant mutants from K. marxianus DMKU 3-1042 as one of the most ther­ mo­ tolerant strains, which was isolated via an enrichment culture method with samples collected in Thailand [18], were performed. The isolated 2-DOG-resistant mutants were characterized and classified by several experiments and eventually one mutant was found to have a significantly enhanced activity of xylose utilization. This mutant may be a preferable candidate for ethanol fermentation from biomass containing mixed sugars including glucose. This study thus provided not only a mutant with enhanced activity of xylose utilization in K. marxianus but also its metabolic characteristics of conversion of xylose to ethanol under the condition of coexistence of glucose.

Materials and methods Strains and media. The thermotolerant Kluyveromyces marxianus DMKU 3-1042 strain isolated in Thailand [18] as a strain that was isolated by an enrichment culture and its derivatives obtained in this study. Pre-culture was carried out in YPGal medium (10 g/l yeast extract, 20 g/l peptone and 20 g/l galactose) for preparation of the inoculum. To examine sugar utilization ability and cell growth, YP medium (10 g/l yeast extract and 20 g/l peptone) supplemented with 20 g/l of glucose (Glc), galactose (Gal) or xylose (Xyl), designated as YPD, YPGal or YPXyl, respectively, was used. YP medium supplemented with 20 g/l Glc and 20 g/l of one of the other sugars was used to examine the effect of glucose on utilization ability of other sugars. YP medium was used for general experiments. Cultivation conditions and spotting test. Cells were precultured in 5 ml of YPGal medium at 30°C under a shaking condition at

SUPRAYOGI ET AL.

160 rpm overnight. The pre-culture was inoculated into a 300-ml Erlenmeyer flask containing 100 ml fresh medium at an initial optical density at 660 nm (OD660) value of 0.1, and cultivation was performed at 30°C under a shaking condition at 160 rpm for an appropriate time. In experiments for spotting tests, pre-cultured cells were washed with deionized water, suspended in deionized water at l × 107 cells/ml, 10-fold sequentially diluted, and then spotted onto agar plates of YPD, YPGal and YPXyl with or without 0.1% 2-DOG. The plates were incubated at 30°C for 48 h. Screening and phenotype characterization of 2-DOGresistant mutants. To screen 2-DOG-tolerant mutants, cells of K. mar­ xianus DMKU 3-1042 were grown in 5 ml YPD at 30°C overnight under a shaking condition at 160 rpm, collected by low-speed centrifugation, suspended in 1 ml sterilized water, spread on Yeast Nitrogen Base plates containing 2% Xyl and 0.1% 2-DOG (YNB + 2% Xyl + 0.1% 2-DOG), and incubated at 30°C for 3 days. Colonies on the plates were re-streaked on YPD, YNB + 2% Xyl + 0.1% 2-DOG, YNB + 2% Gal + 0.1% 2-DOG and YNB + 2% Ara + 0.1% 2-DOG and incubated at 30°C for 3 days. The colonies that were able to grow well on the four different plates were selected as 2-DOGresistant mutants. Growth of all mutants was further examined on YP plates containing different types of sugars; Glc, Gal, Xyl, Gal + 0.1% 2-DOG and Xyl + 0.1% 2-DOG, and on YNB plates containing different concentrations of Glc (0.02, 0.2 and 2%) and the presence of antimycin A. YNB medium was used only for examinations on the first screening of 2-DOG-resistant mutants and effects of glucose concentration on cell growth and antimycin A. Analytical methods. Cell density was measured turbidimetrically at 660 nm using a spectrophotometer (U-2000A, Hitachi Japan). Cultures were sampled and subjected to low-speed centrifugation. The supernatant was frozen and kept at –20ºC until the end of fermentation (96 h) and then analyzed together by using HPLC. Quantitative analysis of sugars, ethanol, glycerol and xylitol was performed by high-performance liquid chromatography (Hitachi Model D-2000 Elite HPLC System Manager) as described previously [28]. A GL-C610-S gel pack column (Hitachi) was used together with a refractive index detector (Model L-2490) at 60°C with 0.3 ml/ min eluent of deionized water. Determination of oxidized NAD+ and reduced NADH concentrations. Cells were pre-cultured in 5 ml of YPGal medium at 30°C under a shaking condition at 160 rpm overnight. The pre-culture was inoculated into a 300-ml Erlenmeyer flask containing a 100-ml fresh YP medium containing 2% Xyl and 2% Glc, at an initial OD660 value of 0.1, and cultivation was performed at 30°C under a shaking condition at 160 rpm for an appropriate time. A sample of the culture (106 cells/ml) was subjected to centrifugation at 4°C. The cell pellet was washed with a cold phosphate-buffered saline. Intracellular NAD+ and NADH concentrations were determined by using EnzyChrom NAD+/NADH Assay Kit (E2ND-100) (BioAssay Systems, USA) according to the instruction manual of the supplier and the reaction mixture was measured in a Powerscan HT microplate reader (DS Pharma Biomedical, Osaka, Japan). Preparation of cell extracts. 2-DOG-resistant no. 23 mutant and the parental strains were pre-cultured in 5 ml YPGal at 30°C overnight under a shaking condition at 160 rpm. The pre-culture was inoculated into a 300-ml Erlenmeyer flask containing a 100-ml fresh YP medium containing 2% Xyl and 2% Glc at an initial OD660 value of 0.1, and cultivation was performed at 30°C under a shaking condition at 160 rpm. Cells in the exponential growth phase were collected by centrifugation (Himac CR20 Hitachi) at 5000 rpm and 4°C for 10 min and washed twice with 10 mM potassium phosphate buffer (pH 7.0). The washed cells were re-suspended in the same buffer. The cells suspension was passed through a French press (Aminico, USA) at 1000 psi twice and centrifuged at 4°C for 10 min at 9000 rpm to remove cells


XYLOSE UTILIZATION IN K. marxianus

debris. The supernatant was further centrifuged at 4°C for 1 h at 44,000 rpm by using a micro-ultracentrifuge (Himac CS 100GXL Hitachi) to remove membrane fractions. The resultant supernatant was used as cell extracts for enzyme assays. Enzyme assays. Hexokinase activity was measured spectropho­ tometrically by coupling the reaction to G6-P dehydrogenase [6]. The assay was performed in a reaction mixture containing 0.24 M triethanolamine (pH 7.5), 5.3 mM ATP, 4 mM D-fructose, 0.72 mM NADP+, 5 mM MgCl2, and 2  U/ml G6-P dehydrogenase from Leuconostoc sp. (Oriental yeast, Japan) by using a spectrophotometer (U-2000A Hitachi, Japan). Glucokinase activity was determined by the same assay except that 4 mM D-glucose was used as a substrate instead of D-fructose. Protein content was determined by the Lowry method [20]. Nucleotide sequencing and alignment. From cells of 2-DOG resistant no. 23 mutant and parental strains that had been grown in YPD medium, genomic DNA was prepared as described [29]. PCR amplification was performed using primeSTAR DNA polymerase (Takara BIO, Japan) with PCR primers listed in Table 1. The amplification condition was as follows: one cycle of 10 s denaturation at 98°C, 30 cycles of 10 s denaturation at 98°C, 5 s annealing at 60°C and 2.5 min extension at 72°C and 1 cycle of 5 min extension at 72°C. DNA fragments were purified using a QIAquick PCR purification kit (QIAGEN) and subjected to nucleotide sequencing [30] by using ABI Prism 310 (Perkin Elmer, USA). DNA sequences determined were subjected to BLAST analysis [1]. Alignment of amino acid sequences was performed using a clustalW [36].

Results Screening and phenotype characterization of 2-DOG-resistant mutants. About 100 colonies that appeared on YNB plates containing 2% Xyl and 0.1% 2-DOG at the first screening were subjected to re-streaking on the same plates, and 33 independent isolates were obtained. To confirm 2-DOG resistance of the isolates, spotting tests were carried out on YPGal and YPXyl plates supplemented with 2-DOG by using YPD or YPGal and YPXyl without 2-DOG plates as controls (Fig. 1). All 33 isolates exhibited sufficient growth at 100, 10–1, 10–2, 10–3 and 10–4 fold dilutions on both YPGal and YPXyl plates supplemented with 2-DOG, suggesting that they are resistant to 2-DOG, but the parental strain hardly grew in the presence of 2-DOG. Consequently, the 33 isolates were further analyzed as 2-DOG-resistant mutants. It was found that the 33 mutants formed colonies of different sizes on YPD plates (Fig. 1). Mutants of no. 1, 5, 9 and 23 as well as the parental strain formed larger colonies than did other mutants on YPD plates at 10–3 and 10–4 fold dilutions. On the other hand, all mutants exhibited colonies of almost the same sizes on YPGal and YPXyl plates. To further analyze the Glc utilization ability of the 33 mutants, their growth on YNB plates containing different

Int. Microbiol. Vol. 18, 2015

237

Table 1. Primers used in this study Name

Sequence 5′ → 3′

RAG5-I5′ a

5′CTGTTGCCAGTTGCCAGTTGC3′

RAG5-I3′

5′GGCTGGTGGCTTCTTTGGACC3′

RAG5-II5′

5′CAAGGAACAACTAGTTAAGC3′

RAG5-II3′

5′ATCTTGTTTTGGGAGGCTGGG3′

RAG5-III5′

5′AGTTGTTCTGGTCAAGTTGGG3′

RAG5-III3′

5′AACCGGAAGTCATCTTTTCG3′

RAG5-IV5′

5′CAAGATGGGTATCATCATTGG3′

RAG5-IV3′

5′TCCTTCAAAGCTTGAGCAGCC3′

RAG5-V5′

5′CCATACGTCATGGACACCACC3′

RAG5-V3′

5′TGAGCGATCGTGAATGAATGTC3′

a

Primers were designed according to the RAG5 nucleotide sequence [17].

concentrations of Glc was compared (Fig. 2A–C). Mutants of no. 1, 5, 9 and 23 as well as the parental strain sufficiently grew on 0.2% Glc, but other mutants hardly grew at that low concentration of Glc. All 33 mutants, however, grew well on 2% Glc. These findings suggested that the 33 mutants except for no. 1, 5, 9 and 23 are defective in Glc uptake or in its initial catabolism. To examine the effect of the respiratory inhibitor antimycin A on cell growth of 2-DOG-resistant mutants, growth of the mutants was examined on YNB plates containing 5 μM antimycin A at 30°C (Fig. 2D). Mutants of no. 5 and 9 grew well like the parental strain in the presence of antimycin A, and mutants of no. 1 and 23 showed weaker growth than that of the parental strain. In contrast, other mutants did not grow in the presence of antimycin A. These results and the growth phenotype on 0.2% Glc (Fig. 2B) suggest that mutants no. 1, 5, 9 and 23 can support growth on glucose on a fermentative basis, which means that respiration is not induced at this low concentration of glucose, and the uptake of 2 g/l glucose into the cells maintains a high enough Glc-6-phosphate concentration inside the cells as to signal a cell growth by fermentation activity. Whereas, the defective growth of other mutants in the presence of the respiratory inhibitor may be due to insufficient metabolic activity of Glc for growth under a fermentation condition. Cell growth and sugar consumption of 2-DOGresistant mutants in YP medium containing mixed sugars of Glc and Xyl. To determine whether the 2-DOG-resistant mutants had acquired the phenotype of glucose repression-defective mutants, their Xyl utilization was examined in the presence of Glc. The growth of mutants was examined in YP medium containing both Glc and Xyl,


Int. Microbiol. Vol. 18, 2015

SUPRAYOGI ET AL.

Int Microbiol

238

of both sugars, cell growth and ethanol accumulation along with cultivation time, the 33 mutants were classified into three groups and representative mutants are shown in Fig. 3.

Int Microbiol

and several factors including concentrations of Glc, Xyl and ethanol in the medium as well as turbidity of the medium were determined. According to the patterns of consumption

Fig. 1. Spotting test of 2-DOG-resistant isolates. Cells were grown in 2% YPGal medium at 30°C overnight and subjected to a spotting test as described in Materials and methods. After spotting (left to right, 100, 10–1, 10–2, 10–3 and 10–4 fold dilutions) on 2% YPD, 2% YPGal, 2% YPXyl, 2% YPGal containing 0.1% 2-DOG, and 2% YPXyl containing 0.1% 2-DOG, plates were incubated at 30°C for 48 h.

Fig. 2. Growth of 2-DOG-resistant mutants at different concentrations of Glc and effect of antimycin A. Cells were grown in 2% YPGal medium at 30°C overnight and streaked on YNB plates containing different concentrations of Glc. The plates were then incubated at 30°C for 48 h. (A) 0.02% Glc; (B) 0.2% Glc; (C) 2% Glc; (D) 2% Glc + 5 μM antimycin A.


Int. Microbiol. Vol. 18, 2015

239

Int Microbiol

XYLOSE UTILIZATION IN K. marxianus

Fig. 3. Growth and sugar consumption of 2-DOG-resistant mutants in YP medium containing Glc and Xyl. Cells were grown in 2% YPGal medium at 30°C overnight, transferred to a fresh YP medium containing 2% Xyl and 2% Glc, and cultivated at 30°C under a shaking condition at 160 rpm for 96 h. No. 3 mutant (open diamonds), no. 5 mutant (open triangles), no. 23 mutant (closed circles) and their parental strain (open squares) were compared by measuring OD660 (A) and concentrations of Glc (B), Xyl (C), xylitol (D), glycerol (E), and ethanol (F) in the medium. Data presented were averages of triplicate experiments and error bars indicate the standard deviations.

One group consisting of no. 1, 5 and 9 mutants (no. 5 as a representative) showed similar patterns of the four parameters of turbidity (OD660), Glc, Xyl and ethanol to those of the parental strain (Fig. 3A–C and F). This type of mutant started to utilize Xyl after depletion of Glc in the medium. Even after depletion of Glc, their turbidity increased (Fig. 3A–C), but ethanol level was slightly reduced during cultivation. The second group consisting of other mutants except for no. 23 (no. 3 as a representative) showed extremely slow Glc and Xyl

consumption rates, and ethanol accumulation in the medium was observed after 24 h (Fig. 3B,C and F). This type of mutant could utilize Glc and Xyl slowly and simultaneously. No. 23 mutant as the third group showed enhancement of Xyl utilization and delay of Glc utilization compared to those of the parental strain (Fig. 3B,C). Notably, both sugars were utilized together after 15 h, indicating suppression of glucose repression. A phenotype similar to that of no. 23 has been reported in an S. cerevisiae 2-DOG-resistant mutant that is


Int. Microbiol. Vol. 18, 2015

SUPRAYOGI ET AL.

