Skip to main content

International Microbiology

Page 1

Publication Board Editorial Board Editor-in-chief Carles Pedrós-Alió, Institute of Marine Sciences-CSIC Secretary General Ricard Guerrero, University of Barcelona Associate Editors Mercedes Berlanga, University of Barcelona Mercè Piqueras, International Microbiology Wendy Ran, International Microbiology Adjunct Secretary and Webmaster Nicole Skinner, International Microbiology Managing Coordinator Carmen Chica, International Microbiology Members Teresa Aymerich, University of Girona Susana Campoy, Autonomous University of Barcelona Jesús García-Gil, University of Girona Josep Guarro, Rovira i Virgili University Enrique Herrero, University of Lleida Emili Montesinos, University of Girona José R. Penadés,Institute of Mountain Livestock-CSIC Jordi Vila, University of Barcelona Jordi Urmeneta, University of Barcelona Addresses Editorial Office International Microbiology Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org www.im.microbios.org Spanish Society for Microbiology Vitruvio, 8 28006 Madrid, Spain Tel. +34-915613381. Fax +34-915613299 E-mail: sem@microbiologia.org www.semicrobiologia.org Publisher Viguera Editores S.L. Plaza Tetuán, 7 08010 Barcelona, Spain Tel. +34-932478188. Fax +34-932317250 E-mail: info@viguera.com; www.viguera.com © 2011 Spanish Society for Microbiology & Viguera Editores, S.L. Printed in Spain Print ISSN: 1139-6709 Online ISSN: 1618-1095 D.L.: B.23341-2004

With the collaboration of the Institute for Catalan Studies

P2

Ricardo Amils, Autonomous University of Madrid, Madrid, Spain Albert Bordons, Rovira i Virgili University, Tarragona, Spain Albert Bosch, University of Barcelona, Barcelona, Spain Enrico Cabib, National Institutes of Health, Bethesda, MD, USA Victoriano Campos, Pontificial Catholic University of Valparaíso, Chile Josep Casadesús, University of Seville, Sevilla, Spain Yehuda Cohen, The Hebrew University of Jerusalem, Jerusalem, Israel Rita R. Colwell, Univ. of Maryland & Johns Hopkins University, MD, USA Katerina Demnerova, Inst. of Chem. Technology, Prague, Czech Republic Esteban Domingo, CBM, CSIC-UAM, Cantoblanco, Madrid, Spain Mariano Esteban, Natl. Center for Biotechnol., CSIC, Cantoblanco, Spain M. Luisa García López, University of León, León, Spain Steven D. Goodwin, University of Massachusetts-Amherst, MA, USA Juan C. Gutiérrez, Complutense University of Madrid, Madrid, Spain Johannes F. Imhoff, University of Kiel, Kiel, Germany Juan Imperial, Technical University of Madrid, Madrid, Spain John L. Ingraham, University of California-Davis, CA, USA Juan Iriberri, University of the Basque Country, Bilbao, Spain Roberto Kolter, Harvard Medical School, Boston, MA, USA Germán Larriba, University of Extremadura, Badajoz, Spain Paloma Liras, University of León, León, Spain Ruben López, Center for Biological Research, CSIC, Madrid, Spain Juan M. López Pila, Federal Environ. Agency, Dessau-Roßlau, Germany Michael T. Madigan, Southern Illinois University, Carbondale, IL, USA M. Benjamín Manzanal, University of Oviedo, Oviedo, Spain Beatriz S. Méndez, University of Buenos Aires, Buenos Aires, Argentina Diego A. Moreno, Technical University of Madrid, Madrid, Spain Ignacio Moriyón, University of Navarra, Pamplona, Spain José Olivares, Experimental Station of Zaidín, CSIC, Granada, Spain Juan A. Ordóñez, Complutense University of Madrid, Madrid, Spain Eduardo Orías, University of California-Santa Barbara, CA, USA José M. Peinado, Complutense University of Madrid, Madrid, Spain J. Claudio Pérez Díaz, Ramón y Cajal Institute Hospital, Madrid, Spain Antonio G. Pisabarro, Public University of Navarra, Pamplona, Spain Carmina Rodríguez, Complutense University of Madrid, Madrid, Spain Manuel de la Rosa, Virgen de las Nieves Hospital, Granada, Spain Tomás A. Ruiz Argüeso, Technical University of Madrid, Spain Hans G. Schlegel, University of Göttingen, Germany James A. Shapiro, University of Chicago, IL, USA John Stolz, Duquesne University, Pittsburgh, PA, USA James Strick, Franklin & Marshall College, Lancaster, PA, USA Jean Swings, Ghent University, Ghent, Belgium Gary A. Toranzos, University of Puerto Rico, San Juan, Puerto Rico Antonio Torres, University of Seville, Sevilla, Spain Josep M. Torres-Rodríguez, Municipal Inst. Medical Research, Barcelona José A. Vázquez-Boland, University of Edinburgh, Edinburgh, UK Antonio Ventosa, University of Seville, Sevilla, Spain Tomás G. Villa, Univ. of Santiago de Compostela, Santiago de C., Spain Miquel Viñas, University of Barcelona, Barcelona, Spain Dolors Xairó, Biomat, S.A., Grifols Group, Parets del Vallès, Spain


CONTENTS INTERNATIONAL MICROBIOLOGY (2011) 14:183-244 ISSN 1139-6709 www.im.microbios.org

Volume 14, Number 4, December 2011

EDITORIAL

Guerrero R Lynn Margulis (1938-2011), in search of the truth

183

RESEARCH REVIEW

César CE, Álvarez L, Bricio C, van Heerden E, Littauer D, Berenguer J Unconventional lateral gene transfer in extreme thermophilic bacteria

187

RESEARCH ARTICLES

Blasco L, Veiga-Crespo P, Viñas M, Villa TG A new disruption vector (pDHO) to obtain heterothallic strains from both Saccharomyces cerevisiae and Saccharomyces pastorianus

201

Olmo JL, Esteban GF, Finlay BJ New records of the ectoparasitic flagellate Colpodella gonderi on non-Colpoda ciliates

207

Mora I, Cabrefiga J, Montesinos E Antimicrobial peptide genes in Bacillus strains from plant environments

213

Araque I, Reguant C, Rozès N, Bordons A Influence of wine-like conditions on arginine utilization by lactic acid bacteria

225

BOOK REVIEW

235

ANNUAL INDEXES

237

A1


Spanish Society for Microbiology The Spanish Society for Microbiology (SEM) is a scientific society founded in 1946 at the Jaime Ferrán Institute of the Spanish National Research Council (CSIC), in Madrid. It’s main objectives are to foster basic and applied microbiology, promote international relations, bring together the many professionals working in this science, and contribute to the dissemination of science in general and microbiology in particular, among society. It is an interdisciplinary society, with approximately 1700 members working in different fields of microbiology.

International Microbiology Aims and scope INTERNATIONAL MICROBIOLOGY, the official journal of the SEM, is a peerreviewed, open access journal whose aim is to advance and disseminate information in the fields of basic and applied microbiology among scientists around the world. The journal publishes research articles and complements (short papers dealing with microbiological subjects of broad interest such as editorials, perspectives, book reviews, etc.). A feature that distinguishes it from many other microbiology journals is a broadening of the term “microbiology” to include eukaryotic microorganisms (protists, yeasts, molds), as well as the publication of articles related to the history and sociology of microbiology. INTERNATIONAL MICROBIOLOGY offers high-quality, internationallybased information, short publication times (< 3 months), complete copy-

editing service, and online open access publication available to any reader prior to distribution of the printed journal. The journal encourages submissions in the following areas: • Microorganisms (prions, viruses, bacteria, archaea, protists, yeasts, molds) • Microbial biology (taxonomy, genetics, morphology, physiology, ecology, pathogenesis) • Microbial applications (environmental, soil, industrial, food and medical microbiology, biodeterioration, bioremediation, biotechnology) • Critical reviews of new books on microbiology and related sciences are also welcome. Jounal Impact Factor The 5-Year Journal Impact Factor (VIF) of INTERNATIONAL MICROBIOLOGY is 2.928. The journal is covered in several leading abstracting and indexing databases, including the following ones: AFSA Marine Biotechnology Abstracts; Biological Abstracts; Biotechnology Research Abstracts; BIOSIS Previews; CAB Abstracts; Chemical Abstracts; Current Contents – Agriculture, Biology & Environmental Sciences; EBSCO; Embase; Food Science and Technology Abstracts; Google Scholar; IEDCYT; IBECS; Latíndex; MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded; Scopus

Cover legends Front cover CENTER. The soil ciliated protozoon Colpoda inflata as seen after Fernández-Galiano silver-carbonate impregnation. Micrograph by J.L. Olmo, at the former Centre for Ecology and HydrologyWindermere, The Ferry House, The Lake District, Cumbria (UK). The image shows the ciliary rows (somatic kineties) on the ciliate’s surface abutting towards the cell equator, where the oral apparatus (seen on the photograph as two fields of packed kinetosomes) is located. The cell’s macronucleus is the brown globular mass in the centre of the ciliate. (Magnification ca. 1500×)

[See article by Olmo et al., pp. 207-211, this issue.] UPPER LEFT. Transmission electron micrograph of negatively stained bacteriophages of the extremely halophilic bacterium Salinobacter ruber. The phages were isolated from brines of a crystallizer pond at the Bras del Port salterns (Santa Pola, Alicante, Spain). Micrograph by Pepa Antón, University of Alicante, Spain, and Inmaculada Meseguer, University Miguel Hernández, Alicante, Spain. (Magnification, ca. 250,000×) UPPER RIGHT. Transmission electron micrograph of two archaeal square cells of Haloquadratum spp. from a crystallizer pond at the Bras del Port salterns (Santa Pola, Alicante, Spain). Gas vacuoles are visible as bright spots around the edges of the cells. An extracellular filamentous structure can be seen as well. By Inmaculada Meseguer, University Miguel Hernández, Alicante, Spain. (Magnification ca. 12,000×) LOWER LEFT. Micrograph of a protist (darkfield microscopy) from the hindgut of an individual of the soldier caste of Reticulitermes grassei, from Cordova, Spain. Termites are eusocial and colonies consist of distinct castes, including sterile workers (pseudergates), soldiers, and the reproductive kings and queens. Preparation by Mercedes Berlanga, University of Barcelona, Spain, and micrograph by Rubén Duro. (Magnification, ca. 2000×). LOWER RIGHT. Fruit bodies of the edible basidiomycete Pleurotus ostreatus (oyster mushroom) growing on a substrate of wheat straw. The mycelium colonizes the wheat straw until the appropriate environmental conditions trigger the change in growth phase and fruit bodies flush in bunches. The bunch size varies

with the strains; the bunches produced by strain N001 (picture) can be formed by up to 20 carpophores and reach a fresh weight of up to 250 g. This strain contains two nuclei whose genome has been sequenced by L. Ramírez and A.G. Pisabarro, and their team, at the Public University of Navarre, Pamplona, Spain in collaboration with the Joint Genome Institute, Walnut Creek, CA, USA. (Magnification, ca. 0.5×)

Back cover Portrait of Néstor Morales Villazón (1879–1957), a pioneer in microbiology in Bolivia. Born in Cochabamba (Bolivia) on February 2, 1879 to Constantino Morales and Aurelia Villazón, he entered the medical school in his hometown, later moving to La Paz to finish his studies. He was a surgeon in the sanitation services of the Federal Army during the early days of the Revolution in 1898, carrying out his work at the Landaeta Hospital and the Public Hospital, with a later appointment as Surgeon to the Army Training School. Soon he was named Assistant Professor of Dissection at the School of Medicine of the University of La Paz, and within a short time Professor of Anatomy. In 1904, Morales was sent to Europe to be trained in bacteriology. Upon his return, he held several positions: Professor of the School of Hygiene, head of the Bacteriology Section at the Board of Health, Dean of the Medical School, and director of the National Institute for Bacteriology. In 1911, he founded the Dental School of La Paz; in 1915, he organized the Pediatrics Section of Landaeta Hospital, even writing a book on childcare. However, he was fascinated by microbiology and most of his professional career was devoted to what was, at that time, a new field of medicine and biology. In 1912, he founded a journal, Revista de Bacteriología e Higiene, which he used as a platform to improve Bolivian hygiene and to promote the prevention of infectious diseases—mainly typhoid fever—through vaccination. Despite his invaluable work and having received many honors both in his country—in 1913 the Senate of Bolivia awarded him a gold medal—and abroad, in 1920 he was forced into exile for political reasons. He began a new life in Argentina but never forgot his beloved Bolivia. During the El Chaco War, he sent vaccines and other products to the Bolivian National Institute of Bacteriology, so that its work could continue. He died in Buenos Aires (Argentina) on May 11, 1957.

Front cover and back cover design by MBerlanga & RGuerrero

A2


EDITORIAL INTERNATIONAL MICROBIOLOGY (2011) 14:183-186 DOI: 10.2436/20.1501.01.147 ISSN: 1139-6709 www.im.microbios.org

Lynn Margulis (1938–2011), in search of the truth Ricardo Guerrero President of the Spanish Society for Microbiology rguerrero@microbios.org

It would have been impossible for INTERNATIONAL MICROto comment on the microbiology-related events of the year 2011 without noting the death of Lynn Margulis, one of the most outstanding biologists of the 20th century and closely involved with this journal since its beginnings, in 1998, first as Associate Editor and, later, as Honorary Associated Editor. For me, the loss is both a professional and a personal one, as Lynn was an important scientific collaborator as well as a my partner for almost 30 years. Lynn Margulis (née Lynn Petra Alexander) died at her home in Amherst, Massachusetts, on November 22, 2011, after suffer-

BIOLOGY

friends, and admirers and by those who, while intellectually at odds with her ideas on evolution, nonetheless recognized the value of her work. Rather than repeat what has already been written, this editorial will focus mainly on her relationship with Spain, the Spanish Society for Microbiology (SEM), and INTERNATIONAL MICROBIOLOGY. But first let’s consider the role of Lynn Margulis in the field of microbiology. Was she indeed a microbiologist? She was rarely seen in a lab coat, nor did she prepare microbial cultures or isolate strains for identification. However, her intellectual contributions were essential to many discoveries,

Fig. 1. Lynn Margulis (1938-2011). Photo by I. Fernández, at the Institute for Catalan Studies, Barcelona, in April 2009.

ing a massive stroke. Her death was noted by the many newspapers and other media in the USA and, internationally, in prominent scientific journals and newspapers. The announcement was followed by tributes from her many colleagues,

reflecting her ability to see “the big picture” and thus to interpret both the research results obtained in her own lab and those of her colleagues in a broad range of related fields. She was an excellent observer of natural samples, usually in vivo,


184

INT. MICROBIOL. Vol. 14, 2011

under the photonic (as she liked to say) microscope. But she also had an extraordinary ability to interpret micrographs of any kind. In addition, her intellectual curiosity motivated her to frequently browse through the older scientific literature, even in languages that she did not understand. It was on one such occasion that she came across the works of Russian biologists such as Andrei Sergeivich Famintsyn (1835–1918), Konstantin Sergeevich Merezhkovsky (1855–1921), and, especially, Boris Mikhaylovich Kozo-Polyansky (1890–1957), who throughout their careers had emphasized the role of symbiosis in evolution. Famintsyn had developed a theory of symbiogenesis but, despite claims to the contrary, did not succeed in isolating and growing chloroplasts from plant cells. Merezhkovsky later maintained that chloroplasts had originated from cyanobacteria and he coined the term endosymbiosis to describe the evolution of novel traits by symbiosis. But it was Kozo-Polyansky who suggested that symbiosis could explain the evolution of cell motility. Nowadays, the notion that both chloroplasts and mitochondria were once free-living bacteria that established a symbiosis with larger, different prokaryotes is fully accepted. Transmission electron microscopy clearly showed that the contents of both “eukaryotic” organelles closely resemble their respective bacterial ancestors, while molecular biology confirmed that chloroplasts and mitochondria not only had their own DNA but also were phylogenetically related to two groups of prokaryotes: cyanobacteria and proteobacteria, respectively. During the late 20th century, Lynn Margulis and other microbiologists provided evidence that the most frequent and representative interactions among all the living beings on Earth are those of cooperation and symbiosis. The focus of Margulis’ work was what are widely known as protozoa and unicellular algae but which she referred to as protists, or protoctista. As an outstanding protistologist, she studied these eukaryotic species not as single entities, but mostly with respect to their symbiotic relationships, which in many cases had evolved to become permanent ones; yet she also carefully analyzed independently existing microorganisms. Her near-intuition for the role of symbiosis in evolution led her to approach the field of microbiology from the viewpoint of ecology, i.e., the relationships among organisms and between them and their environment. A tenet of modern biology is that any kind of life establishes some kind of connection with other living beings. These connections include transient symbiosis; that is, partners meet, live together for a certain amount of time, and then, depending on environmental conditions, separate. But there are also examples of highly complex communities, such as those inhabiting the termite hindgut, that have remained unaltered for millions of years

GUERRERO

because the environment has not been disrupted by external changes. Over the few last decades, more and more symbiotic relationships involving the participation of bacterial species have been revealed, such as Buchnera and aphids, Trychonympha and its endosymbiotic bacteria, and Wolbachia and Onchocerca volvulus. Throughout the 1970s, Lynn Margulis worked exclusively with eukaryotic microorganisms studying them from structural, physiological, genetic, evolutionary, and ecological perspectives. She was recognized as an expert in the field, as established by her role as coeditor, with John O. Corliss, Michael Melkonian, and David J. Chapman, of Handbook of Protoctista, which Lewis Thomas considered “a volume of similar scientific indispensability” as Bergey’s Manual of Systematic Bacteriology. It was in the early 1980s that Lynn Margulis began to consider prokaryotes. This late interest can be explained by the attitude that prevailed in microbiology during the years that she had worked towards her doctorate. At that time, bacteria were studied mostly in terms of pathogenesis and Margulis was not only uninterested in that viewpoint, she believed it was far too narrow. In 1983, she began the first of many collaborations with Spanish microbiologists—prokaryotologists indeed—first from the Autonomous University of Barcelona, and then, in 1988, from the University of Barcelona. In these pioneering studies in what was the still young science of bacterial ecology, she discovered the fascinating world of prokaryotic physiology and genetics. Her soon to be acquired detailed understanding of these microorganisms is reflected in the Introduction of the above-mentioned Handbook of Protoctista. Her collaboration with Karlene V. Schwartz was a fruitful one, resulting in the publication of Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth (first edn., 1982), in the words of its authors “an illustrated guide to the diversity of life” and a book “about the biota, the living surface of the Planet Earth. A catalogue of life’s diversity and virtuosity.” Stephen Jay Gould, in the Foreword, called the book the “rarest of intellectual treasures” and drew upon its contents in pointing out that the greatest division among living beings was not “between plants and animals, but within the onceignored microorganisms—the prokaryotic Bacteria and the eukaryotic Protoctista.” Subsequent changes in our understanding of the relationships among living beings, brought about by the information obtained through DNA sequencing, have been incorporated in the more recent editions of this book. Typically, great achievements are the result of many years of experience. But, in the case of Lynn Margulis, her unique way of thinking combined with fortuitous circumstances


LYNN MARGULIS

INT. MICROBIOL. Vol. 14, 2011

185

Fig. 2. Lynn Margulis with friends from the Autonomous University of Barcelona and the University Barcelona during their official visit to the modern Library of Alexandria, Egypt on December 31, 2003.

resulted in discoveries already during her doctoral research that most scientists do not achieve in a lifetime and which quickly launched her career in biology. Thus, in the early 1960s, she developed the theory of serial endosymbiosis as an evolutionary mechanism explaining the origin of the eukaryotic cell. The theory followed from her appreciation of the fact that, in a world of nuclear inheritance, there were many cases of non-Mendelian heredity, for example, in photosynthetic mutants of plants and algae, in the cortical inheritance in Paramecium, and in the killer phenomenon of yeast. Lynn Margulis explored the scientific literature to find evidence for cytoplasmic heredity and predicted the existence of organellar DNA. Her first paper (under her former name of Lynn Sagan) advanced her hypothesis but it was rejected by some fifteen editors before James Danielli, co-originator of the theory of the lipoprotein bilayer of membranes, dared to publish it in the Journal of Theoretical Biology, in 1967. Her hypothesis met with strong opposition from many colleagues, such as Roger Y. Stanier, who happened to meet Margulis in an elevator in at the University of California-Berkeley and told her that her strange theories on the origin of mitochondria and chloroplasts would never gain acceptance. Years later, after molecular biology and microscopy had proven Stanier wrong by providing overwhelming support for the hypothesis, he and Margulis, through mutual friends, were able to reconcile their intellectual differences with each other.

Mexico was the bridge that linked Lynn Margulis with the Spanish culture and language. At the age of 16, while doing anthropological field research in the country, Margulis learned to speak Spanish and was soon fluent. This ability was to later serve her well, as it allowed her to quickly feel at home in Spain—where, from 1983 on, she often traveled for research and teaching—and to lecture there in Spanish, thus gaining the further admiration of her Spanish students and colleagues. However, Margulis’ academic activities were not confined to the lecture rooms of Spanish universities; rather, she was a popular speaker, often invited to give lectures and to participate in scientific meetings and workshops not only in university settings but also in museums, research centers, schools and high schools, cultural and commercial centers, and even ancient palaces and castles (in 2007 she inaugurated the new premises of Don Alvaro de Luna’s castle, in Arenas de San Pedro, Ávila). She never failed to attract a large audience, with people often resigned to sitting on the floor of a packed auditorium. She received honorary doctorates from the Autonomous University of Madrid, the University of Valencia, the Autonomous University of Barcelona, and the University of Vigo. Many of her books have been translated into Spanish—several of them also into Catalan and Basque—and over the years they have remained very popular, particularly among high-school biology teachers and biology university students, as her “rebellious” writing and thinking continue to resonate among young people.


186

INT. MICROBIOL. Vol. 14, 2011

The collaboration between Lynn Margulis and the SEM started in 1985, when she participated in several SEM-sponsored conferences. In 1998, when INTERNATIONAL MICROBIOLOGY replaced Microbiología SEM as the official SEM journal, her help was invaluable during the transition period, when the journal also sought a new publisher. With the debut of INTERNATIONAL MICROBIOLOGY, published by the Spanish division of Springer-Verlag, Lynn Margulis, along with other outstanding microbiologists, was appointed Associate Editor. This was a responsibility that she took quite seriously and with the full force of her intellectual energies: encouraging researchers to submit articles to the journal, acting as peer reviewer, submitting research articles from her own laboratory, and contributing historical perspectives as well as book reviews. In 2004, she became Honorary Associate Editor but maintained an active involvement with the journal. In an essay published in 1993, Lynn Margulis discussed what she called the “red shoe dilemma” that many women face when confronted with choosing between a professional career and family life. She remembered how—as a teenager—she was moved by the film The Red Shoes, in which a career conflict led a desperate ballerina to commit suicide. Lynn Margulis never even considered the need to choose. She recognized, however, that “children, husband, and excellence in original science are probably not simultaneously possible.” About herself, she wrote: “Probably, I have contributed to science because I twice quit my job as a wife. I abandoned husbands but stayed with children. I’ve been poor, but I’ve never been sorry.” Many of the obituaries have referred to Lynn Margulis as an evolutionary biologist. It is true that most of her research focused on evolution, especially on the role of symbiosis as a major evolutionary mechanism. But she also studied symbiosis in and of itself, specifically, in the relationships formed by microorganisms with other microbial but also with nonmicrobial organisms. These diverse aspects of symbiosis sparked Margulis’ passionate interest in the Gaia theory, postulated by British atmospheric chemist James E. Lovelock, to which she provided supporting (micro)biological evidence. She was indeed an advocate of microbes. She has left her footprint in the world of microbiology and will be remembered as one of the greatest innovative scientists of the 20th century. It would be difficult to summarize in only one sentence the main objective of Lynn Margulis’ life and work; instead, I remember this quote from David Bohm (American physicist, 1917–1992), which lately she always cited at the end of her lectures: “Science is the search for truth... whether we like it or not.”

GUERRERO

Articles by Lynn Margulis published in the SEM journals Microbiología SEM (1985-1997) and International Microbiology (started in 1998) Esteve I, Gaju N, Mas-Castellà J, Guerrero R, Margulis L (1995) Bacterial survival mechanisms in microbial mats. Microbiol SEM 11:397-399 Chapman MJ, Margulis L (1998) Morphogenesis by symbiogenesis (1998). Int Microbiol 1:319-326 Margulis L, Navarrete A, Solé M (1998) Cosmopolitan distribution of the large composite microbial mat spirochete, Spirosymplokos deltaeiberi. Int Microbiol 2:27-34 Wier A, Margulis L (2000) The wonderful lives of Joseph Leidy (1823-1891). Int Microbiol 3:55-58 Wier A, Ashen J, Margulis L (2000) Canaleparolina darwiniensis, gen. nov., sp. nov., and other pillotinaceae spirochetes from insects. Int Microbiol 3:213-223 Margulis L (2005) Hans Ris (1914-2004)–Genophore, chromosomes and the bacterial origin of chloroplasts. Int Microbiol 8:145-148

Book Reviews Margulis L (1999) Darwin among the machines. The Evolution of Global Intelligence [by George B. Dyson]. Int Microbiol 2:5758 Margulis L (1999) The Phototrophic Prokaryotes [by G.A. Peschek, W. Löffelhardt, G. Schmetterer, eds]. Int Microbiol 2:279-283 Margulis L (1999) J.D. Bernal. A Life in Science and Politics [by Brenda Swann, Francis Aprahamian, eds]. Int Microbiol 2:281282 Margulis L, Chica C (2000) Orígenes. Del Big Bang al Tercer Milenio [by Alfred Giner-Sorolla, Mercè Piqueras]. Int Microbiol 3:263-264 Margulis L (2001) The biography of a germ [by Arno Karlen]. Int Microbiol 4:55-56 Margulis L (2002) What evolution is [by Ernst Mayr]. Int Microbiol 5:103-104 Margulis L (2002) Tuberculosis: the greatest story never told [by Frank Ryan]. Int Microbiol 5:151-152 Margulis L (2003) Lichens of North America [by Irwin M. Brodo, Sylvia Duran Sharnoff, Stephen Sharnoff] Int Microbiol 6:149150 Margulis L (2004) Life on a Young Planet [byAndrew H. Knoll]. Int Microbiol 7:152


RESEARCH REVIEW INTERNATIONAL MICROBIOLOGY (2011) 14:187-199 DOI: 10.2436/20.1501.01.148 ISSN: 1139-6709 www.im.microbios.org

Unconventional lateral gene transfer in extreme thermophilic bacteria Carolina E. César1, Laura Álvarez,1 Carlos Bricio,1 Esta van Heerden,2 Dereck Littauer,2 José Berenguer1* 1

Center of Molecular Biology ‘Severo Ochoa’, Autonomous University of Madrid-CSIC, Madrid, Spain. Department of Microbial, Biochemical and Food Biotechnology, University of the Free State, Bloemfontein, South Africa

2

Received 30 October 2011 · Accepted 17 November 2011

Summary. Conjugation and natural competence are two major mechanisms that explain the acquisition of foreign genes throughout bacterial evolution. In recent decades, several studies in model organisms have revealed in great detail the steps involved in such processes. The findings support the idea that the major basis of these mechanisms is essentially similar in all bacteria. However, recent work has pinpointed the existence of new, evolutionarily different processes underlying lateral gene transfer. In Thermus thermophilus HB27, at least 16 proteins are required for the activity of one of the most efficient natural competence systems known so far. Many of those proteins have no similarities to proteins involved in natural competence in other well-known models. This unusual competence system is conserved, in association with the chromosome, in all other Thermus spp. genomes so far available, it being functional even in strains from isolated environments, such as deep mines. Conjugation is also possible among Thermus spp. Homologues to proteins implicated in conjugation in model bacteria are encoded in the genome of a recently sequenced strain of Thermus thermophilus and shared by other members of the genus. Nevertheless, processive DNA transfer in the absence of a functional natural competence system in strains in which no conjugation homologous genes can be found hints at the existence of an additional and unconventional conjugation mechanism in these bacteria. [Int Microbiol 2011; 14(4):187-199] Keywords: Thermus · thermophiles · lateral gene transfer (LGT) · conjugation · transformation

