Journal of Apicultural Research 52(4): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.4.17
Notes and Comments
The COLOSS BEEBOOK Volume II - Foreword
Marie-Pierre Chauzat 1 2
1*
and Alberto Laddomada2
ANSES, Sophia-Antipolis Laboratory, Les Templiers, 105, route des Chappes, BP 111 06902 Sophia-Antipolis, France. Unit G2 Animal Health, Directorate General for Health and Consumers (DG SANCO), European Commission, Brussels, Belgium.
*Corresponding author: Email: marie-pierre.CHAUZAT@anses.fr Honey bees have fascinated mankind since the Stone Age. The oldest
in Europe before the introduction of V. destructor, they were of limited
evidence of honey collection by humans dates from c. 6000 BC in a
economic importance. The deleterious effect of V. destructor on honey
cave near Valencia in Spain. Subsequent to the interest in their honey, bee colonies has now been studied for more than 30 years, yet the the only sweetener available in the wild, honey bees have also captured pathogenicity mechanisms still remain largely unknown, because they the attention of people because of their social organization. In 1973, the Nobel Prize in physiology and medicine was awarded to Karl von
involve complex interactions between the host, pathogens and parasite. The worldwide trade in honey bees and hive products has accelerated
Frisch, Nikolaas Tinbergen and Konrad Lorenz "for their discoveries
the diffusion of ‘new’ pathogens, predators and pests to other parts of
concerning organisation and elicitation of individual and social
world. A new species of Nosema (N. ceranae), also initially described
behaviour patterns" especially the description of the honey bee dance
from the Asian honey bee, has lately been widely detected on A. mellifera.
language by Karl von Frisch. More recently, honey bees have drawn
This parasite has apparently silently spread throughout the world for
the attention of the public and stakeholders because of higher than
decades, yet only recently has it supplanted N. apis in honey bee
normal mortalities of colonies reported by beekeepers in many
colonies in warm climates. American foulbrood (AFB) and European
countries for which the exact causes remain largely unknown. There
foulbrood are two bacterial diseases affecting honey bees. Caused
is, however, a scientific consensus that there is no single cause for
respectively by Paenibacillus larvae and Melissococcus plutonius, the
these losses, which are undoubtedly caused by a combination of a
diseases affect the brood of A. mellifera. Because P. larvae is a spore
number of factors.
forming bacteria, AFB is extremely contagious.
Honey bees are affected by various pathogens, and some have
Beekeeping activity is highly dependent of the environment, more
long been known. In c. 300 BC, the Greek philosopher Aristotle reported so than any other animal keeping or food production industry. It is the presence of “rust” in honey bee colonies, which was probably
therefore crucial to assess the influence all environmental factors on
what we now know as American foulbrood, a serious bacterial disease. honey bee health. These can include, inter alia, the insufficient availability It is also worth noting that the gut parasite Nosema apis has been the and diversity of pollen and nectar as food, the presence of natural bee subject of studies for more than a century. However in recent decades, honey bees have been subjected to new threats. The discovery and exploration of “new worlds” by Europeans made possible the introduction and establishment of the western honey bee (Apis mellifera) outside its natural distribution
predators or competitors and the effects of pesticides on honey bee health, not to mention the role of honey bee genetic diversity and the bees' natural resistance mechanisms against pathogens. The need for more efficient standardisation in honey bee experimentation is widely recognised, but until now has not been
area. This movement suppressed the natural geographical segregation widely adopted. Standardisation is vital for harmonious veterinary established for millions for years between the different species of
standards, and for daily routine diagnostics that are essential to ensure
honey bees. The Asian honey bee (Apis cerana) has evolved together
confidence in the comparability of results from different laboratories.
with its pathogens for thousands of years reaching a sustainable
Researchers, policy makers, veterinary services, beekeepers and other
equilibrium. The introduction of the western honey bee in Asia made
stakeholders all have the same goal: to contribute to a healthy and
possible the jump of pathogens from A. cerana to A. mellifera. The
productive apicultural sector in its quest for long-term sustainability
current major threat of honey bees worldwide is the ectoparasite
both in the EU and worldwide.
Varroa destructor which originated in Asia as a parasite of A. cerana. The mite feeds on the honey bee haemolymph by piercing the host
In terms of the regulatory aspects of honey bee pathogens, under the WTO (World Trade Organisation) agreement on the application of
cuticle. The wounds created facilitate the exchange of viruses between Sanitary and Phytosanitary Measures (SPS Agreement), the OIE the host and the parasite. Although honey bee viruses had been identified (World Organisation for Animal Health) publishes sanitary standards
2
Chauzat, Laddomada
for international trade in animals and animal products. As part of this
where appropriate, supplying strains of the pathogenic agents to
activity, OIE develops international standards and guidelines for
facilitate the diagnostic service in the EU. The EU RL will organise
diagnostic tests and vaccines as well as for veterinary laboratories. Six periodic comparative tests of diagnostic procedures at EU level with honey bee diseases are listed by the OIE in the Manual of Diagnostic
the NRLs (National Reference Laboratories) designated by the Member
Tests and Vaccines for Terrestrial Animals to provide internationally
States, in order to provide information on the methods of diagnosis
agreed diagnostic laboratory methods.
used and the result of the test carried out in the EU.
In the framework of European honey bee health rules, the
The COLOSS BEEBOOK provides many additional protocols which
European Commission designated the ANSES Sophia-Antipolis
can improve pest and pathogen research and its potential impact in
laboratory as the European Union Reference Laboratory (EU RL) for
these times of pollinator declines. It is therefore a pleasure to
bee health on 29 October 2010. The EU RL for honey bee health,
acknowledge the work of the BEEBOOK editors and the authors. The
among its duties and functions, has to coordinate, in consultation with relevant specialists in each field have been gathered to constructively the Commission (more specifically with the Directorate General for Health list and to criticise existing research protocols. The BEEBOOK is thus an and Consumers), the methods employed in the Member States for
important step forward to the establishment of standardised protocols
diagnosing the relevant bee diseases, specifically by typing, storing and, for the study of honey bee diseases.
Journal of Apicultural Research 52(4): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.4.16
GUEST EDITORIAL
The COLOSS BEEBOOK Volume II, Standard methods for Apis mellifera pest and pathogen research: Introduction Vincent Dietemann1,2*, James D Ellis3 and Peter Neumann4,2 1
Swiss Bee Research Centre, Agroscope Liebefeld-Posieux Research Station ALP-Haras, Bern, Switzerland. Social Insect Research Group, Department of Zoology & Entomology, University of Pretoria, Pretoria, South Africa. 3 Honey bee Research and Extension Laboratory, Department of Entomology and Nematology, University of Florida, Gainesville, Florida, USA. 4 Institute of Bee Health, Vetsuisse Faculty, University of Bern, Bern, Switzerland. 2
Received 29 July 2013, accepted for publication 30 July 2013. *Corresponding author: Email: vincent.dietemann@agroscope.admin.ch Keywords: COLOSS, BEEBOOK, honey bee, Apis mellifera, research, standard methods, laboratory, field, pests, disease, diagnosis The COLOSS BEEBOOK is a practical manual compiling standard
necessary for a given method, and cross references all general
methods in all fields of research on the western honey bee, Apis
methods from other papers as necessary. For example, identifying a
mellifera. The COLOSS network was founded in 2008 as a consequence subspecies of honey bee can be done using genetic tools. The general of the heavy and frequent losses of managed honey bee colonies
instructions to use microsatellites are given in the molecular methods
experienced in many regions of the world (Neumann and Carreck, 2010). paper (Evans et al., 2013), whereas the specific method appropriate As many of the world’s honey bee research teams began to address
for subspecies identification is described in the paper on ecotypes and
the problem, it soon became obvious that a lack of standardized
subspecies identification (Meixner et al., 2013). Consequently, one
research methods was seriously hindering scientists’ ability to harmonize would visit the ecotypes paper to determine how to identify a given and compare the data on colony losses obtained internationally. In its
subspecies. That paper will then refer to the molecular methods paper
second year of activity, during a COLOSS meeting held in Bern,
when discussing microsatellites specifically.
Switzerland, the idea of a manual of standardized honey bee research methods emerged. The manual, to be called the COLOSS BEEBOOK,
The reader may wonder about the difference between the BEEBOOK and existing standards provided by the Office International des
was inspired by publications with similar purposes for fruit fly research Epizooties (OIE), and the European Organisation for Economic (Lindsley and Grell, 1968; Ashburner, 1989; Roberts, 1998; Greenspan,
Co-operation and Development (OECD). In the BEEBOOK, we often
2004).
refer to OIE, OECD, and other standards, since they describe methods
Production of the BEEBOOK began after recruiting international
to diagnose pests and diseases (OIE) or to perform, for example,
experts to lead the compilation of each research domain. These senior routine analyses for toxicity tests (OECD). The BEEBOOK, however, authors (first in the author list) were tasked with recruiting a suitable
goes well beyond diagnosis and routine analyses by describing the
team of contributors to select the methods to be used as standards
methods to perform research on the honey bee and associated
and then to report them in a user-friendly manner (Williams et al., 2012).
organisms. Where necessary, the BEEBOOK recognizes existing
The initial BEEBOOK project is divided into three volumes: The
standards such as those provided by the OIE and OECD, and presents
COLOSS BEEBOOK, Volume I: Standard methods for Apis mellifera
a harmonized compendium of research methods, written and reviewed
research; The COLOSS BEEBOOK, Volume II: Standard methods for
by an international team of scientists.
Apis mellifera pest and pathogen research; and The COLOSS BEEBOOK, Volume III: Standard methods for Apis mellifera product research. Papers in the BEEBOOK are organized according to research topics. The authors have compiled those methods selected as the ‘best’ in each domain of research. These methods are for both laboratory
In addition to producing a bench-friendly manual, and in an effort to make the methods broadly available, every paper forming the
BEEBOOK is also available as open access articles in several special issues of the Journal of Apicultural Research. To further build on the availability of digital media, a novel
and field research. We recognize that it is often necessary to use
concept was developed around the manual. An online version of the
methods from several domains of research to complete a given
manual was created, where each method can be discussed and
experiment with honey bees. Whenever there is a need for multi-
improvements suggested. Development work on the online BEEBOOK
disciplinary approach, the manual describes the specific instructions
platform started in 2009, and the current iteration can be found at
Dietemann et al.
2
www.coloss.org/beebook. On the platform, each webpage describing
hope that we have included all of the relevant research pests and
a method has a comment field, which can be used to suggest changes pathogens (including emerging ones such as Tropilaelaps spp.), but or additions. Users can thus assist with the improvement and further
recognize that, as with any undertaking of such size, we may have
development of the BEEBOOK. Once sufficient updates have
overlooked important topics, and other pests and pathogens may
accumulated online, a new print version of the manual can then be
emerge in the future. If so, this can be addressed via the online
edited and published. Such a Wiki-like tool is especially useful for
BEEBOOK platform (www.coloss.org/beebook), leading to an improved
following fast evolving fields, such as for molecular protocols.
version in the future. We hope that the information provided herein
The BEEBOOK is a tool for all who want to do research on honey bees. It was written in such a way that those new to honey bee research can use it to start research in a field with which they may not be familiar. Of course, such an endeavour is often limited by the
will assist everyone interested in investigating the pests and pathogens of the honey bee. The western honey bee remains a fascinating research topic, and one of timeless significance considering the bee’s importance for food
availability of complex and expensive machinery and other equipment. production and ecosystem sustainability. We hope that we and our However, provided access to and training on the necessary equipment team of international colleagues have produced a resource that will be are secured, the instructions provided in the BEEBOOK can be followed useful into perpetuity. We also hope that you will find research on by everyone, from undergraduate student to experienced researcher.
honey bees, their pests and pathogens to be professionally rewarding
All details on how to implement instructions are given.
and intellectually stimulating.
The editors and author team hope that the BEEBOOK will serve as a reference tool for honey bee and other researchers globally. As with the original Drosophila book that evolved into a journal where updates and new methods are published, we hope that the honey bee research
Acknowledgements
community will embrace this tool and work to improve it. The online
The COLOSS (Prevention of honey bee COlony LOSSes) network aims
platform is open for everyone to use and further contribute to the
to explain and prevent massive honey bee colony losses. It was funded
development of our research field.
through the COST Action FA0803. COST (European Cooperation in
The study of honey bee pests and pathogens is globally relevant
Science and Technology) is a unique means for European researchers
and remarkably varied. The major impact of bee pests and pathogens
to jointly develop their own ideas and new initiatives across all scientific
on the well-being of honey bees has led to considerable research in
disciplines through trans-European networking of nationally funded
this field. Consequently, the editorial and author team felt it necessary research activities. Based on a pan-European intergovernmental to develop a volume focused solely on protocols related to studying
framework for cooperation in science and technology, COST has
the pests and pathogens of western honey bees.
contributed since its creation more than 40 years ago to closing the
This effort resulted in the production of Volume II of the COLOSS
gap between science, policy makers and society throughout Europe
BEEBOOK: Standard methods for Apis mellifera pest and pathogen
and beyond. COST is supported by the EU Seventh Framework
research. Here, 98 international scientists from 22 countries have
Programme for research, technological development and demonstration
collaborated to produce 12 chapters including over 500 protocols
activities (Official Journal L 412, 30 December 2006). The European
related to studying honey bee pests and pathogens. The chapters are
Science Foundation as implementing agent of COST provides the
grouped into three sections. The first section focuses on protocols
COST Office through an EC Grant Agreement. The Council of the
related to honey bee epidemiology. They include: epidemiology itself
European Union provides the COST Secretariat. The COLOSS network
(vanEngelsdorp et al., 2013) and survey methods for estimating colony is now supported by the Ricola Foundation - Nature & Culture. losses (van der Zee et al., 2013). The second section includes chapters focused on honey bee pests and they include: small hive beetles (Neumann et al., 2013), tracheal mites (Sammataro et al., 2013),
Tropilaelaps mites (Anderson et al., 2013), varroa (Dietemann et al.,
References
2013), and wax moths (Ellis et al., 2013). The third and final section
ASHBURNER, M (1989) Drosophila: a laboratory manual. Cold Spring
includes chapters listing protocols for studying honey bee pathogens. Included in this section are chapters on: American foulbrood (de Graaf
Harbor Laboratory Press; Cold Spring Harbor, USA. 434 pp. ANDERSON, D L; ROBERTS, J M K (2013) Standard methods for
et al., 2013), European foulbrood (Forsgren et al., 2013), fungi (Jensen
Tropilaelaps mites research. In V Dietemann; J D Ellis; P Neumann
et al., 2013), nosema (Fries et al., 2013), and viruses (de Miranda
(Eds) The COLOSS BEEBOOK, Volume II: standard methods for
et al., 2013). It was our intention to be exhaustive when working with
Apis mellifera pest and pathogen research. Journal of Apicultural
senior authors to develop the chapters included in this volume. We
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.21
The COLOSS BEEBOOK: Volume II introduction
3
DE GRAAF, D C; ALIPPI, A M; ANTÚNEZ, K; ARONSTEIN, K A; BUDGE, G; FRIES, I; CHAUZAT, M-P; CHEN, Y-P; DOUBLET, V; GENERSCH, E; DE KOKER, D; DE SMET, L; DINGMAN, D W; EVANS, J D;
GISDER, S; HIGES, M; MCMAHON, D P; MARTÍN-HERNÁNDEZ, R;
FOSTER, L J; FÜNFHAUS, A; GARCIA-GONZALEZ, E; GREGORC, A;
NATSOPOULOU, M; PAXTON, R J; TANNER, G; WEBSTER, T C;
HUMAN, H; MURRAY, K D; NGUYEN, B K; POPPINGA, L; SPIVAK,
WILLIAMS, G R (2013) Standard methods for Nosema research.
M; VANENGELSDORP, D; WILKINS, S; GENERSCH, E (2013)
In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS
Standard methods for American foulbrood research. In V Dietemann;
BEEBOOK, Volume II: Standard methods for Apis mellifera pest
J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II:
and pathogen research. Journal of Apicultural Research 52(1):
standard methods for Apis mellifera pest and pathogen research.
http://dx.doi.org/10.3896/IBRA.1.52.1.14
Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.11 DE MIRANDA, J R; BAILEY, L; BALL, B V; BLANCHARD, P; BUDGE, G; CHEJANOVSKY, N; CHEN, Y-P; GAUTHIER, L; GENERSCH, E;
GREENSPAN, R J (2004) Fly pushing: the theory and practice of Drosophila genetics (Second Ed.). Cole Spring Harbor Laboratory Press; Cold Spring Harbor, USA. 191 pp. JENSEN, A B; ARONSTEIN, K; FLORES, J M; VOJVODIC, S; PALACIO,
DE GRAAF, D; RIBIÈRE, M; RYABOV, E; DE SMET, L; VAN DER
M A; SPIVAK, M (2013) Standard methods for fungal brood
STEEN, J J M (2013) Standard methods for virus research in Apis
disease research. In V Dietemann; J D Ellis; P Neumann (Eds) The
mellifera. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS
COLOSS BEEBOOK, Volume II: Standard methods for Apis mellifera
BEEBOOK, Volume II: standard methods for Apis mellifera pest
pest and pathogen research. Journal of Apicultural Research 52(1):
and pathogen research. Journal of Apicultural Research 52(4):
http://dx.doi.org/10.3896/IBRA.1.52.1.13
http://dx.doi.org/10.3896/IBRA.1.52.4.22 DIETEMANN, V; NAZZI, F; MARTIN, S J; ANDERSON, D; LOCKE, B; DELAPLANE, K S; WAUQUIEZ, Q; TANNAHILL, C; FREY, E; ZIEGELMANN, B; ROSENKRANZ, P; ELLIS, J D (2013) Standard
LINDSLEY, D L; GRELL, E H (1968) Genetic variations of Drosophila melanogaster. Carnegie Institute of Washington; Washington, USA. 472 pp. MEIXNER, M D; PINTO, M A; BOUGA, M; KRYGER, P; IVANOVA, E;
methods for varroa research. In V Dietemann; J D Ellis; P Neumann
FUCHS, S (2013) Standard methods for characterising subspecies
(Eds) The COLOSS BEEBOOK, Volume II: standard methods for
and ecotypes of Apis mellifera. In V Dietemann; J D Ellis; P Neumann
Apis mellifera pest and pathogen research. Journal of Apicultural
(Eds) The COLOSS BEEBOOK, Volume I: standard methods for
Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.09
Apis mellifera research. Journal of Apicultural Research 52(4):
ELLIS, J D; GRAHAM, J R; MORTENSEN, A (2013) Standard methods
http://dx.doi.org/10.3896/IBRA.1.52.4.05
for wax moth research. In V Dietemann; J D Ellis; P Neumann (Eds) NEUMANN, P; CARRECK, N L (2010) Honey bee colony losses. Journal of
The COLOSS BEEBOOK, Volume II: standard methods for Apis
Apicultural Research 49(1): 1-6.
mellifera pest and pathogen research. Journal of Apicultural
http://dx.doi.org/ 10.3896/IBRA.1.49.1.01
Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.10 EVANS, J D; SCHWARZ, R S; CHEN, Y P; BUDGE, G; CORNMAN, R S;
NEUMANN, P; EVANS, J D; PETTIS, J S; PIRK, C W W; SCHÄFER, M O; TANNER, G; ELLIS, J D (2013) Standard methods for small hive
DE LA RUA, P; DE MIRANDA, J R; FORET, S; FOSTER, L; GAUTHIER,
beetle research. In V Dietemann; J D Ellis; P Neumann (Eds) The
L; GENERSCH, E; GISDER, S; JAROSCH, A; KUCHARSKI, R; LOPEZ,
COLOSS BEEBOOK, Volume II: Standard methods for Apis mellifera
D; LUN, C M; MORITZ, R F A; MALESZKA, R; MUÑOZ, I; PINTO, M
pest and pathogen research. Journal of Apicultural Research 52(4):
A (2013) Standard methodologies for molecular research in Apis
http://dx.doi.org/10.3896/IBRA.1.52.4.19
mellifera. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS ROBERTS, D B (Ed.) (1998) Drosophila: a practical approach. Oxford BEEBOOK, Volume I: standard methods for Apis mellifera research.
Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.11 FORSGREN, E; BUDGE, G E; CHARRIÈRE, J-D; HORNITZKY, M A Z
University Press; Oxford, UK. 389 pp. SAMMATARO, D; DE GUZMAN, L; GEORGE, S; OCHOA, R; OTIS, G (2013) Standard methods for tracheal mites research. In V
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
(2013) Standard methods for European foulbrood research. In V
Volume II: Standard methods for Apis mellifera pest and pathogen
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
research. Journal of Apicultural Research 52(4):
Volume II: Standard methods for Apis mellifera pest and pathogen
http://dx.doi.org/10.3896/IBRA.1.52.4.20
research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.12
Dietemann et al.
4
VAN DER ZEE, R; GRAY, A; HOLZMANN, C; PISA, L; BRODSCHNEIDER, VANENGELSDORP, D; LENGERICH, E; SPLEEN, A; DAINAT, B; R; CHLEBO, R; COFFEY, M F; KENCE, A; KRISTIANSEN, P;
CRESSWELL, J; BAYLISS, K; NGUYEN, K B; SOROKER; V;
MUTINELLI, F; NGUYEN, B K; ADJLANE, N; PETERSON, M;
UNDERWOOD, R; HUMAN, H; LE CONTE, Y; SAEGERMAN, C (2013)
SOROKER, V; TOPOLSKA, G; VEJSNÆS, F; WILKINS, S (2012)
Standard epidemiological methods to understand and improve
Standard survey methods for estimating colony losses and
Apis mellifera health. In V Dietemann; J D Ellis; P Neumann (Eds)
explanatory risk factors in Apis mellifera. In V Dietemann; J D Ellis;
The COLOSS BEEBOOK, Volume II: Standard methods for Apis
P Neumann (Eds) The COLOSS BEEBOOK, Volume II: Standard
mellifera pest and pathogen research. Journal of Apicultural
methods for Apis mellifera research. Journal of Apicultural Research
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.15
52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.18
WILLIAMS, G R; DIETEMANN, V; ELLIS, J D; NEUMANN P (2012) An update on the COLOSS network and the “BEEBOOK: standard methodologies for Apis mellifera research”. Journal of Apicultural
Research 51(2): 151-153. http://dx.doi.org/10.3896/IBRA.1.51.2.01
Journal of Apicultural Research 52(1): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.1.08
REVIEW ARTICLE
Standard epidemiological methods to understand and improve Apis mellifera health. Dennis vanEngelsdorp1*, Eugene Lengerich2, Angela Spleen2, Benjamin Dainat3, James Cresswell4, Kathy Baylis5, Bach Kim Nguyen6, Victoria Soroker7, Robyn Underwood1, Hannelie Human8, Yves Le Conte9, Claude Saegerman10 1
Department of Entomology, 3136 Plant Sciences, University of Maryland, College Park, MD 20742, USA. Department of Public Health Sciences, College of Medicine, The Pennsylvania State University, Hershey, PA, 17033, USA. 3 Swiss Bee Research Centre, Agroscope Liebefeld-Posieux ALP-Haras, Schwarzenburgstrasse 161, 3003 Bern, Switzerland. 4 Biosciences, College of Life & Environmental Sciences, University of Exeter, Hatherly Laboratories, Prince of Wales Road, Exeter, EX4 4PS, UK. 5 Department of Agriculture and Consumer Economics, University of Illinois, Urbana, IL 61801, USA. 6 Department of Functional and Evolutionary Entomology, University of Liege, Gembloux Agro-Bio Tech, B-5030 Gembloux, Belgium. 7 Department of Entomology, Agricultural Research Organization, The Volcani Center P.O.B. 6, Bet Dagan 50250, Israel. 8 Department of Zoology and Entomology, University of Pretoria, Pretoria, South Africa. 9 INRA, UR 406 Abeilles et Environnement, Site Agroparc, Domaine St Paul, 84914 Avignon Cedex 9, France. 10 Research Unit in Epidemiology and Risk Analysis Applied to Veterinary Sciences (UREAR-ULg), Department of Infectious and Parasitic Diseases, Faculty of Veterinary Medicine, University of Liège, Boulevard de Colonster 20, B42, 4000 Liège, Belgium. 2
Received 1 June 2012, accepted subject to revision 10 August 2012, accepted for publication 26 October 2012. *Corresponding author: Email: dennis.vanengelsdorp@gmail.com
Summary In this paper, we describe the use of epidemiological methods to understand and reduce honey bee morbidity and mortality. Essential terms are presented and defined and we also give examples for their use. Defining such terms as disease, population, sensitivity, and specificity, provides a framework for epidemiological comparisons. The term population, in particular, is quite complex for an organism like the honey bee because one can view “epidemiological unit” as individual bees, colonies, apiaries, or operations. The population of interest must, therefore, be clearly defined. Equations and explanations of how to calculate measures of disease rates in a population are provided. There are two types of study design; observational and experimental. The advantages and limitations of both are discussed. Approaches to calculate and interpret results are detailed. Methods for calculating epidemiological measures such as detection of rare events, associating exposure and disease (Odds Ratio and Relative Risk), and comparing prevalence and incidence are discussed. Naturally, for beekeepers, the adoption of any management system must have economic advantage. We present a means to determine the cost and benefit of the treatment in order determine its net benefit. Lastly, this paper presents a discussion of the use of Hill’s criteria for inferring causal relationships. This framework for judging cause-effect relationships supports a repeatable and quantitative evaluation process at the population or landscape level. Hill’s criteria disaggregate the different kinds of evidence, allowing the scientist to consider each type of evidence individually and objectively, using a quantitative scoring method for drawing conclusions. It is hoped that the epidemiological approach will be more broadly used to study and negate honey bee disease.
Métodos estándar epidemiológicos para entender y mejorar la salud de Apis mellifera. Resumen En este trabajo se detalla el uso de métodos epidemiológicos para entender y reducir la morbilidad y la mortalidad de las abejas. Se presentan y definen algunos términos esenciales y también se ponen ejemplos de su uso. La definición de términos tales como enfermedad, población, Footnote: Please cite this paper as: VANENGELSDORP, D; LENGERICH, E; SPLEEN, A; DAINAT, B; CRESSWELL, J; BAYLISS, K; NGUYEN, B K; SOROKER, V; UNDERWOOD, R; HUMAN, H; LE CONTE, Y; SAEGERMAN, C (2013) Standard epidemiological methods to understand and improve Apis mellifera health. In V
Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.08
The COLOSS BEEBOOK: epidemiological methods
2
sensibilidad y especificidad, proporciona un marco de referencia para las comparaciones epidemiológicas. El término población, en particular, es muy complejo en un organismo como la abeja de la miel, porque uno puede ver la "unidad epidemiológica" como las abejas individuales, las colonias, los colmenares o incluso, determinadas operaciones. La población de interés debe, por lo tanto, estar claramente definida. Se proporcionan además ecuaciones y explicaciones sobre cómo calcular las medidas de la tasas de enfermedad en una población.
研究和改善西方蜜蜂健康的标准流行病学研究方法 本文详述了如何应用流行病学的研究方法,探明和降低蜜蜂发病率及死亡率。同时还对一些关键术语进行了定义,并举例和说明了它们的用途。 定义了诸如:疾病、群体、敏感性和特异性等术语,为流行病学比较研究提供了框架。“群体”的含义在蜜蜂学研究中是比较复杂的,研究者可将 一个蜜蜂的个体、一个蜂群、一个蜂场或某项实验定义为一个 “流行病学研究单位”。所以,在开展流行病学研究时必须对所研究的群体加以明 确定义。本文还阐述了如何评价群体的发病程度,并给出了相关的计算公式和注解。 Key words: COLOSS, BEEBOOK, honey bee Apis mellifera, epidemiology, disease, case definition confidence interval, odds ratio, relative risk, Hills Criteria
1. Basic epidemiological terms and calculations Epidemiology is traditionally defined as the study of the distribution and determinants of disease within a human population (Woodward, 2005). To accomplish this, epidemiological studies attempt to identify factors which may explain or contribute to disease outbreak. Once identified, these factors not only inform future clinical etiological studies, but also, and perhaps more importantly, they inform disease prevention and control programmes (Mausner and Kramer, 1985).
Fig. 1. The virtuous circle of epidemiology: Step 1. describe health
The success of epidemiologists in reducing the occurrence of human
characteristics of the population in space and time (descriptive
disease over the last century is undeniable. The identification of
epidemiology); Step 2. analyse data and mechanisms of development
factors that contribute to the occurrence of diseases such as lung
of the disease to understand behaviour (analytical epidemiology);
cancer (smoking), sexually transmitted diseases (unprotected sex),
Step 3. produce, select and apply control or preventive measures
and cardiovascular disease (high blood pressure) have permitted
(operational epidemiology); Step 4. give necessary information that
targeted community health initiatives aimed at preventing or
permits the follow up of measures (evaluative epidemiology); In
controlling risk factor exposure. These initiatives, in turn, have helped
addition, changing epidemiological methods should be supported by
reduce the rate of disease in targeted populations (Mausner and
theoretical epidemiology (modelling).
Kramer 1985; Koepsell and Weiss, 2003; Woodward, 2005). Considering the success of human epidemiology, it is not
factors contributing to disease occurrence, determining methods to
surprising that epidemiological methods have been adopted by those
reduce disease occurrence and then evaluating the effectiveness of
wishing to understand and reduce disease outbreak in non-human
these methods (Toma et al., 1991).
animals (epizootiology) (Nutter, 1999). The term epidemiology is now
A comprehensive review of all of these steps is well beyond the
widely adopted by those studying disease and disease determinants in scope of this paper. Similarly, much of the data used by non-human organisms, including honey bees, and will be the term
epidemiologists are derived from surveillance efforts, a discussion of
used in this paper. Nutter (1999) argued that the application of
which is also beyond the scope of this paper, but has received
epidemiological methods for understanding disease occurrence in
attention in other recent work (Hendrikx et al., 2009, vanEngelsdorp
plant, human, and animal populations involves the implementation of
et al., 2013). Instead, we focus on presenting and defining the
six common steps which include defining disease in quantitative terms vocabulary needed to implement epidemiological studies, and then and quantifying state and rate variables of the disease system. An
outline study design, analysis and interpretation. It is also the intent
alternative way to look at this process is to consider the "virtuous
of this paper to present a framework for understanding and initiating
epidemiological cycle" (Fig. 1) which outlines the various steps
ongoing and future studies of honey bee health. Unless otherwise
involved in quantifying disease in a population, determining risk
noted, the following terms and concepts have been adapted from
vanEnglesdorp et al.
3
Koepsell and Weiss (2003).
Specificity Similarly, specificity is the probability that a human/animal will have a
1.1. Disease
negative test result if indeed it is disease free. This is expressed as: P
To successfully develop tools which either quantify the rate of disease
(T-|D-), where P is the probability, T- is a negative test result and D-
development in a population or quantify the factors which may
is the disease not being present. In applied epidemiology, specificity is
contribute to disease occurrence, the “disease” of interest must be
often expressed as the proportion of non-diseased (healthy) animals
clearly defined. Broadly speaking, disease is any departure from
that test negative, expressed as equation 1.1.2.b.
perfect health. When applied to specific studies, a precise definition the case definition - must be developed which unambiguously allows subjects to be classified as a case or not.
1.1.2.1. Calculating confidence intervals for a proportion Sensitivity and specificity are based upon a sample of test results
1.1.1. Case definition
around which there is uncertainty. In epidemiology, uncertainty can
The case definition is the operating definition of a disease for study
be expressed as confidence interval (CI). Typically, they are
purposes. Aristotle identified two crucial components that made for a
expressed as a 95 % confidence interval (95 % CI). Briefly,
good case definition: 1. it specifies characteristics common to all
confidence intervals indicate the precision of the estimate where a
diseased individuals; and 2. it specifies how diseased individuals differ wide confidence interval indicates that the estimate is not very from non-diseased individuals (Koepsell and Weiss, 2003). Ideally, the precise. In statistical terms, if we were to repeat the test 100 times, characteristics used to identify the disease should be simple and
the point estimate of 95 of those 100 tests would lie within the
recognizable by independent observers in different geographies.
confidence interval. Implicit in presenting 95 % CI is the assumption
Because characteristics cannot always be recognized in the field, case
that the sample from which the CI is derived is representative of the
confirmation by laboratory analyses is sometimes necessary. Case
population from which the sample was drawn. Representativeness is
definitions, especially for emerging or newly identified diseases, often
best achieved when the sample is randomly drawn from the
suffer from having limited specificity. Further, case definitions for a
population of interest. As long as the sample size is greater than 30,
disease can evolve as understanding of a disease changes and / or
the 95 % CI can be calculated using equation 1.1.2.c.
the diagnostic tests performed to determine a diagnosis are refined. An outline of different classifications of case definitions has been provided by the World Health Organization (WHO, 1999). When
Where Zα is the (1-α/2) percentile of the standard normal distribution
applied to apiculture, it is important to define the “epidemiological
(Zα=1.96 for 95% CI) and s.e. is the standard error.
unit” for which the case definition is being applied (discussed in greater detail in section 1.2). Epidemiological units are the groups which make up the population of interest, and can range from individual bees, colonies, apiaries, and operations. In cases where the sample size is smaller than 30, where np<5, n 1.1.2. Test sensitivity and specificity
(1-p)<5 or the proportion estimate is close to 0 or 1.0, standard
Many case definitions are based on laboratory or clinical tests, but
statistical software tools (e.g. SAS JMP) will use the binomial
tests in themselves are prone to errors either by misidentifying truly
distribution to calculate the CI. Estimates can also be determined by
positive cases incorrectly as negative cases, or truly negative cases as
replacing Zα in equation 1.1.2.c above with the critical value from a
positive cases. The accuracy of a test is primarily given as sensitivity
published binomial statistical table.
and specificity.
1.1.3. Positive and negative predictive values Sensitivity
While sensitivity and specificity primarily measure a test’s accuracy,
Sensitivity is the probability that a human or animal will have a
epidemiologists use two other measures, positive and negative
positive test result if indeed the human or animal does have a
predictive values, to help describe the certainty of a specific test
disease. This is expressed as: P(T+|D+), where P is the probability,
result. A Positive Predictive Value (PPV) is the probability that a
T+ is a positive test result and D+ is a disease being present. In
person/animal with a positive test result truly has a disease P(D+/
applied epidemiology, sensitivity is often expressed as a proportion,
T+). PPV is typically expressed as a proportion (Equation 1.1.3.a).
and thus expressed as equation 1.1.2.a.
The COLOSS BEEBOOK: epidemiological methods
A Negative Predictive Value (NPV) is the probability that a person/
4
Box 1.
animal with a negative test result truly does not have disease
Over the inspection season of 2004 and 2005, Pennsylvania state
P (D-/T-). NPV is typically expressed as a proportion (Equation
bee inspectors preformed 107 Holst’s milk tests on suspect cases of
1.1.3.b).
clinical American foulbrood disease (for more information about this test, see the BEEBOOK paper on American foulbrood (de Graaf et
al., 2012)). Ninety samples tested positive with the Holst’s milk test PPV and NPV decrease and increase, respectively, as a function of
(Holst, 1945), of which 89 were confirmed in the laboratory to be
the prevalence of the disease in a population. As the prevalence of a
AFB infection. Confirmation of diagnosis was performed by culturing
disease increases so does the PPV while the NPV decreases (Box 1).
a smear of diseased larvae sampled from the same colony. The Holst’s milk test resulted in 14 negative and three inconclusive re-
1.2. Population Defining the population under study is a critical component of all epidemiological studies. Like case definitions, the population under study must have characteristics which set its members apart from non -members. These members can then be categorized into smaller groups for the purposes of comparing disease levels between different sub-groups within the study population. Defining the population of
sults. The later were discarded. Six of the negative samples were later diagnosed to have had AFB when companion samples were cultured (vanEngelsdorp, unpublished data). The sensitivity and specificity as well as the positive and negative predictive value of this test can be calculated as follows: In summary:
interest in apiculture represents a unique challenge as there is a
Condition (as determined
hierarchy of population units, each of which could be considered
by AFB Culture) Positive Negative
Total
“individual members” (Table 1). In apicultural terms there are several levels of potential interest, thus there are several different definitions
Holst's
Test Positive
89
1
90
for what makes up the individual of interest.
Milk
Test Negative
6
8
14
Total
95
9
104
Test
Individual bees within a colony A group of colonies located within one area make up an
Therefore:
apiary
One or more groups of apiaries owned or managed by one beekeeper make up an operation
Apiaries contained within a defined geography make up a region Characteristics that commonly define sub-groups within any of these given populations often differ according to hierarchal classification of the population, but broadly include individual attributes, such as: age (i.e. bee cohort at the colony level (Giray at
Because the denominator is less than 30, the normal approximation of
al., 2000); genetics (i.e. patriline at the colony level (Estoup et al.,
the binomial distribution cannot be assumed and for the calculation of
1994), queen type at the apiary level); size of operations; production
the 95% CI we used the binomial tables. Thus, the
objectives; and management style (at the regional level) (Table 1). Once the defining criteria for a population have been established, the membership (epidemiological unit) of that population can be quantified. However, size may change over time because new members are added or existing members are removed.
1.3. Measures of disease in a population Comparing frequency of disease between sub-groups of a population
Thus, when a Holst’s milk test is performed and comes back positive
underpins most epidemiological research (see study design in Section
we are 99 % certain the sample does contain American Foulbrood
2.0). As such, various ways to quantify disease frequency have been
spores, while if the Holst’s milk test comes back negative we are 53
developed.
% sure that the sample does not have American foulbrood spores.
vanEnglesdorp et al.
5
Table 1. Hierarchy of possible populations of interest, types of members, and common groupings or sub-categories for comparing members within the same population in honey bee epidemiological studies. Population
Members
Colony
Bees
Apiary
Colonies
Operation
Apiaries
Region
Operations
1.3.1. Point prevalence Point prevalence is the frequency of ongoing disease in a defined population at a certain point in time (Equation 1.3.1).
Common groupings / subcategories for comparisons Caste (worker vs drone) Cohort (foragers, nurses, pupae, etc.) Queen stock Treatment groups Micro –environment (shade vs full sun) Region/microclimate Management system Disease history Operation size Management practices Geographic region
Box 2. In the summer of 2006 apiary inspectors in Pennsylvania inspected a sub-set of beekeeping operations in the state. In total, 1,706 apiaries were inspected containing 11,285 colonies. Clinical signs of
The method for calculating the 95 % confidence interval for point prevalence is outlined in section 1.1.2.1. Again, it is important to
Chalkbrood (CB) disease were found in a total of 384 colonies located in 156 apiaries (vanEngelsdorp, unpublished data).
stress that calculating the CI assumes the sample pool is representative of the population as a whole, this is best achieved if the sample was randomly drawn from the population. The estimate of
Where 95% CI for estimation of the prevalence in the total
the point prevalence is affected by the likelihood that a disease will be
population
detected during a given inspection. Diseases which occur for only short periods of time are less likely to be observed during an inspection than are diseases that are more chronic (Box 2).
= 0.09 ± 0.017 = (0.073 – 0.107) = 7.3-10.7%
1.3.1.1. True versus apparent prevalence. As can be inferred from the discussion above, the reported point prevalence of disease is influenced by the case definition and the test employed to determine a case’s outcome. It is conceivable that for some diseases, in-field examination for phenotypic expression of
Where 95% CI for estimation of the prevalence in the total Population
disease may be negative while laboratory tests determine disease presence (i.e. deformed wing virus). In such cases, two types of prevalence can be specified; true prevalence with all cases of disease existing at a specific point in time, and apparent prevalence that is determined by test results (i.e. in-field examination, molecular test, etc.). The apparent prevalence is subject to the accuracy of the test (sensitivity and specificity).
= 0.034 ± 0.0033 = (0.0307 – 0.0373) = 3.1 -3.7% Thus, assuming that the inspected apiaries were representative of the entire Pennsylvanian population, Chalkbrood was present in 9 % of all colonies (95 % CI: 7.3-10.3 %) while 3.4 % (95 % CI 3.1 – 3.7 %) of all colonies had clinical signs of the disease.
1.3.2. Incidence rate Incidence is the occurrence of a new case if a disease and is best
The incidence rate (IR) accounts for the fact that the number of
calculated if the exact period of time at risk for each participant is
incident cases is dependent on the size of the population observed
known. The incidence rate is the proportion of incident cases in a
and the time period over which individuals were observed. Because
population at risk of becoming an incident case during a specified
IRs are measured over time, the population under observation may
period of time (Equation 1.3.2.a).
change. Where precise data on the population at risk of becoming an incident case over the period is not available, the average population of individuals at risk for the time period is commonly used as the denominator. This technique is particularly useful when attempting to calculate the incidence rate of a condition which is very likely to be
The COLOSS BEEBOOK: epidemiological methods
6
self-reported in a large population. IRs are presented as a number per (TColonies at risk) and multiplying the quotient by 100 % (Equation time, or per unit-time if the exact time at risk is known for each
1.3.3.1).
member of the population.
1.3.2.1. Calculating confidence intervals for incidence rates The confidence interval for an IR can be calculated for a population
Where the total number of colonies at risk of dying (TColonies at risk of
with the same time at risk using equation 1.1.2.b, where Z∝ is based
dying)
on the Poison distribution and n is an individual-time constant. In
the start of the period (TStart) with the number of splits made by the
over a period was calculated by adding the number of colonies at
reality the IR is often not homogenous within a population. For
beekeepers over the period (TSplits) and the number of colonies
instance, a random sample of honey bee colonies would express
purchased over the period (TPurchased) and then subtracting the number
hygienic behaviour differently. As highly hygienic colonies are more
of colonies removed (sold or given away) over the period (TRemoved).
likely to resist brood diseases, these colonies would be less likely to be diagnosed with the condition. Conversely, it is conceivable that the diagnosis of a certain brood disease in a given colony is a marker for
And where the total number of colonies that died (TDead) was
increased susceptibility for the disease. Therefore, in comparison to
calculated by subtracting the total number of colonies at the end of a
disease-free colonies, a second diagnosis is more likely to occur in
period (TEnd) from the total number of colonies at risk of dying for the
colonies that were previously diseased. This phenomenon is referred
period (Tcolonies at risk of dying).
to as extra-Poison variation and if left uncorrected will result in a confidence interval that is too narrow. To address this, a multivariate logistic regression model with terms for previous disease should be employed. Just as the IR is not the same for all individuals in a population, it
Where period was the defined period of time for which colony loss was analysed. The unit of time, is the period defined by the time between TStart and TEnd. This unit is often not reported and is often
is also not likely to be constant over time. The prevalence of many
loosely defined by the season encompassed by that time period (e.g.
bee diseases changes over time, thus affecting 95 % CI calculation.
winter).
This problem can be overcome by restricting analysis to sub-periods or “time bands” so that differences in IR over time are not a factor.
And where, respondents in a specific group are the group of respondents for whom valid loss data was collected.
Alternatively, time itself can be used as a predictor of disease when performing a multivariate analysis (Koepsell and Weiss, 2003).
1.3.3.1.1. 95 % CI for total loss Because total loss is a proportion, theoretically its confidence interval
1.3.3. Special cases of incidence
can be calculated using equation 1.1.2.c. This approach is valid when
Over the last few years considerable effort has been placed on
calculating a 95% CI for losses within one operation. However, if all
documenting winter losses in different regions of the world. As a
the colonies in an operation are measured, one’s sample is the whole
result, different methods to calculate and report winter losses have
population, there is no need to calculate the CI. When total losses
been developed including Total Loss, Average Loss (vanEngelsdorp et
are calculated for a region, the losses of several operations are being
al. 2011).
combined, using the previously mentioned equation to calculate the 95% CI is inappropriate as the basic assumption that the total number
1.3.3.1. Total colony loss (TL) (the cumulative incidence of
of dead (TDead) is independent of the total colonies at risk (TColonies
mortality)
at risk of dying) is not met. In such cases the quasi-binomial family is
This is the percentage of colonies lost in a specific group over a fixed
introduced to take into account the increased standard error
period of time. This figure is the most accurate snap shot of loss in a
introduced by dependence within the data (vanEngelsdorp et al.,
defined group, such as in an operation or geographic region. If all
2011). An R script example which allows for such calculations is given
colonies in a region were enumerated it would give a precise figure
in Box 3.
for the proportion of all colonies that died in that region. However, within the population of interest, operations with large numbers of
1.3.3.2. Average loss (AL)
colonies will have a greater influence on the total colony loss metric
Average loss is the mean % of the total colony loss experienced by
than will the operations with only few colonies. Total Colony Loss in
respondents in a defined group over a defined period of time. This
an operation or in a defined group is calculated by dividing the total
metric is most appropriately used to compare groups partitioned by
number of colonies that died over a given time period (Tdead) by the
different risk factor exposures (see study design in Section 2.1.1.3).
total number of colonies at risk of dying in a given time period
Usually average loss calculations are heavily influenced by smaller beekeeper operations as they often compose a larger portion of the
vanEnglesdorp et al.
7
response population. Average Loss is calculated by dividing the
Box 3.
summed total colony loss of respondents (TLi) within a specified group by the number of respondents in that group (N) and then multiplying the quotient by 100%. Equation 1.3.3.2
In the dialogue below, text starting with # describes the R script which follows. Text in bold is R script and text in italics is output. # import data (format csv) data <- read.csv("C:\\Users\\ ruchersWinterLoss.csv",
1.3.3.2.1. 95 % CI for average loss Like other proportions, average loss confidence intervals can be calculated using equation 1.1.2.c. As mentioned previously, average losses are often skewed by smaller operations resulting in a Poisson distribution of losses rather than a normal distribution. When the number of respondents exceeds 100, the Poisson distribution resembles a normal distribution so adjustment in the equation 1.1.2.c is not needed. However, when the number of respondents is less
header = T, sep = ",") summary(data)
Colony
nCol
nDead
nAlive
Min. : 1.00
Min. : 1.00
Min. : 0.00
Min. : 0.00
1st Qu.: 44.75 1st Qu.: 2.75 1st Qu.: 1.00
1st Qu.: 0.00
Median : 88.50 Median: 5.00
Median : 3.00 Median : 2.00
Mean : 88.50 Mean : 96.51
Mean : 33.60
Mean : 62.91
than 100, the rate multiplier for the 95% CI can be determined by
3rd Qu.: 132.25 3rd Qu.: 12.00 3r Qu.: 8.25 3rd Qu.: 5.00
looking up the lower and higher rate multiplier in an appropriate table
Max.: 176.00
(e.g. Paoli et al., 2002) (Box 3.).
attach(data)
Max.: 6000.00 Max.: 2000.00 Max.: 5000.00
# general linear model, family quasibinomial
2. Study design
wloss.glm1 <- glm(cbind(nDead, nAlive)~1, fami-
Epidemiologists endeavour to reduce disease occurrence in a
ly=quasibinomial, data=data)
population. To achieve this one must quantify disease at the population level and determine risk factors that contribute to disease
# generate confidence intervals via GLM
occurrence. Two study designs can be used to determine the
require(boot)
association of exposure with a health outcome: observational and
Loading required package: boot
experimental. In an experimental design, the exposure is determined by the investigator, whereas in an observational design, the exposure is not determined by the investigator or the study (i.e. exposure is under the control of the study participants or the participant’s environment). For example, if an investigator determines which hives are treated for Nosema and which are not, then the study design would be considered an experimental design. In an observational
prop <- with(data, sum(nDead)/sum(nCol)) # Verification : 'raw' confidence intervals (Wald formula) nColonies <- sum(data$nCol) #deriving the 95% confidence interval prop+c(-1,1)*1.96* sqrt(vcov(wloss.glm1)))
study, the investigator would observe the Nosema responses for beekeepers who applied and who did not apply treatment for
[1] 0.194553621
0.501666796
Nosema, wherein this case, the application of the treatment is
#call specific output and bind them together as a single object
determined by the beekeeper.
titles=c("tot loss","SE","
2.1. Observational study designs 2.1.1. Cross-sectional studies Cross-sectional studies are a point-in-time study, such as a one-time disease surveillance survey, and are typically used to estimate disease prevalence or the simultaneous association between a risk factor and a disease. In this design, the exposure and outcome for each subject in the study are ascertained simultaneously. This simultaneity often
Conf. Int.","")
stats=c(prop,sqrt(vcov(wloss.glm1)),(prop+c(-1,1) *1.96*sqrt(prop*(1-prop)/nColonies))) output=rbind(titles,stats) print(output)
[,1] titles
[,2] "tot loss"
[,3]
[,4]
"SE"
" Conf. Int."
""
stats "0.348110208406923" "0.0794099959221504" "0. " "0.194553621 0.501666796"
leads to difficulty in conclusively establishing the temporal relationship
Thus, this table states the total loss was 34.8 % with a standard
between the exposure and the outcome. It is also important to note
error of 7.9 percentage points, giving a 95 % CI of 19.3 % to 50.2
that chronic conditions are more likely to be identified in a survey
%.
because they are more likely to persist in a population and are more
The COLOSS BEEBOOK: epidemiological methods
common. Therefore this study design is less useful for studies of rare
8
Box 4.
exposures and rare outcomes. However, cross-sectional studies can be inexpensive, relatively quick to conduct, and are used to identify potential associations between exposures and outcomes that warrant further research with more rigorous population-based study designs. An example of a cross-sectional study is when a bee inspector examines hives in an apiary for characteristics, such as size, strength, activity, and disease and then uses these data to generate estimates of the prevalence of hives with a particular disease (e.g., Chalkbrood) in a region.
The bump technique is a new method meant to detect the presence of Tropilaelaps mites (Anderson et al., 2013). This test, when applied to colonies that have an average infestation of 4.6 ± 0.06 mites per 100 brood cells, has a sensitivity of 36 % (Pettis, Rose, and vanEngelsdorp, unpublished data). How many colonies need to be tested in a region with more than 1,000 colonies in order to detect one infected colony with 95 % Confidence, assuming that 5 % of colonies are infested?
2.1.1.1 Detection of rare events Epidemiological surveys are often designed to detect (or not detect) relatively rare events in a population. It is often impractical or impossible to prove that a disease or pest organism is not found in a
Thus, 165 randomly selected colonies would need to be tested to be 95% confident of detecting at least one positive colony given a 5% infestation rate.
region with 100 % certainty. However, a properly designed disease surveillance system can give a set level of confidence that a disease or pest species is not present in a defined population at a predefined prevalence level. These results, by extension, can help to declare a
2.1.1.2 Data analysis and interpretation: making associations
region as free from a particular disease or parasite which may have
between exposure and disease in cross-sectional studies
important implications for policy makers.
When cross-sectional studies collect information on disease
In most cases, disease prevalence in individual members (i.e.
prevalence and simultaneous exposure to factors that may contribute
colonies) will be categorical, that is the disease will either be present
to disease, Odds Ratios (ORs) can be used to calculate the degree of
or absent (Fosgate, 2009). The number of individuals that would need association between concurrent exposure and disease state. We can to be examined (n) in an infinite population (where the number of
calculate the odds of exposure among cases compared to the odds of
individuals exceeds 1,000 members) given a minimum disease
exposure among non-cases (controls). The OR is the odds of
prevalence (P) is given by equation 2.1.1.1.a (Hill, 1965).
exposure in an individual who was diseased divided by the odds of
Equation 2.1.1.1.a
exposure in an individual who was disease free (Equation 2.1.1.2.a). Equation 2.1.1.2.a
Where α is the confidence with which one wants to be certain the Where a,b,c,d are defined by the Table 2. The Confidence
disease is detected. In finite populations (<1,000) with a population size of N, the number of individuals that need to be examined (n) to
Intervals for Odds Ratio can be calculated using Equation 2.1.1.2 b. Equation 2.1.1.2.b
be certain to detect at least one positive case at a defined confidence (α), where the minimum prevalence of disease in the population (P) is given by equation 2.1.1.1.b. Equation 2.1.1.1.b
2.1.1.3. Significance of odds ratio measures Generally speaking OR (and Relative Risk see below) values greater than 1 indicates that a disease is more likely to occur in an exposed group as compared to an unexposed group. Conversely, an OR value
Where D = N × P. Both of these approaches assume tests which are 100 % sensitive, which is often unrealistic. In cases where
less than 1 means that a disease event is less likely to occur in an exposed groups compared to unexposed group. An OR that has a
sensitivity is imperfect but known (S), the number of individuals that would need to be examined (n) in an infinite population to be
Table 2. Structure of data for calculation of odds ratio. Disease
confident (α) of detecting at least one diseased case with a disease prevalence of P is given by equation 2.1.1.1.c
Exposure
Present
Absent
All Individuals
Equation 2.1.1.1.c
Yes
a
b
a+b
No
c
d
c+d
vanEnglesdorp et al.
9
Box 5. Between 1996 and 2007 the apiary inspection programme in the Commonwealth of Pennsylvania inspected 19,933 apiaries for clinical signs of chalkbrood and sacbrood disease. Over all inspections, 1,831 apiaries were found to have at least one colony with chalkbrood, and 547 colonies were found to have sacbrood. 212 apiaries had colonies infected with chalkbrood and sacbrood at the same time (vanEngelsdorp, unpublished data). Was there an association between the presence of chalkbrood and sacbrood?
sacbrood
chalkbrood
apiaries
positive
negative
total
positive
212
1,619
1,831
negative
335
17,767
18,102
total
547
19,386
19,933
Thus, apiaries infected with chalkbrood are 6.9 times more likely to be infected with sacbrood when compared to apiaries not infected with chalkbrood. The 95 % confidence interval for the Odds Ratio =
Where s.e. = Thus, the 95 % confidence interval in this example is = 5.8 -8.3. The confidence interval does not include 1.0, therefore the relationship between Sacbrood and Chalkbrood is statistically significant, and is unlikely due to chance.
95% CI that overlaps with 1 is indicative of an OR that is not a significant (Box 5).
estimates. Generally speaking, populations that have point estimates with overlapping 95 % CI are not significantly different, while those
2.1.1.3 Comparing prevalence / incidence rates Some cross sectional studies may collect information on
who do not have overlapping populations are. More importantly, the 95 % CI aid in the interpretation of any exposure effect in that it puts
presumptive risk factors as well as health outcomes. For instance,
the upper and lower bounds on possible magnitude of any effect
winter loss surveys may collect information on management practices
(Gardner and Altman, 1986).
utilized in addition to health outcome (mortality). When the study permits the population to be divided based on different “exposures”,
When cross sectional studies result in incidence rates (e.g. from winter loss surveys), rates between groups separated by
the measures of disease outcomes (prevalence or incidence rates) can exposure can be compared using ANOVA and other basic parametric be compared. When prevalence is the measure of comparison,
tests. As is the case for the non-parametric tests mentioned in the
differences in exposure between two groups separated by risk factor
above paragraph, these will result in a P value which indicates if the
exposure can be compared using a Chi-Square test, or in cases where
incidence rates in the populations differ. This result is of limited value
fewer than 5 cases were observed in a given cell, the Fisher’s exact
because not only is it of interest that the populations are different;
test. Resulting from this approach is a p value, which simply provides
the magnitude of the difference is of note. Calculating and comparing
a goal post by which we can assert that the populations differ
95% CI for the point estimate of Incidence rates has more meaning
significantly (typically when a p ≤ 0.05 is calculated, the prevalence
than stating that the two groups within a population are different or
rates in two populations are considered to be significantly different).
not based on a statistical test (Box 6).
However, this approach does not give any indication as to the size of the effect of exposure to the risk factor. The magnitude of this effect
2.1.1.4 Multiple regression models
can be gleaned by comparing the 95 % CI of the point prevalence
While comparing exposure prevalence in sub-groups of a population
The COLOSS BEEBOOK: epidemiological methods
may have benefits in elucidating exposures that have pronounced
10
Box 6.
effects on disease, often, several factors may contribute to disease outcomes. In these cases, multivariate regression analysis can be conducted to highlight exposure factors that differ between groups. If the outcome is at the individual level, a multivariate logit or probit may be appropriate. If the outcome is at a group level, a multivariate logistic regression may be preferred, although if most ratios or percentages range between 0.3 and 0.7, a linear regression can often give a good fit. Standard statistical packages (SAS, R, etc.) permit fairly straightforward disease modelling for datasets that are complete, that is have all the needed exposure measures present for each "diseased" and "non-diseased" epidemiological unit. However, frequently, cross sectional studies have incomplete data.
A winter loss survey was conducted to determine the winter mortality (Oct 1 – April 1) of US beekeepers over the winter of 2010 -2011 (vanEngelsdorp et al., 2012). A subset of these respondents also answered various questions regarding their management practices. In all 1,074 beekeepers indicated they had used a known varroa mite control product in a majority of their hives over the previous year, while 1,675 responding beekeepers reported not using any known varroa mite control product in any of their hives. Beekeepers who used a known varroa mite control product lost 29.5 % (95 % CI 27.5-31.4 %) of their colonies, while those who did not indicate they used a known varroa mite control product lost 36.7 % (95 % CI 34.9-38.55) (BeeInformed.org Report 30).
2.1.1.5. Classification and regression tree (CART) analysis This analysis is useful for modelling diseases that have multiple contributing factors and an incomplete data set for quantifying possible risk factors in both the disease and disease-free populations. The CART analysis is a non-linear and non-parametric model, fitted by binary recursive partitioning of multidimensional co-variate space (Breiman et al., 1984, Saegerman et al., 2004, Speybroeck et al., 2004). Using CART 6.0 software (Salford Systems; San Diego, USA), the analysis successively splits the data set into increasingly homogeneous subsets until it is stratified and meets specified criteria. The Gini index is normally used as the splitting method, and a ten-fold cross-validation is used to test the predictive capacity of the trees obtained. The CART analysis performs cross-validation by growing maximal trees on subsets of data, then calculating error rates based on unused portions of the data set. The consequence of this complex process is a set of fairly reliable estimates of the independent predictive accuracy of the tree, even when some data for independent variables are incomplete and/or
As the two confidence intervals do not overlap we know the two populations are different, we can say that beekeepers who treated with a known varroa control product lost 7 fewer overwintering colonies per 100 than those who did not; in other words beekeepers
comparatively scarce. Further details about CART are presented in
who treated with a known varroa control product lost 20 %
previously published articles (Saegerman et al., 2011).
(7/37*100 %) fewer colonies than those who did not.
2.1.2 Cohort studies
time is measured in exposed and unexposed individuals to determine
Cohort studies allow an investigator to estimate the disease incidence
the risk of disease in relation to exposure to a factor of interest.
rate because the study measures the time that participants don’t have These studies can be performed retrospectively, where a post-hoc the disease. As compared to cross-sectional studies, cohort studies
study is executed on previously collected data, or prospectively,
are better able to assess causality because the temporal relationship
where study subjects who do not have the outcome of interest are
of exposure preceding outcome is not subject to question. This design followed forward through time. Examples of cohort studies in honey is implemented through three steps. First, exposed and unexposed
bees include Genersch et al. (2010), Gisder et al. (2010) and
individuals who are free of the outcome of interest are identified and
vanEngelsdorp et al. (2013).
become the cohort. Next, each cohort is observed for a minimum period of time to determine if the outcome of interest develops. The
2.1.2.1 Data analysis and interpretation: making associations
risk of developing the outcome is calculated separately for the
between exposure and disease in cohort studies
exposed group and for the unexposed group. Finally, the risk for the
If the investigator knows the exact time that each participant was at
exposed and unexposed study subjects is compared, often by
risk, it is possible to calculate the incidence rate. Incidence rates can
estimating the relative risk. Essentially, the incidence of disease over
be compared between different groups within a population in the
vanEnglesdorp et al.
11
Box 7. A longitudinal study was set up to monitor colonies for mortality and other factors as they moved up and down the east coast to pollinate crops. Forty nine colonies were examined in June of 2007, and 20 of them were found to have entombed pollen during the examination. In January 2008, 15 of the colonies that had entombed pollen were dead, as compared to the 6 colonies that died in the cohort without entombed pollen (vanEngelsdorp et al., 2009a).
Outcome (January 2008) Colonies
Dead
Alive
Total
Entombed pollen (June
Positive
15
5
20
2007)
Negative
6
23
29
Total
21
28
49
95% CI = 1.18-7.61
As the RR is greater than 1 and the 95% CI do not overlap with 1, we can say that the increased risk of mortality associated with entombed pollen is significant. For every colony that died by January that did not have entombed pollen in June, 3.6 colonies died that did have entombed pollen.
same way as prevalence rates can, that is using standard statistical
There are numerous online RR calculators (e.g. http://
tests, and/or, (perhaps more appropriately) comparing 95 % CI
faculty.vassar.edu/lowry/VassarStats.html). Common statistical
between two groups in a population. Another valuable tool that can
packages often give RR and associated CI when performing tests on
be used to highlight possible associations between disease outcome
2x2 contingency tables. Caution should be used, however, to ensure
and risk factor exposure is the calculation of relative risk.
that the data entered in such packages are in keeping with the layout presented in Table 3.
2.1.2.2. Relative risk The Relative risk is a measure of the chance of developing a disease
2.1.2.4. Significance of relative risk measures
after a particular exposure. It is calculated by dividing the incidence
Generally speaking RR (and Odds Ratio) values greater than 1
rate in an exposed population (Ie) by the incidence rate in an
indicates that a disease is more likely to occur in an exposed group as
unexposed population (Io). (Equation 2.1.2.2.)
compared to an unexposed group. Conversely, a RR value less than 1
Equation 2.1.2.2
means that a disease event is less likely to occur in an exposed group compared to unexposed group. The confidence that a RR value is a measure of a real increased measurable risk, and not a consequence of chance, is dependent on several factors: 1. the size of the
Where a, b, c, d are determined by Table 3.
2.1.2.3. The confidence intervals for relative risk
population; 2. the variability in the responding population; and 3. the
Table 3. Structure of data for calculation of Relative Risk. Both disease outcome and risk factor exposure are dichotomous.
The Confidence Intervals for Relative Risk can be calculated using the Outcome
equation given in Equation 2.1.2.3. Equation 2.1.2.3.
Exposure
Present
Absent
All Individuals
Yes
A
b
a+b
No
c
d
c+d
The COLOSS BEEBOOK: epidemiological methods
intensity of the effect. All of these attributes are accounted for in the
12
causality. The most simple randomized trial design consists of
calculation of the 95 % CI. Thus, to gauge if a RR measure truly does participants being randomly assigned to one of two treatment arms, indicate an increase or decrease in risk of disease after exposure, one
the experimental arm (receive treatment of interest) or the control
should examine a RR 95 % CI. If the interval overlaps with 1, the RR
arm (receive no, placebo or standard treatment). Data from
cannot be considered significant (Box 7).
randomized trials can be utilized to calculate incidence of outcomes per treatment arm and then compare the incidence using the relative
2.1.3. Case-control studies
risk or risk differences. Randomization helps protect against bias,
In contrast to cohort studies where participants are identified by
because it is likely that potential confounders are equally distributed
exposure status, participants in case-control studies are identified by
across the treatment and control study groups. The scope of
their disease or outcome status. Cases are participants who have
randomized studies is limited because these studies aim to confirm or
developed the outcome of interest. Controls are subjects who do not
disprove a specific hypothesis. Additionally, the cost and time needed
have the outcome of interest and provide an estimate of the
to conduct trials are two primary disadvantages of this study design. A
frequency of exposure in the population at risk. In this retrospective
third concern is that the results from a controlled randomized trial
study design, cases and controls are first identified. Subsequently, the may not be generalizable to uncontrolled real-world settings. There exposure to the factor of interest is ascertained, for each case and
are many different variations on the simple randomized study design
control. Lastly, an odds ratio for the outcome of interest (in relation to in which randomization schemes are modified and researchers are exposure status) is calculated. Case-control studies are retrospective
blinded to study conditions.
because they seek to determine previous exposure after the outcome has been established. Thus, they are subject to recall or information bias. Case-control studies are also subject to sampling bias because it is difficult to select controls which are (ideally) perfectly similar to
3. Economic considerations
cases, with the exception of outcome status. However, techniques
Understanding those factors that are associated with a lower rate of
such as matching controls to cases and stratified analysis can improve loss may provide potential treatment options for beekeepers. the precision of estimates from case-control studies.