Int Microbiol

240

Fig. 4. Relative NAD+/NADH values in 2-DOG-resistant no. 23 mutant in YP medium containing Glc and Xyl. Cells were grown in 2% YPGal medium at 30°C overnight, transferred to a fresh YP medium containing 2% Xyl and 2% Glc, and cultivated at 30°C under a shaking condition at 160 rpm. At the times indicated, cells were harvested and concentrations of NAD+ and NADH were determined as described in Materials and methods. The relative NAD+/NADH values of no. 23 mutant (light grey columns) were compared with those of the parental strain (dark grey columns). Data presented were averages of triplicate experiments and error bars indicate the standard deviations. Statistical analysis was performed between no. 23 mutant and the parental strain: +, P < 0.05; ++, P < 0.01; +++, P < 0.001.

able to assimilate both sugars of Glc and Xyl together [14]. Concentrations of ethanol, glycerol and xylitol in the medium increased after 24 h, and the ethanol level was more than that of the parental strain after 48 h (Fig. 3D–F). The ethanol yield of no. 23 mutant was 0.50 g EtOH/g sugars at 24 h, 0.39 g EtOH/g sugars at 48 h, 0.37 g EtOH/g sugars at 72 h and 0.33 g EtOH/g sugars at 96 h. This mutant showed significantly higher ethanol production than that of the parental strain at 48 h (P < 0.05), 72 h (P < 0.01) and 96 h (P < 0.05) (Fig. 3F). NAD+ and NADH concentrations in no. 23 mutant in YP medium containing mixed sugars of Glc and Xyl. Since no. 23 mutant showed a delay of Glc consumption and almost parallel utilization of Xyl with Glc in contrast to the parental strain, it was guessed to be due to the limitation of NAD+ for Glc utilization in the mutant. To obtain the clue of the glucose repression-defective phenotype on the mutant, intracellular NAD+ and NADH concentrations were measured and the relative NAD+/NADH values between no.

23 mutant and the parental strain were compared (Fig. 4). The experiments were performed under the same condition used in Fig. 3. The ratio of NAD+ to NADH concentrations in the mutant was lower than that of the parental strain at all times tested, whereas the relative amount of NAD+ was gradually reduced after about 6 h. The ratio of NAD+ to NADH in the mutant was 1.6, 1.4 and 1.2 at 6 h, 12 h and 24 h, respectively, and that in the parental strain was 2.2, 1.7 and 1.4 at 6 h, 12 h and 24 h, respectively. Therefore, it may be possible that the relatively low level of NAD+ in no. 23 mutant caused its slow utilization of Glc. Weak hexokinase activity in no. 23 mutant. Two main mechanisms for resistance to 2-DOG have been reported to be either the defect of glucose phosphate kinase [19] or the induction of glucose-6-phosphate phosphatase activity [13]. We thus measured activities of hexokinase and glucokinase in no. 23 mutant since K. marxianus DMKU 3-1024 bears these two kinases. Cells were grown under the same condition

Table 2. Hexokinase and glucokinase activities of 2-DOG-resistant no. 23 mutant Substrate

Enzyme

Specific activity (Umg–1) DMKU3-1042

No. 23

P value

Fructose

Hexokinase

0.497 ± 0.027

0.031 ± 0.003

P < 0.001

Glucose

Hexokinase and glucokinase

0.711 ± 0.044

0.220 ± 0.026

P < 0.001


XYLOSE UTILIZATION IN K. marxianus

Int. Microbiol. Vol. 18, 2015

used in Fig. 3 and were harvested at the mid-log phase for the enzyme assay. As shown in Table 2, the specific activity of fructose kinase corresponding to hexokinase of no. 23 mutant was 16 times lower than that of the parental strain. Whereas, the specific activity of glucose kinase corresponding to glucokinase in the no. 23 mutant was 3 times lower than that of the parental strain. These results suggest that no. 23 mutant has a defective hexokinase enzyme but retains glucokinase activity almost equivalent to that of the parental strain. Determination of a mutation site on no. 23 mutant. Due to almost no activity of hexokinase in no. 23 mutant, the nucleotide sequence of RAG5 encoding the enzyme was determined. As a result, there was one nucleotide mutation from G to A at the 270th codon in RAG5, causing

Int Microbiol

Fig. 5. Alignment of amino acid sequences of hexokinases in Kluyveromyces marxianus, K. lactis and Saccharomyces cerevisiae. The primary sequences of hexokinases of K. marxianus KmRag5p (line 1), K. lactis KlRag5p (line 2), S. cerevisiae ScHxk2p (line 3) and S. cerevisiae ScHxk1p (line 4) were aligned. Stars represent conserved amino acid residues. A vertical arrow represents Gly-270, which was substituted to be serine in no. 23 mutant.

241

G270S substitution. Interestingly, G270 is conserved in hexokinases (Fig. 5) and is located close to the substratebinding site [5,15]. The location of the substitution site might match with the fact that there was a trace amount of hexokinase activity in the no. 23 mutant.

Discussion In this study, we attempted to isolate glucose repressiondefective strains by screening 2-DOG-resistant mutants in K. marxianus as promising yeast for economical bioethanol production from various types of biomass [28]. We compared the growth abilities of the mutants isolated at different concentrations of Glc and in the presence of antimycin A and


242

Int. Microbiol. Vol. 18, 2015

the consumption patterns of mixed sugars of Xyl and Glc, and we consequently classified them into three groups. The three groups could be clearly distinguished when compared in liquid culture with YP medium containing mixed sugars of Glc and Xyl (Fig. 3). The first group appears to be similar to the parental strain in utilization timing and patterns of Glc and Xyl and in the accumulation profile of ethanol as well as cell growth. The 2-DOG resistance of the first group might be due to blockage of the import of 2-DOG into cells or enhanced export of the chemical agent. They seem to normally import and ferment Glc as indicated by growth in the presence of antimycin A, and they utilize Xyl after depletion of Glc, indicating retainment of the glucose repression of Xyl utilization like the parental strain. The second group might be defective in hexose transporters or initial catabolism of Glc because the group exhibited remarkable retardation of Glc and Xyl utilization compared to that of the parental strain. The retardation of Xyl utilization suggests that hexose transporters are responsible for the Xyl import in K. marxianus as reported previously [11]. This group appears to utilize Glc and Xyl together presumably because the intracellular concentration of Glc is too low to evoke glucose repression. One mutant numbered 23 as the third group exhibited a glucose repression-defective phenotype (Fig. 3). This 2-DOG mutant may have acquired the ability of Xyl uptake in the presence of Glc in the medium, though Glc consumption was retarded compared to that of the parental strain. Notably, the utilization of Xyl was much faster than that of the parental strain, and larger amounts of glycerol and xylitol than those in the case of the parental strain were accumulated in the medium. The mutant showed a relatively low ratio of NAD+ to NADH concentrations compared to that of the parental strain (Fig. 4). The low ratio may be responsible for the utilization of Xyl because its process contains the conversion reaction of NAD+ to NADH by xylitol dehydrogenase [26], and the limitation of NAD+ may slow down the glycolysis process, which in turn leads the delay of Glc utilization. Such an effect of NAD+ limitation on the Glc utilization has been reported in S. cerevisiae [37]. Alternatively, the delayed Glc assimilation could be the consequence of low hexokinase activity. Further analysis revealed that no. 23 mutant exhibited almost no hexokinase activity and had a single nucleotide mutation to cause amino acid substitution (G270S) in KmRAG5 encoding hexokinase. KmRag5p in K. marxianus shares 89.9% and 72.6% identities with KlRag5p in K. lactis [25] and with ScHxk2p in S. cerevisiae [34], respectively.

SUPRAYOGI ET AL.

Amino acid alignment revealed that G270 of KmRag5p corresponds to G271 of ScHxk2p and is located in one of conserved regions (Fig. 5), and the amino acid substitution of G271C promotes residue-residue interactions to cause slight changes of backbone conformation [5,15]. Interestingly, Gly271 in ScHxk2p is located close to the glucose-binding site. Therefore, it is assumed that the G270S substitution caused reduction of hexokinase activity in no. 23 mutant. Considering the function of hexokinase as a transcriptional regulator for the glucose repression in S. cerevisiae [23,24,31], it may be likely that the amino acid substitution of G270S in hexokinase leads to a glucose repression-defective of no. 23 mutant to permit uptake of Xyl together with Glc. On the other hand, the 2-DOG resistant phenotype of the mutant may be due to reduction in hexokinase-catalyzed formation of 2-DOG-6-phosphate, which hampers glycolysis as an inhibitor of glucose phosphate isomerase [13]. The findings in the experiments using mixed sugars of Glc and Xyl in no. 23 mutant (Fig. 3) can be explained as follows. Due to the defect of glucose repression, Xyl was imported at the same time with Glc, and thus NAD+ would quickly become insufficient for Glc catabolism by its conversion to NADH at the xylitol oxidation step [27], which in turn slows down the glycolysis process, consequently suppressing Glc uptake. The defect of hexokinase may also be responsible for the delay of Glc utilization to some extent. After around 15 h, the glycerol production pathway might be induced to supply NAD+, which promotes glycolysis to import and catabolize Glc and to further provide NAD+ by the ethanol production pathway. The amount of NAD+ provided might be sufficient to assimilate both Glc and Xyl together. This assumption should be experimentally proved. Unlike gene-engineered S. cerevisiae mutants in which foreign genes are introduced [4,8,12,35], K. marxianus strains improved by mutation breeding can be utilized unlimitedly as non-recombinants for the ethanol industry. Therefore, further improvement of no. 23 mutant to be a faster consumer of both sugars of Glc and Xly is expected. We can conclude that K. marxianus is a highly competent yeast that can ferment various sugars including Xyl but bears glucose repression to inhibit the utilization of other sugars. This study was thus aimed at developing glucose repression-defective strains from a strongly thermotolerant K. marxianus DMKU 3-1042. Via the screening of 2-DOGresistant mutants, one isolate, no 23 mutant, was acquired, which showed enhanced utilization ability of Xyl in the presence of Glc but delayed utilization of Glc, due to the RAG5 mutation that largely reduced hexokinase activity. This


XYLOSE UTILIZATION IN K. marxianus

mutant produced significantly higher ethanol than that of the parental strain after 48 h in the medium containing mixed sugars of Glc and Xyl. Acknowledgements. We thank K. Matsushita and T. Yakushi for helpful discussions. Suprayogi had the support of Directorate General of Resources for Science, Technology and Higher Education (DIKTI) scholarship, Ministry of Research, Technology and Higher Education of Indonesia and Brawijaya University, Indonesia. This work was supported by the Special Coordination Funds for Promoting Science & Technology, Ministry of Education, Culture, Sports, Science & Technology, and the Advanced Low Carbon Technology Research and Development Program, Japan Science and Technology Agency. The work was partially performed as collaborative research in the Asian Core Program and in the Core to Core Program, which was supported by the Scientific Cooperation Program agreed by the Japan Society for the Promotion of Science (JSPS), the National Research Council of Thailand and universities involved in the program.

Competing interests: None declared.

References 1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403-410 2. Anderson PJ, McNeil K, Watson K (1986) High-efficiency carbohydrate fermentation to ethanol at temperatures above 40°C by Kluyveromyces marxianus var. marxianus isolated from sugar mills. Appl Environ Microbiol 51:1314-1320 3. Banat IM, Nigam P, Singh D, Marchant R, McHale AP (1998) Review: Ethanol production at elevated temperatures and alcohol concentrations: part I - yeasts in general. World J Microbiol Biotechnol 14:809-821 4. Bera AK, Ho NW, Khan A, Sedlak M (2011) A genetic overhaul of Saccharomyces cerevisiae 424A(LNH-ST) to improve xylose fermentation. J Ind Microbiol Biotechnol 38:617-626 doi:10.1007/ s10295-010-0806-6 5. Bergdahl B, Sandström AG, Borgström C, Boonyawan T, van Niel EW, Gorwa-Grauslund MF (2013) Engineering yeast hexokinase 2 for improved tolerance toward xylose-induced inactivation. PLoS One 8:e75055 doi:10.1371/journal.pone.0075055 6. Cáceres AJ, Portillo R, Acosta H, Rosales D, Quiñones W, Avilan L, Salazar L, Dubourdieu M, Michels PA, Concepción JL (2003) Molecular and biochemical characterization of hexokinase from Trypanosoma cruzi. Mol Biochem Parasitol 126:251-262 doi:10.1016/S01666851(02)00294-3 7. Chen W, Guéron M (1992) The inhibition of bovine heart hexokinase by 2-deoxy-D-glucose-6-phosphate: characterization by 31P NMR and metabolic implications. Biochimie 74:867-873 8. Demeke MM, Dietz H, Li Y, Foulquié-Moreno MR, Mutturi S, Deprez S, Den Abt T, Bonini BM, Liden G, Dumortier F, Verplaetse A, Boles E, Thevelein JM (2013) Development of a D-xylose fermenting and inhibitor tolerant industrial Saccharomyces cerevisiae strain with high performance in lignocellulose hydrolysates using metabolic and evolutionary engineering. Biotechnol Biofuels 6:89 doi:10.1186/17546834-6-89 9. Fonseca GG, Heinzle E, Wittmann C, Gombert AK (2008) The yeast Kluyveromyces marxianus and its biotechnological potential. Appl Microbiol Biotechnol 79:339-354 doi:10.1007/s00253-008-1458-6