Introduction Comparative whole-genome analyses have revealed that prokaryotic genomes are extraordinarily plastic. The enormous internal variation found within closely related species and strains is most likely produced by the rapid gain (and loss) of genetic material through lateral gene transfer (LGT) [26,29]. Indeed, lateral gene transfer is a leading force driving the accelerated evolution of prokaryotes, conferring on bacteria the *Corresponding author: J. Berenguer Centro de Biología Molecular Severo Ochoa (UAM-CSIC) Universidad Autónoma de Madrid 28049 Cantoblanco (Madrid), Spain Tel. +34-911964498. Fax +34-911964420 E-mail: jberenguer@cbm.uam.es

unique ability to rapidly adapt to various environmental changes. Of particular relevance is the capability of prokaryotes to colonize novel, previously restricted ecological niches. This characteristic has come about by the lateral inheritance of settlement modules or operons that can deliver an entire new physiological ability in a single evolutionary event [32,39]. There are three classical pathways described for LGT: transduction, transformation, and conjugation. While transduction involves the accidental packaging of bacterial DNA into prophage capsids and its ulterior propagation through defective bacteriophage infection, transformation and conjugation involve specialized DNA transport machineries able to actively acquire foreign DNA or to transfer it to recipient cells. Natural transformation is the least encountered of the three common LGT processes, with about 70 species of bac-


188

INT. MICROBIOL. Vol. 14, 2011

teria described as able to introduce external DNA into the cell through an energy-requiring mechanism [28]. In most cases this capability is not constitutive but is induced under specific, normally adverse, growth conditions during which cells become ‘competent’ for DNA uptake. This state implies the synthesis of a complex protein machinery that forces the entrance of external DNA through the various cell envelopes of gram-negative bacteria [17]. The induction of competence and the physiology of natural transformation models have been intensively studied in gram-positive and gram-negative bacteria [16,17,30,33,41]. These models are remarkably different among species; in fact, it is likely that many naturally competent bacteria have not been detected yet because of our inability to define the appropriate inducing conditions [15]. In contrast to these highly regulated pathways in well-studied naturally competent bacteria, there are at least two species, Helicobacter pylori and Thermus thermophilus, for which a high efficiency of DNA incorporation is found along the whole growth curve, such that these species are considered as constitutively competent [23,24]. The nature of the competence apparatus of T. thermophilus is discussed in this article. An important issue regarding natural transformation is the fate of the DNA incorporated into the cells, which depends very much on the nature of the DNA itself. In most cases DNA that enters the cell as a single-stranded molecule is used as a nutrient, degraded by nucleases to enter catabolic cycles or to be used as building blocks for new cell material [45]. In some cases, single-stranded DNA (ssDNA) sequences that bear homology to genome sequences can undergo RecA-mediated homologous recombination, allowing gene alleles and even novel genes to be incorporated into the genome of the transformant strain, hence favoring the horizontal spread of new traits. Contrary to natural transformation, which depends on the ability of the recipient cell to take up DNA, conjugation relies on the direct contact between a donor cell harboring all the essential genetic determinants for conjugation [42] and a susceptible recipient strain. Unlike transformation and transduction, conjugation is a highly specialized process in which the nature of the transferred DNA involves, in most cases, an episomal double-stranded DNA (dsDNA) molecule—rarely, chromosomal DNA—that either carries all the genetic material needed for conjugative transfer, i.e., self-transmissible mobile genetic elements, or requires an accessory, generally plasmid-borne, conjugative apparatus in order to be mobilized from one cell to another. However, in some cases, the integration of one of these conjugative episomes into the chromosome, either by specific integrases or through homol-

CÉSAR ET AL.

ogous recombination, results in the mobilization of the whole chromosome, as in the case of Hfr strains of Escherichia coli [25,47]. The existence of the so-called conjugative transposons, or integrative and conjugative elements (ICEs) that can integrate into the genome and be excised from it as a plasmid via a prophage-like mechanism, is also common. Such ICEs encode the conjugative apparatus required for their transfer to a recipient strain [53]. There is little doubt about the contribution of LGT in the exceeding dynamism of prokaryotic genomes. However, LGT is not random but instead has been shown to be greatly influenced by internal and external environmental variables that delimit particular gene-exchange communities on the basis of shared factors such as genome size, GC contents, and carbon and oxygen sources [26]. High-temperature environments could, in principle, be perceived as a limiting factor for LGT, as DNA from mesophiles rarely encodes thermostable proteins. Nonetheless, it has been shown that temperature tolerance is a factor heavily associated with elevated rates of LGT exchange [26]. Systematic genome-scale comparison analyses revealed a complex history of LGT events between and within thermophilic bacteria and archaea. Evidence of ample LGT from Archaea to Bacteria comes from the Aquificae class hyperthermophile Aquifex aeolicus, in which 16 % of the predicted coding sequences are likely derived from Archaea [6]. In another hyperthermophile, Thermotoga maritima, 24 % of the predicted coding regions have probably arisen as a consequence of extensive LTG from thermophilic archaea [37]. By contrast, in mesophilic bacteria the percentage of genes that have probably been acquired from Archaea is much lower, suggesting that thermal environments are especially prone to select for LGT events as a means to accelerate adaptation to such extreme conditions. The Thermus-Deinoccocus clade provides a good example of specialization and innovation through LGT, as evidenced by the thermophile Thermus thermophilus and the radiation-resistant mesophile Deinococcus radiadurans. Remarkably, both organisms are archetypical members of two very distinct lifestyles. Parsimonial evolutionary reconstruction methods predict that the two species share a mesophilic or moderately thermophilic ancestor, from which they evolved through LGT events that facilitated the gradual acquisition of either thermophile adaptations from other thermophilic bacteria and archaea or radiation resistance determinants [40]. This scenario supports the notion that the common ancestor of the two genomes was prone to receive genes by LGT, a property that nowadays is preserved in Thermus spp. but is apparently absent in the genus Deinococcus.


LGT IN THERMOPHILIC BACTERIA

Moreover, a particularly interesting characteristic of T. thermophilus strain HB27 that makes it the thermophilic organism of choice for genetic modification is the constitutive expression of an extremely efficient natural competence system [7,23], which allows strain transformation at high frequencies under laboratory conditions [14]. Indeed, transformability seems to be a widespread characteristic in the genus Thermus [31]. In addition to the natural transformation phenotype of Thermus, DNAse-resistant DNA transfer by means of conjugation has been demonstrated in T. thermophilus, namely, by the ability of aerobic strain HB27 to acquire from the facultative NAR1 strain a respiratory nitrate reductase gene cluster (nar) [43,44]. This conjugative process also has been shown to allow the transfer of a complete set of denitrification genes from strain PRQ25 to the same aerobic HB27 recipient strain [5,9]. In the following sections of this review, we aim to provide the reader with a general overview of the mechanisms and promiscuity of LGT in the genus Thermus, one of the most widespread genera of thermophilic bacteria. We focus in particular on T. thermophilus, a reference organism for the genetic study of thermophiles and for the structural characterization of proteins, as well as an exceptional source of enzymes of great biotechnological potential. Natural competence systems. DNA uptake during competence is mediated by a complex macromolecular assembly comprising a large number of proteins. In order to achieve transfer of the incoming DNA into the cytoplasm, the natural barrier imposed by the cell envelope must be overcome. For gram-positive bacteria, this process means the breaching of a robust peptidoglycan (PG) layer and the cytoplasmic membrane (CM). In gram-negative bacteria, the presence of the outer membrane (OM) is an added barrier to this process. Despite the marked differences in the cell-envelope structures and the distinct characteristics of the DNA-uptake pathways, gram-positive and gram-negative bacteria use related proteins in the construction of the DNA transporter apparatus. Regarding the cell-envelope structure, and due to its unique nature which does not conform to the Gram staining method for classification, the genus Thermus is a fairly singular case. Thermus thermophilus cells are covered by an EDTA-extractable material with high sugar content that hides an array of hexagonal symmetry built up by the SlpA protein, a structure known as the S-layer but which more closely resembles a regular OM protein [8]. This structure constitutes the scaffold for an OM and is tightly bound to an underlying layer of peptidoglycan-associated secondary cell wall polymers (SCWP) [13].

INT. MICROBIOL. Vol.14, 2011

189

These special features involving the anatomy of the Thermus cell envelope together with its thermophilic nature hint at an unusual model of DNA translocation in T. thermophilus strain HB27 [49]. Whole-genome analysis and directed knockout mutagenesis have led to the identification of 16 genes involved in natural competence that are arranged in seven transcriptional units. These competence proteins have been split into three distinct groups: (i) homologues to DNA-translocation-specific proteins from Bacillus subtilis and Neisseria gonorrhoeae (ComEC, ComEA, DrpA), (ii) homologues to components of the type IV pili (PilA1-4, PilD, F, C, Q), and (iii) homologues that are not related to any other natural transformation systems (ComZ, PilM, N, O, W) [7]. Localization and structural analyses performed on these proteins have yielded a model in which the core of the DNA translocator apparatus is a pseudopilus that originates from the cytoplasmatic membrane (CM) and spans the periplasm (Fig. 1). This type IV-like pilus (T4P) is formed by the polymerization of small pilin proteins into long dynamic fibers, which in gram-negatives emerge through the OM via a ring formed by the oligomerization of a secretin-like protein (for a comprehensive review, see [7,17]). T. thermophilus HB27 encodes four pilin-like proteins, PilA1, PilA2, PilA3, and PilA4. Mutations in any of these lead to a transformationnegative phenotype but only pilA4 mutants lack pili, as established by electron microscopy [20]. The multimeric secretinlike PilQ is also essential for transformation and its deletion results in a complete loss of DNA binding ability. PilQ localizes to the OM and forms an oligomeric structure of 15 Ă&#x2014; 34 nm that spans the periplasmic space, forming a channel-like structure wide enough to accommodate a pilus [11]. Localization of PilQ in the OM depends on the presence of the competence protein PilW, which is unique to the genus Thermus [46]. Similarly to other systems, prepilins must be processed into a mature form by a prepilin peptidase, probably encoded by pilD [20,38]. In addition, T4P systems require the presence of an AAA+ ATPase to drive the polymerization of pilins, which are required for both piliation and transformation in gram-negative bacteria [34]. In the Thermus system, the putative traffic NTPase function is covered by PilF; however, in contrast to other traffic NTPases, mutations in this gene that affect transformation ability result in a piliated phenotype, as seen under the electron microscope [21]. In the Thermus â&#x20AC;&#x153;systemâ&#x20AC;?, the well-conserved proteins ComEA and ComEC are thought to play roles analogous to those proposed for other species. ComEA is a periplasmic protein anchored to the membrane. Its function may be to


INT. MICROBIOL. Vol. 14, 2011

CĂ&#x2030;SAR ET AL.

Int. Microbiol.

190

Fig. 1. Model of DNA translocation in Thermus thermophilus HB27, as described in [7]. Pre-pilins A1â&#x20AC;&#x201C;A4 are processed to mature pilins by the cytoplasmic membrane peptidase PilD and secreted to the periplasm, where they are assembled into a fiber-like pilus, powered by the ATPase PilF. The pilin fiber emerges through the outer membrane (OM) via a secretin ring, formed by PilQ units. Localization of the secretin ring to the OM is strictly dependent on PilW. Retraction of the pilus (likely powered by PilF) facilitates DNA transport through the cell wall, where it binds ComEA and is then presented to ComEC. The latter transfers one strand of the DNA molecule to the cytoplasm, while the other strand is degraded in the cytoplasm by an unknown nuclease. PilC, PilN, and PilO are part of the multiprotein inner membrane complex. Type IV pilin proteins are shown in blue, homologous proteins found in B. subtilis and N. gonorrhoeae systems in red, and proteins present only in the Thermus transport system in green. SCWP: secondary cell wall polymers.

bind DNA in the periplasm and then deliver it to the cytoplasmic membrane channel formed by the polytopic ComEC [49]. PilC is another conserved competence protein essential for transformation. It lies on the CM, where it is believed to link the periplasmic and cytoplasmic components of the T2SS and T4P systems [20]. DprA is a cytosolic protein that is also present in other transformation systems. Although not essential for transformation, it has an active role in processing incoming DNA in the cytoplasm [35]. Very little is known about the remaining components of the Thermus competence system. Conservation of ComZ, PilM, PilN, or PilO in other studied systems is not evident. ComZ appears to be anchored to the CM as part of the transporter assembly scaffold [21]. PilM, PilN, and PilO are all located in the inner membrane [46]. Mutations in the pilM, pilN, or pilO genes render the cell incapable of being transformed, although no effect has been demonstrated on DNA binding or transport to the periplasm in any case [48,49].

These remarkable structural differences in the DNA translocator apparatus of T. thermophilus HB27 are conserved in other Thermus spp. isolates, as revealed by genome sequence analyses. pBLAST searches against the GenBank Thermus taxon (including whole-genome projects for T. thermophilus HB8, T. thermophilus SG0.5JP17-16, T. aquaticus Y51MC23, and T. scotoductus SA-01 strains) retrieved highscoring homology matches at the protein level with all the components of six of the seven competence loci mentioned above for T. thermophilus HB27. These well-conserved loci comprise the pilM-Q and comEA-comEC operons, pilD, pilC, pilF, and dprA. Genetic organization of the competence genes is also preserved (Fig. 2A) (in our analyses we have included unpublished data from our laboratory involving the T. thermophilus strain PRQ25). Amino acid sequence alignments of each individual set of orthologous genes yielded overall identity scores ranging from 41 % (PilW) to 83 % (PilF).


INT. MICROBIOL. Vol.14, 2011

191

Int. Microbiol.

LGT IN THERMOPHILIC BACTERIA

Fig. 2. Conservation of competence proteins and loci amongst Thermus spp., based on the transformation system defined for T. thermophilus HB27. Species include: T. thermophilus HB8, SG0.16-17, and PRQ25, T. aquaticus Y51MC23, and T. scotoductus SA-01 spp. and their corresponding megaplasmids, where applicable. (A) Competence loci presenting no deviation from those described in strain HB27. Numbers below the transcription units denote the percentage of overall identity amongst homologous proteins. (B) Conservation of the pilA1-4 operon within Thermus spp. Blocks of proteins presenting significantly similar identity are represented in the same colors (purple for strain HB27-like proteins, blue for those of strain HB8, and green for those of T. aquaticus) and drawn together by broken lines. Overall identities are given below each transcription unit block.

The organization and protein array of the pilA1-4 operon, on the other hand, are somehow less conserved (Fig. 2B). BLAST searches on the four prepilin-like proteins of strain HB27 retrieved positive matches for all the proteins in T. thermophilus strains SG0.5JP17-16 and PRQ25. In T. scotoductus SA-01, no results were obtained for PilA2-4; however, a detailed inspection of the genome context of pilA1 and comZ in the genome of this strain revealed the presence of three putative genes coding for homologues to PilA2, PilA3, and PilA4. Overall identities range between 56.7 % for PilA2 and 72.7 % for PilA1 (also present in the T. thermophilus HB8 strain), with the exception of PilA4, which is conserved in all the analyzed strains with a low overall identity (22.9 %), except for the N-terminal 50 amino acids (65.3 %). This N-terminal part of the protein includes the conserved cleavage/methylation signal that is characteristic of all prepilin-like proteins [38]. Interestingly, all the strains that conserve the genetic

structure of the HB27 pilA1-4 operon present a gene duplication involving pilA1. The protein products of these duplicates are more loosely conserved and have an identity of 40 % with HB27 PilA1, in contrast with the 73.7 % identity of the other PilA1 proteins. In T. thermophilus HB8, a pBLAST approach did not identify any homologue to either PilA2, PilA3, or ComZ. Nevertheless, inspection of the genomic context of the conserved pilA1 and pilA4 genes revealed a genetic organization similar to that of the pilA1-4 operon but comprising four prepilin-like proteins that bear no homology at the sequence level with any of HB27 competence pilins, the exceptions being the conserved PilA1 protein; a larger protein of similar size and operon position to ComZ, which is well conserved at the N-terminal leader region; and a PilA4 homologue and a PilinV like protein. A homologue (60.2 % identity) to this pilinV-like protein was also found downstream from pilA4, in


CÉSAR ET AL.

INT. MICROBIOL. Vol. 14, 2011

Int. Microbiol.

192

Fig. 3. Transformation in Thermus scotoductus SA1. Cells of exponential cultures T. scotoductus SA1 were observed by phase contrast (A,C) and fluorescence (B,D) microscopy. Panels C and D correspond to kanamycin-resistant cells of T. scotoductus SA1 obtained by transformation with a Thermus-E. coli bifunctional vector expressing a thermostable variant of GFP (green fluorescent protein). Panels A and B correspond to the untransformed controls.

the PRQ25 strain. We performed pBLAST searches with each individual protein sequence within HB8 pilA1-4 (ttha1217-ttha1220) and found homologous proteins (29.3–44 % identity) in the T. thermophilus SG0.5JP17-16 plasmid pTHTHE1601 (ththe16_2408-2411), preceding the PilA4 gene sequence. Therefore, two types of pil-comZ clusters (HB27- and HB8-like operons) are present within Thermus strains and they probably play similar roles in transformation. In this sense, it is worthy to note the presence of both types of clusters in T. thermophilus SG0.5JP17-16, one HB27-like in the chromosome and the other HB8-like in the megaplasmid, supporting the idea that their activities are compatible within the cell. Nevertheless, in natural competence assays parallel to those used with transformable strains, we were not able to obtain any transformants with this Thermus strain (C.E. César, unpublished results). Thermus aquaticus Y51MC23 offers a very different picture. The pilin operon consists of only four coding sequences (TaqDRAFT_4097-4094) that code for four putative prepilin-like proteins, including a homologue to PilA4

(TaqDRAFT_4094). The first three prepilin-like proteins of the operon show no identity to any of the previously mentioned pilins. No trace of a putative comZ gene was found by manual inspection, and pBLAST searches did not retrieve any homologous protein in this organism. Assuming that the available genome draft is complete, the absence of this gene suggests that this strain cannot take up external DNA. Unfortunately, there are no experimental data to confirm these results. The presence in the genome of homologues to all of the T. thermophilus HB27 competence proteins does not guarantee a high efficiency of transformation. Actually, there is a great difference in the transformation efficiencies of strain HB27 and any other strain so far studied. The extraordinary DNA transformation efficiency conspicuous to strain HB27 (10–2 transformants/viable cells [31]) is not shared by other T. thermophilus strains, such as HB8, which shows transformation frequencies one or two orders of magnitude lower than those of HB27, and PRQ25, which in spite of the high degree of homology and perfect conservation of the compe-


LGT IN THERMOPHILIC BACTERIA

tence protein components shows very low transformability (four orders of magnitude lower) when transformed either with plasmids or with its own chromosomal DNA (our own results). Nevertheless, it is still possible to transfer genetic markers to other strains for genetic analysis if appropriate conditions for transformation and selection are chosen. An example is strain T. scotoductus SA-01, whose competence genes are remarkably similar to those of T. thermophilus HB27 and which can be transformed at low efficiencies with plasmids expressing fluorescent proteins, when a long expression period is used (Fig. 3). Conjugation proteins in Thermus spp. Undoubtedly, LGT accounts for most of the plasticity found within the restricted thermophile environment, as demonstrated by the widespread presence of homologous clusters within thermophilic bacteria and archaea. Natural transformation in the genus Thermus is an example of the tremendous promiscuity shown by these bacteria, as inferred not only by the high frequency of transformation observed by its members but also by the broad range of DNA species they are able to accommodate, i.e., those from Archaea, Bacteria, and Eukarya [40]. In this sense, note that several of the genes that can be considered as having been acquired by LGT in the aerobic strains HB27 and HB8 are located on their respective pTT27 megaplasmid. These include several genes encoding a DNA repair system found in thermophilic archaea and even a reverse gyrase in strain BH8 that could contribute to the thermophilic lifestyle of Thermus spp. [10]. Recently, genes for denitrification present in facultative strains of this species were identified in the megaplasmid [5,9]. However, whether this extraordinary natural competence ability is sufficient to explain the plasticity observed by Thermus spp. remains to be determined. It is worth considering that conjugation, like DNA transformation, involves a DNA transport system that has to adapt to different environments and cell types in order to transport nucleoprotein complexes across cell membranes. The type 4 secretion system (T4SS) is a well-conserved and versatile system that mediates the transfer of DNA, toxins, and nucleoprotein complexes in both Bacteria and Archaea [3,4]. T4SSs have been recently classified in three functional types: a first type, involved in conjugation processes (cT4SS), which mediates the cell to cell transfer of proteins and DNA; a second type, involved in the translocation of virulence factors to the cytosol of eukaryotic cells by pathogenic species; and a third type, responsible for the specialized uptake and release of DNA [4].

INT. MICROBIOL. Vol.14, 2011

193

The cT4SSs are large macromolecular assemblies that vary substantially in their subunit number and composition, they present a number of mating-pair-formation proteins and two or three dedicated ATPases that provide energy for DNA and protein transfer and for pilus assembly. The prototypical models for cT4SS (Fig. 4A) are derived from E. coli pKM101 plasmid and from Agrobacterium tumefaciens T4SS [51,52]; the latter does not participate in conjugation but is specialized in the delivery of oncogenic nucleoprotein complexes into plant cells. These systems are characterized by: three ATPases (VirB4, VirB11, and VirD4 or coupling protein, CP), which are postulated to pump ssDNA during conjugative transfer [12]; a series of scaffolding proteins (VirB6-VirB10, and possibly VirB3), that cross the entire cell envelope; and T4Ps similar to those involved in the competence DNA translocator system. While the presence of VirB-like proteins is not apparent in those T. thermophilus strains in which conjugation has been addressed (T. thermophilus HB27, T. thermophilus HB8, T. thermophilus NAR1, and T. thermophilus PRQ25), the recently available T. thermophilus SG0.5JP17-16 megaplasmid pTHTHE1601 sequence contains a putative and structurally novel VirB operon consisting of 20 open reading frames (ORFs; conjugative transfer region, ctr, 1-20, Tthe16_2024-2005, Fig. 4B). Three protein products display clear homologies in the amino acid sequence with VirB proteins: the pilin precursor TrbC/VirB2 and the VirB4 and VirD4 ATPases. pBLAST searches involving VirB4 and VirD4 retrieved matches in many different phyla, which is not surprising since VirB4 and T4CPs are extremely well conserved and systematically found in all T4SSs described to date [19]. VirB2 searches, on the other hand, produced significant alignments (E < 0.01) only with T. aquaticus Y51MC23, T. scotoductus SA-01, Meiothermus ruber DSM1279, and M. silvanus DSM9946 proteins. Routine pBLAST searches with each orf product revealed that the conservation of the Thermus VirB-like operon is restricted to these species (Fig. 5). Assignment of VirB functions. Aside from the already mentioned VirB2, VirB4, and VirD4 coded by ctr1, 3, and 7, respectively, the predicted protein products of ctr10, 12, 13, 18, and 20 have annotated functions, while the remaining ctr2, 4â&#x20AC;&#x201C;6, 8, 9, 11, 14â&#x20AC;&#x201C;17, and 19 code for proteins of unknown function. Ctr10 is a putative lytic transglycosidase (LT). These murein-degrading enzymes are ubiquitous to gram-negative T4SS, where they participate in the degradation of the PG to allow pilus assembly [55,56]. In the


INT. MICROBIOL. Vol. 14, 2011

CÉSAR ET AL.

Int. Microbiol.

194

Fig. 4. Type 4 secretion system model structures. (A) Experimentally predicted conjugative VirB4/VirD4 transfer system, based on [51]. OM, outer membrane; CM, cytoplasmic membrane; P, periplasm; C, cytoplasm; PG, peptidoglycan. (B) Predicted subunits for the Thermus termophilus SG0.Jl VirB-like system. Membrane disposition as well as the transmembrane (TM) domains of T4SS subunits are represented schematically, according to SOSUI predictions and the presence of putative peptide signals. The localizations of Ctr12, VIrB1, VirB2, VirB3, VirB4, VirB6, VirB11, and VirD4 are based on the VirB4/VirD4 Agrobacterium tumefaciens model [52]. Proteins with homologous functions are depicted by the same color, proteins of unknown function are represented in purple. SL-OM, S-layer outer-membrane; SCWP, secondary cell wall polymers; PG, peptidoglycan; CM, cytoplasmic membrane.

A. tumefaciens system, the LT role is performed by VirB1. Based on the functional similarities and widespread presence of LTs in T4SS, we have defined Ctr10 as VirB1. ctr12 codes for a 466-residue polypeptide that contains an N-terminal S-layer homology (SLH) domain, involved in the anchoring of secreted protein to the cell surface, and a spectrin-repeat domain typical of cytoskeletal structural proteins. Two other genes, ctr4 and ctr16, code for proteins with 3D structures similar to actinin (E = 0.65) and contractile/cell adhesion proteins (E = 2.5 × 10–05). The conserved presence of cytoskeletal elements in the cluster is unforeseen. The

prokaryotic cytoskeleton is postulated to be a central organizer for the accurate positioning of proteins and nucleoprotein complexes, thereby controlling macromolecular trafficking in cells. We can only speculate that these three proteins are members of a novel cytoskeleton-like scaffold that provides a dynamic brace to the T4SS, with Ctr4 anchored to the inner membrane (topological predictions, SOSUI server, reveal the presence of a transmembrane helix (TM) at the N-terminal end of the protein), Ctr12 anchored to the cell surface via SLH, and the predicted soluble Ctr16 located in the cytoplasm (Fig. 4B).


INT. MICROBIOL. Vol.14, 2011

195

Int. Microbiol.

LGT IN THERMOPHILIC BACTERIA

Fig. 5. Conservation of the putative conjugative virB operon in Thermus spp. Overall identities (as obtained by BLASTp searches) with respect to the T. thermophilus SG0.15-16 virB operon are shown above each open reading frame (ORF). The (–) symbol denotes homologous proteins whose score value is lower than the threshold for BLASTp retrieval. A hypothetical/predicted role for each gene product is given, whereas uncertain roles are denoted by question marks. Purple arrows represent ORFs with significant homology. Blue ORFs code for predicted homologous transmembrane proteins of reduced overall identity. Light green ORFs code for proteins that are unique for a particular spp. A black-filled lightning bolt represents either an interruption of the coding frame or a truncated product.

Ctr13 is an AAA+ type ATPase, as is VirB11. No sequence similarity is found between Ctr13 and VirB11-like proteins, and VirB11 is not part of all T4SS. T4SS, as it is absent from most gram-positive cT4SSs [22]. We have designated this protein as VirB11, since the protein structure prediction (Phyre version 0.2) of Ctr11 ATPase revealed a 100 % match with Brucella suis VirB11 ATPase (E = 3.1 × 10–20). The two other annotated proteins are putative irondependent transcriptional repressors, Ctr18, of unknown function within the system, and a zinc-dependent metallopeptidase, Ctr20. While no peptidases are commonly found in VirB operons, many VirB-like proteins contain a signal peptide for translocation into the periplasm and that peptide is processed from the mature protein once the latter has been delivered. Hence, the presence of a membrane peptidase within the VirB-like operon could represent a novel feature of the Thermus T4SS, whose role is covered by an unknown accessory function not preserved in other well-characterized systems. The fact that ctr20 is not conserved within other Thermus VirB-like operons, or anywhere in the genome, points to the existence of an alternative system, perhaps reminiscent of other, traditional VirB-like systems, for the pro-

cessing of T4SS subunits. Note that the protein product of ctr19, which shows no significant homology to any known function either at the amino acid sequence or structural level but is topologically predicted to be an integral membrane protein, yields multiple low-score pBLAST hits with eukaryotic zinc transporters. We can therefore hypothesize a putative role for this transporter, in which it would act in concert with the zinc-dependent metallopeptidase. With the exception of Ctr6 and Ctr8, which failed to retrieve any sequence or structural similarities with any known protein and were not predicted to contain any signal peptide or TM helices, protein products from ctr2, 5, 9, 11, 15, and 17 contain one or more TM helices (Fig. 4B). Ctr2 is a small protein, 105 residues, that contains two TM helices; its gene is located immediately upstream from that of VirB4. These characteristics are reminiscent of those of VirB3, which in many systems is coded as a chimeric protein fused to the N-terminal portion of VirB4. The presence of VirB4, together with VirB7 and VirB8, is essential in stabilizing VirB3 during T-pilus biogenesis [36]. While we could infer the role of Ctr2 to be that of VirB3, we were unable to extend our analysis to predict putative VirB7 and VirB8 functions.


INT. MICROBIOL. Vol. 14, 2011

CÉSAR ET AL.

Int. Microbiol.

196

Fig. 6. Ten μl of saturated cultures of HB27d-pTT27::hyg strain (containing a plasmid-encoded hygromycin resistance marker, hyg), and HB27::pilA4::km (containing a chromosomally encoded kanamycin marker, km, and transformation-deficient) were plated on hyg-km10 ng/μl. Growth was observed only for the transformation-proficient HB27d-pTT27::hyg strain. When 10 μl of each strain were mixed together, growth was observed (bottom image), due to the conjugation-like transfer of marker genes.