However, just because a practice appears to be effective in reducing
Case-control studies are useful when attempting to isolate a cause loss does not mean that it is necessarily in the beekeeper’s best or causes for an emerging disease condition. Most recently this
interest to adopt it. An additional piece of information for apiary
approach was used in attempts to determine the factors contributing
managers is how much the treatment will cost and how much money
to Colony Collapse Disorder (CCD) (vanEngelsdorp et al., 2009b,
the producer will likely save with its application.
2010; Dainat et al., 2012)
Calculating the costs of practices in beekeeping is relatively straight forward, in that it includes the purchase cost of treatment
2.1.3.1. Data analysis and interpretation
and any labour or materials costs associated with its application.
The data analysis is similar to that presented in cross-sectional study
While each producer can calculate their costs, accurate aggregate
designs above. However, the results from case-control studies have
data are more difficult to obtain, particularly for labour costs, or for
more importance in determination etiology because exposure status is applications where producers use their own recipe. Thus, the true ascertained at a time prior to case and control status are determined.
costs of treatment may vary from producer to producer, and individual managers can be guided to compare their own costs to the average for a better cost estimate.
2.2. Experimental study designs
Calculating the benefit from reducing disease is more nuanced.
In contrast to observational studies, an experimental study assigns
One simple approach is to use the replacement cost of a hive as an
subjects to different treatment or exposure levels. This type of study
estimate for the benefit of losing one less colony. To be as close as
design can be used to investigate the change in health status due to
possible to the actual cost, one would like to find the replacement
disease screening programs, prevention plans, interventions,
process that most closely replicates the scenario of having not lost the
diagnostic techniques or treatment procedures. Ultimately, a research
colony in the first place, such as a nuclear colony. Thus, one would
team decides who will be treated or exposed, which consequently
not simply want to use the cost of splitting a hive, but would want a
results in experimental intervention, not just observation of natural
replacement that would be as productive as quickly as an existing
events.
colony while not reducing the productivity of surviving colonies. The
Randomized studies are very powerful for investigating cause and effect because of the random assignment of study subjects to two or more intervention strategies, which leads to a compelling test of
true replacement costs would include extra feeding and labour costs associated with getting that colony to productivity (Equations 3.0).
vanEnglesdorp et al.
13
Equation 3.0.a
Box 8.
Benefit of saving one colony = Replacement cost
Using the numbers from the winter loss survey given in Box 6, we observed that beekeepers that used a known varroa mite control
Where replacement cost = cost of nuclear colony + cost of feed + cost of labour Once one has a measure of the benefit of saving one colony, one
product lost 7.2 % fewer colonies than beekeepers that did not use a product (29.5 % versus 36.7 % loss, respectively). To calculate the 95 % CI for the difference in the mean, we need to calculate
can determine the expected net benefit of treatment for a disease
1.96 × s.e.d, where s.e.d is the standard error of the difference in
(Equation 3.0.b).
means. The standard error of the difference, s.e.d is defined as
Equation 3.0.b
Expected net benefit of treatment = Replacement cost x (mean survival of untreated colonies – mean survival of treated colonies)
where se1 is the standard error of the mean for sample 1, and s.e.2 is the standard error of the mean for sample 2. The standard error for the sample using treatment is 1.02 and the standard error
Where: mean survival = 100 - Average Loss
for the control sample (or no-treatment sample) is 0.92. Thus, the
If the cost of treatment exceeds the expected benefit, generating
standard error of the difference in means is .
a negative expected net benefit, then despite the fact that the treatment may reduce colony loss, it may not be in the producer’s best interest to use that treatment. Note that the above calculation, even if all treatment and
If using the replacement costs of a hive, including labour and
replacement costs are included, will tend to underestimate the
feeding are $150, then the expected benefit of the treatment is the
benefits associated with treatment. Disease not only affects mortality,
change in probability of loss times the replacement costs, or 0.07 ×
it also affects productivity, which is not captured in the above
$150 = $10.80 (95 % CI $8.07 to $13.53). Assume the cost of
calculation. Thus, the above calculation should be thought of as
treatment is $7.50 per colony. Thus the expected net benefits
generating a lower bound on expected net benefit. A more nuanced
would be $10.80 - $7.50 = $3.30 (95% CI $0.57 to $6.03) per hive.
approach would be to estimate the effect of treatment on disease
Thus, the producer is expected to benefit from the treatment and
load, and the effect of disease load on productivity of honey
those benefits will range from $0.57 to $6.03, 95 times out of 100.
production, pollination or other revenue-generating activities. Further, some beekeepers may place personal value on not losing a colony,
colony, because effects on growth, short-term survival or reproduction
and for them, their expected benefit of treatment may be higher still.
are readily measured (see the BEEBOOK paper on measuring colony
These data are more difficult to collect, and will likely vary greatly
strength parameters (Delaplane et al., 2013)). In principle, it is
from producer to producer. Nonetheless, giving beekeepers an
possible to estimate the impact of the disease on the population’s
estimate of the net benefit of treatment should allow them to
dynamics by using demographic models that quantify the effect on
compare the pure monetary costs and benefits to any other
population growth (Varley et al., 1973).
idiosyncratic costs of colony loss and help them in their management decisions.
4. Inferring causal relationships
There are some cases, however, that are problematic for two reasons. First, the symptom is itself a population-level attribute; for instance, a general population decline. Second, the normal procedure is reversed because the causal agent is already identified, albeit as a
using Hill’s Criteria
hypothesis. An example is the supposed role of trace dietary
To diagnose the cause of a disease in honey bees, scientists typically
asked whether dietary exposure to the pesticide is capable of causing
compare observed symptoms with a list of exposures in colonies that
the observed population decline. Studying impacts at the population
implicate a particular pathogen, toxin or other detrimental aspect of
level by experiments with replicated comparisons presents a severe
the environment. Confirming the cause of the particular instance of
logistical challenge because the required manipulations are at the
these symptoms is relatively straightforward – the scientist either
landscape scale. Some alternative tools are available, such as the
tests for the presence of the diagnosed causal agent itself or removes
classic ‘life table’ method of insect population ecology (Varley et al.,
it and checks for amelioration of the symptoms. These approaches
1973), but these can be applied only if detailed census data are
are feasible when the symptoms occur at the level of the individual or
available that precisely identify causes of death over extended time
pesticides in causing honey bee declines. In this case, scientists are
The COLOSS BEEBOOK: epidemiological methods
14
periods. Where such resorts are stymied, scientists must use the
Table 4. The nine criteria established by Hill (1965), each with a brief
available circumstantial evidence to pass an expert judgement. Hill’s
description.
criteria (Hill, 1965) provide a valuable framework that supports a repeatable and quantitative evaluation process. Sir Austin Bradford Hill, a leading 20th century epidemiologist, identified nine types of information that provide ‘viewpoints’ from
Criterion
Brief description
1. Experimental evidence Fails to contradict established 2. Coherence
knowledge
nine criteria include not only experimental evidence, but also eight
3. Plausibility
Probable given established knowledge
kinds of circumstantial evidence that fall into two categories (Table 4).
4. Analogy
Similar examples known
5. Temporality
Cause precedes effect
6. Consistency
Cause is widely associated with effect
7. Specificity
Cause is uniquely associated with effect
8. Biological gradient
Monotonic dose-response relationship Cause is associated with a substantive
9. Strength
effect
which to judge a proposed cause-effect relationship (Hill, 1965). The
For each criterion, scientists survey the available evidence and then formally describe the level of conviction with which they subsequently hold the proposed cause-effect hypothesis to be true: slight; reasonable; substantial; clear; and certain (Weiss, 2006). The descriptors are then associated with numerical values to produce a quantitative score of certainty (Cresswell et al., 2012). Specifically, an eleven-point scale for each criterion returns a positive value (maximum five) if the evidence suggests that the agent certainly causes population decline, a negative value (maximum minus five) if the factor certainly does not and a zero if the evidence is equivocal or lacking. For example, if the evidence for a criterion gives a reasonable indication that an agent does not cause the symptom, the score for that criterion would be -2, etc. One major value of the criteria is that they disaggregate the different kinds of evidence, requiring the scientist to consider each kind carefully, separately and explicitly. Once the scores are given, there is no a priori reason either to give equal weight to the nine
5. Conclusions The general aim of all scientists studying honey bee health is the same; preservation of the bees. However, without common methods and shared terminology, it is difficult to confidently compare reported results. In an effort to standardize the efforts of those interested in improving honey bee health and make studies comparable, we have introduced epidemiological terminology, experimental design, and methods of calculation that are often different enough to preclude comparisons between studies.
criteria or to calculate an average score. It is important, moreover, to consider whether any large scores have arisen principally on the theoretical criteria, because it is conventional in science to favour
6. References
material evidence (i.e. associational criteria) over conjecture. For
ANDERSON, D (2013) Standard methods for Tropilaelaps mites
example, an evaluation by Hill’s criteria (Cresswell et al., 2012)
research. In V Dietemann; J D Ellis; P Neumann (Eds) The
revealed that the proposition that dietary pesticides cause honey bee
COLOSS BEEBOOK, Volume II: standard methods for Apis
declines was a substantially justified conjecture in the context of
mellifera pest and pathogen research. Journal of Apicultural
current knowledge (positive scores on the theoretical criteria), but was substantially contraindicated by a wide variety of circumstantial
Research 52(2): http://dx.doi.org/10.3896/IBRA.1.52.2.21 BREIMAN, I; FRIEDMAN, J H; OLSEN, R A; STONE, C J (1984)
evidence (negative scores on the associational criteria). The disparity
Classification and regression trees. Wadsworth; Pacific Growe, CA,
in the scores on the two categories of criteria explains in part the
USA. 358 pp.
controversy over this question, because different constituencies make
CRESSWELL, J E; DESNEUX, N; VANENGELSDORP, D (2012) Dietary
differential use of the two kinds of evidence. Hill (1965) himself
traces of neonicotinoid pesticides as a cause of population
refused to weight the criteria because the evaluation of circumstantial
declines in honey bees: an evaluation by Hill's epidemiological
evidence cannot be made algorithmic.
criteria. Pest Management Science: 68: 819-827.
The use of Hill’s criteria formalizes the evaluation of causeconsequence associations and applies a quantitative scoring method
http://dx.doi.org/10.1002/ps.3290 DAINAT, B; VANENGELSDORP, D; NEUMANN, P (2012) Colony
which makes the conclusions both apparent and repeatable. Since
Collapse Disorder in Europe. Environmental Microbiology Reports
their inception over 40 years ago and subsequent widespread use, no
4: 123-125. http://dx.doi.org/10.1111/j.1758-2229.2011.00312.x
criterion has been abandoned and none added, which means that
DE GRAAF, D C; ALIPPI, A M; ANTÚNEZ, K; ARONSTEIN, K A; BUDGE,
they provide a stable and well-established infrastructure in which to
G; DE KOKER, D; DE SMET, L; DINGMAN, D W; EVANS, J D;
process scientific evidence.
FOSTER, L J; FÜNFHAUS, A; GARCIA-GONZALEZ, E; GREGORC, A; HUMAN, H; MURRAY, K D; NGUYEN, B K; POPPINGA, L; SPIVAK,
vanEnglesdorp et al.
15
M; VANENGELSDORP, D; WILKINS, S; GENERSCH, E (2013) Standard methods for American foulbrood research. In V
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
American Bee Journal 14: 34. KOEPSELL, T D; WEISS, N S (2003) Epidemiologic methods: studying
the occurrence of illness. Oxford University Press; New York, USA.
Volume II: standard methods for Apis mellifera pest and pathogen MAUSNER, J S; KRAMER, S (1985) Epidemiology: an introductory text. research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.11 DELAPLANE, K S; VAN DER STEEN, J; GUZMAN, E (2013) Standard methods for estimating strength parameters of Apis mellifera colonies. In V Dietemann; J D Ellis; P Neumann (Eds) The
W B Saunders Company; Philadelphia, USA. 361 NUTTER, F W Jr (1999) Understanding the interrelationships between botanical, human, and veterinary epidemiology: the Ys and Rs of it all. Ecosystems Health 5: 131-140. PAOLI, B; HAGGARD, L; SHAH, G (2002.) Confidence intervals in
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
public health. Office of Public Health Assessment, Utah
research. Journal of Apicultural Research 52(1):
Department of Health, USA. p 8.
http://dx.doi.org/10.3896/IBRA.1.52.1.03 ESTOUP, A; SOLIGNAC, M; CORNUET, J-M (1994) Precise assessment
SAEGERMAN, C ; SPEYBROECK, N ; ROELS, S; VANOPDENBOSCH, E ; THIRY, E ; BERKVENS, D (2004) Decision support tools for clinical
of the number of patrilines and of genetic relatedness in honey
diagnosis of disease in cows with suspected bovine spongiform
bee colonies. Proceedings of the Royal Society of London B,
encephalopathy. Journal of Clinical Microbiology 42: 172-178.
Biological Sciences 258: 1-7.
http://dx.doi.org/10.1128/JCM.42.1.172-178.2004
FOSGATE, G T (2009) Practical sample size calculations for
SAEGERMAN, C; PORTER, S R; HUMBLET, M F (2011) The use of
surveillance and diagnostic investigations. Journal of Veterinary
modelling to evaluate and adapt strategies for animal disease
Diagnostic Investigation 21: 3-14.
control. Revue Scientifique et Technique - Office International des
http://dx.doi.org/10.1177/104063870902100102
Épizooties 30: 555-569.
GARDNER, M J; ALTMAN, D G (1986) Confidence intervals rather than SPEYBROECK, N; BERKVENS, D; MFOUKOU-NTSAKALA, A; AERTS, M; P values: estimation rather than hypothesis testing. British Medical
HENS, N; HUYLENBROECK, G V; THYS, E (2004) Classification
Journal 292: 746-750.
trees versus multinomial models in the analysis of urban farming
GENERSCH, E; VON DER OHE, W; KAATZ, H H; SCHROEDER, A; OTTEN, C; BERG, S; RITTER, W; GISDER, S; MEIXNER, M;
systems in Central Africa. Agricultural Systems 80: 133-149. http://dx.doi.org/10.1016/j.agsy.2003.06.006
LIEBIG, G; ROSENKRANZ, P (2010) The German bee monitoring
TOMA, B; BENET, J-J ; DUFOUR, B ; ELOIT, M ; MOUTOU, F ; SANAA,
project: a long term study to understand periodically high winter
M (1991) Glossaire d'épidémiologie animale. Editions du Point
losses of honey bee colonies. Apidologie 41: 332-352. http://dx.doi.org/10.1051/apido/2010014 GIRAY, T; GUZMAN NOVOA, E; ARON, C W; ZELINSKY, B;
Vétérinaire ; Maisons-Alfort, France. 365 pp. VANENGELSDORP, D; CARON, D; HAYES, J Jr; UNDERWOOD, R; HENSON, K R M; SPLEEN, A; ANDREE, M; SNYDER, R; LEE, K;
FAHRBACH, S E; ROBINSON, G E (2000) Genetic variation in
ROCCASECCA, K; WILSON, M; WILKES, J; LENGERICH, E;
worker temporal polyethism and colony defensiveness in the
PETTIS, J (2012) A national survey of managed honey bee 2010-
honey bee, Apis mellifera. Behavioural Ecology 11(1): 44-55.
11 winter colony losses in the USA: results from the Bee Informed
http://dx.doi.org/10.1093/beheco/11.1.44
Partnership. Journal of Apicultural Research 51: 115-124.
GISDER, S; HEDTKE, K; MÖCKEL, N; FRIELITZ, M C; LINDE, A; GENERSCH, E (2010) Five-year cohort study of Nosema spp. in
http://dx.doi.org/10.3896/IBRA.1.51.1.14 VANENGELSDORP, D; EVANS, J D; SAEGERMAN, C; MULLIN, C;
Germany: does climate shape virulence and assertiveness of
HAUBRUGE, E; NGUYEN, B K; FRAZIER, M; FRAZIER, J; COX-
Nosema ceranae? Applied and Environmental Microbiology 76:
FOSTER, D; CHEN, Y; UNDERWOOD, R; TARPY, D R; PETTIS, J S
3032-3038. http://dx.doi.org/10.1128/AEM.03097-09
(2009b) Colony Collapse Disorder: A descriptive study. PloS ONE
HENDRIKX, P ; CHAUZAT, M-P ; DEBIN, M ; NEUMAN, P ; FRIES, I ; RITTER, W ; BROWN, M ; MUTINELLI, F ; LE CONTE, Y ;
4: e6481. (available at: http://www.plosone.org/article/ info:doi/10.1371/journal.pone.0006481)
GREGORC, A (2009) Bee mortality and bee surveillance in Europe. VANENGELSDORP, D; EVANS, J D; DONOVALL, L; MULLIN, C; Scientific report, European Food Safety Authority, Parma, Italy,
FRAZIER, M; FRAZIER, J; TARPY, D R; HAYES, J Jr; PETTIS, J S
pp. 217 (available at http://www.efsa.europa.eu/en/scdocs/
(2009a). "Entombed Pollen": a new condition in honey bee
doc/27e.pdf)
colonies associated with increased risk of colony mortality. Journal
HILL, A B (1965) The environment and disease: association or causation? Proceedings of the Royal Society of Medicine 58: 295300. HOLST, E C (1945) A simple field test for American foulbrood.
of Invertebrate Pathology 101: 147-149. http://dx.doi.org/10.1016/j.jip.2009.03.008 VANENGELSDORP, D; SPEYBROECK, N; EVANS, J D; NGUYEN, B K; MULLIN, C; FRAZIER, M; FRAZIER, J; COX-FOSTER, D; CHEN, Y;
The COLOSS BEEBOOK: epidemiological methods
TARPY, D R; HAUBRUGE, E; PETTIS, J S; SAEGERMAN, C (2010)
16
VANENGELSDORP, D; TARPY, D R; LENGERICH, E J; PETTIS, J S
Weighing risk factors associated with bee Colony Collapse
(2013) Idiopathic brood disease syndrome and queen events as
Disorder by classification and regression tree analysis. Journal of
precursors of colony mortality in migratory beekeeping operations
Economic Entomology 103: 1517-1523. (available at: http://
in the eastern United States. Preventive Veterinary Medicine. (in
www.bioone.org/doi/pdf/10.1603/EC09429)
press).
VANENGELSDORP, D; BRODSCHNEIDER, R; BROSTAUX, Y; VAN DER ZEE, R; PISA, L; UNDERWOOD, R; LENGERICH, E J; SPLEEN, A; NEUMANN, P; WILKINS, S; BUDGE, G E; PIETRAVALLE, S; ALLIER, F; VALLON, J; HUMAN, H; MUZ, M; LE CONTE, Y; CARON, D; BAYLIS, K; HAUBRUGE, E; PERNAL, S; MELATHOPOULOS, A; SAEGERMAN, C; PETTIS, J S; NGUYEN, B K (2011) Calculating and reporting managed honey bee colony losses. In D Sammataro; J A Yoder (Eds). Honey bee colony
health: challenges and sustainable solutions. CRC Press; FL, USA. pp. 237-244 VANENGELSDORP, D; SAEGERMAN, C; NGUYEN, K B; PETTIS J S (2013) Honey bee health surveillance. In W Ritter (Ed.). OIE
Technical Series no 12: The vet and the bee. OIE. (in press).
VARLEY, G C; GRADWELL, G R; HASSELL, M P (1973) Insect
population ecology. Blackwell Scientific Publications; Oxford, UK. WEISS, N S (2006) Clinical epidemiology: the study of the outcome of
illness (Third edition). Oxford University Press; UK. 178 pp WORLD HEALTH ORGANISATION (WHO) (1999) Norms and standards in epidemiology: case definitions. Epidemiological Bulletin 20. WOODWARD, M (2005) Epidemiology. Study design and data
analysis. Chapman & Hall; New York, USA.
Journal of Apicultural Research 52(4): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.4.18
REVIEW ARTICLE
Standard survey methods for estimating colony losses and explanatory risk factors in Apis mellifera Romée van der Zee1*, Alison Gray2, Céline Holzmann3, Lennard Pisa1, Robert Brodschneider4, Róbert Chlebo5, Mary F Coffey6, Aykut Kence7, Preben Kristiansen8, Franco Mutinelli9, Bach Kim Nguyen10, Adjlane Noureddine11, Magnus Peterson12, Victoria Soroker13, Grażyna Topolska14, Flemming Vejsnæs15 and Selwyn Wilkins16 1
Netherlands Centre for Bee Research, Durk Dijkstrastr. 10, 9014 CC, Tersoal, Netherlands. University of Strathclyde, Department of Mathematics and Statistics, Glasgow, G1 1XH, UK. 3 Formerly at Institut Technique et Scientifique de l’ Apiculture et de la Pollinisation, Institut de l’ abeille, 75595 Paris, France. 4 Department of Zoology, Karl-Franzens University Graz, Universitätsplatz 2, A-8010 Graz, Austria. 5 Slovak University of Agriculture, Department of Poultry Science and Small Animals Husbandry, Tr. A. Hlinku 2, 94976 Nitra, Slovakia. 6 Department of Life Sciences, University of Limerick, Limerick, Ireland. 7 Middle East Technical University, Department of Biology, 06800, Ankara, Turkey. 8 Swedish Beekeepers Association, Trumpetarev 5, SE-59019 Mantorp, Sweden. 9 Istituto Zooprofilattico Sperimentale delle Venezie, National Reference Laboratory for Beekeeping, Viale dell’Universita’ 10,35020 Legnaro (PD), Italy. 10 University of Liege, Gembloux Agro-Bio Tech, Department of Functional and Evolutionary Entomology, B-5030 Gembloux, Belgium. 11 Departement of Biology, University of Boumerdes, Algeria. 12 Scottish Beekeepers Association, 20, Lennox Road, Edinburgh, EH5 3JW, UK. 13 Agricultural Research Organization The Volcani Center, 50250 PO Box 6, Bet Dagan, Israel. 14 Warsaw University of Life Sciences, Faculty of Veterinary Medicine, Ciszewskiego 8, 02-786 Warsaw, Poland. 15 Danish Beekeepers Association, Fulbyvej, DK-4140 Sorø, Denmark. 16 National Bee Unit, Food and Environment Research Agency, Sand Hutton, York, YO41 1LZ, UK. 2
Received 15th June 2012, accepted subject to revision 18 December 2012, accepted for publication 3 June 2013. *Corresponding author: Email: romee.van.der.zee@beemonitoring.org
Summary This chapter addresses survey methodology and questionnaire design for the collection of data pertaining to estimation of honey bee colony loss rates and identification of risk factors for colony loss. Sources of error in surveys are described. Advantages and disadvantages of different random and non-random sampling strategies and different modes of data collection are presented to enable the researcher to make an informed choice. We discuss survey and questionnaire methodology in some detail, for the purpose of raising awareness of issues to be considered during the survey design stage in order to minimise error and bias in the results. Aspects of survey design are illustrated using surveys in Scotland. Part of a standardized questionnaire is given as a further example, developed by the COLOSS working group for Monitoring and Diagnosis. Approaches to data analysis are described, focussing on estimation of loss rates. Dutch monitoring data from 2012 were used for an example of a statistical analysis with the public domain R software. We demonstrate the estimation of the overall proportion of losses and corresponding confidence interval using a quasi-binomial model to account for extra-binomial variation. We also illustrate generalized linear model fitting when incorporating a single risk factor, and derivation of relevant confidence intervals.
Footnote: Please cite this paper as: VAN DER ZEE, R; GRAY, A; HOLZMANN, C; PISA, L; BRODSCHNEIDER, R; CHLEBO, R; COFFEY, M F; KENCE, A; KRISTIANSEN, P; MUTINELLI, F; NGUYEN, B K; ADJLANE, N; PETERSON, M; SOROKER, V; TOPOLSKA, G; VEJSNÆS, F; WILKINS, S (2012) Standard survey methods for estimating colony losses and explanatory risk factors in Apis mellifera. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume I: Standard methods for Apis mellifera research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.18
2
van der Zee et al.
Métodos estándar de encuestas para la estimación de la pérdida de colonias y los factores de riesgo que los explican en
Apis mellifera Resumen Este capítulo trata sobre la metodología de encuestas y el diseño del cuestionario para la recogida de datos relativos a la estimación de las tasas de pérdida de colonias de abejas de la miel y la identificación de los factores de riesgo de la pérdida de colonias. Se describen las fuentes de error en las encuestas. Se presentan las ventajas y desventajas de las diferentes estrategias de muestreo aleatorio y no aleatorio y diferentes modos de recogida de datos que permitan al investigador tomar una decisión informada. Discutimos sobre la metodología de las encuestas y los cuestionarios con cierto detalle, con el propósito de dar a conocer las cuestiones a tener en cuenta durante la fase de diseño de la encuesta con el fin de minimizar el error y el sesgo en los resultados. Se ilustran aspectos de la encuesta que a través de encuestas realizadas en Escocia. Se da como ejemplo parte de un cuestionario estandarizado, desarrollado por el grupo de trabajo COLOSS de Monitoreo y Diagnóstico. Se describen enfoques para el análisis de datos, centrándose en la estimación de las tasas de pérdida. Se utilizaron datos de un monitoreo holandés de 2012 como ejemplo de análisis estadístico con el software de dominio público R. Demostramos la estimación de la proporción total de las pérdidas y el intervalo de confianza correspondiente usando un modelo cuasi-binomial para dar cuenta de la variación extra-binomial. También ilustramos ajustes del modelo lineal generalizado al incorporar un solo factor de riesgo, y la derivación de los intervalos de confianza correspondientes.
西方蜜蜂估测蜂群损失和风险因子的标准调查方法 摘要 本章针对为估测蜂群损失率和鉴定蜂群损失相关风险因子采集数据时所需的调查方法和问卷设计。描述了调查中的误差来源,介绍了不同的随 机或非随机取样方法和不同数据采集模式的利弊,以供研究者做出合理选择。为提高对于在调查设计阶段需要考虑的问题的认识,使结果中的 误差和偏差最小化,我们在一些细节上进一步讨论了调查和问卷的方法学。调查设计部分以在苏格兰的调查为例说明,并以由 COLOSS 工作组 开发的用于监测和诊断的标准化问卷的一部分作为另一个例子进一步说明。描述了针对估测损失率的数据分析方法。以荷兰 2012 年的监测数据 为例,使用公共领域 R 软件,介绍统计分析方法。我们使用类似二项式模型解释额外二项式变化,示范了总体损失比例及相应置信区间的估算 方法。同时,我们举例说明了当合并单一风险因素时广义线性模型的拟合,以及相关置信区间的推导
Keywords: COLOSS BEEBOOK, estimating colony losses, Apis mellifera, surveys, questionnaire, random / randomized sampling, non-random sampling, generalized linear models (GZLMs)
The COLOSS BEEBOOK: survey methods
Table of Contents
3
Page No.
Page No.
1.
Introduction
3 6.1.4.
Non-random methods
14
2.
Objectives and case definitions
5 6.2.
Need for and use of a sampling frame in random sampling
15
2.1.
Objective of epidemiological studies on honey bee colony losses
5 6.3.
Availability of a sampling frame
15
2.2.
Application of definitions associated with honey bee colony losses
6 6.4.
Sources of sampling frames appropriate for different target populations
15
2.3.
Case definitions
6 7.
Questionnaire design
16
3.
Data collection methods
6 7.1.
Completeness of the questionnaire
16
3.1.
Choosing the method of data collection
6 7.2.
Appropriate designs for different sampling methods
16
3.2.
Available data collection methods with advantages and disadvantages
7 7.3.
Common problems to avoid in questionnaire design
16
3.2.1.
Surveyor administered questionnaires
7 7.3.1.
Ambiguity of interpretation
17
3.2.1.1.
Face-to-face interviews
7 7.3.2.
Loaded questions
17
3.2.1.2.
Telephone interviews
7 7.3.3.
Questions on sensitive issues
17
3.2.2.
Self-Administered questionnaires
7 7.4.
Questionnaire design for minimisation of measurement error and ease of analysis.
17
3.2.2.1.
Postal or email survey
7 7.5.
Need to limit data sought, for a high response rate and accurate measurement
18
3.2.2.2.
Internet survey
7 7.6.
Problems of multi-lingual/multi-cultural questionnaires
18
3.2.2.3.
Questionnaire published in beekeeping journals
8 7.7.
Testing survey questions: importance of pilot studies
19
3.2.2.4.
Questionnaires disseminated during meetings
8 7.8.
Example of a standardized questionnaire on colony losses
19
3.3.
Data validity and accuracy
8 8.
Response rates
19
4.
Quality issues in surveys
8 8.1.
Use of incentives and reminders to improve response rates
19
4.1.
Errors
8 9.
Choice of sample size
20
4.1.1.
Coverage error
8 10.
Analysis of survey data
22
4.1.2.
Sampling error
9 10.1.
Assessing data quality
22
4.1.3.
Measurement error
9 10.1.1.
Dealing with missing data
22
4.1.4.
Non-response error
9 10.2.
The use of weighting in statistical analysis
23
4.1.5.
Errors caused by selection bias
9 10.3.
Elementary analysis
23
4.1.6.
Processing errors
9 10.3.1.
Descriptive analysis
23
4.2.
Effort and costs in data accumulation
10 10.3.2.
Loss calculations and confidence intervals
24
4.3.
Issues of anonymity and ethical approval
10 10.3.3.
Loss rate per factor including stratification on the operation size
25
5.
Coverage
11 10.4.
Advanced analysis, identification of risk factors by logistic regression
25
5.1.
Effective coverage
11 10.4.1.
Logistic regression
25
5.2.
Potential bias of the survey sample
11 10.4.2.
Dispersion in statistical models
26
5.3.
Identifying the target population
12 10.4.3.
Multilevel analysis
26
6.
Sampling
12 10.4.4.
Software for logistic models
26
6.1.
Random and non-random sample selection methods
12 10.4.5.
Example of advanced analysis
27
6.1.1.
A census
13 11.
Conclusions
33
6.1.2.
Random sampling
13 12.
Acknowledgements
33
6.1.3.
Recommended approach for random sampling
14 13.
References
33
Online Supplementary Material. Useful resources for survey design
35
1. Introduction
questionnaires for use in surveys, a network of honey bee specialists
Surveys on honey bee colony losses have been conducted by many
by Cost Action FA0803, established at its first meeting a working
researchers over the years to understand the factors that contribute
group (Working Group 1 - WG1) whose aim was to develop and
to colony losses. Recognizing the importance of standard
implement research surveys for the purpose of identifying such
preceding the establishment of the COLOSS Action network, initiated
van der Zee et al.
4
factors. The working group currently represents a global network of
frames in situations where cooperation with a beekeeper association
scientists who monitor colony losses. This group was conscious of the
is not possible or if a beekeeper infrastructure is absent (section 6.4.).
fragility of many survey results and addressed crucial issues to obtain a valid research framework (Van der Zee et al., 2012). Using other
The sample selection method used is one of the main issues for obtaining reliable survey outcomes. Selecting a random sample of
literature sources, the group developed and/or recognized appropriate beekeepers gives results whose accuracy can be quantified (section 6.1.), case definitions, statistics and relevant factors associated with honey
if, as is usually the case, studying the whole target population instead
bee colony losses. The present manuscript aims to make the results of of a sample is not feasible. At present most monitoring surveys with these efforts available to all researchers working in this field and to
questionnaires will gain in quality if the shift is made from the present
provide guidelines for conducting effective surveys.
common practices of self-selected samples (samples in which
Conditions in which to perform surveys on honey bee colony
participants volunteer to take part) towards at least simple random
losses and achieve results which meet methodological standards are
sampling. The same or better survey results may be achieved by
very different between and within countries. The present chapter
using other more sophisticated forms of probability sampling, and
offers guidelines to attain good quality surveys, even under
relatively small sample sizes might then be sufficient.
unfavourable conditions. The main objective of these surveys (section
Detailed consideration will also be given to the various sources of
2.1.) is the estimation of winter colony loss rates, identification of
bias which may affect survey outcomes (De Leeuw et al., 2008),
specific areas with a higher or lower risk of honey bee mortality and
whose effect will usually be to introduce errors into results whose
information on possible determinants such as the control of Varroa
effects are difficult or impossible to assess. In particular, it is good
destructor. This will enable the provision of advice on loss prevention
practice to strive for high response rates, although there is no
and control.
empirical support for the notion that low response rates necessarily
We are conscious that the case definitions we present (section 2.3.) may be refined or changed in the following years because not
produce estimates with high nonresponse bias (Groves, 2006). However that risk is inevitably present if response rates are low.
enough knowledge is yet available to resolve many important issues.
Attention is given here to a variety of methods of statistical data
However what we present here does, in our view, give a good set of
analysis. These range from simple analyses to examine the effects of
standards to which all researchers in this field should aim to conform
different Varroa controls or other individual risk factors on mortality,
in order to produce robust and reliable results.
to more advanced methods involving the use of Generalized Linear
The target population of the surveys is usually the set of active
Models (GZLMs) to investigate simultaneously the possible effects of
beekeepers in a country or specific area. The possibilities for reaching
multiple different factors on colony loss rates. We use the statistical
the target population vary between and within countries. Sometimes
program R to illustrate an analysis in section 10, using data from the
registers of beekeepers can be used for collecting data; but more
Netherlands. Survey design and sampling methodology is illustrated
often, cooperation with beekeepers’ associations is necessary (section
throughout the manuscript using Scotland as a case study. An
5.). In some situations, both are absent and the investigator has to
introduction to this is provided in Box 1.
develop other survey strategies. Suggestions are given for sampling
Box 1. Introduction to the example of surveys of beekeepers in Scotland. Throughout this chapter we illustrate some of the methodology and concepts using as an example surveys of beekeepers in Scotland. These surveys are not perfect in the way they have been conducted, but most of them have used random sampling and we describe how this was achieved. They provide a case study, for those who may be interested, of how random sampling can be done in a situation where reasonably good records of beekeepers are available for use as a sampling frame. It is recognised that this approach is not possible in all situations. We describe the sampling design, the use of records for sample selection, obtaining permission for use of records, maintaining anonymity etc. These surveys have run since 2006. They have all used as the survey population members of the Scottish Beekeepers’ Association (SBA), the national body for beekeepers in Scotland. Persons keeping any number of honey bee colonies, or with no bees but having an interest in bees, can belong to this organisation. Affiliated with the SBA are a large number of local associations for beekeepers. It is possible to belong to one or more local associations as well as, or instead of, the SBA. The first survey used a quota sampling approach, as permission had not at that time been sought for using the membership records of the SBA for sampling purposes (see section 6. and box 5), and made use of SBA representatives to identify beekeepers to include in the sample. Subsequent surveys have used a stratified random sampling approach, by dividing the membership into those belonging to each of several large administrative areas and taking a separate random sample from each of those identified groups of SBA members using the membership records (see section 6.). As these administrative areas are geographical, this approach was chosen to try to ensure coverage of the different geographical areas, since conditions for beekeeping vary across the country. In particular, the more remote parts of the north and west of Scotland are thought to be free of Varroa destructor. Weather patterns also vary geographically. All of the surveys from 2006 to 2012 have been conducted using a postal questionnaire.
The COLOSS BEEBOOK: survey methods
5
Fig. 1. A basic flowchart of the key steps in carrying out a survey.
2. Objectives and case definitions Fig. 1 shows the steps to be addressed in designing a survey. We address each of these in the sections below.
2.1. Objective of epidemiological studies on
the spatial distribution of honey bee colony losses at the operation, apiary or colony level. This enables the formulation of good advice on prevention and control of colony stressors. In this section, we propose standardized case definitions to facilitate various objectives as follows: 1. Reporting and classification of cases of honey bee colony losses by national and international honey bee experts.
honey bee colony losses
2. Standardization of language for communication purposes.
The epidemiological study of honey bee colony losses aims to
3. Comparability of data across time and geographical areas.
determine explanatory factors for, and to monitor the magnitude and
van der Zee et al.
6
2.2. Application of definitions associated with honey bee colony loss 1. The case definitions for use in surveillance are based on
b. a noticeable lack of dead worker bees both within and surrounding the hive (vanEngelsdorp et al., 2009); c.
(Neumann et al., 2013) and wax moths (Ellis et al., 2013))
available epidemiological data summarizing what is currently
into affected colonies and kleptoparasitism of affected
known about the magnitude and spatial distribution of honey bee colony losses. Countries may need to adapt case definitions depending on their own situation. 2. The case definitions have been developed to help national authorities classify and track cases. 3. The case definitions are not intended to provide complete descriptions of the symptomatology of lost colonies but rather
colonies by neighbouring colonies (Cox-Foster et al., 2007); d. the absence of Varroa and Nosema at levels thought to cause economic damage (vanEngelsdorp et al., 2009). 5. Time frames during which honey bee colony losses occurred can be distinguished as: a. Time frames related to seasonal characteristics: For example winter: the period between the moment that
to standardize reporting of these losses.
a beekeeper finished pre-winter preparations for his/her
4. The case definitions will describe the symptoms of dwindling
honey bee colonies and the start of the new foraging
and lost colonies and the timeframe of observation during which honey bee colony losses occurred.
the delayed invasion of hive pests (e.g., small hive beetles
season. b. Fixed time frames: For example: observations every half year.
2.3. Case definitions 1. Lost honey bee colony is a honey bee colony that: a. is reduced to such a small number of bees that it cannot
It is difficult to come to conclusions on losses with a fixed timeframe approach since the outcome depends on beekeeper practices such as merging, splitting, buying and selling of colonies. Recalling the
perform the normal biological activities needed for survival numbers of colonies involved in these practices later when a (brood rearing, resource gathering) or b. has queen problems, such as drone laying queens or
c.
questionnaire is disseminated may easily lead to errors in the data (Van der Zee et al., 2012). Another problem is that no information is
drone laying worker bees in absence of a queen, which
collected on when these increases/reductions were made within the
could not be solved or
timeframe, with the effect that colonies bought at the start of a time
was missing due to burglary, or didn’t survive fire,
frame have the same weight in the risk estimation as colonies bought
inundation, desert storms or similar causes unrelated to
later on. Not recognising these problems may severely bias the
health problems.
outcome.
d. no longer has any living bees present. 2. Weak honey bee colony: A honey bee colony that is not considered as lost, but in which the number of bees is less than would be expected from the colony
3. Data collection methods
size observed at an earlier inspection.
3.1. Choosing the method of data collection
3. Colony Depopulation Syndrome (CDS):
When choosing the mode of data collection, a number of issues must
This is observed if a honey bee colony shows the following conditions
be considered: effective coverage of target populations, data
within a certain time-frame:
accuracy, potential bias of the survey sample, the survey mode(s),
a. reduced to no, or only a few remaining, living bees in the hive and b. no, or only a few dead bees in or in front of the hive or at c.
and the effort and cost of data collection (De Leeuw, 2008; Charrière and Neumann, 2010; Dahle, 2010; Hatjina et al., 2010; Mutinelli et al., 2010; Nguyen et al., 2010). In a survey, the data can be collected by
the apiary while
direct contact of an interviewer with the respondent (face-to-face
food is present in the hive (Van der Zee et al., 2012).
interviews, telephone interviews) or the questions can be
4. Colony Collapse Disorder (CCD) This is observed if the following conditions are present: a. a rapid loss of adult worker bees from affected honey bee
administered and answered by beekeepers without the assistance of an interviewer by means of a self-administered questionnaire (postal surveys, email surveys, internet surveys). The advantages and
colonies, as evidenced by weak or dead colonies with
disadvantages of each mode are described in section 3.2. Further
excess brood populations present relative to adult bee
references are given in the online supplementary material.
populations (vanEngelsdorp et al., 2009);
The COLOSS BEEBOOK: survey methods
3.2. Available data collection methods with advantages and disadvantages 3.2.1. Surveyor administered questionnaires
3.2.1.1. Face-to-face interviews Pros:
7
3.2.2. Self-Administered questionnaires
3.2.2.1. Postal or email survey Beekeepers receive a questionnaire by mail (or email), answer the questions and return the questionnaire.
Pros: The interviewer can explain the importance of a survey and
clarify questions if needed.
The data can often be entered directly into the computer
Beekeepers have time to check their apiary notes and to answer the questions fully.
database and checked for a valid data entry, question by
Quick distribution of questionnaires for survey organisers and quick return (if emailed).
question.
Answers can easily be corrected in situ. It may become apparent immediately that some answers are inconsistent or
Cons:
A good (complete) list of addresses (email addresses) of the
wrong, especially if suitable data checks are built into a
target population of beekeepers is needed. Limited access of
computer questionnaire programme.
beekeepers to the internet can very badly influence the survey coverage if only an email survey is performed.
Cons:
A representative list of beekeepers is needed; there are few
Especially clear questions and instructions are necessary.
Beekeepers are not always actively involved and very often
countries in which it would be available through beekeeping
they do not respond. Free return postage raises the costs for
associations, census registers or the veterinary services.
postal surveys but also beekeepers’ participation in the
The presence of an interviewer may influence the answers,
survey.
unless the interviewer is well-trained.
This method is time-consuming and costly because of: travel costs (unless some form of cluster sampling is used), the
rate.
need for many highly trained interviewers, and the need for multiple call-backs to ensure a high response rate.
Reminders are likely to be necessary for a good response The questionnaires may be filled in carelessly with answers missing.
The time for and cost of data entry can be high, unless the sample is very small.
3.2.1.2. Telephone interviews Pros:
3.2.2.2. Internet survey The interviewer can explain the importance of a survey and
Beekeepers complete a questionnaire hosted on the internet. The
clarify the questions if needed.
same questionnaire could be hosted or linked on different websites,
Beekeepers may feel obliged to participate in the survey,
e.g. research institutes, reference laboratories, beekeepers’
though others may simply say they do not have time to
associations or beekeeping journals. There are several approaches to
participate. The data can often be entered directly into the
the calculation of response rates for internet surveys (AAPOR, 2011).
computer database, as above.
The response rate for an online survey is often comparable with the
Lower costs than face-to-face interviews and call-backs are
response to a questionnaire published in a beekeeper journal, if the
much faster and easier.
invitation to participate in an online survey is published on the website
Many interviews can be completed in a relatively short time.
of a beekeepers’ association.
Pros: Cons:
in a very short time.
A representative list of telephone numbers of the target population of beekeepers is needed; there are very few
Beekeepers under pressure may give the answer without
Low cost of data collection and reduced cost of data analysis.
careful consideration, and it is difficult to correct such
Beekeepers’ associations or beekeeping journals could
answers later.
There is no need for transferring data from paper questionnaires to an e-database.
countries where it would be available.
Large numbers of completed questionnaires can be collected
contribute to increasing the number of filled in questionnaires
Time necessary for some interviews may be longer than is necessary to answer the questions because some people tend to be garrulous, although other people will become impatient if the time required is long.
by advertising the survey.
Beekeepers have enough time to check their apiary notes and to answer the questions fully.
van der Zee et al.
8
Cons:
Cons: A list of email addresses of the target population of
beekeepers is needed to advise them of the survey or issue reminders.
leading to coverage problems.
Beekeepers with ready computer access may not be wholly representative of the general beekeeping population of In principle, a beekeeper could complete the survey more
The survey will cover beekeepers only from specific regions or associations.
interest, which can adversely affect the survey coverage.
Not all beekeepers attend beekeepers’ association meetings,
The questionnaires are often filled in carelessly with many answers missing.
The time for and cost of data entry can be high.
than once; however, there is a choice of a suitable survey software that makes it possible to prevent duplicate submissions.
3.3. Data validity and accuracy The use of unambiguous questions is critical. However, the clarity of
3.2.2.3. Questionnaire published in beekeeping journals
any international questionnaire may well be culturally dependent. In
Completed questionnaires are usually posted, faxed or emailed by
the absence of a face-to-face or telephone interviewer to conduct the
beekeepers.
survey, the questions could be misunderstood by a respondent though
Pros:
this may not be immediately obvious. This would reduce the validity
If a journal has a large circulation, the dissemination of a
or accuracy of the response to the question asked. In self-
questionnaire is widespread.
administered surveys, the respondent is the locus of control and can
Cost of questionnaire dissemination is low.
spend as much time as s/he wants to consult records to answer
Cost of data collection is low. Free return shipment raises the
detailed questions. Especially in telephone interviews, but also face-to
costs but also beekeepers’ participation in the survey.
-face, one may feel pressured to answer and not let the interviewer
Beekeepers have enough time to check their apiary notes and
wait and give an estimate instead of looking up the correct answer.
to answer the questions fully.
Multi-stage manual data entry, such as is often involved in the
Non-response can be estimated, if all beekeepers receive the
collection of data in electronic form from paper questionnaires,
journal for free because they are a member of a beekeeper
completed by individual beekeepers, and then read and entered by
association.
another individual later, is error-prone and needs careful checking.
Compared to disseminating copies of a questionnaire at
4. Quality issues in surveys
Cons:
beekeepers’ association meetings and encouragement to
respond by leaders of those associations, participation rates
4.1. Errors
are lower.
Any survey will be vulnerable to errors which may invalidate the
The survey will not cover non-readers of these journals, so its
extrapolation of the sample results to the target population. The most
representativeness may be limited to the readers of the
important sources of error are discussed in detail below. The aim in
journal.
each investigation must be to minimise the non-sampling errors, and
The questionnaires may be filled in carelessly with answers
to quantify as far as possible the (unavoidable) sampling error.
missing.
Therefore we describe these various sources of error in detail, as they
The time for and cost of data entry can be high.
should be borne in mind at the planning stage of the survey.
3.2.2.4. Questionnaires disseminated during meetings
4.1.1. Coverage error
Completed questionnaires can be collected immediately by the survey
Coverage error arises when the survey population listed in the
organiser or an association representative, or posted, faxed or
“sampling frame” – the list from which the sample selection is made
emailed by beekeepers.
(see section 6.2., usually of beekeepers in a particular country or
Pros:
region) – does not match well with the target population (the
An easy way to disseminate the questionnaires if co-operation population about whom an inference is to be made; usually the set of with the beekeeping association hosting the meeting is good.
all beekeepers in that country or region). The results of the survey will
The survey organiser can explain the importance of the
be seriously affected if those omitted from the sampling frame differ
survey and clarify the questions if needed.
in some respect relevant to the aims of the investigation (in size of
If beekeepers post the filled-in questionnaires by themselves
enterprise, for example, so that perhaps large commercial beekeepers
they have enough time to check their apiary notes and to
are not represented).
answer the questions fully.
The COLOSS BEEBOOK: survey methods
9
4.1.2. Sampling error
Keeping questions clear and simple can help to reduce the chance of
Sampling error is the error that occurs because a sample is taken
missing data. Emphasising the importance of the survey and
instead of examining the whole population (Lohr, 2010). A survey
explaining how the results will be used may increase the response
allows estimation of characteristics of variables (typically a population
rate. If the participant can appreciate that there is some benefit to
mean, sum, or proportion) concerning a whole population, on the
completing the survey, they will be more likely to take part. Use of
basis of a sample. Such an estimate is inevitably not the exact value
rewards and incentives can be useful to increase participation of
of the population quantity. The only way to obtain the exact value is
people selected already to take part in the survey.
to calculate it from the whole population, but this is rarely possible. If the sample has been randomly selected from the population,
Non-response bias occurs when there is something systematically different about participants who do not respond from those who do.
this error can be quantified by calculating the standard error
Trying to minimise non-response is therefore very important.
(standard deviation) of the estimate. This is an estimate of the
Reminders are useful in this regard. Non-response can in principle be
variation of the estimator used between different samples of the same estimated by randomly sampling some sample units after termination size selected from the same population. When a non-random sample
of the survey, approaching the non-respondents with another survey
is used, there is no appropriate analytical form for the standard error
mode and comparing the main outcome with the survey response on
(see any elementary textbook on survey sampling, e.g. Schaeffer et al., these sample units. However such an effort is rarely regarded as a 1990) and therefore the results of any such calculation should be
good use of scarce resources of time and money.
viewed with caution. This variation from sample to sample is usually presented by
4.1.5. Errors caused by selection bias
quoting a confidence interval for the estimate obtained from the
Selection bias should also be considered as a source of error.
sample. A confidence interval can only be reported if the sample is
Selecting an unrepresentative sample will lead to bias in the results.
representative for the population of interest. An example of the
Actively selecting a random sample rather than a self-selecting sample
calculation is given in Box 2.
who may well differ from those not included in the survey (volunteer
The sampling error can be reduced by increasing the size of the
bias), is the best way to avoid this. Using well-trained personnel will
sample. It is possible to calculate the optimum size of the sample for
avoid any haphazard substitution of properly selected participants
a satisfactory estimate at a given cost, depending on the chosen
with more conveniently available participants who had not been
confidence level or required precision or margin of error. Having some selected, which is another possible source of selection bias. approximate knowledge of the population quantities is needed for such a calculation of the sample size (see section 9.).
4.1.6. Processing errors These errors affect the data set. They can arise by errors caused by
4.1.3. Measurement errors
the person who records the data (mistyping, copy/paste errors,
Measurement error occurs when the recorded answer to a question
stretching cells in an Excel spread sheet etc.). If different people
deviates from the true answer. The risk of such error is increased by
capture the data, harmonisation of notation and careful procedures
an imprecise or wrongly formulated question. These errors can also
for recording data should be in place, checks should be made, and
occur in face to face surveys, if the interviewer influences the
personnel should be well-trained and informed to avoid introducing
respondent (interviewer bias). Moreover, a survey is always
errors and biases (Schaeffer et al., 1990).
declarative, so the respondent can voluntarily give a wrong answer if the question is in some way sensitive.
Unlike the sampling error, the non-sampling errors are very difficult, if not impossible, to measure, and cannot be reduced by increasing the sample size. In a large sample, non-sampling errors are
4.1.4. Non-Response errors
the more important source of errors, as the sampling error is reduced.
Non-response can be complete non-response (if a sampling unit, i.e. a The only way of controlling non-sampling error is to know what sorts beekeeper, did not answer at all) or partial non-response (some
of errors are possible, and to be very careful to avoid these as much
questions are not answered or only partially answered).
as possible in the conduct of the survey.
Box 2. Example of confidence interval. The overall proportion of colonies lost from those at risk is estimated as 19.5%, with a standard error (s.e.) of 1.5%. The corresponding 95% confidence interval is obtained in the usual way as the estimate +/- 1.96 (s.e.) giving 19.5% +/- 1.96 (1.5)%, which yields 16.6% to 22.4%. This means that in about 95% of cases when such a calculation is made, using a sample of the same size from the same population, the interval quoted will contain the true value of the overall proportion of colonies lost. This calculation assumes that the sample estimate is approximately normally distributed.
van der Zee et al.
10
4.2. Effort and costs in data accumulation
survey, while trying to keep the sample representative. Comparing the
Manual data entry is costly and time consuming. Although Optical
results of self-administered surveys which are widely distributed and
Character Recognition systems for automatic data entry are available,
interviewer-administered surveys of a selected group of beekeepers
the fastest mode of data collection and accumulation is when
will enable evaluation of the extent of colony losses area/countrywide
beekeepers directly answer the questionnaire using an internet
and indicate the reliability or otherwise of a non-randomly selected
database. Furthermore, after the end of the data collecting period, the sample. It may also identify any special cases that require further respondent can receive feedback and evaluate his/her losses or other
study, such as extreme losses in specific geographical areas that were
aspects of beekeeping experience relative to data accumulated from
overlooked by random sampling and in the event that identification of
other participants in the survey. Such systems can encourage
such areas is the purpose of the study.
participation by other respondents and so achieve a higher response, and are available nowadays for affordable prices. However this
4.3. Issues of anonymity and ethical approval
approach will fail to achieve a representative sample and may be a
Considering the issue of anonymity versus confidentiality is important
source of selection bias if the availability of internet access is
before a questionnaire is disseminated. In an ‘anonymous’ type
associated with questions of underlying interest.
questionnaire, the subject is totally unknown to the survey organiser,
As none of the discussed survey methods is flawless, nowadays
while in a ‘confidential questionnaire’ all the data is known to the
survey organisers often use a combination of data collection modes (a survey organiser, but kept confidential. Box 3 gives an example of mixed-mode survey) to offset the weaknesses of one mode with the
how anonymity can be preserved when postal surveying is used, using
strength of another (Brodschneider et al., 2010; Topolska et al., 2010; experience from surveys in Scotland. Soroker et al., 2010, van der Zee et al., 2012). Data validity and
With the increase in use of email / webmail, using these means of
accuracy can be improved by interviewer-administered questionnaires
communication make it virtually impossible to guarantee total
of a selected group of beekeepers, ideally randomly selected, by
anonymity, as the respondent’s name – or at least the email address
following up a postal or email survey by a telephone interview or
– is automatically included in their reply, although satisfactory survey
offering the opportunity to clarify any points of difficulty. Such a
software packages include the option of suppressing from the
limited follow-up can also sometimes reveal the kinds of bias incurred
recorded responses all means of identifying individual respondents.
by the more extensive survey. However, unless follow-up is so limited
While the perceived possibility of lack of anonymity may raise levels of
as to produce little information, it is a very costly option.
non-response or compromise the validity of responses to any sensitive
Repeating annual surveys among the same group of beekeepers
questions in an email questionnaire, the ease of access to a worldwide
will provide information on time trends, either by simply sampling the
population of beekeepers, the low administration costs and its
same population or possibly by following the same sample of
unobtrusiveness to respondents generally outweigh this negative
beekeepers through time (i.e. using a panel design), when this is
effect. It is also a simple matter to issue reminders by email.
feasible. Use of panel surveys does require some replacement of panel of members who are no longer available to participate in the
However, it is important that the level of confidentiality of the questionnaire is clearly outlined to participants. Hence, the covering
Box 3. Example: Preserving anonymity in a postal survey in Scotland. The membership records of the Scottish Beekeepers’ Association (SBA) provide a well-organised sampling frame of the target population. The help of the SBA Membership Convener was obtained. He is the only person with full access to those records. He was asked not to supply the survey organisers with the full records (which he would not have been permitted to do in any case), but only to supply the list of “Short Reference Numbers”, each of which uniquely identifies one of the members, along with the associated postal code. Before supplying that list, he was asked to remove from the list those ineligible to participate in the survey, including for example members not resident in Scotland, institutional members (such as libraries), and those who had declared themselves unwilling to participate in surveys. (The opportunity to opt out of surveys is available to new members when joining the SBA, and the opportunity was given to all existing members of the SBA to opt out via a short article published in the SBA’s regular publication for members, prior to the first survey using the SBA records for sample selection). The postal codes were abbreviated in the list supplied, so that while preserving the broad geographical location of each potential survey participant, it was not possible to identify any particular address. The postal codes were used to assign each member on the list to a particular geographical region in Scotland, so that the sample selected could be stratified on a geographical basis. This was done by dividing the country into a number of regions related to the administrative areas used by the SBA, in order both to give greater precision in estimation and to ensure greater geographical coverage in sampling and therefore hopefully a more representative sample. Then a stratified sample of the agreed size was selected from the list, using a sampling function available in the R software for objective random selection. Each questionnaire sent out was put into an envelope on which was written a questionnaire number provided by the survey organisers, also written on the questionnaire in the envelope. These envelopes were then sent to the Membership Convener along with a key file linking the questionnaire numbers to the corresponding “Short Reference Numbers”. This enabled the Membership Convener to print the appropriate address on each envelope and to mail out the questionnaires, without the organisers knowing the identity of the selected members. In fact, the majority of participants in the Scottish surveys have willingly provided personal contact details as part of their questionnaire return. (For example, in the survey in 2011, 85% out of 94 respondents did so; there was a 47% response rate).
The COLOSS BEEBOOK: survey methods
11
letter with the original questionnaire should clearly state that a
Legal issues in relation to the preservation of the confidentiality of
reminder will be forthcoming if no response is received. The
data also arise in some countries – for example, all organisations in
availability of this option to issue reminders is important since
the UK are constrained in what data they make available outside their
research indicates that reminders increase the response rate
own membership by the requirements of the Data Protection Act 1998.
(Campbell and Waters, 1990; see also the Scottish example below on
If any method of probability sampling is to be used for a survey,
reminders and incentives). Furthermore, email software allows the
access is also required to a sampling frame (see section 6.2.) which
dispatcher of the questionnaire the option of notification when the
gives good coverage of the target population.
recipient has opened the message. The use of questionnaires raises the question of personal liberty
5.2. Potential bias of the survey sample
and ethics and, because of this, many research institutes/universities
The responsiveness of the target population can be biased. For
require the survey organiser to acquire ethical approval prior to
example, beekeepers suffering higher colony losses might be more
disseminating questionnaires. Since questionnaires related to honey
likely to respond to surveys than those suffering fewer losses,
bee research are primarily concerned with generic rather than
although other biases are also possible. For example, Brodschneider
personal information, it may be possible to acquire multi-annual
et al. (2010) found a potential bias in reported colony losses from the
ethical approval in advance, thus allowing the annual dissemination of same region collected by different media. Respondents who returned the questionnaire. However, this will be specific to different institutes
a postal questionnaire from a beekeeping journal reported higher
and thus clarification on the ethical requirements should be sought
proportions of losses than those responding online or at a convention
locally before a questionnaire is disseminated.
in this particular region. This suggests that responses of some groups (such as from visitors of a convention) may not constitute a statistically representative sample, being from a different population
5. Coverage
than the target population. In such situations a mixed sampling
5.1. Effective coverage
outcome of the different sampling methods, which should be reported
Collecting representative data on the extent of colony losses in any
in the final report. This could be due to different experiences of the
area or country depends on one’s ability to identify and reach the
target groups and hence a different level of motivation of the
approach must be considered. This enables comparison of the
target population (beekeepers in the country, commercial and/or non- beekeeper to respond. A randomized sample may suffer from the commercial). This ability is affected by factors such as:
same non-response problems, but maybe to a lesser extent because
the size of the country and beekeeper community
the approach is more focussed on the individual beekeeper. It may be
the means of contacting the beekeeper community
possible to overcome this problem by increasing the response rate via
the degree of affiliation of beekeepers with beekeeping
encouragement of broad participation in the survey and the use of
associations
reminders. Using mixed media surveys or surveys using random
availability of professional magazines (including the possibility
surveying of the population of beekeepers to achieve a more
of publishing the questionnaire in a beekeeping journal)
representative sample may help, but the underlying problem remains
the holding of regular meetings of beekeepers
that of the association of the response rate with the underlying
the extent and accessibility of internet and telephone
questions of interest to the survey organisers. Response rates can be
networks
rather low. Dahle (2010) quotes a 15% response rate from surveys
availability of addresses, e-mail addresses or telephone
sent out in a beekeeping journal. Van der Zee (2010) quotes a 7.5%
numbers
response rate from beekeepers who were invited in a national
willingness and ability of beekeepers’ associations to
beekeeper journal to participate in an internet survey as well and they
cooperate in providing information
found differences between the results of these surveys and those
the possibility of cooperation with beekeeping inspectors and
from random surveys. In Denmark, response rates of up to 33% have
veterinary services who may hold registers of beekeepers
been achieved (Vejsnæs et al., 2010). In the Netherlands, an average
the number of staff engaged or available to conduct the
of 22% of the beekeepers surveyed from 2006-2012 (van der Zee et al.,
survey and analyse the data
2012) responded to a mixed mode approach of a questionnaire
and, of course, available time and funds.
included in the 2 national beekeeper journals. The letters could be
van der Zee et al.
12
Table 1. Some sampling methods with advantages and disadvantages. Method groups
Method
Explanation
Advantages
Complete
Census
Whole population selected.
With good response rate should give excellent information.
Stratified
Population divided into groups thought to be relevant to the survey objective, and each group sampled independently at random.
Simple
One random sample chosen from whole population.
Random Cluster
Quota
Non-random
Purposive or judgemental
Convenience
Population split into clusters (convenient subgroups), and a census is conducted within each of a randomly selected set of clusters.
Gives well-targeted information where size of errors can be properly estimated if response rate is good. Has the potential for lower sampling error than simple random sampling. Size of errors can be properly estimated if response rate is good. Size of errors can be properly estimated if response rate is good and clusters are well chosen. Only requires good sampling frames within clusters selected. Potentially cheaper than stratified or simple random sample.
Disadvantages Potentially expensive and often infeasible. If attempted without a sampling frame, may be misleading.
Infeasible without a sampling frame.
Infeasible without a sampling frame. Less well-targeted than a well-stratified sample. Requires sampling frame of clusters, and of individuals within selected clusters only. If clusters selected are not representative then may introduce bias to results. Sampling error is higher than with simple or stratified sampling.
Can fail very badly in achievRequires no sampling “Quotas” are set for reing representative results. It frame. Can work well, if searchers to fill of respondis sometimes hard to fill quoquotas are based on sound ents matching given criteria. tas, and non-response is underlying information. disguised. Requires no sampling Personal selection is notoriously Researchers aim to select frame, and aims to achieve bad at choosing a genuinely “representative” respondents. a good mix of respondents. representative sample. Respondents are chosen Cheap and easy to Extremely unreliable and because they provide a implement. Useful for pilot impossible to assess accuracy conveniently available studies. Requires no of results. sample. sampling frame.
sent back without charges or through an email with a personalized link to the questionnaire on the internet.
One or more regional or national beekeeping associations to which most beekeepers belong.
The coverage provided by such potential sources of data is clearly
5.3. Identifying the target population
very variable, and the reliability of survey efforts will depend heavily
A survey of beekeepers can be used to collect reliable data on
on the adequacy of this coverage.
beekeepers and beekeeping activity and/or practice in a certain area or territory of a country. The target population of such a survey should be defined according to the data that one aims to collect. It could be targeted to beekeepers’ associations (local to national in scope) or the individual beekeeper. However, the target population is
6. Sampling 6.1. Random and non-random sample selection
usually the set of all active beekeepers whose colonies are kept in the
methods
area of interest during the time period concerned. Consequently,
There are numerous sample selection methods for drawing the sample
coverage of individual beekeepers’ operations via associations might
from the population, broadly classified into random or probability-based
be incomplete and variable. How easy it is to access such a population sampling schemes or survey design methods, and non-random or non depends on whether beekeepers voluntarily or under legal compulsion -probability based sampling. An overview may be found for example are registered with some record-keeping organisation. Examples
in Schaeffer et al. (1990) or any such survey sampling textbook. A
might be:
number of terms relating to surveys are introduced in the following
A legally required register of all beekeepers within a given
sections, and may all also be found in such standard texts. The main
country;
methods which might be used for sampling beekeepers are summarised
A voluntary register of beekeepers within a region to which
in Table 1. Some more detail is given about each method below. In
most beekeepers subscribe;
general those methods higher up in the table will cost more, but will
The COLOSS BEEBOOK: survey methods
13
give more reliable results, provided that a good response rate can be
Stratified sampling splits the population into subgroups or strata,
achieved.
using stratification factors such as geographical area or degree of experience of the beekeeper, or beekeepers/bee farmers, which are
6.1.1. A census
judged to be important in terms of coverage of the population and
It is possible to approach most of the beekeeper population in smaller which are likely to be related to the response variable(s) or interest. countries such as the Netherlands, where questionnaires are included
Then a random sample, in the simplest case a simple random sample,
in both of the two beekeeper journals, which are sent to all Dutch
is selected separately from each stratum, using predetermined sample
beekeepers who are by their membership of a local organization also
sizes. This ensures representation of all these important groups in the
a member of a national association (>90%). The questionnaire could
sample (which might not be achieved by a single simple random
be returned without postal costs. Beekeepers who provided an email
sample), and the random sampling should compensate for any other
address (>85%) in the past received a personalised link to the online
relevant stratification factors which may have been overlooked in the
questionnaire. In 2012, about 70% of the data was submitted this
survey design. It also allows comparison of the responses from each
way and processed immediately, which reduced costs substantially.
stratum, provided enough responses are achieved in each stratum.