Int. Microbiol. Vol. 18, 2015

243

10. Goshima T, Tsuji M, Inoue H, Yano S, Hoshino T, Matsushika A (2013) Bioethanol production from lignocellulosic biomass by a novel Kluyveromyces marxianus strain. Biosci Biotechnol Biochem 77:15051510 doi:10.1271/bbb.130173 11. Hamacher T, Becker J, Gárdonyi M, Hanh-Hägerdal B, Boles E (2002) Characterization of the xylose-transporting properties of yeast hexose transporters and their influence on xylose utilization. Microbiology 148:2783-2788 doi:10.1099/00221287-148-9-2783 12. Hector RE, Dien BS, Cotta MA, Qureshi N (2011) Engineering industrial Saccharomyces cerevisiae strains for xylose fermentation and comparison for switchgrass conversion. J Ind Microbiol Biotechnol 38:1193-1202 doi:10.1007/s10295-010-0896-1 13. Heredia MF, Heredia CF (1988) Saccharomyces cerevisiae acquires resistance to 2-deoxyglucose at a very high frequency. J Bacteriol 170:2870-2872 14. Kahar P, Taku K, Tanaka S (2011) Enhancement of xylose uptake in 2-deoxyglucose tolerant mutant of Saccharomyces cerevisiae. J Biosci Bioeng 111:557-563 doi:10.1016/j.jbiosc.2010.12.020 15. Kuser PR, Krauchenco S, Antunes OA, Polikarpov I (2000) The high resolution crystal structure of yeast hexokinase PII with the correct primary sequence provides new insights into its mechanism of action. J Biol Chem 275:20814-20821 doi:10.1074/jbc.M910412199 16. Lertwattanasakul N, Rodrussamee N, Suprayogi, Limtong S, Thanonkeo P, Kosaka T, Yamada M (2011) Utilization capability of sucrose, raffinose and inulin and its less-sensitiveness to glucose repression in thermotolerant yeast Kluyveromyces marxianus DMKU 3-1042. AMB Express 1:20 doi:10.1186/2191-0855-1-20 17. Lertwattanasakul N, Kosaka T, Hosoyama A, Suzuki Y, Rodrussamee N, Matsutani M, Murata M, Fujimoto N, Suprayogi, Tsuchikane K, Limtong S, Fujita N, Yamada M (2015) Genetic basis of the highly efficient yeast Kluyveromyces marxianus: complete genome sequence and transcriptome analyses. Biotechnol Biofuels 8:47 doi 10.1186/ s13068-01500227-x 18. Limtong S, Sringiew C, Yongmanitchai W (2007) Production of fuel ethanol at high temperature from sugar cane juice by a newly isolated Kluyveromyces marxianus. Bioresour Technol 98:3367-3374 doi:10.1016/j.biortech.2006.10.044 19. Lobo Z, Maitra PK (1977) Resistance to 2-deoxyglucose in yeast: a direct selection of mutants lacking glucose-phosphorylating enzymes. Mol Gen Gent 157:297-300 20. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-275 21. Lu S, Li L, Zhou G (2010) Genetic modification of wood quality for second-generation biofuel production. GM Crops 1:230-236 doi:10.4161/ gmcr.1.4.13486 22. Martin M, Heredia CF (1977) Characterization of a phophatase specific for 2-deoxyglucose-6-phosphate in a yeast mutant. FEBS Lett 83:245-248 23. Niederacher D, Entian KD (1991) Characterization of Hex2 protein, a negative regulatory element necessary for glucose repression in yeast. Eur J Biochem 200:311-319 24. Peláez R, Herrero P, Moreno F (2010) Functional domains of yeast hexokinase 2. Biochem J 432:181-190 doi:10.1042/BJ20100663 25. Prior C, Mamessier P, Fukuhara H, Chen XJ, Wesolowski-Louvel M (1993) The hexokinase gene is required for transcriptional regulation of the glucose transporter gene RAG1 in Kluyveromyces lactis. Mol Cell Biol 13:3882-3889 26. Ralser M, Wamelink MM, Struys EA, Joppich C, Krobitsch S, Jakobs C, Lehrach H (2008) A catabolic block does not sufficiently explain how 2-deoxy-D-glucose inhibits cell growth. Proc Natl Acad Sci USA 105:17807-17811 doi:10.1073/pnas.0803090105


244

Int. Microbiol. Vol. 18, 2015

27. Richard P, Toivari MH, Penttilä M (1999) Evidence that the gene YLR070c of Saccharomyces cerevisiae encodes a xylitol dehydrogenase. FEBS Lett 457:135-138 doi:10.1016/S0014-5793(99)01016-9 28. Rodrussamee N, Lertwattanasakul N, Hirata K, Suprayogi, Limtong S, Kosaka T, Yamada M (2011) Growth and ethanol fermentation ability on hexose and pentose sugars and glucose effect under various conditions in thermotolerant yeast Kluyveromyces marxianus. Appl Microbiol Biotechnol 90:1573-1586 doi:10.1007/s00253-011-3218-2 29. Sambrook J, Russell DW (2001) Molecular cloning, a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 30. Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 31. Schuurmans JM, Boorsma A, Lascaris R, Hellingwerf KJ, Teixeira de Mattos MJ (2008) Physiological and transcriptional characterization of Saccharomyces cerevisiae strains with modified expression of catabolic regulators. FEMS Yeast Res 8:26-34 doi:10.1111/j.15671364.2007.00309.x 32. Sols A, Crane RK (1954) Substrate speciďŹ city of brain hexokinase. J Biol Chem 210:581-595 33. Sreenath HK, Jeffries TW (1999) 2-Deoxyglucose as a selective agent for derepressed mutants of Pichia stipitis. Appl Biochem Biotechnol 77:211-222 doi:10.1385/ABAB:77:1-3:211

SUPRAYOGI ET AL.

34. Steizt TA (1971) Structure of yeast hexokinase-B. I. Preliminary x-ray studies and subunit structure. J Mol Bio 61:695-700 35. Tanino T, Hotta A, Ito T, Ishii J, Yamada R, Hasunuma T, Ogino C, Ohmura N, Ohshima T, Kondo A (2010) Construction of a xylosemetabolizing yeast by genome integration of xylose isomerase gene and investigation of the effect of xylitol on fermentation. Appl Microbiol Biotechnol 88:1215-1221 doi:10.1007/s00253-010-2870-2 36. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673-4680 37. Vemuri GN, Eiteman MA, McEwen JE, Olsson L, Nielsen L, Nielsen J (2007) Increasing NADH oxidation reduces overflow metabolism in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 104:2402-2407 doi:10.1073/pnas.0607469104 38. Wick AN, Drury DR, Nakada HI, Wolfe JB (1957) Localization of the primary metabolic block produced by 2-deoxyglucose. J Biol Chem 224:963-969


PERSPECTIVES International Microbiology (2015) 18:245-251 doi:10.2436/20.1501.01.256. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Interaction and cooperative effort among scientific societies. Twelve years of COSCE Nazario Martín,1* Carlos Andradas2 Department of Organic Chemistry, Faculty of Chemistry, Complutense University of Madrid, Madrid, Spain. President of COSCE (2015-). 2 Department of Algebra. Faculty of Mathematics. Complutense University of Madrid, Madrid, Spain. Past-President of COSCE (2012-2015)

1

Received 16 October 2015 · Accepted 2 November 2015 Summary. The evolution of knowledge and technology in recent decades has brought profound changes in science policy, not only in the countries but also in the supranational organizations. It has been necessary, therefore, to adapt the scientific institutions to new models in order to achieve a greater and better communication between them and the political counterparts responsible for defining the general framework of relations between science and society. The Federationon of Scientific Societies of Spain (COSCE, Confederación de Sociedades Científicas de España) was founded in October 2003 to respond to the urgent need to interact with the political institutions and foster a better orientation in the process of making decisions about the science policy. Currently COSCE consists of over 70 Spanish scientific societies and more than 40,000 scientists. During its twelve years of active life, COSCE has developed an intense work of awareness of the real situation of science in Spain by launching several initiatives (some of which have joined other organizations) or by joining initiatives proposed from other groups related to science both at the Spanish level and at the European and non-European scenarios. [Int Microbiol 18(4): 245-251 (2015)] Keywords: COSCE (Federation of Scientific Societies of Spain)

Introduction The profound transformation undergone by Spanish society as a result of its incorporation into new structures and inter­ national organizations, has led to a new conception of the relationship between science and society in Spain. And the same has happened for the constant and, sometimes quick, advancing technology.

Corresponding author: Nazario Martín Department of Organic Chemistry Faculty of Chemistry Complutense University of Madrid, Madrid, Spain. *

E-mail: nazmar@ucm.es

In that new scientific-political-social environment, the scien­tific community, grouped in different scientific societies related to different disciplines, has understood the need to join efforts and knowledge to become a key element in making policy decisions which, inevitably, affect society as a whole. This was the conceptual origin of the Federation of Scientific Societies of Spain (COSCE, Confederación de Sociedades Científicas de España) (Fig. 1), whose founding statements clearly reflects its primary objectives [4]: • To contribute to scientific and technological development of the country. • To act as a qualified and unified interlocutor both for the civil society and the representatives of the public institutions in matters affecting science.


246

Int. Microbiol. Vol. 18, 2015

Fig. 1. The COSCE logo.

• To promote the role of science and contribute to its dissemination as a necessary and indispensable ingredient of culture. Currently, COSCE consists of over 70 societies (some of them with more than a century of history) (Table 1) [5], covering almost all fields of human knowledge, both the humanities and sciences, to which it have been added some other adhered societies or associations whose fields of activity include that of the scientific communication to the society. The huge range of areas of interest represented by the societies forming COSCE, as well as the different interests of each of them has led to define five major areas or sections, each one of which has an independent representative on the management structure of the confederation: • Section of Arts, Humanities and Social Sciences. • Section of Mathematics, Physics and Physical Tech­ nologies, and Chemistry and Chemical Technology. • Section of Life Sciences and Health. • Section of Earth Sciences, Agriculture and Environment. • Section of Science and Technology of Materials and Information and Communication.

COSCE and Spanish society The founding statutes of COSCE [4] determine the need to establish a fluid relationship between the confederation and the civil society. To meet this objective COSCE unified efforts

MARTÍN, ANDRADAS

that were previously scattered among different scientific societies with―because of their lower representation, both in science and in society and politics―poor or even no results. With this objective, COSCE, jointly with the Consejo Superior de Investigaciones Científicas (CSIC) and the Conferencia de Rectores de las Universidades Españolas (CRUE), presented the National Declaration on Scientific Integrity (Declaración Nacional sobre Integridad Científica) [6], a document subsequently revised and approved by the Ethics in Science Group of the Debates on Science and the Economic and Social Development Project (Proyecto DECIDES; DEbates sobre la CIENcia y el Desarrollo Económico y Social). The document establishes the ethical basis for a sustainable relationship both among members of the scientific community and the community as a whole, and society. These ethical bases are: honesty, objectivity, fairness and trust. The appearance of COSCE in the field of relations between the scientific community and civil society has changed the previous poor situation. The conjunction of forces and interests of the various scientific and humanistic fields has provided the confederation of a remarkable ability to influence that has been reflected in its growing role as a consultant and partner of different governments that have occurred in the country since its founding in 2003. An outstanding field of the COSCE role as a critical and controlling element of the scientific policies pursued by various governments has been the publication of different “COSCE Reports” on the General State Budget (PGE; Presupuestos Generales del Estado) (Table 2). To know the content of programs of the Expenditure Policy 46 (formerly Function 46) is important for the Spanish scientific and technological community. By initiative of COSCE, and since 2005, a group of experts is working in producing annual reports from the data published in the General State Budget (PGE) These reports offer a critical view on both the state of science in Spain and the resources to strengthen science, currently considered―due in part to its own work―as one of the main engines of progress of the country. In addition to the annual reports on the PGE, COSCE has also issued reports on other matters of relevance to the scientific community and its relationship with society as a whole, reports that have had a significant impact on the decisions taken by the political institutions in relation to science, culture and education in Spain (Table 3) and has enacted various initiatives and projects on specific aspects of science in Spain, some of which have been echoed by other Spanish scientific organizations such as the CSIC or the CRUE. Also, from its prevalent position as a reference of science in


COSCE

Int. Microbiol. Vol. 18, 2015

247

Table 1. Societies and associations in COSCE FEDERATED Asociación Española de Andrología Asociación Española de Ciencia Política y de la Administración Asociación Española de Científicos Asociación Española de Ecología Terrestre Asociación Española de Economía Asociación Española de Genética Humana Asociación Española de Leguminosas Asociación Española de Reproducción Animal Asociación Española de Teoría de la Literatura Asociación Española para la Inteligencia Artificial Asociación para el Desarrollo de la Informática Educativa Asociación para el Estudio de la Biología de la Reproducción Asociación Interacción Persona-Ordenador Asociación Nacional de Investigadores Hospitalarios Asociación de Telemática Federación Española de Sociología Real Sociedad Española de Física Real Sociedad Española de Química Real Sociedad Matemática Española Sociedad Anatómica Española Sociedad de Arquitectura y Tecnología de Computadores Sociedad de Biofísica de España Sociedad de Economía Mundial Sociedad de Espectroscopia Aplicada Sociedad de Estadística e Investigación Operativa Soc. de Ingeniería del Software y Tecnología de Desarrollo de Software Sociedad Española de Antropología Física Sociedad Española de Arcillas Sociedad Española de Astronomía Sociedad Española de Biología Celular Sociedad Española de Biología Evolutiva Sociedad Española de Biometría Sociedad Española de Bioquímica y Biología Molecular Sociedad Española de Biotecnología Sociedad Española de Cerámica y Vidrio Sociedad Española de Ciencias Fisiológicas Sociedad Española de Ciencias Forestales Sociedad Española de Cultivo In Vitro de Tejidos Vegetales

Sociedad Española de Diabetes Sociedad Española de Entomología Aplicada Sociedad Española de Epidemiología Sociedad Española de Farmacología Sociedad Española de Fertilidad Sociedad Española de Fijación de Nitrógeno Sociedad Española de Física Médica Sociedad Española de Fisiología Vegetal Sociedad Española de Fitopatología Sociedad Española de Genética Sociedad Española de Geobotánica Sociedad Española de Geomorfología Sociedad Española de Histología e Ingeniería Tisular Sociedad Española de Inmunología Sociedad Española de Investigación sobre Cannabinoides Sociedad Española de Malherbología Sociedad Española de Matemática Aplicada Sociedad Española de Materiales Sociedad Española de Medicina Tropical y Salud internacional Sociedad Española de Microbiología Sociedad Española de Mineralogía Sociedad Española de Neurociencia Sociedad Española de Neurología Sociedad Española de Óptica Sociedad Española de Paleontología Sociedad Española de Paraplejia Sociedad Española de Parasitología Sociedad Española de Proteómica Soc. Española de Psicofisiología y Neurociencia Cognitiva y Afectiva Sociedad Española de Psicología Experimental Sociedad Española de Psiquiatría Biológica Sociedad Española de Terapia Génica y Celular Sociedad Española de Virología Sociedad Española para el Procesamiento del Lenguaje Natural Sociedad Española para las Ciencias del Animal de Laboratorio Sociedad Ibérica de Citometría

ASSOCIATED Associació Catalana de Comunicació Científica Asociación para el Desarrollo y el Estudio de la Biología en La Rioja Sociedad de la Energía Foto Currently COSCE consists of over 70 societies voltaica Inorgánica y Nanomolecular

Spain [7,8], COSCE has established collaboration agreements with international organizations and projects such as the Responsible Research and Innovation (RRI) project in order to participate in the realization of a greater understanding and consideration of the importance of science to the social, political and cultural development in the international arena.