Similarly, we could not assign identities to VirB9- or VirB10like functions. VirB7-10, together with the already mentioned VirB3, and VirB6 are probably members of the theoretical scaffold that spans the cell envelope and supports substrate translocation [51,52]. VirB6-like proteins are large polytopic proteins (5 ≤ TM segments) characterized by the presence of a central periplasmic domain and a C-terminal hydrophilic domain [4, 27]. Like VirB6, Ctr5 is a polytopic protein containing nine TM segments as well as a central and a C-terminal hydrophilic domain. VirB6-like proteins display a low overall similarity at the sequence level but are ubiquitous to all T4SS described to date. They are proposed to be essential for conjugation and the absolute minimal requirement for substrate translocation across membranes together with the ATPases T4CP and VirB4 [4]. Because of the predicted structural similarities between Ctr5 and VirB6 proteins and corroborated by its position within the Thermus VirBlike operon in addition to the low conservation displayed between homologues present in the genus Thermus (Fig. 5), we have tentatively assigned Ctr5 to the large family of VirB6 proteins. It is likely that this scaffolding function is

provided by the above-mentioned cytoskeletal elements Ctr4, 12, and 16, together with some or all of the non-assigned proteins, Ctr8, 9, 11, 15–17. The presence of genes coding for small, non-conserved, TM-containing proteins overlapping virB-like genes is common to gram-positive VirB operons and very probably represents different strategies, with a common denominator, the T4SS, used by bacterial cells to translocate substances across the cell envelope, in cell surface recognition, and in the formation of mating pairs [4]. Thus, we propose that these unique features of the Thermus T4SS represent an imposed requirement due to the thermophile niche of the genus and the unusual structure and nature of the cell envelope of Thermus species. Our model is corroborated by the strict preservation of this unusual T4SS system within the Thermus group, including not only Thermus but also Meiothermus spp. It is feasible that with the gathering and sequencing of new Thermus strains other structurally similar virB-like operons will come to light. Experimental evidence is still needed to address the participation of these T4SS in conjugation. All functioning cT4SSs are always associated, by CPs, with DNA transfer


LGT IN THERMOPHILIC BACTERIA

replication systems, determined by the presence of a relaxase protein, a site-specific endonuclease that recognizes transferred DNA at a specific site, origin of transfer (OriT), cleaves it, and brings it to the recipient cell [18]. Remarkably, no relaxase-like sequence has ever been described for any Thermus organism. Whereas relaxases have been thoroughly characterized and categorized within six distinct families, there is a strong belief that new families of relaxases could emerge with the sequencing and characterization of novel conjugation systems, particularly in bacteria other than proteobacteria [50]. We believe the genus Thermus, and by extension thermophilic bacteria, are examples of this novel, yet ancient, family of relaxases and as such, part of an unusual conjugation system. A new conjugation mechanism in Thermus thermophilus? Although no conjugation-like homologous proteins have been found in T. thermophilus NAR1, HB27, or PRQ25, a conjugative-like mechanism has been described that involves these strains. This uncharacterized LGT mechanism is responsible for the transfer of a pTT27-plasmid-encoded nar operon from T. thermophilus NAR1 to strain HB27 [43,44], and from T. thermophilus PRQ25 to strain HB27 [5]. Further proof of the existence of this atypical LGT between Thermus strains comes from experiments involving the transfer of an antibiotic resistance marker, coded within the pTT27 megaplasmid, from HB27-pTT27::hyg (hygromycin resistant) to HB27pilA4::Km-pTT27 (transformation-deficient due to the insertion of kanamycin resistance cassette into pilA4, a gift from B. Averhoff) strain (C.E. César, unpublished results, Fig. 6) at frequencies up to 10–2 transconjugants per recipient cell. In all cases, this conjugation-like mechanism involves transfer of (part of) the pTT27 megaplasmid—which is ubiquitously found as part of the T. thermophilus genome, although chromosomal markers have also been shown to be transferred in what was reportedly an HFR-like process [44]—at much lower frequencies than those obtained with plasmid markers (C.E. César, unpublished results). Transduction. Literature reports on Thermus bacteriophages are scarce, and despite the identification of 113 viruses in a single article [54], only a pair of them have been thoroughly studied. This small number of known strains probably correspond to the very tip of an unknown repertoire of thermophilic bacteriophages. A good indication of this misrepresentation is the presence in the HB8 strain of 12 cluster regulatory interspaced short palindromic repeat (CRISPR) systems [1]. CRISPR systems are host genetic modules encoded

INT. MICROBIOL. Vol.14, 2011

197

by several bacteria and most archaea to act against invading genetic elements, such as plasmids, transposons and, particularly, bacteriophages (for a comprehensive review see [2]). The unusually high number of CRISPR systems coded by HB8 supports a scenario of frequent foreign-DNA invasion events. Notably, the transcription profiles of most of the CRISPRS-associated proteins are up-regulated after phage infection [1], supporting phage infection and probably transduction as a fairly active event in Thermus spp. strains. It is difficult to acknowledge and quantify LGT by transduction in the genus Thermus; nonetheless, transduction is yet another mechanism that likely participates in the extensive LGT shown by Thermus spp. Concluding remarks. The ability of microorganisms to exploit and inhabit different environments relies on the plasticity of prokaryotes in acquiring those genetic determinants that facilitate the colonization of diverse, often extreme, niches. In extremophilic bacteria, LGT has been recognized as a major force in adaptation and diversification, and inter-domain gene flow between Archaea and Bacteria has been widely reported. The high-temperature habitat is a good example of this phenomenon, and T. thermophilus, due to its unique repertoire of LGT strategies, provides an excellent model to study horizontal gene flow in this harsh environment. The enormous LGT promiscuity observed in Thermus strains is manifested in the presence of a large megaplasmid as part of the genome, where most of the plasticity observed between T. thermophilus strains resides [11]. We believe that T. thermophilus megaplasmid acts as a reservoir for non-essential to life adaptation traits (e.g., denitrification and carotenoid biosynthesis clusters, CRISPR antiviral systems, etc.) and that the constant gene flow of these traits as needed is a common characteristic in the genus Thermus. Acknowledgements. This work was supported by grant BIO2010-18875 from the Spanish Ministry of Science and Innovation. An institutional grant from Ramón Areces Foundation to CBMSO is acknowledged. CEC holds a Juan de la Cierva postdoctoral contract from the Spanish Ministry of Science and Innovation. CB and LA are founded by FPI and JAE fellowships from the Ministry of Education and the Spanish National Research Council (CSIC), respectively. We thank Dr. B. Averhoff for sending us the pilA4 mutant. Competing interests: None declared.

References 1.

Agari Y, Sakamoto K, Tamakoshi M, Oshima T, Kuramitsu S, Shinkai A (2010) Transcription profile of Thermus thermophilus CRISPR systems after phage infection. J Mol Biol 395:270-281


198

2.

3. 4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14. 15. 16.

17. 18.

19.

20.

21.

CÉSAR ET AL.

INT. MICROBIOL. Vol. 14, 2011

Al-Attar S, Westra ER, van der Oost J, Brouns SJ (2011) Clustered regularly interspaced short palindromic repeats (CRISPRs): the hallmark of an ingenious antiviral defense mechanism in prokaryotes. Biol Chem 392:277-289 Albers SV, Pohlschroder M (2009) Diversity of archaeal type IV pilinlike structures. Extremophiles 13:403-410 Álvarez-Martínez CE, Christie PJ (2009) Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev 73:775808 Álvarez L, Bricio C, Gómez MJ, Berenguer J (2011) Lateral transfer of the denitrification pathway genes among Thermus thermophilus strains. Appl Environ Microbiol 77:1352-1358 Aravind L, Tatusov RL, Wolf YI, Walker DR, Koonin EV (1998) Evidence for massive gene exchange between archaeal and bacterial hyperthermophiles. Trends Genet 14:442-444 Averhoff B (2009) Shuffling genes around in hot environments: the unique DNA transporter of Thermus thermophilus. FEMS Microbiol Rev 33:611-626 Bahl H, Scholz H, Bayan N, Chami M, Leblon G, Gulik-Krzywicki T, Shechter E, Fouet A, Mesnage S, Tosi-Couture E, Gounon P, Mock M, Conway de Macario E, Macario AJ, Fernandez-Herrero LA, Olabarria G, Berenguer J, Blaser MJ, Kuen B, Lubitz W, Sara M, Pouwels PH, Kolen CP, Boot HJ, Resch S (1997) Molecular biology of S-layers. FEMS Microbiol Rev 20:47-98 Bricio C, Álvarez L, Gómez MJ, Berenguer J (2011) Partial and complete denitrification in Thermus thermophilus: lessons from genome drafts. Biochem Soc Trans 39:249-253 Bruggemann H, Chen C (2006) Comparative genomics of Thermus thermophilus: Plasticity of the megaplasmid and its contribution to a thermophilic lifestyle. J Biotechnol 124:654-661 Burkhardt J, Vonck J, Averhoff B (2011) Structure and function of PilQ, a secretin of the DNA transporter from the thermophilic bacterium Thermus thermophilus HB27. J Biol Chem 286:9977-9984 Cabezón E, de la Cruz F (2006) TrwB: an F(1)-ATPase-like molecular motor involved in DNA transport during bacterial conjugation. Res Microbiol 157:299-305 Cava F, de Pedro MA, Schwarz H, Henne A, Berenguer J (2004) Binding to pyruvylated compounds as an ancestral mechanism to anchor the outer envelope in primitive bacteria. Mol Microbiol 52:677-690 Cava F, Hidalgo A, Berenguer J (2009) Thermus thermophilus as biological model. Extremophiles 13:213-231 Claverys JP, Martin B (2003) Bacterial “competence” genes: signatures of active transformation, or only remnants? Trends Microbiol 11:161-165 Claverys JP, Prudhomme M, Martin B (2006) Induction of competence regulons as a general response to stress in gram-positive bacteria. Annu Rev Microbiol 60:451-475 Chen I, Dubnau D (2004) DNA uptake during bacterial transformation. Nat Rev Microbiol 2:241-249 Draper O, César CE, Machón C, de la Cruz F, Llosa M (2005) Site-specific recombinase and integrase activities of a conjugative relaxase in recipient cells. Proc Natl Acad Sci USA 102:16385-16390 Fernández-López R, Garcillán-Barcia MP, Revilla C, Lázaro M, Vielva L, de la Cruz F (2006) Dynamics of the IncW genetic backbone imply general trends in conjugative plasmid evolution. FEMS Microbiol Rev 30:942-966 Friedrich A, Prust C, Hartsch T, Henne A, Averhoff B (2002) Molecular analyses of the natural transformation machinery and identification of pilus structures in the extremely thermophilic bacterium Thermus thermophilus strain HB27. Appl Environ Microbiol 68:745-755 Friedrich A, Rumszauer J, Henne A, Averhoff B (2003) Pilin-like proteins in the extremely thermophilic bacterium Thermus thermophilus

22. 23.

24. 25. 26. 27.

28.

29.

30.

31.

32. 33. 34.

35.

36.

37.

38.

39. 40.

HB27: implication in competence for natural transformation and links to type IV pilus biogenesis. Appl Environ Microbiol 69:3695-3700 Grohmann E, Muth G, Espinosa M (2003) Conjugative plasmid transfer in gram-positive bacteria. Microbiol Mol Biol Rev 67:277-301 Hidaka Y, Hasegawa M, Nakahara T, Hoshino T (1994) The entire population of Thermus thermophilus cells is always competent at any growth phase. Biosci Biotechnol Biochem 58:1338-1339 Israel DA, Lou AS, Blaser MJ (2000) Characteristics of Helicobacter pylori natural transformation. FEMS Microbiol Lett 186:275-80 Jacob F, Wollman EL (1961) Viruses and genes. Sci Am 204:93-107 Jain R, Rivera MC, Moore JE, Lake JA (2003) Horizontal gene transfer accelerates genome innovation and evolution. Mol Biol Evol 20:1598-1602 Jakubowski SJ, Krishnamoorthy V, Cascales E, Christie PJ (2004) Agrobacterium tumefaciens VirB6 domains direct the ordered export of a DNA substrate through a type IV secretion system. J Mol Biol 341:961-977 Johnsborg O, Eldholm V, Havarstein LS (2007) Natural genetic transformation: prevalence, mechanisms and function. Res Microbiol 158: 767-778 Koonin EV, Wolf YI (2008) Genomics of bacteria and archaea: the emerging dynamic view of the prokaryotic world. Nucleic Acids Res 36:6688-6719 Kovacs AT, Smits WK, Mironczuk AM, Kuipers OP (2009) Ubiquitous late competence genes in Bacillus species indicate the presence of functional DNA uptake machineries. Environ Microbiol 11:1911-1922 Koyama Y, Hoshino T, Tomizuka N, Furukawa K (1986) Genetic transformation of the extreme thermophile Thermus thermophilus and of other Thermus spp. J Bacteriol 166:338-340 Lawrence JG (1997) Selfish operons and speciation by gene transfer. Trends Microbiol 5:355-359 Lorenz MG, Wackernagel W (1994) Bacterial gene transfer by natural genetic transformation in the environment. Microbiol Rev 58:563-602 Maier B, Potter L, So M, Long CD, Seifert HS, Sheetz MP (2002) Single pilus motor forces exceed 100 pN. Proc Natl Acad Sci USA 99:16012-16017 Mortier-Barriere I, Velten M, Dupaigne P, Mirouze N, Pietrement O, McGovern S, Fichant G, Martin B, Noirot P, Le Cam E, Polard P, Claverys JP (2007) A key presynaptic role in transformation for a widespread bacterial protein: DprA conveys incoming ssDNA to RecA. Cell 130:824-836 Mossey P, Hudacek A, Das A (2010) Agrobacterium tumefaciens type IV secretion protein VirB3 is an inner membrane protein and requires VirB4, VirB7, and VirB8 for stabilization. J Bacteriol 192:2830-2838 Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Nelson WC, Ketchum KA, McDonald L, Utterback TR, Malek JA, Linher KD, Garrett MM, Stewart AM, Cotton MD, Pratt MS, Phillips CA, Richardson D, Heidelberg J, Sutton GG, Fleischmann RD, Eisen JA, White O, Salzberg SL, Smith HO, Venter JC, Fraser CM (1999) Evidence for lateral gene transfer between Archaea and Bacteria from genome sequence of Thermotoga maritima. Nature 399:323-329 Nunn DN, Lory S (1991) Product of the Pseudomonas aeruginosa gene pilD is a prepilin leader peptidase. Proc Natl Acad Sci USA 88: 3281-3285 Ochman H, Davalos LM (2006) The nature and dynamics of bacterial genomes. Science 311:1730-1733 Omelchenko MV, Wolf YI, Gaidamakova EK, Matrosova VY, Vasilenko A, Zhai M, Daly MJ, Koonin EV, Makarova KS (2005) Comparative genomics of Thermus thermophilus and Deinococcus radiodurans: divergent routes of adaptation to thermophily and radiation resistance. BMC Evol Biol 5:57


LGT IN THERMOPHILIC BACTERIA

41. Palmen R,Hellingwerf KJ (1997) Uptake and processing of DNA by Acinetobacter calcoaceticus—a review. Gene 192:179-190 42. Pérez-Mendoza D, de la Cruz F (2009) Escherichia coli genes affecting recipient ability in plasmid conjugation: are there any? BMC Genomics 10:71 43. Ramírez-Arcos S, Fernández-Herrero LA, Berenguer J (1998) A thermophilic nitrate reductase is responsible for the strain specific anaerobic growth of Thermus thermophilus HB8. Biochim Biophys Acta 1396:215-227 44. Ramírez-Arcos S, Fernández-Herrero LA, Marín I, Berenguer J (1998) Anaerobic growth, a property horizontally transferred by an Hfr-like mechanism among extreme thermophiles. J Bacteriol 180:3137-3143 45. Redfield RJ (1993) Genes for breakfast: the have-your-cake-and-eat-ittoo of bacterial transformation. J Hered 84:400-404 46. Rumszauer J, Schwarzenlander C, Averhoff B (2006) Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27. FEBS J 273:3261-3272 47. Ryan FJ, Lederberg J (1946) Reverse-mutation and adaptation in leucineless Neurospora. Proc Natl Acad Sci USA 32:163-173 48. Schwarzenlander C, Averhoff B (2006) Characterization of DNA transport in the thermophilic bacterium Thermus thermophilus HB27. FEBS J 273: 4210-4218

INT. MICROBIOL. Vol.14, 2011

199

49. Schwarzenlander C, Haase W, Averhoff B (2009) The role of single subunits of the DNA transport machinery of Thermus thermophilus HB27 in DNA binding and transport. Environ Microbiol 11:801-808 50. Smillie C, Garcillán-Barcia MP, Francia MV, Rocha EP, de la Cruz F (2010) Mobility of plasmids. Microbiol Mol Biol Rev 74:434-452 51. Waksman G, Fronzes R (2010) Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci 35:691-698 52. Wallden K, Rivera-Calzada A, Waksman G (2010) Type IV secretion systems: versatility and diversity in function. Cell Microbiol 12:1203-1212 53. Wozniak RA. Waldor MK (2010) Integrative and conjugative elements: mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat Rev Microbiol 8:552-863 54. Yu MX, Slater MR, Ackermann HW (2006) Isolation and characterization of Thermus bacteriophages. Arch Virol 151:663-679 55. Zahrl D, Wagner M, Bischof K, Bayer M, Zavecz B, Beranek A, Ruckenstuhl C, Zarfel GE, Koraimann G (2005) Peptidoglycan degradation by specialized lytic transglycosylases associated with type III and type IV secretion systems. Microbiology 151:3455-3467 56. Zupan J, Hackworth CA, Aguilar J, Ward D, Zambryski P (2007) VirB1* promotes T-pilus formation in the vir-Type IV secretion system of Agrobacterium tumefaciens. J Bacteriol 189:6551-6563


RESEARCH ARTICLE INTERNATIONAL MICROBIOLOGY (2011) 14:201-206 DOI: 10.2436/20.1501.01.149 ISSN: 1139-6709 www.im.microbios.org

A new disruption vector (pDHO) to obtain heterothallic strains from both Saccharomyces cerevisiae and Saccharomyces pastorianus Lucía Blasco,1 Patricia Veiga-Crespo,3 Miquel Viñas,4 Tomás G. Villa1,2* 1

Department of Microbiology, 2School of Biotechnology, Faculty of Pharmacy, University of Santiago de Compostela, Spain. 3 Departament of Cellular Biology and Histology, Faculty of Medicine, University of the Basque Country, Biscay, Spain. 4 Departament of Pathology and Experimental Therapeutics, Medical School, University of Barcelona, IDIBELL, L’Hospitalet, Barcelona, Spain Received 8 September 2011 · Accepted 30 October 2011

Summary. Yeasts are responsible for several traits in fermented beverages, including wine and beer, and their genetic manipulation is often necessary to improve the quality of the fermentation product. Improvement of wild-type strains of Saccharomyces cerevisiae and Saccharomyces pastorianus is difficult due to their homothallic character and variable ploidy level. Homothallism is determined by the HO gene in S. cerevisiae and the Sc-HO gene in S. pastorianus. In this work, we describe the construction of an HO disruption vector (pDHO) containing an HO disruption cassette and discuss its use in generating heterothallic yeast strains from homothallic Saccharomyces species. [Int Microbiol 2011; 14(4):201-206] Keywords: Saccharomyces cerevisiae · Saccharomyces pastorianus · homothallic · heterothallic · gene deletion

Introduction The manipulation of yeast by humans dates back some 7000 years, when beer and wine were first produced [6]. Nowadays, most of the yeast varieties used in industry derive from wild-type strains, although they have been selected over long periods of time in order to improve the final products [1,9,15]. Formerly, mixtures of several species were used in fermentations whereas today industrial fermentations are per*Corresponding author: T.G. Villa Department of Microbiology, Faculty of Pharmacy University of Santiago de Compostela 15782 Santiago de Compostela, Spain Tel +34-981592490. Fax +34-981594912 E-mail: tomas.gonzalez@usc.es

formed by the addition of ‘starter cultures’ in order to obtain homogeneous final products. As a general rule, the yeast Saccharomyces cerevisiae serves as the starter culture in the production of wine and beer, mostly based on its ethanol tolerance. Another species, Saccharomyces pastorianus, is used to produce lager beer because of its ability to ferment at low temperatures [2,4,7,9]. Both S. cerevisiae and S. pastorianus are Saccharomyces sensu stricto species, i.e., they belong to the genus Saccharomyces and are so closely related that, in some cases, they can hybridize and produce viable fertile progeny [11]. Wild-type strains of these species are generally diploid or polyploid, homothallic, heterozygous, poorly sporulating cells, and they are often genetically unstable. The above-mentioned characteristics make it difficult to perform genetic manipulations, which are necessary to obtain a final


202

BLASCO ET AL.

INT. MICROBIOL. Vol. 14, 2011

product, such as wine or beer, with homogeneous properties [1,2,9,10,13,14]. Genetic improvement of wild-type S. cerevisiae strains is difficult because of their homothallism trait and their ploidy level. When a homothallic haploid is generated by meiosis, it quickly switches its “a” or “α” types, subsequently mating and generating a diploid identical to the parental cell. The HO gene, responsible for homothallism, codes for a site-specific endonuclease that recognizes the mating-type locus and produces a double-stranded break. Hence, DNA repair results in a switch in the MAT locus affecting the “a” or “α” cassettes. Heterothallic strains contain a defective HO gene that prevents MAT locus switching. These strains can be improved by sexual breeding because, after meiosis, they remain in the haploid state and can be mated with the desirable strain [5,17,19]. Homothallism is present in several industrially relevant species of Saccharomyces sensu stricto, such as S. cerevisiae and S. pastorianus [11]. S. pastorianus, a natural hybrid of S. cerevisiae and Saccharomyces bayanus, carries two types of chromosomes, one from S. cerevisiae and the other from S. bayanus, and therefore has two HO gene types [4,16,20]. The Sc-HO gene (S. cerevisiae type HO) derives from S. cerevisiae, whereas the Lg-HO gene (lager-fermenting yeast-specific HO) comes from S. bayanus. The two HO genes are functional and located in their respective chromosomal type [18]. Although both types provide the homothallic character, deletion of the Lg-HO gene renders the yeast heterothallic, despite the remaining Sc-HO gene [8,18]. Here we describe the design of a vector with a disruption cassette for the HO gene (based on the S. cerevisiae gene) that renders S. cerevisiae and S. pastorianus more amenable to genetic manipulation and improvement. This cassette worked well on both S. cerevisiae and S. pastorianus, as we

succeeded in obtaining heterothallic, competent mating strains for both yeast species.

Materials and methods Strains and media. Wine wild-type strain 145A211 and two genetic strains, CSH84 L(α) and CSH89L(a), from S. cerevisiae, and the brewery strain Weihenstephan 34/70 from S. pastorianus were used. Escherichia coli TOP10 (Invitrogen) was grown in Luria Bertani (LB) (tryptone 1 %, yeast extract 0.5 %, CaCl 1 %) medium at 37 ºC. S. cerevisiae and S. pastorianus were grown in YPD (dextrose 2 %, yeast extract 1 %, peptone 2 %). Yeast strains harboring auxotrophies were grown in selective dropout (SD) (yeast extract without amino acids 0.67 %, glucose 2 %) medium supplemented with the required amino acid(s). When another carbon source was used for galactose incorporation, YPD and SD were substituted by YPGal and SGal, respectively. All yeast cultures were maintained at 30 ºC. When cultured in sporulation medium SPOI (potassium acetate 1 %, yeast extract 0.1 %, glucose 0.05 %), the strains were maintained at 23 ºC for 5 days. Solid media were prepared by the addition of 2 % agar. When necessary, the media were supplemented with G418 (200 μg/ml; Sigma-Aldrich). Nucleic acid manipulations. Genomic DNA was isolated from an overnight yeast culture using the Genomic Purification Kit (Promega). Enzymatic digestion was done using restriction enzymes from Takara. PCRs were carried out with the primers listed in Table 1. DNA was amplified using the proofreading polymerase ACCUZYMETM DNA polymerase (Bioline). In PCRs, to verify correct integration and deletion of the cassette, the BIOTAQTM DNA polymerase (Bioline) was used (Table 1). pDHO vector construction. Plasmid pDHO (plasmid for HO disruption) was designed to direct loxp-KanMX-loxP cassette integration into the HO gene by homologous recombination (Fig. 1). Two fragments of the HO gene were obtained by PCR amplification of yeast genomic DNA. Primers HO1f and HO1r yielded an 80-bp DNA fragment (HO1) corresponding to nucleotides 16–96 of the HO gene, flanked by PstI (5´) and SalI (3´) restriction sites, which were included in the primers. Primers HO2f and HO2r gave an amplicon of 137 bp (HO2), corresponding to nucleotides 1572–1654 of the HO gene, flanked by BamHI and EcoRV (5´) and EcoRI (3´) restriction sites. The G418 resistance cassette loxP-KanMX-loxP was PCR-amplified from plasmid pUG6, using the loxpF and loxpR primers, which contained BamHI and SalI, and BamHI and EcoRV restriction sites, respectively. The

Table 1. List of primers HO1f

AAAACTGCAGCGACTATTCTGATGGCTAACGG

HO1r

ACGCGTCGACGTGCCATCTGCGCACATAACG

HO2f

CGCGGATCCTGCGATATCTGCAAGTATGTACCAGAAGC

HO2r

CCGGAATTCCACTCTGGTCCTTTAACTG

loxpf

CGCGGATCCGCGGAGGTCGACAACCCTTAATATAAC

loxpr

CGCGGATCCGCGGATATCACCTAATAACTTCGTATAGC

Restriction sites BamHI, EcoRV, EcoRI, and PstI are shown in bold letters.


PDHO IN TWO SACCHAROMYCES

INT. MICROBIOL. Vol.14, 2011

203

HO1 and HO2 fragments were then digested with PstI and EcoRI, respectively, and inserted into pUC19, thus generating the pHO12 plasmid. This plasmid was subsequently digested with BamHI and EcoRV. The loxPKanMX-loxP disruption cassette was digested with the same enzymes followed by ligation into pHO12, between HO1 and HO2, thus generating plasmid pDHO.

appropriate number of asci containing four ascospores were available. Asci were collected and treated with 0.5 μg/ml lyticase (Sigma-Aldrich) at 30 ºC for 15 min. Lyticase-treated asci were dissected using a Micromanipulator II (Allen Benjamin Inc.) coupled to a Nikon SE microscope.

Yeast transformation. Yeast transformations were performed with lithium acetate, using either 2 μg of plasmid DNA or 3–5 μg of PCR product. Selection was in YPD supplemented with the appropriate antibiotic or in SD media lacking the corresponding amino acid.

Results and Discussion

Resistance cassette elimination. The vector used in these experiments was YEp351-Cre-Cyh, which contains a galactose-inducible cre-loxP system, as describe by Delneri et al. [3].

Int. Microbiol.

Tetrad analysis. Tetrads were obtained from either homothallic diploid strains or heterothallic diploids generated by mating the appropriate strains. The diploids were maintained in SPOI medium for 7 days at 30 ºC, until an

The pDHO vector. Yeast genetic manipulation can be carried out by clonal selection, mutation, hybridization, cloning, and transformation. The combination of all of these techniques has increased the possibilities to artificially introduce diversity in yeasts [9]. Yeast genes can be deleted or disrupted by homologous recombination between a disrupting cassette and the genomic DNA. In such cases, the gene is

Fig. 1. pDHO vector construction.


BLASCO ET AL.

INT. MICROBIOL. Vol. 14, 2011

Int. Microbiol.

204

replaced by the cassette, which usually consists of a resistance or prototrophic marker gene flanked by two regions corresponding to the right and left extremes of the disrupted gene [12,22]. Here we report the construction of a vector (pDHO) containing a disrupting cassette (Fig. 1) that causes the specific deletion of the HO (Genbank X90957.1) and ScHO genes (Genbank AB027449.1) present in S. cerevisiae and S. pastorianus, respectively. Amplification of HO1 and HO2 fragments and their subsequent cloning into pUC19 resulted in a new plasmid, pHO12. Amplification of the cassette loxP-KanMX-loxP from the pUG6 plasmid and its cloning into pHO12 between HO1 and HO2 gave rise to the disruption vector pDHO, containing the HO-KanMX disruption cassette, which disrupts the homothallism in HO from S. cerevisiae and Sc-HO from S. pastorianus, which can be obtained from the pDHO vector by PCR or by enzyme digestion.