This approach is in fact not sampling, but addressing the total population of organized beekeepers.
If the average responses do differ between the strata, and/or the variation in recorded responses differs between strata, stratified sampling should provide estimates with a lower variance than simple
6.1.2. Random sampling
random sampling. The lower variance is achieved because separate
Survey designs based on random sampling are designed to select
samples have been taken from populations with smaller variation
sampling units from the population with known probabilities. This
within them compared to the population as a whole (Schaeffer et al.,
means that the sampling properties of estimators of population
1990).
quantities can be determined, such as whether or not the estimator is unbiased (i.e., does it on average give the right answer?) and what is
One basis for stratified sampling is operation size. The scale of beekeeping operations and management practices are very different
its precision (i.e., how do we calculate its variance or its standard error). for hobbyist beekeepers and professional/commercial operators (bee This is the objective scientific approach to sampling and the only one for which sampling properties of estimators are known. Other
farmers). Due to the potential for different numbers of lost colonies and consequences of losses among these two groups, both should be
methods may provide good information but there is no guarantee that included whenever possible in a survey. This allows the colony loss they will, and their sampling properties are unknown. However even
rates experienced by both groups to be compared and it is more
with random sampling, if response rates are poor then the possibility
representative of overall levels of loss. Box 4 gives an example.
of non-response bias will compromise the estimation. Implementation of random sampling methods requires a
The migration of colonies (the movement of colonies to/from nectar flows or for purposes of crop pollination) differs widely
mechanism for random selection, usually accomplished by use of
between beekeeping operations. Therefore, it is also desirable to
random number generators in computer software, e.g. the “sample”
consider different classes of migratory practice where possible when
function in the public domain software R (downloadable from
designing and analysing the survey. As migration may be a factor in
http://www.r-project.org/). It also usually requires a sampling frame,
loss rates (although see VanEngelsdorp et al., 2010), comparing
or list of sampling units in the population (section 6.2).
migratory and non-migratory beekeepers is important, if the sample
The simplest scheme is simple random sampling, which samples randomly without replacement from the sampling frame so that at every stage every sampling unit not already selected from the
Box 4. Example: Case study of stratified random sample selection.
In Scotland, any beekeeper (or other person interested in bees) can choose to become a member of the Scottish Beekeepers’ Association, samples of a given size being equally likely to be selected. while there is a separate Bee Farmers’ Association for the UK, the qualification for the latter being that the beekeeper should keep at Systematic sampling is sometimes used as a simple alternative to least 40 colonies of honey bees within the UK. There is known to be simple random sampling and works at least as well in situations where some overlap between the two membership lists, and care needs to be taken not to request survey participation of the same person twice the population sampled from is "randomly ordered" with respect to for the same survey. Despite the fact that there are far fewer bee the value of a quantity being measured or recorded, or is ordered in farmers than hobbyist beekeepers in Scotland, it is clear that they manage more than half the managed colonies, so that their order of size of such a quantity. It does not always require a sampling contribution to the overall bee population is far greater than their frame. For example, if 1000 beekeepers attend a convention, to numbers would suggest. Therefore in a recent survey it was decided to sample all of the bee farmers who could be identified, while selecting achieve a 10% sample of those attending, a participant may be a random sample of non-commercial beekeepers (Gray and Peterson, selected at random from the first 10 beekeepers to arrive or register, 2012). sampling frame is equally likely to be chosen. This results in all
and then every 10th person after that also selected.
van der Zee et al.
14
sizes permit valid comparisons. In places where there is widespread
example due to local weather conditions in the first case, or the fact
practice of migration on a large scale, this comparison becomes much
that attendees at a convention may be real enthusiasts whose bee
more important. Identifying beekeepers practising migration of bees
husbandry practices are not typical of the general beekeeping
in advance of drawing a sample may be difficult, unless auxiliary
population. A small convenience sample may be very useful for a pilot
sources like membership records include this information. If this
survey (see section 7.7) but is not recommended more generally.
information is available, then a stratified approach may be adopted to ensure coverage of both migratory and non-migratory beekeepers. Geographical stratification may also be important, especially if different regions are subject to different weather conditions and differing exposure to bee diseases. However, combining multiple
An invitation to respond to a survey available on a web-site for example, is an example of taking a self-selected sample unless the people invited to respond to the survey have been selected already (as in Charrière and Neumann, 2010). In some countries, such as Algeria, the most effective method in
stratification factors with lower than ideal response rates can make
terms of response rates is a face-to-face survey in the beekeeper’s
the desired comparisons statistically invalid or impossible due to small
home or at meetings of beekeepers’ associations or co-operatives, as
samples.
using mailed surveys produces an extremely low response. In
Cluster sampling is the other main method of probability sampling. Slovakia, it is also reported that the only method which works well is If the population can be divided into convenient groups of population
to disseminate questionnaires at meetings, as data collection via emails,
elements rather than strata thought to differ in ways relevant to the
web pages and journals has very low rates of return. For example,
response(s) of interest, then randomly selecting a few of the groups
only 5 questionnaires were returned from a beekeeping journal with a
and including everyone in those selected groups as part of the sample circulation of 8 thousand copies (Chlebo, 2012; Pers. Comm.). will provide a representative sample from the whole population if the
Given access to a population to be sampled, a survey organiser
groups or clusters are representative of the population. For example,
could try to take a “representative” sample, which is called
these clusters might consist of local beekeeping associations, which
judgemental or purposive sampling, to select what they think is a
would be viewed as groups of beekeepers. This is a one-stage cluster
suitable mix of people to participate in the survey. The difficulty is
sample design. There are other variants of this method, but they are
that some important factors which have a bearing on the responses
unlikely to be of practical importance in this field of application.
made to the questions may have been overlooked. Using judgemental sampling leads to a serious risk of badly biased samples.
6.1.3. Recommended approach for random sampling
Quota sampling is like stratified sampling in that stratification
In view of the discussion above, stratified sampling is recommended
factors are identified which are thought to be relevant to the survey,
to achieve good spatial coverage of all main geographical areas in a
but instead of sampling randomly the participants to come from each
country or region whose beekeepers are to be surveyed, and to give a stratum, the survey samplers themselves choose the people more representative sample and more precise estimation. Using
subjectively from each stratum until sufficient people have been
proportional allocation (see section 9.) is the simplest way to
chosen and have responded. The main difficulty with this is the
implement this. By ensuring that the chosen strata are represented in
subjective choice of participants. Use of quota sampling also disguises
the sample, comparisons can be made, and these stratification factors non-response, as invited participants may decline to take part but the can also be used as risk factors in modelling the risk of colony loss,
sampling will continue until the quotas are achieved. Quota sampling
for example. Achieving good spatial coverage of the population is also can work well, but can also fail spectacularly badly (as seen most essential for spatial or spatial-temporal model fitting, which requires a notably in pre-election polling; see Schaeffer et al. (1990) for an high degree of data resolution.
overview of this and other methods). An example of using nonrandomized quota sampling to survey American beekeepers is
6.1.4. Non-random methods
described in VanEngelsdorp et al. (2010), who recognised the dangers
Non-random sampling, is any other kind of sampling. Such methods
of using this approach but judged that it had given results consistent
are often used for speed and convenience, and also they do not
with the pattern of US beekeeping. Box 5 gives an example comparing
require a sampling frame. Their big disadvantage is that sampling
quota and stratified random sampling.
error cannot reliably be quantified, as the sampling properties of any
A fundamental guiding principle in survey sampling is to use
estimators used are not known (since the probability of choosing any
randomisation wherever possible in sample selection, to avoid
one individual or sample cannot be determined).
subjective selection bias affecting survey results. Genuinely random
Convenience or accessibility sampling involves asking a sample of
samples are well-known to have the best chance of being
people to respond to a survey. An example is distributing survey
representative of the survey population and should therefore be used
questionnaires at a meeting of a local beekeeping association or at a
unless it really is not possible (Schaeffer et al., 1990) or will lead to
beekeepers' convention. However these people may not be
such a low response rate that the results are of little use.
representative of the whole target population of beekeepers, for
The COLOSS BEEBOOK: survey methods
15
Box 5. Example: A case study: comparing quota and stratified random sampling. In Scotland, the first survey conducted in 2006 for the Scottish Beekeepers' Association (SBA) used a form of quota sampling. This survey used strata which were broadly geographical, as has also been done subsequently. After the organisers decided on the split of the sample size between strata, they contacted the SBA Area Representatives, in order for them to choose the required number of participants from those known to them personally and known by the Secretaries of the Local Associations of beekeepers in that area. This allowed a known quota to be obtained from each geographical area. This was done purely because permission had not been gained at that stage to use the SBA membership records for sampling purposes and there was no other means of obtaining a list of beekeepers. The results (Peterson et al., 2009) suggested to the organisers that the participants ran larger beekeeping operations than were typical of beekeepers in Scotland as a whole, and also that they were more conscientious and organised beekeepers than was typical. This is not entirely surprising, as the Area Representatives and Local Association Secretaries probably would have chosen people they thought were more organised and more likely to complete and return their questionnaire. Subsequent surveys from 2008 onwards have used stratified random sampling. In the 2008 survey a modified Neyman allocation method (Schaeffer et al., 1990; Särndal et al., 1992; section 9.) was used to split the sample between the main SBA areas, and subdivided proportionally within these large areas to smaller geographical areas according to the number of SBA members (Gray et al., 2010). In 2010 the simpler proportional allocation was used, as there was insufficient data from the 2008 survey on which to base Neyman allocation and the 2006 data was felt to be out of date. In 2011, Neyman allocation was used again, based on winter loss rates. The results were more in accord with what was expected, and therefore are probably more representative samples than the earlier one. The response rates however have been lower, and the higher response rate in the 2006 survey (of 77%, compared to 42% in the 2008 survey) almost certainly resulted from the element of personal contact.
Finally, it is essential in any reporting of survey results that the survey
6.3. Availability of a sampling frame
methodology and response rate should be clearly stated. This enables
In some countries, a substantial number of hobbyist beekeepers may
assessment of the reliability of the results, based on how representative choose not to belong to any kind of association of beekeepers or to the sample is likely to be. One way to assess whether or not the
be registered on an official list of beekeepers, meaning that there can
survey has been successful in achieving a representative sample is to
never be 100% coverage in any list used as a sampling frame.
check the responses to a standard question, to which the responses
Personal knowledge of some of these beekeepers may enable survey
are not expected to change much from survey to survey, if past
organisers to extend their sampling frame, however the possibilities
surveys have been carried out on the same population. If the results
for this are likely to be very limited. If such independent, unregistered
of this are different from what is expected this may indicate that the
beekeepers form a significant proportion of the beekeepers in a
sample is not a representative one. The breakdown of the participants country, then it will be virtually impossible to obtain for that country a by key indicators such as geographical area or class of operation size
truly representative sample of beekeepers. To make matters worse, it
can also be examined, although some of these factors will ideally have is difficult to determine how many such unregistered beekeepers been controlled for in the sample design, by use of stratification.
there are. This may be a cause of biased survey results, if the beekeeping experience and loss rates of non-registered beekeepers
6.2. Need for and use of a sampling frame in random sampling Implementation of random sampling generally requires a list of
are likely to be systematically different from those that are registered.
6.4. Sources of sampling frames appropriate for
sampling units, the sampling frame, from which to select the sample
different target populations
by random means, although systematic sampling can in some cases
The ideal situation is one in which all beekeepers of a country (or
be carried out without one. This operates using a numbering system
other geographical unit) are equally represented in a sample. In some
for each person listed. Random selection without replacement of the
countries, beekeepers, usually with a minimum number of colonies,
required sample size from the list of numbers of those having given
may be required to register on an official list, in which case gaining
permission for their records to be used for the purposes of sampling
access to that list enables access to a selected part of the beekeeping
identifies the selected numbers and hence the sample selected, where population. In practice, not all beekeepers will register even if this is a simple random sample is required. For a stratified design, sub-samples are selected in the same way from each stratum, by selecting each sub-sample separately from the
legally required. The level of compliance with registration requirements may vary greatly from one country to another. In the absence of a satisfactory list of registered beekeepers, other sources
list of identifying numbers for those belonging to the relevant stratum. of sampling frames may be membership lists of beekeepers’ A cluster sample might select a few local beekeeping associations
associations or records held by veterinary services. In some countries
randomly from a centrally held list of associations, as for a simple
(e.g. Norway, Sweden, Denmark and the Netherlands), beekeepers’
random sample, and either target everyone in the selected
associations may represent up to 90% of the beekeepers, so use of
associations as a survey participant, or take a further random sample
these association records seems to be the best approach currently.
from the membership list of each local association again using random selection of numbers as the means of sampling.
Use of any of the above sampling frames for random sampling does require prior consent, by some means, of the beekeepers on the
van der Zee et al.
16
list sampled from, for their record to be used in the selection of a
the odds of colony loss through CDS, questions should be asked
survey sample. Those who would not wish this must have the
relating to any suspected risk factors as well as collecting data on
opportunity to opt out and, having done so, should be omitted from
numbers of colonies lost and what number of losses are attributed to
the list before random selection takes place. Ethical approval may also each of a list of possible causes. be required (section 4.3.). If cooperation with beekeeper associations
In a survey concerned with honey bee colony losses, migratory
which represent the majority of beekeepers in a country is not
habits need to be stated as clearly as possible by the respondents in
possible, or complicated because there are many small ones all with a
order to avoid misunderstanding about the place(s) where losses
limited number of members, another approach is advised.
were/were not recorded, as well as possible causes of losses, since
Firstly, generally most of the bee stocks in the country are managed by large scale commercial beekeepers (even though there are also large numbers of small scale beekeepers). Often the commercial beekeepers have their own trade organisation which will list them all, as well as the approximate sizes of their operations, and if access can be obtained to them, estimation is possible. If cooperation with a commercial beekeeper association is not
migratory habit could be one such cause or a contributing factor in honey bee loss. It is also important to collect and record auxiliary information for statistical purposes such as weighting and multivariate analysis.
7.2. Appropriate designs for different sampling methods
possible, an approach using the fragmented smaller organisations
A questionnaire for use by a trained interviewer conducting face-to-
may result at least in some kind of sampling frame from which a
face or telephone interviews can be much more elaborately
sample can be drawn with some hope of being representative of
constructed than one used for general distribution (say at a
beekeepers who belong to these associations, at least in some local
conference) or for a postal or email-based survey or a web-based
areas. How representative these associations are of all beekeepers is
survey.
of course unknown. If no beekeeper infra-structure is available, even if, say, in some parts of the world the post office is the only main central information
In the former situation, the time and cost of obtaining the interviews at all is so large that the additional expenditure for training specialist interviewers and possibly providing them with aids such as
hub, it may be possible to find for each post office district a nucleus of laptop computers with purpose-designed questionnaire software is beekeepers. A representative sample of post offices with respect to
often considered worthwhile. Many large scale government-funded
climate and suitability of area for beekeeping could be drawn up. If
surveys seeking national statistical data are conducted in this way.
such a sample were not too large, then putting out an enumerator for
Questionnaires may then have complicated question routing for
the survey into each of those post office areas might enable that
various alternative pathways through the questionnaire, as indicated
enumerator to find within that area a fairly complete list of the
by answers to key initial questions. Sophisticated questionnaire
beekeepers in the area. Then the cluster sampling approach would be
software will have these paths encoded within it. In other cases the
sensible, where the post offices sampled were regarded as the
interviewer will be familiar with the routes to take depending on the
clusters. A return would be made for each sampled post office area,
responses given. This is the more common situation in surveys with
and the usual techniques for cluster sampling could be used to
visiting inspectors of the extension service, or in general in projects
analyse the results. These approaches may provide a way forward in
which require advanced diagnosis of disease and/or sampling of
situations where there is very little by way of an existing sampling
colonies.
frame and limited resources are available or only small scale surveys
In the second situation, where respondents to the survey have full
are possible. Even an imperfect investigation will yield some
control of the progress of the response and interpretation of the
information. The important thing in considering the results of such
questions, it is vital that shorter and simpler questionnaires are used,
work is to be open about the shortcomings of the results, and not to
with clear instructions and clear questions, to avoid low response
claim more for them than is justified.
rates and inaccurate responses. This is almost always the situation relevant to surveys of beekeepers.
7. Questionnaire design
7.3. Common problems to avoid in questionnaire
7.1. Completeness of the questionnaire
design
In the framing of survey questions, the aims and objectives of the
Some common problems to avoid in questionnaire design include
desired analysis, and the methods to be used in the analysis, should
ambiguity of interpretation, loaded questions and questions on
be borne in mind, in order to ask all of the questions needed to
sensitive issues.
enable collection of the appropriate data. For example, for modelling
The COLOSS BEEBOOK: survey methods
17
7.3.1. Ambiguity of interpretation
beehives, or any of these other issues may mean that some beekeepers
If respondents can interpret a question in various ways, the returns
will not answer those questions at all, will provide incomplete information,
made will not be easy to interpret and the analysis can become
or will supply wrong information. There is no doubt that seeking too
difficult or impossible to conduct. Box 6 gives an example. The way to much sensitive information will seriously reduce response rates and minimise ambiguity is, first of all, to ensure that the early drafts of a
also lead in many cases to incomplete survey returns, thus defeating
questionnaire are always criticised by an independent evaluator
the object of asking the questions.
before they are used, and once all obvious ambiguities have been
It is hard to know how best to address this problem. Firstly,
removed, to pilot the questionnaire (see section 7.7.) in order to try to investigators should be aware of what may be sensitive points in their detect any remaining problems with the questions.
Box 6. Example: Colony management in Canada. An example is provided by recent COLOSS surveys in which beekeepers were asked about increases and decreases during a certain timeframe. All Canadian respondents who reported increases or decreases during the defined wintering period were contacted to verify whether such changes truly reflected the dynamics of the wintering population. Invariably, these changes reflected spring-time activities (typically splitting colonies), where these activities could occur in warmer areas of the country prior to the defined end date of the wintering period. Moreover, these changes were not reflected in total colony counts at the end of the wintering period. The question was clear about the timeframe, but a substantial number of beekeepers ignored this information (van der Zee et al., 2012).
target population, and if necessary, avoid directly asking about them. Sometimes a suitable non-sensitive substitute question may be available for some of these issues, but that too can be problematic. Perhaps seeking information about the mean honey yield per production colony may be felt to be less threatening to a respondent than asking about the financial return for their honey harvest in a particular season, for example. Participants should be assured that all information held will be treated in confidence and only used for the stated purposes of the survey, and that permission would be sought for any subsequent use of the data for other purposes. Any wider data sharing should only be undertaken with extreme caution and great care taken to remove any information which could lead to the identification of the individual beekeeper. There are limits on how
7.3.2. Loaded questions
successful this can be, in a small area, for example, where
Questions can often be framed in such a way that the respondent is
beekeepers may be well-known. Information on exact hive location is
guided towards selecting a particular response, even when that
probably best not shared at all.
response does not reflect the true state of affairs of interest to the investigator. Box 7 gives an example. Critical analysis of the original questions for possible loading, and
7.4. Questionnaire design for minimisation of
careful analysis of pilot survey results, with subsequent revision of the
measurement error and ease of analysis
questionnaire where necessary, are essential.
It is important to word questions carefully, using neutral language,
Box 7. Example: Case study: Experience in a Scottish survey. An example is provided by a question used in a recent Scottish survey in which respondents were asked in what year they had first become aware of varroa infestation of their colonies. The question was intended to discover how far in the past it was when this parasite had first been detected in that area of the country, since there are still remote areas of Scotland where it has not yet been found. However some newly established beekeepers interpreted this as meaning that they were expected to have personally observed the parasite, and so were inclined to respond that the parasite had “not yet been found� - a biased answer leading to an over-optimistic interpretation of the extent of the parts of the country which were still free of varroa.
clearly and unambiguously to avoid misunderstanding and consequent errors in data supplied. Carrying out a pilot survey of a questionnaire (see section 7.7), or part of it, involving any new questions is essential in order to check that the questions are appropriately worded. Modifications of existing questions are best tested in the same way, unless the change is minor. It is worth considering the order of questions asked. The usual guideline is to ask more general questions before more specific ones. This avoids attitudes/responses from becoming fixed early on and may encourage a more flexible way of thinking. It also allows for appropriate question routing, i.e. based on their response to certain
7.3.3. Questions on sensitive issues
questions the respondent is then directed to go to the next
Even in surveys of beekeepers, some issues can be sensitive. Matters
appropriate question for them to answer. For example, the
such as financial returns, incidence of disease, location of beehives,
questionnaire can state something like "If you responded "yes" to this
and methods for treating diseases and parasites may be sensitive
question, please go next to question X". This is important in surveys
topics for some beekeepers. Taxation, personal and commercial
drawn randomly from membership lists of beekeeping associations,
confidentiality issues may be important in financial questions.
where not all members may be active beekeepers at the time of the
Beekeepers may feel sensitive about exposure to criticism for poor
survey and it cannot be determined prior to carrying out the survey
management if they report disease. If unorthodox treatments for
which members are active beekeepers. Asking whether or not the
disease have been used, then exposure to the risk of prosecution may respondent is an active beekeeper early on in the survey allows make respondents reluctant to respond. Concern about safety of
asking such respondents any questions directed at them specifically,
van der Zee et al.
18
while directing the active beekeepers to the start of the main part of
likely that amongst those who do, some of the information will be
the questionnaire and the questions intended for them.
missing. Asking very detailed questions is also likely to result in
For ease of data coding and analysis it is best to use closed
information being less reliable, as not all beekeepers will recall the
format questions where possible, with a fixed number of response
details or will not have kept sufficiently detailed records to be able to
options of most interest and/or thought to be the most common, and
provide correct information, or be unwilling to take time to find the
to provide an "other" or "not applicable" category to cater for
information requested. Longer, more detailed questionnaires and
responses that cannot be fitted into the supplied list of responses,
more complex response options are more likely to be successful in
with the means to provide further details of the answer to the
face-to-face surveys, but less so in more modern forms of survey. (In
question. Closed questions with a given format make it possible to
telephone surveys, participants may become impatient with long and
compare responses from surveys of different populations, for example complicated surveys with many response options, and are likely to in different countries, or of the same or a similar population at
terminate the interview prematurely, so shorter and simpler is best.)
different times. Completely open questions inviting a written response Postal and self-administered surveys in general require especially clear are much less easy to deal with in data coding and analysis and are
questions and response options and should be kept to a manageable
best avoided. The number of response options is best not to be too
length (Schaeffer et al., 1990; Brodschneider et al., 2010). Balancing
long, to avoid confusion or error.
the desire for more information with simpler questions and a shorter
Questions asking for a numerical response are best worded and set out to allow the respondent to supply the exact number, of
questionnaire is likely to produce a higher response rate and more accurate data.
colonies managed, for example, as the answers can be categorised later if required but having the exact numbers provides more
7.6. Problems of multi-lingual/multi-cultural
information for analysis.
questionnaires
It is well-known that asking sensitive questions in surveys (see section 7.3.3.) is less likely to elicit an accurate or complete response than less emotive questions. Some survey methods are more successful in this matter than others (Schaeffer et al., 1990). Questions requiring more knowledge than a participant has are likely to be answered inaccurately. Either some background information should be provided, or a screening question(s) should be asked first to determine whether or not it is appropriate for the participant to be asked the particular question of interest. While constructing the questionnaire and accompanying documentation, including a covering letter/invitation to participate and instructions to the survey participant, a coding sheet should also be prepared. In online surveys, responses will automatically be entered into a database, and the coding of them is part of the questionnaire design (0 = no, 1 = yes, N/A for missing, for example). In surveys requiring manual data entry, a coding sheet is important for consistent translation of survey responses into data entered in a spreadsheet. This is especially important in situations where there is more than one person involved in data entry.
7.5. Need to limit data sought, for a high
Care should be taken in constructing a multi-lingual or multi-cultural questionnaire, to ensure that the questions and response options are relevant to those receiving them, to avoid needless complication and needless irritation of survey participants, with a view to securing the goodwill and co-operation of the questionnaire recipients and hopefully therefore a high response rate. Accurate translation of specialised concepts requires translation by those familiar with specialist terms in both languages involved, which can be hard to achieve. Local modifications may be necessary, for example in specifying in relevant questions the month of the start of the winter/summer season for beekeeping, however care should be taken to preserve the meaning intended by the original question. Similarly, differing response options may be appropriate in different countries. For example, in a question about possible disturbances to bee colonies, bears are a possible hazard in some countries, but not in others. Bee races kept will also vary from country to country. Providing “Other� as a response option allows for any more unusual responses, while keeping the specific response options relevant to the participants. Even some questions may not be felt to be relevant ones for some countries. These local variations have implications for the return of the data for central processing and also for its interpretation. Data
response rate and accurate measurement
coding needs to allow for the different response options and care is
Constructing a long and detailed questionnaire offers the survey
required in returning accurate data to avoid introducing errors.
organisers the opportunity to collect a great deal of useful information
One difficulty when colony losses are being recorded is the time
from those survey participants who return their questionnaire, but is
period of observation. Lost colonies are common within a period when
likely to result in a rather lower response rate than would be
colonies are not foraging. Depending on the climatic zone this may be
desirable, owing to the time and possible difficulty involved in
winter or other periods. Such periods also differ in duration between
completing it. Few respondents may return the questionnaire and it is
years and areas. Using seasonal characteristics allows for comparing
The COLOSS BEEBOOK: survey methods
effects on honey bee survival of the length of the non-foraging
19
periods between climate zones. However, in some parts of the world
8. Response rates
like the USA, Southern Europe and Asia, migration of colonies for
There are different ways to calculate response rates. The examples
pollination purposes to warmer zones during winter can be substantial. given here simply use the number of usable responses (complete or This suggests the use of fixed timeframes and determining how many
otherwise) divided by the size of the sample selected or number of
colonies are present at some fixed moments in time.
participants approached. Variations on this as well as several other measures of outcome rate are discussed fully in the reference AAPOR
7.7. Testing survey questions: importance of pilot (2011). studies It is always sensible to test a new or modified questionnaire in a small
8.1. Use of incentives and reminders to improve
scale pilot survey before circulating it more widely to a larger group of
response rates
survey participants. Inevitably in the answering and reviewing of the
As mentioned above, reminders are an important means of improving
pilot questionnaires, some unanticipated problems will be highlighted,
response rates in self-administered surveys. A personal reminder is
from minor issues such as duplication of question numbers, to
likely to be more effective than a more general public one. Providing
misinterpretation of question wording and issues requiring
an incentive to participate in the survey to those already selected to
modification of question wording, new response options and/or
participate can also encourage return of a questionnaire and hence
additional questions. Box 8 gives an example.
may have some beneficial effect on response rates.
If re-using a well-tried and tested questionnaire, clearly there is
In telephone surveys call-backs are easy to arrange. Sending
less need for a pilot run. However, if new questions are added a small repeat emails is also straightforward. In an online web-based survey, pilot run is still advisable. Almost always some small point has been
as in self-selected survey samples generally, it is the more motivated
overlooked or can be improved upon, despite the most careful survey
who will respond to a general call for participation and these may well
design. Even with an old questionnaire, piloting is often advisable to
coincide with those who have more extreme opinions or experiences
ensure that questions are still comprehensible and relevant.
to report. Therefore reminders are important to try to overcome the bias which this creates, by involving some of those who are less
Box 8. Case study: Pilot surveys in Scotland. In recent surveys in Scotland, for example, about 6 people known to one of the survey organisers through his local beekeeping association were identified as suitable candidates who were readily contactable, covering a wide span of years of beekeeping experience from the beginner to the much more experienced. The questionnaire was delivered to them personally at a time when they able to deal with it immediately or an arrangement made to collect it shortly thereafter, so that no responses went missing. In the face to face situation, any immediate difficulties in understanding the questions are easily dealt with and explained, and a note made that these questions need to be re-worded. In all cases this exercise has suggested some points to be changed in the survey questionnaire, if only minor ones, and has been felt to be very useful.
7.8. Example of a standardized questionnaire on colony losses An example of a standardized questionnaire, produced by the monitoring working group of the COLOSS network (section 1), is provided in Fig. 2. The questionnaire can be split into essential questions which should be implemented in all participating countries and optional questions which are left to the national survey organisers to use or not. Optional questions ask more information about the operation such as postal code and location of the apiary, migration, bee race, increases and decreases made by the beekeeper during winter, origin of queens, queen replacement, pollination services, honey and pollen sources, comb replacement and winter feeding. The survey organisers may replace the concept of winter by another seasonal concept suitable for the local situation.
inclined to participate but who may be more representative of the population as a whole. Box 9 gives an example.
Box 9. The Scottish surveys: use of reminders and incentives. In the 2008 survey in Scotland, a short public reminder was published in “The Scottish Beekeeper”, but the final response rate was only 42%. In that survey no personal reminder was possible as anonymity was built into the survey and questionnaire numbering was not used. Numbering of the questionnaires allows identification of the selected survey participants who have not responded. In recent Scottish surveys the numbers of questionnaires returned by the deadline were removed from the list of numbers of all the questionnaires sent out, the remaining numbers matched to the reference number of the person concerned and this list of numbers sorted into order and sent to the membership convenor for identification of the people in order for him to send a short reminder letter. The first time this was done, in 2010, the response rate was considerably improved, to 69%, although in 2011 it had little effect (response improved from 45% to 49%) and there was barely any effect in 2012. Nonetheless reminders are recommended. In the last few annual surveys of beekeepers, a well-known commercial supplier of beekeeping equipment has willingly provided a generous voucher to be awarded to the winner of a prize draw at the end of the deadline specified for return of the questionnaire. The winner was randomly selected from the list of questionnaire numbers returned by that deadline. The winning number was matched to the identifying short reference number for that participant, and the details were sent to the SBA membership convenor. The convenor identified and contacted the winner, and contacted the commercial company to arrange for the sending of the prize to the winner. The winner was asked what details they would be willing to have published in the SBA’s monthly publication for members, for example, information such as “The winner of the £50 voucher kindly offered by Company A as a prize to the successful participant in the SBA 2010 survey lives in Argyll”), hence giving some publicity to Company A.
van der Zee et al.
20
Survey on Colony Losses 2012 In this questionnaire we try to gather information about production colonies. Please consider colonies which are queen-right and strong enough to provide a honey harvest as production colonies.
1
Country _______________________________________________________
2
Region/Province_________________________________________________
In the next questions you are asked for numbers of colonies lost. Please consider a colony as lost if it is dead, or reduced to a few hundred bees, or alive but with queen problems, like drone laying queens or no queen at all, which you couldn’t solve. Please consider winter as the period between the moment that you finished the pre-winter preparations for your colonies and the start of the new foraging season. 3
How many production colonies did you have before winter 2011-2012?
4
How many of these colonies were lost during winter 2011-2012?
5
How many of the lost colonies did not have dead bees in the hive or in the apiary?
6
How many of the lost colonies had dead workers in cells; and no food present in the hive? and food present in the hive?
7
How many of the lost colonies had queen problems, like drone laying queens or no queen at all?
8
How many production colonies did you have after; winter 2010-2011 winter 2011-2012
9
Have you treated your colonies against Varroa during the period November 2010 - January 2012?
yes
no
To learn about the number of Varroa treatments during the period November 2010-January 2012 we would like to get information on the months you started a Varroa treatment with a product. 10
Could you please indicate in what month and year you started every Varroa treatment of your colonies with a product during the period November 2010 - January 2012? 2010
2011
2012 March
February
January
December
November
October
September
August
July
June
May
April
March
February
January
December
November
Fig. 2. An example of a standardized questionnaire, produced by the monitoring working group of the COLOSS network.
9. Choice of sample size
estimates from the data collected, where these estimates have been
In a probability-based sample, the sample size can be calculated
depend on the sampling scheme to be used. Schaeffer et al. (1990)
statistically in order to achieve a required level of precision of
give details.
identified in advance as being of interest. The formulae required
The COLOSS BEEBOOK: survey methods
21
For example in a simple random sample, to estimate a mean, e.g.
If there is more than one quantity to be estimated, as there will be in
average number of colonies kept per beekeeper, to within a distance
surveys of beekeepers, the larger of the relevant calculated sample
or error bound B of the correct value with approximately 95%
sizes can be used, where this is feasible, or it can be decided to focus
confidence, the formula for the sample size is and
where
is the variance in the population of the quantity of
on one more important estimator, e.g. the proportion of beekeepers experiencing winter colony loss or the proportion experiencing CDS
interest, e.g. the number of colonies kept, and N is the population
losses. It is then accepted that any other estimates requiring a larger
size. In the case of a very large population of beekeepers, where N is
sample size will be estimated with lower precision than is desirable. For a stratified sample, which takes simple random samples from
not known exactly, an approximation to this sample size is given by
each stratum, similar calculations may be done to obtain the overall
. The population variance may be estimated from the
variance calculated from data in a previous survey of the same
sample size required to estimate the mean or total or proportion to
population, or from a pilot survey. To estimate a total (by the
within an error bound B of the true value with approximately 95%
population size N times the sample average) with the same precision
confidence. See Schaeffer et al. (1990), for example, for details.
uses this same formula but with
Various approaches are possible to divide the chosen sample size
. Box 10 provides an
between the strata, including the proportional method which takes the
example of the calculations.
sample size
in the th stratum proportional to
Box 10. Sample size calculation for a survey to estimate a mean or
size of the th stratum and
a total.
taking
For example, using a simple random sampling approach, to estimate the average number of colonies kept to within a margin of
, where
is the
is the population size. This means , where
is the th stratum weight or the
proportion of the population belonging to stratum .
Neyman allocation is a more complex method which splits the
error of 10% (B = 0.10) of the true value with an approximate
sample between strata in order to minimise the variance of the
confidence level of 95%, the sample size is calculated as follows. We use the formula where .
unbiased estimator of the population mean (given by
Assuming that the total number of beekeepers in the population is 1500, and if we have recent information from a previous survey that the variance of the number of colonies per beekeeper is about 4, then we should sample beekeepers,
, where
and
is the
mean of the sample from stratum ) or of the total (taken as
times
the estimator for the mean) by taking the th stratum sample size proportional to
rounding up to the nearest integer. If we wished to estimate the
stratum and
total number of colonies kept, say to within 200 of the actual total with the same level of confidence, then making use of the same
stratum . So
information, we calculate instead now gives
, where
or
, where
is the variance within
is the standard deviation the variance within
0.00444, which beekeepers to be sampled. The within stratum variances may be estimated from previous experience or a pilot survey.
To estimate a proportion p to within an error bound B of the true
To estimate a proportion (by
, where
is the sample
value with approximately 95% confidence, the same exact and
proportion in stratum ), the same formula can be used for allocation
approximate formulae are used as for estimating a mean, but with
as for estimating a mean, but
, so in the large population case
.
These formulae require an approximate value for p based on prior experience, or else substitution of a conservative value of p = 0.5 to maximise the required sample size. Box 11 shows the calculations.
Box 11. Sample size calculation for a survey to estimate a proportion.
is replaced by
where
is
the value of the population proportion in stratum (and in practice an estimate of this is used). The Neyman approach can also be modified, if required, to incorporate different sampling costs for each stratum. More complex modified Neyman allocation schemes are also possible (Särndal et al., 1992). More generally it may be decided, in order to achieve a suitable
For example, using a simple random sampling approach, to estimate an overall proportion of losses which was 20% last year (so p = 0.20 approximately), to within a margin of error of 5% (B = 0.05) of the true value with an approximate confidence level of 95%, the sample size is calculated as follows. The population size is assumed large, but is unknown. So we use the large population version of the sample size formula for estimation of a proportion given by Here this gives , giving exactly. So the sample should be composed of at least 256 individuals to achieve the required level of precision.
coverage of the population, that a fixed percentage of the population should be sampled. For some of the COLOSS surveys, a guideline for acceptable coverage has been that, where possible, at least 5% of beekeepers should be surveyed. This is a simple way to choose sample size, especially in a non-probability sample for which sample size calculations are not valid. Another concern in a smaller population which may be surveyed repeatedly is not to overburden individuals, but to maintain goodwill.
van der Zee et al.
22
This may mean taking a smaller sample than is ideal. Data processing
A high proportion of missing data may indicate inappropriate or
concerns may also limit the sample size.
sensitive questions, for example those which will be important to
If the level of non-response can be anticipated, for example, from
reconsider for the question design of future surveys. Missing data may
recent experience, the calculated or chosen sample size can be
be left as missing for the purposes of the analysis, or a data
increased accordingly, in order still to give a sample of the required
imputation method may be used to replace the missing data with a
size, as
plausible value (De Leeuw et al., 2008, chapter 19).
, where
the new size, and
is the original sample size,
is
is the expected non-response rate as a
proportion, e.g.,
.
Obtaining standard errors of estimates, or confidence intervals, as
2. The proportion of invalid values can be checked. The size of any deviations from what is a valid response is also of interest.
part of the data analysis indicates how precisely the various quantities The response may be a value outside the valid range of responses for of interest have been estimated (see sections 4.1.2. and 10.).
that variable, such as a percentage above 100 or a negative number of colonies lost, or it may be a suspiciously extreme value. This problem occurs when the question was not correctly answered by the
10. Analysis of survey data
respondent, or when the data was not correctly captured at the point
10.1 Assessing data quality
should probably be reformulated. If there is no way of checking what
Prior to the analysis, some assessment and possible improvement of
is the correct answer, the response should be considered as missing
the quality of the data is essential. This is of utmost importance when
data and should be omitted from the analysis.
these data are to be used in statistical models. Errors of different
of data collection or data entry. A question with many invalid answers
3. The proportion of inconsistent values must be checked.
kinds can easily result in false inferences of general patterns, meaning It may be clear from examination of the data that the responses to that effort expended in complex modelling may be largely wasted if
some questions are inconsistent with the responses to some other
the data are unreliable.
questions. For example, the calculation of the number of colonies lost
As numerical data is not directly measured but derived from
in periods when bee management is practised may give a different
surveys, the means of data collection used in the surveys has to be
answer from the number of colonies stated as having been lost. A
designed in such a way that respondents have limited opportunity to
variable recording the difference in these two quantities may be used
generate extreme or erroneous responses. Thorough data validation
as a filter to remove cases with inconsistent data from analysis.
must precede modelling procedures, i.e. checking for out-of-range
These data quality descriptors can be obtained from descriptive
data (invalid responses), and inconsistent responses. The proportion
analysis, for example using summary statistics including the range of
of missing values is also an indication of data quality. See De Leeuw
a variable, tabulations, cross-tabulations and histograms.
et al. (2008), chapters 17-22, for an overview of quality control and data validation for survey data.
10.1.1. Dealing with missing data
If the results of data checking suggest that the data are unreliable, The treatment of missing data is a rather specialised statistical topic. then it may be sensible to limit analysis to simple procedures, or else
Missing data is difficult to deal with adequately in the analysis of
interpret the results of model fitting with some caution. This is also
questionnaire data, especially if it is not "missing at random". Data
true for small data sets where complex model fitting may not be feasible. which is missing at random is such that the responses that would If the selected sample size is known, as for example in a
have been given are not related to the probability of non-response. If
randomized sample, the overall non-response rate can be calculated
data is missing at random, then the data that is available can be
as a first indicator of quality, as a survey with a high non-response
analysed and the results should still be representative of the
rate (a low achieved sample size) may be unrepresentative of the
population, provided that the selected sample was representative. If it
population of interest. Assessing non-response involves comparison of is not missing at random, then the results of analysing the available the actual sample size and the planned sample size (see ยง 9 on choice data are likely to be badly biased. Missing data reduces the number of of sample size).
responses available to analyse and hence reduces the precision of any
Examining responses to individual questions is also necessary. For estimates made. The best approach therefore is to try to minimise the each question, several simple quality measures may be calculated:
chances of data being missing, by careful questionnaire design and by
1. The missing data rate can be checked (for partial non-
choosing a survey mode which gives respondents time to complete all
response).
the questions and secures their co-operation to do so.
The COLOSS BEEBOOK: survey methods
23
10.2. The use of weighting in statistical analysis
well-designed graphs and/or tables can reveal unsuspected patterns
In an analysis of a survey based on random selection, if the survey
in the data, and will ensure that the obvious characteristics of the
does not use simple random sampling or sampling with replacement,
data are clearly understood by readers of any resulting report.
then participants are not all equally likely to be selected from the
Responses to any simple survey question clearly require this
population. In this case, to achieve unbiased estimation, a case
approach, e.g. to determine the proportion of respondents in a postal
weight should be assigned to each of the participants returning data.
survey who are currently beekeepers, where this cannot be
These sampling weights should be inversely proportional to the
determined in advance of choosing the sample, or the proportion
probability of selection of each participant and should sum, over all
wishing to remain anonymous, or the proportion experiencing any
the participants, to the sample size. Sampling weights can only be
colony losses over a specified period. The data on any categorical
calculated if probability sampling is used. The software package SPSS, variable can also be presented in a bar chart and/or a contingency for example, allows a weighted analysis to be carried out.
table, with frequencies and relative frequencies, for an overview of
For example, if a stratified sample is used, based on geographical area, for a case sampled from stratum i the sampling case weight is given by (Ni/N)/(ni/n) =(Nin)/(niN) where N is the population size, Ni is
the responses, the range of values and the most common category. This will also help in identifying invalid responses. Extending this analysis to more than one categorical variable, e.g.
the size of stratum i in the population, ni is the number of people
to compare the proportions of losses experienced by respondents in
sampled from stratum i and n is the total sample size. This requires
different countries, or by geographical area within a single country, or
knowledge of which area or stratum a respondent comes from.
for different sizes of beekeeping operation, two-way tables are useful.
Numbering questionnaires and recording in the data spreadsheet the
Relevant follow-up tests include chi-squared tests of association or
area in a column beside the questionnaire number is probably the
homogeneity, which will permit the statistical investigation of the
best way to ensure that the required information is available.
possible significance of differences in sample proportions. Even if
Inclusion of appropriate questions can make it feasible to set up
observations contributing to each cell in the table are not all
weights to be used in a weighted analysis of the data, however not all independent, the results of this can inform any subsequent modelling, participants may respond to these questions, so it is safer to record
by identifying potential risk factors for colony loss, for example, to be
the information in advance.
included in the model.
Weights can also be used to allow for unit non-response, i.e.
For questions with a quantitative response, of most interest is
where some people do not respond at all. These weights are inversely some measure of a typical or central value. The most appropriate proportional to the probability of responding. So in stratum , each
measure depends on the distribution of the numerical responses.
person would have a non-response weight of
Where these are fairly symmetrically distributed, and there are not
number of people selected from stratum and
where
is the
is the number of
many extreme atypical values, the best measure is the mean or
people responding from that stratum. This and more sophisticated
arithmetical average of the observations. However if the distribution
methods are discussed in Lehtonen and Pahkinen (2004).
of the data is very skewed, and/or there is a fairly large proportion of
The weights for sample design and the weights for non-response
extreme atypical values, then the mean can be seriously misleading.
can both be used at once, by multiplying the two columns of weights
For example, in the distributions of number of colonies kept per
together and rescaling so that the new weights add to the sample
beekeeper, or honey yield, the existence of a few very large numbers
size.
of colonies kept or correspondingly high honey yields has the effect
In a multi-cultural survey, in which different sampling designs may that the mean will give a grossly inflated idea of what is a typical have been used to select participants in different countries, different
value. The number of lost colonies per beekeeper also tends to have a
weight calculations will be needed for respondents from each
highly positively skewed distribution. For such cases the median is
constituent country, and this requires detailed knowledge of the
preferred. This is the central observation, or the mid-point between
different survey designs which were used to select the samples. In
the two central observations, after the data have been arranged in
practice this information may not be readily available.
increasing order of magnitude. Almost as important is some measure of dispersion of the
10.3. Elementary analysis
observations around the mean or median, whichever has been chosen
10.3.1. Descriptive analysis
as being most appropriate. The usual choices are either the standard
Any statistical analysis of data should begin with simple data
deviation for variables for which the mean is used, or the inter-quartile
description and presentation using summary statistics, tables and
range for situations where the median is the appropriate measure of a
plots. While the main interest may well be in modelling, the initial
typical value. (Any first level statistics textbook, such as Ott and
analysis is still an essential first step. The results of such analysis with
Longnecker (2009) or Samuels et al. (2010), will describe the computation
van der Zee et al.
24
of these quantities). Confidence intervals based on the mean are z-
confidence intervals for proportions may be calculated. There
intervals in the case of a large sample, or t-intervals for smaller
are several ways to do this. Alternatively, the average loss
samples. Population means may be compared using Analysis of
rate is the average of the individual loss rates (number of
Variance (ANOVA; see Ott and Longnecker (2009), and Pirk et al. (2013)),
colonies lost divided by number of colonies at risk)
assuming independent observations and independent samples from
experienced by different beekeepers in the sample. Using this
normal distributions. For medians, nonparametric confidence intervals
approach, confidence intervals should be those for an
and tests are available, including the Kruskal-Wallis test as a
average, not a proportion. However, a difficulty of using the
nonparametric equivalent of ANOVA. Nonparametric procedures
average loss rate is that the loss rates experienced by
generally are robust to data which does not conform exactly to the
beekeepers with different sizes of operation are not equally
assumptions of the test procedure.
variable, yet they are weighted equally in the calculation of
Histograms are essential graphical tools to study the nature of the
this average. While the loss rates can only range between 0
probability distribution of a quantitative variable such as number of
and 1 (0 to 100%), larger scale beekeepers have many more
colonies kept or number of colonies lost or honey yield, and hence to
colonies which can be lost, and can experience a much larger
determine whether this is symmetric or skewed. Boxplots can also be
set of possible loss rates within this range; therefore, their
useful in this regard. Comparing these between countries for example
loss rates are subject to greater variation. Also, there are
can indicate differences.
many ties in the individual loss rates, for example due to the
Comparing a histogram visually with the theoretical density
large number of beekeepers with no losses. The median
functions of a range of possible probability distributions is also a
individual loss rate could well be zero. Average individual loss
simple first step in selecting and justifying a plausible model for use in
rate is often higher than overall loss rate, owing to the larger
more advanced statistical modelling of a dataset. The most frequently
number of small scale beekeepers present in many populations
used probability model for the distribution of continuous numerical
of beekeepers, who can suffer extreme individual loss rates.
data is the symmetric bell-shaped Normal or Gaussian distribution.
For this reason, the use of medians and Kruskal-Wallis tests to
However for data which are clearly asymmetrical and skewed, the
compare loss rates should be avoided. Owing to these various
choice is wider. For continuous positive data, the Gamma distribution provides a large family of shapes of probability distribution, or the
difficulties, we recommend use of the overall loss rate. 2. Another difficulty is that the usual procedure to calculate
Beta distribution can be used for positive data over a finite range
standard errors and confidence intervals for the overall loss
between 0 and some given positive value a. For skewed count data,
rate (the proportion of colonies lost) is based on the binomial
the Negative Binomial distribution may be appropriate. For example,
distribution, as the number of losses is limited by the number
data describing number of colony losses contains many zeroes, but
of colonies at risk. This assumes that each bee colony is lost
may also have some rather high numbers lost. Various tests for
or not independently of any other colony, and also that the
goodness of fit can be used to see if any of these models can be
probability of loss is the same for all colonies. Within apiaries,
clearly ruled out, but often the final choice is governed by
whether or not a colony is lost is likely dependent on whether
considerations of convenience and mathematical tractability.
or not neighbouring colonies are lost. Furthermore, the probabilities of losing a colony are likely to differ between
10.3.2. Loss calculations and Confidence Intervals 1. Regarding loss rates, rather than the raw numbers of colonies
beekeepers. One way to account for that extra source of variation in the data is to model the data using a
kept and number of colonies lost which are used in their
generalisation of the binomial distribution. There are different
calculation, different quantities are of interest. The overall loss
ways to do this. One approach uses generalised linear
rate is the proportion calculated as the total number of lost
modelling using a quasi-binomial distribution and a logit link
colonies in the sample of beekeepers divided by the total
function, and derives a confidence interval for the overall loss
number of colonies at risk of loss in the sample.
rate based on the standard error of the estimated intercept in
(VanEngelsdorp et al. (2013) refer to this as "total loss". As
an intercept-only model (see VanEngelsdorp et al. (2012) and
this suggests to us the total number of colonies lost rather than any kind of rate or proportion, we prefer the terms
below). 3. Another approach to calculating confidence intervals, when it
overall loss rate or overall proportion of colonies lost).
is felt that formulae based on parametric models are not
Adjustments can be made to this calculation to take account
appropriate, is to use the nonparametric bootstrap approach,
of colony management (VanEngelsdorp et al., 2012). The
based on resampling the data (Efron and Tibshirani, 1994).
overall loss rate is influenced disproportionately by the larger
This avoids the need to specify any particular model for the data.
beekeepers, who are fewer in number. Using this approach,
This is easy to implement in a software package such as R.
The COLOSS BEEBOOK: survey methods
25
10.3.3. Loss rate per factor including stratification on the
for the observations (beekeepers or operations) grouped together by
operation size
a single factor (such as country, or involvement (or not) in commercial
The loss calculations and confidence intervals described above can be
pollination). Comparing these loss rate estimates and confidence
used as a means to identify risk factors for colony loss, by looking for
intervals for the loss rates can indicate differences between the
confidence intervals that do not overlap each other. Total loss of
groups and hence potential risk factors relating to the risk of colony
operations reporting or not reporting a particular management type
loss. The overall loss rate is a problematic estimator when the
(e.g. transport of colonies) can be compared using the chi-square test contribution of multiple factors to the risk of loss has to be determined, (as in VanEngelsdorp et al., 2010, 2011, for example). The loss rates
since factor responses may be associated, not independent of each
of operations grouped by factors presumed to be involved in colony
other. For example, commercial pollination is more common in certain
mortality (starvation, high varroa infestation etc.) can also be compared. countries than others. Larger scale beekeepers contribute more to the Of course, this analysis does not give any information on, or account for, interdependencies of different factors, for which model fitting is needed (as described below). To account for known or obvious differences among beekeeping
overall loss rate than smaller scale beekeepers. A statistical approach that deals with the difficulties of overall loss rate and enables conclusions on how factors (bee race, pollination practices, size of operation, honey yield, location etc.) influence colony
operations, a first stratification, for example on operation size, can be
losses is regression analysis (see Zuur et al. (2009) and Pirk et al. (2013)).
accomplished, by classifying operations as hobby, side-line or
In regression analysis, the numerical outcome of the essential
commercial. Alternatively the number of colonies per beekeeper can
questions (number of colonies lost, number of colonies alive or the
be used as a basis for stratification.
calculated population at risk) is linked to the factors through a linear
Depending on the size of the survey and cultural differences between
model. In the analysis of bee colony losses, many of the response
the target populations, beekeeping operations can be split into three
variables of interest are positively skewed (having a long tail to the
operation size classes, for example
right) and so generalized linear regression models (GZLMs) are
small operations (≤50 colonies),
appropriate. These models assume that the observations yi arise
intermediate operations (51-500 colonies),
independently from a specified family of probability distributions, and
large scale operations (> 500 colonies).
independent variables or factors x j,i, j=1,…, k, are used to provide a set of linear predictors
If the scale of beekeeping in the survey population is limited mainly to small and intermediate operations, the classes can be split further as:
small hobbyist beekeepers (≤15 colonies),
such that g(µi)= ηi, where µi is the mean of yi, and the βi are model
large hobbyist beekeepers (16-50 colonies),
coefficients to be estimated. Using GZLMs requires the specification of
small-commercial beekeepers (51-150 colonies),
an appropriate probability distribution for the response variable y and
larger-commercial beekeepers (150-500 colonies).
also an appropriate form for the link function g (Krzanowski, 1998; McCullagh and Nelder, 1983).
When comparing several operation size classes, a chi-square test
The dependent variable of interest, the loss rate, is binary in the
can be used first to compare all size classes, and if the result of this is nature of its components (the number of lost colonies divided by the significant, it can be followed up by pairwise multiple comparisons,
number of colonies at risk makes up the loss rate). This property
again using the chi -square test or a z-test of the difference in two
leads to models that use a binomial distribution for the dependent
proportions. In each such pairwise test, the significance level to reject variable. Each colony can be regarded as a “Bernoulli trial” resulting in the null hypothesis should be Bonferroni adjusted (i.e. divided by the
no loss or a loss (0 or 1 respectively), and the number of lost colonies
number of tests being conducted) to reduce the rate of false
for a beekeeper can be regarded as a “binomial trial” of a certain size
rejections of the null hypothesis that operations of different sizes have n (total number of colonies at risk, or number alive before the winter equal rates of loss. It should be borne in mind that the chi-squared
rest period) with a certain probability (p) of any one colony being lost
test and z-test assume independent observations and therefore have
after winter (an “event”) and probability 1-p of the colony being alive
their limitations.
after winter (a “non-event”). If x is the number of events per beekeeper, then the binomial probability distribution describing the
10.4. Advanced analysis; identification of risk
probability of x events has the formula
factors by logistic regression 10.4.1. Logistic regression Elementary analysis of the answers to the essential questions, regarding colony losses, can yield an estimate of the overall loss rate
with the mean value of x given by np and variance of x by np(1-p). Groups of beekeepers or operations can be seen as series of binomial trials which vary in size, and also with different probabilities
van der Zee et al.
26
of an event, p. Hence it is of interest to model the probability of loss
different numbers (heterogeneity of the sample population). An
for (groups of) beekeepers or operations characterized by different
important assumption of a binomial distribution, namely independence
values of the risk factors involved, such as country or operation size
of observations (independent Bernoulli trials), might be violated when
or migratory practice.
losses are not independent (are clustered) through an unknown factor
Probabilities cannot be used directly as a response variable in a classical linear regression model, as probabilities can only have values ranging from 0 to 1, whereas continuous response variables can have
(i.e. effects of a certain location, incidence of pathogens) that cannot be used (properly) in the model. When under- or over-dispersion are not reduced after using the
any value. The solution for this problem is moving from the probability most significant model factors derived from the data and/or stratifying to the “odds” (p/(1-p)) and calculating the logarithm of the odds, the
available data according to binomial trial size, the solution is using a
“logit”, to be used as the dependent variable. The first step, taking
different distribution for the dependent variable. A suitable candidate
the odds, removes the boundary of 1 as the odds can have any
is the quasi-binomial distribution, in which variance is characterised by
positive value, while taking the logit in the second step removes the
adding an additional parameter to the binomial distribution, and
boundary of 0 as the logarithm can be negative (for odds less than 1). hypothesis testing can be corrected for the extra-binomial variance. A probability of 50% has an odds of 1 and a logit of 0, with negative
The form of the quasi-binomial probability distribution is:
and positive logits corresponding to probabilities of less than and more than 50% respectively. Generalized linear models of this nature are called logistic
regression models, and can be expressed in the form
See the manual available online by Kindt and Coe (2005) for an excellent example of the use of a quasi-binomial distribution and its differences compared to the standard binomial distribution. An excess of zero values (no loss) can be a cause of over-dispersion. To investigate
where the βi are model coefficients to be estimated and x j,i, j=1,…, k, the relation between predictor variables and the presence of zero are the values of the k independent variables or factors used in the
values (no loss), zero-inflation techniques can be used (for example,
model for prediction of the log odds of loss for case i.
Hall (2000)).
Substituting the values and the estimated parameters into the right hand side of the equation enables prediction of the log odds of
10.4.3. Multilevel analysis
an event for that beekeeper or operation or group of operations. If
Clustering of losses results in over-dispersed data, but clustering
y
y
this gives a value y, then taking the inverse logit e /(1+e ) gives the
might very well be a biologically relevant phenomenon. A method to
prediction of the probability pi itself.
investigate correlations between groups of observations is to perform
Kleinbaum and Klein (2002), Hosmer and Lemeshow (2000) and
multilevel analysis by means of fitting models that contain random
Agresti (2002) give an in-depth explanation of the principles of logistic effects (random effects models and mixed models). Classic examples regression, their interpretation, and the construction of best fitting
of multilevel analysis include schools or hospitals as random factors in
models.
an analysis of dependent variables on the level of students or patients
When honey bee loss data are involved in the analysis, several
respectively. In the case of colony losses, suitable data levels for
specific characteristics of these data and their analysis have to be
random effects are often spatial in nature, as colonies are clustered
addressed, as are now described.
by beekeepers, beekeepers are clustered in regions or habitat types and the latter are clustered within countries.
10.4.2. Dispersion in statistical models
See Twisk (2010) and Zuur et al. (2009) for practical application
For a binomial distribution, the variance np(1-p) depends on the mean of multilevel analysis methods. Rodríguez (2008) is also useful. A
np. When the variance in the observations is bigger or smaller than
good online resource for multilevel analysis can be found at the
the expected variance, data are said to show over- or under-dispersion. homepage of the University of Bristol Centre for Multilevel Modelling Both types of dispersion are indicated by the goodness-of-fit tests of
(at http://www.bristol.ac.uk/cmm/).
fitted models by the ratio of the residual deviance of the fitted model to the number of degrees of freedom, values appreciably larger than
10.4.4. Software for logistic regression models
1 indicating over-dispersion and values lower than1 indicating under-
Logistic regression can be conducted using generally available
dispersion. Both types can strongly affect and invalidate model
statistical software. The software packages R, SAS, STATA and MLwiN
hypothesis testing (standard errors, confidence intervals and p-
are able to perform logistic multilevel regression. The latest version of
values). See Twisk (2010), Zuur et al. (2009), Hardin and Hilbe (2007) SPSS (19) also has a mixed model procedure but has no option (at and Myers et al. (2002) for examples. Causes of under- or over-
the time of writing) to use quasi-binomial distributions. For an
dispersion can be related to the frequency characteristics of the data,
evaluation of different software used for logistic multilevel analysis,
with relatively small and large beekeepers/operations present in
see Twisk (2010).
The COLOSS BEEBOOK: survey methods
27
10.4.5. Example of advanced analysis
1st October 2010, and Loss1011, the stated number of colonies lost
The analysis below uses the Dutch data collected with the full 2011
over winter 2010/2011, rather than the calculated population at risk
COLOSS questionnaire, as an example of how to estimate overall loss
or calculated colonies lost. Even so, in one case Loss1011 was missing
rates, calculate confidence intervals and fit GZLMs. It uses the quasi-
and in six other cases Loss1011 was greater than ColOct10, causing
binomial family of GZLMs, to account for any extra-binomial variation
negative calculated values of a new variable, NotLost, the number of
in the data. It is a simple illustration of how model fitting can be done
colonies surviving. In some cases, though not all, this was due to
in R, with factors and covariates, rather than a procedure for
winter management (making in/decreases) of colonies. These few
determining a best fitting model. Guidance on model building may be
cases were also removed before carrying out the analysis shown
found, for example, in Dobson (2002) and Zuur et al. (2009).
below.
The data was “cleaned” prior to use to remove some inconsistent values. The “glm” procedure in R is sensitive to invalid values in the
The analysis does not show all available options for the “glm” procedure. Several diagnostic plots are available, for example.
data, and will generate error messages rather than omit the cases with invalid data values, so it is best to deal with these before
a. Calculation of overall loss rate and confidence interval from a null model (Boxes 12-14).
attempting model fitting (or any other kind of analysis). The analysis
b. Fitting a GZLM with an explanatory term.
below uses the variables ColOct10 as the number of colonies kept at
Box 12. Reading in and setting up the data for further analysis. Read in the data, in this case in csv format: >dutch<-read.csv("cleaner_dutchdata.csv", header=T,sep=",")
Check the first few rows and columns: >dutch[1:5,1:6] 1 2 3 4 5
Validity 0 0 0 0 0
COLOSSID2011 6528 6529 6531 6532 6533
IDBeekeeper 1426 1607 5048 5296 5396
Country 167 167 167 167 167
Region NA NA NA NA NA
City
Den Hoorn Amsterdam Amsterdam
Load the data into the memory, so variables can be identified by name: >attach(dutch)
Check the descriptive data for the variables: >summary(ColOct10) Min. 1.000
1st Qu. 3.000
Median 5.000
Mean 8.932
3rd Qu. 9.000
Max. 401.000
1st Qu. 0.000
Median 1.000
Mean 1.905
3rd Qu. 2.000
Max. 67.000
3rd Qu. 7.000
Max. 354.000
> summary(Loss1011) Min. 0.000
Calculate a new variable, the number of colonies not lost (alive), combine this with the data set and check the descriptive statistics of this variable: > NotLost<-ColOct10 - Loss1011 > dutch<-cbind(dutch,NotLost) > summary(NotLost) Min. 0.000
1st Qu. 2.000
Median 4.000
Mean 7.027
van der Zee et al.
28
Box 13. Fitting a quasibinomial intercept-only model for estimation of the overall loss rate. Estimate the overall loss rate by fitting the null (intercept only) model, omitting any missing values. The overall loss rate is the predicted probability of loss. > dutch.glm1<-glm(cbind(Loss1011,NotLost)~1, +family=quasibinomial(link="logit"),data=dutch,na.action=na.omit) > summary(dutch.glm1) Call: glm(formula = cbind(Loss1011, NotLost) ~ 1, + family = quasibinomial(link = "logit"),data = dutch, na.action = na.omit) Deviance Residuals: Min -9.0730
1Q -1.3851
Median -0.6480
3Q 0.8932
Max 10.7613
Estimate -1.30553
Std. Error 0.03732
t value -34.98
Pr(>|t|) <2e-16 ***
Coefficients: (Intercept)
--Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1 (Dispersion parameter for quasibinomial family taken to be 3.196163) Null deviance: 4979 on 1530 degrees of freedom Residual deviance: 4979 on 1530 degrees of freedom AIC: NA Number of Fisher Scoring iterations: 4 > dutch.glm1$fitted.values[1] 1 0.2132358
The overall loss rate 0.213 can also be calculated directly: > overall_loss<-sum(Loss1011)/sum(ColOct10) > overall_loss [1] 0.2132358
Or it can be calculated as the inverse logit of the estimated coefficient (the intercept) of the model. For this the inverse logit function of the bootstrap library is used: > library(boot) > inv.logit(coef(dutch.glm1)) (Intercept) 0.2132358
Box 14. Calculating a confidence interval for the overall loss rate, using results from Box 12. To calculate the 95% confidence interval (CI) for the overall loss rate, the standard error of the null model intercept is stored and used in the formula for the normal approximation interval or t-interval, and then the inverse logit of the result is calculated. If using the t-interval, the value of df below is the residual degrees of freedom from the model fitting above. The t-interval is recommended for smaller samples. While it makes little difference for this data, it is used in the further analysis for greater generality. > se.glm1<-0.03732 > inv.logit(coef(dutch.glm1)+c(-1,1)*1.96*se.glm1) [1]
0.2012216
0.2257647
> inv.logit(coef(dutch.glm1)+c(-1,1)*qt(0.975, df=1530)*se.glm1) [1]
0.2012125
0.2257746
The COLOSS BEEBOOK: survey methods
29
The second step in model building is the use of explanatory variables.
is one that is largely outside of the beekeeper’s control, rather like
Explanation of the methods for evaluating model fit and determining
pesticide use by farmers, yet for various reasons may be associated
optimal models is outside the scope of this document. For this
with the loss rate. In some countries, region may be a substitute for
example analysis, the variable Region is used. The region variable
meteorological variables. Boxes 15 to 18 and Fig. 3 show the analysis.