Sociedad Española de Gravitación y Relatividad Spanish Researchers in the United Kingdom

The “Commissions on Thinking and Study of Science in Spain” action (Acción CRECE; Comisiones de Reflexión y Estudio de la Ciencia en España). The analysis of the situation of science in Spain led to the conclusion that it was necessary to reform it. In response to these conclusions, COSCE initiated


248

Int. Microbiol. Vol. 18, 2015

MARTÍN, ANDRADAS

Table 2. The COSCE Reports from 2005 until present Fecha

Informe

11/2016

Nota de alcance sobre la inversión en I+D+i en los Presupuestos Generales del Estado aprobados para 2016

08/2015

Informe de urgencia sobre la inversión en I+D+i en el Proyecto de Presupuestos Generales del Estado para 2016

01/2015

Nota de alcance sobre la inversión en I+D+i en los Presupuestos Generales del Estado aprobados para 2015

10/2014

Informe de urgencia sobre la inversión en I+D en el Proyecto de Presupuestos Generales del Estado para el año 2015

03/2014

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en los Presupuestos Generales del Estado para el año 2014

01/2014

La inversión en I+D+i en los Presupuestos Generales del Estado aprobados para 2014

10/2013

Informe de urgencia sobre el Proyecto de Presupuestos de la Administración General del Estado de la política de gasto 46 (I+D+i) correspondiente al ejercicio de 2014

03/2013

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en los Presupuestos Generales del Estado para el año 2013

10/2012

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en el Proyecto de los Presupuestos Generales del Estado para el año 2013

09/2012

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en los Presupuestos Generales del Estado para el año 2012. La inversión en I+D+i

04/2012

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en el Proyecto de los Presupuestos Generales del Estado para el año 2012

02/2011

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en los Presupuestos Generales del Estado para el año 2011

02/2010

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en los Presupuestos Generales del Estado para el año 2010

12/2009

Consideraciones sobre los recursos destinados a I+D+i en el proyecto de PGE 2010 desde la perspectiva de la comunidad científica

03/2009

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en los Presupuestos Generales del Estado para el año 2009

01/2008

Análisis de los recursos destinados a I+D+i (Política de Gasto 46) contenidos en los Presupuestos Generales del Estado para el año 2008

12/2006

Análisis de los recursos destinados a la I+D+i (Función 46) contenidos en el Anteproyecto de Presupuestos Generales del Estado para el año 2007

10/2005

Análisis comparado de los PGE 2005-2006

the creation of five independent large committees of experts to carry out “Committees to Consider and Study Science in Spain” (Acción CRECE; Comisiones de Reflexión y Estudio de la Ciencia en España) (Fig. 2). The CRECE Project is participated by scientists, professionals and experts in a wide range of fields whose leadership skills and ability to act have made Acción CRECE one of the strongest initiatives ever undertaken by the scientific community [1]. Conclusions and

Fig. 2. The CRECE Action logo.

proposals from these committees affect both fundamental aspects of the system and aspects related to its economic and social repercussions, and are a clear message to other participants of the system, in particular to business sector and educators, and to society in general. To create funding instruments and to create assessment methods to appropriately allocate the resources are two conclusions that CRECE has reported to the ministries involved in the Spanish R+D system, and these can imply to introduce structural changes to the Spanish scientific system. The way is hard, but the reward is enormous: to strength science as a cultural factor and an economic driving force. The “Debates on Science and Economic and Social Development project” (DECIDES Project; Debates sobre CIENcia y Desarrollo Económico y Social). Directly related to the CRECE Action, COSCE and the La Caixa Foundation, created the DECIDES Project through which it aims to discuss the role of science in the near future and to create the necessary


COSCE

Int. Microbiol. Vol. 18, 2015

249

Table 3. Other studies by COSCE 02/2011

Informe COSCE sobre la Agencia Estatal de Investigación

02/2015

Informe sobre el Uso de Animales en Investigación Científica

03/2010

Informe sobre el Borrador de la Ley de la Ciencia, la Tecnología y la Innovación

04/2007

Informe: Acción CRECE, dos años después

11/2006

Análisis del sistema de evaluación de proyectos científicos y de incorporación de personal científico en España

elements for the development of a prosperous society based on knowledge [7]. The main objective of the project is to establish a science system from initiatives proposed by the scientific collective and become part of an ongoing debate in different forums of science, politics and society (Fig. 3). The project structure is divided into five areas, each managed by a group or working committee consisting of experts proposed by the societies comprising COSCE, coming from both the scientific community and other social areas. The role of these groups is to address issues deemed relevant to the scientific system: the public resources for science; the private resources for science; the management of science, by science; the interweaving of science and society, and ethics in science.

COSCE and the educational community In 2010 COSCE launched an ambitious Science Teaching in the School Project (ENCIENDE; ENseñanza de las CIENcias en la Didáctica Escolar) whose role is to act as connector between the educational and scientific communities and to allow the progress towards a more sensitized, educated and trained in science society [2]. Focusing on all stages of primary and secondary education from 3 to 14 years old, its main objectives are: to highlight the importance of science education in the earliest stages of the educational system, to perform analysis and initiate action in this direction and to promote scientific vocations, to make the Spanish society, at all levels and classes, better educated, prosperous and advanced in knowledge (Fig. 4). To achieve its goals, ENCIENDE is focused on three main areas: social, through families and public spaces that give access to science; school, represented by schools and teachers, and scientific, composed of scientists and facilities where science is generated and developed. One of the actions taken to give visibility to the project and strengthen its penetration in the educational community

Fig. 3. The DECIDES Project logo.

has been the creation of the ENCIENDE Awards, convened since 2012 to recognize the best initiatives or innovative educational activities of quality―that have been put in practice―in bringing science to school, especially among students from an early age. Also, under the project ENCIENDE, in 2013 it was created the newsletter Sparks of science (Chispas de la ciencia) [3] of which have already been published 30 issues on a monthly basis during the school year (Fig. 5).

Fig. 4. The ENCIENDE Program logo.


250

Int. Microbiol. Vol. 18, 2015

MARTÍN, ANDRADAS

Fig. 5. The Sparks of science logo.

COSCE and the mass-media In today’s society, mass-media, both the traditional (press, radio and television) and the new ones (based on social networks and the Internet), are the main tools for the transmission of scientific knowledge to society. Although access to scientific information is becoming simpler, it supposes a challenge for the scientific community whose message must be properly translated to society, fact that does not always happen. In order to avoid possible errors in the transmission of that knowledge, COSCE has launched a Network of Correspondents (Red de Corresponsales) whose mission is to provide scientific advice to the media across the country, especially the local media generally endowed with fewer resources and therefore more likely to make unintentional mistakes both in the understanding and interpretation of knowledge generated from scientific establishment and in the transmission of such knowledge to society through a nearby and accessible language.

Fig. 6. The RRI Tools web frontpage.

The Network currently consists of experts presented by the different societies forming part of COSCE, which offer their services voluntarily. It is designed as an open and easily searchable database to the media for finding experts in different areas of knowledge and in different provinces.

International relationships Because its goal to actively participate in the definition of scientific policies, not only Spanish but also international, COSCE currently collaborates with the Responsible Research and Innovation project (RRI Tools), whose Spanish hub (Fundació Bancària “la Caixa”, Barcelona) is the program coordinator at the European level. The aim is that the scientific societies of other European countries involved in the project reach the same stage in the implementation of approaches of responsibility in science by developing instruments with which researchers can obtain greater social interweaving and acceptance for their job (Fig. 6).


COSCE

By its own definition, Responsible Research and Inno­ vation is: “A concept which has been adopted as a crosscutting issue at Horizon 2020, the EU Framework Programme for Research and Innovation 2014–2020; doing science and innovation with society and for society, including the involvement of society ‘very upstream’ in the processes of research and innovation to align its outcomes with the values of society and, finally, a wide umbrella that brings together different aspects of the relationship between science and innovation and society: public engagement, open access, gender equality, science education, ethics and governance”.

Int. Microbiol. Vol. 18, 2015

science education; disseminating the scientific spirit; and promoting social appreciation for scientific values. Acknowledgements. We thank Prof. Ricardo Guerrero, current Vicepresident of COSCE, for his help in the preparation of this article, and all members of the Board along those intense twelve years for their constant and enthusiastic collaboration.

References 1. 2.

Final remarks

3. 4.

As we have said, COSCE currently has more than 70 member societies, which involve more than 40,000 scientists. The Federation fully represents the Spanish scientific com­munity and can therefore act as its interlocutor. It also aims to provide knowledge that may be of use to different economic, social, and political agents. COSCE approaches science from a global, practice-oriented perspective, rather than one that is merely academic or theoretical. It is capable of generating information that can be applied to actively promote, support, and contribute to developing initiatives—in both the public and private sectors—aimed at strengthening the role of science as a component of Spanish economic and social progress. In view of this, COSCE has become a corporate instrument capable of: encouraging research; improving

251

5. 6.

7.

8.

9.

COSCE (2006) Acción CRECE. Proposals by the Scientific Community to bost Science in Spain. http://www.cosce.org/crece_ingles.htm COSCE (2009) Proyecto ENCIENDE. Enseñanza de las ciencias en la didáctica escolar. http://www.cosce.org/pdf/Proyecto_ENCIENDE.pdf COSCE (2013) Chispas de la ciencia. http://enciende.cosce.org/boletin/ sumario.asp?item=148 COSCE (2015) Estatutos de la confederación de sociedades científicas de España (COSCE). http://www.cosce.org/estatutos01.htm COSCE (2015) Sociedades y asociaciones confederadas. http://www. cosce.org/miembros.htm COSCE, CRUE, CSIC (2015) Declaración Nacional sobre Integridad Científica. http://documenta.wi.csic.es/alfresco/downloadpublic/direct/ workspace/SpacesStore/2d44b554-327b-4e00-9b01-763554d25a62/ Declaracio_n%2520Nacional%2520Integridad%2520Cienti_ fica%2520definitiva.pdf COSCE, Fundación La Caixa (2014) Proyecto DECIDES. Debates sobre ciencia y desarrollo económico y social. http://www.cosce.net/pdf/ proyecto_DECIDES_2014_guion_inicial_17nov14.pdf Ministerio de Hacienda y administraciones públicas (2015) Real Decreto 1067/2015, de 27 de noviembre, por el que se crea la Agencia Estatal de Investigación y se aprueba su Estatuto. BOE núm. 285, de 28/11/2015. https://www.boe.es/boe/dias/2015/11/28/pdfs/BOE-A-2015-12889.pdf Rodríguez Zapatero JL (2011) Ley 14/2011, de 1 de junio, de la Ciencia, la Tecnología y la Innovación. BOE núm. 131, de 02/06/2011. https:// www.boe.es/buscar/act.php?id=BOE-A-2011-9617


PERSPECTIVES International Microbiology (2015) 18:253-261 doi:10.2436/20.1501.01.257. ISSN (print): 1139-6709. e-ISSN: 1618-1095

www.im.microbios.org

Hypercompetition in biomedical research evaluation and its impact on young scientist careers Shina Caroline Lynn Kamerlin Science for Life Laboratory, Department of Cell and Molecular Biology, Uppsala University, Uppsala, Sweden Received 16 October 2015 · Accepted 2 November 2015

Summary. Recent years have seen tremendous changes in the modes of publication and dissemination of biomedical information, with the introduction of countless new publishers and publishing models, as well as alternative modes of research evaluation. In parallel, we are witnessing an unsustainable explosion in the amount of information generated by each individual scientist, at the same time as many countries’ shrinking research budgets are greatly increasing the competition for research funding. In such a hypercompetitive environment, how does one measure excellence? This contribution will provide an overview of some of the ongoing changes in authorship practices in the biomedical sciences, and also the consequences of hypercompetition to the careers of young scientists, from the perspective of a tenured young faculty member in the biomedical sciences. It will also provide some suggestions as to alternate dissemination and evaluation practices that could reverse current trends. [Int Microbiol 18(4):253-261 (2015)] Keywords: biomedical publications · excellence evaluation· research competition · young scientists careers · information overload

Introduction Recent years have witnessed an explosion in the amount of scientific output produced by each individual researcher [12, 43,56], creating major challenges for both scientists eager to keep up with the scientific literature, as well as for grant panels and recruitment and promotion committees as they attempt to assess growing volumes of researcher productivity. These challenges were foreseen to some extent by Toffler [79]. This

Correspondence: S. C. Lynn Kamerlin Science for Life Laboratory Department of Cell and Molecular Biology Uppsala University S-751 24 Uppsala, Sweden Tel. +46-184714423. *

E-mail: kamerlin@icm.uu.se

author introduced the concept of “information overload”, and we are very clearly witnessing this information overload in practice in the biomedical sciences today. For example, in any year in the period 2003–2012, there were about 3000–4000 biomedical journals a scholar had available to choose from when deciding where to send their work [28]. In 2009, there were 25,400 journals in science, technology and medicine [9], with a projected annual growth of 3.5% [84] (which is probably currently larger due to the unfortunate explosion in predatory publishers [8]) and publishing about 1.5 million scientific papers a year [9]. Additionally, as of 1st October 2015, PubMed contained >25 million citations to the biomedical literature [59]. This explosion in total number of papers is in turn coupled with the increasing granularity of publications and of journals’ focus, leading in turn to a growing number of new journals targeting highly specialized subfields of a discipline.


254

Int. Microbiol. Vol. 18, 2015

However, even though the amount of information we are required to follow and keep up with has exploded, the speed at which we can read the literature has not. For example, it has been suggested that the average specialist only manages to read 322 papers a year [76]. However, based on both my personal experience and discussions with colleagues, I would venture to believe that the real number is most likely far less. This impacts the modes of dissemination of information, such that not only does readership become a collective effort [33], but also this can lead to many scientists becoming authors first, and readers second. This also means that being ignorant of 100% of the literature in your field is not actually very different from being ignorant of 98% of it [33], and the problem with this is that a lot of extremely valuable research can be lost in the noise. The American Chemical Society (ACS) summed up the zeitgeist of the times in a recent article [5], and the ramifications of this change in publishing culture are dramatic for all scientists, and for young starting scientists in particular. Tying in with this, there has been a tremendous science policy push towards using “excellence” as a criterion in determining funding [15,37,40,49,70]. This in turn affects reward outcomes for young researchers, and, in its path, it establishes an essentially new “social contract” for science [75]. For example, within Europe, both national and European level policies to promote excellent research are affecting the organization of research [19–22,70], making it increasingly project-based. This also affects the development of academic careers (which is increasingly directly correlated to grant income [72]) and the definition and operationalization of research excellence within universities. The latter is, again, increasingly, based exclusively on assessment criteria such as the amount of grants received, and on the number of highly cited articles in high-impact journals [38,41]). In such an information-flooded environment, therefore, how then do you measure and reward excellence, in biomedicine or any other discipline?