Fig. 2. PCR analyses of the yeast clones generated to confirm correct cassette integration and gene deletions. (A) Schematic representation of the HO-KanMX cassette, with the location of the different PCR primers used for the analyses indicated. (B) Correct integration of the cassette into the yeast DNA was verified by PCR amplification using different combinations of primers. (B1) S. cerevisiae 145A211 clone1 (lanes 1–4) and clone 2 (lanes 5–8), were amplified with primers HO1f/HO2r (lanes 3 and 7); HO1f, loxpr (lanes 1 and 5); loxpf/HO2r (lanes 2 and 6); and loxpf/lopr (lanes 4 and 8). (B2) S. pastorianus Weihenstephan 34/70 clone1 (lanes 1–4) and clone 2 (lanes 5-8) were amplified with primers: HO1f/HO2r (lanes 1 and 5); HO1f/loxpr (lanes 2 and 6); loxpf/HO2r (lanes 3 and 7); and loxpf/loxpr (lanes 4 and 8). (C) PCR-amplified chromosomal DNA from two of the Δho clones generated from S. cerevisiae 145A211 and S. pastorianus Weihenstephan 34/70, to confirm removal of the HO and sc-HO genes, respectively. PCR amplification was carried for: (C1) S. cerevisiae 145A211 clone1 (lanes 1 and 3) and clone 2 (lanes 2 and 4) with primers: HO1f/HO2r (lanes 1 and 2) and loxpf/loxpr (lanes 3 and 4). (C2) S. pastorianus Weihenstephan 34/70. Clone1 (lanes 1 and 3) and clone 2 (lanes 2 and 4) were amplified with primers: HO1f/HO2r (lanes 3 and 4) and loxpf/loxpr (lanes 1 and 2). Lane M corresponds to the molecular weight marker 2-Log DNA Ladder (GE Healthcare).

Generation of heterothallic strains. We used the HO-KanMX disruption cassette, obtained by PCR using the primers HO1F/HO2R, to transform S. cerevisiae wine strain 145A211 and S. pastorianus Weihestephan 34/70 lager strain. This resulted in 100 S. cerevisiae transformants/μg DNA and about 40 S. pastorianus transformants/μg DNA. Two G418resistant transformants containing the HO-KanMX cassette were selected for each strain. Disruption of the HO and Sc-HO genes and the correct insertion of the cassette were confirmed by PCR, using the primers pairs sets described in Table 1. Amplification of the expected size PCR fragments was obtained, as seen in Fig. 2A, B. Primers HO1F/HO2R generated, in all cases, two PCR fragments: one of 1761 bp, corresponding to the wild-type gene, and another of 1879 bp, corresponding to the gene disrupted with the cassette. The presence of two bands indicated that only one allele was disrupted and therefore that the G418-resistant clones were heterozygous for


PDHO IN TWO SACCHAROMYCES

sc-HO and HO (sc-HO/Sc-ho::KanMX and HO/ho::KanMX), since recombination of the disruption cassette occurred only in one chromosome of the pair [3]. To obtain a homozygous disrupted strain, the sc-HO/Scho::KanMX and HO/ho::KanMX transformants were induced to sporulate in SPOI medium, followed by the selection of G418-resistant spore clones. As gene segregation was 2:2, half of the spores were resistant to G418 and therefore ho::KanMX and Sc-ho::KanMX. These resistant spore clones were cultured in sporulation medium but no asci were obtained, confirming the heterothallic nature of the S. cerevisiae and S. pastorianus strains generated. As genetically engineered yeast strains harboring exogenous DNA are not permitted in industrial use, the resistance KanMX cassette was removed. For this purpose, we selected a disrupted ho::KanMX clone from S. cerevisiae and another from S. pastorianus and transformed them with the vector YEp351-Cre-Cyh. The transformants obtained (Δho), lacking the exogenous KanMX gene, were selected based on their inability to grow in the presence of G418. To confirm the removal of the exogenous cassette, the resulting constructs were PCR-amplified. As seen in Fig. 2C, amplification with the HO1/HO2 primer pair produced only a DNA fragment of the expected size (HO1 plus the HO2 fragments). Additionally, no PCR product was obtained when primers loxpf/loxpr were employed, confirming elimination of the Kan resistance cassette.

INT. MICROBIOL. Vol.14, 2011

Acknowledgements. The authors wish to express their gratitude to the School of Biotechnology of the University of Santiago de Compostela and the Ramón Areces Foundation for partly furnishing the laboratory where this work was done. They also thank A.S.P. from Sydney University, Australia, for useful comments on the manuscript.

Competing interests: None declared.

References 1.

2.

3.

4.

5.

6.

7.

Mating ability of the heterothallic strains generated. To verify the mating competence of the heterothallic cells generated above, we mated six spore clones each for S. cerevisiae and S. pastorianus with two S. cerevisiae strains, CSH84L(α) and CSH89L(a). In all mating assays, diploid cells were obtained with only one of the mating type strains (either α or a), thus establishing the mating type of the generated S. cerevisiae and S. pastorianus spores. Like the strains derived from 145A211 and Weihestephan 34/70, they lacked auxotrophic markers. The presence of zygotes and the sporulation ability of the cells obtained confirmed the occurrence of mating and therefore the heterothallism of the Δho strains in both species. Although S. pastorianus contains two HO gene types, Sc-HO and Lg-HO, heterothallic competent mating strains could be obtained simply by deletion of the Sc-HO gene. The pDHO vector described herein is thus a useful tool for obtaining heterothallic strains from both S. cerevisiae and S. pastorianus. These heterothallic strains can, in turn, be used to improve industrial strains by either traditional breeding techniques or genetic engineering.

205

8. 9. 10.

11. 12.

13.

14. 15.

16.

Blasco L, Feijoo-Siota L, Veiga-Crespo P, Villa TG (2008) Genetic stabilization of Saccharomyces cerevisiae oenological strains by using benomyl. Int Microbiol 11:127-132 Cebollero E, González-Ramos D, Tabera L, González R (2007) Transgenic wine yeast technology comes of age: is it time for transgenic wine? Biotechnol Lett 29:191-200 Delneri D, Tomlin GC, Wixon JL, Huter A, Sefton M, Louis EJ, Oliver SG (2000) Exploring redundancy in yeast genome: An improving strategy for use of the cre-loxP system. Gene 252:127-135 Dunn B, Sherlock G (2008) Reconstruction of the genome origins and evolution of the hybrid lager yeast Saccharomyces pastorianus. Genome Res 18:1610-1623 Herskowitz I, Jensen RE (1991) Putting HO gene to work: practical uses for mating-type switching. In: Guthrie C, Fink GR (eds) Methods in Enzymology. Guide to yeast genetics and molecular biology. Academic Press, San Diego, USA, pp 132-146 García Garibay M, López-Mungía Canales A (2004) Non distilled alcoholic beverages. In: García Garibay MR, Quintero Ramírez A & LópezMungía Canales A (eds) Food Biotecnology (In Spanish). Editorial Limusa, México D.F., México, pp 263-317 Moreno-Arribas M, Polo MC (2005) Winemaking biochemistry and microbiology: current knowledge and future trends. Crit Rev Food Sci Nutr 45:265-268 NakaoY, Kanamori T, Itoh T, et al. (2009) Genome sequence of the lager brewing yeast, an interspecies hybrid. DNA Res 16:115-129 Pretorius IS (2000) Tailoring wine yeast for the new millennium: novel approaches to the ancient wine making. Yeast 16:675-729 Puig S, Querol A, Barrio E, Pérez-Ortín JE (2000) Mitotic recombination and genetic changes in Saccharomyces cerevisiae during wine fermentation. Appl Environ Microbiol 66:2057-2061 Rainieri S, Zambonelli C, Kaneko Y (2003) Saccharomyces sensu stricto: systematics, genetic diversity and evolution. J Biosc Bioeng 96:1-9 Rothstein RJ (1983) One step gene disruption. In: Wu R, Lawrence L, Moldave K (eds) Methods in Enzymology. Academic Press, San Diego, USA, pp 202-211 Saerens SMG, Duong CT, Nevoigt E (2010) Genetic improvement of brewer’s yeast: current state, perspectives and limits. Appl Microbiol Biotechnol 86:1195-1212 Storchová Z, Breneman A, Cande J, et al. (2006) Genome-wide genetic analysis of polyploidy in yeast. Nature 443:541-547 Swiegers J H, Bartowsky EJ, Henschke PA, Pretorius IS (2005) Yeast and bacterial modulation of wine aroma and flavor. Austr J Grape Wine Res 11:139-173 Tamai Y, Momma T, Yoshimoto H, Kaneko Y (1998) Coexistence of two types of chromosome in the bottom fermenting yeast, Saccharomyces pastorianus. Yeast 14:923-933


206

INT. MICROBIOL. Vol. 14, 2011

17. Tamai Y, Tanaka K, Kaneko Y, Harashima S (2001) HO gene polymorphism in Saccharomyces industrial yeasts and application of novel HO genes to convert homothallism to heterothallism in combination with the mating-type detection cassette. Appl Microbiol Biotechnol 55:333-340 18. Van Zyl WH, Lodolo EJ, Gericke M (1993) Conversion of homothallic yeast to heterothallism through HO gene disruption. Curr Genet 23:290-294

BLASCO ET AL.

19. Vaughan-Martini A, Kurzman CP (1985) Deoxyribonucleic acid relatedness among species of the genus Saccharomyces sensu stricto. Int J Syst Bacteriol 35:508-511 20. Wach A (1996) PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12:259-265


RESEARCH ARTICLE INTERNATIONAL MICROBIOLOGY (2011) 14:207-211 DOI: 10.2436/20.1501.01.150 ISSN: 1139-6709 www.im.microbios.org

New records of the ectoparasitic flagellate Colpodella gonderi on non-Colpoda ciliates José Luis Olmo,1 Genoveva F. Esteban,2* Bland J. Finlay3 1 Department of Plant Production and Technological Agriculture, Engineering School of Technical Agriculture, University of Castilla-La Mancha, Ciudad Real, Spain. 2Conservation Ecology and Environmental Sciences Group, School of Applied Sciences, Bournemouth University, Poole, UK. 3Queen Mary University of London, School of Biological and Chemical Sciences, The River Laboratory, Wareham, UK

Received 19 September 2011 · Accepted 22 October 2011

Summary. Colpodella gonderi is the only ectoparasitic flagellate of ciliated protozoa described thus far. This investigation reveals new records of C. gonderi retrieved from soil samples in southern Scotland, UK. Of fourteen ciliates species identified in one single occasion, three of them, Colpoda steinii, Pseudoplatyophrya nana and Grossglockneria acuta, were infested with the parasite. These results provide further evidence that C. gonderi is not host-specific of the ciliate genus Colpoda. [Int Microbiol 2011; 14(4):207-211] Keywords: Colpoda steinii · Colpodella · Spiromonas · colpodids · flagellated protozoa · parasitism

Introduction The only ectoparasitic flagellate of ciliated protozoa described thus far is Colpodella gonderi [8,14]. First reported by Stein in 1878 in fresh waters in Germany, C. gonderi has subsequently been found in hay infusions also in Germany [9], in fen pond samples in France [2], and more recently in saline soils in eastern Austria [8], and in a decaying-wood sample in a forest in Slovakia [16]. Nearly every record of C. gonderi in the literature is of flagellates attached to the pellicle of ciliates of the genus Colpoda. Consequently, the organisms were traditionally considered to be host-specific of that ciliate genus [8].

*Corresponding author: G.F. Esteban Conservation Ecology and Environmental Sciences Group School of Applied Sciences Bournemouth University, Talbot Campus Poole, Dorset BH12 5BB, UK Tel. +44-1929401886 E-mail: gesteban@bournemouth.ac.uk

However, in 2004 [16], C. gonderi was observed parasitizing some individuals of the scuticociliate Pseudocohnilembus pusillus, making it the first record of the ectoparasitic flagellate on non-Colpoda ciliates. The research presented here reveals new records of infection in two further ciliate genera, Grossglockneria and Pseudoplatyophrya, providing additional evidence that Colpodella gonderi is not host-specific of the genus Colpoda. In the work described herein, C. gonderi was found in grassland soils in Scotland.

Material and methods Study site and soil sampling. Soil samples were obtained from a 1-ha upland grassland experimental site at the Sourhope Research Station of the Macaulay Land Use Research Institute, near Kelso in Southem Scotland (grid reference NT 854196) [7]. The site is mid-altitude (304–312 m a.s.l.) temperate upland grasslands on base-poor mineral soils, with the common bent (colonial bentgrass) Agrostis capillaris as the dominant plant species. The average annual rainfall is ca. 950 mm. The soils are shallow brown forest soils with localised gleying on andesite and undifferentiated intermedi-


208

OLMO ET AL.

INT. MICROBIOL. Vol. 14, 2011

ate igneous rock type, with the pH ranging from 4.54 to 4.81 across the experimental plots. Livestock have been excluded from the site since 1998. Samples were taken to a depth of ca. 5 cm using a 6-cm diameter steel soil corer. The soil consisted mainly of the upper soil organic layer. Samples were kept in the dark in a cool box at 4 °C for transport to the laboratory. Details of the sampling treatment, the protocol to estimate protozoan growth potential, and the techniques used to investigate protozoan cell morphology are in [4,5,7]. Briefly, the protocol we followed to study protozoa from soils consisted of removing above-ground foliage from the soil core sample, and breaking up and mixing the remaining soil. The soil was spread as an even layer in 15-cm diameter glass Petri dish bases in a containment room at room temperature (18–22 °C) for six days. After that time, the soil was passed through a 3.35-mm sieve and homogenised. This material is referred to as ‘air-dried soil’. To determine its oven-dried weight, 5 g of air-dried soil was heated to 80 °C and weighed at 24 h and 48 h [7]. Enumeration and characterisation of ciliates. Five grams of air-dried soil prepared as explained above was placed into a plastic Petri dish. The sample was incubated by adding a measured volume of filtered (0.2-μm pore-size filters) rain water sufficient to produce a slurry. This slurry was obtained by adding 10–15 ml of filtered water to 5 g of air-dried soil (see [7] for full details of procedure). The water was added to just beyond field capacity so that the crumb structure of the soil was retained and excess

water drained to the edge of the Petri dish. The sample was incubated in the dark at 15° C for four days. Fifty μl drops were then removed from the runoff and examined in a Sedgewick-Rafter counting chamber. Median abundance was calculated and the results were subsequently extrapolated to obtain numbers of individuals per gram of oven-dried soil weight [7]. For ciliate species identification, silver impregnation techniques (Protargol and the pyridinated silver carbonate methods [3,6]) were used to reveal the ciliates’ infraciliature in order to characterise and identify the different species. Video clips of living Colpodella gonderi attached to different species of colpodids have been deposited with Spanish National Research Council (CSIC), at the National Museum of Natural Sciences, Madrid, Spain: http://www.cienciatk.csic.es/index.php?module=search&search=colpodella

Results and Discussion A flagellate attached to the surface of ciliates unexpectedly occurred in one soil sample out of 150 soil samples analysed on a single occasion. This ectoparasitic flagellate had the following morphological characteristics: two flagella of equal

Table 1. Ciliate species identified in soil from upland grassland in Scotland (UK). The species are sorted from highest to least median abundance in the sample. The percentage of cells infested with the ectoparasitic flagellate is also recorded

Species

Median abundance of ciliates per gram dry weight soil

% of population infested

Colpoda steinii

812

26

Grossglockneria acuta

560

7

Gonostomum affine

280

0

Pseudoplatyophrya nana

252

11

Colpoda inflata

154

0

Holosticha sp.

140

0

Colpoda cucullus

98

0

Nivaliella plana

70

0

Cyrtolophosis elongata

42

0

Leptopharynx costatus

42

0

Platyophrya vorax

42

0

Sathrophilus muscorum

42

0

Cyclidium glaucoma

28

0

Aspidisca turrita

14

0


INT. MICROBIOL. Vol.14, 2011

209

Int. Microbiol.

NEW RECORDS OF COLPODELLA GONDERI

Fig. 1. Ciliates infested with the flagellate Colpodella gonderi. (A) Colpoda steinii with three flagellates attached to its surface; (B) Pseudoplatyophrya nana with two flagellates; (C) Grossglockneria acuta with one flagellate. Scale bars: ca. 10 μm.

length of 1.5–2 times the cell length; the size of the wellnourished individual was 10–12 μm long by 8–10 μm wide, and nearly spherical; the cytoplasm contained few granules, sometimes a large spherical or kidney-shaped inclusion was observed at the posterior end; the nucleus was placed approximately in the middle of the cell; no contractile vacuole was observed. These characteristics match those of the ectoparasitic flagellate Colpodella gonderi [8]. Fourteen ciliates species were identified in this soil sample. Species names, median abundances and the percentage of infection by the parasitic flagellate are shown in Table 1. Of fourteen ciliates species retrieved, only three species, Colpoda steinii, Pseudoplatyophrya nana and Grossglockneria acuta, had Colpodella gonderi attached to their surfaces. Other Colpoda species observed in the soil sample, i.e. C. inflata and C. cucullus, which have been previously reported as hosts [2,8,9,15], did not bear any flagellates. The highest infection occurred on Colpoda steinii (Fig.1, Table 1) with 26 % of the population infected by the flagellate; 11 % of the ciliates Pseudoplatyophrya nana (Fig. 1) and 7 % of Grossglockneria acuta were infested by Colpodella gonderi (Fig. 1). These three ciliate species also registered the highest population abundances (except for Gonostomum affine, which was not infected) out of the fourteen ciliate species recorded in the sample (Table 1). Higher ciliate abundances might, therefore, have facilitated flagellate infestation. Infestation with C. gonderi in large ciliate populations has also been reported in the finding of the ectoparasitic flagellate on the non-Colpoda ciliate Pseudocohnilembus pusillus [16]. The number of flagellate parasites attached to ciliate individuals was usually one, two or three, but in some cases up

to ten. Colpoda steinii was the species with the highest numbers of parasites while Pseudoplatyophrya nana and Grossglockneria acuta usually had only one or two parasites. Colpodella gonderi attached most commonly to the posterior end of the host (Fig. 1) although they were also observed attached to the ciliate cell equator (Figs. 1 and 2). When ciliates are severely infested or in the last stage of infestation, the ciliate cytoplasm becomes vacuolated, and they eventually round up and burst. Flagellates of the genus Colpodella are small (< 20 μm) alveolate protozoa. The genus includes seven species [14]: Colpodella edax, C. gonderi, C. perforans, C. pugnax, and C. vorax, C. angusta and C. turpis. While the latter two species are also considered as within the Colpodella genus, this needs further taxonomic support. All species are predatory free-living or parasitic; the latter, after attaching to their prey’s surface, suck the cytoplasm by means of a rostrum. Their preys are other single-celled eukaryotes such as microalgae and ciliates [8,14]. Colpodella is the genus with free-living species most closely related to apicomplexan parasites [14], which comprise animal parasites: coccidia, gregarines, Plasmodium and Babesia, amongst others [13]. Molecular phylogenetic studies [10,11] suggested colpodellids as potential ancestors of apicomplexans. It is now recognised that colpodellids constitute a sister group of parasitic apicomplexa and that they probably have a common origin [1]. Colpodella gonderi was originally described as Spiromonas gonderi [8]; the genus Spiromonas was established by Perty in 1852 (see, e.g. [8]). However, the type species was not actually a flagellate and the genus name was


OLMO ET AL.

INT. MICROBIOL. Vol. 14, 2011

Int. Microbiol.

210

Fig. 2. Previous records of Colpodella gonderi on flagellates attached to ciliates of the genus Colpoda as published in the scientific literature (after [2,8,9,15]). See text for details on infection of non-colpodid ciliates.

consequently invalidated [12]. Full details and justification of the Spiromonas species’ status are given in [12,14]. Nearly every record of C. gonderi in the scientific literature is of flagellates infecting ciliates of the genus Colpoda (Fig. 2): C. inflata [15], C. cucullus [9], C. steinii [2] and C. maupasi [8]. Thus, Colpodella gonderi was historically considered to be host-specific of Colpoda [8]. However, in 2004 [16], C. gonderi was observed on the cell surface of the scuticociliate Pseudocohnilembus pusillus, making it the first record of the ectoparasitic flagellate on non-Colpoda ciliates. The research presented here provides new, further records of infection in two other ciliate genera, Grossglockneria and Pseudoplatyophrya, thus serving as additional evidence that Colpodella gonderi is not host-specific of the genus Colpoda. There is the possibility that Grossglockneria and Pseudoplatyophrya were ‘accidental’ hosts, hence the lower infestation rates (Table 1). However, in all instances, the flag-

ellates did attach successfully to the ciliate, causing the host to eventually perish. Had infestation occurred by chance, other ciliate genera and/or colpodids co-existing in the same soil sample would have been expected to be infested, but this was not the case. Furthermore, no flagellates were observed to become detached from their hosts, which might have indicated a non-successful infection. The other colpodids detected in the sample probably had too low an abundance to provide a strong attachment signal and therefore were not infected; but this could not be verified. Research published in the scientific literature has shown that non-colpodid ciliate species can be parasitized [16]. Thus far, the flagellate has been found attached to three genera of colpodid ciliates, and on a scuticociliate, once population abundance of the (potential) host reaches a certain threshold. Its incidence is undeniably higher on colpodids, particularly those of the Colpoda genus. It may be that the characteristics of the colpodids’ pel-


NEW RECORDS OF COLPODELLA GONDERI

licle facilitate attachment of the flagellates. Further research —including laboratory experimental work—into the biology of this parasite is essential. Thus far, we can conclude that Colpodella gonderi is an ectoparasite flagellate, most commonly found attached to the surface of colpodid ciliates, but not host-specific of the ciliate genus Colpoda. Acknowledgements. This work was funded by the U.K. Natural Enviroment Research Council, through the Soil Biodiversity Thematic Programme (grant no. OST 2130) and by the Spanish Ministry of Education and Culture, with a postdoctoral fellowship awarded to J.L. Olmo. Funds from Esmée Fairbairn Foundation (UK) are also acknowledged.

INT. MICROBIOL. Vol.14, 2011

6.

7.

8.

9. 10.

Competing interests. None declared. 11.

References 12. 1.

2. 3.

4.

5.

Adl SM, Simpson AGB, Farmer MA, Andersen RA, Anderson OR, Barta JR, Bowser SS, Brugerolle G, Fensome RA, Fredericq S, James TY, Karpov S, Kugrens P, Krug J, Lane CE, Lewis LA, Lodge J, Lynn DH, Mann DG, McCourt RM, Mendoza L, Moestrup Ø, MozleyStandridge SE, Nerad TA, Shearer CA, Smirnov AV, Spiegel FW, Taylor MFJR (2005) The new higher level classification of eukaryotes with emphasis on the taxonomy of protists. J Eukaryot Microbiol 52:399-451 Chardez D (1981) Les protozoaires ciliés des Fagnes. Revue Verviétoise Hist Nat 38:51-58 Esteban GF, Clarke KJ, Finlay BJ (1998) Rapid techniques for the identification of free living protozoa. In: Burlage RS, Atlas R, Stahl D, Geesey G, Sayler G (eds) Techniques in microbial ecology. Oxford University Press, Oxford, UK, pp 203-217 Esteban GF, Olmo JL, Finlay BJ (2001) Redescription of the genera Psilotricha acuminata Stein, 1859 and revisions of the genera Psilotricha and Urospinula (Ciliophora, Hypotrichida). J Eukar Microbiol 48:280-292 Esteban GF, Clarke KJ, Olmo JL, Finlay BJ (2006) Soil Protozoa—An intensive study of population dynamics and community structure in an upland grassland. App Soil Ecol 33:137-151

13.

14.

15.

16.

211

Fernández-Galiano D (1994) The ammoniacal silver carbonate method as a general procedure in the study of protozoa from sewage (and other) waters. Water Research 28:495-496 Finlay BJ, Black HIJ, Brown S, Clarke KJ, Esteban GF, Hindle RM, Olmo JL, Rollett A, Vickerman K (2000) Estimating the growth potential of the soil protozoan community. Protist 151:69-80 Foissner W, Foissner I (1984) First record of an ectoparasitic flagellate on ciliates: an ultrastructural investigation of the morphology and the mode of attachment of Spiromonas gonderi nov. spec. (Zoomastigophora, Spiromonadidae) invading the pellicle of ciliates of the genus Colpoda (Ciliophora, Colpodidae). Protistologica 20:635-648 Gonder R (1910) Ein Parasit von Colpoda cucullus. Arch Protistenk 18:275-278 Kuvardina ON, Leander BS, Aleshin VV, Myl’nikov AP, Keeling PJ, Simdyanov TG (2002) The phylogeny of colpodellids (Alveolata) using small subunit rRNA gene sequences suggests they are the free-living sister group of apicomplexans. J Eukar Microbiol 49:498-504 Leander BS, Kuvardina ON, AleshinVV, Myl’nikov AP, Keeling PJ (2003) Molecular phylogeny and surface morphology of Colpodella edax (Alveolata): Insights into the phagotrophic ancestry of Apicomplexans. J Eukar Microbiol 50:334-340 Patterson DJ, Zölffel M (1991) Heterotrophic flagellates of uncertain taxonomic position. In: Patterson DJ, Larsen J (eds) The biology of free-living heterotrphic flagellates. Clarendon Press, Oxford, UK, pp 427-475 Perkins FO, Barta JR, Clopton RE, Peirce MA, Upton SJ (2000) Phylum Apicomplexa. In: Lee JJ, Leedale GF, Bradbury P (eds) An illustrated guide to the Protozoa, 2nd ed. Society of Protozoologists. Lawrence, Kansas, USA, Vol 1, pp 190-369 Simpson AGB, Patterson DJ (1996) Ultrastructure and identification of the predatory flagellate Colpodella pugnax Cienkowski (Apicomplexa) with a description of Colpodella turpis n. sp. and a review of the genus. Syst Parasitol 33:187-198 Stein F (1878) Der Organismus der Infusionsthiere nach eigenen Forschungen in systematischer Reihenfolge bearbeitet. III. Abtheilung. Die Naturgeschichte der Flagellaten oder Geisselinfusorien. 1. X. W. Engelmann, Leipzig, 154 pp Tirjaková E (2004) Protozoans parasiting on ciliates (Protozoa: Ciliophora) in Slovakia. Acta Zoologica Universitatis Comenianae 46:1-5


RESEARCH ARTICLE INTERNATIONAL MICROBIOLOGY (2011) 14:213-223 DOI: 10.2436/20.1501.01.151 ISSN: 1139-6709 www.im.microbios.org

Antimicrobial peptide genes in Bacillus strains from plant environments Isabel Mora, Jordi Cabrefiga, Emilio Montesinos* Institute of Food and Agricultural Technology-XaRTA-CIDSAV, University of Girona, Girona, Spain Received 10 October 2011 · Accepted 17 November 2011

Summary. The presence of the antimicrobial peptide (AMP) biosynthetic genes srfAA (surfactin), bacA (bacylisin), fenD (fengycin), bmyB (bacyllomicin), spaS (subtilin), and ituC (iturin) was examined in 184 isolates of Bacillus spp. obtained from plant environments (aerial, rhizosphere, soil) in the Mediterranean land area of Spain. Most strains had between two and four AMP genes whereas strains with five genes were seldom detected and none of the strains had six genes. The most frequent AMP gene markers were srfAA, bacA, bmyB, and fenD, and the most frequent genotypes srfAA-bacA-bmyB and srfAAbacA-bmyB-fenD. The dominance of these particular genes in Bacillus strains associated with plants reinforces the competitive role of surfactin, bacyllomicin, fengycin, and bacilysin in the fitness of strains in natural environments. The use of these AMP gene markers may assist in the selection of putative biological control agents of plant pathogens. [Int Microbiol 2011; 14(4):213-223] Keywords: Bacillus · antimicrobial peptides · bacillomycin · fengycin · surfactin · bacilysin

Introduction Plant disease control has been reoriented towards the rational use of fungicides and bactericides and the application of non-chemical methods with decreased environmental impact. Microbial biopesticides, which consist of microbial strains including bacterial or fungal species and bacteriophages [37], offer an alternative to or are able to complement chemical pesticides [19,35,40]. For example, several strains of the bacteria Pantoea agglomerans [18] in addition to Pseudomonas fluorescens [51], Pseudomonas chlororaphis [53], Lactoba-

*Corresponding author: E. Montesinos Laboratory of Plant Pathology, Institut de Tecnologia Agroalimentària Campus Montilivi, s/n. Universitat de Girona 17071 Girona, Spain Tel. +34-972418427. Fax +34-972418399 E-mail: emonte@intea.udg.edu

cillus spp. [54] and Bacillus subtilis [34] have been reported in the successful control of many plant diseases. Bacillus subtilis and related species have been the object of particular interest because of their safety, their widespread distribution in very diverse habitats, their remarkable ability to survive adverse conditions due to the development of endospores, and their production of compounds that are beneficial for agronomical purposes [16,17,25,34,37,39]. Several strains of Bacillus have been shown to control plant diseases by different mechanisms of action, including antibiosis, the induction of defense responses in the host plant, and competition for nutrient sources and space [2,14,42,46]. Among these mechanisms, antibiosis by means of antimicrobial peptides has been explored in detail [39]. Antimicrobial peptides (AMPs) produced by Bacillus spp. have been implicated in the biocontrol of several plant pathogens causing aerial, soil, and postharvest diseases [4,10,12,17,23,24,28,32,36,50] and in the promotion of plant


214

MORA ET AL.