Box 15. Fitting a quasibinomial GZLM with one explanatory factor. The categorical predictor variable “Region” is added to the model by means of the as.factor command. A continuous predictor variable would be added in the same way, but omitting the use of as.factor(). Significant effects of several regions are found. The intercept corresponds to the first level of the factor, i.e. region 2073. Note that there are large differences in the number of observations between regions (shown by the tabulation of Region below, giving frequencies for each of regions 2073 to 2086) so differences in loss have to be interpreted cautiously. > region.glm1<-glm(cbind(Loss1011,NotLost)~ as.factor(Region), + family=quasibinomial(link="logit"),data=dutch,na.action=na.omit) > region.summary<-summary(region.glm1) >region.summary Call: glm(formula = cbind(Loss1011, NotLost) ~ as.factor(Region), + family = quasibinomial(link = "logit"), data = dutch, na.action = na.omit) Deviance Residuals: Min -8.0276
1Q -1.2511
Median -0.6123
3Q 0.8868
Max 9.3824
Coefficients: Estimate Std. Error (Intercept) -1.36639 0.12719 as.factor(Region)2074 0.41251 0.32822 as.factor(Region)2075 0.49789 0.18588 as.factor(Region)2076 -0.16554 0.15226 as.factor(Region)2077 0.52147 0.20211 as.factor(Region)2079 -0.11394 0.18460 as.factor(Region)2080 0.36701 0.15172 as.factor(Region)2081 0.01721 0.18930 as.factor(Region)2082 0.08012 0.18101 as.factor(Region)2083 0.05483 0.19392 as.factor(Region)2084 -0.78537 0.39354 as.factor(Region)2086 -0.21667 0.19578 --Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1
T value -10.743 1.257 2.679 -1.087 2.580 -0.617 2.419 0.091 0.443 0.283 -1.996 -1.107
Pr(>|t|) < 2e-16 *** 0.20902 0.00747 ** 0.27713 0.00997 ** 0.53720 0.01568 * 0.92759 0.65809 0.77742 0.04615 * 0.26861
(Dispersion parameter for quasibinomial family taken to be 3.106299) Null deviance: 4895.9 on 1509 degrees of freedom Residual deviance: 4734.8 on 1498 degrees of freedom (21 observations deleted due to missingness) AIC: NA Number of Fisher Scoring iterations: 4 >table(Region) Region 2073 116
2074 25
2075 108
2076 327
2077 76
2079 95
2080 208
2081 118
2082 151
2083 115
2084 37
2086 134
van der Zee et al.
30
Box 16. Testing factor significance, and obtaining confidence intervals for log odds of loss per region. To determine if the fitted model gives better prediction than the null model, the models are compared by means of an ANOVA. In this case the model with the factor region is a significantly better predictor of loss than the null model: >anova(region.glm1,test="F") Analysis of Deviance Table Model: quasibinomial, link: logit Response: cbind(Loss1011, NotLost) Terms added sequentially (first to last) Df Deviance Resid. Df Resid. Dev NULL 1509 4895.9 as.factor(Region) 11 161.09 1498 4734.8 --Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1
F
Pr(>F)
4.7143
3.912e-07***
Odds, probabilities and corresponding CIs can be calculated for the factor levels. For example, to get just the predicted loss rate for the region coded 2074: > predict(region.glm1, data.frame(Region=2074),type="response") 1 0.2781065
Or for all the regions, and requesting standard errors for calculation of confidence intervals: > + > > >
values<-predict(region.glm1,data.frame(Region=levels(as.factor(Region))), type="link",se.fit=T) logodds<-values$fit lowerlim<-values$fit-qt(0.975, df= 1498)*values$se.fit upperlim<-values$fit+qt(0.975, df= 1498)*values$se.fit
Approximate 95% CIs for the log odds of loss per region, given as the lower limit, log odds and upper limit respectively: > cbind(lowerlim, logodds, upperlim)
1 2 3 4 5 6 7 8 9 10 11 12
lowerlim -1.615869 -1.547393 -1.134385 -1.696136 -1.153013 -1.742775 -1.161645 -1.624211 -1.538904 -1.598711 -2.882287 -1.875024
logodds -1.3663880 -0.9538734 -0.8685001 -1.5319275 -0.8449141 -1.4803233 -0.9993760 -1.3491820 -1.2862660 -1.3115591 -2.1517622 -1.5830575
upperlim -1.1169065 -0.3603536 -0.6026148 -1.3677194 -0.5368147 -1.2178717 -0.8371073 -1.0741526 -1.0336283 -1.0244077 -1.4212369 -1.2910912
The COLOSS BEEBOOK: survey methods
31
Box 17. Obtaining confidence intervals for the odds of loss and the model coefficients. Approximate 95% CIs for the odds of loss per region, given as the lower limit, odds and upper limit respectively: > odds<-exp(logodds) > cbind(exp(lowerlim),odds, exp(upperlim))
1 2 3 4 5 6 7 8 9 10 11 12
0.1987178 0.2128020 0.3216197 0.1833908 0.3156840 0.1750340 0.3129710 0.1970670 0.2146163 0.2021570 0.0560065 0.1533513
odds 0.2550265 0.3852459 0.4195804 0.2161187 0.4295943 0.2275641 0.3681091 0.2594524 0.2763006 0.2693997 0.1162791 0.2053463
0.3272907 0.6974296 0.5473785 0.2546871 0.5846074 0.2958592 0.4329611 0.3415871 0.3557140 0.3590091 0.2414152 0.2749706
Approximate 95% CIs for the odds ratios per region, relative to the reference region, can be obtained from 95% CIs for the coefficients in the model, which we find first: >coeffs<-region.summary$coef[,1] >se.coeffs<-region.summary$coef[,2] >coeffs.lowerlim<-coeffs-qt(0.975, df=1498)*se.coeffs >coeffs.upperlim<-coeffs+qt(0.975, df=1498)*se.coeffs >coeffs.CIs<-cbind(coeffs.lowerlim, coeffs, coeffs.upperlim)
These are the CIs for the model coefficients: >coeffs.CIs
(Intercept) as.factor(Region)2074 as.factor(Region)2075 as.factor(Region)2076 as.factor(Region)2077 as.factor(Region)2079 as.factor(Region)2080 as.factor(Region)2081 as.factor(Region)2082 as.factor(Region)2083 as.factor(Region)2084 as.factor(Region)2086
coeffs.lowerlim -1.61586947 -0.23130745 0.13328402 -0.46421217 0.12503197 -0.47604280 0.06940126 -0.35411884 -0.27493680 -0.32556165 -1.55732512 -0.60070769
coeffs -1.36638799 0.41251455 0.49788793 -0.16553956 0.52147392 -0.11393532 0.36701199 0.01720602 0.08012204 0.05482889 -0.78537421 -0.21666949
coeffs.upperlim -1.1169065 1.0563366 0.8624918 0.1331331 0.9179159 0.2481722 0.6646227 0.3885309 0.4351809 0.4352194 -0.0134233 0.1673687
van der Zee et al.
32
Box 18. Obtaining confidence intervals for odds ratios and probability of loss, per region. >odds.ratios<-exp(coeffs) >odds.ratios.CIs<-cbind(exp(coeffs.lowerlim), odds.ratios, exp(coeffs.upperlim))
The CIs for the odds ratios (excluding the baseline category) are as follows, given as the lower limit, odds ratio and upper limit respectively : >odds.ratios.CIs[-1,] as.factor(Region)2074 as.factor(Region)2075 as.factor(Region)2076 as.factor(Region)2077 as.factor(Region)2079 as.factor(Region)2080 as.factor(Region)2081 as.factor(Region)2082 as.factor(Region)2083 as.factor(Region)2084 as.factor(Region)2086
0.7934955 1.1425745 0.6286302 1.1331847 0.6212369 1.0718662 0.7017916 0.7596201 0.7221217 0.2106989 0.5484234
odds.ratios 1.5106115 1.6452427 0.8474363 1.6845087 0.8923157 1.4434152 1.0173549 1.0834193 1.0563598 0.4559490 0.8051960
2.8758163 2.3690566 1.1424020 2.5040662 1.2816806 1.9437570 1.4748125 1.5452425 1.5453021 0.9866664 1.1821901
Note that the CIs excluding 1 correspond to the significant regions in the summary.region model output. 95% confidence intervals and point estimates of the probability of loss for each region, given as the lower limit, estimated probability and upper limit respectively: > library(boot) > prob<-inv.logit(logodds) > cbind(inv.logit(lowerlim), prob, inv.logit(upperlim)) 1 2 3 4 5 6 7 8 9 10 11 12
0.16577531 0.17546308 0.24335270 0.15497064 0.23993910 0.14896082 0.23836856 0.16462490 0.17669472 0.16816191 0.05303613 0.13296150
prob 0.2032040 0.2781065 0.2955665 0.1777118 0.3005008 0.1853786 0.2690641 0.2060041 0.2164855 0.2122261 0.1041667 0.1703629
0.2465855 0.4108740 0.3537457 0.2029886 0.3689289 0.2283112 0.3021444 0.2546142 0.2623813 0.2641697 0.1944677 0.2156682
The row numbers 1-12 of the above output correspond with the order of the region names in the Figure below, which shows the estimated probability and its 95% CI for each region. Some of the confidence intervals overlap each other, indicating that there is no significant difference between these pairs of regions in terms of probability of loss. However, significant differences between some groups of regions can be seen. Gelderland, Limburg, Zeeland and Zuid-Holland have a lower probability than Friesland and Groningen and Noord-Brabant.
The COLOSS BEEBOOK: survey methods
33
funded through the COST Action FA0803. COST (European Cooperation in Science and Technology) is a unique means for European researchers to jointly develop their own ideas and new initiatives across all scientific disciplines through trans-European networking of nationally funded research activities. Based on a panEuropean intergovernmental framework for cooperation in science and technology, COST has contributed since its creation more than 40 years ago to closing the gap between science, policy makers and society throughout Europe and beyond. COST is supported by the EU Seventh Framework Programme for research, technological development and demonstration activities (Official Journal L 412, 30
December 2006). The European Science Foundation as implementing agent of COST provides the COST Office through an EC Grant Agreement. The Council of the European Union provides the COST Secretariat. The COLOSS network is now supported by the Ricola Foundation - Nature & Culture.
Fig. 3. Estimated probability of loss and 95% confidence interval per region.
13. References AAPOR (2011) Standard definitions: final dispositions of case codes
11. Conclusions
and outcome rates for surveys. The American Association for Public Opinion Research. Available at: http://www.esomar.org/
Estimating colony loss rates reliably depends both on selecting
uploads/public/knowledge-and-standards/codes-and-guidelines/
representative samples of beekeepers and also on using suitable
ESOMAR_Standard-Definitions-Final-Dispositions-of-Case-Codes-
methods of estimation. Examining potential risk factors for losses also
and-Outcome-Rates-for-Surveys.pdf
requires use of suitable statistical methodology. Standardisation of methodology will enable valid comparisons of loss rates to be made across time and between/within countries. Standardisation of terminology avoids confusion and facilitates the required comparisons. In this manuscript, we have defined terminology associated with
AGRESTI, A (2002) Categorical data analysis (2nd Ed.). John Wiley and Sons, Inc., Hoboken, NJ, USA. BRODSCHNEIDER, R; MOOSBECKERHOFER, R; CRAILSHEIM, K (2010) Surveys as a tool to record winter losses of honey bee colonies: a two year case study in Austria and South Tyrol. Journal of
colony losses, and have presented the concepts involved in
Apicultural Research 49(1): 23-30.
conducting a survey. The latter ranges from choosing the method of
http://dx.doi.org/10.3896/IBRA.1.49.1.04
data collection to designing the questionnaire and how to select a
CAMPBELL, M J; WATERS, W E (1990) Does anonymity increase the
representative sample and guidelines for choosing the sample size.
response rate in postal questionnaire surveys about sensitive
Practical suggestions and examples are given.
subjects? A randomised trial. Journal of Epidemiology and
We have examined many of the difficulties of conducting surveys and the important or most likely sources of error in surveys. Being aware of the potential for error makes it more likely that the survey organiser will be careful to avoid practices which are likely to introduce error into a survey, and therefore should achieve a more
Community Health 44: 75-76. http://dx.doi.org/10.1136/jech.44.1.75 CHARRIERE, J D; NEUMANN, P (2010) Surveys to estimate winter losses in Switzerland. Journal of Apicultural Research 49(1): 132133. http://dx.doi.org/10.3896/IBRA.1.49.1.29 COX-FOSTER, D L; CONLAN, S; HOLMES, E C; PALACIOS, G; EVANS, J
reliable result. We have also reviewed relevant methods for assessing
D; MORAN, N A; QUAN, P; BRIESE, T; HORNIG, M; GEISER, D M;
the quality of the data and for statistical analysis, and have illustrated
MARTINSON, V; VANENGELSDORP, D; KALKSTEIN, A L;
the more advanced techniques proposed for analysis.
DRYSDALE, A; HUI, J; ZHAI, J; CUI, L; HUTCHISON, S K; SIMONS, J F; EGHOLM, M; PETTIS, J S; LIPKIN, W I (2007) A metagenomic survey of microbes in honey bee colony collapse disorder. Science
12. Acknowledgements
318: 283-287. http://dx.doi.org/10.1126/science.1146498 DAHLE, B (2010) The role of Varroa destructor for honey bee colony
The COLOSS (Prevention of honey bee COlony LOSSes) network aims
losses in Norway. Journal of Apicultural Research 49(1): 124-125.
to explain and prevent massive honey bee colony losses. It was
http://dx.doi.org/10.3896/IBRA.1.49.1.26
van der Zee et al.
34
DE LEEUW, E D (2008) Choosing the method of data collection. In E D MCCULLAGH, P; NELDER, J A (1983) Generalized Linear Models.
De Leeuw, J J Hox, and D A Dillman (Eds). International handbook of survey methodology. Lawrence Erlbaum Associates, Taylor & Francis Group; New York, USA. pp 113-135. DE LEEUW, E D; HOX, J J; DILLMAN, D A (Eds) (2008) International
handbook of survey methodology. Lawrence Erlbaum Associates, Taylor & Francis Group; New York, USA. DOBSON, A J (2002) An introduction to Generalized Linear Models
(2nd Ed.). Chapman & Hall / CRC; Boca Raton, Florida, USA. EFRON, B; TIBSHIRANI, R J (1994) An introduction to the bootstrap. Chapman and Hall / CRC; New York, USA. ELLIS, J D; GRAHAM, J R; MORTENSEN, A (2013) Standard methods
Chapman and Hall Ltd; London, UK. MUTINELLI, F; COSTA, C; LODESANI, M; BAGGIO, A; FORMATO, G; MEDRZYCKI, P; PORRINI, C (2010). Honey bee colony losses recorded in Italy. Journal of Apicultural Research 49(1): 119-120. http://dx.doi.org/10.3896/IBRA.1.49.1.24 MYERS, R H; MONTGOMERY, D C; VINING, G G (2002) Generalized
Linear Models: with applications in engineering and the sciences. John Wiley and Sons, Inc.; New York, USA. NEUMANN, P; PIRK, C W W; SCHÄFER, M O; EVANS, J D; PETTIS, J S; TANNER, G; WILLIAMS, G R; ELLIS, J D (2013) Standard methods for small hive beetle research. In V Dietemann; J D Ellis, P Neumann
for wax moth research. In V Dietemann; J D Ellis; P Neumann (Eds)
(Eds) The COLOSS BEEBOOK: Volume II: Standard methods for
The COLOSS BEEBOOK, Volume II: standard methods for Apis
Apis mellifera pest and pathogen research. Journal of Apicultural
mellifera pest and pathogen research. Journal of Apicultural
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.19
Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.10
NGUYEN, B K; MIGNON, J; LAGET, D; DE GRAAF, D C; JACOBS, F J;
GRAY, A; PETERSON, M; TEALE, A (2010) An update on colony losses
VANENGELSDORP, D; BROSTAUX, Y; SAEGERMAN, C; HAUBRUGE,
in Scotland from a sample survey covering 2006-2008. Journal of
E (2010) Honey bee colony losses in Belgium during the 2008-2009
Apicultural Research 49(1): 129-131.
winter. Journal of Apicultural Research 49(4): 337-339.
http://dx.doi.org/10.3896/IBRA.1.49.1.28
http://dx.doi.org/10.3896/IBRA.1.49.4.07.
GRAY A; PETERSON, M (2012) SBA member surveys 2010/2011 (main OTT, R L; LONGNECKER, M (2009) An introduction to statistical results). The Scottish Beekeeper 89(12): 312-316. GROVES, R M (2006) Nonresponse rates and nonresponse bias in household surveys. Public Opinion Quarterly 70(5): 646-675. http://dx.doi.org/10.1093/poq/nfl033 HALL, D B (2000) Zero-inflated Poisson and Binomial regression with random effects: a case study. Biometrics 56: 1030-1039. HARDIN, J W; HILBE, J M (2007) Generalized Linear Models and
extensions (2nd Ed.). Stata Press; Texas, USA. HATJINA, F; BOUGA, M; KARATASOU, A; KONTOTHANASI, A;
methods and data analysis. (6th Ed.). Brooks / Cole, Cengage Learning; Belmont, CA, USA. PETERSON, M; GRAY, A; TEALE, A (2009) Colony losses in Scotland in 2004-2006 from a sample survey. Journal of Apicultural Research 48(2): 145-146. http://dx.doi.org/10.3896/IBRA.1.48.2.11 PIRK, C W W; DE MIRANDA, J R; FRIES, I; KRAMER, M; PAXTON, R; MURRAY, T; NAZZI, F; SHUTLER, D; VAN DER STEEN, J J M; VAN DOOREMALEN, C (2013) Statistical guidelines for Apis mellifera research. In V Dietemann; J D Ellis; P Neumann (Eds) The
CHARISTOS, L; EMMANOUIL, C; EMMANOUIL, N; MAISTROS, A-D
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
(2010) Data on honey bee losses in Greece: a preliminary note.
research. Journal of Apicultural Research 52(4):
Journal of Apicultural Research 49(1): 116-118.
http://dx.doi.org/10.3896/IBRA.1.52.4.13
http://dx.doi.org/10.3896/IBRA.1.49.1.23 HOSMER, D W; LEMESHOW, S (2000) Applied Logistic Regression
(2nd Ed.). John Wiley and Sons, Inc.; New York, USA. KINDT, R; COE, R (2005) Tree diversity analysis. A manual and software for common statistical methods for ecological and biodiversity studies. Nairobi: World Agroforestry Centre (ICRAF). Available at http://www.worldagroforestry.org/downloads/ publications/PDFs/B13695.pdf. KLEINBAUM, D G; KLEIN, M (2002) Logistic Regression: a self-learning
text (2nd Ed.). Springer-Verlag; New York, USA. KRZANOWSKI, W J (1998) An introduction to statistical modelling. Arnold Publishers; London, UK. LEHTONEN, R; PAHKINEN, E (2004) Practical methods for design and
RODRIGUEZ, G (2008) Multilevel Generalized Linear Models. In J De
Leeuw; E Meijer (Eds). Handbook of multilevel analysis. Springer; New York, USA. Chapter 9. SAMUELS, M L; WITMER, J A; SCHAFFNER, A (2010) Statistics for the
life sciences (4th Ed.). Pearson; USA. SÄRNDAL, C-E; SWENSSON, B; WRETMAN, J (1992) Model-assisted
survey sampling. Springer-Verlag; New York, USA. SCHAEFFER, R L; MENDENHALL, W; OTT, L (1990) Elementary survey
sampling (4th Ed.). PWS-Kent Publishing Company; Boston, USA. SOROKER, V; HETZRONI, A; YAKOBSON, B; DAVID, D; DAVID, A; VOET, H; SLABETZKI, Y; EFRAT, H; LEVSKI, S; KAMER, Y; KLINBERG, E; ZIONI, N; INBAR, S; CHEJANOVSKY, N (2010) Evaluation of colony losses in Israel in relation to the incidence of
analysis of complex surveys (2nd Ed.). John Wiley and Sons Ltd;
pathogens and pests Apidologie 42: 192-199.
Chichester, UK.
http://dx.doi.org/10.1051/Apido/2010047
LOHR, S L (2010) Sampling: design and analysis (2nd Ed.). Brooks / Cole, Cengage Learning; Boston, USA.
The COLOSS BEEBOOK: survey methods
TOPOLSKA, G; GAJDA, A; POHORECKA, K; BOBER, A; KASPRZAK, S;
35
VANENGELSDORP, D; UNDERWOOD, R M; CARON, D; HAYES, J Jr;
SKUBIDA, M; SEMKIW, P (2010) Winter colony losses in Poland.
PETTIS, J S (2011) A survey of managed honey bee colony losses
Journal of Apicultural Research 49(1): 126-128.
in the USA, fall 2009 to spring 2010. Journal of Apicultural
http://dx.doi.org/10.3896/IBRA.1.49.1.27
Research 50(1): 1-10. http://dx.doi.org/10.3896/IBRA.1.50.1.01
TWISK, J W R (2010) Applied multilevel analysis. A practical guide
(4th Ed.). Cambridge University Press; Cambridge, UK. VAN DER ZEE, R (2010) Colony losses in the Netherlands. Journal of
VANENGELSDORP, D; BRODSCHNEIDER, R; BROSTAUX, Y; VAN DER ZEE, R; PISA, L; UNDERWOOD, R; LENGERICH, E J; SPLEEN, A; NEUMANN, P; WILKINS, S; BUDGE, G E; PIETRAVALLE, S; ALLIER,
Apicultural Research 49(1): 121-123.
F; VALLON J; HUMAN, H; MUZ, M; LE CONTE, Y; CARON, D;
http://dx.doi.org/10.3896/IBRA.1.49.1.25
BAYLIS, K; HAUBRUGE, E; PERNAL, S; MELATHOPOULOS, A;
VAN DER ZEE, R; PISA, L; ANDONOV, S; BRODSCHNEIDER, R;
SAEGERMAN, C; PETTIS, J S; NGUYEN, B K (2012) Calculating
CHARRIERE, J-D; CHLEBO, R; COFFEY, M F; CRAILSHEIM, K;
and reporting managed honey bee colony losses. In D Sammatro;
DAHLE, B; GAJDA, A; GRAY, A; DRAZIC, M; HIGES, M; KAUKO, L;
J A Yoder (Eds). Honey bee colony health: challenges and
KENCE, A; KENCE, M; KEZIC, N; KIPRIJANOVSKA, H; KRALJ, J;
sustainable solutions. CRC Press / Taylor and Francis Group; Boca
KRISTIANSEN, P; MARTIN-HERNANDEZ, R; MUTINELLI, F; NGUYEN, B K; OTTEN, C; ÖZKIRIM, A; PERNAL, S F; PETERSON,
Raton, Florida, USA. VANENGELSDORP, D; LENGERICH, E; SPLEEN, A; DAINAT, B;
M; RAMSAY, G; SANTRAC, V; SOROKER, V; TOPLOSKA, G;
CRESSWELL, J; BAYLISS, K; NGUYEN, K B; SOROKER, V;
UZUNOV, A; VEJSNÆS, F; WEI, S; WILKINS, S (2012) Managed
UNDERWOOD, R; HUMAN, H; LE CONTE, Y; SAEGERMAN, C (2013)
honey bee colony losses in Canada, China, Europe, Israel and
Standard epidemiological methods to understand and improve
Turkey, for the winters of 2008–2009 and 2009–2010. Journal of
Apis mellifera health. In V Dietemann; J D Ellis, P Neumann (Eds)
Apicultural Research 51(1): 100-114.
The COLOSS BEEBOOK: Volume II: Standard methods for Apis
http://dx.doi.org/10.3896/IBRA.1.51.1.12
mellifera pest and pathogen research. Journal of Apicultural
VANENGELSDORP, D; EVANS, J D; SAEGERMAN, C; MULLIN, C; HAUBRUGE, E; NGUYEN, B K; FRAZIER, M; FRAZIER, J; COX-
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.15 VEJSNÆS, F; NIELSEN, S L; KRYGER, P (2010) Factors involved in the
FOSTER, D; CHEN, Y; UNDERWOOD, R; TARPY, D; PETTIS, J S
recent increase in colony losses in Denmark. Journal of Apicultural
(2009) Colony Collapse Disorder: A Descriptive Study. PLoS ONE 4
Research 49(1): 109-110. http://dx.doi.org/10.3896/IBRA.1.49.1.20
(8): e6481. http://dx.doi.org/10.1371/journal.pone.0006481 VANENGELSDORP, D; HAYES, J Jr; UNDERWOOD, R M; PETTIS, J (2010) A survey of honey bee colony losses in the United States,
ZUUR, A F; IENO, E N; WALKER, N J; SAVELIEV, A A; SMITH, G M (2009) Mixed Effects Models and Extensions in Ecology with R. Springer; New York, USA.
fall 2008 to spring 2009. Journal of Apicultural Research 49(1): 7-14. http://dx.doi.org/10.3896/IBRA.1.49.1.03
Online Supplementary Material: Useful resources for survey design. (http://www.ibra.org.uk/downloads/20130805_1/download)
Journal of Apicultural Research 52(4)
© IBRA 2013
Journal of Apicultural Research 52(4): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.4.19
REVIEW ARTICLE
Standard methods for small hive beetle research
Peter Neumann1,2*, Jay D Evans3, Jeff S Pettis3, Christian W W Pirk2, Marc O Schäfer4, Gina Tanner1 and James D Ellis5 1
Institute of Bee Health, Vetsuisse Faculty, University of Bern, Bern, Switzerland. Social Insect Research Group, Department of Zoology & Entomology, University of Pretoria, Pretoria, South Africa. 3 USDA-ARS Bee Research Laboratory, Beltsville, Maryland, USA. 4 National Reference Laboratory for Bee Diseases, Friedrich-Loeffler-Institute (FLI), Federal Research Institute for Animal Health, Greifswald Insel-Riems, Germany. 5 Honey Bee Research and Extension Laboratory, Department of Entomology and Nematology, University of Florida, Gainesville, Florida, USA. 2
Received 28 March 2013, accepted subject to revision 20 June 2013, accepted for publication 15 July 2013. *Corresponding author: Email: peter.neumann@vetsuisse.unibe.ch
Summary Small hive beetles, Aethina tumida, are parasites and scavengers of honey bee and other social bee colonies native to sub-Saharan Africa, where they are a minor pest only. In contrast, the beetles can be harmful parasites of European honey bee subspecies. Very rapidly after A.
tumida established populations outside of its endemic range, the devastating effect of this beetle under suitable climatic conditions prompted an active research effort to better understand and control this invasive species. Over a decade, A. tumida has spread almost over the entire USA and across the east coast of Australia. Although comparatively few researchers have worked with this organism, a diversity of research methods emerged using sets of diverse techniques to achieve the same goal. The diversity of methods made the results difficult to compare, thus hindering our understanding of this parasite. Here, we provide easy-to-use protocols for the collection, identification, diagnosis, rearing, and for experimental essays of A. tumida. We hope that these methods will be embraced as standards by the community when designing and performing research on A. tumida.
Métodos estandar para la investigación del pequeño escarabajo de las colmenas Resumen Los pequeños escarabajos de la colmena, Aethina tumida, son parásitos y carroñeros de la abeja de la miel y otras colonias de abejas sociales nativas de África subsahariana, donde sólo son una plaga menor. Sin embargo, los escarabajos pueden ser parásitos dañinos de las subespecies de abejas europeas. Muy rápidamente después de que A. tumida estableciera poblaciones fuera de su área endémica, el efecto devastador de este escarabajo en condiciones climáticas adecuadas impulsó un activo esfuerzo de investigación para comprender y controlar mejor esta especie invasora. En más de una década, A. tumida se ha extendido prácticamente por todos los EE.UU. y en toda la costa este de Australia. Aunque comparativamente son pocos los investigadores que han trabajado con este organismo, surgió una diversidad de métodos de investigación utilizando diversas técnicas para lograr el mismo objetivo. La diversidad de métodos complica la comparación de los resultados, lo que dificulta la comprensión de este parásito. Aquí, ofrecemos protocolos fáciles de utilizar para la recolección, la identificación, el diagnóstico, la crianza, y para ensayos experimentales con A. tumida. Esperamos que estos métodos se adopten como normas estándar por la comunidad para el diseño y la realización de investigaciones sobre A. tumida.
Footnote: Please cite this paper as: NEUMANN, P; EVANS, J D; PETTIS, J S; PIRK, C W W; SCHÄFER, M O; TANNER, G; ELLIS, J D (2013) Standard methods for small hive beetle research. In V Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.19
2
Neumann et al.
蜂箱小甲虫研究的标准方法 摘要 蜂箱小甲虫(Aethina tumida )是源于撒哈拉以南非洲地区土著蜜蜂和其它社会性蜂群的一种寄生虫和食腐动物。在当地,它们危害极小。但是 对于欧洲蜜蜂亚种,这种甲虫却是有害寄生虫。小甲虫在其原产地以外建立种群后,在适宜的气候条件下造成了破坏性的影响,迅速促进了针对 了解和有效控制这一入侵物种的热点研究。十多年来,A. tumida几乎已经扩散至整个美国以及澳大利亚的东海岸。虽然针对这一物种的研究者 相对较少,但是出现了针对同一研究目标利用不同技术手段的多样化研究方法。研究方法的多样性导致了研究结果难以进行比较,妨碍了我们对 这一寄生虫的进一步认识。本章我们提供了有关A. tumida的样品采集、鉴定、诊断和实验研究的简易方法。我们希望这些方法今后能被业内当 作针对A. tumida的研究设计和实施的标准。
Keywords: COLOSS, BEEBOOK, Aethina tumida, Apis mellifera, research method, protocol, small hive beetle, honey bee
The COLOSS BEEBOOK: small hive beetles
Table of Contents
3
Page No.
Page No.
1.
Introduction
4 3.1.1.1.
SHB diet
11
2.
Diagnostics and sampling
4 3.1.1.2.
SHB maintenance and transport conditions
11
2.1.
Beetle appearance during the different developmental stages
4 3.1.1.2.1.
Mass maintenance
11
2.1.1.
Eggs
4 3.1.1.2.2.
Individual maintenance
11
2.1.2.
Larvae
5 3.1.3.
Rearing techniques
11
2.1.3.
Pupae
5 3.1.3.1.
Rearing procedure
11
2.1.4.
Adults
5 3.1.3.2.
Individual rearing approach
14
2.2.
Beetle locations during the different development stages
6 3.1.4.
Sex determination
14
2.2.1.
Eggs
6 3.1.4.1.
Sex determination of adults
14
2.2.2.
Larvae
6 3.1.4.2.
Sex determination of pupae
14
2.2.3.
Pupae
6 3.1.5.
Marking techniques
15
2.2.4.
Adults
7 3.1.5.1.
Marking SHB larvae
15
2.3.
Shipped bee samples
7 3.1.5.2.
Marking adult SHB
15
2.3.1.
Inspection of honey bee queen shipments for small hive beetle
7 3.1.5.2.1.
Feeding adult SHB with coloured food
15
2.4.
Sampling of adult small hive beetles
7 3.1.5.2.2.
Thoracic notching of adult SHB
16
2.4.1.
Manual collection
7 3.1.6.
Effect of external conditions on SHB in the laboratory
16
2.4.2.
Traps in colonies
7 3.1.6.1.
Investigating diet effects on SHB reproduction
16
2.4.3.
Traps outside of colonies
8 3.1.6.2.
Determining soil effects on SHB pupation
17
2.4.3.1.
Trapping of adult small hive beetles
8 3.1.7.
Transmission of bee pathogens by small hive beetles
17
2.4.3.2.
Trapping of small hive beetle larvae
8 3.1.7.1.
Investigating potential interactions between A. tumida and Paenibacillus larvae, the causative organism of American foulbrood
18
2.4.4.
Storage and shipment of SHB samples
9 3.1.7.2.
Investigating the potential of SHB to vector honey bee viruses
18
2.4.5.
Molecular diagnostics
9 3.1.8.
Investigations of SHB pathogens and parasites
18
2.4.5.1.
DNA extraction
9 3.1.8.1.
Inoculating SHB larvae with entomopathogenic fungi
18
2.4.5.2.
Mitochondrial DNA analyses
9 3.1.8.2.
Infesting SHB with nematodes
18
2.4.5.3.
Microsatellite analyses
In vitro infestation of wandering larvae with an
18
In vitro soil infestation of larvae using a sand
19
In vitro soil infestation of pupae with an
19
In vitro soil infestation of pupae with nematode
19
10 3.1.8.2.1.
aqueous suspension of nematodes 2.4.5.4.
Screening hive debris for SHB
10 3.1.8.2.2.
bioassay 2.4.5.5.
Future genetic work with SHB
11 3.1.8.2.3.
aqueous suspension of nematodes 3.
Techniques for experimental investigations
11 3.1.8.2.4.
-infected cadavers 3.1.
Laboratory techniques
11 3.2.
Field techniques
19
3.1.1.
Maintaining adult SHB in the laboratory and transport
11 3.2.1.
Investigating intra-colonial interactions between adult bees and adult SHB
19
Neumann et al.
4
Table of Contents cont’d
Page No.
Page No.
3.2.1.1.
General experimental establishment
19 3.2.3.2.
Counting the number and distribution of beetles in freshly-killed colonies
24
3.2.1.2.
Behavioural categories
20 3.2.3.2.1.
Killing with liquid nitrogen
25
3.2.1.3.
Investigating behavioural interactions of adult honey bees and adult SHB at the colony entrance – two alternative options
21 3.2.3.2.2.
Killing with petrol fuel
25
3.2.2.
Investigating SHB oviposition behaviour and bee hygienic responses to SHB eggs and young larvae
22 3.2.3.2.3.
Freeze killing
25
3.2.2.1.
Promoting SHB oviposition behaviour in capped bee brood
22 3.2.3.3.
Counting the number of beetles and defining their spatial distribution in winter clusters killed by dipping in liquid nitrogen
25
3.2.2.2.
Identifying and marking brood cells in which SHB have oviposited
23 3.2.4.
Collecting SHB eggs
26
3.2.2.3.
Determining honey bee hygienic responses to SHB eggs and young larvae
23 3.2.5.
Introducing adult SHB into colonies
26
3.2.2.4.
Determining proportion of perforated capped brood cells containing SHB eggs (oviposition rate)
24 4.
Acknowledgments
27
3.2.3.
Determining the number and distribution of adult SHB inside a field colony and winter clusters and starting colonies without SHB
24 5.
References
28
3.2.3.1.
Visually screening the number of beetles in live colonies and/or removing beetles to start beetle -free colonies
24
1. Introduction
and Ellis, 2008). Although comparatively few laboratories have worked
Aethina tumida (Coleoptera: Nitidulidae) was named and described in
with this organism, a range of different research methods emerged.
1867 by Andrew Dickson Murray in the Annals and Magazine of
Here we provide an overview on methods in the field and in the
Natural History London (Murray, 1867). He received two specimens
laboratory for experimental essays of A. tumida, which we hope will
originating from Old Calabar, on the west coast of Africa. Small hive
be embraced as standards by the community when designing and
beetles (SHB) are parasites and scavengers of honey bee and other
performing research on SHB.
social bee colonies native to sub-Saharan Africa, where they are considered to usually be a minor pest only (Lundie, 1940; Schmolke, 1974; Hepburn and Radloff, 1998; Neumann and Elzen, 2004; Neumann and Ellis, 2008). In 1996, SHB were discovered outside of
2. Diagnostics and sampling
their native range in colonies of European subspecies of honey bees in Small hive beetle research requires diagnostic as well as experimental the southeastern USA (Elzen et al., 1999; Hood, 2004). Since then,
approaches and involves a wide range of different techniques for
SHB introductions have been reported from a number of other
laboratory and field trials. For both, diagnostics as well as experiments
countries (Neumann and Elzen, 2004; Ellis and Munn, 2005; Neumann it is crucial to find and identify the SHB. Knowledge about beetle and Ellis, 2008). In these new ranges, the beetles can be harmful
appearance and location in the colony during the different
parasites of colonies of European honey bee subspecies (Elzen et al.,
developmental stages is necessary to work with this pest.
1999; Hood, 2004) and may also damage colonies of non-Apis bees such as bumble bees and stingless bees (Spiewok and Neumann,
2.1. Beetle appearance during the different
2006a; Hoffmann et al., 2008; Greco et al., 2010; Halcroft et al.,
developmental stages
2011). Very rapidly after A. tumida established populations outside of
2.1.1. Eggs
its endemic range, the devastating effects of this beetle on honey bee A. tumida eggs are pearly-white and about 2/3 the size of a honey colonies (given suitable climatic and soil conditions, Ellis et al., 2004c) bee egg (Fig. 1) and can usually be found in typical egg-clutches resulted in an active research effort to better understand and control
(Lundie 1940). Normally, eggs hatch in about three days, occasionally
this pest. Over a decade, A. tumida has spread and established almost in up to six days (Lundie, 1940). In low relative humidity, egg over the entire USA and across the east coast of Australia (Neumann
hatching may be reduced (Somerville, 2003; Stedman, 2006).
The COLOSS BEEBOOK: small hive beetles
5
2.1.3. Pupae
A. tumida pupae are free pupae (pupa libera), which means that their extremities such as legs and wing sheaths are, in contrast to pupa
obtecta, not glued to the body (Fig. 3). Pupae in early stages (Fig. 3a) are pearly-white with a series of characteristic projections on the thorax and the abdomen, but darken as they develop (Fig. 3b) and their exoskeleton hardens, with pigmentation first appearing in the
Fig. 1. Small hive beetle eggs oviposited in clutches in a honey bee
eyes and then the under wings (Lundie, 1940). Depending on soil
mating nucleus colony. They are ~1.4 mm in length and ~0.26 mm in temperature pupation time varies between 15 – 74 days (Neumann width (Lundie, 1940).
Photo: Peter Neumann. et al., 2001a), but may take up to 100 days in cold periods (Stedman, 2006). During eclosion, the puparium bursts and the adult beetle emerges (Fig. 3c).
2.1.2. Larvae SHB larvae are creamy-white and emerge from the egg shell through
2.1.4. Adults
a longitudinal slit at the anterior end (Lundie, 1940). After hatching,
Adult A. tumida beetles (Fig. 3d) are about 1/3 the size of a honey
the larvae are about 1.3 mm long and grow to a final size of about 8.6 bee worker. They are oval-shaped and vary in size ranging from 5 to to 10.5 mm in length (Schmolke, 1974; Fig. 2). Larval development
7 mm in length and 3 to 4.5 mm in width. The adults’ bodies are broad
takes 10-14 days, but may extend to 30 days, depending on food
and dorsoventral flattened. For a short period after emergence, they
resources and temperature (Stedman, 2006). They have three pairs of are coloured reddish-brown (Fig. 3c), but during maturation they darken legs close to the head, a characteristic row of paired dorsal spines on
to dark brown or even black (Fig. 3d). The head, thorax and abdomen
each segment and two larger paired spines protruding sub terminal on are well separated. Their elytra are short, so that a few segments of the rear end of the dorsum which distinguishes it from the greater
their abdomens are visible, and their antennae are distinctively club
wax moth larvae (Galleria mellonella).
shaped. The entire body is covered with short, fine hair. Note: Caution must be taken not to confuse SHB with closely related Nitidulidae beetles. This is especially true for Cychramus luteus, which might be easily confused with not fully mature adult SHB (Neumann and Ritter, 2004, Fig. 4). In cases of doubt, species status should be confirmed based on definitive morphological characteristics (e.g. shape of ovipositor and antennae, coloration, shape of pronotum, length of elytra, and other defined attributes, Freude et al., 1967).
Fig. 2. Small hive beetle larvae. The post-feeding wandering stage is shown.
Photo: Marc Schäfer.
Fig. 3. Small hive beetle pupae and adults: A. early pupal stage; B. late pupal stage; C. adult ready to emerge from pupation chamber; D. adult on honey bee comb (dorsal view) with typical antenna and short elytra.
Photos A-C: Anna Röttger; D: Nelles Ruppert.
Neumann et al.
6
Fig. 4. Adult beetles of the family Nitidulidae, which are associated with honey bee colonies: a. Aethina tumida ready to emerge from the pupation chamber. Photo: Anna Röttger; b. Cychramus luteus. Photo: Frank Koehler.
The following SHB characteristics are most useful to distinguish them
standards or unsuitable storage conditions for (honey) combs or other
from other nitidulids in the field:
material. Please note that SHB wandering larvae can crawl
Broadened ends of club shaped antennae are as long as wide
considerable distances to find suitable soil (> 200 m, Stedman, 2006).
Short wing cases: end of abdomen is visible
SHB larvae have rarely been reported outside of hives, apiaries and
Spiky edges on the lateral margins of the pronotum.
other apicultural facilities (e.g. occasionally in fruit buckets, Buchholz
et al., 2008).
2.2. Beetle locations during the different development stages 2.2.1. Eggs
A. tumida eggs are mostly deposited in clutches (Fig. 1) that can be found anywhere within the hive. Females appear to prefer crevices or cavities for oviposition (Neumann and Härtel, 2004), however, eggs can also be found on combs or underneath sealed honey combs (Neumann and Hoffmann, 2008) or directly with the honey bee pupae underneath the cell cappings (Ellis et al., 2003f; Ellis and Delaplane, 2008). 2.2.2. Larvae All stages of larvae may be found crawling on and in the combs where they especially pierce the cappings and side walls of rather fresh combs. By contrast, older combs with several layers of cocoons seem
Fig. 5. Small hive beetle wandering larvae underneath hives. Photo: Peter Neumann.
to withstand penetration better. Larvae can also be found underneath sealed honey combs (Neumann and Hoffmann, 2008) and on the bottom boards provided that sufficient food can be found in the debris 2.2.3. Pupae (e.g. dead adult bees, Spiewok and Neumann, 2006b). Fully grown,
Pupation takes place in the soil surrounding the colony in individual
so-called wandering larvae (Fig. 5; Lundie, 1940) may also be found
chambers at shallow depth (seldom deeper than 20 cm, de Guzman
on the ground surrounding the infested colony, where they search for
et al., 2009). Pupae can be carefully sieved out of the soil of a cavity
suitable earth to pupate, e.g. underneath hives. Larvae can also be
(sieve: 20 x 20 cm; mesh width: 1 mm) and then be collected with
spotted in apicultural facilities (e.g. honey houses) given low sanitary
tweezers or an aspirator (Pettis and Shimanuki, 2000).
The COLOSS BEEBOOK: small hive beetles
2.2.4. Adults
7
2.4. Sampling of adult small hive beetles
In the hive, SHB are regularly found everywhere, where they can hide For many experimental studies it is necessary to collect small hive from bees or in areas of the hive with low bee densities, but seem to
beetles in the field. Aethina tumida can be sampled not only directly
prefer bottom boards (up to 40% of the hive SHB population,
from honey bee colonies (Neumann and Hoffmann, 2008), but also
Neumann and Hoffmann, 2008). Most SHB are prevented from freely
from their surroundings (Pettis and Shimanuki, 2000). Several
roaming the hive because honey bees defend against SHB by chasing
techniques can be used for the sampling of SHB.
and corralling them into confinement sites (Neumann et al., 2001c; Ellis, 2005). Beekeepers working a colony often open these confinement 2.4.1. Manual collection sites, which sets the beetles free and running over the hive material.
For the manual collection of adult SHB, many devices are feasible to
Nevertheless, adult SHB are often notoriously difficult to spot during
use (e.g. battery operated vacuums) and can be modified for SHB
colony surveys due to their dark coloration and their tendencies to
collection. However, the easiest and most common ones are aspirator
avoid sunlight and hide in corners or underneath material. Outside of
devices and suction devices (e.g. Spiewok et al., 2007; 2008;
the hives, adult SHB can often be spotted in honey houses and
Neumann and Hoffmann, 2008, Fig. 6), which are widely used for
underneath hives, pending local beetle population density and sanitation collection of insects in general. Such aspirators consist of a container efficacy of the respective beekeeper(s) (Spiewok et al., 2007; 2008).
for the specimen and two tubes connected to the container. A longer
Besides hives and apicultural facilities adult SHB have rarely been
tube allows suction by connecting the container to the collector’s
reported (e.g. in fruit buckets, Buchholz et al., 2008).
mouth, while a shorter tube guides a targeted insect into the container. The longer tube is covered with cloth mesh to prevent
2.3. Shipped bee samples
accidental aspiration of the specimen. As this method is very easy and
Rapid detection and identification of SHB is crucial to limit further
requires no prearrangements, we recommend this method for any
distribution of this species. To prevent the beetle from being introduced type of collection of SHB, but especially for collection at apiaries which to other areas or countries, imported queens, worker bees or honey
are visited only once and where none of the following methods can be
bee colonies should be inspected carefully. In any case, suspect honey applied. bee sample shipments from countries where SHB is known to be present should be immediately sent to the respective national reference
Note: It is highly recommended to clearly label the two tubes
laboratory or competent authority for examination and identification.
differently to avoid accidental inhalation of SHB and bees during collection.
2.3.1. Inspection of honey bee queen shipments for small hive beetle
2.4.2. Traps in colonies
When receiving a shipment of honey bee queens that are to be
Several devices to trap adult SHB inside colonies are available. All of
inspected for presence of small hive beetle, the following methods can them have entrances which allow SHB to enter but exclude honey be used: 1. Remove the queen from queen cage and visually inspect her
bees. Most of these traps use mineral or vegetable oil as a killing agent. There are traps available for all positions in the hive: under the
for signs of SHB (adult, larval, or egg stages; Fig. 1-3) or any
bottom board, on the bottom board, in the frame, as a replacement
other potentially introduced species, such as the mites
for a frame, between frame top bars, and at the entrance of the hive.
Tropilaelaps spp. (see the BEEBOOK paper on Tropilaelaps
Two very similar devices that are widely used are the “Beetle Eater®”
(Anderson et al., 2013)) or Varroa destructor (see the
and the “Beetle Blaster®”. Both are designed to be placed between
BEEBOOK paper on Varroa (Dietemann et al., 2013)).
two frame top bars either in the bottom chamber or in supers. Most of
2. Store queen appropriately (e.g. in a colony), according to
these in-hive trapping-devices are designed to kill SHB and only allow
local procedures and regulations. 3. Immediately place the shipping container and queen cage,
an approximately measurement of the SHB infestation rate of colonies. For collection of live SHB for laboratory studies, we
including the worker attendants, in a sealable bag and store in recommend a very simple method to catch adult SHB inside of the a freezer for at least 24 hours to kill attendants and any
colonies using diagnostic strips (Schäfer et al., 2008; 2010a). These
introduced species such as SHB or Tropilaelaps spp.
devices are made of corrugated plastic strips (75 × 500 × 4 mm)
4. Perform a second visual inspection on the queen cage, the dead which create rows of narrow tunnels for SHB to hide in, but prevent worker attendants, the shipping container and other accompanying access of bees. Diagnostic strips have a mean capture efficacy of 30% materials as quickly as possible after the freeze period.
of the colony SHB population, and provide a fast, cheap, and easy quantitative diagnosis for estimating SHB population sizes in the field
Note: A similar protocol can be applied if inspecting shipped worker
(Schäfer et al., 2008). Furthermore, in light of the very efficient
honey bees.
detection rate (96.3%), these diagnostic strips are also a suitable tool
Neumann et al.
8
Fig. 7. Usage of diagnostic strips to detect adult small hive beetles. The strips are placed on the bottom board of a hive by sliding it through the flight entrance. Special care must be taken that the bottom boards are clean and even to avoid SHB hiding underneath the strips and not inside.
Photo: USDA.
2.4.3. Traps outside of colonies
2.4.3.1. Trapping of adult small hive beetles A variety of different traps and baits have been used to capture adult
Fig. 6. Manual collection of small hive beetle adults in a hive using an SHB outside the hive (Elzen et al., 1999; Arbogast et al., 2007; Benda aspirator (for details please refer to Neumann and Hoffmann (2008)).
et al., 2008; Buchholz et al., 2008; Neumann and Hoffmann, 2008; de
Photo: Dorothee Hoffmann. Guzman et al., 2011). Plastic bucket traps with 8-mesh hardware cloth glued across 7 cm diameter holes (large enough for adult beetles to to screen colonies in areas, where SHB have not been reported yet
enter) have been used to trap SHB outside of colonies. Selection of an
(Schäfer et al., 2010a). This will foster a fast sanitation response to
attractive bait is critical to capture of SHB outside the hive environment.
prevent SHB spread given accidental introductions. Please refer to the While a mixture of honey, pollen, and adult bees showed the highest Portugal case for successful prevention of SHB spread (Murilhas,
catch numbers in the field (Elzen et al., 1999), fruits were not efficient
2005) and to Australia/USA for consequences of too late detections
(Buchholz et al., 2008). Arbogast et al. (2007) used pollen dough
(Neumann and Ellis, 2008). Usage is as follows (Schäfer et al., 2008;
inoculated with the yeast Kodamaea ohmeri (Benda et al., 2008) as
2010a):
bait in traps made of 25.5 cm PVC pipe sections with a removable cap
1. Place one diagnostic strip on the bottom board of a colony by sliding it through the flight entrance (Fig. 7). 2. Leave the strips in the hives for two nights to provide SHB time to find the refuges. 3. Remove the strips by pulling them out quickly and shake the enclosed SHB into bright trays for counting or for collection
at each end. Two openings covered with 4-mesh screen allowed beetles to enter the trap. An 18-mesh screen inverted cone, located just below the openings, funnelled SHB into the bottom cap through a small hole in the cone apex. Traps of this type positioned at 46 cm (same height as colony entrances) showed the highest catch numbers in the field.
with an aspirator or other suction devices (see section 2.4.1.). Although these traps generally do not catch high numbers of beetles, these traps allow for continuous observations that provide a relative Note: Caution must be taken with respect to both bottom board
measure of A. tumida migration (de Guzman et al., 2011).
debris (boards should be clean to allow no space below the trap in which SHB can crawl) and ambient weather conditions. For example,
2.4.3.2. Trapping of small hive beetle larvae
under cold conditions sample SHB from bee clusters, where beetles
To our knowledge, the wandering larvae trap (mounted on the
cluster with the resident bees for warmth (Pettis and Shimanuki,
entrance of the colony) of Arbogast et al. (2012) is the only published
2000; Schäfer et al., 2011).
trap that captures wandering larvae at a colony scale. The trap
The COLOSS BEEBOOK: small hive beetles
9
consists of two parts constructed of three-eighths inch (0.95 cm)
4. Vortex the solution.
acrylic plastic held together by catches. The lower part of the trap is
5. Incubate for 15 min. at 95°C and 30 min. at 55°C before
water tight and half filled with a solution of detergent and water. The upper part intercepts the larvae and is covered, except for a 3 mm gap at the level of the bottom board. Larvae enter through this gap
cooling. 6. Remove aliquots of 1 µl from this solution, which will suffice for genetic tests.
and fall through a screen (18 gauge stainless steel wire with 2 mm
When removing these aliquots, care must be taken to avoid including
openings). The screen prevents bees from falling into the detergent
the Chelex® resin, as this can inhibit the next steps.
solution. The trap is attached to the bottom board by two 18 cm
Alternate extraction methods for long-term use of DNA (e.g. the
extensions on the upper part. We recommend the trap primarily as a
‘CTAB’ method and the commercial DNEasy kit from Qiagen) are also
research tool for colony-wide SHB population dynamics.
effective and are described in detail in the BEEBOOK paper on molecular methods by Evans et al., (2013). Extractions of legs are
Note: Please see the original publications for a drawing of the trap.
advised since this avoids the heavily pigmented elytra, which can lead to inhibition of enzymatic assays and procedures.
2.4.4. Storage and shipment of SHB samples Storage and shipping conditions obviously depend on the planned
2.4.5.2. Mitochondrial DNA analyses
subsequent analyses (e.g. for viruses see the BEEBOOK paper by de
The mitochondrion, a maternally inherited organelle, provides
Miranda et al., 2013). For morphometric analysis, the samples should
numerous genetic polymorphisms that can be useful for inferring
be immediately preserved in 70-95% EtOH. This ensures that the
sources for new SHB populations and for some small-scale studies of
specimens are suitable for this kind of analyses for at least a few
populations. Mitochondrial DNA (mtDNA) sequences for this species
months, and often considerably longer. Alternatively, for later usage
have been analysed for the gene encoding the Cytochrome oxidase I
in DNA analysis, the samples should be stored in a freezer at ≤ -20°C
enzyme, a gene often used for DNA ‘barcoding’ (species-level and
to slow down the degeneration of DNA in tissues. DNA from
population-level identification) in insects. Evans et al. (2000)
specimens frozen at -20°C remains viable for several years, but to
described two oligonucleotide primers, AT1904S
remain viable for longer, samples should be stored at -70°C (for
(5’-GGTGGATCTTCAGTTGATTTAGC-3’) and AT2953A
details please refer to section 9.3. in ‘Storing dead adults’ in the
(5’-TCAGCTGGGGGATAAAATTG-3’) that amplify a ca. 1,000 base-pair
BEEBOOK paper on miscellaneous methods by Human et al., 2013). If region of the SHB mitochondrion. These can be amplified and SHB samples are shipped for scientific purposes, it is important to note that no living material should be sent to avoid the further
analysed as below: 1. Amplify using a thermal cycling protocol of
distribution of this honey bee pest. Adult beetles or larvae should be
93°C (1 min.),
first killed by over-night freezing or by soaking the specimen in
54°C (1 min.),
70-95% EtOH, and sent in a sealed container.
72°C (2 min.) for 35 cycles, followed by a 5 min. elongation step at 72°C.
2.4.5. Molecular diagnostics Below we describe and reference tools for using modern molecularbiology techniques to diagnose SHB. They can also be used to gain
2. Prepare a 1% agarose gel in 1X TAE buffer by mixing: 2.1. 10X solution of 48.4 g of Tris base (tris (hydroxymethyl) aminomethane),
knowledge about the introduction(s) of this beetle from Africa into
2.2. 11.4 ml of glacial acetic acid (17.4 M),
and among the current ranges (Lounsberry et al., 2010). This will
2.3. 3.7 g of EDTA, disodium salt.
elucidate pest populations and invasion pathways and contribute to
2.4. Bring to a final volume of 1 l with deionized water.
knowledge of how this parasite expands in new populations
2.5. Mix 1 g agarose/100 ml gel buffer.
(Lounsberry et al., 2010). These tools will also enable future studies
2.6. Microwave in an Erlenmeyer flask for ca. 1 min.
to better understand SHB behaviour, health, and other aspects of
2.7. Swirl the liquids.
their biology. We here cover only DNA techniques.
2.8. Microwave again for ca. 1 min. Solution should reach a rapid boil and be fully dissolved.
2.4.5.1. DNA extraction
2.9. Let cool for 10 min.
For rapid DNA analyses, including genotyping with the markers
2.10. Add 1 µl of 10 mg/ml Ethidium bromide per 100 ml of
described below, an extraction step is necessary: 1. Place one leg from an adult SHB into a 1.7 ml centrifuge tube.
gel volume. 3. Prepare sucrose loading buffer by mixing:
2. Grind with a disposable pestle.
4 g sucrose,
3. Add 200 µl of 5% Chelex®-100 solution (Bio-Rad Corp.; Walsh
25 mg bromophenol blue or xylene cyanol (0.25%),
et al., 1991).
dH2O to 10 ml.
Neumann et al.
10
4. Mix 3 µl of each sample with 2 µl sucrose loading buffer.
56°C for 30 sec.,
5. Load each sample in an individual well.
65°C for 1 min., and
6. Include a DNA size standard in a well alongside the products
a final extension at 65°C for 2 min.
(e.g. the 100 base-pair ladder from Invitrogen). 7. Electrophorese the products at ca. 100 V/25 amps (depending on gel apparatus) in a horizontal gel rig.
3. Add 1 μl each PCR product (diluted 1:20) to 10 μl Formamide containing 1X LIZ size standard (Applied Biosystems, ABI). 4. Determine labelled product size via one capillary gel run using
8. Visualize under UV light.
an ABI 3730 DNA machine and GeneMapper software (e.g.
There should be a single strong band at ca. 1,000 base pairs.
version 3.7, ABI)
9. Purify the resulting products (e.g. PCR Purification Kit, Qiagen). 10. Sequence from each direction via standard Sanger dideoxy
5. Carry out population-genetic analyses with the programs GenAlex (Peakall and Smouse, 2006), STRUCTURE (Falush
sequencing (see the BEEBOOK paper on molecular methods,
et al., 2007) or other software programs designed to assess
Evans et al., 2013) and the amplification primers.
multi-allelic data, see section 3.3.2. on DNA microsatellites of
Sequences can be aligned against numerous SHB haplotypes in public sequence databases (e.g., http://www.ncbi.nlm.nih.gov/
the BEEBOOK paper on methods for characterising subspecies and ecotypes of Apis mellifera (Meixner et al., 2013).
gquery/?term=aethina+tumida) to determine novelty or placement into a described haplotype.
2.4.5.4. Screening hive debris for SHB Since adult SHB show cryptic behaviour, they are notoriously difficult
2.4.5.3. Microsatellite analyses
to spot in hives. Moreover, beetles are highly migratory (Spiewok et al.,
Microsatellites are regions containing tandem repeats of 1-six-nucleotide 2008; Neumann et al., 2012) and may have left the hive prior to repeats that are widespread in eukaryotic genomes including that of
inspection. We therefore recommend the following molecular method
the SHB (please refer to Evans et al., 2013 for details). For example a
to screen imported hives for SHB (modified after Ward et al., 2007):
CA12 microsatellite has 12 adjoining ‘CA’ nucleotides in the middle of non-repetitive DNA. These regions are inherently unstable, adding and clipping repeat units during cell replication and recombination. As a result, individuals often differ from each other in their genotypes at
1. Extract DNA from hive debris samples: 1.1. Place ~10 g samples of debris into grinding mill canisters (Kleco, Visalia, California, USA). 1.2. Add CTAB (Hexadecyltrimethylammoniumbromide,
these loci, and they offer a powerful tool for describing populations
(Sigma)) lysis buffer (12% Sodium phosphate buffer pH
and gene flow. Several microsatellite loci have been described for the
8.0, 2% CTAB, 1.5 M NaCl), (20 ml) containing 1%
SHB (Evans et al., 2008) and these loci have proven useful in
antifoam B (Sigma) to each canister.
mapping the movement of SHB in the Americas (Lounsberry et al.,
2. Seal canisters.
2010). Below is a protocol for genotyping using dinucleotide (CA)
3. Load onto Kleco grinding mill.
microsatellites.
4. Ground for 2 min. at top speed.
1. Prepare 5 μl reaction mixes for each sample and primer
5. Pour the lysate from each canister into a 50 ml Falcon tube.
containing:
6. Spin the tubes at 4,000 g for 5 min.
1 Unit Taq DNA polymerase with appropriate 1X buffer
7. Remove 2 ml of the cleared lysate.
(Invitrogen),
8. Place into a 2 ml micro-centrifuge tube.
1 mM dNTP mix,
9. Spin for a further 3 min. at 10,000 g.
2 mM added MgCl2,
10. Transfer cleared lysate (1 ml) to a fresh 2 ml micro-centrifuge
0.2 μM of each forward and reverse primer, 0.08 μM of the Forward primer end-labelled on the 5’ end with FAM or HEX fluorophores (ordered from Invitrogen, or another supplier). 2. Carry out the polymerase chain reaction (PCR) with a cycling
tube. 11. Add 250 µl of lysis buffer B (Promega) and 750 µl of precipitation buffer (Promega). 12. Vortex. 13. Spin tubes at 10,000 g for 10 min.
program of
14. Transfer clarified extract (750 µl) to a fresh micro-centrifuge tube.
96°C for 2 min., then
15. Add 50 µl of kit MagneSilTM beads and 600 µl of isopropanol.
3 cycles of 96°C for 30 sec.,
16. Incubate tubes at RT for 10 min.
60°C for 30 sec. (-1°C/Cycle),
17. Extract DNA from each sample using the robotic magnetic
65°C for 1 min.,
particle processor (Kingfisher mL, Thermo Labsystems) in
followed by 35 cycles of
conjunction with the Promega DNA purification system for
food kit following the instructions of the supplier.
96°C for 30 sec.,
The COLOSS BEEBOOK: small hive beetles
2.4.5.5. Future genetic work with SHB The SHB is well poised for genomic studies of olfaction (finding colonies to exploit or finding other SHB for mating), reproduction, and symbioses with fungi and other microbes. Hence, analyses of genomic
11
pliable consistency. This recipe makes enough for 20, 400 g sections of diet. 3. If sticky, add protein supplement to the diet mixture incrementally until it is no longer sticky.
and transcriptomic (high-throughput sequencing of expressed genes)
The diet should not be sticky to the touch because larvae feeding on a
traits in the SHB are sure to follow. The methods for these analyses
sticky substrate are able to crawl up vertical surfaces (their bodies
will be identical to those used previously for honey bees and other
become sticky) and are difficult to collect..
insects, and these methods are described in the BEEBOOK paper on
4. Provide water ad libitum.
molecular methods (Evans et al., 2013).
3.1.1.2. SHB maintenance and transport conditions Whenever maintaining or transporting adult SHB individually or en
3. Techniques for experimental investigations
masse for experimental purposes, it is recommended besides ad libitum water supply to avoid direct sunlight exposure, to keep temperatures in general low (RT) and to allow for sufficient air
The experimental work with SHB can basically be divided into two
circulation, since unsuitable storage conditions can quickly result in
main categories; laboratory and field experiments. The following part
death (Peter Neumann, unpublished data).
of this manual includes recommendations and protocols of previously applied methods for various investigations.
3.1.1.2.1. Mass maintenance 1. Provide autoclaved glass containers with food (see 3.1.1.1.)
3.1. Laboratory techniques
and water ad libitum (or not in case starving is required).