Author placement and research rewards At the heart of all forms of scientific dissemination is authorship. Whether it is of scientific publications, reports, technical notes, or presentations, authorship is, in essence, the “currency” of academia [82]. It is used to measure research productivity, it is used as a basis for funding decisions and professional appointments, and it also brings direct rewards to the

KAMERLIN.

author, in terms of dissemination of work, new collaborations, and greater collegiality. As such, therefore, the core aims of authorship are laudable and greatly beneficial to the scientific community. There are many cases, however, when the monetization and incentivization of authorship becomes questionable [21,22], as for example, in reports of Chinese universities that provide impact factor based monetary bonuses upon the publication of manuscripts. That can be several times higher than the average urban wage [60] (which provides a tremendous incentive for fraud for even the most ethically oriented of researchers, although publication ethics are the responsibility of all parties involved in the publication process [83]). Other examples of problematic incentivization include personal accounts from several colleagues working at departments across Europe, whose departments have introduce arbitrary requirements of N publications before promotion to full Professor, without even taking into account differences in the publishing practices of various subfields (names and identities withheld for confidentiality). The biggest problem to arise out of this monetization of authorship, whether through direct financial rewards or through using it as leverage for tenure and promotion, is that it encourages an explosion in the amount of scientific output, creating a drive towards the “least publishable unit” [17] style of publication, and completely overwhelming the readership in the process. The tight links between authorship and the reward system then also impacts the research process itself [62], turning the choice of which projects and collaborations are selected to a decision based on where the work is likely to be ultimately publishable, while optimizing for the minimum amount of work in a fixed time that will lead to the highest impact. This, in turn, affects the very core of doing research [39,62], as publication pressures affect study designs (non-risky topics, increasing chances of false positives), and convert scientific exchanges into a process designed mainly to secure a competitive advantage [51,52,62], even in supposedly collaborative settings or in venues intended to advance the shared knowledge of a field. As a result, the core work of knowledge production is being cropped and tweaked to fit a narrow metricbased evaluation system [19,29,62]. The next major challenge facing the assessment of individual researchers is the fact that despite changes in research practices, author placement still drives many if not even most recruitment, tenure and funding decisions. In biomedical sciences, this typically means that most credit is given to the first and last author, although author positioning is very field


Int. Microbiol. Vol. 18, 2015

255

Int Microbiol

RESEARCH EVALUATION

Fig. 1. Fig. 1. Bubble plot illustrating the impact of biomedical journals in the years 2003–2012, on a logarithmic scale. The numerator of the plot shows the number of journal citations in 2012 to articles that were published in the years 2010 and 2011, and the denominator of the plot is the absolute number of articles published in 2010 and 2011. All data was taken from Thomson Reuter’s Journal Citation Report. The figure has been kindly provided by Phil David from the Scholarly Kitchen, and was originally published at http://scholarlykitchen.sspnet.org/2013/07/24/dynamic-visualizationof-biomedical-journals-2003-2012/

dependent. Additionally, and despite improvements, ghost authorships are still a major problem in biomedicine [53,74,86]. However, Science is not a solo enterprise, and with the increasing importance of interdisciplinarity [54], it is increasingly common to see papers in the literature with dozens if not hundreds of authors on it, following a long ongoing trend of increasing numbers of authors on scientific publications [61,80,91]. For instance, a 2007 publication in the journal Science listed 28 authors, 7 of which were marked as having contributed equally [90]. However, one of these “authors” was the Wellcome Trust Case Consortium, which in fact brings the total author listing up to over 200 authors. An even more extreme incarnation of this can be seen in a recent paper in Physical Review Letters, which set the current authorship record with no less than 5154 individual authors [1], comprising of 9 pages of actual science, and 24 pages of author names and institutions. A final example of direct relevance to biomedical research is a 2015 genomics paper that involved contributions from 900 undergraduate students and listed 1000 authors in total [44].

Clearly, with author lists of these lengths, it can be extremely difficult to distinguish the added value each individual author brings to the manuscript, and yet biomedical research assessment still puts a majority of emphasis on the contributions of first and last authors, including elite grants that only allow you to list your “main author” papers. This is particularly problematic taking also into account the fact that the number of authors on individual papers is constantly growing [61,80,91], and, in particular in interdisciplinary research, even if there are only a few authors on the paper, the contribution of individual researchers from the different disciplines can be equally critical to the success of the project, and yet only one person can be first or last author respectively. One easy way around this might seem to be to just move to an alphabetical author listing, however, even here there is trouble in paradise, as it has been demonstrated that in disciplines such as economics, where alphabetical author listing is the norm, each letter close to an A gives an increased chance of tenure at a top US department (and the associated professional recognition) [30]. Therefore, highlighting researcher


256

Int. Microbiol. Vol. 18, 2015

contri­butions in an effective way is absolutely critical [53,74, 80,82,86]. There have, however, been positive moves in this direction. One example of this is the fact that an increasing number of institutions explicitly require applicants for recruitment or promotion to explicitly list their contributions to each of the publications on their publication lists, which if executed with honesty, should reduce the incentive for ghost and honorary authorships. Additionally, an increasing number of journals are requiring that not just author lists but also individual author contributions be provided upon submission of an article, for publication with the final manuscript. The taxonomy for this can be as simple as “analyzed data”, “wrote paper”, “performed experiments”, but it can also become quite complex, as was for example the case in a 14-role taxonomy suggested by the publication Nature in 2014, which was based on correspondence with 1200 authors and publishers of leading life sciences journals [4]. Examples of this taxonomy include, for example, “Study conception: ideas, formulation of research question, statement of hypothesis”, or “Data curation: management activities to annotate (produce metadata) and maintain research data for initial use and later re-use”. According to Nature [4], this was generally well received, but is of course a small sample size and a very preliminary study. However, this is a promising direction that provides a much more streamlined template with which to assign author contributions and give appropriate credit where credit is due, rather than the rigid first/last authorship model being used in a lot of natural sciences today. By demanding explicit author contributions on published papers, the corresponding journals are significantly contributing to helping reduce the problem of “ghost” and “honorary” authorships, which make it even harder to assess genuine contributions on multi-author papers [82,83,86]. This move towards transparency should be lauded, as it will, hopefully, over time, create a scientific assessment model that allows interdisciplinary research to be properly assessed [60], as well as fostering an environment of greater collaboration rather than competition for the most coveted positions on the author list.

Changing publication culture and moving away from bibliometrics A 1987 manuscript, by one of the most eminent enzymologists of the 20th Century, opens with the following text “We

KAMERLIN.

report here an examination of the mechanisms of general acid and general base catalysis of the reactions of water and alcohols with acetaldehyde. These two mechanisms of catalysis are entirely different and are discussed separately; however, the work is described in a single long paper for economy of presentation of the experimental data” (italics mine for emphasis) [69]. For any scientist working in the life sciences today, no further comment is necessary to illustrate just how much publication culture has changed in the past three decades. There has been much discussion in the recent literature about the uses and abuses of quantitative metrics such as the total number of citations, journal impact factors, or the ever-ubiquitous H-index (see e.g., refs. [13,14,18,29,45,50, 65,68,85,89], among many others). Additionally, in chasing to publish their work in the highest impact journal possible, few researchers outside of the field of scientometrics are aware that the original purpose of journal impact factors (JIF) was never to assess individual researchers, but rather, to help librarians decide what journals to purchase for institutional collections [7] (see also ref. [34] for further information about the history of the JIF). Despite the concerns about uses and misuses of JIF, the information overload facing biomedical researchers in and of itself creates overdependence on bibliometrics, with JIF becoming synonymous with quality and being used to reduce complexity in the evaluation process by acting as an information filter in search of relevant papers [26,87]. Recent research [62] has shown that the JIF is not only used in assessing of individual researchers, but also (and worryingly), impact factor considerations kick in at a very early stage in the research process long before researchers start to think about publishing results. That is, JIF considerations have begun to structure work processes at the epistemic level, for instance affecting choices of which projects to work on, or which laboratories to collaborate with, and so forth. This makes moving away from bibliometrics-based criteria complicated, and although much work has been done on the misuses of impact factors, things evolve in use when they are taken up in different research practices. As such, it is promising to see increased awareness of the problems with arbitrary metrics among scientists and research institutions, initiatives such as the San Francisco Declaration on Research Assessment (DORA) [64], and the push towards the development of alternative metrics by which to assess researchers [10,11,14, 57,67,88]. Additionally, citation counts and metrics such as the H-index are inherently flawed because they do not


RESEARCH EVALUATION

tell you how many people are citing this paper as an example of bad work (they take into account negative as well as positive citations), and they can both over-exaggerate and harm the track records of achievements of scientists working at the interface of multiple disciplines with very disparate publishing practices, depending on which discipline is performing the assessment. Therefore, quantitative metrics start having more limited usage in the assessment of interdisciplinary research, if discipline-dependent context is not taken into account. In addition to flooding the literature by pushing scientists to produce an inordinately large number of publications, such hypercompetition does not come without a cost to young scientists. That is, as commented on recently by Alberts and colleagues [3], current Western research and authorship models are based on post-World War II concepts of constant growth. However, most biomedical research is done by an increasing number of graduate students and postdocs, leading to an explosion in scientists at the bottom of the professional “pyramid”, and the amount of science that needs assessing. Therefore, scientific output has shot radically upwards at a time when research funding has gone down, and this has led to a toxically hypercompetitive environment, which can both put off even the most outstanding young scientists from an academic career, and puts undue pressure on established scientists, taking their attention away from the goal of producing the highest quality research (see the discussion in ref. [3]). From the perspective of the entire science system, this makes research over-dependent on what is essentially a huge PhD and postdoc “factory” [27,36,58] of cheap labor services [72,73], where only a very small portion of these researchers have the possibility to move up the academic ladder (for example, according to the Royal Society, the figure for the UK for progression to professorial level in the natural sciences is only c.a. 0.5% of all granted PhDs [77]. This is problematic in and of itself, because not everyone can or should be at the “top” of the research pyramid – rather, we need an ecology of researchers working on different systems, and research group levels with different expertise and ambitions (to use a sports analogy, one would not want an entire football team to consist only of forward strikers). Finally, while competition in general is good for science, as it leads to higher quality research, when taken too far, it suppresses creativity, collegiality and risk taking, characteristics that are all essential for groundbreaking discoveries [3]. In addition, the growing pressure to publish in top journals leads more and more scientists to cut corners, exaggerate

Int. Microbiol. Vol. 18, 2015

257

findings and overstate the significance of their work [3], as is observed not just in the explosion of journal retraction rates [25,71,81], but is also diligently covered in the popular blog Retraction Watch [http://retractionwatch.com]. The main impact this has had on my work and that of my colleagues is that it also kills collaborative environments among one’s own team members, as graduate students and postdocs develop an “if I’m not first author what’s in it for me?” mentality, and it makes it harder and harder for them to work together. Clearly, this is not sustainable in the long term, and something has to change towards a healthier and more productive system if we, as a scientific community, want to continue producing excellent science and training well-balanced young researchers.

How to identify and assess excellent young scientists? A term that is increasingly used in grant applications and recruitment panels is “excellence”, although this term in itself is quite vague. How does one define excellence? [55]. And, more critically, how does one get it right when assessing a young scientist at the start of their career, who may have little or no independent track record to draw on as of yet. In an aptly titled recent article [47], Loeb pointed out the problem that many prestigious universities are plagued with “dead wood” faculty who were exploding with promise when they were initially hired, while in parallel, there are many stories of scientists who do not receive tenure at their initial institution, move to “lesser” institutions, and still end up carrying the day. He argued that this is for a number of reasons, including the tendency of senior scientists to push forward junior candidates who best replicate their own research and ideas, the fact that early career achievements are just a frozen snapshot of a researcher’s career, as well as over or under appreciation of a faculty applicant that is a former graduate, due to again a frozen memory of the applicant’s achievements [47]. Hopefully, despite these problems we do still manage to get recruitment of young candidates right most of the time; however, in light of the changing dynamic in publication and dissemination practices, current productivity-based assessment criteria clearly need re-addressing and updating to match current modes of authorship and interdisciplinarity. As a thought experiment, I would like to propose the reader to consider two potential candidates that have made it to the very last stage of your hypothetical faculty search,


258

KAMERLIN.

Int. Microbiol. Vol. 18, 2015

both of whom are research compatible with your top research department, and who have made a positive impression on the entire search committee. The first candidate is a postdoc from a world-leading University, with a roster of famous mentors, extensive publication record, and several high impact publications. The second candidate comes from a smaller University, and from a country where funding for equipment and other research expenses is scarce, and therefore has fewer publications, but has several nationally prestigious prizes and put in an exciting and novel research proposal. Who, then, would you pick for this faculty position? The knee-jerk response, of course, would be to take the first candidate. But at the start of their career, and with excellent mentors, how much of a contribution did they really make to that work? Also, in the case of the second candidate, what if their lower output is due only to resources, and if you scale up to the resources that were available, what if they actually produced more scaled for resources than the first candidate? If so, how much could they then achieve with a well-funded startup package and excellent graduate students? The choice is not straightforward, but it highlights the need to take into account contextualized researcher profiles when assessing candidates for recruitment or high-profile grants and awards, rather than quantitative metrics. Clearly, fewer very good publications are superior to a large number of mediocre ones, and therefore it is important to actually read at least the top five publications flagged by the candidate to get a better idea of their research achievements (see also DORA). Mandating author contributions on publications lists submitted with tenure and promotion packages, and grant applications, allows the candidate to outline their contributions to each individual publication, in the case of multi-author papers. Additionally, in terms of impact on the field, not just publications should be taken into account, but also other metrics such as patents, speaker invitations, awards, distinctions and also collaborative ability (“is this person going to be a good colleague?”). Finally, despite the push to always recruit the highest profile researchers that fulfill the criteria for (a very fluid definition of) excellence, once again, the need for an ecology rather than pyramid of researchers needs to be taken into account, as it is within such multi-dimensional research environments that the best quality research thrives and progresses. There are, increasingly, other forms of dissemination of material, such as a new preprint server for the life sciences, bioaRxiv [http://bioRxiv.org], which has been modeled on

the well-established and successful arXiv server in physics and mathematics [http://arXiv.org]; new modes of publication and peer review experimented with by for instance PLoS One [http://www.plosone.org/], F1000Research [http://f1000research.com] and others which include publishing based on soundness rather than impact, allowing reader comments and open peer review; new forms of metrics as implemented for example by new forms of measuring impact such as those provided by Impact Story [https://impactstory.org] and AltMetrics [http://altmetrics.org, http://altmetric.com], and, recently, a comprehensive manifesto on research evaluation, the “Leiden Manifesto” [42], which outlines a 10-point list to be taken into account in the evaluation of research. Irrespective of what particular direction the field takes, change needs to be made, and fast, to protect the futures of the next generation(s) of outstanding young researchers.