INT. MICROBIOL. Vol. 14, 2011

growth [22,25,45]. AMPs include cyclic lipopeptides such as fengycin, iturin, bacillomycin, and surfactin. These compounds are characterized by a wide antimicrobial spectrum and intense surfactant activities [50,55], and they have been implicated in the biocontrol of several plant diseases [6,9,12,38,46]. In addition to lipopeptides, other peptidic compounds are active in the biocontrol of plant pathogens, such as bacilysin, a dipeptide described in B. amyloliquefaciens FZB42 [11,41,43], and subtilin, a lantibiotic described in B. subtilis [8,29,49]. Note that, in several strains of Bacillus, the biocontrol of plant pathogens has been linked to the presence of the AMP biosynthetic genes bmyB, fenD, ituC, srfAA, and srfAB [20,23,46]. The simultaneous production of different AMPs is important for the efficiency of disease control and underlies the broad range of antagonistic activity in Bacillus. Specifically, the production of mixtures of bacillomycin, fengycin, and iturin A by B. subtilis has been related to the control of Podosphaera fusca in cucurbits [46], and the production of bacilysin, iturin, and mersacidin in B. subtilis ME488 to the suppression of Fusarium wilt of cucumber and Phytophthora blight of pepper [12]. Accordingly, strains of Bacillus that score positive for all of the abovementioned AMP biosynthetic genes are more effective at inhibiting the growth of Rhizoctonia solani and Pythium ultimum than other Bacillus isolates that lack one or more of those markers [23]. In addition, genome analysis of the commercial strain B. amyloliquefaciens FZB42 revealed the presence of genes responsible for the synthesis of several antimicrobial compounds [11], and similar genes have been reported in the commercialized B. subtilis strains GB03, QST713, and MBI600 [3,23]. An understanding of the role of AMPs in the ecological fitness of plants requires an appreciation of the distribution of the respective genes in natural populations of the relevant Bacillus species. However, thus far, our knowledge is restricted to strains identified based on their antagonism of specific target plant pathogens such as Sclerotina sclerotiorum [5] or other fungal pathogens of canola and wheat [44]. By contrast, little is known about the distribution and, specifically, the number and expression pattern of AMP biosynthetic genes in strains of Bacillus not previously selected for antagonism against a given plant pathogen. Thus, the aim of this work was to study the distribution of six AMP genes (srfAA, surfactin; bacA, bacylisin; fenD, fengycin; bmyB, bacyllomicin; spaS, subtilin; and ituC, iturin) in an unselected collection of Bacillus spp. obtained from different plant environments in a Mediterranean land area.

Materials and methods Bacterial strains and growth conditions. A collection of reference strains of Bacillus including 14 strains belonging to six species of the genus was used. The strains were B. amyloliquefaciens FZB42 (ABiTEP GmbH, Germany), B. subtilis QST713 (Agraquest, USA), B. subtilis EPS2004 (CIDSAV, University of Girona, Spain), B. subtilis UMAF6614 and UMAF6639 (Departament of Microbiology, University of Malaga, Spain), B. subtilis RGAF9, RGAF32, B. circulans RGAF11, B. polymyxa RGAF5 and RGAF84, B. macerans RGAF101, B. megaterium RGAF46 and RGAF51, and Bacillus RGAF66 (Institute for Sustainable Agriculture, CSIC, Spain). In addition, several non-Bacillus bacterial species were examined: Pantoea agglomerans EPS10, EPS13, EPS21, EPS130, EPS132, EPS156, EPS207, EPS210, EPS230, and EPS453, Pseudomonas fluorescens ESP62e, EPS82, EPS87, EPS95, EPS98F, EPS102, EPS173, ES282, ESP353, and EPS684, Pseudomonas syringae EPS94 and Serratia marcescens EPS131 and EPS318 (CIDSAV, University of Girona, Spain), Pectobacterium carotovorum CECT225 (Spanish Type Culture Collection, Valencia, Spain), Xanthomonas arboricola pv. fragariae CFBP3549 and Xanthomonas axonopodis pv. vesicatoria CFBP327 (CFBP, French Collection of Plant Pathogenic Bacteria, UMR PaVé-INRA, France), and Pseudomonas syringae pv. tomato DC3000 (NCPPB4369) (NCPPB, National Collection of Plant Pathogenic Bacteria, UK). Bacillus strains were cultured in Luria-Bertani (LB) agar at 28 ºC for 24 h, and P. agglomerans, P. fluorescens, and S. marcescens in LB at 23 ºC also for 24 h. Concentrations of cell suspensions for each bacterial genus were obtained using a standard curve relating cell concentration to optical density at 620 nm. DNA extraction. DNA was obtained according to the method described by Llop et al. [31]. Briefly, 1 ml of bacterial suspension was centrifuged at 10,000 ×g for 10 min and the pellet was resuspended in 500 μl of extraction buffer (200 mM Tris-HCl, pH 7.5, 250 mM NaCl, 25 mM EDTA, 05 % SDS, 2 % PVP). After 1 h of shaking, the tubes were centrifuged at 5000 ×g for 5 min and 450 μl was transferred to a new tube to which 450 μl of isopropanol was then added. Precipitation took place over at least 1 h, followed by centrifugation at 13,000 ×g for 10 min. The DNA pellet was dried and then resuspended in 200 μl of sterile ultrapure water. AMP gene primer design and PCR assays. For the development of PCR primers, six sequences were chosen from the coding regions of bmyB (bacillomycin L synthetase B), fenD (fengycin synthetase), ituC (iturin A synthetase C), srfAA (surfactin synthetase subunit 1), bacA (bacilysin biosynthesis protein), and spaS (lantibiotic subtilin). Also, two sequences were used as markers of Bacillus, based on the coding regions of the 16S rRNA genes and spoVG (putative septation protein spoVG). Primers reported by Joshi and McSpadden [23], to detect the genes bmyB, fenD, ituC, and srfAA, were used for comparison. New primers were developed for bmyB, fenD, ituC, and srfAA due to the need to increase the sensitivity of the PCR, which is essential when working with natural samples. Gene sequences were obtained from the GenBanK database and aligned using MultAlin software [13]. Consensus regions were used to design specific primers using Primer3 software [47] (Table 1). PCR was carried out in a total volume of 50 μl containing 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTP (Invitrogen Technologies), 0.2 μM of each primer, 2.0 U of Taq DNA polymerase (Biotools), and 4 μl of genomic DNA. The cycling conditions for the amplification of all targets were as follows: 95 ºC for 4 min, 40 cycles of 94 ºC for 1 min, annealing temperature for 1 min, and 70 ºC for 1 min. A final extension step at 70 ºC for 5 min was followed by a 4 ºC soak. The annealing temperature was set to 58 ºC for 16S rRNA genes and for fenD, ituC, srfAA,


ANTIMICROBIAL PEPTIDES IN BACILLUS

INT. MICROBIOL. Vol.14, 2011

215

Table 1. Oligonucleotide primers used to detect genetic markers in field samples and in Bacillus spp. strains Primer 16SBACF

Expression product 16S rRNA

16SBACR SPOF

Spore protein

Fengycin

Bacyllomicin

Iturin

Surfactin

SPASR

163

AATACCGATGGTCGCATGA

spoVG

59.5

226

GGCCCGTTCTCTAAATCCAT

fenD

60.1

269

GAATCCCGTTGTTCTCCAAA

bmyB

59.9

370

GGCTGCTGCAGATGCTTTAT

ituC

60.1

423

TCGGGACAGGAAGACATCAT

srfAA

60.4

201

bacA

60.1

498

spaS

59.6

375

CCACTCAAACGGATAATCCTGA Bacylisin

BACR SPASF

59.9

TCGCAGATAATCGCAGTGAG

SRFAR BACF

16S rDNA

GCGGGTATTGAATGCTTGTT

ITUCR SRFAF

Product size (bp)

GTCATGCTGACGAGAGCAAA

BMYBR ITUCF

GCTTGCTCCCTGATGTTAGC

Melting T (ºC)

CAGAATCACCCAAACGATGA

FENDR BMYBF

Gene

CGGGTCCATCTGTAAGTGGT

SPOR FENDF

Sequence (5′ → 3′)

CAGCTCATGGGAATGCTTTT CTCGGTCCTGAAGGGACAAG

Subtilin

GGTTTGTTGGATGGAGCTGT GCAAGGAGTCAGAGCAAGGT

bacA and spaS, to 55 ºC for bmyB, and to 52 ºC for spoVG. Amplifications were carried out in a T3000 thermocycler (Biometra, Germany). The amplification products were analyzed in a 1.8 % agarose gel in 1× Tris-acetate EDTA (TAE), run for 45 min at 90 V, and viewed after staining with ethidium bromide. Size comparisons were made with a 1-kb plus ladder (Invitrogen, California, USA). Gel images were captured with an imaging system (Kodak 120; Kodak, Rochester, NY, USA). The sensitivity of the primer pairs was determined in four Bacillus strains (RGAF51, UMA6614, UMA6639, and EPS2004). Suspensions of each strain were prepared at 108, 107, 106, 105, 104, 103, 102, and 101 colonyforming units (CFU)/ml and DNA extracted as described above. The specificity of the primer pairs was determined as described above in 14 strains of Bacillus spp., 10 strains of P. agglomerans, 10 strains of P. fluorescens, and 2 strains of S. marcescens. Suspensions of each strain were prepared at 106 and 108 CFU/ml and DNA was extracted as before. Sampling and isolation procedures. Field samples from plant environments were collected from three locations of the Mediterranean area of Spain in late spring–early summer (Table 2). For validation of the selective enrichment method, 45 samples were collected, mainly from Girona, Lleida, and Menorca. Fifteen samples were from the aerial plant part, 15 from the rhizosphere, and 15 from the soil sorrounding the plant root system. The sampled plants were representative species of ten families of herbaceous plants typical of the Mediterranean area. To compare the efficiency of isolation of the Bacillus strains, two methods were compared: the standard method (ST) and the selective enrichment method (SE). The ST method was based on the recovery of Bacillus isolates directly from the sample extract and was carried out as follows: 1 g of material was homogenized for 90 s in 10 ml of phosphate buffer (0.02 M Na2HPO4, 0.05 M KH2PO4) using a stomacher (Masticator 400, IUL Instruments, Barcelona, Spain). Next, 100 μl of

serial 10-fold dilutions of each extract were spread onto LB agar plates and incubated at 28 ºC for 24 h. Bacillus-like colonies were identified on the basis of their morphology [46], by optical microscopy, and by means of PCR directed at the 16S rRNA genes. Both total bacteria and Bacillus population levels were determined. The presence of Bacillus was also determined in the sample extract by PCR using the primers developed for the 16S rRNA genes. Isolated strains and sample extracts were also analyzed by PCR, using specific primers for the biosynthetic genes bmyB, fenD, ituC, srfAA, bacA, and spaS. The SE method involved thermal treatment of the sample extract at 80 ºC for 10 min followed by enrichment, which consisted of an inoculation (1:100 diluted) in LB for 24 h at 40 ºC. After each of the procedures was completed, the samples were analyzed by PCR using primers directed at the 16S rRNA genes. Only extracts showing amplification for Bacillus were further processed for the isolation of Bacillus colonies, confirmed as previously described. Finally, the presence of biosynthetic genes (bmyB, fenD, ituC, srfAA, bacA and spaS) was determined both in the extracts and in the Bacillus isolates obtained. The distribution and pattern of AMP biosynthetic genes were examined in 184 Bacillus isolates obtained from 183 field samples, including different plant environments (143 samples of the aerial plant part, 25 samples of the rhizosphere, 15 samples of bare soil) and 35 plant species (cultivated, wildtype) collected from seven sampling sites in the Mediterranean area (mainly in Catalonia and the Balearic Islands) of Spain (Table 2). Strain recovery was enhanced by processing the samples using the SE method as previously described. A maximum of three different colonies of the typical Bacillus morphology were purified and identified per sample. Finally, the presence of AMP biosynthetic genes in the plant extracts and Bacillus isolates was determined by PCR using the specific primers for these genes (bmyB, fenD, ituC, srfAA, bacA, and spaS) as described above.


216

MORA ET AL.

INT. MICROBIOL. Vol. 14, 2011

Table 2. Sampling locations Location

Latitude

Longitude

Sample type*

Number of samples

Barcelona

41º 21′ 41.63′′ N

1º 40′ 09.90′′ E

A

7

Girona

42º 03′ 07.25′′ N 42º 03′ 07.03′′ N 42º 14′ 17.39′′ N 42º 02′ 35.44′′ N 42º 03′ 07.03′′ N 42º 02′ 35.44′′ N 42º 03′ 07.03′′ N 42º 02′ 35.44′′ N

3º 04′ 00.00′′ E 3º 11′ 46.66′′ E 2º 51′ 25.98′′ E 3º 07′ 34.90′′ E 3º 11′ 46.66′′ E 3º 07′ 34.90′′ E 3º 11′ 46.66′′ E 3º 07′ 34.90′′ E

A A A A R R S S

12 23 4 3 13 4 4 6

Lleida

41º 31′ 13.89′′ N 42º 22′ 55.49′′ N 42º 27′ 00.16′′ N 42º 35′ 17.44′′ N 42º 34′ 00.66′′ N 42º 34′ 00.66′′ N 42º 27′ 00.16′′ N

0º 52′ 09.13′′ E 1º 06′ 56.29′′ E 1º 13′ 30.68′′ E 1º 19′ 34.89′′ E 0º 55′ 29.10′′ E 0º 55′ 29.10′′ E 1º 13′ 30.68′′ E

A A A A R S S

6 10 4 1 3 3 2

Malaga

36º 46′ 43.12′′ N

4º 06′ 02.43′′ W

A

3

Minorca

40º 03′ 15.39′′ N 40º 05′ 21.91′′ N 39º 59′ 27.22′′ N 40º 05′ 21.91′′ N

4º 03′ 15.79′′ E 4º 08′ 31.46′′ E 4º 05′ 37.71′′ E 4º 08′ 31.46′′ E

A A A R

8 11 10 4

Navarre

42º 41′ 43.41′′ N

1º 40′ 33.85′′ W

A

4

Zaragoza

42º 13′ 85.13′′ N 41º 36′ 20.94′′ N 41º 30′ 27.89′′ N

1º 53′ 13.60′′ W 1º 14′ 48.12′′ W 1º 24′ 09.12′′ W

A A A

1 1 4

Sevilla

37º 20′ 24.41′′ N

6º 08′ 19.53′′ W

A

2

Tarragona

41º 10′ 19.43′′ N 41º 10′ 19.43′′ N

1º 01′ 13.68′′ E 1º 01′ 13.68′′ E

A R

20 1

Valencia

38º 54′ 12.53′′ N 39º 11′ 51.65′′ N

0º 25′ 02.49′′ W 0º 20′ 03.56′′ W

A A

8 1

*A, aerial plant part; R, rhizosphere; S, soil.

Results Evaluation of PCR assays. PCR using the generalist primers for Bacillus directed at the 16S rRNA and spoVG genes resulted in amplifications for the four Bacillus strains tested. However, primers spoVG also amplified three P. agglomerans (EPS10, EPS13, and EPS230) and four P. fluorescens (EPS173, EPS62e, EPS353, and EPS684) strains at both concentrations tested (106 and 108 CFU/ml). Primers 16SBACF and 16BACR also amplified three P. fluorescens (EPS173, EPS353, and EPS684) strains at 108 CFU/ml, although only strain EPS317 was positive at the lowest concentration. The 16S rRNA genes primers were more sensitive than the spoVG primers in the four Bacillus spp. strains analyzed. Thresholds

were established between 5× 101 and 5× 104 CFU/ml for the 16S rRNA genes, and between 5× 103 and 5× 106 CFU/ml for spoVG, depending on the Bacillus strain. On the basis of these results, primers for 16S rRNA genes were used for the confirmation of Bacillus, but with diluted samples thereof. For the biosynthetic genes (bmyB, fenD, ituC, srfAA, bacA, and spaS), the sensitivity of primer detection was highly variable, also among the strains. The fenD primers were the most sensitive and most consistent among strains, with a detection limit around 102 CFU/ml, while spaS primers were the least sensitive and least consistent among strains, with a detection limit between 1× 104 and 1× 107 CFU/ml. Primers for srfAA, bmyB, ituC, and bacA showed a wide threshold of detection, with values between 5× 102 and 1× 104 CFU/ml depending on the strain. The specificity study showed that


ANTIMICROBIAL PEPTIDES IN BACILLUS

INT. MICROBIOL. Vol.14, 2011

217

Table 3. Population levels of total bacteria and Bacillus spp. in samples of different plant parts according to two methods of analysis Positive samples for Bacillus ≥ 3 AMP*

Isolates number

14

8

2

2

2.54 ± 2.88

5

2

9

4

6.62 ± 0.75

2.80 ± 2.75

3

1

7

7

45

6.57 ± 1.00

1.88 ± 2.60

22

11

18

13

Aerial

15

8.10 ± 2.63

6.60 ± 3.32

15

13

14

13

Rhizosphere

15

8.03 ± 1.49

7.55 ± 2.50

15

14

19

11

Soil

15

7.29 ± 0.78

6.41 ± 2.31

15

10

22

17

Total

45

7.81 ± 1.80

6.85 ± 2.73

45

37

55

41

Method Standard

Enrichment

Confirmed Bacillus

Origin

Samples

Total culturable bacteria (log10 CFU/g)

Bacillus-like (log10 CFU/g)

Aerial

15

6.01 ± 1.59

0.29 ± 1.11

Rhizosphere

15

7.08 ± 0.65

Soil

15

Total

16S rRNA genes

≥ 3 AMP*

*Three or more antimicrobial peptide genes simultaneously.

genes related to the biosynthesis of AMPs were differently distributed among the Bacillus strains used as reference. srfAA was detected in all 14 strains, except RGAF84, while the other genes were very rare; spaS was detected only in UMA6614 and EPS2004, and ituC only in three strains. The distribution pattern of the six AMP genes among these 14 Bacillus strains was strain-dependent. However, none of the AMP genes was found in RGAF84. In the remaining strains, the distribution patterns were as follows: srfAA (RGAF5); srfAA and bacA (RGAF9, RGAF11, RGAF101); srfAA, bacA and bmyB (RGAF66, RGAF32, RGAF46), srfAA, bacA, bmyB and fenD (FZB42); srfAA, bacA, bmyB, fenD, and ituC (QST713, RGAF51, UMAF6639); srfAA, bacA, bmyB, fenD and spaS (UMAF6614, EPS2004) were identified. None of the strains had all six AMP genes. Generally, unspecific amplifications of the AMPs genes were not observed in the strains of the other bacterial species, except for P. fluorescens (EPS282 and EPS353), which amplified for bmyB primers at a concentration of 106 CFU/ml. Validation of the isolation procedure. In the validation experiment, the population of total culturable bacteria ranged from 6.01 to 7.08 log10 CFU/ml, whereas the population of Bacillus ranged from 0.29 to 2.8 log10 CFU/g (Table 3). A low presence of Bacillus was determined in the field samples, although the proportion of Bacillus spp. in the total population was higher in rhizosphere and soil samples than in the

aerial plant part. In addition, the frequency distribution of the population of total bacteria and of Bacillus spp. did not follow a normal distribution (according to the Shapiro-Wilk normality test, P < 0.05 in both cases). PCR using 16S rRNA genes detected Bacillus spp. in 22 out of 45 samples and in 18 putative Bacillus colonies that were isolated (2 from aerial plant parts, 9 from rhizosphere, and 7 from soil). Following the application of the SE method, Bacillus population levels increased until they reached high concentrations, with a consistent presence among the different sample types. Total culturable bacteria population levels were 7.29–8.10 log10 CFU/g compared to Bacillus spp. population levels of 6.41–7.55 log10 CFU/g. With the SE method, 55 putative Bacillus colonies were isolated, 14 from aerial plant samples, 19 from rizhosphere, and 22 from soil. After enrichment the 16S rRNA gene primers were amplified in all samples, indicating the presence of Bacillus spp. in all cases. Thus, the yield obtained by the SE method was around threefold that obtained with the ST method. Furthermore, 21.9 % of Bacillus spp. isolates came from aerial plant part samples, while 38.3 % and 39.7 % of isolates came from rhizosphere and soil samples, respectively. The presence of the six AMP genes (bmyB, fenD, ituC, srfAA, bacA, and spaS) was determined in natural extracts and in the corresponding Bacillus isolates. The methods differed in the frequency of AMP genes per sample. In the ST method, 11 out of 45 samples contained three or more AMP genes whereas in the SE method this was the case in 37 out


MORA ET AL.

INT. MICROBIOL. Vol. 14, 2011

Int. Microbiol.

218

Fig. 1. Type of antimicrobial peptide biosynthetic genes in field samples and in the corresponding Bacillus isolates processed directly by the standard method or the selective enrichment method.

of 45 samples (see also Table 3). There were significant differences between the ST and SE methods in terms of the frequency of distribution of the number of genes per sample (c2, P < 0.0001), although the differences were not significant (P = 0.054) in the Bacillus isolates. Figure 1 shows the distribution frequencies of the six AMP genes for the samples and the Bacillus isolates depending on the method used (ST, SE). In field samples and isolates, the frequency distributions were similar (c2, P = 0.900) and independent of the method used. Therefore, the SE method was used to build-up a larger collection of isolates, composed of 184 Bacillus strains, submitted to AMP gene analysis using the primer sets previously developed. Patterns of AMP genes in Bacillus strains. The distribution of the number of genes per strain and the frequency of each gene within the population are shown in Fig. 2. The number of simultaneous genes per strain followed a normal distribution (Fig. 2A). Most isolates had at least one of the biosynthetic genes (171 isolates, 92.9 %) and the majority of strains had 2â&#x20AC;&#x201C;4 simultaneous genes (76.1 %). The simultaneous presence of five genes was rare (3.3 % strains);

none of the isolates had all six genes. The distributions of the number of genes were similar among aerial and rhizosphere samples but differed with soil isolates, in which the numbers of genes tended to be higher (3â&#x20AC;&#x201C;4). The most frequent genes were srfAA (69.0 %), bacA (61.4 %), and bmyB (55.4 %), followed by fenD (40.2 %). The genes ituC (9.8 %) and spaS (15.2 %) were less frequent (Fig. 2B). These frequencies did not differ significantly by sample origin (P > 0.05). Figure 3 shows the patterns of AMP gene markers and the frequencies of these genes among strains. The most frequent genotypes were srfAA-bacA-bmyB (15.2 %) and srfAA-bacA-bmyB fenD (14.1 %). Isolates containing at least srfAA, srfAAbacA, or srfAA-bacA-bmyB accounted for 69 %, 46.7 %, and 34.8 %, respectively.

Discussion Studies on AMP biosynthetic genes in natural populations of Bacillus may be useful for discovering new inoculant strains with broad-ranging and better efficacy of pathogen control as well as improved fitness in plant environments. The


INT. MICROBIOL. Vol.14, 2011

219

Int. Microbiol.

ANTIMICROBIAL PEPTIDES IN BACILLUS

Fig. 2. Frequency distribution of the number (A) and type (B) of antimicrobial peptide biosynthetic genes in 184 strains of Bacillus spp. isolated from field samples. Data are presented separately by sample origin (soil, rhizosphere, aerial plant part or combined).

sequenced genomes of B. amyloliquefaciens FZB42 and B. subtilis 168 together with the finding of relevant genes in other strains has been applied to the identification of functional molecular markers related to secondary metabolite production (e.g. AMPs) and to their beneficial effects in plants [10]. In turn, this has facilitated the development of PCR tools to analyze the prevalence and distribution of these markers in commercial biocontrol Bacillus strains and in isolates from natural populations. In the present study, we developed sensitive PCR methods to analyze six AMP genes reportedly related to the antagonistic capacity of Bacillus [23]. The study of these markers

in a reference collection of Bacillus spp. confirmed the presence of srfAA, bacA, bmyB, and fenD in strain FZB42, and of srfAA, bmyB, fenD, and ituC genes in strain QST713, in agreement with previous reports [23,26]. However, we detected a fifth AMP gene, coding for bacA, in strain QST713. Although these AMP gene markers have not been reported previously in other strains, our results are consistent with the production of bacillomycin, fengycin, and surfactin detected by other authors in strain UMAF6614 and of iturin, fengycin and surfactin in strain UMAF6639 [46]. Note that we detected gene markers for bacilysin in both strains, for bacillomycin in UMAF6639, and for subtilin in UMAF6614.


INT. MICROBIOL. Vol. 14, 2011

MORA ET AL.

Int. Microbiol.

220

Fig. 3. Frequency distribution of patterns of antimicrobial peptide biosynthetic gene markers in 184 strains of Bacillus spp. isolated from field samples. The number of strains (N) within each group of simultaneous number of gene markers is indicated in the upper part of the panels. The presence (+) or absence (–) of antimicrobial peptide biosynthetic gene markers is also indicated.

The Bacillus population levels in samples from plants obtained for the present work were frequently very low (< 2.8 log10 CFU/g), in accordance with other reports in which they were either not detected or varied strongly with sample type and origin, with isolates being more frequently obtained from soil or rhizosphere than from aerial plant parts [1,21,33]. Also, the primers we developed for the AMP markers were sensitive enough in some cases but not in others. Consequently, a method to increase Bacillus population levels in the extracts from natural samples was developed and validated. This SE method consisted of thermal treatment at 80 ºC for 10 min followed by a cultivation stage at 40 ºC for 24 h. The method was validated for its capacity to recover Bacillus populations in complex communities, similar to other studies in which enrichment procedures have been used to increase the yield of isolation of Bacillus thuringiensis for insect pest control [7]. A comparison of the SE and ST methods in terms of Bacillus isolation yield and the distribution of

AMP genes within isolates showed that higher yields were obtained with the former, whereas the two methods did not significantly differ regarding the frequency distribution of genes, thus providing evidence that the SE method did not distort the actual Bacillus population structure in the original sample. Screening of the collection of isolates obtained from field samples covering a wide range of plant environments (soil, rhizosphere, and aerial plant parts) within a Mediterranean land area in Spain indicated a prevalence of AMP gene markers within the Bacillus population, since most strains had at least one marker. Note that the number of gene markers per strain followed a normal distribution, with the most frequent values being 2–4. The dominant gene markers were srfAA, bmyB, bacA, and fenD, with ituC and spaS only scarcely represented. This high presence of certain AMP gene markers among the Bacillus population is in agreement with the fact that the genomes of strains B. subtilis 168 and Bacillus amy-


ANTIMICROBIAL PEPTIDES IN BACILLUS

loliquefaciens FZB42 have six AMP operons [26]. However, in a study of the gene markers of bacillomycin D, iturin A, surfactin, mycosubtilin, fengycin, and zwittermicin A within a collection of strains antagonistic to S. sclerotiorum, the majority of strains were found to harbor sufactin and iturin [5]. Our results are in agreement with the prevalence of the surfactin gene, but not in the case of iturin gene. This may be due to the fact that in the above report the strain collection included only strains active against the target pathogen, whereas in our study the strains were not selected for a specific pathogen. In addition, those authors analyzed ituA rather than ituC. The finding that srfAA, bmyB, bacA, and fenD genes are dominant in plant environments reinforces the competitive role of surfactin, bacyllomicin, fengycin, and bacilysin in conferring strain fitness in natural environments. Surfactin production is widespread among B. subtilis and B. amyloliquefaciens and it has been implicated both in cell attachment and detachment to surfaces during biofilm formation and in swarming motility [39,42]. For example, the colonization of plant roots by B. subtilis is associated with surfactin production and biofilm formation. In addition, surfactin has been linked to the protection of Arabidopsis thaliana against infection by the pathogen P. syringae pv. tomato [6]. Bacyllomicin, a member of the iturin family, has been reported together with fengycin to have strong antifungal activity [52], being responsible for the main antagonistic activity of B. amyloliquefaciens FZB42 against Fusarium oxysporum [27]. In the case of bacilysin, activity against a wide range of bacteria has been reported [11,30]. The fact that the most abundant pattern observed in our isolates was srfAA-bmyB-bacA, either alone or with fenD, suggests a certain degree of linkage between these genes. The probability of paired associations of these gene markers is not related to their relative distance, at least on the basis of genome sequences and relative distances in known strains of Bacillus [10,26]. Alternatively, horizontal genetic exchange followed by a positive selection pressure within the population can be postulated. In fact, the uptake of phage, plasmid, or naked DNA, including clustered non-ribosomal protein synthesis (NRPSs) genes, has been suggested for genetically competent cells of Bacillus strains 168, FZB42, and GA1 due to the presence of insertion sequence elements [3,15]. In addition, the predominance of the above-mentioned four genes in the Bacillus population could be due to the benefit provided by complementary mechanisms of action among the gene products, including the biosurfactant and biofilm

INT. MICROBIOL. Vol.14, 2011

221

activating properties of surfactin, the antifungal activity of bacillomycin and fengycin, and the antibacterial activity of bacilysin. While we have demonstrated the prevalence of several AMP genes in plant-associated populations of Bacillus, the relationship of the presence of these genes with the antagonistic capacity of the respective strains and with the synthesis of the expression products remains to be determined. The identification of these gene markers in Bacillus strains can be applied to increase the yield of putative biological control agents for a wide range of plant pathogens. Acknowledgements. This work has been supported in part by project AGL2009-13255-C02-01 from Spanish Ministry of Science and Innovation. The research group has been accredited by the CIRIT of the Autonomous Government of Catalonia (2009SGR812).