3.1.1. Maintaining adult SHB in the laboratory and transport
2. Place adult SHB in the glass containers.
3.1.1.1. SHB diet
3. Adjust SHB numbers according to experimental needs (single,
SHB feed and reproduce on honey, pollen, and most rapidly, on bee brood (Lundie, 1940; Ellis et al., 2002b). A diet of bee brood alone is
pairs, groups). 4. Store containers at RT in darkness.
impractical, however, because (1) many colonies are needed to produce enough brood to sustain a SHB rearing program, especially a large one, (2) of the destructive nature of removing brood from a colony and (3) using brood is not economical (a full brood frame can be easily consumed by the offspring of 10-15 breeding pairs; Neumann et al., 2001a). Although other Nitidulidae are often reared on fruits (see Peng and Williams, 1990b), rearing SHB on fruits alone is impractical
3.1.1.2.2. Individual maintenance 1. Provide 0.5 g food (see section 3.1.1.1.) in standard Eppendorf® 1.5 ml reaction tubes. 2. Place them in laboratory trays and puncture the lids with a needle (3-4 small holes) to allow air circulation and feeding. 3. Place individual adult SHB in the Eppendorf® tubes using tweezers and seal them.
because of the beetle’s low fecundity on such diet (Ellis et al., 2002b;
4. Store trays at RT in darkness.
Buchholz et al., 2008). We also recommend avoiding artificial diets
5. Provide to each tube honey : water in a 1:1 ratio daily by
(like that proposed for rearing multiple species of Nitidulidae, Peng
carefully pipetting via the small holes.
and Williams, 1990a), because of the general expense of artificial diets, the difficulty one has in obtaining the ingredients, and to keep
Notes: The SHB can be maintained for up to 8 weeks in darkness at
the diet of SHB as natural as possible. One successful semi-defined
RT. Take care to seal containers quickly to limit SHB escape. To
SHB diet consists of dry granulated pollen, honey, and a honey bee
enable ovary activation in female SHB, use protein-rich food (see
protein supplement (e.g. Brood Builder™, Dadant and Sons, Inc.;
section 3.1.1.1.) instead of honey : water in a 1:1 ratio. Ensure that
Hamilton, IL, USA or Booster bee Protein Feed™, Beequipment South
water is always provided ad libitum to prevent SHB dehydration.
Africa, Mike Miles) mixed together in a 1:1:2 volume ratio. The exact ratio varies depending on how moist the honey is:
3.1.3. Rearing techniques
To make the diet,
3.1.3.1. Rearing Procedure
1. Add in a large stand mixer the three ingredients 2000 ml of pollen, 2000 ml honey, 4000 ml protein supplement 2. Mix for about 20 min. until the mixture has a firm but
The rearing procedure is summarized in Table 1. 1. Conduct all laboratory manipulations with adult SHB under a screened insect cage to prevent adult escape. 2. Place 25 sexually mature adult pairs (see section 3.1.4.) into a 3 l plastic mating container with ~400 g of SHB diet. No other
Neumann et al.
12
Table 1. Summary of SHB mass rearing procedure. Number
Description
Maintained at:
50 adult SHB with 400 g diet in a plastic container
1
25°C, no light, > 80% humidity
(~3 l volume) Remove adults from container; SHB eggs, larvae, and food
2
Mature larvae + food placed on ridged tray
25°C, no light, humidity needs
> 99% larvae will leave
(e.g.: 45 × 35 × 6 cm, l × w × h with 4 ridges 8 cm apart
to be high enough to keep
the food < 5 days and
running the width of the tray)
larvae from desiccating
can be collected
80 ml mature larvae added on top of ~1.75 l sandy soil in a 4
2 weeks
25°C, no light, > 80% humidity 2 weeks
present
3
Duration
plastic container (25.5 cm height, 15 cm diameter, 3.7 l capacity); add another ~1.75 l sand to burry larvae
25°C, constant light for 1 week, then no light
20 days In 2-5 days, > 80% of
5
Place funnel trap on pupation container
25°C, > 80% humidity, full light adults will be in top container
6
Remove funnel from trap and
25°C, > 80% humidity, light
store adult SHB in top container
optional
substrate, including wax comb or water should be placed in a
Adults will survive 8+ weeks. Adult mortality will increase over time
Neumann and Härtel, 2004). Any moisture added at this part of the
mating container, because the inclusion of additional materials procedure permits larvae to escape the tray. makes future larval collection difficult. Each container should be fitted with a lid ventilated with tiny holes. 3. The mating containers should be kept at 25°C, > 80% humidity with no light in incubators for 14 days to promote SHB reproduction and oviposition. A high relative humidity is needed because SHB egg hatch rate is positively correlated with humidity (Jeff Pettis, unpublished data cited in Somerville, 2003). 4. Following the 2 week oviposition period, remove the adult beetles from the old diet with an aspirator, leaving the SHB eggs and larvae behind. 5. Transfer the adults in a new mating container with 400 g of beetle diet to continue the rearing program.
8. Post-feeding mature larvae (wandering stage, Lundie, 1940) become positively phototactic, wander away from the diet in search of soil and fall through the hole on the opposite end of the tray. The ridges in the tray prevent the beetle diet from spreading over the tray and falling down the hole. 9. Place a second walled tray (same dimensions as aluminium tray) under the hole of the first to collect the falling wandering larvae. 10. Maintain the trays at 25°C, ~40% humidity, and no light for 5 days. Placement of the larvae trays in a dark room encourages the larvae to crawl away from the diet when finished feeding. This takes advantage of a biological characteristic of the larvae, which normally leave bee
SHB diet should not be reused because old diet supports mould and
colonies during the night. The larvae will remain hidden in the diet if
fungus growth and may promote increased mortality in SHB larvae
maintained under constant light.
and pupae. 6. Move the mating containers from which the adult SHB were removed (they contain old diet, eggs, and developing larvae) to a second incubator for 2 weeks under similar conditions. Larvae are thus allowed additional time to develop in the absence of adult beetles. 7. Following the 2 week larval growth period, place the larvae and food opposite of a hole (~5 cm) cut into the bottom at the far end of a tray that has raised (2 cm) ridges spaced 5-8 cm apart that run the width of the tray. Larvae developing on the recommended beetle diet are not sticky and are unable to crawl up the tray walls (= dry rearing approach;
11. Collect the wandering larvae daily from the bottom tray as long as they are observed wandering from the food (usually up to 4 days). Collected larvae are ready to pupate in the soil. 12. To facilitate pupation, half fill cylindrical plastic containers (pupation containers, 25.5 cm height, 15 cm diameter, 3.7 l capacity) with ~1.75 l sandy autoclaved soil (see section 3.1.6.2.) that is ≥ 10% moisture by mass. 13. Add about 2,000 wandering larvae (~80 ml larvae at 25 larvae/ml) to a pupation container and bury the larvae with ~1.75 l additional moist sand. This number of individuals added to the chamber seems to create an
The COLOSS BEEBOOK: small hive beetles
13
optimal density of pupae in the volume of sand used (approximately 1.9 ml soil/pupa). If too many larvae are added, those that cannot create pupation chambers will crawl back to the surface and wander the soil in an attempt to leave the container. 14. The pupation containers should be maintained at 25°C, > 80% humidity and constant light for 1 week, followed by constant darkness for 13 days, until the adults begin emerging. Notes for pupation containers:
Use sandy soils when rearing SHB because sand is easier to sift through to expose and recover buried adult SHB if necessary. Most soil types will work; sand is easier to use. See Ellis et al. (2004c) for details.
Soil should be discarded after one use or sterilized since there often is an increase in pupal mortality when unsterilized soil is reused.
Never rely on wandering larvae to bury themselves naturally. If put on top of the soil, some larvae may not burrow into the ground for more than 2 weeks, thus widening the range of adult emergence. Manually-buried larvae emerge in a much narrower time period. Larvae will remain buried if the pupation containers are exposed to constant light. Wandering larvae may crawl to the soil surface if the containers are put in a dark room, thus widening the time range of adult emergence.
Container depth (rather than width) appears to be important to pupation success.
Fig. 8. Small hive beetle pupation chamber with an adult beetle funnel trap fitted on top. There is an inverted funnel in the middle
15. Twenty days after burying the larvae in the pupation
that beetles from the pupation chamber (container with soil) crawl
containers, fit the pupation containers with an inverted,
through to access the adult chamber (top). The adults can be fed with
similar container (adult beetle funnel trap) with a funnel
honey water that is sprayed through the ventilation holes in the upper
pointing up into the mouth of the top container (Fig. 8).
container.
Photo: James Ellis.
The adult trap should be ventilated. 16. Loosely cover the funnel hole with a small strip of nylon mesh (1 × 3 cm) that can be secured with tape. Adult beetles emerging from the soil crawl through the funnel into the
be present in the top container. At this time, remove the
top container where they are unable to go back down. The nylon
funnel from the top container, invert the adult trap, and
mesh discourages the adults from returning to the pupation container once they have entered the top container.
securely fasten its lid. Since adult SHB often remain underneath the soil surface without
17. Spray a 1:1 mixture (by volume) of honey/water with a hand-
emerging (up to 35 days, Muerrle and Neumann, 2004), they can be
held pump sprayer through the ventilation holes into the
sifted out of the sand and collected using an aspirator. Adult SHB can
container to feed the emerging adults.
be kept alive in these containers for more than 8 weeks by feeding
Spray enough honey water to wet the side walls of the containers but
them 1:1 honey water with a sprayer as previously described (see
not too much to promote pooling of the honey water on the bottom of step 17). the container. 18. Maintain the adults at 25°C and > 80% humidity under full
Note: Since buried adult SHB can sexually mature before emergence,
light. The light encourages adults to move into the top
adult SHB may mate before emergence from the soil or before they
container.
are collected. Thus, rearing programs aimed at unmated adults should
19. After 2-5 days, more than 80% of the emerging adult SHB will use the individual rearing approaches described below.
Neumann et al.
14
Fig. 9. Sexing of adult small hive beetles. Squeezing the abdomen will cause the female to extend her ovipositor (arrowed in a.) and the male to protrude his 8th tergite (arrowed in b.). The line sketches inset in both pictures are redrawn from Schmolke, 1974 and show the female ovipositor and male 8th tergite in detail.
3.1.3.2. Individual rearing approach ®
1. Fill standard 1.5 ml Eppendorf reaction tubes 1/3 full with
Sketches: Kay Weigel (University of Florida); photos: Marc Schäfer.
Ellis et al., 2002a, Africa: Schmolke, 1974; Spiewok and Neumann, 2012; Australia: Spiewok and Neumann 2012; laboratory: Neumann
autoclaved pupation soil (see section 3.1.3.1.). Seal the tubes, et al., 2001a; Ellis et al., 2002b; Muerrle and Neumann, 2004). place them in laboratory trays, and puncture the lids with a needle (3-4 small holes) to allow air circulation. 2. Collect wandering larvae from the rearing program (see section 3.1.3.1.). 3. Gently introduce an individual larva onto the soil of each tube using soft tweezers. 4. Cover the larvae with another 1/3 full with autoclaved pupation soil (see section 3.1.3.1.). 5. Seal the tubes.
3.1.4.1. Sex determination of adults The easiest approach for adults has been developed by Schmolke (1974; Fig. 9). 1. Grasp the adult beetle so that the ventral side of the tip of the abdomen can be viewed. 2. Gently squeeze the beetle abdomen. 3. Squeezing the abdomen will cause the female to extend her ovipositor and the male to protrude his 8th tergite (Fig. 9).
Follow instructions for storage conditions of trays in incubators until
Females readily extend their ovipositor without much squeezing. If
adult emergence (see section 3.1.3.1.).
you are squeezing “hard” with little result, the beetle likely is a male.
6. Transfer adults, which have finished pupation (Fig. 3c), into new individual tubes. 7. Provide with 1:1 honey water ad libitum using a pipette.
It is more difficult to cause male beetles to protrude their 8th tergite so care must be taken to avoid harming the beetle. If done gently, the sexed adults will not be affected adversely.
The SHB can be maintained for up to 8 weeks in darkness at RT. Note: When sexing many adult beetles (Ellis et al., 2002b; Spiewok Notes:
and Neumann, 2012), it is recommended to slow them down by placing
If any other diet is used to rear or maintain SHB (e.g. to test
them in a fridge or in a vial on ice for at least 5 min. (up to 10 min.).
reproductive success (Ellis et al., 2002b; Buchholz et al., 2008)), the food should be frozen first, especially if field collected (e.g. fruit) to
3.1.4.2. Sex determination of pupae
kill any other insect eggs that may be present.
The sex of pupal SHB can be determined visually without the need to manipulate the individual (Fig. 10).
3.1.4. Sex determination
1. Observe the ventral side of the distal section of the abdomen.
It is often required to determine the sex of individual SHB for experimental
2. Look for two bulbous projections on this location.
or monitoring purposes. SHB seem to have a female-biased adult sex
If present (Fig. 10a), it is a female pupa. These projections are absent
ratio both in the field and in laboratory rearing approaches (field: USA: in male pupae (Fig. 10b).
The COLOSS BEEBOOK: small hive beetles
15
Fig. 10. Sexing pupal small hive beetles. A. and C. show the tip of the ventral side of the abdomen of a female small hive beetle. The two bulbous protrusions are circled. B. and D. show the tip of the ventral abdomen of a male small hive beetle. The bulbous protrusions are absent from the circled area. A. and B. are shown with enhanced contrast to highlight the genital area. Sketches: Kay Weigel, University of Florida; photos Lyle Buss, University of Florida
3.1.5. Marking techniques Experimental purposes often require cohort-specific or individual marking of SHB, e.g. for behavioural studies (see the BEEBOOK paper on behavioural methods by Scheiner et al., 2013). Therefore various
5. Place 10 young larvae (see section 3.1.3.1.) into each container and incubate for 8 days at 30°C till they reach the wandering stage. 6. Wandering larvae fed with Sudan Blue 670 will show green
marking techniques employing dyes, food colouring, dusting, and
colouration. Sudan M Red results in reddish and Rhodamine B
thoracic notching have been attempted in SHB larvae and adults with
in violet coloured larvae.
different levels of persistence and mortality. Note: Feeding SHB larvae with food colours showed no decent results
3.1.5.1. Marking SHB larvae
in the adults after metamorphosis (S. Spiewok, unpublished data).
Coloured food is a good method to mark SHB larvae. 1. Dissolve 1 g of the dye (Sudan Blue 670, Sudan M Red,
3.1.5.2. Marking adult SHB
Rhodamine B; S. Spiewok, unpublished data) in 9 g olive oil to 3.1.5.2.1. Feeding adult SHB with coloured food obtain a stock solution.
1. Dissolve the dye (Rhodamine B, green and blue food
2. Stir 3 g stock solution into 57 g honey.
colouring; S. Spiewok, unpublished data) in sugar water
3. Mix the honey with 90 g powdered pollen to obtain dye-
(40%).
concentrations of 2,000 ppm. 4. Fill 10 g of the coloured food into small containers with lids
2. Allow recently emerged, unfed SHB adults to feed for 3 days
ad libitum.
ventilated with tiny holes that allow airflow but prevent escape of SHB larvae.
Note: After two weeks in field colonies, SHB fed with green and blue food colouring were distinguishable from other SHB, but both colours
Neumann et al.
16
came out turquois (S. Spiewok, unpublished data). Rose Bengal, fed
3. Prepare at least 10 containers of beetles (10 replicates) per
to bees, was used successfully to identify the feeding interactions between SHB and honey bees (Ellis et al., 2002c) but resulted in high
diet tested. 4. Add an appropriate amount of diet per adult container to
mortality when fed to SHB directly (S. Spiewok, unpublished data).
accommodate the amount of offspring that will be produced. Unfortunately, there is no established formula for the volume of food
3.1.5.2.2. Thoracic notching of adult SHB
that should be added given an established number of adult beetles.
For capture-mark-recapture studies of adult we recommend thoracic
The investigator will have to experiment with this since this is an
notching, as notched beetles (Fig. 11) survived and resulted in a high
important consideration. For example, SHB adults reproduce explosively
rate of recovery (de Guzman et al., 2012).
on bee brood but considerably less so on fruit. Therefore, larvae can
1. Hold the SHB between two fingers under a stereo microscope. quickly exhaust food resources in some circumstances. The diet 2. Carefully notch the edge of either the right or left margin of the
should be frozen first, especially if field collected (e.g. fruit) to kill any
SHB’s pronotum (Fig. 11) using the tip of an iris scissor (8 mm). other insect eggs that may be present. 5. Move adult beetles from the food chambers to new ones Note: With double notches or different cutting angles, individual
every 3-4 days to alleviate problems associated with explosive
marking may also be possible. De Guzman et al. (2012) also tested
population growth on limited food resources, if necessary.
the use of blue and red chalk dusts to mark SHB, but this was not
Limiting the amount of time adults spend in a given container equally
persistent and caused high mortality. For specific details please refer
limits the number of eggs female beetles will be able to oviposit in the
to the original publication.
container, thus lessening the likelihood that food will be rapidly exhausted by larvae. This way, adults can be moved from container to container throughout their reproductive lifetime. 6. Monitor the containers daily to ensure that the beetles always have food available (only in case of ad libitum studies, otherwise adjust accordingly, e.g. let SHB starve). In reproduction studies, larvae should be able to feed ad libitum if one is determining how diet impacts the number of larvae produced and amount of time it takes the larvae to reach the wandering phase. 7. Once larvae in the diet container reach the wandering phase, empty the diet and larvae into a metal tray to facilitate capture (see section 3.1.3.1.). 8. Place wandering larvae in soil pupation containers (see section 3.1.3.1.).
Fig. 11. Adult SHB marked by thoracic notching.
Drawing: FLI.
9. Keep all rearing containers at 25°C and > 80% humidity for one week under light and then until adult emergence under dark conditions (see section 3.1.3.1.).
3.1.6. Effect of external conditions on SHB in the laboratory
10. Determine reproductive success.
3.1.6.1. Investigating diet effects on SHB reproduction
Reproductive success is defined by Ellis et al. (2002b) collectively as
SHB feed on honey, pollen, and bee brood in honey bee colonies.
the total number of offspring produced per female on a given diet
However, they have been shown to reproduce on other diets as well
(determined by counting the number of larvae produced in all of the
(Ellis et al., 2002b; Buchholz et al., 2008). Below, we outline a
food containers assigned to the adult pairs) and the percentage of
method for investigating diet effects on SHB reproduction modified
those offspring that pupate successfully (= live adult SHB). One may
after Ellis et al. (2002b).
also look at the reproductive capacity of the F1 generation for further
1. Laboratory rear (see section 3.1.3.2.) and sex (3.1.4.) adult
evidence of reproductive success.
male and female beetles individually to ensure that mating occurs only in the food containers. In reproduction studies, it is essential to know the ratio of males and females. Only use > 1 week old adults to ensure their reproductive maturity. 2. Place a SHB couple (one female and one male) into a plastic container (Fig. 12). The container lids should contain small holes to allow sufficient ventilation.
Notes: 
Allowing SHB adults to reproduce on wet or sticky diets is of special concern because the adults can drown in the food if it becomes fermented and begins to pool in the container. In these instances, it is advisable to place a piece of paper towel in the bottom of the container to absorb moisture.
The COLOSS BEEBOOK: small hive beetles
Larvae maturing on wet or sticky diets cause the container
1. Autoclave test soils prior to use to kill pathogens.
environment to become inhospitable in many instances. So,
2. The soil moisture can be manipulated by first drying the soil in
these containers should be well ventilated (with holes that
an oven.
larvae cannot traverse) to facilitate airflow and checked 2-3
2.1. Spread the soil in a shallow, metal tray to facilitate
times daily for any problems or inconsistencies.
drying. The drying oven can be set to 85°C. The soil is
Field-collected adult beetles are not suited for determining
“dry” when the tray holding the soil no longer loses
maximum reproductive capacity because their age and mating
weight over a 24 h period. This takes 6 weeks or longer
status at the time of collection is not known and they may
at 85°C. If decomposition of organic soil compounds is of
have already reproduced prior to the experiment.
concern to the research, the soils can be dried at lower
Manipulations with adult beetles should be done under insect
temperatures for longer periods of time.
nets to minimize beetle escape (see section 3.1.).
2.2. Measure soil moisture as water by weight (either a dry
The rearing containers should be provisioned with water
mass or wet mass basis). For the dry mass gravimetric
(moistened cotton balls (Fig. 12) similar to maintain adult
method, soil moisture = grams of water/grams of dry soil.
bees in cages see respective BEEBOOK paper Williams et al.,
17
2.3. Using this formula, create soils of various moistures by
2013), especially when the adults are attempting to reproduce
first drying the soil as outlined above, weighing it, and
on a dry food (such as pollen).
then adding an appropriate amount of distilled water to
Freezing the diet to kill eggs of other insects potentially
create the desired water by weight moisture level.
present will alter its microbial balance. This could alter the diet’s nutrition or attractiveness to SHB.
3. For each soil type of interest, place a desired amount of loose soil into plastic pupation containers (pupation chambers are better if they are tall rather than wide). Ellis et al. (2004c) used cylindrical containers that were ~22 cm in height and 1,000 ml in volume. The containers should have small holes drilled in the bottom to allow water to exit. 4. Compact the soil while in the pupation chamber if soil density is an important component of the study. 4.1. Run 1 l of distilled water through the soil-filled pupation container. The holes in the bottom of the container will allow the water to drain. The water compacts the soil naturally. 4.2. If a predetermined amount of water by weight is desired in the packed soil, dry the packed soil while in the pupation container. The oven must be set at a temperature that does not melt or distort the plastic container, or decompose soil compounds/ nutrients (for the microbes, not the beetles themselves) if that
Fig. 12. Plastic container for maintenance of adult SHB (Photo: Elise
is of interest. The container of soil must remain in the oven
Jeanerat) with standard food ad libitum (see section 3.1.1.1. pollen,
until it no longer loses weight over a 24 h period.
honey, and a honey bee protein supplement in a 1:1:2 volume ratio),
4.3. Add the appropriate amount of distilled water to the
tap water in a small glass vial sealed with a piece of cotton wool to prevent draining, and two microscope slides as oviposition site (see section 3.2.4.). Food and equipment can be adjusted according to
dried, packed soil to achieve the desired water by weight moisture. 5. Place wandering SHB larvae produced according to standard
experimental needs (e.g. fruits instead of standard food and two or no
rearing procedures (see section 3.1.3.1.) in the pupation
oviposition sites).
containers once the soils are conditioned to need.
3.1.6.2. Determining soil effects on SHB pupation
3.1.7. Transmission of bee pathogens by small hive beetles
Ellis et al. (2004c) determined the impact of soil type, moisture, and
Similar to other pests, SHB may act as vectors of honey bee
density of SHB pupation success see section 3.1.3.1.). The methods
pathogens (AFB: Schäfer et al., 2010b; viruses: Eyer et al., 2009a, b).
they used are applicable to any study focusing on pupation habits of
This section describes experimental methods to investigate such
SHB.
pathogen transmission by SHB.
Neumann et al.
18
3.1.7.1. Investigating potential interactions between A.
3.1.8. Investigations of SHB pathogens and parasites
tumida and Paenibacillus larvae, the causative organism of
Knowledge about pathogens and parasites of SHB may offer
American foulbrood
alternative avenues for pest control and will in general contribute to
Brood combs with clinical American foulbrood (AFB) symptoms can be our understanding of this species. used to contaminate larval and adult SHB in the laboratory (Schäfer
et al., 2010b). This contamination was shown to persist in pupae and
3.1.8.1. Inoculating SHB larvae with entomopathogenic fungi
newly emerged adults. Contaminated adult SHB can be used to
Fungal infected cadavers (Ellis et al., 2004e) or conidial suspensions
expose honey bee field colonies with P. larvae spores. The
(Muerrle et al., 2006) can be used to infect SHB. Ellis et al. (2004e)
corresponding methods are outlined below:
achieved about 30% mortality among pupating beetles exposed as
1. Take clinical combs with sealed and unsealed brood from infected AFB colonies and arrange into plastic containers with an equal amount of infected brood cells each.
wandering larvae to beetle cadavers from which Aspergillus flavus and
A. niger were isolated (see BEEBOOK paper by Jensen et al., 2013): 1. Collect healthy-looking wandering SHB larvae produced using
2. Collect adult SHB from rearing programs or from infested field colonies and introduce into the containers (N = 20).
autoclaved soil and the rearing method (see section 3.1.3.). 2. Place desired amount of wandering larvae in a small plastic
3. Keep the containers in darkness at 30°C and high relative
container (11 x 11 x 9 cm) that has SHB larvae/pupae that show signs of being infected with a fungal pathogen (Ellis et al.,
humidity (> 50%). 4. After seven days, collect contaminated adult small hive
2004e). It is important to confirm that the cadavers are
beetles.
carrying the pathogen of interest using adequate microbiological techniques (Mürrle et al., 2006 and the
5. Three days later, collect wandering larvae.
respective BEEBOOK paper (Jensen et al., 2013)).
Both adults and larvae can be used depending on the needs of the experiment. If needed, larvae can be moved into sand containers
3. Allow the healthy larvae to wander in the container among
placed in darkness in an incubator to allow further development (see section 3.1.3.).
the cadavers for 24 hours. 4. After 24 hours exposure to infected cadavers, place the
6. To quantify the number of P. larvae spores per specimen (see
wandering larvae in soil pupation chambers and allow to
respective BEEBOOK paper by de Graaf et al., 2013),
pupate (see section 3.1.3.).
immediately freeze the samples after collection. 7. To expose field colonies to contaminated adult SHB, introduce
3.1.8.2. Infesting SHB with nematodes
the collected beetles into the experimental field colonies,
This method to infest SHB with nematodes was developed by Ellis et al.
which should be free of P. larvae spores.
(2010). It allows for the testing of a variety of nematode species aiming at alternative control of SHB.
Note: Please always consider the biosafety risks when manipulating
P. larvae for research! (see the BEEBOOK paper on American
3.1.8.2.1. In vitro infestation of wandering larvae with an
foulbrood by de Graaf et al., 2013). This method might also be
aqueous suspension of nematodes
practicable for European foulbrood and other brood diseases.
Nematode infective juveniles (IJs) often are suspended in water by the company from which the nematodes are obtained. It is such
3.1.7.2. Investigating the potential of SHB to vector honey
suspension that the following method is based on to infest SHB
bee viruses
larvae.
To investigate the potential of SHB as a vector of honey bee viruses, SHB can be fed with virus-infected workers or brood or with viruscontaminated wax or pollen. Eyer et al. (2009a, b) found no virus
1. Place a piece of filter paper in the bottom of a petri dish. The filter paper should cover the bottom of the dish entirely.
infections through feeding of contaminated pollen, but SHB became
2. Determine the density of IJs suspended in the water solution.
infected through feeding on infected worker or brood and on
3. Add the desired number of IJs to the filter paper using a
contaminated wax: 1. Maintain laboratory-reared adult SHB (see section 3.1.1. and
pipette. One should gently invert the container of IJs to ensure even dispersal of nematodes throughout the liquid.
Fig. 8 & 12) and provide virus contaminated food or other
The total volume of water including the suspended IJs added
material.
to the filter paper should be 1.5 ml.
2. Collect adult SHB after 6 days and store adequately until virus
For example, suppose that you are trying to infect wandering
analysis (see respective BEEBOOK paper by de Miranda et al.,
beetle larvae with 200 IJs per larvae. If you plan to add 10
2013).
beetle larvae to the petri dish, you will need to add 2,000 IJs
The COLOSS BEEBOOK: small hive beetles
19
to the dish. If you determine that there are 2,000 IJs per
3.1.8.2.4. In vitro soil infestation of pupae with nematode-
0.5 ml of water, pipette 0.5 ml of the water/nematode
infected cadavers
suspension and 1 ml of distilled water to the paper for a total
Follow the method outlined in section 3.1.8.2.3. with one modification
of 1.5 ml solution added to the paper.
at step 5.
4. Add desired number of wandering SHB larvae to the petri dish.
5. Rather than applying nematodes via aqueous suspension, add
5. Replace the lid to the petri dish and secure the lid to the
a SHB cadaver infected with the target nematode to the cup.
bottom using a tight rubber band. SHB larvae can push up the
Bury the cadaver about 0.5 cm below the soil surface. The
lid of a petri dish and escape so a rubber band is necessary to
cadaver can be produced according to the method outlined in
keep this from occurring.
section 3.1.8.1.
6. Place the dishes in an incubator at 25°C and no light. 7. Assess mortality in the SHB larvae at any time period though resolution is greater the more often one views the dishes.
Notes:
8. Experimental controls include adding nothing to the dish (no paper, water or nematodes), adding only filter paper, adding
The methods outlined can be scaled up and modified for field use.
Ellis et al. (2010) did this by burying the soil cups outside. The
only 1.5 ml of distilled water, or adding filter paper and 1.5 ml
cups had screened lids and bottoms to allow rain drainage
of distilled water.
through the cups. Otherwise, nematodes and SHB larvae were added to the cups as in the in vitro assays. The methods also
3.1.8.2.2. In vitro soil infestation of larvae using a sand
can be used to determine the generational persistence of the
bioassay
nematodes. This is accomplished by adding 5 additional SHB
This method is similar to that presented above.
larvae to the soil cups weekly. If the nematodes are
1. Rather than using filter paper in the petri dish, use 30 g of dried autoclaved sand. 2. Pipette the aqueous nematode suspension directly onto the
reproducing and moving into the newly-burrowing larvae, adult SHB emergence rates in the soil cups will be perpetually low.
sand, which is then wetted to about 10% water by weight. 3. Add wandering SHB larvae to the petri dish.
3.2. Field techniques
4. Replace and secure the top.
The described field techniques involve a wide range of different
5. Place the dishes in an incubator at 25°C and no light.
protocols for investigations including interactions between honey bees
6. Assess mortality in the SHB larvae at any time period though
and SHB, behavioural studies, quantification of SHB in colonies and
resolution is greater the more often one views the dishes.
more general techniques such as the introduction of SHB into honey
7. Control petri dishes include adding nothing to the dish (no sand, bee colonies. water or nematodes), adding only sand, adding only 1.5 ml of distilled water, or adding sand and 1.5 ml of distilled water.
3.2.1. Investigating intra-colonial interactions between adult bees and adult SHB
3.1.8.2.3. In vitro soil infestation of pupae with an aqueous
SHB and adult worker honey bees interact with one another regularly
suspension of nematodes
within a colony (see Elzen et al., 2001; Neumann et al., 2001c; Ellis
1. Autoclave soil.
2005; Ellis and Hepburn, 2006; Ellis et al., 2003c, d; 2004a, b; Pirk
2. Moisten soil to 10% water by weight.
and Neumann, 2013). Most of the studies on bee/beetle behavioural
3. Place autoclaved soil in small plastic cups.
interactions have been conducted using honey bee colonies hosted in
Ellis et al. (2010) used 118 ml cups. A similar size is appropriate. 4. Place 5 wandering SHB larvae in the soil cups and allow them to bury themselves and begin the process of pupating. 5. Two days after the addition of larvae, pipette the desired
observation hives (see the BEEBOOK paper on behavioural methods, Scheiner et al., 2013). To that end, we discuss initial experimental establishment and then various methods that can be used to investigate a suite of beetle/bee interactions. The series of procedures
amount of IJs suspended in an aqueous solution onto the soil
outlined below likely are amendable for use by those investigating the
in the cup.
interactions between adult bees and larval SHB.
6. Add 5 ml of water to the soil cups every 3-4 days as needed to maintain adequate soil moisture. 7. Place the cup lids on the cups to enclose the SHB.
3.2.1.1. General experimental establishment 1. Establish equalized 3-frame observation hives (see the
One can expect the SHB in the control cups (no nematodes) to begin
respective BEEBOOK paper Delaplane et al., 2013) according
to emerge as early as day 17 post addition to the soil.
to the parameters set for the study (one brood frame and two
Neumann et al.
20
honey frames; queenright or queenless, etc., see the
to ensure that one can actually observe the behaviour. The
BEEBOOK paper on behavioural methods by Scheiner et al.,
labelling of the rows and columns should be included on the
2013 for details on establishing and maintaining observation
edge of the grid. To avoid confusion, the rows should be
hives) and remove any beetles currently living in the colony
labelled with numbers and the columns with letters (or vice
using aspirators (see Fig. 6).
versa). It is highly recommended when preforming
2. The observation hives should be kept in a dark room, with no
observations on both sides of an observation frame to
outside or artificial light shining on the hive.
continuously label the columns around both sides. For
3. According to the needs of the experiment, collect adult SHB
example with a 6 x 9 grid on each side, the rows are labelled
from rearing programs (see section 3.1.3.) or from infested
1-9 and the columns are labelled A-F on one side and G-L on
field colonies. The beetles can be all males, all females, age-
the opposite side.
cohort specific, etc. per the needs of the experiment. Adult
7. At each observation period, the observer should screen the
beetles should be sexed if required (see section 3.1.4.) and
colony in a left-to-right pattern, following the uppermost 5 ×
introduced into the observation hives after dusk, the preferred
5 cm bold square. This pattern should be followed with the
time window for SHB flights (Neumann et al., 2012).
second row of 5 × 5 cm bold squares, continuing to the
4. Hives should be monitored at least twice daily (Neumann et al.,
bottom of the grid. This observation pattern minimizes the
2001c; Ellis et al., 2003c, d, 2004a, b) at time windows
chance that the same area will be viewed more than one time
suitable for the experimental needs (morning and afternoon
and that behaviour will be double counted. Both sides of the
or only after local dusk for nocturnal behaviour). All night
observation hive should be monitored this way.
observations of the hives should be done using red lights to minimize behaviour disturbance to colonies. It may be
3.2.1.2. Behavioural categories
necessary to use a small flashlight to find beetles confined in
The following behavioural categories are a synthesis of the numerous
particularly hard-to-view areas. The order of observed hives
studies (Elzen et al., 2001; Neumann et al., 2001c; Solbrig, 2001; Ellis
should be altered at a daily basis at each time window.
2005; Ellis et al., 2002c; 2003c; 2004a, b; Pirk and Neumann 2013)
5. During behavioural studies, it is essential to precisely define the behavioural categories/pattern. They have to be clearly
and can be used to investigate interactions. The following behavioural categories were defined:
defined and distinct; under no circumstance should the observer come into the situation that a certain observed
SHB:
behavioural pattern could be either behaviour 1 or behaviour
Resting/Ignore (within 5 mm of a honey bee) — not moving at all,
2. As a hypothetical example let’s assume that two categories
none of the other categories can be observed.
are labelled “walking” and “running”. These categories would
Walking — moving around (< 5 mm/sec. without being chased by a
be examples of poorly defined behaviours, since they do not
SHB or worker).
give a clear objective definition. The categories “walking,
Running — moving fast (> 5-10 mm/sec.), without being chased by
speed less than 5 mm/sec” and “running, speed greater than
a SHB or worker.
5 mm/sec” would be clearly defined and are distinct. As
Flee — moving fast (> 5-10 mm/sec.), while being chased by a SHB
another hypothetical example, the categories “feeding” and
or worker.
“trophallactic interactions” would be not helpful category
Being chased — a) by fellow SHB, b) by a worker c) by more than
choices since they overlap.
one worker.
6. In most behavioural studies, it is important to know where the Mating — male is mounting the female interaction took place, especially in a social insect colony like a NOTE: in this definition of the behavioural category mounting is used honey bee colony and especially in the case of SHB/honey bee as a proxy for mating. interactions. Therefore, it is useful to superimpose a
Feeding on — a) pollen store, b) nectar store, c) larvae, d) a dead
transparent grid of squares onto both side windows of an
honey bee worker, e) a dead SHB, f) a live honey bee worker.
observation hive to fix the location of the interaction.
Antennating with a SHB — antennal contact with one or more a SHB.
Obviously, the size of the square determines the spatial
Antennating with a honey bee worker — antennal contact with
resolution. The general consensus is to use 5 x 5 cm squares
any bee e.g. with a guard bee (guarding the entrance of the hive
(Moritz et al., 2001; Neumann et al., 2001b, 2003; Ellis et al.,
(Rösch, 1925) or at a confinement site or prison (Neumann et al.,
2003d), which then could be even further subdivided with
2001c; Ellis, 2005)).
slightly drawn internal 1 x 1 cm squares (Ellis et al., 2003d).
Trophallactic contact with worker bee — obtaining a drop of
One has to avoid overloading the side windows with markings
food from a bee that is presenting food between its mandibles.
The COLOSS BEEBOOK: small hive beetles
21
Interfering with other SHB in trophallactic contact with
acrylic glass or another material. Pierce the acrylic glass with
worker bee — obtaining food while another SHB gets fed.
holes to accommodate normal airflow into and out of the hive.
Turtle-defence posture — stays motionless and tucks its head underneath the pronotum with the legs and antennae pressed tightly to the body.
3. Build a side entrance to the test arena through which beetles can be introduced (Fig. 13 and 14). 4. Conduct the trials under red light conditions to take into
Mount a bee — mounting the workers’ abdomen and cutting with
account usual SHB flight activity after dusk (Neumann et al.,
the mandibles through the tissue between the tergites.
2012). 5. Close both doors to the test arena to “trap” guard bees in
Honey bees:
place in the nest entrance. The doors should be closed slowly
There are more than 50 behavioural categories described for honey
and with minimum disturbance in order to not excite the
bees (see for example Kolmes, 1985; Neumann et al., 2001b; Pirk, 2002). The following state only the basic ones related to SHB:
guard bees. 6. Introduce, for each trial, one adult SHB through the side entrance of the test arena.
Resting/Ignore (within 5 mm of a SHB) — not moving at all, none
7. Insert likewise a glass bead into the test arena as a control.
of the other categories can be observed.
The bead should be roughly the same size and colour as the invader.
Walking — moves around at < 1 cm/sec.
Atkinson and Ellis (2011a) tethered a 60 mg black bead to a 15 cm
Running — moves around at > 1 cm/sec.
piece of monofilament fishing line so that the bead could be retracted
Chasing — running and following an intruder (SHB).
from the test arena after the observation period.
Biting — mandibles are open and the bee tries to bit and grab the
8. Once introduced, record the responses of guard bees to the
SHB.
beetle or glass bead for any length of time though Atkinson
Stinging — bends the abdomen to bring the stinger into position
and Ellis (2011a) recorded responses for 60 sec.
and/or sting is moving in and out of the sting sheath .
9. Three potential guard bee responses can be recognized
Trophallactic interaction with/feeding — a) another worker, b)
(perhaps more can be discovered using this method):
queen, c) confined or SHB, d) one free running SHB – the worker
regurgitates a droplet from its honey stomach, which can be observed between the mandibles and from which one or more food receivers
Ignore (a bee’s head comes within 5 mm of the subject but without making contact),
Contact/interacting (the bee physically contacts the
will feed (SHB or bees).
subject in a non-defensive manner, which involves licking
Guarding — a worker prevents a SHB from moving freely by keeping
of the beetle and antennating), and
it at bay in a crack or a prison/confinement. This kind of pattern is
Defend (the bee attempts to sting and/or remove the
often followed by feeding and/or biting.
subject from the nest, Elzen et al., 2001, see section
Building prison (confinement) — chewing or/moulding the wax-
3.2.1.2. on behaviour)
propolis mixture constituting the barrier of the prison (confinement).
In the event that the test arena is not sealed well enough to prevent beetle escape, only trials in which the beetles remain in the arena for
Final note: All categories can be further subdivided or merged depending on the needs of the experiment.
≥ 30 sec. should be counted. 10. After the observation period, open the acrylic glass doors on either side of the test arenas for > 10 sec. to allow movement
3.2.1.3. Investigating behavioural interactions of adult honey bees and adult SHB at the colony entrance – two alternative options
of honey bees into/out of the central nest area and to reduce guard bee agitation. 11. Allow time between trials for the beetles to naturally exit the
Option 1 – at the entrance:
test arena or for the bead to be withdrawn. In Atkinson and
Two methods have been developed to investigate adult bee and SHB
Ellis (2011a), the average time between trials was > 1 min.
(or other nest invader) interactions at the hive entrance (Halcroft et al.,
12. Use test beetles and beads only once.
2011; Atkinson and Ellis, 2011a):
13. It is common to trap different numbers of guard bees in the
1. Build a modified observation hive to facilitate nest entrance observation.
test arena for each trial and colony when following this method. Consequently, convert bee responses to beetles or
The entrance corridor to the hives should contain a test arena
beads to proportional data to facilitate fair data comparison
(Atkinson and Ellis, 2011a, used a test arena of 10 x 20 cm, L x W),
across trials. Atkinson and Ellis (2011a) state that this is not
2
with a floor marked with a 1 cm grid system (Fig. 13 and 14). 2. Build a closable partition at both ends of the test arena using
the proportion of bees performing a given response but rather the proportion of all responses that were Ignore, Contact, and
Neumann et al.
22
Defend responses. This way, a single bee may demonstrate
4. Superimpose a grid on the glass if spatial information has to
these behaviours multiple times throughout the observation period and the behaviours be counted.
be recorded (see section 3.2.1.1.). 5. Insert a piece of metal mesh (Âą 9.5 x 4.9 cm) into the
14. Analyse data as outlined in the statistical guidelines of the
wooden box as a barrier to separate the intruder/SHB and
BEEBOOK (Pirk et al., 2013).
honey bees. Instead of wood also polycarbonate could be used (KĂśhler et al., 2013). Holes in the mesh are only large
Note: Trials should be conducted using multiple observation hives
enough for SHB to move through, thereby preventing honey
and simultaneously if resources permit. The latter allows one to
bees from moving into the part of the container where the
minimize observation period and weather impacts on behaviour at the
SHB were released. In this design, SHB have access to both
nest entrance.
the hive and container whereas honey bees only have access to the hive and the part of the container closest to the hive
Option 2: T-shaped arena entrances in an observation hive This option was developed in the Social Insect Research Group at the
entrance. 6. To optimize the observations and to reduce the influence of
University of Pretoria (Strauss, 2009). The advantage is that it does
the observer, record the interactions using a remotely
not interfere with the ongoing foraging activity of the colony and
controlled CCTV system.
utilizes the observation, that any given natural colony often has more
The recorded footage can be analysed using software designed for
than one entrance. It further allows the manipulation of the intruder,
behavioural studies.
in this case SHB, without having the risks of releasing guard bees.
Advantage of option 2 is that the setup is not interfering with the gas
The T-shaped form (Fig. 13) offers two chambers to introduce
exchange of the colony, normal activity is unaffected, and therefore
intruders from more than one position and prevents any line of sight
observations during the day are possible. In addition, ample of space
between the guards and the intruder before the experiments starts.
for the observer or additional equipment is available, so one does not
1. Attach the T-shape container to the hive.
have to squeeze between the exit hole and the observation hive.
2. Give at least three days for the guard bees to recognize the additional hive entrance.
Note: Depending on the questions asked both options have their
3. Cover the arena with a glass lid to allow for observations and to prevent SHB and honey bees from escaping.
advantages or disadvantages. If one needs constant flow of foragers coming into contact with the SHB option 1 might be better. If the experiment should not interfere with the normal activities of the colony option 2 might be more suitable. 3.2.2. Investigating SHB oviposition behaviour and bee hygienic responses to SHB eggs and young larvae Adult SHB females will oviposit in cracks and crevices around the honey bee nest (Fig. 1, Lundie, 1940; Neumann and Härtel, 2004). Occasionally, the females will bite holes in the capping and/or side of brood cells, insert their ovipositor into the hole, and oviposit on the bee developing in the cell (Ellis et al., 2003a; 2003c; 2004d; Ellis and Delaplane, 2008). In response, adult worker honey bees can detect SHB eggs/young larvae present in capped brood cells, uncap the cell, and remove the brood and/or SHB eggs/larvae (termed hygienic behaviour). A number of methods have been developed to facilitate studying SHB oviposition behaviour and the resulting honey bee hygienic responses to the behaviour.
3.2.2.1. Promoting SHB oviposition behaviour in capped bee brood The idea of this method is that SHB adults are trapped and allowed to
Fig. 13. Observation hive with t-shaped container as a testing area attached to it. Figure with permission from the author. Drawing: Ursula Strauss.
reproduce on a section of brood. 1. SHB used in the study can be laboratory-reared, fieldcollected, all males, all females, age-cohort specific, etc., per
The COLOSS BEEBOOK: small hive beetles
the needs of the experiment. They should be at least 1 week old to ensure that they have reached sexual maturity. 2. Remove a frame of capped brood (~60-90% capped) from a colony.
23
the use of a flashlight. 2. Mark capped brood cells exposed to SHB and containing perforated cappings and/or side walls using a transparent sheet of plastic (acetate).
The capped brood should not contain any uncapped larvae as these
3. Cut the acetate to about the size of the face of the frame.
will crawl out of the cells and be macerated by the SHB in this
4. Mark the sheet with a permanent marker in one of the corners
procedure. Any uncapped larvae in the brood patch should be
of the frame to identify its correct placement on the comb in
removed with forceps. It is best to use a section of brood that does
subsequent observations.
not contain any honey stores. Furthermore, the selected brood should be > 6 days from enclosing (determined by uncapping and examining select brood cells in the test area, see the section on obtaining
5. Label the sheet according to frame and colony if several are used for replication. 6. Once the acetate is stable on the frame, use a permanent
workers and brood of know age in the BEEBOOK paper on
marker to place a small dot on top over all brood cells
miscellaneous methods, Human et al., 2013) so that no bees will
containing perforated cappings and/or side walls.
emerge during the test period. 3. Prepare a sheet-metal, push-in cage (10 x 10 x 2.5 cm cage,
7. Once marked and labelled, remove the acetate sheet from the frame and store until needed.
L x W x H). The face of the cage should be screen mesh to allow for ventilation.
3.2.2.3. Determining honey bee hygienic responses to SHB
The screen mesh should be too small for SHB or bees to traverse.
eggs and young larvae.
4. Trap the required number of SHB in small vials.
1. Following the methods outlined in sections 3.2.2.1. and
5. Place the vials on ice 4-5 min.
3.2.2.2., expose reproductive SHB adults to brood comb. They
6. Once anesthetized, dump the beetles onto the brood section.
will breed, and the females might oviposit in capped brood
Trap the beetles on the section by pushing the cage onto the section and into the wax to the comb midrib. 7. Return the frame containing the beetles caged on a section of brood to the centre of the bee cluster in the colony from which the brood was removed. 8. Allow SHB to mate and the females to oviposit for 24 hours. Though the length of time for this can vary, the beetles may not oviposit in the brood cells sufficiently if allowed less time. In contrast, they decimate the brood section beyond use if allowed access longer than 24 hours. This is especially true if > 20 adult SHB are added to the comb section. 9. After the oviposition period concludes, remove the combs from the colony 10. Collect the cages and beetles.
cells. 2. Mark the cells (see section 3.2.2.2.). 3. Use a pin to put small holes in brood cell cappings as a positive control (Ellis et al., 2004d). When pin-pricking, the holes should be made around the cap perimeter to avoid damaging the developing bee within the cell. 4. Mark capped brood cells with no perforations in the cappings and/or side walls as negative controls (Ellis and Delaplane, 2008). 5. Return the frame containing the perforated brood cells to the centre of the nest cluster. Consequently, the brood section returned to the colony in step 3 will be investigated and attended to by worker bees. Honey bee workers that possess heightened hygienic responses can detect SHB eggs/ young larvae present in capped brood cells, uncap the cell, and
Note: It is important to know that some adult SHB may exit the cage
remove the brood and/or SHB eggs/larvae (Ellis et al., 2003a, c;
during the oviposition period unless the cage is pushed firmly into the
2004d; Ellis and Delaplane, 2008).
comb. Likewise, SHB already present in the colony at the time of the study can migrate into the cage. These situations usually only present
6. Leave the frame containing the test section of brood in the nest for a predetermined amount of time.
a problem if one is trying to investigate the oviposition behaviour of
Ellis et al. (2003c) left the brood in the colonies post exposure to SHB
an exact number of beetles.
for 48 hours. However, worker bee hygienic response to the capped brood neared 100% in all test colonies so Ellis and Delaplane (2008)
3.2.2.2. Identifying and marking brood cells in which SHB
lessened the brood time in the colony to 24 hours in subsequent tests
have oviposited
to look for colony differences in hygienic responses.
1. Capped brood cells in which SHB have oviposited naturally or per the methods outlined in section 3.2.2.1. contain perforated cappings or side walls of the cell. The former is easy to note though the latter often requires a keen eye and
7. After the 24 hour period, remove the frame from the colony. 8. Replace the marked acetate (see section 3.2.2.2.) on the corresponding frame and align to the section of brood. 9. Consider hygienically removed the marked brood cells having
Neumann et al.
24
perforated cappings/side walls the day before that no longer
3.2.3.1. Visually screening the number of beetles in live
contained a developing bee.
colonies and/or removing beetles to start beetle-free colonies
10. Calculate the level of hygienic behaviour (or proportion of brood removed) as
These methods are modified from Ellis et al., 2002a; Ellis and Delaplane, 2006; Spiewok et al., 2007; 2008; Neumann and Hoffmann, 2008. The procedure is best accomplished with two people, one to
# marked brood cells containing no developing bee after 24 hours exposure to adult bees _________________________________________________________________________ total number of marked cells containing perforated side walls and/or cappings
work the colony and the second to collect the beetles. 1. Place a sheet of opaque plastic (~2 x 2 m, preferably white or light in colour) or plywood in front of the colony in which you
The higher the proportion, the more hygienic the colony.
want to count the number of beetles. 2. Lightly smoke the colony.
3.2.2.4. Determining proportion of perforated capped brood
3. Remove the lid from the colony.
cells containing SHB eggs (oviposition rate)
4. Bounce the lid on the plywood. This dislodges all bees and
1. Use the method outlined in section 3.2.2.3. to determine the oviposition rate of SHB females in capped brood.
beetles adhering to the lid. 5. A second individual (the beetle collector) combs through the
2. A female SHB will not oviposit in all cells in which she
bees by hand or with a small stick and collects all visible adult
perforates the capping and/or side wall. Consequently
beetles with an aspirator. All bees on the plywood should be
calculate the “oviposition rate” as:
inspected since beetles can easily be concealed in clusters of bees. 6. Remove the outermost frame in the uppermost super.
# marked capped brood cells containing SHB eggs ____________________________________________________________________________
7. Shake the bees from the frame onto the plywood.
total number of marked capped brood cells containing perforated cappings and/or side walls
8. The beetle collector repeats step 5. 9. Once the bees have been shaken from the frame, turn the
3. Open the cells marked according to section 3.2.2.3. with forceps.
frame onto its face. 10. Bounce the frame against the plywood to dislodge adult
4. Determine the number and presence of SHB eggs. 5. Remove the developing pupa/prepupa to facilitate egg quantification.
beetles from the comb. This step should be repeated 2-3 times for both sides of the frame. 11. The beetle collector repeats step 5. 12. After all frames in a box have been examined, the individual
Potential additional uses:
working the colony bounces the empty box on the plywood to
The procedures outlined in sections 3.2.2.1. – 3.2.2.4. can be used to:
remove the remaining SHB. This step should be repeated for
investigate beetle density effects on oviposition (simply vary the number of SHB in the cages during the oviposition
all supers, all frames, and the bottom board of the colony. 13. The bees accumulated on the plywood can be bounced off the
period),
board in front of the reassembled colony. The bees will return
screen and possibly select for the level of hygienic expression
to the hive.
of honey bees (within and between subspecies) toward SHB
eggs and young larvae,
Notes:
determine time, environmental, bee subspecies, etc. impacts
A certain proportion of the adult SHB will remain undetected during
on SHB oviposition behaviour,
such visual inspections (Neumann and Hoffmann, 2008). This
determine colony strength impacts on hygienic behaviour
procedure can be repeated 2-3 times in a 24 hour period in order to
(Ellis and Delaplane, 2008),
create beetle-free colonies for experiments.
and investigate other similar areas.
3.2.3.2. Counting the number and distribution of beetles in freshly-killed colonies 3.2.3. Determining the number and distribution of adult SHB
A more accurate approach for counting SHB is to examine beetles in
inside a field colony and winter clusters and starting colonies
freshly-killed colonies (modified from Ellis et al., 2003a; Neumann and
without SHB
Hoffmann, 2008; Schäfer et al., 2011). One can, presumably, find
To estimate infestation loads of colonies and preferential SHB
100% of the beetles inhabiting the nest if all the beetles and bees are
locations, it is essential to quantify and locate the beetles adequately.
dead. However, these methods are fatal to the colony and are useful
Some experiments also require beetle-free colonies. Here we provide
only under certain circumstances. One of the following methods can
any overview on the respective methods.
be used to conduct absolute counts of SHB in colonies depending on what data are required and what facilities are available.
The COLOSS BEEBOOK: small hive beetles
25
3.2.3.2.1. Killing with liquid nitrogen
2. Once thawed, remove the lid to the colony.
It is possible to kill whole colonies by dipping them into liquid
3. Carefully inspect for beetles. Bees should be removed to facilitate
nitrogen. The hives have to be manipulated to allow quick air
beetle visualization and cracks/crevices examined carefully.
displacement while keeping all bees and SHB inside. This can be
4. Remove all frames from the colony
achieved with a screened lid (mesh width, 1 mm). As killing with liquid
5. Inspect each frame for beetles.
nitrogen is fast, the spatial distribution of the bees and the beetles
This includes removing bees from the combs, tapping the combs on
inside or on the combs will remain stable.
their sides to dislodge beetles hiding in the wax cells and uncapping
1. Place an adequate container, filled with liquid nitrogen, next to the colony.
of sealed honey combs to detect mining larvae (Neumann and Hoffmann, 2008). It is important to note that bees cluster in cold
2. Install the screened lid.
temperatures, with many bees clustering head first into empty cells.
3. Dip the colony into the liquid nitrogen.
Beetles often can be found at the bottom of cells that bees are in
4. Store the colonies in a cold room until they are carefully
(Ellis et al., 2003a) so all clustering bees should be removed from all
dissected.
cells (this can be done using forceps) in order to find every beetle
Note: it is very important to follow the safety regulations for handling present in the nest. liquid nitrogen.
6. Inspect all supers and the bottom board for hiding beetles.
3.2.3.2.2. Killing with petrol fuel
3.2.3.3. Counting the number of beetles and defining their
Colonies can also be killed with petrol fuel. This method doesn’t
spatial distribution in winter clusters killed by dipping in
require hive manipulation, but one has to make sure, that no petrol
liquid nitrogen
fuel leaks out of the colony for environmental safety reasons.
This method is modified from Schäfer et al. (2011). It is an accurate
1. Seal the complete hive with masking tape, except the lid.
method for counting the number and determining the spatial
2. Quickly open the top lid.
distribution of adult SHB inside honey bee winter clusters. One can,
3. Pour 500 ml standard petrol fuel into the colony.
presumably, find 100% of the beetles inhabiting the colony. However,
4. Close the colony.
the method is fatal to the colony and is useful only under certain
5. Store in a cold room until dissection.
circumstances. Furthermore, it requires manipulation of the hives and the availability of liquid nitrogen and a cool room that can
Note: Petrol is poisonous for humans. Inspections should be done open air and gas masks or similar protection is highly recommended. Furthermore it is very important to be aware of the great flammability of petrol and its fumes!
accommodate the clustering colonies. 1. Place the colonies in hives without entrances and with screened bottom and lid (mesh width, 1 mm). 2. Transfer the colonies into a cold room at -5°C and constant darkness, to allow the formation of the clusters.
3.2.3.2.3. Freeze killing
3. Kill the colonies by dipping the whole hives into liquid nitrogen
If large freezers are available, colonies can be killed by freezing them,
(see section 3.2.3.2.1.), immediately after taking them out of
but the placement of colonies into a cool room or freezer will change
the cool room.
the distribution of SHB, because of the resulting clustering behaviour
This will fix the spatial distribution of adult A. tumida inside the
of the bees.
clusters and keep the structure of the cluster.
1. Close all colony entrances with tape, grass, or other similar material. 2. Place the colonies into a freezer room (< -20°C) for 2 weeks to ensure that all the bees in the colonies are dead. It is important to note that honey bees are able to thermoregulate, so strong colonies with honey reserves (the fuel for thermoregulation) may die slowly. Wherever possible, colonies
4. Leave the colonies inside the liquid nitrogen long enough to kill all the bees and SHB (1 min. for a cluster of ~4,000 bees). 5. Store the colonies in a cold room until they are carefully dissected. 6. Record the position of the cluster (e.g. by taking pictures) and of each SHB (all bees inside cells have to be removed to investigate the cell bottoms).
should be placed into very cold freezers and left for at least 2
The positions of SHB can be recorded as follows: core (= central area
weeks. Colonies kept at temperatures > -20°C may die too
of the cluster), periphery (= inside cluster, except core area) and
slowly.
outside clusters or elsewhere inside the colony.
Regardless of which way of killing, the SHB in the stored colonies are counted as follows:
Note: it is very important to follow the safety regulations for handling
1. Thaw the colonies at RT for 24 hours prior to inspection for beetles. liquid nitrogen.
Neumann et al.
26
3.2.4. Collecting SHB eggs
SHB are quick crawlers and can easily escape the vial once the lid is
This method has been designed by Ellis and Delaplane (2007)
removed if they are not tapped to the bottom of the vial first.
1. Lay a microscope slide on a flat surface.
6. Open the lid to the colony just enough to allow room to add
2. Place ½ of a cover slip on both ends of the slide. 3. Place another microscope slide on top of the cover slip halves.
the beetles. 7. Add the adults to the uppermost super of the hive and close
In effect, you are separating two microscope slides with a cover slip.
to the nest periphery to avoid overreaction by the host bees
4. Tape both ends of the slides so that they will remain together.
(“beetle shock”: bees being exposed to SHB abnormally and
5. Place the slides in a petri dish that contains a small amount
immediately removing the beetles from the hive). If the
(~5 g) of SHB food (see section 3.1.1.1. for food recipe).
beetles are dumped into the centre of the bee cluster, the
6. Add mated females or adult beetles (see section 3.1.3.) to the
bees will attack the beetles immediately and many beetles
petri dish and replace the petri dish top.
may exit the colony within minutes of introduction. Beetles
7. Secure the top and bottom of the petri dish to one another
should not be anesthetized prior to introduction into the nest
with a rubber band.
because anesthetized beetles are easily removed from
SHB females will oviposit in the space between the two slides created by the cover slip (see Fig. 12).
colonies by adult bees. 8. Replace the lid to the colony immediately after beetle
8. Handle SHB eggs with a small paint brush.
introduction.
This procedure can be modified by using a small piece of wax paper (~10 cm x 10 cm) that has been folded back and forth 10 times (making ~1 cm folds). The folds should be tight and the ends of the
Modifications, additional uses, research on future improvements:
The same method can be used to add adult SHB to full-size or
paper should be paper clipped to keep it from unfolding. The SHB
nucleus colonies and to observation hives. Modifications can
females will oviposit between the folds in the paper.
be made to the observation hive to accommodate SHB introduction since observation hive lids often cannot be
3.2.5. Introducing adult SHB into colonies Ellis et al. (2003b) investigated the impacts of adult SHB on nests and
removed (depending on hive design) (Fig. 14).
Ellis et al. (2003b) added 100 SHB/night for 15 nights
flight activity of Cape and European subspecies of honey bees. They
(totalling 1,500 SHB). Delaplane et al. (2010) added from 75
did this by adding SHB to nucleus colonies nightly for 15 nights to
– 1,200 SHB/introduction every two months for a beetle
simulate a large-scale, chronic invasion of SHB into colonies. They
threshold study. Consequently, the method is useful to
developed the method outlined below for introducing adult SHB into
simulate chronic, small scale beetle invasions or large, acute
colonies daily.
beetle invasions into the bee nest.
1. Rear adult SHB according to the methods outlined in section
3.1.3.
For possible future improvement, one should investigate how SHB can be “control-released” into the nest over a longer
2. Prepare/equalize colonies prior to the experiments according
period of time. The method outlined above involves the
to the methods outlined in the BEEBOOK paper on estimating
sudden addition of SHB adults to the nest, heightening the
colony strength (Delaplane et al., 2013).
likelihood of “beetle shock”. Controlled introductions should
3. Collect adult SHB from the rearing program with an aspirator (see Fig. 6).
be a point of future investigation.
4. Place the exact number and sex (if needed see Fig. 9) of adult
This procedure can be used to investigate SHB impacts on colony absconding behaviour, honey and pollen stores,
SHB intended for each colony into small vials before their
amount of bees/brood in the nest, average colony flight
release into the colonies. Adult SHB are much easier to
activity, colony weight gain, SHB reproduction, SHB migration
release from a vial into a colony than by other methods.
between colonies, etc. The beetles can be laboratory-reared,
5. Colonies can be artificially-infested with SHB on any time
field-collected, all males, all females, age-cohort specific, etc.
schedule (daily, weekly, etc.) provided the introductions are done during evening hours. SHB adults preferentially invade
according to the needs of the experiment.
Neumann and Härtel (2004) investigated the removal of SHB
colonies during evening hours (Neumann et al., 2012) so adults
larvae by honey bee colonies. They introduced larvae using
should be introduced during regionally-appropriate hours,
petri-dishes. Since SHB larvae are neither quick crawlers nor
between 1-2 hours before sunset and 1-2 hours after sunset.
able to show the turtle defence posture of adult SHB
Ellis et al. (2003b) introduced SHB between 17:00 – 21:00 h.
(Neumann et al., 2001c), worker bees quickly remove them
5. To introduce SHB into the colony, lightly tap the vial containing the beetles to cause the beetles to fall to the bottom of the vial.
(Neumann and Härtel, 2004).
The COLOSS BEEBOOK: small hive beetles
27
SHB have now well established populations in North America and Australia (Neumann and Ellis, 2008), and are likely to spread into more areas (Asia, South America, Europe) with potentially devastating effects on local managed honey bees and possibly other bees under suitable climatic conditions. This calls for concerted efforts of the community to better control this invasive species. However, despite this BEEBOOK paper there are still significant gaps in SHB methodology, thereby limiting its further study and control. This calls for more research in this rather small field. Development of alternative treatments with natural enemies or an optimized trapping of adult/ larval SHB in the field might constitute promising future avenues. On the other hand, this beetle has a truly fascinating biology and there is considerable potential to shed light on numerous fundamental questions in ecology and evolution. We therefore hope that this set of standard methods will attract more researchers to join the SHB research field, thereby stimulating exciting future research on this species.
4. Acknowledgements Appreciation is addressed to Geoff Williams and an anonymous referee for constructive comments on an earlier draft of the manuscript and to Sebastian Spiewok for sharing his unpublished data. The COLOSS (Prevention of honey bee COlony LOSSes) network aims to explain and prevent massive honey bee colony losses. It was funded through the COST Action FA0803. COST (European Cooperation in Science and Technology) is a unique means for European researchers to jointly develop their own ideas and new initiatives across all scientific disciplines through trans-European networking of nationally funded research activities. Based on a pan-European intergovernmental framework for cooperation in science and technology, COST has contributed since its creation more than 40 years ago to closing the gap between science, policy makers and society throughout Europe
Fig. 14. Diagram of the modified observation hive used by Atkinson
and beyond. COST is supported by the EU Seventh Framework
and Ellis (2011a, b). A. shows a side view of the observation hive.