Summary and outlook I have written this Perspective not as a practitioner in scientometrics, but from the personal perspective of a biomedical researcher very interested in questions surrounding research evaluation strategies. For economy of space there are many topics I have not touched on here, but as is the case also for other young scientists, I am personally affected by increasing hypercompetition. I am also, in particular, highly alarmed by the speed at which this is increasing, such that purely subjectively, it appears that the pressure on the current generation of postdocs seeking faculty positions is already tremendously larger than (the already large) pressure I faced only half a decade ago. The most tragic consequence of our current models, however, may well be how the current evaluation and reward system is eroding the “social” aspects of science [3,6,23,22,48], e.g.,, the collegiality principle, increasing competitive struggles, blistering “benchmark masculinity” [78], and decreasing service to the scientific community [31]. In particular, some of the authorship and evaluation practices that are becoming central to academic work are in great tension with fostering innovative, collaborative and societally relevant science. Similarly, in the current research assessment models, even when the research comes from large charity funds (such as for instance cancer research foundations), the potential societal impact of the research (e.g., the effects on the clinic, potential new treatments) as usually not the main assessment criterion for determining the “value” of the re-


RESEARCH EVALUATION

search, or whether the money was well-spent. These tensions play a great role in creating the disillusionment and elevated stress levels facing academics [2,3,35,46,48,51,52,63], which for sure contribute to driving some the best young scientists from the field. There has been strong concern voiced by many others about the direction the field is taken, and as starting points I would recommend readers to turn to refs. [26,28,68,83,84] and references cited therein for further reading on this topic. Nevertheless, despite the great cause for concern, it is also promising to see the field take proactive measures to correct itself. The Leiden Manifesto [42] and DORA [64] are examples of this, as is proactive work to address these problems by many leading research organizations. Another promising step is that an increasing number of funding agencies request to see only a fixed number of your top publications, which creates a push towards quality over quantity in scientific publishing. Therefore, signs of change do exist, and there is cause to be hopeful. Ultimately, I have written this perspective because, while sustainable biomedical research can only come about at this stage through a major system overhaul at every level (research, funding, dissemination), we, the practitioners, are ultimately the ones who decide what Science will look like, and it is in our hands to fix it. Acknowledgments. I would like to thank Elizabeth Wager and Sarah de Rijcke for helpful discussion, and Sarah de Rijcke in particular for reading and providing valuable feedback on this contribution. The bulk of this contribution arose as part of an Authorship in Transition workshop held at the Lorentz Center in Leiden in February 2015 [63].

References 1. Aad Gea (2015) Combined measurement of the higgs boson mass in pp collisions at √s=7 and 8 TeV with the ATLAS and CMS Experiments. The Atlas and CMS Collaborations. Phys Rev Lett 114:191803 2. Adamo SA (2013) Attrition of women in the biological sciences: Workload, motherhood and other explanations revisited. BioScience 63:43-48. 3. Alberts B, Kirschner MW, Tilghman S, Varmus H (2014) Rescuing US biomedical research from its systemic flaws. Proc Natl Acad Sci USA 111:5773-5777 4. Allen L, Scott J, Brand A, Hlava M, Altman M (2014) Publishing: Credit where credit is due. Nature 508:312-313 5. American Chemical Society Publications (2013) Be Found or perish: Writing scientific manuscripts for the digital age. Bio Journals 1-5 6. Anderson MS, Ronning EA, de Vries R, Martinson BC (2007) The perverse effects of competition on scientists’ work and relationships. Sci Eng Ethics 13:437-461

Int. Microbiol. Vol. 18, 2015

259

7. Archambault É, Larivière V (2009) History of the journal impact factor: Contingencies and consequences. Scientometrics 79:635-649 8. Beall J (2015) Beall’s list: Potential, possible, or probably predatory scholarly open-access publishers. [http://scholarlyoa.com/publishers/] 9. Björk B, Roos A, Lauri M (2009) Scientific journal publishing: Yearly volume and open access availability. Information Research 14:paper 391 10. Bollen J, van de Sompel H, Smith JA, Luce R (2005) Toward alternative metrics of journal impact: A comparison of download and citation data. Inform Process Manag 41:1419-1440 11. Bornmann L, Marx W, Gasparyan AY (2005) Diversity, value and limitations of the journal impact factor and alternative metrics. Rheumatol Int 32:1861-1867 12. Bornmann L, Mutz R (2015) Growth rates of modern science: A bibliometric analysis based on the number of publications and cited references. J Assoc Inf Sci Technol. 66:2215-2222. 13. Bornmann L, Daniel H-D (2008) What do citation counts measure? A review of studies on citing behavior. J Doc 64:45-80 14. Bornmann L, Ruediger M, Daniel H-D (2008) Are there better indices for evaluation purposes than the H index? A comparison of nine different variants of the H-index using data from biomedicine. J Assoc Inf Sci Technol 59:830-837 15. Bourne HR (2013) A fair deal for PhD students and postdocs. eLife 2:e01139 16. Breithaupt H (2004) Push for innovation. EMBO Rep 5:339-341 17. Broad WJ (1981) The publishing game: Getting more for less. Science 21:1137-1139 18. Burrows R (2012) Living with the h-index? Metric assemblages in the contemporary academy. Soc Rev 60:355-372 19. Butler L (2003) Modifying publication practices in response to funding formulas. Res Eval 12:39-46. 20. Butler L (2003) Explaining Australia’s increased share of ISI publications ̶ the effects of a funding formula based on publication counts. Res Policy 32:143-155 21. Butler L (2004) What happens when funding is linked to publication counts? In: Moed HF et al. (eds.) Handbook of Quantitative Science and technology research. Springer, pp. 389-405 22. Butler L (2010) Impacts of performance-based research funding systems: A review of the concerns and the evidence. OECD Publishing 23. Casadevall A (2012) Reforming science: Methodological and cultural reforms. Infect Immun 80:891-896 24. Chandler J, Barry J, Clark H (2002) Stressing academe: The wear and tear of the new public management. Hum Relat 55:1051-1069 25. Cokol M, Ozbay F, Rodriguez-Esteban R (2008) Retraction rates are on the rise. EMBO Rep 9:2 26. Collini S (2015) Defending universities: Argument and persuasion. Power & Education 7:29-33 27. Cyranoski D, Gilbert N, Ledford H, Nayar A,Yahia M (2011) Education: The PhD factory. Nature 472:276-279 28. Davis P (2013) Dynamic visualization of biomedical journals 2003-2012 [http://scholarlykitchen.sspnet.org/2013/07/24/dynamic-visualizationof-biomedical-journals-2003-2012/] 29. de Rijcke S, Wouters P, Rushforth A, Franssen T, Hammarfelt B (2016) Evaluation practices and effects of indicator use ̶ a literature review. Res Eval 2016 In Press. 30. Einav L, Yariv L (2006) What’s in a surname? The effect of surname initials on academic success. J Econ Perspect 20:175-187 31. Elton L (2000) The UK research assessment exercise: Unintended consequences. High Educ Quart 23:274-283


260

Int. Microbiol. Vol. 18, 2015

32. Fang FC, Casadevall A (2015) Competitive science: Is competition ruining science? Infect Immun 83:1229-1233 33. Fraser AG, Dunstan FD (2010) On the impossibility of being an expert. BMC 341:c6815 34. Garfield E (2006) The history and meaning of the journal impact factor. JAMA 295:90-93 35. Gill R (2009) Breaking the silence: The hidden injuries of neo-liberal academia. Routledge, London, UK 36. Goldman CA, Massy WF (2000) The PhD factory: Training and employment of engineering doctorates in the United States. Anker Pub Company 37. Hallonsten O, Silander C (2012) Commissioning the university of excellence: Swedish research policy and new public research funding. Quality in Higher Education 18:367-381 38. Hammarfelt B, Nelhans G, Eklund P, Åström F (2016) The heterogenous landscape of bibliometric indicators: Evaluating models for allocating resources at Swedish universities. In Press. doi:10.1093/reseval/rvv040. 39. Harley S (2012) The impact of research selectivity on academic work and identity in UK universities. Stud High Educ 27:187-205 40. Hicks D, Katz JS (2011) Equity and excellence in research funding. Minerva 49:137-151 41. Hicks D (2012) Performance-based university research funding systems. Res Policy 41:251-261 42. Hicks D, Wouters P, Waltman L, de Ricjke S (2015) The Leiden Manifesto for research metrics. Nature 520:429-431 43. Larsen PL, von Ins M (2010) The rate of growth in scientific publication and the decline in coverage provided by Science Citation Index. Scientometrics 84:575-603 44. Leung W, et al. (2015) Drosophila muller F elements maintain a distinct set of genomic properties over 40 million years of evolution. Genes Genome Genetics 5:719-740 45. Leydesdorff L, Bornmann L (2011) Integrated impact indicators compared with impact factors: An alternative research design with policy implications. J Am Soc Inf Sci Tech 62:2133-2146 46. Lober Newsome J (2008) The chemistry PhD: The impact on women’s retention. Royal Society of Chemistry, London, UK 47. Loeb A (2015) How to collect matches that will catch fire. arXiv:150200709 [astro-phIM] 1-3 48. Marder E, Kettenmann H, Grillner S (2010) Impacting our young. Proc Natl Acad Sci USA 107:21233 49. Martin BR (2011) The research excellence famework and the ‘impact agenda’: Are we creating a Frankenstein monster? (2011) Res Eval 20:247-254 50. Moed HF, van Leeuwen TNV, Reedijk J (1996) A critical analysis of the journal impact factor of Angewandte Chemie and The Journal of the American Chemical Society. Innacuracies in published impact factors based on overall citations only. Scientometrics 37:105-116 51. Müller R (2012) Collaborating in life science research groups: The question of authorship. High Educ Pol 25:289-311 52. Müller R (2014) Postdoctoral life scientists and supervision work in the new corporate university: A case study of changes in the cultural norms of science. Minerva 52:329-349 53. Mulligan A, Taylor M, Newsum L (2014) The challenges around defining authorship ̶ you have your say. Elsevier PubTrends 54. News Feature (2015) Why interdisciplinary research matters. Nature 525:305 55. Paradeise C, Thoenig J-C (2013) Academic institutions in search of quality: Local orders and global standards. Organ Stud 34:189-218 56. Pautasso M (2012) Publication growth in biological sub-fields: Patterns,

KAMERLIN.

predictability and sustainability. Sustainability 4:3234-3247 57. Piwowar H (2013) Altmetrics: Value all research products. Nature 493:159 58. Powell K (2015) The future of the postdoc. Nature 520:144-147 59. PubMed.gov [http://www.ncbi.nlm.nih.gov/pubmed] 60. Rafols I, Leydesdorff L, O’Hare A, Nightingale P, Stirling A (2012) How journal rankings can suppress interdisciplinary research: A comparison between innovation studies and business & management. Res Policy 41:1262-1282. 61. Regalado A (1995) Multiauthor papers on the rise. Science 268:25 62. Rushforth A, de Rijcke S (2015) Accounting for impact? The journal impact factor and the making of biomedical research in the Netherlands. Minerva 53:117-139 63. Rushforth A, de Rijcke S, Beaulieu A, Wouters P, Müller R, Burton M, de Vries S, Derksen M, Faasse P, Garfinkel M et al. (2015) The author multiple: Reflections on a one week Lorentz-workshop on authorship in transition. EASST 34 64. San Francisco Declaration on Research Assessment (2013) [http://www. ascb.org/dora/] 65. Seglen PO (1997) Why the impact factor of journals should not be used for evaluating research. BMJ 314:498-502 66. Shao J, Shen H (2011) The outflow of academic papers from China: Why is it happening and can it be stemmed? Learned Publishing 24:95-97 67. Shema H, Bar-Ilan J, Thelwall M (2014) Do blog citations correlate with a higher number of future citations? Research blogs as a potential source for alternative metrics. J Assoc Inf Sci Technol 65:1018-1027 68. Simons K (2008) The misused impact factor. Science 322:165 69. Soerensen PE, Jencks WP (1987) Acid- and base-catalyzed decomposition of acetaldehyde hydrate and hemiacetals in aqueous solution. J Am Chem Soc 109:4675-4690 70. Sousa SB, Brennan JL (2014) The UK research excellence framework and the transformation of research production. Springer, Dordrecht 71. Steen RG, Casadevall A, Fang FC (2013) Why has the number of scientific retractions increased? PLoS ONE 8:e68397 72. Stephan P-E (2012) How economics shapes science. Harvard Univ. Press, Cambridge, USA 73. Stephan P (2013) How to exploit postdocs. BioScience 63:245-246 74. Strange K: Authorship: Why not just toss a coin? Am J Physiol Cell Physiol 295:C567-C575 75. Sunkel C (2015) Excellence and the new social contract for science. In search for scientific excellence in a changing environment. EMBO Rep 16:553-556 76. Tenpor C, King DW, Bush A (2004) Medical faculty’s use of print and electronic journals: changes over time and in comparison with scientists. J Med Libr Assoc 92:233-241 77. The Royal Society (2010) The Scientific Century. Securing our future prosperity. The Royal Society, London, UK 78. Thornton M (2007) ‘Otherness’ on the Bench: How merit is gendered. Sydney Law Review 29:391-413 79. Toffler A (1970) Future Shock: Random House 1970 80. Tschartnke T, Hochberg ME, Rand TA, Resh VH, Krauss J (2007) Author sequence and credit for contributions in multiauthored publications. PLoS Biol 5:e18 81. van Noorden R (2011) Science publishing: The trouble with retractions. Nature 478:26-28 82. Wager E (2009) Recognition, reward and responsibility: Why the authorship of scientific papers matters. Maturitas 62:109-112 83. Wager E (2012) Publication ethics: Whose problem is it? Insights 25:294-299


RESEARCH EVALUATION

84. Ware M, Mabe M (2009) The STM report. An overview of scientific and scholarly journal publishing. Internat Ass Scientific Technical and Medical Publis, Oxford, UK, pp 68 85. Wilsdon J, Allen L, Belfiore E, Campbell P, Curry S, Hill S, Jones R, Kain R, Kerridge S, Thelwall M, et al. (2015) The metric tide: Report of the independent review of the role of metrics in research assessment and management. HEFCE doi:10.13140/RG.2.1.4929.1363 86. Wislar JS, Flanagin A, DeAngelis CD (2011) Honorary and ghost authorship in high impact biomedical journals: A cross sectional survey. theBMJ 343:d6128 87. Woelert P (2013) ‘The economy of memory’: Publications, citations and the paradox of effective research governance. Minerva 51:341-362

Int. Microbiol. Vol. 18, 2015

261

88. Woolston C (2014) Funders drawn to alternative metrics. Nature 516:147 89. Wouters P, Thelwall M, Kousha K, Waltman L, de Ricjke S, Rushforth A, Franssen T (2015) The metric tide. Literature review. Supplementary report I to the independent review of the role of metrics in research asessment and management. HEFCE doi:10.13140/RG.2.1.5066.3520 90. Zeggini E, Weedon MN, Lindgren CM, Rayling TM, Elliot KS, Lango H, Timpson MJ, Perry JRB, Rayner NR, Freaty RM et al. (2007) Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. Science 316:1336-1341 91. Zetterström R (2004) The number of authors of scientific publications. Acta Paediatr 93:581-582


BOOK REVIEWS International Microbiology (2015) 18:263-264 ISSN 1139-6709, e-ISSN 1618-1095 www.im.microbios.org

Zoonoses.