Competing interests: None declared

References 1. Adesina MF, Lembke A, Costa R, Speksnijder A, Smalla K (2007) Screening of bacterial isolates from various European soils for in vitro antagonistic activity towards Rhizoctonia solani and Fusarium oxysporum: Site-dependent composition and diversity revealed. Soil Biol Biochem 39:2818-2828 2. Ahimou F, Jacques P, Deleu M (2000) Surfactin and iturin A effects on Bacillus subtilis surface hydrophobicity. Enzyme Microbe Technol 27:749-754 3. Arguelles-Arias A, Ongena M, Halimi B, Lara Y, Brans A, Joris B, Fickers P (2009) Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens. Microb Cell Fact 8:63-74 4. Asaka O, Shoda M (1996) Biocontrol of Rhizoctonia solani dampingoff of tomato with Bacillus subtilis RB14. Appl Environ Microbiol 62:4081-4085 5. Athukorala SNP, Fernando WGD, Rashid KY (2009) Identification of antifungal antibiotics of Bacillus species isolated from different microhabitats using polymerase chain reaction and MALDI-TOF mass spectrometry. Can J Microbiol 55:1021-1032 6. Bais HP, Fall R, Vivanco JM (2004) Biocontrol of Bacillus subtilis against infection of Arabidopsis roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production. Plant Physiol 134:307-320 7. Bizzarri MF, Bishop AH (2007) Recovery of Bacillus thuringiensis in vegetative form from the phylloplane of clover (Trifolium hybridum) during a growing season. J Invertebr Pathol 94:38-47 8. Bongers RS, Veening J-W, Van Wieringen M, Kuipers OP, Kleerebezem M (2005) Development and characterization of a subtilin-regulated expression system in Bacillus subtilis: Strict control of gene expression by addition of subtilin App Environ Microb 71:8818-8824 9. Chen X-H, Koumoutsi A, Scholz R, Borriss R (2009a) More than anticipated-production of antibiotics and other secondary metabolites


222

10.

11.

12.

13. 14.

15. 16. 17. 18.

19. 20.

21.

22.

23.

24.

25.

26.

INT. MICROBIOL. Vol. 14, 2011

by Bacillus amyloliquefaciens FZB42. J Mol Microbiol Biotechnol 16:14-24 Chen X-H, Koumoutsi A, Scholz R, Schneider K, Vater J, Süssmuth R, Piel J, Borriss R, (2009) Genome analysis of Bacillus amyloliquefaciens FZB42 reveals its potential for biocontrol of plant pathogens. J Biotechnol 140:27-37 Chen X-H, Scholz R, Borriss M, Junge H, Mögel G, Kunz S, Borris R (2009) Difficidin and bacilysin produced by plant-associated Bacillus amyloliquefaciens are efficient in controlling fire blight disease. J Biotechnol 140:38-44 Chung S, Kong H, Buyer JS, Lakshman DK, Lydon J, Kim S-D, Roberts DP (2008) Isolation and partial characterization of Bacillus subtilis ME488 for suppression of soilborne pathogens of cucumber and pepper. Appl Microbiol Biotechnol 80:115-123 Corpet F (1988) Multiple sequence alignment with hierarchical clustering. Nucl Acids Res 16:10881-10890 Debois D, Hamze K, Guérineau V, Le Caër J-P, Holland IB, Lopes P, Ouazzani J, Séror SJ, Brunelle A, Laprévote O (2008) In situ localisation and quantification of surfactins in a Bacillus subtilis swarming community by imaging mass spectrometry. Proteomics 8:3682-3691 Earl AM, Losick R, Kolter R (2007) Bacillus subtilis genome diversity. J Bacteriol 189:1163-1170 Earl AM, Losick R, Kolter R (2008) Ecology and genomics of Bacillus subtilis. Trends Microbiol 16:269-275 Emmert EAB, Handelsman J (1999) Biocontrol of plant disease: a (Gram-) positive perspective. FEMS Microbiol Lett 171:1-9 Francés J, Bonaterra A, Moreno MC, Badosa E, Montesinos E (2006) Pathogen aggressiveness and postharvest biocontrol efficiency in Pantoea agglomerans. Postharvest Biol Tec 39:299-307 Fravel DR (2005) Commercialization and implementation of biocontrol. Annu Rev Phytopathol 43:337-359 González-Sánchez MA, Pérez-Jimenez RM, Pliego C, Ramos C, de Vicente A, Cazorla FM (2010) Biocontrol bacteria selected by a direct plant protection strategy against avocado white root rot show antagonism as a prevalent trait. J Appl Microbiol 109:65-78 Han JG, Xia DL, Li LB, Sun L, Yang K, Zhang LP (2009) Diversity of culturable bacteria isolated from root domains of Moso Bamboo (Phyllostachys edulis). Microb Ecol 58:363-373 Idris EE, Iglesias DJ, Talon M, Borriss R (2007) Tryptophan-dependent production of indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol Plant Microbe Interact 20:619-626 Joshi R, McSpadden-Gardener BB (2006) Identification and characterization of novel genetic markers associated with biological control activities in Bacillus subtilis. Phytopathology 96:145-154 Kim PI, Ryu J, Kim YH, Chi YT (2010) Production of biosurfactant lipopeptides iturin A, fengycin and surfactin A from Bacillus subtilis CMB32 for control of Colletotrichum gloeosporioides. J Microbiol Biotechnol 20:138-145 Kloepper JW, Ryu C-M, Zhang S (2004) Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology 94:1259-1266 Koumoutsi A, Chen X-H, Henne A, Liesegang H, Hitzeroth G, Franke P, Vater J, Borriss R (2004) Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42. J Bacteriol 186:1084-1096

MORA ET AL.

27. Koumoutsi A, Chen X-H, Vater J, Borriss R (2007) DegU and YczE positively regulate the synthesis of bacillomycin by Bacillus amyloliquefaciens strain FZB42. Appl Environ Microb 73:6953-6964 28. Leclére V, Marti R, Béchet M, Fickers P, Jacques P (2006) The lipopeptides mycosubtilin and surfactin enhance spreading of Bacillus subtilis strains by their surface-active properties. Arch Microbiol 186:475-483 29. Lee H, Kim H-Y (2011) Lantibiotics, Class I bacteriocins from the genus Bacillus. J Microbiol Biotechnol 21:229-235 30. Loeffler W, Tschen JSM, Vanittanakom N, Kugler M, Knorpp E, Hsieh T-F, Wu T-G (1986) Antifungal effect of bacilysin and fengycin from Bacillus subtilis F-29-3 a comparision with activities of other Bacillus antibiotics. J Phytopathol 115:204-213 31. Llop P, Caruso P, Cubero J, Morente C, López MM (1999) A simple extraction method for efficient routine detection of pathogenic bacteria in plant material by polymerase chain reaction. J Microbiol Meth 37:23-31 32. Mannanov RN, Sattarova RK (2001) Antibiotics produced by Bacillus bacteria. Chem Nat Compd 37:117-123 33. Martínez-Alonso M, Escolano J, Montesinos E, Gaju N (2010) Diversity of the bacterial community in the surface soil of a pear orchard based on 16S rRNA gene analysis. Int Microbiol 13:123-134 34. McSpadden-Gardener BB (2004) Ecology of Bacillus and Paenibacillus spp. in agricultural systems. Phytopathology 94:1252-1258 35. Montesinos E (2003) Development, registration and commercialization of microbial pesticides for plant protection. Int Microb 6:245-252 36. Montesinos E (2007) Antimicrobial peptides and plant disease control. FEMS Microbiol Lett 270:1-11 37. Montesinos E, Bonaterra A (2009) Microbial pesticides. In: M. Schaechter (ed) Encyclopedia of Microbiology, 3rd ed. Elsevier, pp 110-120 38. Ongena M, Jacques P, Toure Y, Destain J, Jabrane A, Thonart P (2005) Involvement of fengycin-type lipopeptides in the multifaceted biocontrol potential of Bacillus subtilis. Appl Microbiol Biotechnol 69:29-38 39. Ongena M, Jacques P (2008) Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol 16:115-125 40. Pal KK, McSpadden-Gardener BB (2006) Biological control of plant pathogens. The Plant Health. DOI:10.1094 41. Phister, TG, O’Sullivan DJ, McKay LL (2004) Identification of bacilysin, chlorotetaine, and iturin A produced by Bacillus sp. strain CS93 isolated from pozol, a Mexican fermented maize dough. Appl Environ Microbiol 70:631-634 42. Raaijmakers JM, de Bruijn I, Nybroe O, Ongena M (2010) Natural functions of lipopeptides from Bacillus and Pseudomonas: more than surfactants and antibiotics. FEMS Microbiol Rev 34:10371062 43. Rajavel M, Mitra A, Gopal B (2009) Role of Bacillus subtilis BacB in the Synthesis of Bacilysin J Biol Chem 46:31882-31892 44. Ramarathnam R, Bo S, Chen Y, Fernando WGD, Gao XW, de Kievit T (2007) Molecular and biochemical detection of fengycin and bacillomycin D producing Bacillus spp. antagonistic to fungal pathogens of canola and wheat. Can J Microbiol 53:901-911 45. Romero D, Pérez-García A, Rivera ME, Cazorla FM, de Vicente A (2004) Isolation and evaluation of antagonistic bacteria towards the cucurbit powdery mildew fungus Podosphaera fusca. Appl Microbiol Biotechnol 64:263-269 46. Romero D, de Vicente A, Rakotoaly RH, Dufour SE, Veening J-W, Arrebola E, Cazorla FM, Kuipers OP, Paquot M, Pérez-García A


ANTIMICROBIAL PEPTIDES IN BACILLUS

47.

48.

49.

50. 51.

(2007) The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaera fusca. Mol Plant-Microbe Interact 20:430-440 Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, USA, pp 365-386 Sneath PHA (1986) Nomenclature of bacteria. In: Ride WDL, Younès T (eds), Biological Nomenclature Today, IRL Press, Oxford, UK, pp 36-48 Stein T, Entian K-D (2002) Maturation of the lantibiotic subtilin: matrix-assisted laser desorption/ionization time-of-flight mass spectrometry to monitor precursors and their proteolytic processing in crude bacterial cultures. Rapid Commun Mass Specrom 16:103-110 Stein T (2005) Bacillus subtilis antibiotics: strutures, syntheses and specific functions. Mol Microbiol 56:845-857 Temple TN, Stockwell VO, Loper JE, Jhonson KB (2004) Bioavailability of iron to Pseudomonas fluorescens strain A506 on flowers of pear and apple. Biol Control 94:1286-1294

INT. MICROBIOL. Vol.14, 2011

223

52. Thimon L, Peypoux F, Wallach J, Michel G (1995) Effect of the lipopeptide antibiotic, iturin A, on morphology and membrane ultrastructure of yeast cells. FEMS Microbiol Lett 128:101-106 53. Tombolini R, van der Gaag DJ, Gerhardson B, Jansson JK (1999) Colonization pattern of the biocontrol strain Pseudomonas chlororaphis MA 342 on barley seeds visualized by using green fluorescent protein GLP. Appl Environ Microb 65:3674-3680 54. Trias R, Bañeras L, Montesinos E, Badosa E (2008) Lactic acid bacteria from fresh fruit and vegetables as biocontrol agents of phytopathogenic bacteria and fungi. Int Microbiol 11:231-236 55. Vater J, Kablitz B, Wilde C, Franke P, Mehta N, Cameotra SS (2002) Matrix-assisted laser desorption ionization–time of flight mass spectrometry of lipopeptide biosurfactants in whole cells and culture filtrates of Bacillus subtilis C-1 isolated from petroleum sludge. App Environ Microb 68:6210-6219


RESEARCH ARTICLE INTERNATIONAL MICROBIOLOGY (2011) 14:225-233 DOI: 10.2436/20.1501.01.152 ISSN: 1139-6709 www.im.microbios.org

Influence of wine-like conditions on arginine utilization by lactic acid bacteria Isabel Araque, Cristina Reguant, Nicolas Rozès, Albert Bordons* Department of Biochemistry and Biotechnology, Faculty of Enology, Rovira i Virgili University, Tarragona, Spain Received 20 October 2011 · Accepted 17 November 2011

Summary. Wine can contain trace amounts of ethyl carbamate (EC), a carcinogen formed when ethanol reacts with carbamyl compounds such as citrulline. EC is produced from arginine by lactic acid bacteria (LAB), e.g., Lactobacillus and Pediococcus. Although the amounts of EC in wine are usually negligible, over the last few years there has been a slight but steady increase, as climate change has increased temperatures and alcohol levels have become proportionately higher, both of which favor EC formation. In this study, resting cells of LAB were used to evaluate the effects of ethanol, glucose, malic acid, and low pH on the ability of non-oenococcal strains of these bacteria to degrade arginine and excrete citrulline. Malic acid was found to clearly inhibit arginine consumption in all strains. The relation between citrulline produced and arginine consumed was clearly higher in the presence of ethanol (10–12 %) and at low pH (3.0), which is consistent with both the decreased amount of ornithine produced from arginine and the reduction in arginine degradation. In L. brevis and L. buchneri strains isolated from wine and beer, respectively, the synthesis of citrulline from arginine was highest. [Int Microbiol 2011; 14(4):225-233] Keywords: Lactobacillus · Pediococcus · arginine · ethyl carbamate · wine

Introduction Wine, like most fermented foods and beverages [37], contains trace amounts of ethyl carbamate (EC) [21], also referred to as urethane. EC can bind covalently to DNA and is therefore a carcinogen to animals [26]. It is formed at low pH by the reaction between ethanol and N-carbamyl compounds, such as urea, citrulline, and carbamyl phosphate, with formation dependent on reactant concentrations [22]. As this reaction is favored by high temperatures [29], EC content

*Corresponding author: A. Bordons Departament de Bioquímica i Biotecnologia Facultat d’Enologia, Campus Sescelades N4 C/ Marcel·lí Domingo, 1 Universitat Rovira i Virgili 43007 Tarragona, Spain Tel. +34-977558043. Fax +34-977558232 E-mail: albert.bordons@urv.cat

is higher in wines that have been stored for a long time under conditions in which the temperature has been poorly controlled [35]. Although EC concentrations in wine are usually negligible (< 10 μg/l), since 2002, in parallel with climate changes, a slight increase has been determined [20], since higher temperatures give rise to higher ethanol levels, both of which favor EC formation. This trend has evidenced the need for control and research on the mechanisms of EC formation. Urea produced by yeast is the main potential EC precursor in wine, but lactic acid bacteria (LAB), mainly spoilage strains, can contribute to EC formation as well, due to their production of citrulline and carbamyl-P from arginine [2,12]. Furthermore, significant levels of EC found in some wines have been correlated with the former presence of LAB [35]. L-Arginine is one of the main amino acids in grapes and wine [11] and it is known to be degraded by some wine LAB [13]. Arginine catabolism by these LAB involves the arginine deiminase (ADI) pathway [14,18], which includes three


226

ARAQUE ET AL.

INT. MICROBIOL. Vol. 14, 2011

enzymes, ADI (EC 3.5.3.6), ornithine transcarbamylase (EC 2.1.3.3, OTC), and carbamate kinase (EC 2.7.2.2, CK) [13], catalyzing the following reactions:

L-arginine

+ H2O

L-citrulline

+ Pi

carbamyl-P + ADP

ADI → L-citrulline + NH3 OTC ↔ L-ornithine + carbamyl-P CK ↔ ATP + CO2 + NH3

This pathway is thought to contribute positively to the growth and viability of LAB through ATP formation and the decrease in acidity caused by ammonium production [32]. Nevertheless, this has not been confirmed for Oenococcus oeni, the main malolactic bacteria in wine. In fact, arginine and citrulline do not stimulate the growth of some strains of this species in wine, in contrast to the growth of Lactobacillus buchneri [31]. In general, however, the degradation of arginine yields citrulline, which can react with ethanol to form EC. Moreover, the ADI pathway is sometimes indirectly related to the production of biogenic amines, specifically putrescine, which can be produced from ornithine by LAB [10,17]. Wine lactobacilli vary in their ability to degrade arginine. All heterofermentative lactobacilli are degradative [1,15]. In particular, Lactobacillus hilgardii plays a major role in fermented beverage spoilage, and those strains isolated from wine have been shown to degrade arginine [34,36]. Different strains of Lactobacillus brevis and L. buchneri isolated from wine have also been shown to degrade arginine [12]. While presumably facultative heterofermentative lactobacilli from wine are unable to degrade arginine [7,13], some Lactobacillus plantarum have been shown to consume arginine by means of the ADI pathway [1,28]. Likewise, homofermentative pediococci isolated from other fermented foods (beer, cheese, sausages) can degrade arginine [15], and we have found that some strains of Pediococcus pentosaceus isolated from wine also degrade this amino acid [1]. Although O. oeni is the main species responsible for malolactic fermentation (MLF) [9,38] and can degrade arginine [1,3,34], other LAB may proliferate during the early stages of MLF, or later if the conditions are propitious, such as when the acidity is low [16]. Some LAB, mainly Pediococcus and Lactobacillus, are also known to be spoilage microorganisms for beer [25].

Beer’s acidic pH and ethanol conditions, similar to those of wine, are suitable for the production of EC precursors by these bacteria. Although the metabolic activity of LAB is influenced by ethanol, very little information is available regarding ethanol’s influence on the activity of the arginine deiminase pathway in these LAB species, so such that their potential to degrade arginine in wine and beer is poorly understood. The aim of this study was to determine the effects of ethanol, glucose, malic acid, and low pH values on the ability of LAB found mainly in wine to degrade arginine and to excrete citrulline, ornithine, and ammonia. We focused on those species considered responsible for spoiling wine (and beer), and therefore did not include O. oeni, the main species for MLF in wine. Moreover, arginine degradation and the metabolism and genetics of the ADI pathway are already well known in this species [4,12,15,19,31–33,39], and no effect of ethanol on arginine degradation has been reported [4], while pH values lower than 3.5 have been found to inhibit arginine consumption [30]. This study was based on LAB resting-cell experiments, in which the bacteria were grown in a complex medium and then prepared as highly concentrated cell suspensions in a defined medium for further analysis.

Materials and methods Microorganisms and growth conditions. A pair of strains was used for each of the four different species of LAB frequently found in wine. Each pair consisted of the corresponding type culture strain (Lactobacillus brevis 4121T, Lactobacillus hilgardii 4786T, Lactobacillus buchneri 4111T and Pediococcus pentosaceus 4695T) and another strain isolated from wine (L. brevis 3824, L. hilgardii 4681 and P. pentosaceus 4214) or beer (L. buchneri 4674). All strains were from the CECT (Spanish Type Culture Collection, Valencia, Spain), except L. brevis 3824 and P. pentosaceus 4214, which were kindly contributed by S. Ferrer (Enolab, University of Valencia, Spain). All strains were grown anaerobically at 27 ºC in MRS medium [6] supplemented with 4 g DL-malic acid/l and 5 g D(–)-fructose/l. Bacterial growth was measured by determining the OD600 of the bacterial suspension and by direct cell counts with a Neubauer chamber. Culture condition and resting cells experiments. Each strain was grown anaerobically in 500 ml of MRS medium supplemented with 5 g L-arginine/l, at 27 ºC, to the late-exponential/early-stationary phase. The cells were then harvested by centrifugation at 6000 ×g for 5 min at room temperature. The procedure for resting-cell experiments was designed based on that of Mira de Orduña et al. [18]. Cell pellets were resuspended in appropriate amounts of resting-cell buffer and transferred to small glass vials containing an aqueous solutions of 0.5 g arginine/l, at pH 3.6 (control assay, without ethanol or glucose or malic acid). The other conditions assayed with the same arginine concentration differed with respect to pH (3.0, 4.0, and 4.5), concentration of added ethanol (0, 5, 10, and 12 %), and amount of


ARGININE UTILIZATION BY LAB

Analyses of amino acids and ammonia. An HPLC method based on one previously described [8,27] was adapted to improve the resolution of the three peaks of the amino acids of interest. The analyses were carried out on an Agilent 1100 series HPLC (Agilent Technologies, Wilmington, DE, USA) equipped with an automatic sampler system. The samples were filtered through a 0.45-μm membrane (Millipore) before injection. Two μl of each sample was mixed with 5 μl of borate buffer 0.4 M at pH 10.2, 1 μl of L-norvaline (internal standard), and 1 μl of the derivatization agent o-phthaldehyde-3-mercaptopropionic acid (OPA-3-MPA). One μl of this mixture was injected into a 4.0 × 250 mm ID column filled with Hypersil-ODS (Agilent Technology), with a 4 mm × 5 μm guard-column packed with the same phase. Separation of the amino acids under study took 30 min at a flow rate of 1.5 ml/min. The mobile phase was composed of two different solvents: A and B. Solvent A was a mixture of 2.2 g of sodium acetate (Sigma), 220 μl triethanolamine (TEA, Sigma), and 6 ml tetrahydrofurane (Aldrich). After mixing, the pH was adjusted to 7.2 with 1 % acetic acid. Solvent B was a mixture of 1.8 g sodium acetate (Sigma), 320 ml of methanol (Panreac), and 400 ml of acetonitrile (Panreac), with the pH adjusted to 7.0 with 1 % acetic acid. The gradient was 100 % A for 7.5 min, 10 min with 15 % B, 1 min with 60 % B, 2 min more at 100 % B, and ending with 100 % A for 5 min, in order to prepare the column for the next sample. The analysis temperature was set at 40 ºC. Amino acids were detected using the retention time established for the individual amino acids and for a mixture thereof. The linearity of the peak areas for each amino acid was determined for different concentrations, ranging from 0 to 1000 μM. Calculations were based on the area under the

Fig. 1. Box-and-whiskers plot of the effect of different conditions on the degradation of arginine (0.5 g/l) for all assayed strains. The control assay was performed at pH 3.6. Malic: presence of L-malic acid (0.5 and 2.0 g/l) in the assay. Ethanol: presence (5, 10, and 12 %) in the assay. Glucose: presence (0.5; 3.0 and 5.0 g/l) in the assay. The assays plotted at pH 3 and pH > 4 (4 and 4.5) were without ethanol or glucose or malic acid. The line in the box is the median; the lower whisker is the minimal value found; the upper whisker the maximal value. Circles are the outliers with values greater than 1.5 times the spread outside.

227

peak established for a given amino acid of known concentration and normalized with the internal standard. Ammonia was quantified with an enzymatic kit from Boehringer-Mannheim (Roche Pharma GmbH, Darmstadt, Germany). Statistical analyses. Data univariate (ANOVA) and multivariate (PCA) analyses were conducted using SPSS version 17.0 (SPSS Inc., Chicago, IL, USA). Variable means showing statistic significance were compared using Scheffé post-hoc comparisons at a significance level of 0.05, after testing the homogeneity of variance assumption between the various groups. Principal component analysis (PCA) with varimax rotation was performed for all the samples (408 samples: 4 species × 2 strains × 3 replicates × 17 conditions). The observed variables were the ratios between ornithine and arginine (Orn/Arg), between citrulline and arginine (Cit/Arg), and between ammonium and arginine (NH4/Arg), as well as the percentage of arginine degradation (Arg %), and final pH. The experiments were performed in a laboratory that complies with ISO 9001 standards.

Results Approximately 109 cells per ml were obtained from the strains grown in MRS medium and harvested at OD 1.0 as determined by direct counts. Measurements of total arginine degradation are presented with respect to the specific group, defined according to the examined conditions, with the results for the different strains shown in the same group (Fig. 1). The data obtained under all the conditions are not shown, in order to facilitate a visual analysis of the results. Arginine (0.5 g/l) was almost fully degraded (70–100 %) in most of the

Int. Microbiol.

added glucose (0.5, 3.0, and 5.0 g/l), or L-malic acid (0.5 and 2.0 g/l). Assays were also performed with increasing concentrations of arginine (1.5, 3.0, and 5.0 g/l) and the same control conditions. The glass vials were placed in a water bath (25 ºC) and stirred gently. Samples were taken periodically, centrifuged at 13,000 ×g for 5 min, and the supernatants were frozen and kept at –20 ºC until analyzed.

INT. MICROBIOL. Vol.14, 2011


ARAQUE ET AL.

INT. MICROBIOL. Vol. 14, 2011

Int. Microbiol.

228

experiments. The strain with the highest levels of arginine consumption was, under most conditions, L. hilgardii 4681, with values exceeding 95 %. Slightly higher consumption was observed for all the strains upon increasing pH whereas consumption was lower in the presence of ethanol. The presence of glucose also decreased arginine degradation. The only condition in which arginine was not consumed at all was in the presence of Lmalic acid. When 0.5 or 2 g L-malic acid/l was added to the resting cells, the degradation of the initial 0.5 g arginine/l was nearly zero. When the initial arginine concentration was increased from 0.5 to either 1.5, 3, or 5 g/l (results not shown in figures), good consumption rates were noted for all the tested strains, with a few lower degradation values, progressively decreasing to 60 % at higher arginine levels, but also a higher total quantity of arginine consumed. Degradation rates were somewhat higher than those of the controls. The amounts of citrulline, ornithine, and ammonium produced are expressed in relation to the arginine consumed, as determined by means of PCA (Fig. 2). The percentage of arginine degradation and the final pH obtained under different conditions were also used in the factorial analysis. Factor 1 explained 40.7 % of the variation and was marked by high

Fig. 2. Plot values of the first two factors (Factor 1 and Factor 2) of the PCA analysis according to the experimental conditions for the 408 samples. Kaiser-MeyerOlkin (KMO): 0.803; variance of Factor 1: 40.7 %; variance of Factor 2: 22.4 %. Factor 1 positively correlated with Orn/ Arg (0.930), Arg % (0.733) and final pH (0.719). Factor 2 positively correlated with Cit/Arg (0.710).

positive loadings for Orn/Arg, Arg %, and final pH. This result implies that higher levels of ornithine production led to higher final pH values. On the other hand, factor 2, which still explained 22.4 % of the variation, was marked by a high positive loading for Cit/Arg, which could be related to the high citrulline production by the strains. In relation to the third component (not shown), factor 3 explained 20.4 % of the total variation and was marked by a high positive loading for NH4/Arg (0.900). To facilitate the interpretation of these results, the obtained scores were plotted by selecting the first two factors as axes (Fig. 2). As shown, the samples basically clustered in two groups. The first cluster (bottom left corner) represents the non-degradation of arginine in the presence of malic acid, regardless of the strain tested, and the second cluster represents the clear tendency of some species to alkalinize the medium when ornithine (but not citrulline) was produced from arginine. Depending on the experimental conditions (ethanol, glucose, low pH values or increasing amounts of arginine), the strains used in this study showed different arginine-consuming behaviors. We obtained values of Cit/Arg ranging from 10 % to 50 %, as shown in Fig. 3 for strain L. hilgardii 4786T as an example. At higher pH, less citrulline was excreted and more


INT. MICROBIOL. Vol.14, 2011

229

Int. Microbiol.