Programme for research, technological development and demonstration
The white arrow indicates the location where beetles are introduced
activities (Official Journal L 412, 30 December 2006). The European
into the observation hive, while the black arrows indicate the location
Science Foundation as implementing agent of COST provides the
of the eight grooves (confinement sites) located on the periphery of
COST Office through an EC Grant Agreement. The Council of the
the observation hive. The confinement sites are present on both sides, European Union provides the COST Secretariat. The COLOSS network totalling 16 sites. Invading beetles are more likely to be confined in these sites (facilitating their observation) than in other locations in the nest. B. shows the bottom board of the observation hive (top picture) and a top view of the gridded base (test arena) of the observation hive. The white arrow indicates the location where beetles or control beads can be introduced into the test arena. The black arrows indicate the location of the acrylic glass doors that, when slid in place, capture guard bees in the test arena.
is now supported by the Ricola Foundation - Nature & Culture.
Neumann et al.
28
5. References ANDERSON, D L; ROBERTS, J M K (2013) Standard methods for
Tropilaelaps mites research. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for
DE GUZMAN, L I; FRAKE, A M; RINDERER, T E (2012) Marking small hive beetles with thoracic notching: effects on longevity, flight ability and fecundity. Apidologie 43: 425-431. http://dx.doi.org/10.1007/s13592-011-0107-8 DELAPLANE, K S; VAN DER STEEN, J; GUZMAN, E (2013) Standard
Apis mellifera pest and pathogen research. Journal of Apicultural
methods for estimating strength parameters of Apis mellifera
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.21
colonies. In V Dietemann; J D Ellis; P Neumann (Eds) The
ARBOGAST, R T; TORTO, B; VAN ENGELSDORP, D; TEAL, P E A
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
(2007) An effective trap and bait combination for monitoring the
research. Journal of Apicultural Research 52(1):
small hive beetle, Aethina tumida (Coleoptera: Nitidulidae). Florida
http://dx.doi.org/10.3896/IBRA.1.52.1.03
Entomologist 90(2): 404-406. ARBOGAST, R T; TORTO, B; WILLMS, S; FOMBONG, A T; DUEHL, A;
DE MIRANDA, J R; BAILEY, L; BALL, B V; BLANCHARD, P; BUDGE, G; CHEJANOVSKY, N; CHEN, Y-P; GAUTHIER, L; GENERSCH, E;
TEAL, P E A (2012) Estimating reproductive success of Aethina
DE GRAAF, D; RIBIÈRE, M; RYABOV, E; DE SMET, L VAN DER
tumida (Coleoptera: Nitidulidae) in honey bee colonies by trapping
STEEN, J J M (2013) Standard methods for virus research in
emigrating larvae. Environmental Entomology 41(1): 152-158.
Apis mellifera. In V Dietemann; J D Ellis; P Neumann (Eds) The
http://dx.doi.org/10.1603/EN11186
COLOSS BEEBOOK, Volume II: standard methods for
ATKINSON, E; ELLIS, J D (2011a) Adaptive behaviour of honey bees (Apis mellifera) toward beetle invaders exhibiting various levels of colony integration. Physiological Entomology 36: 282-289. http://dx.doi.org/10.1111/j.1365-3032.2010.00774.x ATKINSON, E; ELLIS, J D (2011b) Honey bee, Apis mellifera L.,
Apis mellifera pest and pathogen research. Journal of Apicultural
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.22 DELAPLANE, K S; ELLIS, J D; HOOD, W M (2010) A test for interactions between Varroa destructor (Acari: Varroidae) and
Aethina tumida (Coleoptera: Nitidulidae) in colonies of honey bees
confinement behaviour toward beetle invaders. Insectes Sociaux
(Hymenoptera: Apidae). Annals of the Entomological Society of
58: 495-503. http://dx.doi.org/10.1007/s00040-011-0169-7
America 103(5): 711-715. http://dx.doi.org/10.1603/AN09169
BENDA, N D; BOUCIAS, D; TORTO, B; TEAL P (2008) Detection and
DIETEMANN, V; NAZZI, F; MARTIN, S J; ANDERSON, D; LOCKE, B;
characterization of Kodamaea ohmeri associated with small hive
DELAPLANE, K S; WAUQUIEZ, Q; TANNAHILL, C; FREY, E;
beetle Aethina tumida infesting honey bee hives. Journal of
ZIEGELMANN, B; ROSENKRANZ, P; ELLIS, J D (2013) Standard
Apicultural Research 47(3): 194-201.
methods for varroa research. In V Dietemann; J D Ellis;
http://dx.doi.org/10.3827/IBRA.1.47.3.07
P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard
BUCHHOLZ, S; SCHÄFER, M O; SPIEWOK, S, PETTIS J S, DUNCAN M,
methods for Apis mellifera pest and pathogen research. Journal of
RITTER W, SPOONER-HART R, NEUMANN P (2008) Alternative
Apicultural Research 52(1):
food sources of Aethina tumida (Coleoptera: Nitidulidae). Journal
http://dx.doi.org/10.3896/IBRA.1.52.1.09
of Apicultural Research 47(3): 201-208. http://dx.doi.org/10.3827/IBRA.1.47.3.08 DE GRAAF, D C; ALIPPI, A M; ANTÚNEZ, K; ARONSTEIN, K A; BUDGE, G; DE KOKER, D; DE SMET, L; DINGMAN, D W; EVANS, J D;
ELLIS, J D (2005) Reviewing the confinement of small hive beetles (Aethina tumida) by western honey bees (Apis mellifera). Bee
World 86(3): 56-62. ELLIS, J D; DELAPLANE, K S (2006) The effects of habitat type,
FOSTER, L J; FÜNFHAUS, A; GARCIA-GONZALEZ, E; GREGORC, A;
ApilifeVAR™, and screened bottom boards on small hive beetle
HUMAN, H; MURRAY, K D; NGUYEN, B K; POPPINGA, L; SPIVAK, M;
(Aethina tumida) entry into honey bee (Apis mellifera) colonies.
VANENGELSDORP, D; WILKINS, S; GENERSCH, E (2013) Standard methods for American foulbrood research. In V Dietemann; J D
American Bee Journal 146(5): 537-539. ELLIS, J D; DELAPLANE, K S (2007) The effects of three acaricides on
Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II:
the developmental biology of small hive beetles (Aethina tumida).
standard methods for Apis mellifera pest and pathogen research.
Journal of Apicultural Research 46(4): 256-259.
Journal of Apicultural Research 52(1):
http://dx.doi.org/10.3896/IBRA.1.46.4.08
http://dx.doi.org/10.3896/IBRA.1.52.1.11 DE GUZMAN, L I; PRUDENTE, J A; RINDERER, T E; FRAKE, A M;
ELLIS, J D; DELAPLANE, K S (2008) Small hive beetle (Aethina
tumida) oviposition behaviour in sealed brood cells with notes on
TUBBS, H (2009) Population of small hive beetles (Aethina tumida
the removal of the cell contents by European honey bees (Apis
Murray) in two apiaries having different soil textures in
mellifera). Journal of Apicultural Research 47(3): 210-215.
Mississippi. Science of Bee Culture, 1: 4-8.
http://dx.doi.org/10.3896/IBRA.1.47.3.09
DE GUZMAN, L I; FRAKE, A M; RINDERER, T E; ARBOGAST R T
ELLIS, J D; DELAPLANE, K S; HEPBURN, H R; ELZEN, P J (2002a)
(2011) Effect of height and colour on the efficiency of pole traps
Controlling small hive beetles (Aethina tumida Murray) in honey
for Aethina tumida (Coleoptera: Nitidulidae). Journal of Economic
bee (Apis mellifera) colonies using a modified hive entrance.
Entomology 104(1): 26-31. http://dx.doi.org/10.1603/EC10300
American Bee Journal 142(4): 288-290.
The COLOSS BEEBOOK: small hive beetles
ELLIS J D; DELAPLANE K S, HOOD W M (2002b) Small hive beetle
29
ELLIS, J D; DELAPLANE, K S; HOOD, W M (2002a) Small hive beetle
(Aethina tumida Murray) weight, gross biometry, and sex
(Aethina tumida Murray) weight, gross biometry, and sex
proportion at three locations in the southeastern United States.
proportion at three locations in the south-eastern United States.
American Bee Journal 142(7):520–522.
American Bee Journal 142: 520–522.
ELLIS, J D; HEPBURN, H R (2006) An ecological digest of the small
ELLIS, J D; NEUMANN, P, HEPBURN, H R; ELZEN, P J (2002b)
hive beetle (Aethina tumida), a symbiont in honey bee colonies
Longevity and reproductive success of Aethina tumida
(Apis mellifera). Insectes Sociaux 53: 8-19.
(Coleoptera: Nitidulidae) fed different natural diets. Journal of
http://dx.doi.org/10.1007/s00040-005-0851-8
Economic Entomology 95(5): 902-907.
ELLIS, J D; MUNN, P A (2005) The worldwide health status of honey bees. Bee World 86(4): 88–101. ELLIS, J D; HEPBURN, H R; DELAPLANE, K S; ELZEN, P J (2003a) A
http://dx.doi.org/10.1603/0022-0493-95.5.902 ELLIS, J D; PIRK, C W W; HEPBURN, H R; KASTBERGER, G; ELZEN, P J (2002c) Small hive beetles survive in honey bee prisons by
scientific note on small hive beetle (Aethina tumida) oviposition
behavioural mimicry. Naturwissenschaften 89: 326-328.
and behaviour during European (Apis mellifera) honey bee
http://dx.doi.org/10.1007/s00114-002-0326-y
clustering and absconding events. Journal of Apicultural Research 42(3): 47-48. ELLIS, J D; HEPBURN, H R; DELAPLANE, K S; NEUMANN, P; ELZEN, P J (2003b) The effects of adult small hive beetles, Aethina tumida (Coleoptera: Nitidulidae), on nests and flight activity of Cape and
ELLIS, J D; RICHARDS, C S; HEPBURN, H R; ELZEN, P J (2003f) Oviposition by small hive beetles elicits hygienic responses from Cape honey bees. Naturwissenschaften 90(11): 532-535. http://dx.doi.org/10.1007/s00114-003-0476-6 ELLIS, J D; RICHARDS, C S; HEPBURN, H R; ELZEN, P J (2004d)
European honey bees (Apis mellifera). Apidologie 34: 399-408.
Hygienic behaviour of Cape and European Apis mellifera
http://dx.doi.org/10.1051/apido:2003038
(Hymenoptera: Apidae) toward Aethina tumida (Coleoptera:
ELLIS, J D; HEPBURN, H R; ELLIS, A M; ELZEN, P J (2003c) Prison
Nitidulidae) eggs oviposited in sealed bee brood. Annals of the
construction and guarding behaviour by European honey bees is
Entomological Society of America 97(4): 860-864.
dependent on inmate small hive beetle density.
http://dx.doi.org/10.1603/0013-8746(2004)097[0860:HBOCAE]
Naturwissenschaften 90: 382-384. http://dx.doi.org/10.1007/s00114-003-0447-y ELLIS, J D; HEPBURN, H R; ELLIS, A M; ELZEN, P J (2003d) Social
2.0.CO;2 ELLIS, J D; RONG, I H; HILL, M P; HEPBURN, H R; ELZEN, P J (2004e) The susceptibility of small hive beetle (Aethina tumida
encapsulation of the small hive beetle (Aethina tumida Murray) by
Murray) pupae to fungal pathogens. American Bee Journal 144
European honey bees (Apis mellifera L.). Insectes Sociaux 50: 286
(6): 486-488.
-291. http://dx.doi.org/10.1007/s00040-003-0671-7 ELLIS, J D; HOLLAND, A J; HEPBURN, H R; NEUMANN, P; ELZEN, P J
ELLIS, J D; SPIEWOK, S; DELAPLANE, K S; BUCHHOLZ, S; NEUMANN, P; TEDDERS, L (2010) Susceptibility of Aethina tumida (Coleoptera:
(2003e) Cape (Apis mellifera capensis) and European (Apis
Nitidulidae) larvae and pupae to entomopathogenic nematodes.
mellifera) honey bee guard age and duration of guarding small
Journal of Economic Entomology 103(1): 1-9.
hive beetles (Aethina tumida). Journal of Apicultural Research 42
http://dx.doi.org/10.1603/EC08384
(3): 32-34. ELLIS, J D; HEPBURN, H R; ELZEN, P J (2004a) Confinement
ELZEN, P J; BAXTER, J R; WESTERVELT, D; RANDALL, C; DELAPLANE, K S; CUTTS, L; WILSON, W T (1999) Field control and biology studies
behaviour of cape honey bees (Apis mellifera capensis Esch.) in
of a new pest species, Aethina tumida Murray (Coleoptera:
relation to population densities of small hive beetles (Aethina
Nitidulidae), attacking European honey bees in the Western
tumida Murray). Journal of Insect Behaviour 17(6): 835-842.
Hemisphere. Apidologie 30: 361-366.
http://dx.doi.org/10.1023/B:JOIR.0000048992.26016.7f
http://dx.doi.org/10.1051/apido:19990501
ELLIS, J D; HEPBURN, H R; ELZEN P J (2004b) Confinement of small
ELZEN, P J; BAXTER, J R; NEUMANN, P; SOLBRIG, A J; PIRK, C W W;
hive beetles (Aethina tumida) by Cape honey bees (Apis mellifera
HEPBURN, H R; WESTERVELT, D; RANDALL, C (2001) Behaviour
capensis). Apidologie 35(4): 389-396.
of African and European subspecies of Apis mellifera toward the
http://dx.doi.org/10.1051/apido:2004030
small hive beetle, Aethina tumida. Journal of Apicultural Research
ELLIS, J D; HEPBURN, H R, LUCKMANN, B; ELZEN, P J (2004c) The effects of soil type, moisture, and density on pupation success of
40: 40-41. EYER, M ; CHEN, Y P ; SCHÄFER, M O; PETTIS, J; NEUMANN, P
Aethina tumida (Coleoptera: Nitidulidae). Environmental
(2009a) Small hive beetle, Aethina tumida, as a potential
Entomology 33(4): 794-798.
biological vector of honey bee viruses. Apidologie 40: 419-428.
http://dx.doi.org/10.1603/0046-225X-33.4.794
http://dx.doi.org/10.1051/apido:2008051
Neumann et al.
30
EYER, M ; CHEN, Y P ; SCHÄFER, M O; PETTIS, J; NEUMANN, P (2009b) Honey bee sacbrood virus infects adult small hive beetles,
Aethina tumida (Coleoptera: Nitidulidae). Journal of Apicultural
HOOD, W M (2004) The small hive beetle, Aethina tumida: a review.
Bee World 85: 51–59. HUMAN, H; BRODSCHNEIDER, R; DIETEMANN, V; DIVELY, G; ELLIS, J;
Research 48(4): 296-297.
FORSGREN, E; FRIES, I; HATJINA, F; HU, F-L; JAFFÉ, R; JENSEN, A B;
http://dx.doi.org/10.3896/IBRA.1.48.4.11
KÖHLER, A; MAGYAR, J; ÖZIKRIM, A; PIRK, C W W; ROSE, R;
EVANS, J D; PETTIS, J S; SHIMANUKI, H (2000). Mitochondrial DNA
STRAUSS, U; TANNER, G; TARPY, D R; VAN DER STEEN, J J M;
relationships in an emergent pest of honey bees: Aethina tumida
VAUDO, A; VEJSNÆS, F; WILDE, J; WILLIAMS, G R; ZHENG, H-Q
(Coleoptera: Nitidulidae) from the United States and Africa. Annals
(2013) Miscellaneous standard methods for Apis mellifera
of the Entomological Society of America 93: 415-420.
research. In V Dietemann; J D Ellis; P Neumann (Eds) The
http://dx.doi.org/10.1603/0013-8746(2000)093[0415:MDRIAE]
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
2.0.CO;2
research. Journal of Apicultural Research 52(4):
EVANS, J D; PETTIS, J S; HOOD, H; SHIMANUKI, H (2003). Tracking an invasive honey bee pest: Mitochondrial DNA variation in North
http://dx.doi.org/10.3896/IBRA.1.52.4.10 JENSEN, A B; ARONSTEIN, K; FLORES, J M; VOJVODIC, S; PALACIO, M A;
American small hive beetles. Apidologie. 34: 103-109.
SPIVAK, M (2013) Standard methods for fungal brood disease
http://dx.doi.org/10.1051/apido:2003004
research. In V Dietemann; J D Ellis, P Neumann (Eds) The
EVANS, J D; SPIEWOK, S; TEIXEIRA, E W; Neumann, P (2008)
COLOSS BEEBOOK: Volume II: Standard methods for Apis
Microsatellite loci for the small hive beetle, Aethina tumida, a nest
mellifera pest and pathogen research. Journal of Apicultural
parasite of honey bees. Molecular Ecology Resources 8: 698–700.
Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.13
http://dx.doi.org/10.1111/j.1471-8286.2007.02052.x EVANS, J D; SCHWARZ, R S; CHEN, Y P; BUDGE, G; CORNMAN, R S;
KÖHLER, A; NICOLSON, S W; PIRK, C W W (2013) A new design for honey bee hoarding cages for laboratory experiments. Journal of
DE LA RUA, P; DE MIRANDA, J R; FORET, S; FOSTER, L;
Apicultural Research 52(2): 12-14.
GAUTHIER, L; GENERSCH, E; GISDER, S; JAROSCH, A;
http://dx.doi.org/10.3896/IBRA.1.52.2.03
KUCHARSKI, R; LOPEZ, D; LUN, C M; MORITZ, R F A; MALESZKA, KOLMES, S A (1985) An information-theory analysis of task R; MUÑOZ, I; PINTO, M A (2013) Standard methodologies for
specialization among worker honey bees performing hive duties.
molecular research in Apis mellifera. In V Dietemann; J D Ellis;
Animal Behaviour 33: 181-187.
P Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
LOUNSBERRY, Z; SPIEWOK, S; PERNAL, S F; SONSTEGARD, T S;
methods for Apis mellifera research. Journal of Apicultural
HOOD, W M; PETTIS, J S; NEUMANN, P; EVANS, J D (2010)
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.11
Worldwide diaspora of the small hive beetle, Aethina tumida, a
FALUSH, D; STEPHENS, M; PRITCHARD, J K (2007) Inference of
nest parasite of honey bees, Apis mellifera. Annals of the
population structure using multilocus genotype data: dominant
Entomological Society of America 103: 671-677.
markers and null alleles. Molecular Ecology Notes 7 (4): 574-578.
http://dx.doi.org/10.1603/AN10027
http://dx.doi.org/10.1111/j.1471-8286.2007.01758.x FREUDE, H; HARDE, K W; LOHSE, G A (1967) Die Käfer Mitteleuropas, Goecke und Evers, Krefeld, 72 pp. GRECO, M K; HOFFMANN, D; DOLLIN, A; DUNCAN, M; SPOONER-
LUNDIE, A E (1940) The small hive beetle Aethina tumida. Science
Bulletin 220: Department of Agriculture and Forestry, Government Printer; Pretoria, South Africa. 30 pp. MEIXNER, M D; PINTO, M A; BOUGA, M; KRYGER, P; IVANOVA, E;
HART, R; NEUMANN, P (2010) The alternative Pharaoh approach:
FUCHS, S (2013) Standard methods for characterising subspecies
stingless bees mummify beetle parasites alive.
and ecotypes of Apis mellifera. In V Dietemann; J D Ellis;
Naturwissenschaften 97: 319-323.
P Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
http://dx.doi.org/10.1007/s00114-009-0631-9
methods for Apis mellifera research. Journal of Apicultural
HALCROFT, M; SPOONER-HART, R; NEUMANN, P (2011) Behavioral defense strategies of the stingless bee, Austroplebeia australis,
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.05 MORITZ, R F A; CREWE, R M; HEPBURN, H R (2001) Attraction and
against the small hive beetle, Aethina tumida. Insectes Sociaux
repellence of workers by the honey bee queen (Apis mellifera L.).
58: 245-253. http://dx.doi.org/10.1007/s00040-010-0142-x
Ethology 107: 465-477.
HEPBURN, H R; RADLOFF, S E (1998) Honey bees of Africa. Springer Verlag; Berlin, Germany. HOFFMANN, D; PETTIS, J S; NEUMANN, P (2008) Potential host shift of the small hive beetle (Aethina tumida) to bumble bee colonies
http://dx.doi.org/10.1046/j.1439-0310.2001.00681.x MURILHAS, A M (2005) Aethina tumida arrives in Portugal. Will it be eradicated? EurBee Newsletter 2: 7–9. MURRAY, A (1867) List of Coleoptera received from Old Calabar, on
(Bombus impatiens). Insectes Sociaux 55: 153–162
the west coast of Africa. The Annals and Magazine of Natural
http://dx.doi.org/10.1007/s00040-008-0982-9
History 19: 167.
The COLOSS BEEBOOK: small hive beetles
MUERRLE, T M; NEUMANN, P (2004) Mass production of small hive
31
PEAKALL, R; SMOUSE, P E (2006) Genalex 6: genetic analysis in
beetles (Aethina tumida Murray, Coleoptera: Nitidulidae). Journal
Excel. Population genetic software for teaching and research.
of Apicultural Research 43(3): 144-145.
Molecular Ecology Notes 6 (1): 288-295.
MUERRLE, T M; NEUMANN, P; DAMES, J F; HEPBURN, H R; HILL, M P
http://dx.doi.org/10.1111/j.1471-8286.2005.01155.x
(2006) Susceptibility of adult small hive beetle to entomopathogenic PENG, C; WILLIAMS, R N (1990a) Multiple-species rearing diet for sap fungi. Journal of Economic Entomology 99: 1-6.
beetles (Coleoptera: Nitidulidae). Annals of the Entomological
http://dx.doi.org/10.1603/0022-0493(2006)099[0001:SOAATC]
Society of America 83(6): 1155-1157.
2.0.CO;2 NEUMANN, P; HÄRTEL, S (2004) Removal of small hive beetle (Aethina tumida Murray) eggs and larvae by African honey bee colonies (Apis mellifera scutellata Lepeletier). Apidologie 35: 3136. http://dx.doi.org/10.1051/apido:2003058 NEUMANN, P; ELLIS, J D (2008) The small hive beetle (Aethina
tumida Murray, Coleoptera: Nitidulidae): distribution, biology and control of an invasive species. Journal of Apicultural Research 47 (3): 180-183. http://dx.doi.org/10.3896/IBRA.1.47.3.01 NEUMANN, P; ELZEN, P J (2004) The biology of the small hive beetle (Aethina tumida, Coleoptera: Nitidulidae): Gaps in our knowledge
PENG, C; WILLIAMS, R N (1990b) Pre-oviposition period, egg production and mortality of six species of hibernating sap beetles (Coleoptera: Nitidulidae). Journal of Entomological Science 25(3): 453-457. PETTIS, J S; SHIMANUKI, H (2000) Observations on the small hive beetle, Aethina tumida, Murray, in the United States, American
Bee Journal 140, 152-155. PIRK, C W W (2002) Reproductive conflicts in honey bee colonies. PhD thesis, Department of Zoology & Entomology, Rhodes University, South Africa. PIRK, C W W; NEUMANN, P (2013) Small hive beetles are facultative
of an invasive species. Apidologie 35: 229-247.
predators of adult honey bees. Journal of Insect Behaviour 26:
http://dx.doi.org/10.1051/apido:2004010
http://dx.doi.org/10.1007/s10905-013-9392-6
NEUMANN, P; RITTER, W (2004) A scientific note on the association
PIRK, C W W; DE MIRANDA, J R; FRIES, I; KRAMER, M; PAXTON, R;
of Cychramus luteus (Coleoptera: Nitidulidae) with honey bee
MURRAY, T; NAZZI, F; SHUTLER, D; VAN DER STEEN, J J M; VAN
(Apis mellifera) colonies. Apidologie 35: 665-666.
DOOREMALEN, C (2013) Statistical guidelines for Apis mellifera
http://dx.doi.org/10.1051/apido:2004051
research. In V Dietemann; J D Ellis; P Neumann (Eds) The
NEUMANN, P; HOFFMANN, D (2008) Small hive beetle diagnosis and control in naturally infested honey bee colonies using bottom board traps and CheckMite+ strips. Journal of Pest Science 81: 43 –48. http://dx.doi.org/10.1007/s10340-007-0183-8 NEUMANN, P; PIRK, C W W; HEPBURN, H R; EELZEN, P J; BAXTER, J R
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.13 RÖSCH, G A (1925) Untersuchungen über die Arbeitsteilung im Bienenstaat. 1. Teil: Die Tätigkeiten im normalen Bienenstaate
(2001a) Laboratory rearing of small hive beetle, Aethina tumida
und ihre Beziehungen zum Alter der Arbeitsbienen. Zeitschrift für
(Coleoptera: Nitidulidae). Journal of Apicultural Research 40: 111-112.
vergleichende Physiologie 2: 571-631.
NEUMANN, P; PIRK, C W W; HEPBURN, H R; RADLOFF, S E (2001b)
SCHÄFER, M O; PETTIS, J S; RITTER, W; NEUMANN, P (2008) A
A scientific note on the natural merger of two honey bee colonies
scientific note on quantitative diagnosis of small hive beetles,
(Apis mellifera capensis). Apidologie 32: 113-114.
Aethina tumida, in the field. Apidologie 39: 564-565.
http://dx.doi.org/10.1051/apido:2001116 NEUMANN, P; PIRK, C W W; HEPBURN, H R; SOLBRIG, A J;
http://dx.doi.org/10.1051/apido:2008038 SCHÄFER, M O; PETTIS, J S; RITTER, W; NEUMANN, P (2010a)
RATNIEKS, F L W; ELZEN, P J; BAXTER, J R (2001c) Social
Simple small hive beetle diagnosis. American Bee Journal 150:
encapsulation of beetle parasites by Cape honey bee colonies
371-372.
(Apis mellifera capensis Esch.). Naturwissenschaften 88: 214–216. SCHÄFER, M O; RITTER, W; PETTIS, J S; NEUMANN, P (2010b) Small http://dx.doi.org/10.1007/s001140100224 NEUMANN, P; RADLOFF, S E; PIRK, C W W; HEPBURN, H R (2003) The behaviour of drifted Cape honey bee workers (Apis mellifera
hive beetles, Aethina tumida, are vectors of Paenibacillus larvae.
Apidologie 41: 14-20. http://dx.doi.org/10.1051/apido/2009037
capensis): predisposition for social parasitism? Apidologie 34: 585- SCHÄFER, M O; RITTER, W; PETTIS, J S; NEUMANN, P (2011) 590. http://dx.doi.org/10.1051/apido:2003048 NEUMANN, P; HOFFMANN, D; DUNCAN, M; SPOONER-HART, R;
Concurrent parasitism alters thermoregulation in honey bee (Hymenoptera: Apidae) winter clusters. Annals of the
PETTIS, J S (2012) Long-range dispersal of small hive beetles.
Entomological Society of America 104(3): 476-482
Journal of Apicultural Research 51(2): 214-215.
http://dx.doi.org/10.1603/AN10142
http://dx.doi.org/10.3896/IBRA.1.51.2.11
Neumann et al.
32
SCHEINER, R; ABRAMSON, C I; BRODSCHNEIDER, R; CRAILSHEIM, K; SPIEWOK, S; DUNCAN, M, SPOONER-HART, R; PETTIS, J S; FARINA, W; FUCHS, S; GRÜNEWALD, B; HAHSHOLD, S; KARRER, M;
NEUMANN P (2008) Small hive beetle, Aethina tumida,
KOENIGER, G; KOENIGER, N; MENZEL, R; MUJAGIC, S;
populations II: dispersal of small hive beetles. Apidologie 39:
RADSPIELER, G; SCHMICKLl, T; SCHNEIDER, C; SIEGEL, A J;
683–693.
SZOPEK, M; THENIUS, R (2013) Standard methods for
http://dx.doi.org/10.1051/apido:2008054
behavioural studies of Apis mellifera. In V Dietemann; J D Ellis;
STEDMAN, M (2006) Small hive beetle (SHB): Aethina tumida Murray
P Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
(Coleoptera: Nitidulidae). Government of South Australia. Primary
methods for Apis mellifera research. Journal of Apicultural
Industries and Resources for South Australia. Factsheet 03/06: 13 pp.
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.04 SCHMOLKE, M D (1974) A study of Aethina tumida: the small hive
STRAUSS, U (2009) Small hive beetle (Aethina tumida) behaviour in honey bee (Apis mellifera) colonies. Honours thesis, Social Insect
beetle. University of Rhodesia Certificate in Field Ecology Project
Research Group, Department of Zoology and Entomology,
Report, 178 pp.
University of Pretoria, South Africa.
SOLBRIG, A J (2001) Interaction between the South African honey
WALSH, P S; METZGER, D A; HIGUCHI, R (1991) Chelex 100 as a
bee, Apis mellifera capensis Esch., and the small hive beetle,
medium for simple extraction of DNA for PCR-based typing from
Aethina tumida Murray. Diplomarbeit, Freie Universität Berlin,
forensic material. BioTechniques 10(4): 506-513.
Institut für Zoologie, Berlin, Germany. SOMERVILLE, D (2003) Study of the small hive beetle in the USA.
WARD, L; BROWN, M; NEUMANN, P; WILKINS, S; PETTIS, J S; BOONHAM, N (2007) A DNA method for screening hive debris for
Rural Industries Research and Development Corporation, Barton,
the presence of small hive beetles (Aethina tumida). Apidologie
Australian Capital Territory. 57 pp.
38: 289-295.
SPIEWOK, S; NEUMANN, P (2006a) Infestation of commercial bumble bee (Bombus impatiens) field colonies by small hive beetles
http://dx.doi.org/10.1051/apido:2007004 WILLIAMS, G R; ALAUX, C; COSTA, C; CSÁKI, T; DOUBLET, V;
(Aethina tumida). Ecological Entomology 31: 623-628.
EISENHARDT, D; FRIES, I; KUHN, R; MCMAHON, D P;
http://dx.doi.org/10.1111/j.1365-2311.2006.00827.x
MEDRZYCKI, P; MURRAY, T E; NATSOPOULOU, M E; NEUMANN, P;
SPIEWOK, S; NEUMANN, P (2006b) Cryptic low-level reproduction of
OLIVER, R; PAXTON, R J; PERNAL, S F; SHUTLER, D; TANNER, G;
small hive beetles in honey bee colonies. Journal of Apicultural
VAN DER STEEN, J J M; BRODSCHNEIDER, R (2013) Standard
Research 45(1): 47-48 http://dx.doi.org/10.3896/IBRA.1.45.1.11
methods for maintaining adult Apis mellifera in cages under in
SPIEWOK S; NEUMANN, P (2012) Sex ratio and dispersal of small hive
vitro laboratory conditions. In V Dietemann; J D Ellis; P Neumann
beetles. Journal of Apicultural Research 51(2): 216-217.
(Eds) The COLOSS BEEBOOK, Volume I: standard methods for
http://dx.doi.org/10.3896/IBRA.1.51.2.12
Apis mellifera research. Journal of Apicultural Research 52(1):
SPIEWOK, S; PETTIS, J, DUNCAN, M; SPOONER-HART, R; WESTERVELT, D; NEUMANN, P (2007) Small hive beetle, Aethina
tumida, populations I: Infestation levels of honey bee colonies, apiaries and regions. Apidologie 38: 595–605. http://dx.doi.org/10.1051/apido:2007042
http://dx.doi.org/10.3896/IBRA.1.52.1.04
Journal of Apicultural Research 52(4): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.4.20
REVIEW ARTICLE
Standard methods for tracheal mite research
Diana Sammataro1*, Lilia de Guzman2, Sherly George3, Ron Ochoa4 and Gard Otis5 1
USDA-ARS Carl Hayden Honey Bee Research Center, Tucson, Arizona, USA. USDA-ARS Honey Bee Breeding, Genetics & Physiology Lab., Baton Rouge, Louisiana, USA. 3 Plant Health & Environment Lab., Investigation & Diagnostic Centres & Response, Ministry for Primary Industries, New Zealand. 4 USDA-ARS Systematic Entomology Lab., Beltsville, Maryland, USA. 5 School of Environmental Sciences, University of Guelph, Guelph, Ontario, Canada. 2
Received 24 April 2012, accepted subject to revision 2 October 2012, accepted for publication 21 June 2013. *Corresponding author: Email: Diana.Sammataro@ars.usda.gov
Summary The honey bee tracheal mite (HBTM) Acarapis woodi (Rennie) (Acari: Tarsonemidae) is an obligate endoparasite of honey bees. First described from the Western (European) honey bee Apis mellifera L., this mite species was initially observed when honey bee colonies on the Isle of Wight, UK were dying between 1904 and 1919 (Rennie, 1921). Since then, this mite has been found in Europe, North and South America and parts of Asia, but its global distribution is not well understood. In this chapter, we outline protocols for collecting, detecting, identifying, diagnosing and measuring the infestation rates of A. woodi. We also describe methods to determine the damage threshold, outline several control measures, and describe methods for studying live mites.
Métodos estándar para el estudio del ácaro traqueal Resumen El ácaro traqueal de la abeja de la miel (HBTM son sus siglas en inglés) Acarapis woodi (Rennie) (Acari: Tarsonemidae) es un endoparásito obligado de la abeja. Fue descrito por primera vez en la abeja occidental europea Apis mellifera L. Esta especie se describió inicialmente en la mortandad de las colonias de abejas de la isla de Wight, Reino Unido, entre 1904 y 1919 (Rennie, 1921). Desde entonces, este ácaro ha sido encontrado en Europa, en el Sur y Norte de América y en zonas de Asia, aunque su distribución global aún no se comprende bien. En este capítulo, se describen los protocolos para la recolección, detección, identificación, diagnóstico y medición de las tasas de infestación de A.
woodi. También se describen métodos para determinar el umbral de daño, se esbozan una serie de medidas de control, y se describen métodos para el estudio de ácaros vivos.
气管螨研究的标准化方法 摘要 蜜蜂气管螨(Acarapis woodi )(Rennie) (Acari: Tarsonemidae)是一种蜜蜂的专一性体内寄生虫。该螨最早发现于西方蜜蜂(Apis mellifera L) 上,当时正值1904至1919年间英国怀特岛上蜂群死亡期(Rennie, 1921)。此后,该螨发现于欧洲、南北美洲和部分亚洲地区,但它在全球的 分布情况尚未充分探明。本章我们概述了气管螨研究中样品采集、检测、鉴定、诊断和感染率测定的实验方法。同时,我们介绍了测定损伤阈值 的方法,概述了多种防治措施,并介绍了研究活体螨的方法。
Keywords: COLOSS BEEBOOK, Acarapis woodi, Apis mellifera, honey bee, research methods, protocol Footnote: Please cite this paper as: SAMMATARO, D; DE GUZMAN, L; GEORGE, S; OCHOA, R; OTIS, G (2013) Standard methods for tracheal mites research. In V Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.20
Sammataro et al.
2
Table of Contents
Page No.
Page No.
1.
Introduction
2 3.3.5.
Screening a large number of bees
11
2.
Taxonomy and systematics
2 3.3.6.
Thoracic Disc Method (TDM)
11
2.1.
Taxonomy
2 3.4.
Serological detection of Acarapis woodi
12
2.2.
Identifying tracheal mites
3 3.4.1.
Enzyme-linked Immunosorbent Assay (ELISA)
12
2.2.1.
Mite appearance
3 3.4.2.
Guanine visualization
12
2.2.2.
New tarsonemid mite associations
4 3.4.3.
Molecular detection of Acarapis woodi in Apis mellifera
12
2.2.3.
Where to find mites
4 3.4.4.
Real-time PCR
13
2.2.4.
Life cycle
5 4.
Experimentation with mites
13
2.2.5.
Mite dispersal
5 4.1.
Rearing HBTM in colonies
13
3.
Collecting mites
7 4.1.1.
Removing sealed brood
13
3.1.
Field methods
7 4.1.2.
Artificial rearing of HBTM
14
3.2.
Sampling methods from colonies
7 4.2.
Infesting bees with HBTM
14
3.2.1.
When to sample
7 4.3.
Collecting live mites
14
3.2.2.
Collecting bee samples
7 5.
Controlling tracheal mites
14
3.2.3.
Shipping samples
8 5.1.
Effects on bees
14
3.2.4.
Number of bees to be examined to detect the presence of HBTM
8 5.2.
Resistant bees
15
3.3.
Detection methods
8 5.3.
Chemical control
15
3.3.1.
Laboratory detection: microscopic detection of Acarapis
8 5.4.
Cultural control
16
3.3.2.
Screening individual bees
9 6.
Acknowledgements
16
3.3.3.
Sample preparation: morphological analysis and slide preparation
9 7.
References
17
3.3.4.
How to mount specimens
9
woodi
1. Introduction
(Ellis and Munn, 2005). To date, it is not known to occur in Australia,
Countries that export bees and bee products are required to conduct
New Zealand or Scandinavia (Denmark et al., 2000; Hoy, 2011).
apiculture surveillance programmes to meet disease reporting and
Recent work by Kojima et al. (2011a) reported A. woodi was found on
sanitary control requirements of the OIE (Office International des
Asian honey bees, A. cerana japonica, in Japan.
Epizooties) to facilitate international trade. A surveillance programme
From what we currently know, A. mellifera is the original host of
also aids in early detection of honey bee pests and diseases including
HBTM, as this mite has only been recorded on other Apis species
any new introductions. One pest is the Honey Bee Tracheal Mite
following the introduction of A. mellifera to Asia. The exact causes of
(HBTM) Acarapis woodi (Acari: Tarsonemidae), an obligate
the loss of colonies infested with HBTM are still unknown. This
endoparasite of honey bees. This microscopic mite was discovered in
problem is exacerbated by the lack of unique symptoms associated
1919 in the UK (Rennie et al. , 1921). The identification and
with tracheal mite.
detection of the mite led to a law from the US Department of Agriculture restricting all live honey bee imports into the USA in 1922 (Phillips, 1923). Despite this restriction, HBTM was first seen in the
2. Taxonomy and systematics
USA by beekeepers in Texas in 1984 and the prairie provinces of
2.1. Taxonomy
Canada in 1985. Thereafter, A. woodi spread throughout the USA and
Honey bee tracheal mites were first described by Rennie as
most Canadian provinces, facilitated by commercial beekeepers
Tarsonemus woodi in 1921, as parasites of the Western (European)
transporting bees for pollination, and the sale of mite-infested
honey bee Apis mellifera L. This discovery followed extensive colony
package bees.
mortality on the Isle of Wight and elsewhere in the UK between 1904
In addition, infested swarms, drifting bees, and the worldwide
and 1919 when bee colonies began to die from unknown causes
distribution of A. mellifera have contributed to the spread of this mite. (Rennie, 1921). The initial suspicion that the “Isle of Wight Disease� Although its current range is not fully known, the HBTM has
was caused by tracheal mites (Hirst, 1921; Rennie, 1921) was never
successfully been established in many countries in most continents,
confirmed (Bailey, 1964). Hirst (1921) reclassified the species as
including Europe, Asia, parts of Africa, and North and South America
Acarapis woodi, the name by which it is known today (Lindquist, 1986).
The COLOSS BEEBOOK: tracheal mites
3
Table 1. Differential diagnosis of Acarapis species (Ritter, 1996). Character Notch of the coxal plate Space between stigmata Length of tarsal limb (IV leg pair)
A. dorsalis A. externus Deep 16.7 µm 7.6 µm
Flat to Short 16.8 µm 11.4 µm
A. woodi Short 13.9 µm 7.5 µm
When found, they are often at very low levels, perhaps due to the treatments used to control V. destructor (see Dietemann et al., 2013). The current taxonomy of HBTM, based on Krantz et al. (2009) is: Kingdom: Animalia Phylum: Arthropoda
Its detection led to the restriction of all live honey bee imports into
Class: Arachnida
the USA in 1922 (Phillips, 1923). Despite this, the first report of colony
Subclass: Acari
losses from HBTM in the USA came from beekeepers in Texas in
Superorder: Acariformes
1984. Thereafter, A. woodi spread to all states of the USA and most
Suborder: Prostigmata
Canadian provinces. Their range expansion was facilitated by commercial
Order: Trombidiformes
beekeepers transporting bees for pollination, and from the sale of
Cohort: Heterostigmatina
mite-infested package bees.
Superfamily: Tarsonemoidea
In addition to A. woodi, there are two external mite species in the
Family: Tarsonemidae
genus Acarapis that infest honey bees. A. externus Morgenthaler is
Genus: Acarapis
found on the cervix (the neck region) and A. dorsalis Morgenthaler is
Species: woodi
found on the dorsal groove of the thorax (Ibay and Burgett, 1989; Fig. 1. A, B; Table 1). They were considered to be harmless by Eckert (1961) and Delfinado-Baker (1984), but that may reflect a lack of
2.2. Identifying tracheal mites
information on these two Acarapis species. A third external species,
Also see Section 3 for methods of collecting and identifying mites.
A. vagans (Schneider), described from central Europe and New Zealand, was found principally on drones, on the basal part of the hind wing (Lindquist, 1986). However, other researchers considered
2.2.1. Mite appearance
this species to be nomen dubium and to date this issue has not been
Adult female tracheal mites have a pyriform (pear-shaped) body (Fig. 2),
resolved (Delfinado-Baker and Baker, 1982; Lindquist, 1986).
measuring 120 to190 µm long by 77 to 80 µm wide. Female mites can
Unfortunately, HBTM is now overshadowed by the ectoparasitic
be distinguished by their stubby form and the presence of five setae
mite, Varroa destructor Anderson and Trueman. As a result, the
on leg IV (Fig. 1C). Adult males are 125 to 136 µm long by 60 to 77 µm
presence of HBTM in some instances is not regularly investigated.
wide (Fig. 2). Leg IV of the males lacks all the tarsal structures. Both
Fig. 1. A. Ventral view of Acarapis dorsalis (ex. New Zealand honey bee); B. A. externus (ex. New Zealand honey bee) and; C. A. woodi adult female (ex. Canadian honey bee) taken at a 400x magnification under light microscopy.
Photos: Dr Qing-Hai Fan.
Sammataro et al.
4
reported the presence of P. indoapis on A. mellifera in Egypt. However, based on the information and drawing by Abou-Senna (1997), Ochoa et al. (2003) considered this association and the identification of the mite incorrect. The males, immatures and the feeding habits of
P. indoapis have been described by Sumangala and Haq (2002), while males, immatures, and the feeding behaviour of P. trispicula remain unknown. Recently, P. indoapis were reported from both A. cerana and A. mellifera from Vanuatu and from China (Q-H Fan and S George, pers. comm. 2013; see Fig. 4). 2.2.3. Where to find mites
Acarapis woodi can hide under the flat lobe that covers the bee’s first thoracic spiracle, accessing the main pro-thoracic tracheal trunk (Fig. 5). To look for or collect mites, bees must be dissected, see sections 3 and 4.
Fig. 2. LT-SEM micrographs of the dorsal view of a male (top) and female (bottom) of A. woodi.
Photos: E Erbe and R Ochoa.
sexes have the dorsum covered with round to elongated bumps and an absence of bothridial setae on the prodorsal area (Fig. 2). The gnathosoma contains the mouth parts, palps and the chelicerae. Ventrally, the adults have an anterior apodeme forming a Y-shaped juncture with the prosternal apodeme (Fig. 1C). All tracheal mites are a semi glossy white colour. Immature mites have 3 pairs of legs and are bigger than the adult female (Figs 3 and 6C). Delfinado-Baker and Baker (1982), Lindquist (1986) and Ochoa et al. (2005) present detailed descriptions of the genus Acarapis, and in particular of A. woodi. 2.2.2. New tarsonemid mite associations Other mites in the family Tarsonemidae have been reported in association with Apis bees. Tarsonemus apis was reported on Apis spp. by Rennie (1921) and Pseudacarapis indoapis was reported on
Apis cerana Fabricius by Lindquist (1986). In 2003, Ochoa et al. reported a new mite, Pseudacarapis trispicula (Fig. 4), collected from the comb of live A. mellifera in Mexico. Females of P. trispicula are similar in size (length 173-214 Âľm, width 85-93 Âľm) to Acarapis mites. Studies in India found P. indoapis was only associated with colonies of
A. cerana in areas where colonies of A. mellifera were also present
Fig. 3. SEM micrographs of anterior region of A. woodi female (top)
(Sumangala, 1999; Sumangala and Haq, 2001). Abou-Senna (1997)
and close-up of the larva (bottom).
Photos: E Erbe and R Ochoa.
The COLOSS BEEBOOK: tracheal mites
5
2.2.5. Mite dispersal Once a suitable host is found (queens, workers or drones), the female mite enters a trachea via the spiracle to lay eggs. Drones have been found to have more mites than workers (Royce and Rossignol, 1991; Dawicke et al., 1992), perhaps due to their larger tracheal trunks. Workers, however, which are more abundant through the year, are the prime host and reservoir for HBTM in bee colonies. Queens, even those commercially reared, often have HBTM. Camazine et al. (1998) found that infested queens weighed less, however, queens with completely black thoracic tracheae have been observed laying eggs and otherwise acting normally (D Sammataro, pers. obs.). Mites will also infest the air sacs of the bees’ abdomen and head (Giordani, 1965), and can be found externally at the base of the bee’s wings (Royce and Rossignol, 1991); the fate of the mites found in these areas and their effect on the host is unknown. Female mites can disperse when the host bee is more than 12 days old, peaking at 15 to 25 days by questing on bee setae (Pettis and Wilson, 1996; Fig. 8); mites have a higher dispersal rate at night (Pettis et al., 1992). Eggs and female HBTM have been found at the wingbase of the bee’s thorax (Royce et al., 1988). During this questing period, mites are vulnerable to desiccation and starvation, and their
Fig. 4. Pseudoacarapis trispicula on Apis mellifera.
survival depends on the ambient temperature and humidity
Photo: R Ochoa (400×).
2.2.4. Life cycle The life stages are, egg, larva, and adult. The nymphal instar remains inside the larval skin (Fig. 5). Males complete their development in 11 to 12 days, females in 14 to 15 days; therefore, a new generation of mites can emerge in two weeks (Pettis and Wilson, 1996). All larval and adult stages of HBTM feed on bee haemolymph, which they obtain by piercing the walls of the trachea and air sacs with their sharply pointed stylets that move by internal chitinous levers (Hirschfelder and Sachs, 1952). Once the bee trachea is pierced, the mites’ mouth presses close to the wound and bee haemolymph is sucked through the short tube into the pharynx. All mite instars live within the tracheae and associated air sacs (Figs. 5, 6, 7, 8), except during a brief period when adult, mated females disperse to search for young (generally less than four days old) bee hosts. Mites are attracted to the outflowing air from the prothoracic spiracle and to specific hydrocarbons from the bees’ cuticle (Phelan et al., 1991; McMullan et al., 2010) and immature stages may move into the trachea via air currents during bee respiration (Ochoa et al., 2005). HBTM females are less attracted to older bees, which during the summer will usually not live long enough for the mites to complete their life cycle.
Fig. 5. Life cycle of tracheal mites. (Morse, 1991)
Sammataro et al.
6
A
B A
B
C
Fig. 7. A. View of interior of tracheal tube containing a female HBTM; Fig. 6. A. Pro-thoracic trachea of a honey bee, filled with HBTM;
the long setae on Leg IV are thought to be used to help measure the
B. Micrograph of stained tracheal tubes with mites (left) and clean, no interior walls of tracheae (Ochoa et al., 2005); mites (right) (Photos: D Sammataro, Light Stereoscope 400Ă—);
C. LT-SEM micrograph of an open tracheal tube showing female, male
B. Larval mite (arrow), adults and egg (far right). LT-SEM photos: E Erbe and R Ochoa.
and immature mites and eggs. Note the smaller males further inside the trachea, arrowed.
Photo: E Erbe and R Ochoa.
(Giordani, 1962). An exposed mite will die after a few hours unless it enters a host; they are also at risk of being dislodged during bee flight and grooming (Sammataro and Needham, 1996; Sammataro et al., 2000). In infested and crowded tracheal tubes, males move about and locate pharate nymphal females that are about to moult to adulthood and guard them in advance of mating (Ochoa et al., 2005). The males do not attach to the immature stages as is common in other genera in the family Tarsonemidae (Ochoa et al., 2005). Only the female HBTM go deep into the tracheal system, measuring the walls of the tracheal branches with their dorsal and ventral setae and the leg IV seta; see Fig. 7A (Ochoa et al., 2005). The eggs are 5 to 15 Âľm longer than the adult females (see Fig. 7B). The genotype of honey bees and the location of the colonies influence the levels of HBTM infestations. Buckfast, ARS-Y-C-1 (Yugoslavian) and Russian honey bees are known to be resistant to
Fig. 8. A female tracheal mite questing on bee seta. Drawing:
HBTM (Lin et al., 1996; Danka et al., 1995; de Guzman et al., 2002,
D Sammataro (Sammataro and Avitabile, 2011).
2005). Heat is also associated with mite mortality (Harbo, 1993). Exposing hives to direct sun impedes HBTM mite population growth and shading them tends to accelerate it (L. de Guzman, unpub. data).
The COLOSS BEEBOOK: tracheal mites
3. Collecting mites Beekeepers often use unreliable bee and colony symptoms, such as
7
Procedure: 1. Collect about 50 bees from frames in the honey super or from
dwindling populations, abandoned overwintered hives full of honey, or
the inner covers where older bees congregate. Highly-infested,
weak bees crawling on the ground, as symptoms of HBTM infestation.
older bees will have darkened trachea and many stages of
These symptoms are not dependable and are not recommended.
mites, although some of the younger female mites may have migrated out of the tubes.
3.1. Field methods
2. If young nurse bees (found in the broodnest) are present,
In general, bees do not show symptoms that are reliable indicators of
these young bees may only have foundress mites that just
mite infestation. Tracheal mites affect the overwintering capability of
started reproducing. The presence of one foundress or a
bee colonies and have been associated with bees displaying disjointed
foundress and an egg near the opening of the trachea may be
wings (called ‘K-wing’) or crawling on the ground near hives. Crawling
difficult to detect. Thus, to determine mite abundance
bees are only apparent during winter or early spring months,
(number of mites per bee) or mite intensity (number of mites
particularly when HBTM infestations are very high. With the
per infested bee), it is best to sample bees from the honey
widespread distribution of nosemosis (see Fries et al., 2012) and
and pollen regions of brood frames, where a good mixture of
some viral infections which may cause similar symptoms (de Miranda
young and old bees is generally found.
et al., 2013), the presence of crawlers in front of colonies should not
3. Collect bees by using portable insect vacuums (Fig. 9) or by
be used as a reliable indicator of HBTM infestation (Bailey, 1961;
scooping bees with a plastic cup directly from the frames or
Bailey & Ball, 1991).
inner cover.
The only way to identify HBTM is to physically examine honey
4. Place samples into vials or plastic bags or sample directly into
bees for mites. This section describes several sampling techniques to
a wide-mouth jar containing 70% ethanol. Label each
look for mites inside bees.
container or plastic bag with location, colony number and the date the samples were collected.
3.2. Sampling colonies 3.2.1. When to sample When trying to detect tracheal mites, sampling time is crucial. Infestation by tracheal mites varies through time. For detection of HBTM in colonies, bees should be collected in winter or early spring when HBTM populations are highest because of the reduced bee brood production. During this time, a high proportion of older, overwintering bees is present in the colonies, and the mites have had a long time to reproduce. The large number of actively feeding mites can cause the tracheae to turn black. Infestation of HBTM decreases in summer due to the dilution of mite populations as they enter the large population of emerging host bees. 3.2.2. Collecting bee samples Because HBTM infestations are influenced by the age of bees, the location within the hive from which bees are sampled should be considered. Since queens can be found on honey frames, it is recommended to examine frames of the entire colony to find the queen before taking any samples; this will ensure that the queen will not end up in the sample jar. Collect adult drones for sampling as well, as they tend to have higher mite abundance than worker bees (Royce and Rossignol, 1991; Dawicke et al., 1992). However, because Fig. 9. Sampling bees for HBTM using a modified portable car vacuum, drones are seasonal, adult worker bees are most often sampled for detection or surveillance purposes.
which collects bees directly into a plastic vial. Photo of S Cobey by D Sammataro.
Sammataro et al.
8
5. Although bees can be preserved in 70% alcohol, fresh or frozen bees are easier to dissect. Examination of tracheae is easier when no alcohol is inside them. Bees stored for a long
found in statistical tables which contain the area under the normal curve. e is the desired level of precision (for example, setting it at 0.05
time in alcohol will have darker muscle and tracheal tissues,
means that the sample size provides 95% certainty of detecting
making the mites harder to detect.
a 5% tracheal mite infestation level),
6. If molecular techniques are used for mite detection, bee
p is the estimated proportion of bees infested with tracheal mites,
samples should be stored in a refrigerator at 4°C or frozen at
q is 1-p.
-80°C. Storage containers are similar to those used for varroa
Example: A colony has an expected infestation of about 5%.
(see Dietemann et al., 2013).
Using this equation to determine a sample size, we will have: Z = 1.96; α (Alpha) = 0.05 (significance level)
3.2.3. Shipping samples
p = 0.05 (5%, estimated proportion of bees that are infested)
If bees are to be used for molecular analysis, samples should be
q = 0.95 (1-0.05)
shipped overnight on dry ice. Otherwise, alcohol wet samples can be
e (Beta, β) = 0.05 (95% precision level)
shipped through postal services (see similar for varroa: Dietemann
et al., 2013).
Substituting the values:
3.2.4. Number of bees to be examined to detect the presence
=
of HBTM About 30-50 bees are examined per colony in most studies. Because
If, on the other hand, infestation is estimated to be 10%, about
the tracheal networks on the two sides of the bees do not interconnect, 17 bees should be examined; an estimated 20% infestation only this represents independent samples of 60-100 tracheae. There are
requires about 4 bees to be examined, since there is a higher
different ways of determining the sample size needed to accurately
percentage of bees infestated. This method as well as the sequential
detect tracheal mite infestation of a colony. Frazier et al. (2000)
sampling technique may be useful for detection purposes (to determine
developed a sequential sampling technique which they validated twice when to apply treatments or for regulatory purposes) and is not by using two levels of significance (α = 0.10 and 0.20), and a
recommended for scientific reporting. In that case, a full sample
precision level of β = 0.05 and 0.10 (Table 2). This technique allows
should be analysed (e.g. 50 or 100 bees) to determine mite prevalence
one to classify low-infested (< 10%) and highly infested (> 10%)
(percentage of hosts infested) and/or mite abundance (number of
colonies. Such information is needed before deciding when to treat or
mites per host bee). In general, tracheal mite infestations lower than
not to treat a colony, and also if further sampling is necessary. This
20% do not require treatment, but this depends on the severity and
improved technique can save time and money since it requires fewer
length of the winter months (when bees are confined in their hives).
than 50 bees to reach a decision. For example, when 3 bees are found infested after examining 3-7
3.3. Detection methods
bees, stop sampling and decide to treat the colony because it is highly Since these parasitic mites reside inside the tracheae, their detection infested. However, if only 1 or 2 bees are infested with the first 7
requires specialized techniques, such as thoracic disc preparation and
examined, continue dissecting samples. If after dissecting 17 bees
examination under a dissecting microscope. This is a laborious
only 1 bee is found infested, also stop sampling and declare the
procedure. Molecular techniques are currently being developed (see
colony to be low-infested and therefore, no treatment is required.
section 3.4.3.) for processing bees in bulk, and should provide increased
However, if 5 bees are infested out of 17 bees examined, then the
sensitivity, specificity and speed of screening bees for tracheal mites.
colony is highly-infested and needs to be treated. If only 2, 3 or 4 bees are infested out of 17 bees, continue sampling (see Table 2). The following equation developed by Cochran (1963) is another
3.3.1. Laboratory detection: microscopic detection of
Acarapis woodi
way of finding the number of bees that need to be sampled for each
The morphological technique most frequently used involves examining
colony in order to get an accurate number of mites per bee and
the prothoracic tracheae under a microscope. Detection of low level
therefore if the colony needs to be treated:
infestation by A. woodi requires careful microscopic examination of tracheae. When the infestation is heavy, the trachea will turn opaque
Where: n0 is the sample size needed, 2
Z is the abscissa of the normal curve that cuts off an area at the tails (1 equals the desired confidence level). The value for Z is
and discoloured and mites can be noticed without the aid of a microscope. One method is to pull off the head and collar of a bee and examine the trachea (Sammataro, 2006; see video of bee dissection at: http://www.ars.usda.gov/pandp/docs.htm?docid=14370).
The COLOSS BEEBOOK: tracheal mites
9
Table 2. How to make decisions using the sequential sampling technique 3.3.2. Screening individual bees (modified from Frazier et al., 2000); Calderone and Shimanuki 1992;
When the level of infestation is low, tracheae from an individual bee
see text 3.2.4. for explanation.
need to be examined. Bees may be anesthetized or killed by freezing
Number of infested bees No. of bees Low infestation High infestation Moderate infestation examined (stop, don't treat) (stop, treatment) (continue sampling)
before examination. Milne (1948) developed a technique to locate the internal mites on individual bees (see Figs. 10 and 11 for details). 1. The bee is placed under a dissecting microscope, held prone
1
-
-
0,1
2
-
-
0,1,2
3
-
3
0,1,2
4
-
3
0,1,2
5
-
3
0,1,2
6
-
3
0,1,2
7
-
3
0,1,2
8
-
4
0,1,2,3
9
-
4
0,1,2,3
10
-
4
0,1,2,3
11
0
4
0,1,2,3
12
0
4
1,2,3
13
0
5
1,2,3,4
14
0
5
1,2,3,4
5. Lorenzen and Gary (1986) modified this technique where the
15
0
5
1,2,3,4
thoracic tergite was removed as a flap to look at mites in situ
16
1
5
1,2,3,4
(see also Ritter et al., 2013).
17
1
5
2,3,4
18
1
6
2,3,4,5
19
1
6
2,3,4,5
20
1
6
2,3,4,5
21
1
6
2,3,4,5
perfused with thiazolyl blue tetrazolium solution (5 mg stain in 5 ml
22
1
6
2,3,4,5
distilled water). The cuticle of live mites picks up the stain immediately
23
2
6
3,4,5
24
2
7
3,4,5,6
25
2
7
3,4,5,6
3.3.3. Sample preparation: morphological analysis and slide
26
2
7
3,4,5,6
preparation
27
2
7
3,4,5,6
28
3
7
4,5,6
29
3
8
4,5,6,7
30
3
8
4,5,6,7
31
3
8
4,5,6,7
for mounting specimens.
32
3
8
4,5,6,7
Mounting medium (Hoyer’s medium from Kranz and Walter, 2009)
33
4
8
5,6,7
34
4
8
5,6,7,8
35
4
9
5,6,7,8
36
4
9
5,6,7,8
37
4
9
5,6,7,8
38
4
9
5,6,7,8
39
5
9
6,7,8
above. Allow each solid ingredient to dissolve before adding the next
40
5
10
6,7,8,9
one. The mixture needs to be warmed and stirred gently so the gum
41
5
10
6,7,8,9
arabic can melt. Filter and store in airtight containers with rubber
42
5
10
6,7,8,9
stoppers. Do not use a screw top container. Caution: chloral hydrate
43
5
10
6,7,8,9
44
6
10
7,8,9
is a toxic chemical, a mutagen and a chromosome-damaging agent.
45
6
11
7,8,9,10
46
6
11
7,8,9,10
47
6
11
7,8,9,10
48
6
11
7,8,9,10
49
6
11
7,8,9,10
50
7
11
8,9,10
with forceps (across abdomen) and the head and the first pair of legs is scraped off using a scalpel or razor blade. 2. The ring of prothoracic sclerite (collar) is also removed using a fine forceps. 3. The exposed tracheae of both sides are removed after carefully detaching them from the thoracic wall. 4. The tracheae are removed and placed on a glass slide and examined under a microscope for mites; this technique is very time-consuming and also has the possibility to lose mites while separating tracheae from the thoracic wall and transferring them to the slide.
Liu (1995) developed a rapid technique to distinguish live mites from dead by staining with thiazolyl blue tetrazolium, which stains the live mites purple. The tracheae, after mounting on glass slides, are
and turns purple, dead mites turn greenish yellow.
HBTM specimens should be preserved carefully for microscopic examination. Since these mites are weakly sclerotized, no clearing agents are need. The mounting medium listed below is recommended
50 ml of distilled water 30 g gum Arabic 200 g chloral hydrate 20 ml glycerol
Note: The ingredients should be mixed in the sequence listed
3.3.4. How to mount specimens 1. Place a drop of Hoyer’s medium (section 3.3.3.) in the centre of a clean microscope slide. 2. Using the tip of a fine needle, minute pin or a wire loop, pick up a mite.
10
Sammataro et al.
Fig. 10. Dissecting a bee to determine tracheal mite infestation. A. Pin a worker bee through the thorax using two insect pins (the bee’s body will pivot in the dish if pinned with only 1 pin). The bee in this figure is pinned into a petri dish of hardened beeswax. The bee is covered in 70% ethanol to facilitate dissection. B. Remove the abdomen. This is a helpful technique to limit contents from the bee’s digestive systems from emptying into the field of view. C. Remove the head and front pair of legs. The “collar” junction is arrowed. D. The beginning of collar removal. The area where the collar has been removed is arrowed. E. The collar has been removed, including the part that covers the spiracles (arrowed). The bee’s right trachea (the one on the left in the figure) is outlined to show shape and position. F. Trachea infested with mites (on left, arrowed) and not infested with mites (on right, arrowed). G. Close-up of infested trachea and H. close-up of uninfested trachea. Photos: Lyle Buss and Tricia Toth, University of Florida, USA.
The COLOSS BEEBOOK: tracheal mites
3. Touch the tip of the tool to which the mite adhered to the droplet of Hoyer’s medium. 4. Gently press the mite to the bottom of the droplet and position the mite on a vertical axis.
11
1986; S George, pers. obs. in New Zealand). A ‘tracheal flotation technique’ developed by Camazine (1985) reduced this risk somewhat (of mixed Acarapis species) by grinding the bee thoraces in water; however, this method would not be suitable to detect low levels of
5. Using a pair of forceps, pick up a cover slip and gently place it infestation. on top of the droplet. 6. Mark the mite’s location by drawing a ring around the
3.3.6. Thoracic disc method (TDM)
specimen using a permanent marker, to facilitate locating the
TDM is a technique developed for detailed assessment of mite
specimen later.
infestations. TDM involves cutting a thoracic disc that contains the
7. Label slides with date of collection, place of collection, species prothoracic tracheae. name, host species and name of collector.