Infectious diseases transmissible from animals to humans Bauerfeind R, von Graevenitz A, Kimmig P, Schiefer HG, Schwarz T, Slenczka W, Zahner H (eds) 2016. ASM Press, Washington, DC, USA 532 pp, 18 × 25 cm Price: 100.00 US ISBN: 978-1-555-81925-5

Zoonotic diseases are increasingly impacting human popu­ la­tions due to the effects of globalization, urbanization and climate change. The book Zoonoses. Infectious diseases transmissible from animals to humans presents the most significant aspects of zoonotic diseases in a concise manner such as occurrence, transmission, clinical manifestations, diagnosis, therapy and prophylaxis. Originally, zoonoses were regarded as animal diseases. Later, in the 19th century, they had a double meaning, animal diseases and diseases of humans transmitted from animals, directly (by contact) or indirectly (by a vector). Today, no difference is made with regard to the direction of transmission, such as animal to human or human to animal, although the latter play only a minor role in the epidemiology of zoonoses. More than 200 diseases occurring in humans and animals are known to be mutually transmitted. They are caused by viruses and prions (Chapter 1), bacteria (Chapter 2), fungi (Chapter 3) and parasites (Chapter 4). Many new, emerging and re-emerging diseases of humans are caused by pathogens that originate from animals or products of animal origin. Emerging pathogens are now considered to be a major microbiologic public health threat. Different animal species, both domestic and wild, can act as reservoirs for pathogens that may be viruses, bacteria, or parasites. Major contributing factors in the emergence of these bacterial infections are: (i) development of new diagnostic tools, such as improvements in culture methods, and development of molecular techniques; (ii) increase in human exposure to bacterial pathogens as a result of sociodemographic and

environmental changes; and (iii) emer­gence of more virulent bacterial strains and opportunistic infections, especially those affecting immunocompromised populations. A precise definition of their implications in human disease is challenging and requires the comprehensive integration of microbiological, clinical and epidemiological aspects. Classical infectious diseases, such as rabies, plague, and yellow fever, well known for centuries, are zoonoses that have not been eliminated despite major efforts. Recent epidemics of Ebola virus, Zika virus, avian influenza, and bovine spongiform encephalopathy have served as a reminder of the existence of infectious diseases and of the capacity of these diseases to occur unexpectedly in new locations and animal species. Zika virus is a flavivirus that was first isolated in 1947 from a febrile rhesus macaque monkey in the Zika Forest of Uganda, and later identified in Aedes africanus mosquitoes from the same forest. Zika virus is the focus of an ongoing pandemic and public health emergency. Zika virus were limited to sporadic cases in Africa and Asia, but the emergence of Zika virus in Brazil in 2015 indicated rapid spread throughout the Americas. Zika virus in the United States, Canada, and Europe has been limited to travelers from affected areas. Although most Zika virus infections are characterized by subclinical or mild influenza-like illness, severe manifestations have been described, including Guillain-Barre syndrome in adults and microcephaly in babies born to infected mothers. Neither an effective treatment nor a vaccine is available for Zika virus; therefore, the public health response primarily


264

Int. Microbiol. Vol. 18, 2015

focuses on preventing infection, particularly in pregnant women. Despite growing knowledge about this virus, questions remain regarding the virus’s vectors and reservoirs, pathogenesis, genetic diversity, and potential synergistic effects of co-infection with other circulating viruses. The need for greater international co-operation, better local, regional and global networks for communicable disease surveillance and pandemic planning is also illustrated by these examples. These diseases have contributed to the definition of new paradigms, especially relating to food safety policies and more generally to the protection of public health. Viruses that produce zoonoses belong to various virus groups that have similarities in the disease patterns that they induce, and they may also have similarities involved in host and vectors. Among the agents causing zoonotic diseases, viruses are the most abundant and the majority of zoonotic viruses have RNA (e. g., Alphaviruses, Flaviviruses, Bunyaviruses, etc.). RNA viruses do not have proofreading mechanisms, and every reproductive cycle will originate a great number of genetic variants. By chance, these new variants may have the ability to extend the host range to other hosts. All these variants will have to overcome a selection process that in most cases, restrict, or in some cases, improve their reproductive success (Chapter 1). Bacterial zoonoses occur by transmission via one of several mechanisms: (i) Direct contact with animals or infected materials (e.g., Bacillus anthracis, Brucella spp., Bartonella spp., Burkholderia mallei, Leptospira interrogants). (ii) Animal bites and scratches (e.g., Pasteurella multocida, Capnocytophaga canimorsus, Streptobacillus moniliformis). (iii) Bites or mechanical transmission by arthropod vectors (Borrelia burgdorferi, Yersinia pestis, Francisella tularensis, Rickettsia sp.). And (iv) consumption of contaminated foods (e.g., Salmonella enteritidis, Listeria monocytogenes, Yersinia enterocolitica, etc.). The bacteria that cause the infections can sometimes be acquired by more than one transmission mechanism, complicating control measures (Chapter 2).

BOOK REVIEWS

Fungal infections associated with zoonotic and/or sapro­ notic (i. e., the source is environmental, interhuman transfer is exceptional, but could be pathogenic) transmission are among the group of the most common fungal diseases as dermatophytosis (fungi that are able to utilize keratincontaining structures, e.g., hair, nails, scales, etc.) from humans and animals. Nearly all fungi are able to thrive in the environment for extended periods, but pathogens have the evolutionary advantage of using a vertebrate vector during a part of their life cycle. Often animals other than humans are the prime target of the fungus, with humans as nonoptimal hosts. In Chapter 3, the genera Microsporum, Trichophyton, Sporotrichosis and Pneumocystis are described Chapter 4 refers to the parasitic zoonoses caused by protozoa, helminths (e.g., trematodes, cestodes and nema­ todes); acanthocephalan; pentastomids and arthropods. Arthro­pods play an additional role as transmitter of viruses, bacteria, protozoa and helminths. Parasites are eukaryotes organisms with complex development cycles. Many zoonotic parasites involve one or several intermediate hosts in which further development and multiplication take place. Humans may be involved in these cycles as a final host or intermediate host. Zoonoses. Infectious diseases transmissible from animals to humans is an update of information about different diseases occurring in humans and in animals and that are caused by viruses, bacteria, fungi and parasites. The book is based on the 4th German edition, published in 2013, and it is highly recommended for students and researchers interested in clinical microbiology.

Mercedes Berlanga University of Barcelona mberlanga@ub.edu


INDEX VOLUME 18 International Microbiology (2015) www.im.microbios.org

Contents Volume 18 · 2015 Anaya-Velázquez F à Padilla-Vaca F Andradas Cà Martín N Argüelles JC à Guirao-Abad P Armas-Freire PI à Unexpected distribution of the fluoroquinolone-resistance gene qnrB in Escherichia coli isolates from different human and poultry origins in Ecuador, 85 doi:10.2436/20.1501.01.237 Atanasov Ià Stefanova K Aulicino M à Toledo A Ayris P à LERU roadmap towards Open Access, 195 doi:10.2436/20.1501.01.250 Bačun-Družina V à Križanović S Balatti P à Toledo A Berenguer J à Blesa A Berlanga M à Functional symbiosis and communication in microbial ecosystems. The case of wood-eating termites and cockroaches, 159 doi:10.2436/20.1501.01.246 Berlanga M à Orús P Björnshauge L à Ayris P Blaz J à Espinosa-Asuar L Blesa A à Contribution of vesicle-protected extracellular DNA to horizontal gene transfer in Thermus spp., 177 doi:10.2436/20.1501.01.248 Butorac A à Križanović S Cabeza MC à Velasco R Calogero R à Cappello S Calva E à Martínez-Gamboa A Cambero MI à Velasco R Cappello S à Bioremediation of oil polluted marine sediments: A bio-engineering treatment, 127 doi:10.2436/20.1501.01.242 Cevallos W à Armas-Freire PI Chou JW à Huang HY Christensen JB à Kristiansen JE Cindrić M à Križanović S Collier M à Ayris P Das S à Kristiansen JE Dastidar SG à Kristiansen JE de Vries S à Ayris P Denaro R à Cappello S Dolan MFà Soyer-Gobillard M-O Eguiarte LE à Espinosa-Asuar L Eisenberg JNS à Armas-Freire PI Escalante AE à Espinosa-Asuar L

Espinosa-Asuar L à Aquatic bacterial assemblage structure in Pozas Azules, Cuatro Cienegas Basin, Mexico: Deterministic vs. stochastic processes, 105 doi:10.2436/20.1501.01.240 Fernández-Ibáñez P à Polo D Fernández-Mora M à Martínez-Gamboa A Ferwerda E à Ayris P Fisher JC à McLellan SL Franco B à Padilla-Vaca F García-Fernández I à Polo D Gasca-Pineda J à Espinosa-Asuar L Genovese L à Cappello S Genovese M à Cappello S Giuliano L à Cappello S Gómez-Pérez L à Orús P González C à Guerra M González K à Guerra M González-Fandos E à The 25th SEM Congress (Logroño, Spain, July 7-10, 2015), 135 doi:10.2436/20.1501.01.243 González-Fandos E à Effect of propionic acid on Campylobacter jejuni attached to chicken skin during refrigerated storage, 171 doi:10.2436/20.1501.01.247 González-Párraga P à Guirao-Abad P Guerra M à Dormancy in Deinococcus sp. UDEC-P1 as a survival strategy to escape from deleterious effects of carbon starvation and temperatures, 189 doi:10.2436/20.1501.01.249 Guerrero R à Year’s comment, 203 doi: 10.2436/20.1501.01.251 Guirao-Abad JP à Strong correlation between the antifungal effect of amphotericin B and its inhibitory action on germ-tube formation in a Candida albicans URA+ strain, 25 doi:10.2436/20.1501.01.231 Hendricks O à Kristiansen JE Huang HY à Properties of Lactobacillus reuteri chitosan-calcium-alginate encapsulation under simulated gastrointestinal conditions, 61 doi:10.2436/20.1501.01.235 Jacobs N à Ayris P Jiménez-Díaz RM à Montes-Borrego M

Kambourova M à Stefanova K Kamerlin SCL à Hypercompetition in biomedical research evaluation and its impact on young scientist careers, 253 doi:10.2436/20.1501.01.257 King VAE à Huang HY Kishi F à Yanatori I Kosaka T à Suprayogi Kristiansen JE à Phenothiazines as a solution for multidrug resistant tuberculosis: From the origin to present, 1 doi:10.2436/20.1501.01.229 Križanović S à Characterization of a S-adenosyl-l-methionine (SAM)accumulating strain of Scheffersomyces stipitis, 117 doi:10.2436/20.1501.01.241 Krpan M à Križanović S

Landa BB à Montes-Borrego M Lenicov AMR à Toledo A Leranoz S à Orús P LERU à LERU Roadmap towards Open Access, 195 doi:10.2436/20.1501.01.250 Lertwattanasakul N à Suprayogi Levy K à Armas-Freire PI Limtong S à Suprayogi Lopes JRS à Montes-Borrego M López S à Toledo A

Mancini G à Cappello S Marrs CF à Armas-Freire PI Martín N à Interaction and cooperative effort among scientific societies. Twelve years of COSCE, 245 doi:10.2436/20.1501.01.256 Martínez M à Guerra M Martínez-Gamboa A à IS200 and multilocus sequence typing for the identification of Salmonella enterica serovar Typhi strains from Indonesia, 99 doi:10.2436/20.1501.01.239 Maya N à González-Fandos E McLellan SL à The microbiome of urban waters, 141 doi:10.2436/20.1501.01.244 Montes-Borrego M à Combined use of a new SNP-based assay and multilocus SSR markers to assess genetic diversity of Xylella fastidiosa subsp. pauca infecting citrus and coffee plants, 13 doi:10.2436/20.1501.01.230 Mrvčić J à Križanović S

265


Newton RJ à McLellan SL Nguyen MT à Suprayogi Ordóñez JA à Velasco R Orús P à Increasing antibiotiotic resistance in preservative-tolerant bacterial strains isolated from cosmetic products, 51 doi:10.2436/20.1501.01.234 Ouchi K à Yanatori I Padilla-Vaca F à Synthetic biology: Novel approaches for microbiology, 71 doi:10.2436/20.1501.01.236 Palchoudhuri S à Kristiansen JE Parra B à Guerra M Peña L à Espinosa-Asuar L Pérez-Arnedo I à González-Fandos E Polo D à Solar water disinfection (SODIS): Impact on hepatitis A virus and on a human Norovirus surrogate under natural solar conditions, 41 doi:10.2436/20.1501.01.233 Ponce de León A à Martínez-Gamboa A Proaño-Bolaños C à Armas-Freire PI

266

Radchenkova N à Stefanova K Reguera G à Microbes, cables, and an electrical touch, 151 doi:10.2436/20.1501.01.245 Rodrussamee N à Suprayogi Romalde JL à Polo D Roy DS à Kristiansen JE Santisi S à Cappello S Silva C à Martínez-Gamboa A Sinikara K à Ayris P Souza V à Espinosa-Asuar L Soyer-Gobillard M-O à Chromosomes of Protists: The crucible of evolution, 209 doi:10.2436/20.1501.01.252 Stanzer D à Križanović S Stefanova K à Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demonstrated by 16S rRNA and GH-57 genes, 217 doi:10.2436/20.1501.01.253 Suprayogi à A Kluyveromices marxianus 2-deoxyglucose-resistant mutant with enhanced activity of xylose utilization, 253 doi:10.2436/20.1501.01.255 Swan A à Ayris P

Tang YJ à Huang HY Toledo A à Antagonism of entomopathogenic fungi by Bacillus spp. associated with the integument of cicadellids and delphacids, 91 doi:10.2436/20.1501.01.238 Tomova A à Stefanova K Tomova I à Stefanova K Trueba G à Armas-Freire PI Tsen JH à Huang HY van Wesenbeeck A à Ayris P Velasco R à Use of E-beam radiation to eliminate Listeria monocytogenes from surface mould cheese, 33 doi:10.2436/20.1501.01.232 Wiesner M à Martínez-Gamboa A Yakimov MM à Cappello S Yamada M à Suprayogi Yanatori I à Chlanydia pneumoniae CPj0873 interaction with Huntingtin-protein14, 225 doi:10.2436/20.1501.01.254 Yasui Y à Yanatori I Zhang L à Armas-Freire PI


Authors Index · 2015 Anaya-Velázquez F à 71 Andradas C à 245 Argüelles JC à 25 Armas-Freire PI à 85 Atanassov I à 217 Aulicino M à 91 Ayris P à 195 Bačun-Družina V à 117 Balatti P à 91 Berenguer J à 177 Berlanga M à 51, 159 Blaz J à 105 Blesa A à 177 Björnshauge L à 195 Butorac A à 117 Cabeza MC à 33 Calogero R à 127 Calva E à 99 Cambero MI à 33 Cappello S à 127 Cevallos W à 85 Chou JW à 61 Christensen JB à 1 Cindrić M à 117 Collier M à 195

Das S à 1 Dastidar SG à 1 de Vries S à 195 Denaro R à 127 Dolan M à 209 Eguiarte LE à 105 Eisenberg JNS à 85 Escalante AE à 105 Espinosa-Asuar à 105 Fernández-Ibáñez P à 41 Fernández-Mora M à 99 Ferwerda E à 195 Fisher JC à 141 Franco B à 71 García-Fernández I à 41 Gasca-Pineda J à 105 Genovese L à 127 Genovese M à 127