ARGININE UTILIZATION BY LAB

Fig. 3. Ratios of products from arginine degraded by Lactobacillus hilgardii 4786T under different conditions: citrulline (black), ornithine (diagonal stripes), ammonium (× 2) (dotted). Percentages of degraded arginine are indicated with diamonds. Data represent the mean of three samples ± SD.

A higher-level production of citrulline occurred when the quantity of ethanol was increased, which, in turn, led to lower values of Orn/Arg and NH4+/Arg. The maximum ratio of Cit/Arg was obtained at 12 % ethanol. Increased glucose did

Int. Microbiol.

ornithine and ammonium were obtained. The ammonium /arginine ratio was expressed as 2 moles of NH4+ per mole of arginine, because if all arginine were degraded then one mole of it would yield two moles of NH4+.

Fig. 4. Ratios of citrulline produced from arginine by different strains of LAB (see Materials and methods) under these conditions: without ethanol at pH 3.0 (black columns); without ethanol at pH 3.6 (control, dotted columns); without ethanol 12 % at pH 3.6 (gray). Data represent the mean of three samples ± SD.


INT. MICROBIOL. Vol. 14, 2011

ARAQUE ET AL.

Int. Microbiol.

230

Fig. 5. Time evolution of arginine (solid squares), citrulline (empty circles), ornithine (triangles), and ammonium (crosses) in assays of resting cells and in the presence of 12 % ethanol. The strains used were Lactobacillus brevis 3824, L. buchneri 4674, L. hilgardii 4681 and Pediococcus pentosaceus 4214. Data represent the mean of three samples Âą SD.

not have as clear an effect as the other conditions, although there was a slight tendency towards lower values of Orn/Arg and H4+/Arg. Thus theoretically, higher relative production of citrulline would be expected with increasing amounts of glucose. In addition to these effects of pH, ethanol, glucose, and malic acid, the Cit/Arg values for all eight strains together (Fig. 4) was determined under the conditions that had the most significant effect, i.e., low pH and high ethanol, in order to compare all the strains. As Fig. 4 shows, strains L. brevis 3824 and L. buchneri 4674 produced the most citrulline in relation to arginine consumed. For all the strains, more citrulline was produced at pH 3 than at pH 3.6 (control), and in the presence of 12 % ethanol than in its absence. A clear and logical relationship between a higher initial and higher final pH was found for all the strains (results not shown). Lower final pH values were recorded in the presence of higher quantities of ethanol, which correlates with the higher citrulline and lower ammonium production. When the percentage of glucose was higher, the final pH was lower,

consistent with the reduced production of ammonium in these assays. Generally, higher final pH values were observed for all the strains of L. hilgardii and L. buchneri. In addition to the data presented above, corresponding to 2-h resting-cell experiments, analyses were conducted at 0 h and at 1 h in order to study the kinetics of the different compounds. In all cases, the kinetics showed a linear decrease in arginine and increases in citrulline, ornithine, and ammonium. As examples, Fig. 5 shows the results obtained for the four strains, one of each species, in the presence of 12 % ethanol. In some cases, as noted above for L. buchneri 4674, an initial increase of citrulline was followed by a subsequent decline in the last hour of the experiment. The degradation rates for arginine were calculated based on the data obtained at 0 and 2 h. In the control assays, the values ranged from 19.96 ÎźM of arginine degraded per min for L. brevis 4121T to 25.19 ÎźM per min for L. hilgardii 4681. The degradation rates were higher in the isolated strains than in the type strains. The rates were slightly lower than those of controls under conditions of lower pH or more ethanol, for all


ARGININE UTILIZATION BY LAB

strains. Thus, in the presence of 12 % ethanol, the rate of arginine degradation was 18.54 μM per min for L. brevis 4121T and 20.89 μM per min for L. hilgardii 4681.

Discussion The resting-cell experiments performed in this study, like those in other works [18], have several advantages: they avoid the presence of other compounds that could interfere with the experiment; they are an easy way to monitor degradation kinetics; and, compared to growth experiments, they can be established in very little time under conditions similar to those of wine. The strains used in this work were previously shown to degrade arginine when grown in MRS medium [1]. These strains were able to degrade 60–90 % of 5 g arginine/l in less than 2 h. All the strains of heterofermentative lactobacilli used in this study (L. brevis, L. hilgardii and L. buchneri) degraded almost all the arginine, as expected. The degradative ability of P. pentosaceus was also demonstrated, confirming the results obtained in growth medium [1]. The only condition under which arginine was not degraded was in the presence of malic acid. As shown in other works [19,30], malic acid degradation seems to take priority over arginine consumption for LAB. It may be that since MLF involves just one reaction, the consequent rapid production of ATP is more advantageous than the more complex and inducible ADI pathway of arginine utilization. From a technological point of view, MLF could be used to control the appearance of citrulline from arginine, as reported previously [30]. In spite of a low initial pH, arginine degradation increased during the assays, with final pH values ranging from 5.0 to 7.0 due to the production of ammonia from the degraded arginine. A similar increase in pH, by around 2.5 units, was recorded in assays with different initial pH values, ranging from 3.0 to 4.0, and a similar quantity of ammonia was accordingly produced. Good inverse correlations between the values of Cit/Arg and Orn/Arg (Fig. 3, for L. hilgardii 4786T) were found in the different assays. The former was higher when the second was somewhat lower, due to the conversion of citrulline to ornithine. The molar ratio of ammonium per arginine is usually higher (expressed as 2× in the figures) due to the appearance of two ammonium molecules for each one arginine (see the Introduction). The relation between citrulline produced and arginine consumed ranged from 10 % to 50 %, depending on the strain and the conditions. In a previous work with resting cells, val-

INT. MICROBIOL. Vol.14, 2011

231

ues around 5 % were reported [18], and in a more recent study of wine, the maximum was 4–5 % [30]. However, in yet other studies values of near 40 % were obtained for strains of L. hilgardii [34], and around 30–40 % for strains of O. oeni [24]. Thus, there seems to be great variability depending on the species and the different conditions. These ratios can be used to estimate the contribution of citrulline to the EC precursor pool from a given amount of initial arginine, as suggested by Mira de Orduña et al. [19]. Of all the different conditions assayed, those that clearly resulted in higher rates of citrulline production compared to arginine consumption in all the strains (Fig. 4) included the presence of ethanol. The Cit/Arg value increased significantly when the ethanol concentration increased from 0 (control) to 5, 10, and 12 %. At 12 % ethanol, the average increase in the ratio in all the strains was ca. 85 %, with values ranging from 44 % (L. brevis 4214T or L. buchneri 4674) to 173 % in L. buchneri 4111T. Regarding the lower pH, a comparison of the control (pH 3.6) with the assays carried out at pH 3.0 showed that the average increase in the Cit/Arg value was 29 %, ranging from 6 % for L. buchneri 4674 to 43 % for L. hilgardii 4681. Regarding the effect of ethanol, the higher Cit/Arg value recorded here is consistent with the decreased Orn/Arg value. There seemed to be less conversion of citrulline to ornithine, accompanied by a decreased incorporation of arginine. The exposure of cells to ethanol usually results in an increase in their permeability and the concomitant loss of intracellular material [5]. Therefore, it may have been the case that the cells were less efficient at retaining citrulline, such that it could easily escape. The higher value of Cit/Arg at low pH (3.0) is also consistent with reduced arginine degradation. The release of ammonium from the arginine-deiminase reaction, yielding citrulline, would allow the cells to compensate for the external acidity. The results obtained for the different species and strains tested (Fig. 4) clearly show that strains of L. brevis and L. buchneri isolated from wine and beer, respectively, produced higher yields of citrulline in relation to arginine consumed, more than the type culture strains, which were isolated from other environments. Therefore, an increased ability to produce citrulline might characterize strains genetically accustomed to ethanol environments. In most cases citrulline production was linear, although in some strains, particularly L. buchneri 4674, a period of increased synthesis was followed by a decline. This can be interpreted as due to the excretion of citrulline, which was


232

then reabsorbed by the cells and transformed into ornithine and ammonia, as other authors have also postulated [12,18]. In most of the assays, there was a balance between degraded arginine and the sum of the amount of citrulline, ornithine, and ammonia produced. However, this was not the case with L. hilgardii 4681, for which the sum of these products was less than the amount of arginine consumed. This might be explained by the transformation of ornithine into putrescine by ornithine decarboxylase, as described in O. oeni [17] and in other LAB [23]. In conclusion, in this work we were able to demonstrate the effects of both ethanol and low pH on a higher relative production of citrulline compared to arginine consumed in some species of LAB related to wine and beer. In addition, the yields were found to depend on both the species and the strain. Since these species are mainly related to spoilage, possible contaminations must be prevented with well-controlled aseptic processes and through the use of starters that ensure correct alcohol fermentation and of MLF, if required. This should prevent the appearance of citrulline, and thus a potential source of EC.

Acknowledgements. This work was supported by grants AGL-20000827-C02-02 and AGL2006-3070ALI from the Spanish Ministry of Science and Technology. Isabel Araque was the recipient of a predoctoral fellowship from the University of Pamplona (Colombia).

Competing interests: None declared.

References 1.

2.

3.

4.

5.

6.

ARAQUE ET AL.

INT. MICROBIOL. Vol. 14, 2011

Araque I, Gil J, Carreté R, Bordons A, Reguant C (2009) Detection of arc genes related with the ethyl carbamate precursors in wine lactic acid bacteria. J Agric Food Chem 57:1841-1847 Arena ME, Saguir FM, Manca de Nadra MC (1999) Arginine, citrulline and ornithine metabolism by lactic acid bacteria from wine. Int J Food Microbiol 52:155-161 Arena ME, Manca de Nadra MC, Muñoz R (2002) The arginine deiminase pathway in the wine lactic acid bacterium Lactobacillus hilgardii X1B: structural and functional study of the arcABC genes. Gene 301: 61-66 Arena E, Manca de Nadra MC (2005) Influence of ethanol and low pH on arginine and citrulline metabolism in lactic acid bacteria from wine. Res Microbiol 156:858-864 Da Silveira MG, San Romao MV, Loureiro-Dias MC, Rombouts FM, Abee T (2002) Flow cytometric assessment of membrane integrity of ethanol-stressed Oenococcus oeni cells. Appl Environ Microbiol 68:6087-6093 De Man JC, Rogosa M, Sharpe ME (1960) A medium for the cultivation of lactobacilli. J Appl Bacteriol 23:130-135

7.

Edwards CG, Powers JR, Jensen KA, Weller KM, Peterson JC (1993) Lactobacillus spp. from Washington State wines: isolation and characterization. J Food Science 58:453-458 8. Gratzfeld-Huesgen A (1998) Sensitive and reliable amino acid analysis in protein hydrolysates using the Agilent 1100 series HPLC. Technical Note. Agilent Technologies. Publication number 5968-5658E 9. Henick-Kling T (1993) Malolactic fermentation. In: Fleet GH (ed), Wine microbiology and biotechnology. Harwood Academic, Chur, Switzerland, pp 289-326 10. Landete JM, Arena ME, Pardo I, Manca de Nadra MC, Ferrer S (2010) The role of two families of bacterial enzymes in putrescine synthesis from agmatine via agmatine deiminase. Int Microbiol 13:169-177 11. Lehtonen P (1996) Determination of amines and amino acids in wine— A review. Amer J Enol Viticult 47:127-133 12. Liu SQ, Pritchard GG, Hardman MJ, Pilone GJ (1994) Citrulline production and ethyl carbamate (urethane) precursor formation from arginine degradation by wine lactic acid bacteria Leuconostoc oenos and Lactobacillus buchneri. Amer J Enol Viticult 45:235-242 13. Liu SQ, Pritchard GG, Hardman MJ, Pilone GJ (1995) Occurrence of arginine deiminase pathway enzymes in arginine catabolism by wine lactic acid bacteria. Appl Environ Microbiol 61:310-316 14. Liu SQ, Pritchard GG, Hardman MJ, Pilone GJ (1996) Arginine catabolism in wine lactic acid bacteria: is it via the arginine deiminase pathway or the arginase-urease pathway? J Appl Bacteriol 81:486-492 15. Liu SQ, Pilone GJ (1998) A review: arginine metabolism in wine lactic acid bacteria and its practical significance. J Appl Microbiol 84:315-327 16. Lonvaud-Funel A (1999) Lactic acid bacteria in the quality improvement and depreciation of wine. Antonie van Leeuwenhoek 76:317-331 17. Mangani S, Guerrini S, Granchi L, Vincenzini M (2005) Putrescine accumulation in wine: Role of Oenococcus oeni. Current Microbiol 51:6-10 18. Mira de Orduña R, Liu SQ, Patchett ML, Pilone GJ (2000) Ethyl carbamate precursor citrulline formation from arginine degradation by malolactic wine lactic acid bacteria. FEMS Microbiol Lett 183:31-35 19. Mira de Orduña R, Patchett ML, Liu SQ, Pilone GJ (2001) Growth and arginine metabolism of the wine lactic acid bacteria Lactobacillus buchneri and Oenococcus oeni at different pH values and arginine concentrations. Appl Environ Microbiol 67:1657-1662 20. Mira de Orduña R (2010) Climate change associated effects on grape and wine quality and production. Food Res Int 43:1844-1855 21. Ough CS (1976) Ethyl carbamate in fermented beverages and foods. I. Naturally occurring ethyl carbamate. J Agric Food Chem 24:323-328 22. Ough CS, Crowell EA, Gutlove BR (1988) Carbamyl compound reactions with ethanol. Amer J Enol Viticult 39:239-242 23. Pereira CI, San Romão MV, Lolkema JS, Barreto Crespo MT (2009) Weissella halotolerans W22 combines arginine deiminase and ornithine decarboxylation pathways and converts arginine to putrescine. J Appl Microbiol 107:1894-1902 24. Romero S, Reguant C, Bordons A, Masqué MC (2009) Potential formation of ethyl carbamate in simulated wine inoculated with Oenococcus oeni and Lactobacillus plantarum. Int J Food Sci Technol 44:1206-1213 25. Sakamoto K, Konings WN (2003) Beer spoilage bacteria and hop resistance. Int J Food Microbiol 89:105-124 26. Schlatter J, Lutz WK (1990) The carcinogenic potential of ethyl carbamate (urethane): risk assessment at human dietary exposure levels. Food Chem Toxicol 28:205-211 27. Soufleros E, Bertrand A (1998) Evaluation d’une méthode CLHP adaptée au dosage des acides amines du vin. Vitis 37:43-53 28. Spano G, Chieppa G, Beneducce L, Massa S (2004) Expression analysis of putative arcA, arcB and arcC genes partially cloned from


ARGININE UTILIZATION BY LAB

29.

30.

31.

32.

33.

Lactobacillus plantarum isolated from wine. J Appl Microbiol 96: 185-193 Stevens DF, Ough CS (1993) Ethyl carbamate formation: reaction of urea and citrulline with ethanol in wine under low to normal temperature conditions. Amer J Enol Viticult 44:309-312 Terrade N, Mira de Orduña R (2006) Impact of winemaking practices on arginine and citrulline metabolism during and after malolactic fermentation. J Appl Microbiol 101:406-411 Terrade N, Mira de Orduña R (2009) Arginine and citrulline do not stimulate growth of two Oenococcus oeni strains in wine. FEMS Microbiol Lett 290:98-104 Tonon T, Lonvaud-Funel A (2000) Metabolism of arginine and its positive effect on growth and revival of Oenococcus oeni. J Appl Microbiol 89:526-531 Tonon T, Bourdineaud JP, Lonvaud-Funel A (2001) Catabolisme de l’arginine par Oenococcus oeni: aspects energetiques et genetiques. Lait 81:139-159

INT. MICROBIOL. Vol.14, 2011

233

34. Tonon T, Lonvaud-Funel A (2002) Arginine metabolism by wine Lactobacilli isolated from wine. Food Microbiol 19:451-461 35. Uthurry CA, Varela F, Colomo B, Suárez Lepe JA, Lombardero J, García del Hierro JR (2004) Ethyl carbamate concentrations of typical Spanish red wines. Food Chem 88:329-336 36. Uthurry CA, Suárez Lepe JA, Lombardero J, García del Hierro JR (2006) Ethyl carbamate production by selected yeasts and lactic acid bacteria in red wine. Food Chem 94:262-270 37. Vahl M (1993) A survey of ethyl carbamate in beverages, bread and acidified milks sold in Denmark. Food Addit Contam10:585-592 38. Wibowo D, Eschenbruch R, Davis CR, Fleet GH, Lee TH (1985) Occurrence and growth of lactic acid bacteria in wine: A review. Amer J Enol Viticult 36:302-313 39. Zé-Zé L, Chelo IM, Tenreiro R (2008) Genome organization of Oeconoccus oeni strains studied by comparison of physical and genetic maps. Int Microbiol 11:127-244


BOOK REVIEWS INTERNATIONAL MICROBIOLOGY (2011) 14: 235-236 ISSN: 1139-6709 www.im.microbios.org

Brucella. Molecular microbiology and genomics IGNACIO LÓPEZ-GOÑI, DAVID O’CALLAGHAN (EDS) 2012. Caister Academic Press 261 pp, 18 × 25 cm Price: £159 ISBN 978-1-904455-93-6

Brucellosis is a zoonotic infection transmitted from animals to humans by the ingestion of infected food products, direct contact with an infected animal, or the inhalation of aerosols. Among these, inhalation is remarkably efficient given the relatively low concentration of organisms (10–100 bacteria) needed to establish infection in humans. Brucella is a facultative intracellular pathogen that survives and multiplies in phagocytes, and it has evolved to avoid the host’s immune system. Brucellosis is usually characterized by the long-term persistence of the bacteria in the body. The diagnosis can be challenging since the disease can involve any body organ or system, and its symptoms may overlap with those of a wide spectrum of infectious, as well as non-infectious conditions. The clinical presentations of brucellosis are not only undulant fever but also joint manifestations, such as spondylitis, and neurological complications, often associated with personality changes (anxiety, amnesia, delusions, hallucinations, delirium, phobias and irritability), in addition to prolonged frontal or occipital headaches. Additional symptoms are anorexia and abdominal pain. “Micrococcus melitensis” was first isolated in 1887 by David Bruce (1855–1931), who detected the bacterium in the spleen of humans who had died from undulant fever in Malta. It is believed that Florence Nightingale (1820–1910, the famous nurse driving implement of hygiene in hospitals) endured over 25 years of the illness, including personality changes (neurobrucellosis) and spondylitis, which left her bedridden for six years. The severity of this disease and the lack of vaccines suitable for use in humans have led to the

investigation of Brucella as bioterrorism agents. Indeed, the American military weaponized Brucella suis in 1954; however, changing global politics resulted in the abandonment of these studies following the Biological and Toxic Weapons Convention of 1972. The book Brucella. Molecular microbiology and genomics introduces the reader to what is known thus far and to the current challenges in the taxonomy, genomics and proteomics, diagnosis and epidemiology, vaccine development, virulence mechanisms, and life cycle posed by these enigmatic bacteria. The authors of the 13 chapters are experts in the field and they are the book’s editors, Ignacio López-Goñi (University of Navarra, Spain) and David O’Callaghan (INSERM, Nimes, France). The genus Brucella belongs to the alphaproteobacteria. In addition to the type genus Brucella, six further genera, Crabtreella, Daeguia, Mycoplana, Ochrobactrum, Paenochrobactrum, and Pseudochrobactrum, are currently recognized within the family Brucellaceae. The closest phylogenetic neighbor of Brucella is Ochrobactrum. Initially, two species were described for Brucella, B. melitensis (melitensis in Latin refers to the Malta island) and B. abortus (named after the discovery that the organism is responsible for spontaneous abortion in cattle, Chapter 1). Currently, the genus Brucella consists of ten species with validly published names. Of these, the six so-called classical species show a preferential host range and other distinguishing phenotypic features: B. melitensis (infects mainly sheep and goats), B. abortus (cattle and other bovidae), B. suis (swine), B. ovis (sheep), B. neotomae (desert woodrats) and B. canis (dogs). The remaining four species comprise two from marine mammals, B. ceti and B. pinnipedialis, and the novel B. microti (common voles) and B. inopinata (recently isolated from a breast-implant infection in an elderly woman). In 2002, two Brucella genomes were sequenced and analyzed. At present, 40 Brucella genomes have been sequenced (Chapter 2). The Brucella genome is composed of two chromosomes. Expression analysis in Brucella grown in vitro has confirmed a higher rate of synthesis of proteins encoded in chromosome I than in chromosome II (Chapter 5). The presence of two chromosomes could be consistent with the ability of Brucella to adapt and live in at least two very different environments, as free-living bacteria and intracellularly. In the latter, the bacterium must metabolically adapt to the intracellular environment and then manipulate its host cell’s biology to create conditions for its survival and multiplication.


236

INT. MICROBIOL. Vol. 14, 2011

Thus, the identification of protein shifts and interactions is necessary to understand the Brucella life cycle (Chapter 6). A major aspect of the pathogenicity of Brucella is its survival and replication within host macrophages. However, the Brucella genome does not seem to encode the classical virulence factors found in other bacterial pathogens; rather, its main virulence factors are a lipopolysaccharide (LPS) of low endotoxicity (Chapter 7), the BvrR/BvrS system, which controls the expression of a set genes involved in a broad range of species-specific functions (Chapter 10), and the type IV secretion system (Chapter 11). An interesting aspect of Brucella, albeit one thus far incompletely studied, is its gene clusters acquired by horizontal transfer, including genomic islands, whose acquisition and deletion may be related to the host preference manifested by the corresponding Brucella species (Chapter 3). The genomic islands contained in Brucella are made up of functional classes of genes that have been divided into two groups: one comprising virulence factors and the other, genes of metabolic or unknown function. Moreover, virulence may also depend on metal acquisition (Chapter 9). Traditionally, brucellosis is diagnosed using cultural and serological approaches. The potential of molecular assays for Brucella identification based on 16S rRNA, the cell surface protein bcsp31, IS711, etc., is a subject of current investigations (Chapter 4). However, such assays will need to be validated in clinical samples before they can be adapted for routine laboratory testing.

BOOK REVIEWS

Brucellosis is an important bacterial zoonosis worldwide. In endemic areas (Mediterranean Europe, Middle East, Latin America), the incidence of the disease in humans may be more than 200 per 100,000 habitants. The classical treatment of brucellosis consists of a course of antibiotics (doxycycline and rifampicin) for six weeks. New antibacterials that are specifically active at the intracellular phase of Brucella are being developed. Such drugs would also have the potential to limit the selection pressure favoring the growth of resistant mutants, thereby reducing the secondary effects of antibiotic treatment on the human microbiota (Chapter 12). Other strategies aimed at the control of Brucella include a vaccine (Chapter 13). Brucella. Molecular microbiology and genomics can be recommended to microbiologists, immunologists, veterinarians, and clinicians with an interest in microbial pathogenesis, host-bacterium interactions, and microbial diagnosis.

MERCEDES BERLANGA University of Barcelona mberlanga@ub.edu


INDEX VOLUME

14

www.im.microbios.org

Contents Volume 14 · 2011 Ageitos JM → Serrat M Alcoba-Flórez J → Donate-Correa J Alcolea PJ → Genome-wide gene expression profile induced by exposure to cadmium acetate in Leishmania infantum promastigotes, 1 DOI:10.2436/20.1501.01.129 Alfaro M → Ramírez L Allan BJ → Biswas D Álvarez L → César CE Amils R → García-Muñoz J Amis R → Köchling T Alonso A → Alcolea PJ Alonso MP → Mora A Araque I → Influence of wine-like conditions on arginine utilization by lactic acid bacteria, 225 DOI: 10.2436/20.1501.01.152 Arnold E → Martínez-Luis S Azevedo MB → Iorio NLP Barcellos AG → Iorio NLP Barros EM → Iorio NLP Berenguer J → César CE Berlanga M → Comparison of the gut microbiota from soldier and worker castes of the termite Reticulitermes grassei, 83 DOI: 10.2436/20.1501.01.138 Bernárdez MI → Mora A Berthiaume L → Starek M Biswas D → Genes coding for virulence determinants of Campylobacter jejuni in human clinical and cattle isolates from Alberta, Canada, and their potential role in colonization of poultry, 25 DOI: 10.2436/20.1501.01.132 Blanco J → Mora A Blanco JE → Mora A Blanco M → Mora A Blasco L → Proteins influencing foam formation in wine and beer: the role of yeast, 61 DOI: 10.2436/20.1501.01.136 Blasco L → A new disruption vector (pDHO) to obtain heterothallic strains from both Saccharomyces cerevisiae and Saccharomyces pastorianus, 201 DOI:10.2436/20.1501.01.149 Bordons A → Araque I Bricio C → César CE Cabrefiga J → Mora I Caleja C → Antimicrobial resistance and class I integrons in Salmonella enterica isolates from

wild boards and Bísaro pigs, 19 DOI: 10.2436/20.1501.01.131 Camacho M → Serrat M Carvalho C → Caleja C Castanera R → Ramírez L Cercenado E → de Toro M César CE → Unconventional lateral gene transfer in extreme thermophilic bacteria, 187 DOI: 10.2436/20.1501.01.148 Chambel L → Marques AP Cherigo L → Martínez-Luis S Cubilla-Rios L → Martínez-Luis S Dahbi G → Mora A de Lacey AL → García-Muñoz J de Mattos CS → Iorio NLP de Toro M → Genetic characterization of the mechanisms of resistance to amoxicillin/clavulanate and third-generation cephalosporins in Salmonella enterica from three Spanish hospitals, 173 DOI: 10.2436/20.1501.01.146 de Toro M → Caleja C Donate-Correa J → New Staphylococcus aureus genetic cluster associated with infectious osteomyelitis, 33 DOI: 10.2436/20.1501.01.133 d’Ostuni V → Ruiz-Martínez L dos Santos KRN → Iorio NLP Dousset X → Messaoudi S Drider D → Messaoudi S Duarte AJ → Marques AP Esteban GF → Olmo JL Ferchichi M → Messaoudi S Fernández VM → García-Muñoz J Finlay BJ → Olmo JL Frazão VH → Iorio NLP Fusté E → Ruiz-Martínez L García-Campello M → de Toro M García-Muñoz J → Electricity generation by microorganisms in the sediment-water interface of an extreme acidic microcosm, 73 DOI: 10.2436/20.1501.01.137 Gerwick WH → Martínez-Luis S Gonçalves A → Caleja C González-Mazo E → Köchling T Grandcolas P → Berlanga M Guerrero R → Berlanga M

Guerrero R → Lynn Margulis (1938-2011), microbiologist, 183. DOI: 10.2436/20.1501.01.147 Hannon SJ → Biswas D Hausner M → Starek M Herrera A → Mora A Higginbotham S → Martínez-Luis S Ibañez A → Martínez-Luis S Igrejas G → Caleja C Iorio NLP → Methicillin-resistant Staphylococcus epidermis carrying biofilm formation genes: detection of clinical isolates by multiplex PCR, 13 DOI: 10.2436/20.1501.01.130 Kergourlay G → Messaoudi S Köchling T → Microbial community composition of anoxic marine sediments in the Bay of Cádiz (Spain), 143 DOI: 10.2436/20.1501.01.143 Kolev KI → Starek M Lara-Martín P → Köchling T Larraga V → Alcolea PJ Lavín JL → Ramírez L Littauer → César CE Llovo J → Mora A López C → Mora A López-Jiménez L → Ruiz-Martínez L Malki M → García-Muñoz J Mamani R → Mora A Manai M → Messaoudi S Marques AP → Genomic diversity of Oenococcus oeni from different winemaking regions of Portugal, 155 DOI: 10.2436/20.1501.01.144 Martínez-Luis S → Screening and evaluation of antiparasitic and in vitro anticancer activities of Panamanian endophytic fungi, 95 DOI: 10.2436/20.1501.01.139 Méndez-Álvarez S → Donate-Correa J Messaoudi S → Identification of lactobacilli residing in chicken ceca with antagonism against Campylobacter, 103 DOI: 10.2436/20.1501.01.140 Monteiro D → Caleja C Montesinos E → Mora I