1. The bee is placed, dorsal side down and pinned in place and a
8. Dry slides at 45ºC for 48 h to one week.
razor blade or scalpel is used to cut off the head; then a thin
9. Slides can be sealed with a ring of glyptal (Glyptal, Inc.;
transverse section is cut from the anterior face of the thorax,
Chelsea, MA, USA)
resulting in a 1 to 1.5 mm section, which includes the trachea (Fig. 12). 2. The discs are then heated on a hot plate (approximately 60ºC for a minimum of 2 h) in 5-10% potassium hydroxide (KOH) to dissolve the surrounding tissues. 3. The contents then are passed through a fine strainer over a sink and rinsed with cold water to remove dissolved matter. 4. The samples are returned to a hot plate to digest further for another hour after adding fresh KOH, if the muscle tissue has not been completely cleared. 5. When the thoracic discs become transparent in the middle, leaving only the sclerotized tergites around the outside, they are sieved and gently rinsed with cold tap water. 6. The discs are returned to the Petri dish and suspended in
Fig. 11. Mites seen through tracheal tube. Light Microscope photo: L de Guzman (140x).
distilled water containing a few drops of aqueous methylene blue (1%) (Peng and Nasr, 1985). 7. Tracheae are then examined for tracheal mites under magnification (ca. 20-40×) using a dissecting microscope with
3.3.5. Screening a large number of bees
lighting from below. Even a small number of mites can be
For screening tracheae of many bees together to look for HBTM, a
detected through this method.
number of methods have been developed. Colin et al. (1979) developed the following technique. 1. Place bee thoraces in a blender with water 2. Grind for several seconds at 10,000 rpm 3 times to suspend the mites. 3. Strain the liquid through a screen mesh to remove larger particles and then centrifuge it to deposit the suspended particles at the bottom of the tube, which is then examined for mites. The advantage of this technique is that a large number of bees (100-200) can be processed together. However, other Acarapis species such as A. dorsalis and A. externus that reside on the neck, thorax and wing bases will also be extracted with this method; see Section 2.2. The morphological separation of these species is very time consuming. Washing bees prior to grinding was not found to be
Fig. 12. Positioning a bee to cut thoracic disks. The head is first removed,
effective in removing A. externus or A. dorsalis (Lorenzen and Gary,
then a thin section of the thorax is sliced. From Shimanuki and Knox, 1991.
Sammataro et al.
12
8.
Once cleared, the tracheae are then individually mounted on
Kojima et al. (2011b) published a conventional PCR method shown to
slides and examined under a microscope (Shimanuki and
amplify A. woodi DNA and not A. externus, but this method has not
Cantwell, 1978; Delfinado-Baker, 1984; Shimanuki and Knox,
been tested on A. dorsalis DNA. Although their test was able to detect
1991). A modified version of the thoracic disc method is used
A. woodi when four mites were present in a single bee, it was not
for detection of HBTM in New Zealand. Sampled bees are
able to detect the presence of a single mite unless a nested-PCR was
frozen for at least 24 h to facilitate cutting the thorax.
performed. Furthermore, Kojima et al. (2011b) did not test the sensitivity of detection at different bulking rates for extractions and
3.4. Serological and molecular detection of
Acarapis woodi
the need for post amplification handling (i.e. electrophoresis) increases the length of the detection procedure. Delmiglio and Ward (unpublished) obtained sequences from the
3.4.1. Enzyme-linked Immunosorbent Assay (ELISA)
CO1 region for A. woodi, A. externus and A. dorsalis and designed
Ragsdale and Furgala (1987) developed antiserum against A. woodi
real-time PCR primers and a TaqMan probe for A. woodi within a
where infested tracheae were detected using a direct enzyme-linked
single variable region of the CO1 gene. The assay was able to amplify
immunosorbent assay (ELISA); this method was further modified by
A. woodi DNA from a single mite (specimens obtained from Canada
Ragsdale and Kjer (1989). This assay was sensitive enough to detect
and UK).
a very low level of tracheal mite infestation but was found to cross-react
Tests showed that the assay was able to detect A. woodi down to
with other proteins present in the haemolymph and thoracic muscles.
1% and 2% prevalence in bees, and 200 copies of the target DNA
The lack of specificity limits the application of this test to tracheal
when using plasmid standards. The real-time assay was not found to
preparations. A practical ELISA test was developed by Grant et al. (1993) cross-react with mites of other genera associated with bees; however where whole bee samples could be analysed for HBTM detection, but
a very low level of cross-reaction occurs with the other two Acarapis
the sensitivity of the test was reduced when mite prevalence fell
species when sequence from these species are present at high
below 5%.
concentrations in the form of plasmid DNA, or when there are a very high number Acarapis mites. To counter this, bees are externally
3.4.2. Guanine visualization
washed before testing and a lower Ct cut-off of 35 cycles is used.
This is an indirect method based on detecting Guanine (2-amino-6oxypurine), which is the main end product of nitrogen metabolism in mites and other arachnids. It is present only in a negligible amount in
Nucleic acid extraction: Note: the extraction method is based on the semi-automated
bee excretions. In this method, bee tracheae are individually
system Thermo Kingfisher & InviMag® DNA Mini Kit (Invitek GmbH;
homogenized and their guanine content is visualized on thin layer
Germany):
chromatography (TLC) plates. Since bees need to be individually tested and low level infestations may go undetected (Mozes-Koch and Gerson, 1997), this method is not usually recommended.
1. Using this semi-automated extraction method, 15 bees maximum can be sampled per extraction to allow reliable detection of A. woodi from a single infected bee. 2. Prepare bees by removing the abdomens using a clean
3.4.3. Molecular detection of Acarapis woodi in Apis mellifera Because morphological detection is time -consuming and requires detailed and sustained attention by the screener, detection of A. woodi
scalpel, and place bee heads and thoraces into a filter grinding bag (Bioreba; Switzerland) of suitable size. 3. Add lysis Buffer P (Invitek GmbH; Germany) to the grinding
using a molecular technique is currently being developed by various
bag at a rate of 0.5 ml buffer per bee (i.e. use 7.5 ml for 15
laboratories for routine screening and quarantine checking. A real-time
bees), and using a Homex grinder (Bioreba, Switzerland)
PCR assay for A. woodi was designed by Giles Budge at the UK Food
grind the bees to form a lysate.
and Environment Research Agency (Fera) which amplifies a section of
4. Decant 600 µl of the lysate into a clean micro-centrifuge tube,
the internal transcribed spacer region 2 (ITS2); however when tested,
add 30 µl of proteinase K (Invitek GmbH; Germany) and
it was found to also amplify the ITS sequence from other Acarapis
incubate at 65oC for 30 min in a thermomixer (Eppendorf;
species. Evans et al. (2007) developed a nested PCR to amplify part of the cytochrome oxidase1 gene (CO1) of A. woodi. The PCR was designed to detect a low level of infestation of A. woodi from the entire thorax of a bee. At the time of development, the assay was not
Germany). 5. Centrifuge the resulting lysate at 8000 g for 1 minute to pellet debris. 6. Extract DNA from the cleared lysate using a KingFisher® ml
tested against other Acarapis species, but subsequent testing has
Magnetic Particle Processor system (Thermo Fisher Scientific
shown that these primers amplify sequences from them also
Inc.; USA) using the protocol and program recommended by
(Delmiglio et al., in prep.).
the manufacturer, and using buffers and magnetic beads
The COLOSS BEEBOOK: tracheal mites
13
supplied in an InviMag® DNA Mini Kit (Invitek GmbH;
4.1. Rearing HBTM in colonies
Germany).
Tracheal mite prevalence (the proportion of infested bees in a sample;
7. The resulting DNA is eluted in 260 ml of elution buffer D
Margolis et al., 1982) generally decreases during periods of the year
(Invitek), transferred to a fresh 1.5 ml tube and stored at -80°C when large numbers of young bees are emerging (due to extensive prior to use.
brood rearing and relatively short-lived adult bees). Prevalence increases during fall (when brood rearing is declining) or periods of
3.4.4. Real-time PCR
confinement (e.g. rainy weather), presumably because there is
1. qPCR reactions are run in final volume of 10 µl using
extensive contact between older infested bees and young susceptible
®
Platinum qPCR SuperMix-UDG (Invitrogen-Life Technologies) bees (Bailey & Ball, 1991). In cold temperate climates, mite 2. Each reaction contains a final concentration of:
prevalence usually increases rapidly from late summer until early
- 1x qPCR SuperMix
winter (Otis et al., 1988; de Guzman et al., 2002). However, HBTM
- 3.5 mM of Mg ions
prevalence in individual colonies in summer is not correlated with mite
- 0.3 µg of Bovine Serum Albumin (BSA)
prevalence in late fall; only when bee brood has largely disappeared
- 300 nM each of forward and reverse primer (Table 3) and
can mite prevalence in wintering colonies be predicted with any
- 100 nM of LNA probe (Table 3)
assurance (r = ~0.8, Dawicke et al., 1989). Due to variable bee
3. The cycling conditions used are (as optimized in a BioRad CFX mortality during the winter as well as brood production in infested -BioRad Laboratories) - 50oC for 2 min (UDG incubation-single colonies in early spring, mite prevalence in the fall is uncorrelated with mite prevalence the following spring (Dawicke et al., 1989). This
hold) o
- 95 C for 2 min (initial denaturation-single hold)
makes experimentation difficult because heavily infested colonies
And 35 cycles of:
cannot be identified until shortly before they are needed for
o
- 95 C for 10 sec (denaturation) o
- 59 C for 45 sec (anneal and extension) - Reading of signal at end of each cycle.
experiments. Once the wintering population of bees has developed (Mattila et al., 2001), mite prevalence tends to remain relatively constant over the
Note: The PCR competency and success of nucleic acid extracted
winter months in the absence of newly emerging worker bees (Bailey,
from bees is assessed using the internal control real-time PCR assay
1958); however, in some situations mite prevalence has increased
which amplifies part of the 18s rRNA gene of A. mellifera (Ward et al., over winter (Otis et al., 1988; McMullan, 2011). It is possible that mite 2007). The 18s real-time reactions were set-up and cycled as
emigration from tracheae is stimulated by high or increasing titers of
described for the A. woodi assay.
juvenile hormone (JH). This speculation would explain observations that although mite abundance (i.e. the mean number of mites per
4. Experimentation with live mites
bee) continues to increase in bee tracheae during the winter months due to continuing mite reproduction, mite prevalence (percent of bees
Mite populations tend to fluctuate seasonally, in patterns that are
infested of the total number of bees in the samples) generally does
moderately consistent at the regional level. However, individual
not. J McMullan (pers. comm.) indicated that when there is little or no
colonies frequently experience unexpected increases or decreases in
brood present in autumn and winter, it is difficult to influence mite
mite abundance, thereby complicating experimentation with them.
infestations experimentally.
There is no record of experimentation with individual mites until after they were discovered in North America in the 1990s. Because little
4.1.1. Removing sealed brood
has been published on techniques for experimenting with mites, most
During spring and summer, when brood rearing is continuous and
of the researchers who have studied mites in recent years provided
extensive, it is possible to increase mite infestations in colonies by
information that is synthesized below.
removing sealed bee brood (i.e. pupae). This has been done regularly
Table 3. Real-time PCR (qPCR). Sequence of primers and probe used for the detection of Acarapis woodi. Areas of sequences in bold (column 2) are non-complementary flaps; [+] Locked nucleic acid bases. Primer/Probe name
Sequence 5’-3’
aw_F1-flap
AATAAATCATAATGATATCCCAATTATCTGAGTAATG
aw_R3
AATATCTGTCATGAAGAATAATGTC
aw-LNAProbe
6FAM-ACC[+T]GT[+C]AA[+T]CC[+A]CCTAC-BHQ1
Amplicon length
113 bp
Sammataro et al.
14
by numerous researchers (McMullan and Brown, 2005; G W Otis, pers. obs.; J Villa, pers. comm.). Confining bees in hives may also
angle to the bee’s surface (Smith et al., 1987) 3. The lobe, spiracle, and most of the main tracheal trunk will be
increase infestation of young workers, but this has not been tested.
removed together. This technique was subsequently used by
One challenge is to increase mite prevalence, yet not so much that
Phelan et al. (1991), Bruce et al. (1991), and Sammataro and
winter survival is jeopardized. Because many heavily infested colonies
Needham (1996) to obtain living mites.
die over winter, studying live mites often requires sampling hives in
4. Other researchers have removed the bee’s head and
spring to find heavily infested colonies for experimentation. Several
pronotum to expose the large thoracic tracheal trunks. These
researchers have moved heavily infested colonies, only to subsequently
are either grasped at the spiracle with fine forceps (J Pettis,
find that the mite infestations declined drastically (J Pettis, pers.
pers. comm.; vanEngelsdorp and Otis, 2001b) or a cut is
comm.; J McMullan, pers. comm.; G W Otis, pers. obs.). It is not
made around the spiracle before removing the tracheal trunk
known why this occurs, but suggested causes are overheating or chilling during transport, loss of infested bees due to their failure to return to their hives after orientation flights in new locations (J Pettis, pers. comm.), or emigration of infested bees from the nest (J McMullan, pers. comm.).
(McMullan et al., 2010). 5. Allow the section of the trachea to dry onto a glass slide for ~ 2 min. 6. Tear open trachea with a minuten pin and pick up the mites with an eyelash attached to a wooden dowel (Phelan et al., 1991; vanEngelsdorp and Otis, 2001b; McMullan et al., 2010).
4.1.2. Artificial rearing of HBTM
7. Young, lightly bronzed female mites can be selected; males,
Bruce et al. (1991) experimented with in vitro rearing of A. woodi.
darker (older) females and those obviously gravid with an egg
They encased modified insect tissue culture medium, Medium MD1
can be avoided because they have reduced mobility (McMullan
(Whitcomb, 1983) developed for rearing Pyemotes tritici mites (Bruce,
et al., 2010; J Pettis, pers. comm.).
®
1989) in tiny parafilm tubes with a thickness of approximately 10 µm,
8. A female mite placed externally near the paranotal flap of a
made by stretching the film several times. Live mites were placed on
bee will crawl towards and enter the spiracle, (D Sammataro,
these tubes of medium within a closed Petri dish. Although only a
pers. obs.). When drones are present, they are preferred
small number of mites were studied, all of them successfully pierced
because mite intensity is generally higher in drones than in
the artificial membrane and fed on the medium. There has been no
workers (Dawicke et al., 1992).
further research on artificial rearing methods for HBTM.
9. Exposed mites are sensitive to desiccation, so they should be
4.2. Infesting bees with HBTM
10. vanEngelsdorp and Otis (2001b) could perform bioassays with
kept at high humidity.
1.
Allow worker bees to emerge in incubators.
living mites only at night, perhaps because of a circadian
2.
Mark bees with paint on their abdomens or numbered tags
rhythm in mite activity that influences their nocturnal dispersal
glued to their thoraces shortly after emergence. Paint applied
to new hosts (Pettis et al., 1992).
to the bees’ thoraces may interfere with migration of mites into their tracheae. 3.
Introduce them to infested colonies, preferably at dusk. Otherwise, screen the hive entrances for 1-2 h to prevent
5. Controlling tracheal mites
their rejection. Giordani (1962) referred to this method as
5.1. Effects on bees
infestation expérimentale. It has served as the method of
HBTM can cause diminished brood area, smaller bee populations,
obtaining infested bees to study the life history of the mite
looser winter clusters, increased honey consumption, lower honey
(Pettis and Wilson, 1996), host age-preference (Morgenthaler, yields and frequently, colony demise (Komejli et al., 1989). In 1931; Lee, 1963; Gary et al., 1989), caste preference
temperate regions, mite populations increase during the winter, when
(Dawicke et al., 1992), relative resistance of bees from
bees are confined to the hive in the winter cluster. Heavy mite
different genetic sources (Page and Gary, 1990; Danka and
infestation affects bee metabolism and the ability of colonies to
Villa, 1999; Nasr et al., 2001), and the effects of mites on
regulate the cluster temperature (Skinner, 2000); chilling may be a
adult bees (Bailey and Lee, 1959; Gary et al., 1989).
significant cause of colony death. In North America, colony losses increased shortly after first exposure to HBTM (Wilson et al., 1997).
4.3. Collecting live mites 1. Anesthetize a bee with CO2 (or place bees in refrigerator until immobile). 2. Grab the paranotal lobe that covers the metathoracic spiracle with fine forceps and pull the lobe posteriorly at a modest
Colonies with 40-50% tracheal mite infestation or higher frequently die during the winter in northern USA and Canada (Furgala et al. 1989; Otis and Scott-Dupree, 1992). The colder the winter temperatures, the greater the probability of mortality at any mite prevalence value.
The COLOSS BEEBOOK: tracheal mites
15
Treatments for HBTM include using vapours from menthol crystals,
to determine mite prevalences (percent of mite-infested bees in
synthetic acaricides and oil or grease patties made from vegetable
the samples) or mite abundances (average number of mites
shortening and sugar. Additionally, resistant lines of bees have been
per bee/total number of individuals of the host bees in the
developed.
sample) for the bees from each test colony source. Original colonies that tested lowest for HBTM can then be selected for
5.2. Resistant bees
a breeding program. For more information on breeding and
Some races of bees are less susceptible to tracheal mite infestations.
selecting traits in queen bees, see BĂźchler et al., 2013.
Resistance is accomplished in part by the increased autogrooming behaviour of bees (Lin et al., 1996; Pettis and Pankiw, 1998; Danka
5.3. Chemical control
and Villa, 2005; Villa, 2006; de Guzman et al., 2002, 2005). Russian
The overriding constraints for chemical control of mites are that the
and Buckfast queens are among the more resistant lines of bees.
chemicals must be effective against the target (i.e. mites) and
Fig. 13 illustrates steps needed to select and propagate bees that
harmless to bees, and they must not accumulate in hive products.
show resistance to HBTM. Colonies with 15-25% of workers infested
Because bees and mites are both arthropods, many of their basic
experience increased winter mortality. Bee stock can be screened for
physiological processes are similar, narrowing the possibilities for
HBTM resistance to develop resistant queen lines. In general,
finding suitable toxicants. To control HBTM, the material must be
untreated colonies that survive the winter with low mite numbers
volatile to reach the bee, inhaled, and lethal only to the parasite.
should be selected for a breeding programme. 1. First, select colonies to be tested for mite resistance and collect sealed brood frames from them. 2. Brush off the bees clinging to the frame and place it into a
Based on early research by Giordani (1977), menthol was widely tested and registered for treatment of hives in the United States and Canada. Menthol is extracted from the mint plant Mentha arvensis and is sold as crystals, which can be applied inside hives (usually 50 g
frame cage (Fig. 13, insert) and then into an incubator set at
of crystals in a nylon mesh sac are placed on the top bars of frames).
35ÂşC and 50% RH.
In cold conditions, menthol is ineffective for mite control because the
3. Mark each frame to identify the test colony it was removed from rate of vaporization is too low to provide concentrations lethal to the 4. After 12-24 hours in the incubator, remove and mark any
mites. Some Canadian beekeepers obtained good results under cool
emerging bees. Bees identified by coloured plastic tags or
conditions by applying pieces of cardboard saturated with a mixture of
model paint can be separated by colony of origin and placed
menthol (dissolved in alcohol) and vegetable shortening to hives. If
into an inoculation colony, where HBTM prevalence is high
the air temperatures outside are too high, menthol vapours may drive
(> 50%). (see section 4.2)
bees out of their hives. If bees are hanging outside the colony entrance
5. After a week or more, the marked bees that were released into host colonies can be retrieved and dissected
in treated colonies, crystals should be removed until temperatures drop.
Fig. 13. Schematic diagram outlining a procedure to determine the relative susceptibility of honey bee colonies to HBTM infestation. Brood combs with emerging bees are brushed free of adult bees and then placed into frame cages (insert) or other containers to isolate bees; frames are placed into an incubator. After a week, emerging bees are marked and then placed into inoculation colonies. The marked bees are retrieved after a week and dissected to determine mite prevalences or mite abundances for the bees from each test colony source (from Danka, 2001). See text for explanation.
Sammataro et al.
16
The synthetic pesticide amitraz, (sold as Apivar®) has been used for HBTM control. Check current regulations to determine its registration status. Formic acid has also been used against A. woodi (Hoppe et al., 1989; Amrine and Noel, 2006; Underwood and Currie, 2009; Hood and McCreadie 2001). Widely used as a treatment for varroa mites, formic acid (along with other acaricides used against varroa) may be contributing to current lower populations of HBTM in North America. As many of these chemicals could have a negative impact on both the bees and the honey, they are not recommended as both non-toxic vegetable shortening and resistant queen stock are better alternatives.
5.4. Cultural control An alternate, environmentally safe control is to use a ‘grease’ patty.
Fig. 14. Integrated Pest Management (IPM) tactics for bee mites. For
More accurately, this is a vegetable shortening and sugar patty (2:1
HBTM, ‘grease’ patty should be listed with essential oils and powdered
sugar: shortening by volume, or sufficient shortening that the mixture
sugar (D Sammataro).
does not break apart). Vegetable shortening (solid, hydrogenated vegetable oil, not animal fat) and white granulated sugar will keep mite prevalence to 10%, well below typical economic thresholds (< 20%). Animal fat will go rancid over time and is not recommended. Liquid vegetable oil can be used, but the patty will be looser and may
6. Acknowledgements
not hold up in the hive, unless mixed with ample amount of sugar.
We are grateful to the authors and the reviewers who gave helpful
A 113 g patty, placed on the top bars at the centre of the
suggestions and especially to Jamie Ellis for his patience. We wish to
broodnest where it comes in contact with the most bees, will protect
acknowledge the COLOSS network for making the BEEBOOK possible.
young bees (which are most at risk) from becoming infested. Patties
The COLOSS (Prevention of honey bee COlony LOSSes) network aims
can be prepared ahead of time if they are wrapped in waxed paper
to explain and prevent massive honey bee colony losses. It was
and stored in the freezer. The shortening appears to disrupt the
funded through the COST Action FA0803. COST (European
questing female mites as they search for new hosts (young bees)
Cooperation in Science and Technology) is a unique means for
(Sammataro and Needham, 1996; Sammataro et al., 1994). Because
European researchers to jointly develop their own ideas and new
young bees are emerging continuously, the patty must be present for
initiatives across all scientific disciplines through trans-European
an extended period. The optimal application seasons are fall and early networking of nationally funded research activities. Based on a panspring, when mite levels are increasing. Requeening colonies is likely to alter HBTM infestations once
European intergovernmental framework for cooperation in science and technology, COST has contributed since its creation more than 40
offspring of the new queens begin to emerge; those new offspring
years ago to closing the gap between science, policy makers and
may be more or less resistant to mites than the worker offspring of
society throughout Europe and beyond. COST is supported by the EU
the original queens. Apiary location may also affect tracheal mite
Seventh Framework Programme for research, technological
infestations (vanEngelsdorp and Otis, 2001a; L de Guzman, unpubl.
development and demonstration activities (Official Journal L 412, 30
data), perhaps due to temperature or humidity effects. Harbo (1993)
December 2006). The European Science Foundation as implementing
demonstrated that hives exposed to the sun in Louisiana had reduced
agent of COST provides the COST Office through an EC Grant
mite infestations. Integrated Pest Management (IPM) techniques have Agreement. The Council of the European Union provides the COST been successful in keeping HBTM under control; however, no
Secretariat. The COLOSS network is now supported by the Ricola
biological controls currently exist (Fig. 14).
Foundation - Nature & Culture.
A cautionary note should be added. Many beekeepers are opting not to treat for mites or diseases, allowing survivor stock to become established. HBTM may reappear if treatments for varroa mites are suspended; sampling for HBTM is therefore recommended, especially if colony symptoms consistent with tracheal mite infestations are observed.
The COLOSS BEEBOOK: tracheal mites
7. References ABOU-SENNA, F M (1997) A new record of phoretic mites on honey bee Apis mellifera L. in Egypt. Social Parasitology 27(3): 667-680. AMRINE, J W Jr; NOEL, R (2006) Formic acid fumigator for controlling honey bee mites in bee hives. International Journal of Acarology 32: 115-124. BAILEY, L (1958) The epidemiology of the infestation of the honey bee, Apis mellifera L., by the mite Acarapis woodi Rennie and the mortality of infested bees. Parasitology, 48: 493-506. BAILEY, L (1961) The natural incidence of Acarapis woodi (Rennie)
17
DANKA, R G (2001) Resistance of honey bees to tracheal mites. In T
Webster; K S Delaplane (Eds). Mites of the honey bee. Dadant and Sons; Hamilton, IL, USA. pp 117-129. DANKA, R G; VILLA, J D (1996) Influence of resistant honey bee hosts on the life history of the parasite Acarapis woodi. Experimental
and Applied Acarology 20 (6): 313-322. DANKA, R G; VILLA, J D (2005) An association in honey bees between autogrooming and the presence of migrating tracheal mites.
Apidologie 36(3): 331-333. DANKA, R G; VILLA, J D; RINDERER, T E; DELATTE, F T (1995) Field test of resistance to Acarapis woodi (Acari: Tarsonemidae) and of
and the winter mortality of honey bee colonies. Bee World 42: 96-
colony production by four stocks of honey bees (Hymenoptera:
100.
Apidae). Journal of Economic Entomology 88: 584–91.
BAILEY, L (1964) The ‘Isle of Wight disease’: the origin and significance of the myth. Bee World 45: 32-37, 18. BAILEY, L; BALL, B V (1991) Honey bee pathology. Academic Press; London, UK. BAILEY, L; LEE, D C (1959) The effect of infestation with Acarapis
woodi (Rennie) on the mortality of honey bees. Journal of Insect Pathology 1: 15-24. BRUCE, W A (1989) Artificial diet for the parasitic mite Pyemotes tritici
DAWICKE, B L; OTIS, G W; SCOTT-DUPREE, C; NASR, M E (1992) Host preference of the honey-bee tracheal mite (Acarapis woodi (Rennie)). Experimental and Applied Acarology 15: 83-98. DAWICKE, B; OTIS, G W; SCOTT-DUPREE, C D (1989) Predicting tracheal mite infestations and effects on colonies. American Bee
Journal 129: 814. DE GUZMAN, L I; RINDERER, T E; BIGALK, M; TUBBS, H; BERNARD, S J (2005) Russian honey bee (Hymenoptera: Apidae) colonies:
(Acari: Pyemotidae). Experimental and Applied Acarology 6: 11-
Acarapis woodi (Acari: Tarsonemidae) infestations and
18.
overwintering survival. Journal of Economic Entomology 98
BRUCE, W A; HENEGAR R B; HACKETT, K J (1991) An artificial membrane for in vitro feeding of Varroa jacobsoni and Acarapis
woodii, mite parasites of honey bees. Apidologie 22: 503-507. BÜCHLER, R; ANDONOV, S; BIENEFELD, K; COSTA, C; HATJINA, F; KEZIC, N; KRYGER, P; SPIVAK, M; UZUNOV, A; WILDE, J (2013) Standard methods for rearing and selection of Apis mellifera
(6):1796-1801. DE GUZMAN, L I; RINDERER, T E; DELATTE, G T; STELZER, J A; BEAMAN, G; KUZNETSOV, V (2002) Resistance to Acarapis woodi by honey bees from Far-eastern Russia. Apidologie 33(4): 411415. DE MIRANDA, J R; BAILEY, L; BALL, B V; BLANCHARD, P; BUDGE, G;
queens. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS
CHEJANOVSKY, N; CHEN, Y-P; GAUTHIER, L; GENERSCH, E;
BEEBOOK, Volume I: standard methods for Apis mellifera
DE GRAAF, D; RIBIÈRE, M; RYABOV, E; DE SMET, L;
research. Journal of Apicultural Research 52(1):
VAN DER STEEN, J J M (2013) Standard methods for virus
http://dx.doi.org/10.3896/IBRA.1.52.1.07
research in Apis mellifera. In V Dietemann; J D Ellis; P Neumann
CALDERONE, N W; SHIMANUKI, H (1992) Evaluation of sampling
(Eds) The COLOSS BEEBOOK, Volume II: standard methods for
methods for determining infestation rates of the tracheal mite
Apis mellifera pest and pathogen research. Journal of Apicultural
(Acarapis woodi R.) in colonies of the honey bee (Apis mellifera):
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.22
Spatial, temporal and spatio-temporal effects. Experimental and
Applied Acarology 15: 285-298. CAMAZINE, S (1985) Tracheal flotation: a rapid method for the detection of honey bee acarine disease. American Bee Journal 125
DELFINADO-BAKER, M (1984) Acarapis woodi in the United States.
American Bee Journal 124: 805–806. DELFINADO-BAKER, M; BAKER, E W (1982) Notes on honey bee mites of the genus Acarapis Hirst (Acari: Tarsonemidae). International
(2): 104-105.
Journal of Acarology 8: 211–26. CAMAZINE, S; ÇAKMAK, I; CRAMP, K; FINLEY, J; FISHER, J; FRAZIER, DELMIGLIO, C; WARD, L I; GEORGE, S; KUMARASINGHE, L; FLYNN, M (1998) How healthy are commercially-produced US honey bee A; CLOVER, G R G (2013) Development and evaluation of a Realqueens? American Bee Journal 138: 677–80. Time PCR assay for the detection of Acarapis woodi (tracheal COCHRAN, W G (1963) Sampling techniques (2nd Ed.). John Wiley and Sons Inc.; New York, USA. COLIN, M E; FAUCON, J P; GIAUFFRET, A; SARRAZIN, C (1979) A
mites) in Apis mellifera. (in prep.). DENMARK, H A; CROMROY, H L; SANFORD, M T (2000) Honey bee tracheal mite, Acarapis woodi (Rennie) (Arachnida: Acari:
new technique for the diagnosis of acarine infestation in honey
Tarsonemidae). DPI Entomology Circular, 267. Un. Florida, IFAS
bees. Journal of Apicultural Research 18: 222-224.
Extension.
Sammataro et al.
18
DIETEMANN, V; NAZZI, F; MARTIN, S J; ANDERSON, D; LOCKE, B; DELAPLANE, K S; WAUQUIEZ, Q; TANNAHILL, C; FREY, E; ZIEGELMANN, B; ROSENKRANZ, P; ELLIS, J D (2013) Standard methods for varroa research. In V Dietemann; J D Ellis;
P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.09 ECKERT, J E (1961) Acarapis mites of the honey bee, Apis mellifera Linnaeus. Journal of Insect Pathology 3:409–25. ELLIS, J D; MUNN, P A (2005) The worldwide health status of honey bees. Bee World 86(4): 88-101. EVANS, J D; PETTIS, J S; SMITH, I B (2007) A diagnostic genetic test
GRANT, G A; NELSON, D L; OLSEN, P E; RICE, W A (1993) The ELISA detection of tracheal mites in whole honey bee samples. American
Bee Journal 133: 652-655. HARBO, J (1993) Field and laboratory tests that associate heat with mortality of tracheal mites. Journal of Apicultural Research 32(34): 159-165. HIRSCHFELDER, H; SACHS, H (1952) Recent research on the acarine mite. Bee World 33: 201–9. HIRST, S (1921) On the mite (Acarapis woodi, Rennie) associated with Isle of Wight bee disease. Annals and Magazine of Natural
History, Ser.9, 7: 509-519. HOOD, W M; MCCREADIE, J W (2001) Field tests of the Varroa Treatment Device using formic acid to control Varroa destructor
for the honey bee tracheal mite, Acarapis woodi. Journal of
and Acarapis woodi. Journal of Agriculture and Urban Entomology
Apicultural Research 46(3): 1-5.
18(2): 87.
FRAZIER, M T; FINLEY, J; HARKNESS, W; RAJOTTE, E G (2000)
HOPPE, H; RITTER, W; STEPHEN, E W-C (1989) The control of
A sequential sampling scheme for detecting infestation levels of
parasitic bee mites: Varroa jacobsoni, Acarapis woodi, and
tracheal mites (Heterostigmata: Tarsonemidae) in honey bee
Tropilaelaps clareae with formic acid. American Bee Journal 129:
(Hymenoptera: Apidae) colonies. Journal of Economic Entomology 93(3): 551-558. FRIES, I; CHAUZAT, M-P; CHEN, Y-P; DOUBLET, V; GENERSCH, E; GISDER, S; HIGES, M; MCMAHON, D P; MARTÍN-HERNÁNDEZ, R; NATSOPOULOU, M; PAXTON, R J; TANNER, G; WEBSTER, T C; WILLIAMS, G R (2013) Standard methods for nosema research. In
V Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK:
739-742. HOY, M A (2011) Agricultural acarology: introduction to integrated
mite management. CRC Press; Florida, USA. pp 303–308. IBAY, L A; BURGETT, D M (1989) Biology of the two external Acarapis species of honey bees: Acarapis dorsalis Morgenthaler, and
Acarapis externus Morgenthaler. American Bee Journal 129: 816. KOJIMA, Y; TOKI, T; MORIMOTO, T; YOSHIYAMA, M; KIMURA, K;
Volume II: Standard methods for Apis mellifera pest and
KADOWAKI, T (2011a) Infestation of Japanese native honey bees
pathogen research. Journal of Apicultural Research 52(1):
by tracheal mite and virus from non-native European honey bees
http://dx.doi.org/10.3896/IBRA.1.52.1.14
in Japan. Microbial Ecology, 62: 895-906.
FURGALA, B; DUFF, S; ABOULFARAJ, S; RAGSDALE, D; HYSER, R (1989) Some effects of the honey bee tracheal mite (Acarapis
woodi Rennie) on non-migratory, wintering honey bee (Apis mellifera L.) colonies in east central Minnesota. American Bee Journal 129: 195-197. GARY, N E; PAGE, R E JR (1989) Tracheal mite (Acari, Tarsonemidae) infestation effects on foraging and survivorship of honey bees (Hymenoptera, Apidae). Journal of Economic Entomology 82: 734-739. GARY, N E; PAGE, R E JR; LORENZEN, K (1989) Effect of age of worker honey bees (Apis mellifera L.) on tracheal mite (Acarapis
http://dx.doi.org/10.1007/s00248-011-9947-z KOJIMA, Y; YOSHIYAMA, M; KIMURA, K; KADOWAKI, T (2011b) PCRbased detection of a tracheal mite of the honey bee Acarapis
woodi. Journal of Invertebrate Pathology 108: 135-137. KRANTZ, G W; WALTER, D E (2009) A manual of acarology (3rd Ed.). Texas Tech University Press; Lubbock, TX, USA. 807 pp. LEE, D C (1963) The susceptibility of honey bees of different ages to infestation by Acarapis woodi (Rennie). Journal of Invertebrate
Pathology 6: 11-15. LIN, H; OTIS, G W; SCOTT-DUPREE, C (1996) Comparative resistance
woodi (Rennie)) infestation. Experimental and Applied Acarology
in Buckfast and Canadian stocks of honey bees (Apis mellifera L.)
7: 153-160.
to infestation by honey bee tracheal mites (Acarapis woodi
GIORDANI, G (1962) Recherches au laboratoire suyr Acarapis woodi Rennie, agent de l’acariose des abeilles (Apis mellifica L) Note 1.
Bulletin Apicole, V: 33-48. GIORDANI, G (1965) Richerche di laboratorio su Acarapis woodi
(Rennie). Experimental and Applied Acarology 20: 87-101. LINDQUIST, E E (1986) The world genera of Tarsonemidae (Acari: Hetersotigmata): A morphological, phylogenetic and systematic revision with a reclassification of family-group taxa in the
Rennie agente dell’acariosi delle api (Apis mellifica L.) Nota 4.
Heterostigmata. Memoirs of the Entomological Society of Canada
Bulletin Apicole, VIII: 159-175.
No. 136, 517 pp.
GIORDANI, G (1977) Facts about acarine mites. In Proceedings of the LIU, T P (1995) A rapid differential staining technique for live and
XXVIth International Congress of Apiculture, Adelaide. Apimondia Publishing House; Bucharest, Romania. pp 459-467.
dead tracheal mites. Canadian Beekeeping 18:155.
The COLOSS BEEBOOK: tracheal mites
LORENZEN, K; GARY, N E (1986) Modified dissection technique for diagnosis of tracheal mites (Acari: Tarsonemidae) in honey bees (Hymenoptera: Apidae). Journal of Economic Entomology 79: 1401-1403. MARGOLIS, L; ESCH, G W; HOLMES, J C; KURIS, A M; SCHAD, G A (1982) The use of ecological terms in parasitology (Report of an
ad hoc committee of the American Society of Parasitologists). Journal of Parasitology 68: 131-133. MATTILA, H R; HARRIS, J L; OTIS, G W (2001) Timing of production of winter bees in honey bee (Apis mellifera) colonies. Insectes
Sociaux 48: 88-93. MCMULLAN, J B (2011) A scientific note: migration of tracheal mites
19
PAGE, R E, JR; GARY, N E (1990) Genotypic variation in susceptibility of honey bees (Apis mellifera) to infestation by tracheal mites (Acarapis woodi). Experimental and Applied Acarology 8: 275-283. PENG, Y S; NASR, M E (1985) Detection of honey bee tracheal mites (Acarapis woodi) by simple staining techniques. Journal of
Invertebrate Pathology 46: 325-331. PETTIS, J S; PANKIW, T (1998) Grooming behaviour by Apis mellifera L. in the presence of Acarapis woodi (Rennie) (Acari: Tarsonemidae). Apidologie 29: 241-253. PETTIS, J S; WILSON, W T (1996) Life history of the honey bee tracheal mite (Acari: Tarsonemidae). Arthropod Biology 89(3): 368-374.
(Acarapis woodi) to old winter honey bees. Apidologie 42: 577-578. PETTIS, J S; WILSON, W T; EISCHEN, F A (1992) Nocturnal dispersal MCMULLAN, J B; BROWN, M J F (2005) Brood pupation temperature affects the susceptibility of honey bees (Apis mellifera) to infestation by tracheal mites (Acarapis woodi). Apidologie 36: 97-105. MCMULLAN, J B; D'ETTORRE, P; BROWN, M J F (2010) Chemical cues in the host-seeking behaviour of tracheal mites (Acarapis woodi) in honey bees (Apis mellifera mellifera). Apidologie 41: 568-578. http://dx.doi.org/10.1051/apido/2010004 MILNE, P S (1948) Acarine disease of bees. Journal of the UK Ministry
of Agriculture and Fisheries 54: 473-477. MORGENTHALER, O (1931) An Acarine disease experimental apiary in the Bernese Lake District and some of the results obtained there.
Bee World 12: 8-10. MORSE, R A (1991) Biology and control of tracheal mites of honey
by female Acarapis woodi in honey bee (Apis mellifera) colonies.
Experimental and Applied Acarology 15: 99-108. PHELAN, P L; SMITH, A W; NEEDHAM, G R (1991) Mediation of host selection by cuticular hydrocarbons in the honey bee tracheal mite
Acarapis woodi (Rennie). Journal of Chemical Ecology 17: 463– 473. PHILLIPS, E F (1923) The occurrence of diseases of adult bees. II. US Department of Agriculture Circular #287. RAGSDALE, D W; FURGALA, B (1987) A serological approach to the detection of Acarapis woodi parasitism of Apis mellifera.
Apidologie 18: 1-10. RAGSDALE, D W; KJER, K M (1989) Diagnosis of tracheal mite (Acarapis woodi Rennie) parasitism of honey bees using a
bees. Cooperative Extension Bulletin, Cornell University; Ithaca,
monoclonal based enzyme-linked immunosorbent assay. American
NY, USA. 4 pp.
Bee Journal 129: 550-553.
MOZES-KOCH, R; GERSON, U (1997) Guanine visualization: a new method for diagnosing tracheal mite infestation of honey bees.
Apidologie 28: 3-9. NASR, M E; OTIS, G W; SCOTT-DUPREE, C D (2001) Resistance to
Acarapis woodi by honey bees (Hymenoptera: Apidae): divergent selection and evaluation of selection progress. Journal of
Economic Entomology 94: 332-338. OCHOA, R; PETTIS, J S; ERBE, E; WERGIN, W P (2005) Observations on the honey bee tracheal mite Acarapis woodi (Acari:
RENNIE, J (1921) Notes on acarine disease. VI. Bee World 13: 115117. RENNIE, J; WHITE, P B; HARVEY, E J (1921) XXIX. Isle of Wight disease in hive bees. 1. The etiology of the disease. Transactions
of the Royal Society of Edinburgh 52(4): 737-754. RITTER, W (1996) Diagnostik und Bekämpfung der Bienenkrankheiten
[Diagnosis and control of bee diseases]. Gustav Fischer Verlag; Jena, Stuttgart, Germany. RITTER, W; SAMMATARO, D; DE GUZMAN, L (2013) Acarapiosis of
Tarsonemidae) using low-temperature scanning electron
honey bees, Chap. 2.2.1. In OIE, World Organisation for Animal
microscopy. Experimental and Applied Acarology 35: 239-249.
Health, Manual of Diagnostic Tests and Vaccines for Terrestrial
OCHOA, R; PETTIS, J S; MIRELES, O M (2003) A new bee mite of the genus Pseudacarapis (Acari: Tarsonemidae) from Mexico.
International Journal of Acarology 29(4): 299-305 OTIS, G W; BATH, J B; RANDALL, D L; GRANT, G M (1988) Studies of the honey bee tracheal mite (Acarapis woodi) (Acari: Tarsonemidae) during winter. Canadian Journal of Zoology 66: 2122-2127. OTIS, S W; SCOTT-DUPREE, C D (1992) Effects of Acarapis woodi on
Animals 2012. www.oie.int/en/international-standard-setting/ terrestrial-manual/ ROYCE, L A; ROSSIGNOL, P A (1991) Sex bias in tracheal mite [Acarapis woodi (Rennie)] infestation of honey bees (Apis
mellifera L.). Bee Science 1: 159–61. ROYCE, L A; KRANTZ, G W; IBAY, L A; BURGETT, D M (1988) Some observations on the biology and behaviour of Acarapis woodi and
Acarapis dorsalis in Oregon. In G R Needham; R E Page, Jr; M
overwintered colonies of honey bees (Hymenoptera: Apidae) in
Delifnado-Baker; C E Bowman (Eds). Africanized honey bees and
New York. Journal of Economic Entomology 85: 40-48.
bee mites. Ellis Horwood; Chichester, UK. pp 498-505.
Sammataro et al.
20
SAMMATARO, D (2006) An easy dissection technique for finding the
SUMANGALA, K; HAQ, M A (2001) Survey of the mite fauna
tracheal mite, Acarapis woodi (Rennie) (Acari: Tarsonemidae), in
associated with Apis spp. in Kerala, Southern India. In R B
honey bees, with video link. International Journal of Acarology 32:
Halliday et al. (Eds). Acarology: proceedings of the 10th
339-343.
International Congress. CSIRO Publishing; Australia. pp 565-567.
SAMMATARO, D; AVITABILE, A (2011) Beekeeper’s handbook (4
th
Ed.). Comstock Publishing; Ithaca, NY, USA. 308 pp. SAMMATARO, D; COBEY, S; SMITH, B H; NEEDHAM, G R (1994) Controlling tracheal mites (Acari: Tarsonemidae) in honey bees
SUMANGALA, K; HAQ, M A (2002) Ecobiology of Pseudacarapis
indoapis (Acari: Tarsonemidae): Ontogeny and breeding behaviour. Journal of Entomological Research 26: 83-88. UNDERWOOD, R M; R W CURRIE (2009) Indoor winter fumigation
(Hymenoptera: Apidae) with vegetable oil. Journal of Economic
with formic acid for control of Acarapis woodi (Acari:
Entomology 87: 910–16.
Tarsonemidae) and nosema disease (Nosema sp.). Journal of
SAMMATARO, D; GERSON, U; NEEDHAM, G R (2000) Parasitic mite of honey bees: life history, implications and impact. Annual Review
of Entomology 45: 519-548. SAMMATARO, D; NEEDHAM, G R (1996) Host-seeking behaviour of tracheal mites (Acari: Tarsonemidae) on honey bees
Economic Entomology 102: 1729-1736. VANENGELSDORP, D; OTIS, G W (2001a) Field evaluation of nine families of honey bees for resistance to tracheal mites. Canadian
Entomologist 133: 793-803. VANENGELSDORP, D; OTIS, G W (2001b) The role of cuticular
(Hymenoptera: Apidae). Experimental and Applied Acarology 20:
hydrocarbons in the resistance of honey bees (Apis mellifera) to
121–36.
tracheal mites (Acarapis woodi). Experimental and Applied
SHIMANUKI, H; CANTWELL, G E (1978) Diagnosis of honey bee
diseases, parasites, and pests. USDA Manual ARS-NE-87. 18 pp. SHIMANUKI, H; KNOX, D A (1991) Diagnosis of honey bee diseases. US Department of Agriculture, Agriculture Handbook No. AH-690. 53 pp. SKINNER, A J (2000) Impacts of tracheal mites (Acarapis woodi
Acarology 25: 593-603. VILLA, J D (2006) Autogrooming and bee age influence migration of tracheal mites to Russian and susceptible worker honey bees (Apis mellifera L). Journal of Apicultural Research 45: 28-31. WARD, L I; WAITE, R; BOONHAM, N; FISHER, T; PESCOD, K;
(Rennie)) on the respiration and thermoregulation of
THOMPSON, H; CHANTAWANNAKUL, P; BROWN, M (2007) First
overwintering honey bees in a temperate climate. MSc. thesis,
detection of Kashmir bee virus in the UK using real time PCR.
University of Guelph; Guelph, Ontario, Canada. 186 pp.
Apidologie 38: 181-190.
SMITH, A W; NEEDHAM, G W; PAGE, R E JR (1987) A method for the detection and study of live honey-bee tracheal mites (Acarapis
woodi Rennie). American Bee Journal 127: 433-434. SUMANGALA, K (1999) Ecobiology of Pseudacarapis indoapis (Acari:
WHITCOMB, R F (1983) Culture media for spiroplasmasa. Methods in
Mycoplasmology 1: 147-158. WILSON, W T; PETTIS, J S; HENDERSON, C E; MORSE, R A (1997) Tracheal mites. In R A Morse; K Flottum (Eds). Honey bee pests,
Tarsonemidae): Nutrition, dispersal and host range. Entomon 24:
predators, and diseases (3rd Ed.). A I Root Co.; Medina, OH, USA.
235-239.
pp. 253-278.
Journal of Apicultural Research 52(4): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.4.21
REVIEW ARTICLE
Standard methods for Tropilaelaps mites research
Denis L Anderson1* and John M K Roberts1 1
CSIRO Ecosystem Sciences, PO Box 1700, Canberra ACT 2601, Australia.
Received 2 February 2013, accepted subject to revision 15 May 2013, accepted for publication 31 May 2013. *Corresponding author: Email: denis@beesdownunder.com
Summary Mites in the genus Tropilaelaps are native brood parasites of the non-domesticated giant Asian honey bees, Apis dorsata, A. breviligula and
A. laboriosa. They spread onto the managed European honey bee (A. mellifera) some time after humans introduced that bee into Asia. Nowadays, A. mellifera is kept for beekeeping throughout Asia and Tropilaelaps mites are one of its most damaging pests. At present, these mites remain confined to Asia and bordering areas but are recognized as emerging threats to world apiculture. In spite of their important pest-status, Tropilaelaps mites remain poorly studied and much remains to be learned about them. The methods reviewed here are intended to assist future research efforts to better understand these parasites. The review begins with an introduction that clarifies why Tropilaelaps mites are worthy of immediate research. It is followed by an outline of the mites’ taxonomy and descriptions of various methods (including their pros and cons) by which mites can be collected, identified and aspects of their life history and behaviour studied. The role that microbial pathogens play in the pathogenicity of Tropilaelaps mites is briefly discussed and a list of future research priorities is suggested.
Métodos estándar para la investigación de ácaros Tropilaelaps Resumen Los ácaros del género Tropilaelaps son parásitos originales de la cría de las abejas de la miel gigantes asiáticas no domesticadas Apis dorsata,
A. breviligula y A. laboriosa. Se propagaron hacia la abeja de la miel europea (A. mellifera) en algún momento después de que el ser humano introdujera esta abeja en Asia. Hoy día, A. mellifera es utilizada para la apicultura en toda Asia y el ácaro Tropilaelaps es una de sus plagas más dañinas. Actualmente estos ácaros se mantienen confinados en Asia y sus zonas fronterizas pero están reconocidos como una amenaza emergente para el mundo de la apicultura. A pesar de su importante estatus como plaga, el ácaro Tropilaelaps permanece escasamente estudiado y aún hay mucho que aprender sobre él. Los métodos revisados aquí son un intento para ayudar en los futuros esfuerzos de la investigación para entender mejor este parásito. La revisión comienza con una introducción que aclara porqué el ácaro Tropilaelaps debe ser tenido en cuenta para una investigación inmediata. Continúa con un esquema sobre la taxonomía del ácaro y la descripción de varios métodos (incluyendo pros y contras) para su colecta, la identificación y aspectos sobre la vida y comportamiento ya estudiados. Se discute brevemente el papel que juegan los microbios patógenos en la patogenicidad de Tropilaelaps y se sugiere una lista de prioridades para futuras investigaciones.
Footnote: Please cite this paper as: ANDERSON, D L; ROBERTS, J M K (2013) Standard methods for Tropilaelaps mites research. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.21
2
Anderson, Roberts
小蜂螨研究的标准方法 摘要 Tropilaelaps 属的螨是一类幼体寄生虫,原始寄主为野生大型亚洲蜜蜂 Apis dorsata, A. breviligula 和 A. laboriosa。在亚洲引入欧洲蜜蜂(A. mellifera)之后的某个时间,该蜂螨传播至饲养的欧洲蜜蜂。现如今,A. mellifera的饲养已遍及亚洲,小蜂螨是其危害性最大的害虫之一。目 前,这些螨仍仅限于亚洲及其周边地区,但已被公认为世界养蜂业新出现的威胁因素。虽然Tropilaelaps 是十分重要的虫害,但关于它的研究甚 少,诸多方面有待进一步了解。本章综述了相关方法,旨在有助于将来对其更深入的探索。本综述首先在前言部分阐明为何小蜂螨值得当前研 究,其次概述了该螨的分类,描述了蜂螨采集、鉴定、生活史和行为研究的不同方法(包括它们的优缺点)。简要探讨了微生物致病体在小蜂螨 致病性中发挥的作用,并列举了一些未来需要重点研究的内容。
Keywords: COLOSS, BEEBOOK, honey bee, Tropilaelaps mercedesae, Tropilaelaps clareae, Tropilaelaps koenigerum, Tropilaelaps thaii, Apis mellifera, giant Asian honey bees, research method, protocols, identification, taxonomy
The COLOSS BEEBOOK: Tropilaelaps
Table of Contents
3
Page No.
Page No.
1.
Introduction
3 4.1.
Morphological methods
7
2.
Taxonomy and host-specificity
4 4.2.
Molecular methods and systematics
8
2.1.
Taxonomy
4 5.
Life cycle and rearing
10
2.2.
Host specificity
4 5.1.
Life cycle of T. mercedesae on A. mellifera
10
3.
Sample collection
5 5.2.
Methods for studying mite development on
10
3.1.
Mite appearance
5 5.3.
Methods for studying mite development on giant Asian bees
13
3.2.
Where to find mites
5 5.4.
Methods for studying mite mating behaviour
13
3.3.
Collecting mites from bee brood
6 6.
Pathogenicity, control and association with pathogens
13
3.4.
Collecting mites from adult bees
7 7.
Future research priorities
14
3.5.
Storage of collected mites
7 8.
Concluding comments
14
3.6.
Shipping collected mites
7 9.
Acknowledgements
14
4.
Methods for identifying mites
7 10.
References
15
1. Introduction
A. mellifera
The mites can only survive for a few days in the absence of bee brood
Mites in the genus Tropilaelaps are native brood parasites of the non- (Woyke, 1984; Koeniger and Musaffar, 1988; Rinderer et al., 1994). domesticated giant Asian honey bees, Apis dorsata, A. breviligula and
This limited food source restricts their ability to disperse, as they can
A. laboriosa. They spread onto the managed European honey bee
only disperse on adult bees on which they cannot feed.
(A. mellifera) some time after humans introduced that bee into Asia.
The ever-increasing global trade of live honey bees, which
Nowadays, A. mellifera is kept for beekeeping throughout Asia and
provides a potential pathway for Tropilaelaps mites to disperse out of
Tropilaelaps mites are one of its most damaging pests (Burgett et al.,
Asia, has not yet contributed to any increase in their geographical
1983; Woyke, 1985a; Anderson and Morgan, 2007; Dainat et al., 2009). range. This is probably because live bee trade involves movements of At present, these mites remain confined to Asia and bordering areas
adult bees (in the form of ‘package bees’) and live adult queen bees,
but are recognized as emerging threats to world apiculture.
on which Tropilaelaps mites cannot feed or survive for more than
A question that is constantly asked of Tropilaelaps mites, the
about 74 hours (Wilde, 2000). Because the mites cannot feed on adult
answer to which justifies or counters the need to direct scarce
bees, very few are found on them at any one time, even in heavily
resources to study them, is: can they become a serious global pest of
infested bee colonies (Woyke, 1984; 1985b). Those mites that do
A. mellifera, like Varroa destructor? The answer is emphatically yes
venture onto adult bees can spread to neighbouring bee colonies by
and it lies in how the mites feed and reproduce on their bee hosts,
various means, such as on swarms, on worker bees that rob resources
how they disperse, how they spread among bee colonies and how
from other colonies, on foraging bees that become disorientated and
they might survive on A. mellifera in temperate zones outside of Asia.
enter the wrong colony or simply by moving between forager bees
The breeding cycle of Tropilaelaps mites on their honey bee hosts
from different colonies that visit the same flowers. In the Philippines,
superficially resembles that of Varroa mites, in that a mature mated
it has been suggested that Tropilaelaps mites spread between
female enters a bee brood cell that contains a developing bee larva
A. breviligula (their natural host) and A. mellifera colonies by
that is in the process of being capped by worker bees with a wax
interspecific robbing (Laigo and Morse, 1969).
covering. Safely concealed within the sealed cell, the mother mite
As Tropilaelaps mites venture onto adult bees at some stage of
produces several offspring that all feed on blood (haemolymph) of the their life, then live bee exports from Asia could potentially carry them, developing bee. Eventually the mites are released from the cell when
albeit at low numbers, and therefore aid their dispersion. However,
the developing bee (which by now may or may not be physically
for mites to survive this pathway, the exported bees would need to be
damaged) chews its way out of the cell through the wax capping
moved quickly to their destination country and, on arrival, come in
(Woyke, 1987; 1994). Unlike Varroa mites, the survival of Tropilaelaps contact with local brood-right bee colonies into which mites could mites depends solely on them having regular access to bee brood
disperse and feed on brood before they starve to death. Another new
(larvae or pupae) on which to feed, as their mouthparts and body
potential pathway for the mites’ spread out of Asia was recently
shape do not allow them to feed on adult bees, as do Varroa mites.
uncovered in Australia, when A. dorsata worker bees were detected
4
Anderson, Roberts
on air cargo that arrived at an international airport from Malaysia.
emerging threats to world apiculture (OIE, 2004) and hence deserve
These bees were probably night-foragers that had become disoriented immediate attention from the global research community. The by airport lights in Malaysia and rested and became stranded on cargo methods presented here should assist those future research efforts. that was being loaded into an airplane bound for Australia. Even given these and other potential pathways for Tropilaelaps mites to spread, they nevertheless still remain restricted to Asia and bordering areas. They currently occur as far west as Afghanistan-
2. Taxonomy and host-specificity
Pakistan and as far east as the large Melanesian island of New
2.1. Taxonomy
Guinea, where they were introduced in the 1980s in brood-right hived The first species in the genus was described more than 50 years ago colonies of A. mellifera imported from Java (Delfinado and Aggarwal,
and the most recent in 2007. The taxonomy of the genus has recently
1987; Anderson, 1994; Baker et al., 2005). They were also reported
been revised and it currently stands as follows (Lindquist et al., 2009;
from Kenya during the early 1990s (Kumar et al., 1993; Matheson,
Anderson and Morgan, 2007):
1997), but this report has not been verified and it may have resulted from a false identification, as recent testing in Australia of mites that
Kingdom:
Animalia
had been collected from honey bees in Kenya, and assumed to be
Phylum:
Arthropoda
Tropilaelaps, were found to be plant mites (Anderson, unpublished
Class:
Arachnida
data).
Subclass:
Acari
Superorder:
Parasitiformes
of Tropilaelaps mites reflect their inability to survive outside of Asia in
Order:
Mesostigmata
temperate zones in the absence of their native bee hosts? The
Family:
Laelapidae
successful establishment of Tropilaelaps mites on A. mellifera in New
Genus:
Tropilaelaps
Guinea suggests the answer is no, and that they can survive in
Species:
T. clareae Delfinado and Baker (1961)
So the question remains: does the current restricted distribution
T. koenigerum Delfinado-Baker and Baker (1982)
temperate zones given an important proviso.
T. mercedesae Anderson and Morgan (2007)
New Guinea is located to the north of Australia and it contains no
T. thaii Anderson and Morgan (2007)
native Apis species. Humans introduced colonies of A. mellifera to the island last century and their descendants have since thrived in the cool temperate-like highland regions, but not so well in the hotter
2.2. Host specificity
humid tropical lowland regions (Clinch, 1979). Since their introduction
Some behavioural and morphological features of Tropilaelaps mites,
to New Guinea in the 1980’s, Tropilaelaps mites have become an
such as their fast movement and ‘pincer-shaped’ chelicerae, suggests
endemic damaging pest of A. mellifera in the western half of the
they may have only recently adopted a parasitic life-style on honey
island (Irian Jaya). Their success is thought to be due to the unbroken bees and that they may not be very host-specific. Indeed, when they year-round production of brood by the A. mellifera colonies, which
were first discovered in the Philippines in the 1960’s they were found
provides a continuous food source for the mites and an ideal
inside an A. mellifera colony and on field rats nesting nearby
environment for their reproduction.
(Delfinado and Baker, 1961). It is likely that those rats picked up the
Hence, the New Guinea situation confirms that Tropilaelaps mites
mites after they entered the A. mellifera colonies, which rats often do
can survive and become an endemic pest of A. mellifera in temperate
in the tropics, because evidence gathered since that initial discovery
zones in the absence of their native hosts provided they have access
indicates that Tropilaelaps mites are highly specialized parasites of
to A. mellifera brood on a year-round basis. Such conditions are found honey bees. in many temperate countries, such as parts of the USA, Australia and
Tropilaelaps mites are now recognized as common natural
Europe. It has also been suggested that, in coming years, temperate
parasites of giant honey bees distributed throughout Asia. They have
areas in which A. mellifera can produce brood all year round may
not colonized any other host organism, other than A. mellifera.
increase, as colder regions become warmer, due to the effects of
Molecular studies have confirmed that T. clareae is native to
climate change (Le Conte and Navajas, 2008).
A. breviligula in the Philippines (except on Palawan Island), T.
This all adds up to a situation where it appears that good fortune
mercedesae and T. koenigerum to A. dorsata and A. laboriosa in other
has played a major role in restricting the distribution of Tropilaelaps
parts of Asia (including Palawan Island) and T. thaii to A. laboriosa, in
mites and that it may be only a matter of time until they spread
mountainous region of Mainland Asia (Laigo and Morse, 1969;
outside of Asia to cause hardship for temperate zone beekeepers. It is Delfinado-Baker and Baker, 1982; Tangjingjai et al., 2003; Anderson therefore no surprise that the mites are currently recognized as
and Morgan, 2007).
The COLOSS BEEBOOK: Tropilaelaps
5
Tropilaelaps mercedesae and T. clareae colonized A. mellifera after humans introduced that bee into Asia. However, in contrast with
Varroa mites, of which only a few genotypes have switched-host to A. mellifera, many different genotypes of T. mercedesae and T. clareae now utilize A. mellifera as a host. In this respect, Tropilaelaps mites are less host-specific than Varroa mites but they are still relatively host-specific compared to some mites, such as the water mite Protzia
eximia that parasitizes a wide variety of insect hosts (Walter and Proctor, 1999). Evidence suggests that T. koenigerum and T. thaii are restricted to their Asian bee hosts and are harmless to A. mellifera (Anderson and Morgan, 2007). Very occasionally, Tropilaelaps mites are found in A. cerana and
A. florea colonies in Asia, but in none of these instances have the mites been found to be producing offspring (Otis and Kralj, 2001). The exception is a report of a single female T. mercedesae found
Fig. 1. A gravid T. mercedesae adult female feeding on an A. mellifera
parasitizing and producing offspring on A. cerana brood in Thailand
pupa. Note the first pair of legs of the mite is held upright, resembling
(Anderson and Morgan, 2007). The authors, when commenting on
antennae.
Photo: Denis Anderson.
this find, stated that their observation was the exception rather the rule, as T. mercedesae mites are rarely found in A. cerana colonies and, when they are, they are not found inside brood cells or with offspring. Obviously, other factors, other than the ability to produce offspring on that bee, are responsible for preventing T. mercedesae from colonising A. cerana.
3. Sample collection 3.1. Mite appearance
Fig. 2. Comparisons of a female T. mercedesae (left) with two female
Adult Tropilaelaps mites are small (< 1 mm long), light brown, and
V. jacobsoni (right) on an A. mellifera larva.
Photo: Denis Anderson.
hold their first pair of legs upright, resembling antennae (Fig. 1). They can often be seen moving quickly over the surface of combs in
3.2. Where to find mites
infested colonies. Their body shape is quite different from that of
Adult females are most easily found inside of capped worker and drone
Varroa mites, being much longer than it is wider (Fig. 2).
bee brood cells of infested colonies, where they reproduce. They do
There are clear morphological differences between the sexes of
not appear to markedly favour either cell type for their reproduction.
the different species. Males of T. thaii have not yet been discovered.
This is also the only place where nymphal stages can be found. To
Males of T. mercedesae, T. clareae and T. koenigerum are slightly
find a mother mite and her nymph offspring, simply uncap a bee brood
smaller than their female counterparts and their epigynial thoracic
cell of an infested colony and remove the developing bee inside. Tilt
plates are also shorter and sharply pointed toward their posterior end
the entire comb so that the ambient light will be directed into a cell.
(Fig. 3). In any collection of Tropilaelaps mites, males are usually
Any mites present will be easily seen with the naked eye in the bottom
much less common than females (Rath et al., 1991; Anderson and
of the cell or on the cell wall.
Morgan, 2007). Males can be easily identified in the field using a
The presence of adult mites with offspring inside bee brood cells
magnifying glass to observe the chela spermatodactyl (sperm transfer
is clear evidence that they have reproduced and have not simply entered
organ), which in T. mercedesae and T. clareae is long with a spirally
the bee cell after being transported (say on robbing bees) from another
coiled apex and in T. koenigerum is short with a ‘pig-tail’ loop at its
colony of a sympatric bee species, which might confuse host-specificity
apex (Fig. 4).
attributed to them. Male mites are best found inside of capped cells in
The nymph stages of Tropilaelaps are brilliant white and are easily which the developing bee is about to emerge or else in random observed with the naked eye (Fig. 5).
collections of adult mites found moving on the surfaces of combs.
6
Anderson, Roberts
Fig. 5. A family of mites (T. mercedesae) with mother mite (light brown) and different stages of offspring (white) at the bottom of a cell from which the honey bee pupa was removed.
Photo: Denis Anderson.
Adult Tropilaelaps mites are much more mobile than adult Varroa mites and can be seen moving quickly across the surface of infested brood combs. In this situation they are hard to collect. When they are not moving, they also become well camouflaged against the background colour of the wax combs and are hard to see. When the brood comb is lifted out of the colony into the open light mites also quickly enter open cells and remain still on the cell walls, where again, they are hard to see.
Fig. 3. Comparison of mounted specimens of a T. mercedesae male (top) and female (bottom). Anterior arrow on male points to the corkscrew like spermodactyl (sperm transfer organ) and posterior arrow points at the non-overlapping epigynial thoracic plate. Bars = 0.1 mm.
Photo: Denis Anderson.