Giuliano L à 127 Gómez-Pérez L à 51 González C à 189 González K à 189 González-Fandos E à 135, 171 González-Párraga P à 25 Guerra M à 189 Guerrero R à 203 Guirao-Abad JP à 25 Hendricks O à 1 Huang HY à 61 Jacobs N à 195 Jiménez-Díaz RM à 13 Kambourova A à 217 Kamerlin L à 253 King VAE à 61 Kishi F à 225 Kosaka T à 235 Kristiansen JE à 1 Križanović S à 117 Krpan M à 117 Landa BB à 13 Lenicov AMR à 91 Leranoz S à 51 Lertwattanasakul N à 235 LERU Open Access Working Group à 195 Levy K à 85 Limtong S à 235 Lopes JRS à 13 López S à 91 Lorena P à 105

Ordóñez JA à 33 Orús P à 51 Ouchi K à 225 Padilla-Vaca F à 71 Palchoudhuri S à 1 Parra B à 189 Peña L à 105 Pérez-Arnedo I à 171 Polo D à 41 Ponce de León A à 99 Proaño-Bolaños C à 85 Radchenkova N à 217 Reguera G à 151 Rodrussamee N à 235 Romalde JL à 41 Roy DS à 1 Santisi S à 127 Silva C à 99 Sinikara K à 195 Souza V à 105 Soyer-Gobillard M-O à 209 Stanzer D à 117 Stefanova K à 217 Suprayogi à 235 Swan A à 195 Tang YJ à 61 Toledo A à 91 Tomova A à 217 Tomova I à 217 Trueba G à 85 Tsen JH à 61

Mancini G à 127 Marrs CF à 85 Martín N à 245 Martínez M à 189 Martínez-Gamboa A à 99 Maya N à 171 McLellan SL à 141 Montes-Borrego M à 13 Mrvčić J à 117

van Wesenbeeck A à 195 Velasco R à 33

Newton RJ à 141 Nguyen MT à 235

Zhang L à 85

Wiesner M à 99 Yakimov MM à 127 Yamada M à 235 Yanatori I à 225 Yasui Y à 225

267


Keywords Index ¡ 2014 Amphotericin B 25 Antagonism 91 Antibiotics 51 Aquatic food webs 141 Archaea 217 Artificial cells 71 Astrobiology 71 Bacillus spp. 91 Bacterial assemblage structure 105 Bacterial diversity 105 Bacterial molecular typing 99 Bioethics 71 Biogeography 105 Biomedical publications 253 Bioremediation 127 Biostimulation 127 Burkholderia 51 C-24 sterol methyltransferase (Erg6p) 117 Campylobacter jejuni 171 Candida albicans 25 C-cytochromes 151 Cell killing 25 Chitosan-calcium-alginate encapsulation 61 Chlamydia pneumoniae 225 Chronically polluted sediments 127 Cicadellidae 91 Citrus variegated chlorosis 13 Clonal complex 99 Coffee leaf scorch 13 Corophium orientale (Crustacea, Amphipoda) 127 COSCE 245 Cosmetic preservatives 51 Cross-resistance 51 Cuatro Cienegas, Mexico 105 Deinococcus 189 Delphacidae 91 Dormancy 189 Dinoflagellates 209 Dinokaryon 209 Dinomitosis 209 E-beam radiation 33 Ectosymbiosis 159 Electrochemical reactors 151 Enterobacter 51 Entomopathogenic fungi 91 Escherichia coli 85 Ethanol fermentation on xylose 235 Excellence evaluation 253 Extracellular vesicles 177 Eukaryotic nucleous 209

268

Flow cytometry 189 Food safety objective (FSO) 33 Gene qnrB 85 Genetic engineering 71 Genomics 71 Geobacter 151 Germ-tube 25 GH-57 gene 217 Glucose repression 235 Gut microbiota 159 Haplotype characterization 13 Hepatitis A virus (HAV) 41 HIP14 225 Holobiont 159 Horizontal gene transfer 177 Host-plant association 13 Hot spring 217 Human health 141 Industrial poultry operations 85 Information overload 253 Infrastructure and sanitation 141 Inland waters 105 Insertion sequence IS200 99 Intracellular pathogen 335 Kluyveromyces marxianus 235 Lactobacillus reuteri 61 Listeria monocytogenes 33,61 LogroĂąo (LaRioja) 135 Lower-termites 159 Meat safety 171 Metabolism 189 Microbial fuel cells 151 Multilocus sequence typing (MLST) 99 Murine Norovirus (MNV-1) 41 Mycobacterium tuberculosis 1 Nanowires 151 Next generation sequencing 141 Oil-degrading bacteria 127 Open Access 195 Pathogen reduction 171 Pathogenesis 71 Phenotiazines 1 Phylogenetic analysis 217 Poultry 171 Probiotic properties 61

Pseudomonas 51 Pseudomonas spp. 171 Protist chromosomes 209 Protein mis-sorting 225 Quinolone resistance 85 Research competition 253 s-adenosyl-l-methionine

(SAM) 117 Salmonella Typhi 99 SAM accumulating yeast 117 Scheffersomyces stipitis 117 SEM congress 135 Simulated gastrointestinal conditions 61 Soft mould-ripened cheeses 33 Solar water disinfection (SODIS) 41 Spanish microbiology 135 Starvation 189 Synthetic biology 71 Thermus 177 Thioridazine 1 Tuberculosis 1 Type IV pili 151 Thermotolerant yeast 235 Urban fresh waters 141 Urban hospitals 85 Vector transmission 13 Vesicle transport 225 Water disinfection 41 Wood-eating cockroaches 159 Xylem-limited bacteria 13 Yeast two-hybrid screening CPj0783-HIP14 225 Young scientists careers 253 16S rRNA gene 217 2-Deoxyglucose-resistant mutants 235 5-Fluorocytosine 25


List of reviewers · 2015 The editorial staff of International Microbiology thanks the following persons for their invaluable assistance in reviewing manuscripts from January through December 2015. The names of several reviewers have been omitted at their request. Aguirre, Juan. University of Prince Edward Island, Charlottetown, Canada Amils, Ricardo. Autonomous University of Madrid, Madrid, Spain Andrew Lang. Memorial University, St. John’s, Canada Antón, Josefa. University of Alicante, Alicante, Spain Ayala, Juan. Autonomous University of Madrid, Madrid, Spain Baldrianm, Petr. Institute of Microbiology, CAS, Prague, Czech Republic Barberan, Albert. University of Colorado, Boulder, CO, USA Beney, Laurent. University of Burgundy, Dijon, France Berenguer, José. Autonomous University of Madrid, Madrid, Spain Berlanga, Mercedes. University of Barcelona, Barcelona, Spain Bonaterra, Anna. University of Girona, Girona, Spain Borrego, Juan José. University of Malaga, Malaga, Spain Boscia, Donato. CNR, Bari, Italy Butaye, Patric. Ross University, Iselin, NJ, USA Campoy, Sussana. Autonomous Univ. of Barcelona, Bellaterra, Spain Casamayor, Emili O. Center for Advanced Studies, Blanes, Spain Chen, Ding. UT Southwestern Medical Center, Dallas, TX, USA Christodoulides, Myron. University of Southampton, Southampton, UK Church, Georges. Harvard University, Cambridge, MA, USA Coque, Teresa. Hospital Univ. Ramón y Cajal (IRYCIS), Madrid, Spain Cubero, Jaime. INIA, Madrid, Spain Da Costa, Milton. University of Coimbra, Coimbra, Portugal Díaz, Ramón. University of Navarra, Pamplona, Spain Dolan, Michael. University of Amherst, Amherst, MA, USA Dung, Ngo Thi Phuong. Can Tho University, Can Tho City, Vietnam Dworkin, Jonathan. Columbia University, New York, NY, USA Esteve, Isabel. Autonomous Univ. of Barcelona, Barcelona, Spain García, Ernesto. CIB-CSIC, Madrid, Spain Garcìa del Portillo, Francisco. CNB-CSIC, Madrid, Spain Giraldo, Rafael. CIB-CSIC, Madrid, Spain Guarro, Josep. University Rovira Virgili, Reus, Spain Guerrero, Ricard. University of Barcelona, Barcelona, Spain Gutiérrez, Juan Carlos. Complutense Univ. of Madrid, Madrid, Spain

Herrero, Enric. University of Lleida, Lleida, Spain Huber, Julia. MBL, Woods Hole, MA, USA Imperial, Juan. Technical University of Madrid, Madrid, Spain Iriberri, Juan. University of the Basque Country, Bilbao, Spain Jones, Rheinallt. Emory University, Atlanta, GA, USA Ladero, Víctor. IPLA, CSIC, Villaviciosa, Spain Lang, Andrew. Memorial University, St. John’s, NL, Canada López Lastra, Claudia. Center of Parasitology Studies, La Plata, Argentina Martins, Bruna. Universidade Estadual de Campinas, Campinas, Brazil Martiny, Jennifer. University of California, Irvine, CA, USA Mas, Jordi. Autonomous Univ. of Barcelona, Barcelona, Spain Méndez, Beatriz. University of Buenos Aires, Buenos Aires, Argentina Mira, Alex. Fund Health & Biomed Oral Microbiome Lab, Valencia, Spain Montesinos, Emili. University of Girona, Girona, Spain Nascimento, Maria San José. University of Porto, Porto, Portugal Nogales, Balbina. Univ. of the Balearic Islands, Palma de Mallorca, Spain Pallecchi, Lucia. Università di Siena, Siena, Italy Partridge, Sally. University of Sydney, Sydney, Australia Pedrós Alió, Carles. CNB-CSIC, Madrid, Spain Penadés, José R. Research Institute in Livestock Mountain, Segorbe, Spain Piqueras, Mercè. Catalan Assoc. Science Communication, Barcelona, Spain Puig, Sergi. IATA-CSIC, Paterna, Valencia Quindós, Guillermo. University of Basque Country, Bilbao, Spain Requena, Teresa. Inst. of Food Science Research-CSIC, Cantoblanco, Spain Rodríguez, Ana. IPLA-CSIC, Villaviciosa, Spain Suárez, Evaristo. University of Oviedo, Oviedo, Spain Tamarit, Jordi. University of Lleida, Lleida, Spain Theerthankar, Das. University of New South Wales, Sydney, Australia Vila, Jordi. University of Barcelona, Barcelona, Spain Viñas, Miquel. University of Barcelona, Barcelona, Spain Wilson, Stephen W. Univ. of Central Missouri, Warrensburg, MO, USA Xairó, Dolors. Grifols Group, Barcelona, Spain Zhang, Chengxian. Vanderbilt University, Nashville, TN, USA

269


Volume 18(4) DECEMBER 2015

Acknowledgement of Institutional Subscriptions International Microbiology staunchly supports the policy of open access (Open Access Initiative, see Int Microbiol 7:157161). Thus, the journal recognizes the help received from the many institutions and centers that pay for a subscription—in spite of the possibility to download complete and current issues of the journal free of charge. We would therefore like to thank those entities. Their generous contribution, together with the efforts of the many individuals involved in preparing each issue of International Microbiology, makes publication of the journal possible and plays an important role in improving and expanding the field of microbiology in the world. Some of those institutions and centers are: Area de Microbiología. Departamento de Biología Aplicada. Universidad de Almería / Biblioteca. Institut Químic de Sarrià. Universitat Ramon Llull. Barcelona / Biblioteca. Instituto Nacional de Seguridad e Higiene en el Trabajo-Ministerio de Trabajo y Asuntos Sociales. Barcelona / Ecologia microbiana. Departament de Genètica i de Microbiologia. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Biblioteca. Institut de Biotecnologia i Biomedicina. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Laboratori d’Ecogenètica. Departament de Microbiologia. Universitat de Barcelona / Departament de Microbiologia i Parasitologia Sanitàries. Facultat de Farmàcia. Universitat de Barcelona / Societat Catalana de Biologia. Institut d’Estudis Catalans. Barcelona / Departamento de Microbiologia. Universidade Federal de Minas Gerais. Belo Horizonte. Brasil / Departamento de Inmunología, Microbiología y Parasitología, Universidad del País Vasco, UPV-EHU. Bilbao / Biblioteca. Universidad de Buenos Aires. Argentina / Biblioteca. Facultad de Ciencias. Universidad de Burgos / Biblioteca. Departamento de Producción Animal CIAM-Centro Mabegondo. Abegondo (Coruña) / Laboratorio de Microbioloxia. Universidade da Coruña. A Coruña / Biblioteca. Divisió

270

Alimentària del IRTA-Centre de Tecnologia de la Carn. Generalitat de Catalunya. Monells (Girona) / Biblioteca Montilivi. Facultat de Ciències. Universitat de Girona / Área de Microbiología. Departamento de Ciencias de la Salud. Universidad de Jaén / Microbiologia. Departament de Ciències Mèdiques Bàsiques. Facultat de Medicina. Universitat de Lleida / Laboratorio de Microbiología Aplicada. Centro de Biología Molecular. Universidad Autónoma de Madrid-CSIC. Cantoblanco (Madrid) / Laboratorio de Patógenos Bacterianos Intracelulares. Centro Nacional de BiotecnologíaCSIC. Cantoblanco (Madrid) / Grupo de Investigación de Bioingeniería y Materiales (BIO-MAT). Escuela Técnica Superior de Ingenieros Industriales. Universidad Politécnica de Madrid / Biblioteca. Centro de Investigaciones Biológicas, CSIC. Madrid / Merck Sharp & Dohme de España. Madrid / Departamento de Microbiología. Facultad de Ciencias. Universidad de Málaga / Grupo de Fisiología Microbiana. Depto. de Genética y Microbiología. Universidad de Murcia. Espinardo (Murcia) / Library. Department of Geosciences. University of Massachusetts-Amherst. USA / Biblioteca de Ciencias. Universidad de Navarra. Pamplona / Grupo de Genética y Microbiología. Departamento de Producción Agraria. Universidad Pública de Navarra. Pamplona / Microbiología Ambiental. Departamento de Biología. Universidad de Puerto Rico. Río Piedras. Puerto Rico / Biblioteca General. Universidad San Francisco de Quito. Ecuador / Biblioteca. Facultat de Medicina. Universitat Rovira Virgili. Reus / Instituto de Microbiología Bioquímica-Departamento de Microbiología y Genética. CSIC-Universidad de Salamanca / Departamento de Microbiología y Parasitología. Universidad de Santiago de Compostela. Santiago de Compostela / Laboratorio de Referencia de E. coli (LREC). Facultad de Veterinaria. Universidad de Santiago de Compostela. Lugo / Departamento de Genética. Universidad de Sevilla / Tecnología de los Alimentos. Facultad de Ciencias. Universidad de Vigo / General Library. Marine Biological Laboratory. Woods Hole, Massachusetts, USA.


A3


Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686 A4

Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter.SI units should be used throughout. For Nomenclature of organisms genus and species scientific names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewers. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.


Turn static files into dynamic content formats.

Create a flipbook
International Microbiology by Institut d'Estudis Catalans - Issuu