237


Mora A → Characteristics of the Shiga-toxinproducing enteroaggregative Escherichia coli O104:H4 German outbreak strain and of STEC strains isolated in Spain, 121 DOI: 10.2436/20.1501.01.142 Mora I → Antimicrobial peptide genes in Bacillus strains from plant environments, 213 DOI:10.2436/20.1501.01.151 Muguerza E → Ramírez L Oguiza JA → Ramírez L Olmo JL → New records of the ectoparasitic flagellate Colpodella gonderi on non-Colpoda ciliates, 207 DOI:10.2436/20.1501.01.150 Omarini A → Ramírez L Parenti A → Ramírez L Paster BJ → Berlanga M Pereira EM → Iorio NLP Pérez G → Ramírez L Pisabarro AG → Ramírez L Pita JM → Mora A Poeta P → Caleja C Potter A → Biswas D Prévost H → Messaoudi S Ramírez L → Genomics and transcriptomics characterization of genes expressed during postharvest at 4°C by the edible basidiomycete Pleurotus ostreatus, 111 DOI: 10.2436/20.1501.01.141

238

Reguant C → Araque I Rodrigues J → Caleja C Rodríguez O → Serrat M Rojo-Bezares E → de Toro M Rossero A → Messaoudi S Rozès N → Araque I Ruiz-Martínez L → A mechanism of carbapenem resistance due to a new insertion element (ISPa133) in Pseudomonas aeruginosa, 51 DOI: 10.2436/20.1501.01.135 Sáenz Y → Caleja C Sáenz Y → de Toro Santoyo F → Ramírez L San Romão MV → Marques AP Sanz JL → Köchling T Serrat M → Influence of nutritional and environmental factors on ethanol and endopolygalacturonase co-production by Kluyveromyces marxianus CCEBI 2011, 41 DOI: 10.2436/20.1501.01.134 Sleep BE → Starek M Spadafora C → Martínez-Luis S Starek M → A flow cell simulating a subsurface rock fracture for investigations of groundwaterderived biofilms, 163 DOI: 10.2436/20.1501.01.145 Teixeira MF → Marques AP Tenreiro R → Marques AP Themudo P → Caleja C Torres C → Caleja C

Torres C → de Toro M Townsed HGG → Biswas D Undabeitia E → de Toro M Vallejo JA → Serrat M Van Heerden E → César CE Veiga-Crespo P → Blasco L Vieira-Pinto M → Caleja C Vinuesa T → Ruiz-Martínez L Villa TG → Serrat M Villa TG → Blasco L Viñas M → Ruiz-Martínez L Viñas M → Blasco L Wolfaardt GM → Starek M Yeung CW → Starek M


Author Index · 2011 Ageitos JM Æ 41 Alcoba-Florez J Æ 33 Alcolea PJ Æ 1 Alfaro M Æ 111 Allan BJ Æ 25 Alonso A Æ 1 Alonso MP Æ 121 Alvarez L Æ 187 Amils R Æ 73, 143 Araque I Æ 225 Arnold E Æ 95 Azevedo MB Æ 13 Barcellos AG Æ 13 Barros EM Æ 13 Berenguer J Æ 187 Berlanga M Æ 83 Bernárdez MI Æ 121 Berthiaume L Æ 163 Biswas D Æ 25 Blanco J Æ 121 Blanco JE Æ 121 Blanco M Æ 121 Blasco L Æ 61, 201 Bordons A Æ 225 Bricio C Æ 187 Cabrefiga J Æ 213 Caleja C Æ 19 Camacho M Æ 41 Carvalho C Æ 19 Castanera R Æ 111 Cercenado E Æ 173 César CE Æ 187 Chambel L Æ 155 Cherigo L Æ 95 Cubilla-Rios L Æ 95 Dahbi G Æ 121 De Lacey AL Æ 73 de Mattos CS Æ 13 de Toro M Æ 19, 173 Donate-Correa J Æ 33 dos Santos KRN Æ 13 d’Ostuni V Æ 51 Dousset X Æ 103 Drider D Æ 103 Duarte AJ Æ 155 Esteban GF Æ 207 Fernández VM Æ 73 Finlay BJ Æ 207 Frazão VH Æ 13

Ferchichi M Æ 103 Fusté E Æ 51 García-Campello M Æ 173 Garcìa-Muñoz J Æ 73 Gerwick WH Æ 95 Gonçalves A Æ 19 González-Mazo E Æ 143 Grandcolas P Æ 83 Guerrero R Æ 83, 183 Hannon SJ Æ 25 Hausner M Æ 163 Herrera A Æ 121 Higginbotham S Æ 95 Ibañez A Æ 95 Igrejas G Æ 19 Iorio NLP Æ 13 Kergourlay G Æ 103 Köchling T Æ 143 Kolev KI Æ 163 Lara-Martín P Æ 143 Larraga V Æ 1 Lavín JL Æ 111 Littauer D Æ 187 Llovo J Æ 121 López C Æ 121 López-Jiménez L Æ 51 Malki M Æ 73 Mamani R Æ 121 Manai M Æ 103 Martínez-Luis S Æ 95 Marques AP Æ 155 Méndez-Álvarez S Æ 33 Messaoudi S Æ 103 Monteiro D Æ 19 Montesinos E Æ 213 Mora A Æ 121 Mora I Æ 213 Muguerza E Æ 111

Prévost H Æ 103 Ramírez L Æ 111 Reguant C Æ 225 Rodrigues J Æ 19 Rodríguez O Æ 41 Rojo-Bezares B Æ 173 Rossero A Æ 103 Rozès N Æ 225 Ruiz-Martínez L Æ 51 Sáenz Y Æ 19, 173 San Romão Æ 155 Santoyo F Æ 111 Sanz JL Æ 143 Serrat M Æ 41 Sleep BE Æ 163 Spadafora C Æ 95 Starek M Æ 163 Teixeira MF Æ 155 Tenreiro R Æ 155 Themudo P Æ 19 Torres C Æ 19, 173 Townsend HGG Æ 25 Undabeitia E Æ 173 Vallejo JA Æ 41 Van Heerden E Æ 187 Veiga-Crespo P Æ 201 Vieira-Pinto M Æ 19 Villa TG Æ 41, 61, 201 Vinuesa T Æ 51 Viñas M Æ 51, 61, 201 Wolfaardt GM Æ 163 Yeung CW Æ 163

Oguiza JA Æ 111 Olmo JL Æ 207 Omarini A Æ 111 Parenti A Æ 111 Paster BJ Æ 83 Pereira EM Æ 13 Pérez G Æ 111 Pisabarro AG Æ 111 Pita JM Æ 121 Poeta P Æ 19 Potter A Æ 25

239


Keyword Index · 2011 M13-PCR 155 16S rDNA gene library 143 Acidophiles 73 Actinobacteria 83 Anoxic marine sediments 143 Antibiotic resistance 19 Anticancer activity 95 Antimicrobial peptides 213 Antimicrobial resistance 51 Arginine 225

Gene deletion 201 Genetic diversity 33 Genomic diversity 155 Groundwater 163

Simplex method 41 Sparkling wine 61 Spirochaetes 83 Spiromonas 207 Staphylococcus aureus 33 Staphylococcus epidermis 13 Sugarcane juice 41 Surfactin 213

Heterothallic 201 Homothallic 201 Imipenem 51 Insertion elements 51 Integrons 173

Kluyveromyces marxianus 41 Bacillomycin 213 Bacillus 213 Bacilysin 213 Bacterial adherence 25 Bacterial antagonism 103 Bacterial colonization 25 Bacterial invasion 25 Beer 61 Biofilm formation genes 13 Biofilms 163 Bísaro pigs 19 β-lactam-resistance 173 Cadmium 1 Campylobacter jejuni 25, 103 Carbapenems 51 Chagas’ disease 95 Chicken cecum 103 Colpoda steinii 207 Colpodella 207 Colpodids 207 Confocal microscopy 163 Conjugation 187 DNA microarrays 1 Edible mushroom 111 Electricity generation 73 Endomicrobia 83 Endophytic fungi 95 Enteroaggregative E. coli 121 Enterohemorrhagic E. coli 121 Ethanol 41 Ethyl carbamate 225 Expressed sequence tag (EST) 111 Extended-spectrum β-lactamases (ESBL) 173 Fengycin 213 Fingerprinting 155 Flagellated protozoa 207 Flow cells 163 Foam 61 240

Lactic acid bacteria (LAB) 103, 155 Lactobacillus ssp. 103, 225 Lateral gene transfer 187 Leishmania 95 Leishmania infantum 1 Leishmania infantum promasatigotes 1 Malaria 95 Mannoprotein 61 Methicillin resistance gene 13 Microbial community composition 143 Microbial fuel cells 73 Microcosm 73 Molecular identifications 13 Multiplex PCR 13

Oenococcus oeni 155 Optimization 41 Osteomyelitis infections 33 Parasitism 207 Pediococcus 225 PHA-accumulating bacteria 83 Pleurotus ostreatus 111 Polygalacturonase 41 Portuguese winemaking regions 155 Postharvest 111 Protein OprD 51 Pseudomonas aeruginosa 51 Pseudomonas putida 163

Reticulitermes grassei Río Tinto 73 Rock fractures 163

83

Saccharomyces cerevisiae 201 Saccharomyces pastorianus 201 Salmonella enterica 173 Salmonella spp. 19 Serotypes O104:H4, O157:H7, O146:H21 121 Shiga toxin 121

Termite castes 83 Termite gut microbiota 83 Thermofiles 187 Thermus 187 Transcriptome profiling 111 Transformation 187 Translation factors 1 Virulence genes 25 Wild boards 19 Wine 225 Wolbachia 83 Yeast 61 Year’s comments for 2011 183


List of reviewers · 2011 The editorial staff of INTERNATIONAL MICROBIOLOGY thanks the following persons for their invaluable assistance in reviewing manuscripts from January 1, 2011, through December 2011. The names of several reviewers have been omitted at their request.

Amils, Ricardo. Autonomous Univ. of Madrid, Cantoblanco (Madrid), Spain Antón, Josefa. University of Alicante, Alicante, Spain Averhoff, Beate. Universitty of Frankfurt, Frankfurt am Main, Germany Aymerich, Marta. IRTA, Monells (Girona), Spain Badosa, Esther. University of Girona, Girona, Spain Barbé, Jordi. Autonomous University of Barcelona, Bellaterra, Spain Barja, Juan Luis. University of Santiago de Compostela, Spain Benítez, Tahía. University of Sevilla, Sevilla, Spain Berlanga, Mercedes. University of Barcelona, Barcelona, Spain Billi, Daniela. University of Rome, Rome, Italy Blanco, Jorge. University of Santiago de Compostela, Lugo, Spain Blatterer, Hubert. Department of Environment and Water, Linz, Austria Bordons, Albert. Rovira Virgili University, Tarragona, Spain Borrego, Carles. University of Girona, Girona, Spain Bugg, Timothy. University of Warwick, Coventry, UK Cabrefiga, Jordi. University of Girona, Girona, Spain Campoy, Susana. Autonomous University of Barcelona, Bellaterra, Spain Casadesús, Josep. University of Sevilla, Sevilla, Spain de Vicente, Antonio. University of Malaga, Málaga, Spain Delneri, Daniela. University of Manchester, Manchester, UK Dolan, Michael F. University of Massachussetts, Amherst, MA, USA Domínguez, Ángel. University of Salamanca, Salamanca, Spain Esteban, Genoveva. Bournemouth University, Poole, Dorset, UK Estévez-Toranzo, Alicia. University of Santiago de Compostela, Spain García del Portillo, Francisco. CNB, CSIC, Cantoblanco (Madrid), Spain García, Ernesto. CBM, CSIC, Madrid, Spain Genilloud, Olga. Medina Foundation, Armilla (Granada), Spain Goodwin, Steven D. University of Massachussetts, Amherst, MA, USA Grandcollas, Philippe. National Natural Science Museum, Paris, France Guarro, Josep. Rovira Virgili University, Reus, Spain Gullo, Maria. University of Modena & Reggio Emilia, Reggio Emilia, Italy Herrero, Enrique. University of Lleida, Lleida, Spain Holley, Richard A. University of Manitoba, Winnipeg, Manitoba, Canada Imperial, Juan. Center for Plant Biology & Genomics, Madrid, Spain Kolter, Roberto. Harvard Univ. Medical School, Boston, MA, USA Landa, Blanca. Institute for Sustainable Agriculture, CSIC, Córdoba, Spain Lasa, Iñigo. Public University of Navarra, Pamplona, Spain Llagostera, Montserrat. Autonomous Univ. of Barcelona, Bellaterra, Spain Machida, Curt. Oregon Health & Science University, Portland, Oregon, USA Mack, Dietrich. Swansea University, Swansea, UK Martí, Belén. IRTA, Monells (Girona), Spain Martínez, J. Pedro. University of Valencia, Valencia, Spain McMaster, Robert. University of British Columbia, Vancouver, BC, Canada Méndez, Beatriz S. University of Buenos Aires, Buenos Aires, Argentina Méndez, Sebastián. Univ. Hospital Virgin of Candelaria, La Laguna, Spain Michaelidou, Urania. Wetsus Center Sustainable Water Tech., Leewarden, Holland Mira, Ramón. Cornell University, Ithaca, New York, USA Moriyón, Ignacio. University of Navarra, Pamplona, Spain Montesinos, Emilio. University of Girona, Girona, Spain Muniesa, Maite. University of Barcelona, Barcelona, Spain

Murillo, Jesús. Public University of Navarra, Pamplona, Spain Nitzan, Yeshayahu. Bar-Ilan University, Ramat-Gan, Israel Nogales, Balbina. Univ. of the Balearic Islands, Palma de Mallorca, Spain Obornik, Miroslav. Univ. of South Bohemia, Ceské Budejovice, Czech Republic Pandiella, Atanasio. University of Salamanca, Salamanca, Spain Paster, Bruce. Forsyth Institute, Cambridge, Massachusetts, USA Pedrós-Alió, Carlos. Institute of Marine Sciences, CSIC, Barcelona, Spain Pisabarro, Antonio G. Public University of Navarra, Pamplona, Spain Polymenakou, Paraskevi. University of Crete, Heraklion, Greece Poulsen, Keith. University of Wisconsin-Madison, WI, USA Prats, Clara. Technical University of Catalonia, Barcelona, Spain Reguera, Gemma. Michigan State University, East Lansing, Michigan, USA Rosselló-Mora, Ramon. Univ. Baleric Islands, Palma de Mallorca, Spain Sanz, José Luis. Autonomous Univ. of Madrid, Cantoblanco (Madrid), Spain Serrano, Aurelio. University of Sevilla-CSIC, Sevilla, Spain Shapiro, James. University of Chicago, Chicago, Illinois, USA Soriano, José Miguel. University of Valencia, Valencia, Spain Spano, Giuseppe. University of Foggia, Foggia, Italy Taylor, Erika. Wesleyan University, Middletown, Conneticut, USA Toledo, Alejandro. Public University of Navarra, Pamplona, Spain Valle, Jaione. Public University of Navarra-CSIC, Pamplona, Spain Vila, Jordi. University of Barcelona, Barcelona, Spain Villa, Tomás G. University of Santiago de Compostela, Spain Villanueva, Laura. NIOZ, Texel, Holland Vinuesa, Pablo. Autonomous Natl. Univ. of Mexico, Cuernavaca, Mexico Viñas, Miquel. University of Barcelona, Barcelona, Spain Yongqiang, Zhang. Johns Hopkins University, Baltimore, MA, USA Zagorec, Monique. INRA, Jouy en Josas, France

241


Books Reviewed in Volume 14 · 2011

The lure of bacterial genetics. A tribute to John Roth Stanley Maloy, Kelly T. Hughes, Josep Casadesús (eds) ASM Press, Washington, DC, 2011 ISBN 978-1-55581-538-7 Reviewed in 14(1), pp 59-60

242

Brucella. Molecular microbiology and genomics Ignacio López-Goñi, David O’Callaghan (eds) Caister Academic Press, 2012 ISBN 978-1-904455-93-6 Reviewed in 14(4), pp 235-236


VOLUME 14(4) DECEMBER 2011 www.im.microbios.org

Acknowledgement of Institutional Subscriptions INTERNATIONAL MICROBIOLOGY staunchly supports the policy of open access (Open Access Initiative, see Int. Microbiol. 7:157-161). Thus, the journal recognizes the help received from the many institutions and centers that pay for a subscription—in spite of the possibility to download complete and current issues of the journal free of charge. We would therefore like to thank those entities. Their generous contribution, together with the efforts of the many individuals involved in preparing each issue of INTERNATIONAL MICROBIOLOGY, makes publication of the journal possible and plays an important role in improving and expanding the field of microbiology in the world. Some of those institutions and centers are: Area de Microbiología. Departamento de Biología Aplicada. Universidad de Almería / Biblioteca. Institut Químic de Sarrià. Universitat Ramon Llull. Barcelona / Biblioteca. Instituto Nacional de Seguridad e Higiene en el TrabajoMinisterio de Trabajo y Asuntos Sociales. Barcelona / Ecologia microbiana, Fisiologia microbiana. Departament de Genètica i de Microbiologia. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Biblioteca. Institut de Biotecnologia i Biomedicina. Universitat Autònoma de Barcelona. Bellaterra (Barcelona) / Laboratori d’Ecogenètica. Departament de Microbiologia. Universitat de Barcelona / Societat Catalana de Biologia–Institut d’Estudis Catalans. Barcelona / Departamento de Microbiologia. Universidade Federal de Minas Gerais. Belo Horizonte. Brasil / Departamento de Inmunología, Microbiología y Parasitología, Universidad del País Vasco, UPV-EHU, Bilbao / Biblioteca. Universidad de Buenos Aires. Argentina / Biblioteca. Facultad de Ciencias. Universidad de Burgos / Biblioteca. Departamento de Producción Animal CIAM-Centro Mabegondo. Abegondo (Coruña) / Laboratorio de Microbioloxia. Universidade da Coruña. Coruña / Biblioteca. Divisió Alimentària

del IRTA-Centre de Tecnologia de la Carn. Generalitat de Catalunya. Monells (Girona) / Biblioteca Montilivi. Facultat de Ciències. Universitat de Girona / Área de Microbiología. Departamento de Ciencias de la Salud. Universidad de Jaén / Microbiologia. Departament de Ciències Mèdiques Bàsiques. Facultat de Medicina. Universitat de Lleida / Facultad de Ciencias. Universidad de Vigo / Laboratorio de Microbiología Aplicada. Centro de Biología Molecular. Universidad Autónoma de Madrid-CSIC. Cantoblanco (Madrid) / Grupo de Investigación de Bioingeniería y Materiales (BIO-MAT). Escuela Técnica Superior de Ingenieros Industriales. Universidad Politécnica de Madrid / Biblioteca. Centro de Investigaciones Biológicas, CSIC. Madrid / Fundación Ciencias Microbianas. Servicio de Microbiología. Hospital Universitario Ramón y Cajal, INSALUD. Madrid / Merck Sharp & Dohme de España, Madrid / Departamento de Microbiología. Facultad de Ciencias. Universidad de Málaga / Grupo de Fisiología Microbiana. Departamento de Genética y Microbiología. Universidad de Murcia. Espinardo (Murcia) / Library. Department of Geosciences. University of Massachusetts-Amherst. USA / Biblioteca de Ciencias. Universidad de Navarra. Pamplona / Grupo de Investigación de Genética y Microbiología. Departamento de Producción Agraria. Universidad Pública de Navarra. Pamplona / Microbiología Ambiental. Departamento de Biología. Universidad de Puerto Rico. Río Piedras. Puerto Rico / Biblioteca General. Universidad San Francisco de Quito. Ecuador / Biblioteca. Facultat de Medicina. Universitat Rovira Virgili. Reus / Instituto de Microbiologia. Universidade Federal de Rio de Janeiro. Brasil / Instituto de Microbiología Bioquímica-Departamento de Microbiología y Genética. CSIC-Universidad de Salamanca / Departamento de Microbiología y Parasitología. Universidad de Santiago de Compostela. Santiago / Laboratorio de Referencia de E. coli (LREC). Facultad de Veterinaria. Universidad de Santiago de Compostela. Lugo / Departamento de Genética. Universidad de Sevilla / General Library. Marine Biological Laboratory. Woods Hole, Massachusetts, USA.

243


General Information International Microbiology is a quarterly, open-access, peer-reviewed journal in the fields of basic and applied microbiology. It publishes two kinds of papers: research articles and complements (editorials, perspectives, books reviews, etc.). Submission Manuscripts must be submitted by one of the authors of the manuscript by e-mail to int.microbiol@microbios.org. As part of the submission process, authors are required to comply with the following items, and submissions may be returned if they do not adhere to these guidelines: 1. The work described has not been published before, including publication on the World Wide Web (except in the form of an Abstract or as part of a published lecture, review, or thesis), nor is it under consideration for publication elsewhere. 2. All the authors have agreed to its publication. The corresponding author signs for and accepts responsibility for releasing this material and will act on behalf of any and all coauthors regarding the editorial review and publication process. 2. The submission file is in Microsoft Word, RTF, or OpenOffice document file format. 3. The manuscript has been prepared in accordance with the journal’s accepted practice, form, and content, and it adheres to the stylistic and bibliographic requirements outlined in “Preparation of manuscripts”. 4. Illustrations and figures are placed separately in another document. Large files should be compressed. Copyright and license If an article is accepted for publication in International Microbiology, the authors (or other copyright holders) must transfer the copyright to the journal, which covers the right—not exclusive—to reproduce and distribute the article including reprints, translations, photographic reproductions, microforms, electronic form (offline, online) or any other reproduction of similar nature. Creative Commons The journal is published under a Creative Commons AttributionNonComercial-ShareAlike 3.0 Unported License. http://creativecommons.org/licenses/by-nc-sa/3.0/

Open access and article processing charges Open access publishing provides immediate, permanent, free online access to the full texts of all the journal’s peer-reviewed research articles. It allows all interested readers to view, download, print, and/or redistribute any article without requiring a subscription on the principle that making research freely available to the public supports a greater global exchange of knowledge. International Microbiology’s open access policy enables a far greater distribution and impact of an author’s work and is in the interest of the scientific community worldwide. The journal’s expenses for providing immediate, permanent, free online access to the full text of research articles are recovered partly from article-processing charges. Currently many research funding agencies not only allow these expenses to be paid from their grants, but also encourage open access publication. The journal’s standard processing fee is 800.00 €. If a manuscript requires extensive editorial work, an extra charge may be requested. The acceptance of a paper, however, will not depend on the authors’ ability to pay these charges. Individual waiver requests must be done during the submission process and will be considered on a case-to-case basis. Information for Subscribers International Microbiology is published quarterly. Volume 14 will consist of 4 issues—March, June, September and December—and will be published during 2011. Recommended annual subscription is 300.00 € plus shipping and handling. Single-issue prices are available upon request. SAL (Surface Air Lifted) delivery is mandatory for Japan, Northeast and Southeast Asia, India, Australia and New Zealand. Airmail delivery to all other countries is available upon request. Orders or claims can be sent directly to: International Microbiology Poblet, 15 08028 Barcelona, Spain Tel. & Fax +34-933341079 E-mail: int.microbiol@microbios.org Cancellations must be received by 30 September to take effect at the end of the same year. Change of address: allow six weeks for all changes to become effective. Please contact int.microbiol@ microbios.org if you have any questions regarding your subscription. Information for advertisers For advertising inquiries, please contact us at int.microbiol@microbios.org. All advertisements are subject to the publisher's approval.

All articles in International Microbiology will be available on the Internet to any reader at no cost. The journal allows users to freely download, copy, print, distribute, search, and link to the full text of any article provided the authorship and source of the published article is cited and it is not used for commercial purposes. We recommend authors read about the Creative Commons Attribution-NonComercialShareAlike 3.0 Unported License before submitting their paper.

244

Disclaimer While the contents of this journal are believe to be true and accurate at the date of its publication, neither the authors and editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no guarantee, expressed or implied, with regard to the material contained therein.


Instructions for authors Preparation of manuscripts General information Research articles and research reviews should not exceed 12 pages, including tables and figures. The text should be typed in 12-point, Times New Roman font, with one and a half line spacing, left justification, and no line numbering. All pages must be numbered consecutively, starting with the tile page. The Title page should comprise: title of the manuscript, first name and surname and affiliation (department, university, city, state/province, and country) for all authors. The address, telephone and fax numbers, and e-mail address of the corresponding author should also be included. The Summary should be informative and completely comprehensible, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. It should not exceed 200 words. Standard nomenclature should be used and abbreviations should be avoided or defined. No references should be cited. Immediately following the Summary, up to five Keywords should be provided; these will be used for indexing purposes. The Introduction should be concise and define the objectives of the work in relation to other work done in the same field. It should not give an exhaustive review of the literature. Materials and methods should provide sufficient detail to allow the experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. The suppliers of chemicals and equipment should be indicated if this might affect the results. Subheadings may be used. Statistical techniques used must be specified. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the author’s experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. The Discussion should be confined to interpretation of the results (not to recapitulating them), also in light of the pertinent literature on the subject. When appropriate, the Results and Discussion sections can be combined. This will be the case in research notes. Acknowledgements should be presented after the Discussion section. Personal acknowledgements should only be made with the permission of the person(s) named. Competing interests should be declared by authors at submission indicating whether they have any financial, personal, or professional interests that could be construed to have influenced their paper. References should be listed and numbered in alphabetical order. In the text, citations should be indicated by the reference number in square brackets. The list of references should include only works that are cited in the text and that have been published or accepted for publication. Unpublished work in preparation, Ph.D. and Masters theses, etc., should be mentioned in the text only, in parentheses. The author(s) must obtain written permission for the citation of a personal communication or other’s researchers’ unpublished results. References cited in the text should be numbered and placed within square brackets, referring to an alphabetized list at the end of the paper. References should be in the following style: Published papers Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA, Wuertz S (2005) Architecture of a nascent Sphingomonas sp. biofilm under varied hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686

Books Miller JH (1972) Experiments in molecular genetics. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA Book chapters Lo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis with symbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: a modern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50 Please list the first eight authors and then add “et al.” if there are additional authors. Citation of articles that have appeared in electronic journals is allowed if access to them is unlimited and their URL or DOI number to the full-text article is supplied. Tables and Figures should be restricted to the minimum needed to clarify the text; a total number (F + T) of five is recommended. Neither tables nor figures should be used to present results that can be described with a short statement in the text. They also must not be integrated into the text. Figure legends must be typed double-spaced on a separate page and appended to the text. Photographs should be well contrasted and not exceed the printing area (17.6 × 23.6 cm). Magnification of micrographs should be shown by a bar marker. For color illustrations, the authors will be expected to pay the extra costs of 600.00 € per article. Color figures may be accepted for use on the cover of the issue in which the paper will appear. Tables must be numbered consecutively with Arabic numerals and submitted separately from the text at the end of the paper. Tables may be edited to permit more compact typesetting. The publisher reserves the right to reduce or enlarge figures and tables. Electronic Supporting Information (SI) such as supplemental figures, tables, videos, micrographs, etc. may be published as additional materials, when details are too voluminous to appear in the printed version. SI is referred to in the article’s text and is ported on the journal’s website (www.im.microbios.org) at the time of publication. Abbreviations and units should follow the recommendations of the IUPAC-IUB Commission. Information can be obtained at: http://www.chem.qmw.ac.uk/iupac/. Common abbreviations such as cDNA, NADH and PCR need not to be defined. Non-standard abbreviation should be defined at first mention in the Summary and again in the main body of the text and used consistently thereafter. SI units should be used throughout. For Nomenclature of organisms genus and species names must be in italics. Each genus should be written out in full in the title and at first mention in the text. Thereafter, the genus may be abbreviated, provided there is no danger of confusion with other genera discussed in the paper. Bacterial names should follow the instructions to authors of the International Journal of Systematic and Evolutionary Microbiology. Nomenclature of protists should follow the Handbook of Protoctista (Jones and Bartlett, Boston). Outline of the Editorial Process Peer-Review Process All submitted manuscripts judged potentially suitable for the journal are formally peer reviewed. Manuscripts are evaluated by a minimum of two and a maximum of five external reviewers working in the paper’s specific area. Reviewers submit their reports on the manuscripts along with their recommendation and the journal’s editors will then make a decision based on the reviewersAcceptance, article preparation, and proofs. Acceptance, article preparation, and proofs Once an article has been accepted for publication, manuscripts are thoroughly revised, formatted, copy-edited, and typeset. PDF proofs are generated so that the authors can approve the final article. Only typesetting errors should be corrected at this stage. Corrections of errors that were present in the original manuscript will be subject to additional charges. Corrected page proofs must be returned by the date requested.

P3


Turn static files into dynamic content formats.

Create a flipbook
International Microbiology by Institut d'Estudis Catalans - Issuu