Adults of both sexes can also be found on the bodies of adult bees, but only in extremely low numbers, even in heavily infested colonies. This is probably because mites avoid adult bees as much as possible because they cannot feed on them and hence can only survive for a few days (Woyke, 1984; Wilde, 2000). Nevertheless, at some stage they have to move on to adult bees in order to disperse from the colony.
3.3. Collecting mites from bee brood Phoretic mites that are moving on the surfaces of bee combs are relatively hard to collect with forceps. In these situations it is best to collect them with a fine bristle bush slightly wetted with honey, water or alcohol (not human spittle as it will contaminate the sample with human DNA) or a small mouth aspirator. When large numbers of mites are required, it is best to collect them from infested capped bee brood cells. This can be done in the field, or if large numbers of colonies needs to be sampled, combs can
Fig. 4. Scanning electron micrographs of the sperm transfer organs of male (A) T. clareae and (B) T. koenigerum. Bar = 10 Âľm. Photo: Denis Anderson.
be collected and sampled later in the comfort of the laboratory. To do this: 1. Remove the wax cappings from a large number of bee brood cells on one side of a comb all at once. 2. Remove the developing bee brood from these cells.
The COLOSS BEEBOOK: Tropilaelaps
3. Invert the comb over a sheet of white paper and tap it
7
alternative method to placing adult bees into ethanol, soapy water or
relatively hard on its upper surface to dislodge mites from the
sugar prior to shaking to dislodge mites, is to place the bees into
cells onto the paper.
plastic bags, label accordingly and freeze until the bees can be
4. Collect the mite from the paper into small vials containing 70% ethyl alcohol, using a fine paint brush wetted in honey,
visually examined. However, this is much slower than the shaking methods.
alcohol or water (not human spittle) or with a fine pair of tweezers, as shown for Varroa mites in Dietemann et al. (2013).
Pros: A quick and simple method for finding mites on adult bees
Tropilaelaps mites (similar to Varroa mites) will immediately
in any given infested bee colony.
sink to the bottom of a container when immersed in ethyl alcohol. The white paper onto which mites fall can also be
Cons: Bee colonies need to be relatively highly infested with
substituted with brown paper if mite collection is
mites for this method to succeed. To increase the chances of
targeted at nymphal stages.
collecting mites from adult bees, one can select a frame with
There are benefits in sometimes collecting live mites into hot
emerging brood to collect mites emerging with the bees.
water before transferring them into alcohol for storage (Section 4.1
However, it should be remembered that some of those mites will
below).
be new adults and may not be mated or fully mature.
Pros: Mites collected into ethyl alcohol can be subsequently
3.5. Storage of collected mites
tested in the laboratory in a range of different tests, such as
Methods for storing Tropilaelaps mites are identical for those
morphometric and DNA analyses.
described for Varroa mites in Dietemann et al. (2013).
Cons: Mites used in inoculation or behavioural studies cannot be
3.6. Shipping collected mites
placed into ethyl alcohol after collection. But even then, mites
Methods for shipping Tropilaelaps mites are identical to those also
collected by this method are of little use for those types of studies, described for Varroa mites in Dietemann et al. (2013). as the development stage of the collected mites cannot be ascertained with certain. Live mites to be used in those kinds of studies are best collected from very recently capped bee brood cells that contain late larval or prepupal stages. This ensures that
4. Methods for identifying mites
the mites collected are mature adults that are at a specific stage
4.1. Morphological methods
of development – that is, at the pre-reproductive stage. These
Morphological analyses are best carried out on mite specimens that
mites can be kept alive until needed by keeping them in a small
have been cleared of their body tissue and mounted on glass microscope
Petri dish or a glass bottle with late stage bee larvae.
slides. Methods for clearing and mounting Tropilaelaps mites are the same as those described for Varroa mites (Dietemann et al., 2013).
3.4. Collecting mites from adult bees
Generally these specimens have been previously collected and stored
As mentioned, adult Tropilaelaps mites are usually only present in low in alcohol. However, sometimes it helps to collect specimens that are numbers on adult bees in any given bee colony. Hence, it is usually a
destined for morphological analyses into hot water before they are
waste of time trying to manually find them on individual bees. A
transferred in alcohol. This relaxes their internal body tissues and
simple method for collecting them from adult bees is:
exposed hard-to-see organs, such as chelicerae, which are normally hard to see in mounted specimens that have simply been collected
1. Collect a sample of 200 or so adult bees from an infested colony into a transparent container (such as a plastic bottle) that contains 70% ethyl alcohol. 2. Secure the lid on the container and shake it vigorously for about 1 minute. 3. Collect mites from the bottom of the container into containers
into alcohol. Identification of specimens to the species level using morphology can be troublesome. Hence, the starting-point for identifying them should always be from information known about the location and host bee from which they were collected. Mites found on either giant Asian honey bees or European honey bees in the Philippines (except on
containing fresh 70% ethyl alcohol, as described for Varroa
Palawan Island) will in all probability be T. clareae, whereas those found
mites in Dietemann et al. (2013).
on European honey bees in other parts of Asia (and Melanesia) will be
T. mercedesae. The two other species, T. koenigerum and T. thaii, Mites can also be removed from adult bees by washing the bees in soapy water or by treating them by the ‘sugar-shake’ method as also described for Varroa mites in Dietemann et al. (2013). Also, an
have been found only on their native Asian bee hosts, A. dorsata, and
A. laboriosa respectively.
8
Anderson, Roberts
Table 1. Key to identification of Tropilaelaps mites. Males of T. thaii
3. Structure of the male sperm transfer organ (chela
have not been discovered, but this species is restricted to A. laboriosa.
spermatodactyl or spermadactyl).
Tropilaelaps clareae
Males of T. koenigerum have a ‘pig-tail’ loop at the apex of
The Philippines (except
Parasitizes Apis breviligula and
the chela spermatodactyl, while the apex of the chela
Palawan Island) and
Apis mellifera in the Philippines
spermatodactyls of male T. mercedesae and T. clareae are
1 a. Collection sites:
long cork-screw-like structures (Fig. 4).
Sulawesi Island (in Indonesia). and Apis dorsata binghami and
Apis mellifera in Sulawesi.
4. Placement and shape of teeth on female chelicerae. Female T. koenigerum have a single sub apical tooth on the chelicerae with a characteristic groove near its anterior base,
1 b. Collection sites: All other localities
whereas T. mercedesae and T. clareae females also have the
(including Palawan Island).
sub apical tooth, but without the groove. Female T. thaii lack
2 a. Body length: ≤ 700 µm.
Primarily found parasitizing A
dorsata dorsata in mainland Asia.
1990s to examine genetic variation between so-called T. clareae and
≥ 840 µm No apical tooth.
4.2. Molecular methods and systematics Molecular technology was first used in Tropilaelaps research in the
2 b. Body length: 3 a. Female chelicerae:
the sub apical tooth (Fig. 6).
Tropilaelaps koenigerum
Tropilaelaps thaii
T. koenigerum (Tangjingjai et al., 2003). It has since proved very
Parasitizes Apis laboriosa in
useful to examine genetic variation within the genus and to help
mountainous regions of mainland
re-define known species and describe new species and new types
Asia.
within species (Anderson and Morgan, 2007). DNA sequence obtained from a 538 base-pair fragment of
3 b. Female chelicerae: One apical tooth present
Tropilaelaps mercedesae
Tropilaelaps mtDNA cox1 gene, as well as from the entire nuclear
Primarily parasitizes Apis dorsata
ITS1-5.8s-ITS2 genes, provides a useful means for identifying mites
dorsata and Apis mellifera in
to the species level. The cox1 sequence is also useful for looking at
mainland and southeast Asia.
genetic variation within a species.
Many of the physical characters used to identify mites (such as their
Methods for extracting, amplifying and sequencing Tropilaelaps
body size, sensilli and structures on body plates) are highly variable
DNA are the same as those described for Varroa in Dietemann et al.
within the genus and even among member of the same species
(2013). The DNA primers used to amplify the cox1 and ITS1-5.8s-ITS2
(Anderson and Morgan 2007). A key for identifying the different
gene regions are shown in Table 2.
species of Tropilaelaps is given in Table 1. The 4 main physical characters most useful for identifying
Tropilaelaps mites to the species levels are: 1. Body length.
T. koenigerum is the smallest member of the genus with a
Table 2. Forward (F) and reverse (R) primer sequences (and their names) used in Tropilaelaps research to amplify fragments (base pairs) of specific genes. Gene
body length of < 700 µm for females and ~575 µm for males. region Female T. mercedesae, T. clareae and T. thaii are much CoxI
Fragment Primer sequences (5’-3’)
name
538
(F) CTATCCTCAATTATTGAAATAGGAAC
TCF1
(R) TAGCGGCTGTGAAATAGGCTCG
TCR2
(F) GGAAGTAAAAGTCGTAACAAGG
ITS5
(R) TCCTCCGCTTATTGATATGC
ITS4
longer at ~ 950-990 µm, ~870-885 µm and ~ 890 µm respectively, while the body lengths of male T. mercedesae and T. clareae are slightly smaller than their respective females at 907-927 µm and 852-858 µm, respectively. Males
Primer
size (bp)
ITS1-5.8S- 522-526 ITS2
of T. thaii have yet to be discovered. 2. Shape of the anal plate. Male and female T. koenigerum have a distinct pear-shaped
Once a DNA sequence is obtained from a particular mite
anal plate, female T. Thaii have a bell-shaped anal plate,
specimen, it is compared to other sequences of the same region that
while the anal plates of male and female T. mercedesae and
have been deposited in the GenBank database (Dietemann et al., 2013).
T. clareae are highly variable and of little use as a taxonomic
The ITS region shows no genetic variation within a particular species
reference.
of Tropilaelaps, whereas cox1 sequence shows from 1-4% variation within species and from 11-15% between species. Mites of particular
The COLOSS BEEBOOK: Tropilaelaps
9
Fig. 6. Comparisons of female chelicerae of T. clareae (TC), T. mercedesae TM), T. koenigerum (TK) and T. thaii (TT) (light microscopy, x800). Photo: Denis Anderson.
species that vary in the cox1 gene sequence are referred to as ‘haplotypes’. The concept of ‘haplogroup’, as described for Varroa mites in Dietemann et al. (2013), has not been adopted for
Tropilaelaps mites, as there is much more variation in the cox1 gene of Tropilaelaps than in Varroa (Anderson and Trueman, 2000).
Tropilaelaps mites can also be identified to the species level by digesting amplified fragments of their cox1 gene with a combination of the FauI BsrI BstYI and SwaI restriction enzymes, without the need for sequencing the fragments. Products produced from these digestions are visualized as bands in 2% agarose gels (Anderson and Morgan, 2007). The results of using these restriction enzymes to digest the cox1 gene fragment of the 4 known species are shown in Fig. 7. In summary, Fau1 only digests coxI fragments obtained from
T. koenigerum, BsrI only digests fragments from T. koenigerum and T. mercedesae (2 bands are produced from each species, but the smaller band produced from T. mercedesae is larger than that of
Fig. 7. Mites can be identified by digesting fragments of their cox1 gene
T. koenigerum), BstYI only digests fragments from T. clareae, while
with FauI, BsrI, BstYI and SwaI restriction enzymes (labeled a–d
SwaI only digests fragments from T. thaii.
respectively). The numbers 1-4 represent: T. koenigerum, T. mercedesae,
T. clareae and Thaii respectively. M = 100 bp DNA Ladder. Photo: Denis Anderson.
10
Anderson, Roberts
As cox1 gene sequence can resolve Tropilaelaps mites to the species
about 25:1 in favour of Tropilaelaps (DEFRA, 2005). A diagram that
level it is useful in phylogenetic studies. Methods used to carry out
summarizes data on the life cycle of T. mercedesae on A. mellifera in
phylogenic analyses on Tropilaelaps cox1 gene sequence are the
New Guinea, reported by Saleu (1994), is shown in Fig. 9.
same as those used for V. destructor and other species, described in Dietemann et al. (2013). A phylogenetic tree of all the currently
5.2. Methods for studying mite development on
known and published Tropilaelaps haplotypes is shown in Fig. 8.
A. mellifera No artificial media has been described for rearing Tropilaelaps mites and hence aspects of their reproduction must be studied within a bee
5. Life cycle and rearing
colony. To study their life cycle in an A. mellifera colony one first
Much remains to be learned about the life cycle of Tropilaelaps mites.
mites. The general method is as follows:
Reports published to date refer to the life cycle of T. clareae on A. mellifera,
needs to select a colony that is already reasonably infested with 1. Determine mite infestation levels in a number of A. mellifera
but with the recent taxonomic revision of the genus, which separated
colonies by removing the cell cappings from 300 capped cells/
T. clareae into 2 species (Anderson and Morgan, 2007), it is now clear
colony and determining how many contain mites.
that those reports refer to T. mercedesae on A. mellifera. There are no reports of the life cycles of T. clareae, T, koenigerum or T. thaii, although they are thought to be very similar to that of T. mercedesae on A. mellifera. Obviously, this is an area ripe for research.
2. Select a colony with the highest mite infestation and use this for further studies. 3. Remove 2 brood combs from the middle of the brood area of the selected colony and replace them with 2 brood combs from a non-infested colony that contains larvae that are 2-3
5.1. Life cycle of T. mercedesae on A. mellifera
days away from being capped (Note: these brood combs can be obtained from other nearby colonies in which queen bees
As mentioned, to begin their reproduction, mated female mites enter
have been restrained to combs with a queen excluder for 24
A. mellifera worker or drone brood cells that are in the process of
hours. The queens will fill the cells of the combs with eggs,
being capped (Burgett et al., 1983; Ritter and Schneider-Ritter, 1986).
meaning that all brood that develops for the eggs with be
There is no marked difference in the type of cell type that female
within 24 hours of the same age).
mites choose to reproduce in. However, much variation has been
4. Once the 2 brood combs have been capped, remove 1 at
reported in the timing of different events during the reproduction
regular intervals to the laboratory (usually every 12 or 24
phase. After entering a cell a single female mite lays from 1-4 eggs
hours is best).
(but typically 3-4) about 1 day apart. A comparison of the time in
5. In the laboratory uncap a number of cells, remove the bee
hours after cell capping that the first egg, larva, protonymph,
brood and determine the number of adult mites, eggs and
deutonymph, and young adult mite appear in a cell, as reported by
mite nymphs within each cell.
different authors, is shown in Table 3. At the end of the reproduction phase, the mother mite and her offspring exit the cell when the developing bee chews its way out of
6. Once all cells on this comb have been inspected, move on to the second comb. 7. Collate the recorded data. There are many methods by which
the cell through the wax capping. They then enter a brief phoretic
this can be done but a simple method is simply to produce a
phase, in which they move about the comb, probably mate (as recently
diagram of the capping phase of the bee and plot the data
emerged male and female mites have been observed mating in glass
recorded directly onto it.
test tubes (Woyke, 1994)) and spend time on adult bees, before they commence a new reproduction phase. The phoretic phase of
Pros: This method is relatively simple and will show the
T. mercedesae mites is much shorter than that of Varroa mites, and
progression of mite development, from egg to adult.
may be as short as 1-2 days. This means that T. mercedesae mites have quicker reproductive cycles than Varroa mites and hence their
Cons: The method requires access to both infested and
population buildup within a bee colony is much faster than that of
no-infested bee colonies.
Varroa mites, said by a UK Government source to be in the order of
The COLOSS BEEBOOK: Tropilaelaps
Fig. 8. A phylogenetic tree of all the currently known and published haplotypes of Tropilaelaps.
11
Photo Denis Anderson and John Roberts.
12
Fig. 9. Life cycle of T. mercedesae on A. mellifera. Diagram was constructed from data reported by Saleu (1994).
Anderson, Roberts
Photo: Denis Anderson.
The COLOSS BEEBOOK: Tropilaelaps
13
Table 3. Comparison of time (in hours) after bee brood cell capping
Pros: This method is relatively simple and will show the
of the first appearance of different developmental stages of
progression of mite development, from egg to adult.
T. mercedesae, as reported in 4 different studies: Saleu, 1994 (New Guinea); Kiprasert, 1984 (Thailand); Woyke 1984, 1985a (Afghanistan
Cons: It is often difficult to gain access to wild nests.
and Vietnam); Kumar et al., 1993 (India). The numbers in brackets represent honey bee brood development time in days. Mite development Stage Egg: Larva: Protonymph: Deutonymph: Young Adult:
5.4. Methods for studying mite mating behaviour Mating behaviour can be studied by placing a single adult male mite
Study 1
Study 2
Study 3
Study 4
72
96
24-48
96
(10-11)
(12)
(9-10)
(12)
96
96
24-48
96
(11-12)
(12)
(9-10)
(12)
Pros: This method allows for mating behaviour to be observed
96
192
72-96
192
and videoed.
(11-12)
(16)
(11-12)
(16)
168
216
120
192
Cons: Behaviours of mites in-vitro, such as those shown in
(14-15)
(17)
(13)
(16)
216
312
192
298
(16-17)
(22)
(16)
20)
5.3. Methods for studying mite development on
and female mite inside a clear plastic Petri dish (or glass bottle) that contains a bee larva on which the mites can feed. Mites are kept alive in the dish by continually replacing the bee larva.
plastic or glass containers, may not necessarily be those shown naturally inside the bee colony.
6. Pathogenicity, control and
giant Asian honey bees
association with pathogens
There are virtually no reported studies on the life cycle of different
Tropilaelaps mercedesae (formerly known as T. clareae) may infest as
species of Tropilaelaps on their native Asian giant bee hosts. This is a
much as 90% of the brood in A. mellifera colonies (Kiprasert, 1984),
pity, as mites of the different species do not typically cause as much
but smaller brood infestation levels of 3 to 6% have been consistently
harm to their giant honey bee hosts as they do to A. mellifera. Hence
reported from A. dorsata colonies (Underwood, 1986) and adult
studies on the life cycles of mites on the giant honey bees could
A. dorsata and A. cerana workers show greater resistance to the mite
provide clues as to how to control them on A. mellifera.
than A. mellifera workers (Khongphinitbunjong et al., 2012). High
Studies on the life cycle of Tropilaelaps mites on their giant honey infestations of A. mellifera brood by this species often results in callow bee hosts in Asia can be done as follows: 1.
First, and most importantly, locate a local ‘honey-hunter’ to
adult bees with deformed wings (De Jong et al., 1982; Burgett et al., 1983) and reduced body weights (Kiprasert, 1984) (see Fig. 10).
gain access to a nest, as virtually all giant honey bee nests in Untreated infestations rapidly increase to high levels and invariably the wild in Asia are ‘owned’ by a local hunter and accessing
lead to the death of entire colonies (Atwal & Goyal, 1971; Ritter,
them without permission (or help) can lead to serious problems. 1988; Woyke, 1985a, 1985b). 2.
Once a nest is located, smoke the bees off the single comb (typically most of the bees will fly off the comb when it is smoked, but they will return later).
3.
Remove a section of the comb that contains capped brood using a sharp knife (in this way the comb will not be significantly damaged and the bees will soon return to it and resume their normal activities).
4.
Transport the comb to the comfort of the laboratory for examination.
5.
In the laboratory open each capped cell and remove the developing bee noting the approximate age of the bee (prepupa, white –eyed pupa, pink-eyed pupa, and so on).
6.
Record how many individuals of the various mite stage are present.
7.
Collate the recorded data.
Fig. 10. Damage caused by T. mercedesae to A. mellifera brood. Photo: Denis Anderson.
14
Anderson, Roberts
The control of Tropilaelaps mites in A. mellifera colonies has been reviewed by De Jong et al. (1982) and Ritter and Sneider-Ritter (1988),
8. Concluding comments
but is in need of revision. Many of the various synthetic chemical
Tropilaelaps mites, particularly T. mercedesae and T. clareae, present
acaricides used to control Varroa mites are also effective against
a serious threat to world beekeeping and hence they deserve the
Tropilaelaps mites (Pichai, et al., 2008). Sulphur, formic acid and
immediate attention of the global research community. Of the two
thymol have also proved satisfactory (Atwal and Goyal, 1971; Raffique species, T. mercedesae is the more likely to spread out of Asia, as it is
et al., 2012). Non-chemical means of controlling T. mercedesae in
found throughout mainland Asia and South East Asia, while T. clareae
A. mellifera colonies have been achieved by interrupting the brood
is confined just to the Philippines.
cycle of the bees. For example, Woyke (1984; 1985a & b) controlled
Evidence suggests that while these two species may be as, if not
T. mercedesae in A. mellifera colonies by removing all brood for
more, pathogenic to A. mellifera as V. destructor, they may be easier
2 days, but removal for 5 days is recommended in order to kill all
to control for small-scale beekeepers. However, large-scale
mites. Such methods would probably not be viable for commercial
commercial beekeepers that manage hundreds and thousands of bee
beekeepers that manage large numbers of colonies and they are very
colonies, and cannot afford the time to keep them broodless for even
time-consuming.
short periods, will find these mites as difficult to control as
There have been few studies on the pathogens associated with
Tropilaelaps. However, like Varroa mites, Tropilaelaps mites have been
V. destructor. Pre-emptive research carried out on Tropilaelaps mites before
associated with spread and infection of deformed wing virus in A. mellifera they spread globally is far more desirable than reactive research colonies (Dainat et al., 2009; Forsgren et al., 2009). Methods involved carried out once the mites have spread, as it reduces potential future with studying bee viruses can be found in Dietemann et al. (2013).
losses and hardship for beekeepers.
7. Future research priorities
9. Acknowledgements
Much remains to be learnt about Tropilaelaps mites. The taxonomy of
The COLOSS (Prevention of honey bee COlony LOSSes) network aims
the genus is one area that has been relatively well studied, and it now to explain and prevent massive honey bee colony losses. It was seems to be well resolved. Given that each species is closely
funded through the COST Action FA0803. COST (European Cooperation
associated with a particular giant Asian bee species or sub-species,
in Science and Technology) is a unique means for European researchers
and that most of these bees have been examined for mites, it is
to jointly develop their own ideas and new initiatives across all
unlikely that further species will be discovered. Nevertheless, more
scientific disciplines through trans-European networking of nationally
haplotypes of each species will undoubtedly be found, as has recently
funded research activities. Based on a pan-European intergovernmental
been demonstrated in China (Luo et al., 2011). With this in mind, the
framework for cooperation in science and technology, COST has
follow list highlights areas that warrant immediate research effort.
contributed since its creation more than 40 years ago to closing the gap between science, policy makers and society throughout Europe
1. Morphological descriptions of the different life stages of all 2.
and beyond. COST is supported by the EU Seventh Framework
species.
Programme for research, technological development and
Life habits and reproductive behaviour of all species on both
demonstration activities (Official Journal L 412, 30 December 2006).
their native and adopted hosts.
The European Science Foundation as implementing agent of COST
3. Control of T. mercedesae and T. clareae on A. mellifera.
provides the COST Office through an EC Grant Agreement. The
4. Associations of microbial pathogens with T. mercedesae and
Council of the European Union provides the COST Secretariat. The
T. clareae infestations on A. mellifera. 5. Resistance (or tolerance) mechanisms of Asian bees to
Tropilaelaps mites. 6. Genomic sequence information on T. mercedesae and
T. clareae.
COLOSS network is now supported by the Ricola Foundation - Nature & Culture.
The COLOSS BEEBOOK: Tropilaelaps
10. References ANDERSON, D L (1994) Non-reproduction of Varroa jacobsoni in
15
FORSGREN, E; DE MIRANDA, J R; ISAKSSON, M; WEI, S; FRIES, I (2009) Deformed wing virus associated with Tropilaelaps
mercedesae infesting European honey bees (Apis mellifera).
Apis mellifera colonies in Papua New Guinea and Indonesia.
Experimental and Applied Acarology 47: 87-97.
Apidologie 25: 412-421.
http://dx.doi.org/10.1007/s10493-008-9204-4
ANDERSON, D L; MORGAN, M J (2007) Genetic and morphological
KHONGPHINITBUNJONG, K; DE GUZMAN, L I; BURGETT, M D;
variation of bee-parasitic Tropilaelaps mites (Acari: Laelapidae):
RINDERER, T E; CHANTAWANNAKUL, P (2012) Behavioural
new and re-defined species. Experimental and Applied Acarology
responses underpinning resistance and susceptibility of honey
43: 1-24.
bees to Tropilaelaps mercedesae. Apidologie 43: 590-599.
ANDERSON, D L; TRUEMAN, J W H (2000) Varroa jacobsoni is more
http://dx.doi.org/10.1007/s13592-012-0129-x
than one species. Experimental and Applied Acarology 24: 165-189. KIPRASERT, C (1984) Biology and systematics of the parasitic bee ATWAL, A A; GOYAL, N P (1971) Infestation of honey bee colonies with Tropilaelaps, and its control. Journal of Apicultural Research 10: 137-142. BAKER, A B; HICK, A; CHMIELEWSKI, W (2005) Aspects of the history and biogeography of the bee mites Tropilaelaps clareae and T.
koenigerum. Journal of Apicultural Science 49: 13-19. BURGETT, M D; AKRATANAKUL, P; MORSE, R A (1983) Tropilaelaps
clareae: a parasite of honey bees in South-East Asia. Bee World 64: 25-28. CLINCH, P (1979) Nosema apis and mites in honey bee colonies in Papua New Guinea. Journal of Apicultural Research 18: 298-301. DAINAT, B; KEN, T; BERTHOUD, H; NEUMANN, P (2009) The
mite Tropilaelaps clareae Delfinado and Baker (Acarina: Laelapidae). MSc thesis, Kasetsart University; Bangkok, Thailand. KOENIGER, N; MUSAFFAR, N (1988) Lifespan of the parasitic honey bee mite Tropilaelaps clareae on Apis cerana, dorsata and
mellifera. Journal of Apicultural Research 27: 207-212. KUMAR, N R; KUMAR, R; MBAYA, J; MWANGI, R W (1993)
Tropilaelaps clareae found on Apis mellifera in Africa. Bee World 74: 101-102. LAIGO, F M; MORSE, R A (1969) Control of the bee mites Varroa
jacobsoni Oudemans and Tropilaelaps clareae Delfinado and Baker with chlorobenzilate. Philippine Entomologist 1: 144-148. LE CONTE, Y; NAVAJAS, M (2008) Climate change: impact on bee
ectoparasitic mite Tropilaelaps mercedesae (Acari, Laelapidae) as
populations and their illnesses. Revue Scientifique Et Technique –
a vector of honey bee viruses. Insectes Sociaux 56: 40-43.
Office International Des Epizooties 27: 485-497.
http://dx.doi.org/10.1007/s00040-008-1030-s DEFRA (2005) Tropilaelaps: parasitic mites of honey bees. UK Department for environment, Food and Rural Affairs; London, UK. 14 pp. DEJONG, D; MORSE, E W; EICKWORT, G C (1982) Mite pests of honey bees. Annual Review of Entomology 27: 229-252. DELFINADO, M D; BAKER, E W (1961) Tropilaelaps, a new species of mite from the Philippines (Laelapidae [s. lat]: Acarina). Fieldiana
Zoology 44: 53-56. DELFINADO-BAKER, M; AGGARWAL, K (1987) Infestations of
LINDQUIST, E E; KRANTZ, G W; WALTER, D E (2009) Order Mesostigmata. In G W Krantz; D E Walter (Eds). A manual of
acarology. Texas Technical University Press. pp 124-232. LUO, Q H; ZHOU, T; WANG, Q; DAI, P L; WU, Y Y; SONG, H L (2011) Identification of Tropilaelaps mites (Acari, Laelapidae) infesting
Apis mellifera in China. Apidologie 42: 485-498. http://dx.doi.org10.1007/s13592-011-0028-x MATHESON, A (1997) Country records for honey bee diseases, parasites and pests. Appendix 11. In R M Morse; K Flottum (Eds).
Tropilaelaps clareae and Varroa jacobsoni in Apis mellifera
Honey bee pests, predators and diseases (3rd Ed.). A I Root Co.,
colonies in Papua New Guinea. American Bee Journal 127: 443.
Medina OH, USA. pp 586-602.
DELFINADO-BAKER, M D; BAKER, E W (1982) A new species of
OIE (2004) Tropilaelaps infestation of honey bees (Tropilaelaps
Tropilaelaps parasitic on honey bees. American Bee Journal 122:
clareae, T. koenigerum). In Manual of diagnostic tests and
416-417.
vaccines for terrestrial animals (mammals, birds and bees) (5th
DIETEMANN, V; NAZZI, F; MARTIN, S J; ANDERSON, D; LOCKE, B; DELAPLANE, K S; WAUQUIEZ, Q; TANNAHILL, C; FREY, E; ZIEGELMANN, B; ROSENKRANZ, P; ELLIS, J D (2013) Standard methods for varroa research. In V Dietemann; J D Ellis;
P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard
Ed.). Office International des Epizooties; Paris, France. OTIS, G W; KRALJ, J (2001) Parasitic brood mites not present in North America. In T C Webster; K S Delaplane (Eds). Mites of the honey
bee. Dadant and Sons; Illinois, USA. pp 251-272. PICHAI, K; POLGAR, G; HEINE, J (2008) The efficacy of Bayvarol®
methods for Apis mellifera pest and pathogen research. Journal of
and CheckMite+® in the control of Tropilaelaps mercedesae in
Apicultural Research 52(1):
the European honey bee (Apis mellifera) in Thailand. Apiacta 43:
http://dx.doi.org/10.3896/IBRA.1.52.1.09
12-16.
16
Anderson, Roberts
RATH, W; DELFINADO-BAKER, M; DRESCHER, W (1991) Observations TANGJINGJAI, W; VERAKALASA, P; SITTIPRANEED, S, LEKPRAYOON, C on the mating behaviour, sex ratio, phoresy and dispersal of
(2003) Genetic differences between Tropilaelaps clareae and
Tropilaelaps clareae (Acari: Laelapidae). International Journal of
Tropilaelaps koenigerum in Thailand based on ITS and RAPD
Acarology 17: 201-208.
analyses. Apidologie 34: 514-524.
RAFFIQUE, M K; MAHMOOD, R; ASLAM, M; SARWAR, G (2012) Control of Tropilaelaps clareae mite by using formic acid and thymol in honey bee Apis mellifera colonies. Pakistan Journal of
Zoology 44: 1129-1135. RINDERER, T E; OLDROYD, B P; LEKPRAYOON, C; WONGSIRI, S; THAPA, R (1994) Extended survival of the parasitic mite
http://dx.doi.org/10.1051/apido:2003042 UNDERWOOD, B A (1986) The natural history of Apis laboriosa Smith in Nepal. MSc thesis, Cornell University; Ithaca, NY, USA. WALTER, D E; PROCTOR, H C (1999) Mites: ecology, evolution and
behaviour. UNSW Press. 322 pp. WILDE, J (2000) Is it possible to introduce Tropilaelaps clareae
Tropilaelaps clareae on adult workers of Apis mellifera and Apis
together with imported honey bee queens to Europe? Pszczeln.
dorsata. Journal of Apicultural Research 33: 171-174.
Zesz. Nauk. 44: 155-162.
RITTER, W (1988) Varroa jacobsoni in Europe the tropics and
WOYKE, J (1984) Survival and prophylactic control of Tropilaelaps
subtropics. In G R Needham; R E Page, Jr; M Delfinado-Baker;
clareae infesting Apis mellifera colonies in Afghanistan. Apidologie
C E Bow (Eds). Africanized honey bees and bee mites. Halsted
15: 421–434.
Press; Chichester, UK. pp 349-359. RITTER, W; SCHNEIDER-RITTER, U (1986) Varroa jacobsoni und
Tropilaelaps clareae in bienenvolkern von Apis mellifera in Thailand. Apidologie 17: 384-386. RITTER, W; SCHNEIDER-RITTER, U (1988) Differences in biology and means of controlling Varroa jacobsoni and Tropilaelaps clareae, two novel parasitic mites of Apis mellifera. In G R Needham; R E
Page, Jr; M Delfinado-Baker; C E Bow (Eds). Africanized honey bees and bee mites. Halsted Press; Chichester, UK. pp 378-395. SALEU, L (1994) Studies of the parasitic mite Tropilaelaps clareae in
WOYKE, J (1985a) Tropilaelaps clareae, a serious pest of Apis mellifera in the tropics, but not dangerous for apiculture in temperate zones. American Bee Journal 125: 497–499. WOYKE, J (1985b) Further investigation into control of the parasitic bee mite Tropilaelaps clareae without medication. Journal of
Apicultural Research 24: 250–254. WOYKE, J (1987) Length of successive stages in the development of the mite Tropilaelaps clareae in relation to honey bee brood age.
Journal of Apicultural Research 26: 110–114. WOYKE, J (1994) Mating behaviour of the parasitic honey bee mite
Apis mellifera colonies in Papua New Guinea. MSc thesis, The
Tropilaelaps clareae. Experimental and Applied Acarology 18: 723
Australian National University; Canberra, Australia 96 pp.
–733.
Journal of Apicultural Research 52(1): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.1.09
REVIEW ARTICLE
Standard methods for varroa research
Vincent Dietemann1,2*, Francesco Nazzi3, Stephen J Martin4, Denis L Anderson5, Barbara Locke6, Keith S Delaplane7, Quentin Wauquiez1, Cindy Tannahill8, Eva Frey9, Bettina Ziegelmann9, Peter Rosenkranz9 and James D Ellis8 1
Swiss Bee Research Centre, Agroscope Liebefeld-Posieux Research Station ALP, Bern, Switzerland. Social Insect Research Group, Department of Zoology and Entomology, University of Pretoria, Pretoria, South Africa. 3 Dipartimento di Scienze Agrarie e Ambientali, Università di Udine, vi delle Scienze 206, 33100 Udine, Italy. 4 School of Environment and Life Sciences, University of Salford, Manchester, UK, M5 4WT 5 CSIRO Entomology, Canberra, ACT 2601, Australia. 6 Department of Ecology, Swedish University of Agricultural Sciences, Uppsala, Sweden. 7 Department of Entomology, University of Georgia, Athens, GA 30602, USA. 8 Honey Bee Research and Extension Laboratory, Department of Entomology and Nematology, University of Florida, Gainesville, Florida, USA. 9 University of Hohenheim, Apicultural State Institute, 70593 Stuttgart, Germany. 2
Received 16 May 2012, accepted subject to revision 25 October 2012, accepted for publication 14 November 2012. *Corresponding author: Email: vincent.dietemann@alp.admin.ch
Summary Very rapidly after Varroa destructor invaded apiaries of Apis mellifera, the devastating effect of this mite prompted an active research effort to understand and control this parasite. Over a few decades, varroa has spread to most countries exploiting A. mellifera. As a consequence, a large number of teams have worked with this organism, developing a diversity of research methods. Often different approaches have been followed to achieve the same goal. The diversity of methods made the results difficult to compare, thus hindering our understanding of this parasite. In this paper, we provide easy to use protocols for the collection, identification, diagnosis, rearing, breeding, marking and measurement of infestation rates and fertility of V. destructor. We also describe experimental protocols to study orientation and feeding of the mite, to infest colonies or cells and measure the mite’s susceptibility to acaricides. Where relevant, we describe which mite should be used for bioassays since their behaviour is influenced by their physiological state. We also give a method to determine the damage threshold above which varroa damages colonies. This tool is fundamental to be able to implement integrated control concepts. We have described pros and cons for all methods for the user to know which method to use under which circumstances. These methods could be embraced as standards by the community when designing and performing research on V. destructor.
Métodos estándar de la investigación en varroa étodos Resumen Poco tiempo después de que el ácaro Varroa destructor invadiera las colmenas de Apis mellifera, su efecto devastador produjo un efectivo esfuerzo investigador para comprender y controlar este parásito. En unas pocas décadas, la varroasis se ha extendido a la mayoría de los países que explotan a A. mellifera. Como consecuencia, un gran número de equipos han trabajado con este organismo desarrollando diversos métodos de investigación. A menudo, se han utilizado diferentes enfoques para lograr el mismo objetivo. La diversidad de métodos hizo que los resultados fueran difíciles de comparar, lo que dificulta la comprensión de este parásito. En este artículo se proporcionan protocolos fáciles de usar para la recolección, identificación, diagnóstico, cría, cruzamiento, marcaje y medición de los índices de infestación y la fertilidad de V.
destructor. También se describen los protocolos experimentales para el estudio de la orientación y la alimentación de los ácaros, la infestación de colonias o células y para medir la susceptibilidad del ácaro a los acaricidas. Cuando es pertinente, se describe qué ácaro se debe utilizar para los bioensayos puesto que su comportamiento está influido por su estado fisiológico. También proporcionamos un método para
Footnote: Please cite this paper as: DIETEMANN, V; NAZZI, F; MARTIN, S J; ANDERSON, D; LOCKE, B; DELAPLANE, K S; WAUQUIEZ, Q; TANNAHILL, C; FREY, E; ZIEGELMANN, B; ROSENKRANZ, P; ELLIS, J D (2013) Standard methods for varroa research. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.09
Dietemann et al.
2
determinar el umbral de daño más allá del cual varroa causa daños a las colonias. Esta herramienta es fundamental para poder poner en práctica el concepto de control integrado. Hemos descrito los pros y los contras de todos los métodos para que el usuario sepa qué método utilizar según las circunstancias. Estos métodos podrían ser adoptados como estándares por la comunidad para el diseño y la realización de investigaciones sobre V. destructor.
大蜂螨研究的标准方法 自狄斯瓦螨侵袭西方蜜蜂蜂场以来,其带来的毁灭性危害促进了该领域的研究工作。在过去的几十年里,大蜂螨已分布到大多数饲养西方蜜蜂的 国家。由此许多研究团队开展了蜂螨的研究工作,并形成了多种研究方法。但往往是运用不同的方法解决了同一问题,同时也造成了实验结果难 以比较,妨碍了我们对大蜂螨的认知。本文我们提出了一些简单实用的实验方案,可用于开展大蜂螨感染率和生殖力方面的研究,包含了收集、 鉴定、诊断、饲养、育种、标记和检测技术。还提供了研究蜂螨定位和饲养蜂螨,蜂螨侵染蜂群、侵染巢房以及蜂螨对杀螨剂的耐药性的相关实 验方案。在相关内容中还描述了如何选择蜂螨开展生物学实验,因为蜂螨的行为在其不同的生理阶段是不同的。还给出了测定蜂螨对蜂群危害的 临界值的方法,这是实施蜂螨综合治理的基本工具。对所有的方法我们都描述了其优、缺点,以帮助研究者选择合适的方法开展工作。这些方法 也可作为标准方法介绍给广大从事大蜂螨研究或治理的工作者。
Keywords: COLOSS, BEEBOOK, Varroa destructor, Apis mellifera, research method, protocol, orientation, feeding, marking, taxonomy, bioassay, damage threshold, acaricide, artificial infestation, breeding, honey bee
Table of Contents
Page No.
1.
Introduction
4
3.1.2.
Icing sugar
11
2.
Taxonomy and systematics
4
3.1.3.
Washing with water
11
2.1
Taxonomy
4
3.1.4.
Collecting mites from brood
12
2.2
Collection of mites for identification
5
3.1.4.1.
Collecting mites from L5 larvae
12
2.2.1
Mite appearance
5
3.1.4.2.
Collecting mites from capped cells
13
2.2.2.
Where to find mites
5
3.1.4.2.1.
Opening each cell
13
2.2.3.
Sampling techniques
6
3.1.4.2.2.
Opening large number of cells and washing the brood
13
2.2.4.
Storage of mite samples
6
3.2.
Rearing mites in the laboratory
14
2.2.4.1.
Storage medium and conditions
6
3.2.1.
Maintaining mites in the laboratory
14
2.2.4.2.
Storage and collection container
6
3.2.1.1.
Maintaining mites on adult honey bees
14
2.2.5.
Sample shipping
6
3.2.1.2.
Maintaining mites on honey bee brood
15
2.3.
Morphological methods for identifying varroa
6
3.2.1.3.
Artificial diet
15
2.3.1.
Sample preparation
6
3.2.2.
Breeding mites in the laboratory
15
2.3.1.1.
Recipe for Nesbitt’s Solution:
7
3.2.2.1.
Natural infestation
15
2.3.1.2.
Recipe for Hoyer’s medium:
7
3.2.2.2.
Artificial infestation
15
2.3.2.
Sample identification
7
3.3.
Assessing reproduction in the laboratory
16
2.4.
Molecular methods and systematics
7
3.3.1.
Assessing fertility
16
2.4.1.
DNA extraction
8
3.3.2.
Assessing oogenesis
16
2.4.2.
DNA amplification
8
3.4.
Marking techniques
16
2.4.3.
DNA sequencing
8
3.4.1.
Oogenesis
16
2.4.4.
Species identification
8
3.4.2.
Feeding site
16
2.4.5.
Haplogroup and haplotype identification
9
3.4.3.
Marking mites
17
2.4.6.
Kinship determination with microsatellites
9
3.5.
Infecting varroa with secondary diseases
18
2.5.
Perspectives on the taxonomy of Varroa spp.
9
3.5.1.
Microinjection
18
3.
Laboratory techniques
11
3.5.2.
Dipping
18
3.1
Collecting mites
11
3.6.
Bioassays
18
3.1.1.
Manual collection
11
3.6.1.
Experimental conditions
18
Page No.
The COLOSS BEEBOOK: varroa
3
Page No.
Table of Contents — continued
Page No.
3.6.1.1.
Environment
18
4.2.3.3.
Evaluation of total mite population size in the colony
29
3.6.1.2.
Dosage of chemicals
18
4.2.4.
Natural mite fall
29
3.6.1.3.
Mites to be used in the tests
18
4.2.5.
Sub-sampling mites to count on a bottom board
30
3.6.2.
Bioassays in varroa chemical ecology
18
4.3.
Estimating reproduction parameters
30
3.6.2.1.
Cell invasion
18
4.3.1.
Assessing reproductive success
30
3.6.2.1.1.
Mites to be used
18
4.3.2.
When to measure reproductive success
30
3.6.2.1.2.
Experimental setup
19
4.3.3.
How to measure reproductive success
31
3.6.2.1.3.
Data analysis
19
4.3.4.
Assessing oogenesis
32
3.6.2.2.
Oogenesis
19
4.4.
Estimating damage thresholds
32
3.6.2.2.1.
Mites used in the bioassay
19
4.4.1.
How to estimate damage thresholds
32
3.6.2.2.2.
Experimental setup to test the activation of oogenesis
19
4.4.1.1.
Colony establishment
33
3.6.2.2.2.1
In the field
19
4.4.1.2.
Experimental treatments, sample size and colony arrangements
34
3.6.2.2.2.2
In the laboratory
20
4.4.1.3.
Dependent variables and sampling protocols
36
3.6.2.2.3.
Experimental setup to test oviposition
20
4.4.1.4.
Analyses, interpretation, and pitfalls
38
3.6.2.3.
Orientation inside the sealed cell
20
4.4.2.
Regional variations in reported damage thresholds
39
3.6.2.3.1.
Mites to be used
20
4.5.
Standardising field trials
39
3.6.2.3.2.
Experimental setup
20
4.5.1.
Starting conditions
39
3.6.2.3.3.
Data analysis
20
4.5.1.1.
Obtaining mite free colonies
39
3.6.2.4.
Phoretic phase
20
4.5.1.2.
Obtaining residue free hives
39
3.6.2.4.1.
Mites to be used
21
4.5.2.
Artificial mite infestations
40
How many mites to introduce
40
3.6.2.4.2.
Experimental setup
21
4.5.2.1.
3.6.2.4.3.
Data analysis
21
4.5.2.2.
How to introduce varroa mites in colonies
41
3.6.2.5.
Mating bioassays
22
4.5.2.3.
How to introduce varroa mites in cells
41
3.6.2.5.1.
Mites used in the bioassay
22
4.5.2.3.1.
Manual infestation
41
3.6.2.5.2.
Experimental setup
23
4.5.2.3.2.
Natural infestation
41
3.6.3.
Bioassays to quantify the susceptibility of the varroa mite to acaricides
23
4.5.3.
Field bioassays of semiochemicals
41
3.6.3.1.
Mites used in susceptibility bioassays
24
4.5.3.1.
Cell invasion
41
3.6.3.2.
Bioassays for contact substances
24
4.5.3.1.1.
Data analysis
42
3.6.3.3.
Bioassays for volatile substances
25
4.5.3.2.
Mite reproduction
42
3.6.3.4.
Data analysis
25
4.5.4.
Testing varroacides in the field
42
4.
Field methods
25
4.5.4.1.
Preliminary tests
42
4.1.
Diagnostic techniques
25
4.5.4.2.
Efficacy tests
43
4.1.1.
Debris examination
25
4.5.4.2.1.
Statistical analysis
43
4.1.2.
Brood examination
25
4.5.4.2.2.
Hives
43
4.1.3.
Bee examination
26
4.5.4.2.3.
Colonies
43
4.2.
Measuring colony infestation rate
26
4.5.4.2.4.
Location
43
4.2.1.
Acaricide treatment
26
4.5.4.2.5.
Treatment
43
4.2.2.
Whole colony estimate
27
4.5.4.2.6.
Observations and parameters
43
4.2.3.
Measuring the infestation rate of brood and adult bees
27
4.5.4.6.2.1.
Assessment of efficacy
44
4.2.3.1.
Infestation rates of adult bees
27
4.5.4.2.6.2.
Assessment of safety of product for honey bees
44
4.2.3.1.1.
Sampling
27
4.5.4.3.
Resistance pattern
44
4.2.3.1.2.
Dislodging mites from bees
27
4.6.
Breeding mites in colonies
45
4.2.3.1.2.1.
Powdered sugar
27
4.7.
Brood attractiveness
46
4.2.3.1.2.2.
Ether wash
28
4.7.1.
Procedures to test brood attractiveness
47
4.2.3.1.2.3.
Warm/soapy water or ethanol (75%)
28
5.
Acknowledgements
47
4.2.3.1.2.4.
Assessing the efficiency of dislodging method
28
6.
References
47
4.2.3.2.
Infestation rates of brood
28
Dietemann et al.
4
1. Introduction
varroa mites that have since utilized A. mellifera as a host are all
Most honey bee researchers consider the ectoparasitic mite Varroa
genus, and are native to A. cerana in northeast Asia (Anderson and
destructor to be the most damaging enemy of the honey bee. It has
Trueman, 2000). Hence, the current four recognized species of varroa
been recently identified as one of the major factor responsible for
came about through a long process of speciation on Asian honey bee
members of V. destructor, the most recently described species of the
colony losses worldwide (e.g. Brodschneider et al., 2010; Chauzat et al., hosts and, given the rather uncertain taxonomic status of those bees, 2010; Dahle, 2010; Genersch et al., 2010; Guzman-Novoa et al.,
it is possible that new varroa species await discovery. Prolonged co-
2010; Schäfer et al., 2010; Topolska et al., 2010; vanEngelsdorp et al., evolution of V. destructor and A. mellifera may yet see these mites 2011; Martin et al., 2012; Nazzi et al., 2012). Both the development
also becoming genetically diverse (Oldroyd, 1999), particularly as they
of new and innovative control methods against the mite and further
gradually adapt to exist on isolated populations of A. mellifera.
studies on the complex interaction with the honey bee should be a
However, the movement of bee stocks around the world by man and
priority in bee health research (Dietemann et al., 2012). The use of
the beekeeping practice of re-queening large numbers of A. mellifera
standardised methods by those studying the mite will greatly increase
colonies on a regular basis with queens from a common source will, to
the impact of such work. When reviewing the literature, researchers
some extent, counter natural evolutionary processes that may
should take note that publications prior to 2000 mention V. jacobsoni
eventually lead to varroa speciation on A. mellifera.
instead of V. destructor. The species name was changed after
Various methods have been used over the years to determine
Anderson and Trueman (2000) demonstrated with molecular tools
variation within varroa, all of which have contributed to the current
that the invasive population was not the species from Indonesia
level of taxonomic understanding. The most common and simple
described by Oudemans in 1904.
methods of identifying species have been those that provide measurements of mite physical characteristics (morphology). These methods are discussed below. The initial discoveries of V. jacobsoni
2. Taxonomy and systematics 2.1. Taxonomy
on A. cerana, V. underwoodi on A. cerana and V. rindereri on
A. koschevnikovi all resulted from morphological studies. More recently, molecular methods have helped clarify varroa
Varroa mites were first discovered more than 100 years ago on the
taxonomy and have proven particularly useful for identifying genetic
Asian honey bee (Apis cerana) in Java, Indonesia and named Varroa
variation within species and even identifying cryptic species. These
jacobsoni (Oudemans, 1904). They were assigned to a new genus,
methods, also described below, played a crucial role in the discovery
Varroa, and eventually to a new family, Varroidae (Delfinado-Baker
of a new species, V. destructor, and in showing that it was that
and Baker, 1974). At present the genus contains four species.
species, not V. jacobsoni as previously thought, that had colonized
Since the initial discovery, it has become clear that varroa mites are
A. mellifera after its introduction into Asia (Anderson and Trueman,
native brood parasites of a group of cavity nesting Asian honey bees
2000).
that are closely related to A. cerana. These include, A. cerana itself (which is distributed throughout most of Asia), A. koschevnikovi
The current taxonomy of varroa on Asian honey bees can be summarized as follows (after Lindquist et al., 2009):
(Borneo and surrounding regions), A. nigrocincta (Sulawesi) and
Kingdom: Animalia
A. nuluensis (Borneo). These bees are still undergoing taxonomic
Phylum: Arthropoda
revision as seen by the recent proposal to elevate the plains honey
Class: Arachnida
bee of south India to a new species, A. indica, and separate it from
Subclass: Acari
A. cerana (Lo et al., 2010). At present, varroa mites are only known
Superorder: Parasitiformes
to infest A. cerana, A. koschevnikovi and A. nigrocincta, although very
Order: Mesostigmata
few surveys for mites have been reported for A. nigrocincta, A. nuluensis
Family: Varroidae
or A. indica and those mites that have been found on A. nigrocincta in
Genus: Varroa
Sulawesi were most likely not native to that bee, but rather to sympatric
Species:
A. cerana (Anderson and Trueman, 2000). It is not exactly certain when the European honey bee (A. mellifera)
V. jacobsoni (Oudemans, 1904) V. underwoodi (Delfinado-Baker and Aggarwal, 1987)
first came in contact with varroa but it certainly occurred after that
V. rindereri (De Guzman and Delfinado-Baker, 1996)
bee was introduced into Asia by man (De Jong et al., 1982a). There
V. destructor (Anderson and Trueman, 2000).
are specimens of varroa in the Acarological Collection at Oregon State
The taxonomic status of three genetically distinct varroa types
University, USA, that were collected from A. mellifera in China during
that infest A. cerana in the Philippines remains unresolved at this time
the middle of the last century (Akratanakul and Burgett, 1975). The
(Anderson, 2000; Anderson and Trueman, 2000).
The COLOSS BEEBOOK: varroa
5
Mites of just two ‘haplogroups’ of V. destructor (see section 2.4.5. ‘Haplogroup and haplotype identification’) have colonized A. mellifera globally. Of the two, those belonging to a Korea haplogroup are the most common and widespread on A. mellifera, being present in Europe, the Middle East, Africa, Asia, the Americas and New Zealand. Mites of a Japan haplogroup are less common on A. mellifera, and are only found in Thailand, Japan and the Americas (Anderson and Trueman, 2000; Warrit et al., 2006). At the present time Australia remains the only large landmass on earth on which the resident
A. mellifera are free of varroa.
2.2. Collection of mites for identification The best varroa specimens for laboratory analyses are those that have been collected live and preserved immediately. A benefit of sampling live mites is that they can be submerged in hot water prior to their preservation. This relaxes internal body tissues and exposes hard-to see organs, such as the chelicerae, which usually remain hidden from sight in mites collected directly into alcohol.
Fig. 1. A mite family with mother mite (reddish brown) and different stages of offspring at the bottom of a cell from which the honey bee pupa was removed.
Photo: Denis Anderson.
Fig. 2. Tool kit to collect Varroa spp. mites.
Photo: Denis Anderson.
2.2.1. Mite appearance Adult females are large (about 1.5 mm in width) and reddish-brown in colour, whereas males and female nymph stages are smaller and cream or white in colour. All stages are easily seen by the naked eye (Fig. 1). Each of the different life stages may be carefully removed from cells with the aid of a fine pair of forceps (such as #55 biologie forceps, Cat. No. 11255, from FST Fine Science Tools Inc.; Canada; Fig. 2) or soft paintbrush and dunked immediately into preserving fluid in a collection vial. Mites dunked into a vial of alcohol will immediately die and sink to the bottom, whereas those dunked into a vial of RNAlater will float on the surface and crawl around the inside of the vial before eventually dying some time later. 2.2.2. Where to find mites Live adult mites, nymphs and eggs are most easily found in capped brood cells of bee colonies in which adult female mites are reproducing. In A. cerana colonies this is restricted to drone cells, but in A. mellifera colonies it may be either drone or worker cells. After removing the wax cappings and bee brood, the presence of white faecal deposits on cell walls (Fig. 3) is a sure indicator of the presence of reproducing females. Collecting mites from brood cells with offspring also provides evidence that these mites indeed reproduce on the bee species they have been collected from, as mites sometimes drift to and from colonies of foreign species on which they are unable to reproduce (Anderson and Trueman, 2000; Koeniger et al., 2002), which might confuse the host-specificity attributed to them. Only live adult female varroa can be collected from broodless bee colonies.
Fig. 3. In this section of a cell (the bottom is on the right side), the
These are generally found on the bodies or in body cavities of worker
pearly white faeces deposit is visible on the upper and back walls.
bees.
Mature and immature varroa mites are also visible. Photo: Swiss Bee Research Institute
Dietemann et al.
6
2.2.3. Sampling techniques
Some countries (e.g. Australia and the USA) require an official
Varroa spp. mites can be sampled from brood or adult workers.
quarantine import permit to accompany imported varroa mite
Sampling techniques are described below in section 3.1. ‘Collecting
specimens. Other countries (e.g. Brazil) may prohibit the exportation
mites’.
of specimen due to specific laws on biopiracy. Therefore, before sending or transporting specimens to a particular country, that
2.2.4. Storage of mite samples
country’s policy on importing biological specimens should be checked
2.2.4.1. Storage medium and conditions
and followed.
Mites collected in the field should be preserved immediately in 70-95% ethyl alcohol or RNAlater. This ensures the specimens are not damaged
2.3. Morphological methods for identifying
and, even if they are kept this way at room temperature, are good for
varroa
morphological analyses for at least a few months, but often much
The four recognized species of varroa are readily identified
longer. However, if specimens are to be used in DNA analysis, they
morphologically and are shown for comparison in Fig. 4.
should be stored in a cool environment, such as a fridge at 4°C or freezer at -20°C, within a few days of collection to slow the degradation of DNA in body tissues. Specimens frozen at -20°C remain viable for several years, but to remain viable longer, they should be stored at -70°C (see the section on ‘Storing dead adults’ in the BEEBOOK paper on miscellaneous methods (Human et al., 2013)).
2.2.4.2. Storage and collection container Ideal containers for collecting mites are small and made from tough plastic, such as the small plastic 1.5 ml cryogenic vial supplied by Nalgene®, shown in Fig. 2. This vial may hold hundreds of mite specimens and has a large white-coloured area on its outside for a label. Importantly, its lid is secured on a thread that runs down the outside of the vial. This ensures that no preserving fluid is forced from the vial as it is being closed, which could result in smudging or complete removal of the label. The label should contain essential information, such as the date of collection, name of host bee, location and name of collector, using a fine point permanent marker pen. To overcome external labels becoming removed from the collection vial, a small piece of paper on which the collection data have been written with a pencil (alcohol resistant) may be inserted in the vial, with the sample. 2.2.5. Sample shipping Specimens should be transported to their destination as soon as possible after collection. Some airlines prohibit the carriage of biological specimens preserved in alcohol on aircraft, whilst others are less stringent. It pays to check airline policy in this regard before attempting to send or carry specimens preserved in alcohol. A convenient way to avoid this problem is to pour the alcohol off the specimens shortly before transportation. In this way the specimens
Fig. 4. The four species of Varroa: a. V. jacobsoni dorsal view; b. V. jacobsoni ventral view; c. V. destructor dorsal view; d. V. destructor ventral view; e. V. rindereri; f. V. underwoodi. Photo: Denis Anderson.
will still remain covered with a very small amount of alcohol and thus remain saturated in alcohol and preserved during transport. However, upon arrival the specimens should be again well-covered in fresh
2.3.1. Sample preparation
alcohol before storage. Some transportation courier services have
Morphological analyses are best carried out on mite specimens that
arrangements in place with airlines to transport biological specimens
have been mounted on glass microscope slides. For this, a specimen
preserved in alcohol on aircraft.
must first be cleared of its soft tissues before being mounted on a slide.
The COLOSS BEEBOOK: varroa
This is achieved as follows.
7
2.3.1.2. Recipe for Hoyer’s medium:
1. Remove specimen from preserving medium.
30 g of gum Arabic.
2. Immerse specimen in Nesbitt’s Solution (see recipe below) in
200 g of chloral hydrate.
20 ml of glycerol.
All dissolved in 50 ml of distilled water.
the depression of a concave slide. 3. Wait until the specimen becomes saturated with Nesbitt’s Solution, and then push it under the surface of the solution to
Note: the mixture needs to be stirred and warmed gently to allow
make it sink to the bottom, using a fine needle.
the gum Arabic to dissolve, then filtered through muslin and
4. Place a cover slip over the depression of the slide.
stored in an airtight container, but not a container with a screw
5. Warm the slide in an oven for 1 hour at 45°C.
cap, as the cap will become permanently stuck.
The specimen should become free of body tissue and appear transparent, but older specimens may require further clearing
2.3.2. Sample identification
in the oven for several hours or overnight.
Mounted mite specimens are best examined with dissecting or compound light microscopes that have been fitted with ocular
This procedure can be speeded-up by warming the slide over a
micrometers. The following measurements should be considered.
flame or hotplate for a few seconds, instead of placing it in an oven.
Body size (length and width).
However, extreme care should be taken to avoid boiling the Nesbitt’s
Structure and setation (i.e. stiff hair, bristle) of dorsal shield.
Solution, which will destroy the specimen. Laboratory gloves and coat
Structure and chaetotaxy of the sternal, epigynal, anal and
should be worn when clearing specimens.
metapodal shields, peritreme, tritosternum and hypostome (see Fernandez and Coineau, 2007 for a description of varroa
The cleared specimen is then mounted as follows: 6. Remove specimen from the Nesbitt’s Solution and transfer it to a drop of Hoyer’s Mounting Medium (see recipe below) on a glass microscope slide.
morphology).
Number, arrangement and morphology of setae on the legs and palps.
The two species V. destructor and V. jacobsoni are morphologically
Note: the drop should be just large enough to form a thin
similar, except in body size and shape. V. jacobsoni is much smaller
layer when a cover slip is placed on top, without overflowing
and more circular in shape than V. destructor (Fig. 4). Nevertheless,
around the edges of the cover slip.
some V. jacobsoni (e.g. those found on A. cerana in Laos, mainland
7. Push the specimen down through the Hoyer’s so that it rests on the slide, using a fine needle. 8. Gently lower a cover slip (thickness No. 1, diameter 16 mm) over the drop of Hoyer’s, starting from the edge of the drop
Asia) are much larger than other V. jacobsoni. Hence it is always best to confirm a diagnosis of either of these species with additional molecular information. In case varroa work is conducted in Asia where several species
and letting it slowly settle over the drop under its own weight, cohabit, we provide a determination key adapted from Oldroyd and spreading the Hoyer’s as it goes. 9. Place the slide horizontally to cure in an oven at 45°C for at least 2 weeks. 10. Label and store slide.
Wongsiri (2006) and Warrit and Lekprayoon (2011) to differentiate those mites. Varroa mites have body as wide or wider as it is long. This characteristic distinguishes it from other Asian parasitic mite genera Tropilaelaps (with a body longer than it is wide) and Euvarroa (triangular shaped body).
Hoyer’s medium does not completely harden and remains watersoluble, so that the slide can be reheated and specimen floated off
2.4. Molecular methods and systematics
the slide for dissection or re-mounting. For long-term storage or for
Molecular technology was first used in varroa research during the
transporting, the edges of the cover slip should be sealed with some
1990s to look for variation within and among mite populations (Kraus
water-resistant material, such as clear fingernail varnish. Laboratory
and Hunt, 1995; De Guzman et al., 1997, 1998, 1999; Anderson and
gloves and coat should be worn when mounting specimens.
Fuchs, 1998). Initially it was expensive and was only used by specialised laboratories. Currently, the landscape has changed and a
2.3.1.1. Recipe for Nesbitt’s Solution:
number of quick and easy commercial kits can be purchased for
60 g of chloral hydrate.
extracting DNA from tissue and any number of laboratories will
10 ml of concentrated (35.4%) hydrochloric acid.
sequence DNA for a reasonable fee within hours of its extraction.
All dissolved in 100 ml of distilled water.
Sequence data from small DNA fragments (< 1,000 base pairs)
Note: care should be taken in preparing this solution, as it is
has been particularly useful in providing ‘snap-shots’ of genetic
highly corrosive to skin and microscope.
variation across the entire varroa genome and for use in phylogenetic
Dietemann et al.
8
Key to identification of varroa species * ‘gutters’ protruding from the spiracle on the ventral side, towards the edge of the body at the level of the third pair of legs (see Fernandez and Coineau, 2007).
Varroa rindereri (Fig. 4e)
1. a. Peritremes* are long and looping up from the ventral side, extending beyond the lateral margin of the dorsal shield and thus
primarily found parasitizing A. koschevnikovi
sometimes visible on a dorsal view. b. Peritremes not extending beyond the lateral margin of the dorsal
2.
shield. 2. a. Setae of the lateral margin long and slender
Varroa underwoodi (Fig. 4f) primarily found parasitizing A. dorsata, A. laboriosa and
A. breviligula b. Setae shorter and stout. 3. a. Body size ratio (width to length) 1.2-1.3:1
3.
Varroa jacobsoni (Fig. 4a, b) parasitize A. cerana on Sundaland, including A.
nigrocincta on Sulawesi b. Body size ratio ≥ 1.4
Varroa destructor (Fig. 4c, d) parasitize A. cerana on Mainland Asia, and A. mellifera worldwide
analyses or as molecular markers (Avise, 2004). Sequencing involves
3. 1 min annealing at 52°C.
three basic steps described below in sections 2.4.1., 2.4.2. and 2.4.3.:
4. 2 min extension at 72°C.
1. Extraction of total DNA from mite tissue.
5. Final extension at 72°C for 5 min.
2. Amplifying (making copies of) fragments of that DNA using Polymerase Chain Reaction (PCR). 3. Sequencing the amplified fragments.
2.4.3. DNA sequencing Amplified DNA can be then sent to a laboratory for sequencing and the sequence can then be compared with sequences in GenBank
2.4.1. DNA extraction
using BLAST (see the section ‘Obtaining and formatting sequences of
DNA is sourced from the tissue of Varroa spp. mites that have been
interest for phylogenetics’ of the BEEBOOK paper on molecular
collected and preserved in 70% ethyl alcohol or RNAlater (as
methods (Evans et al., 2013)). The critical part of DNA sequencing is
described in section 2.2.4.1. ‘Storage medium and conditions’). Any
to decide which gene to sequence for a particular outcome, and only
tissues can be used, but if the tissue is dissected from a single
trial and error will determine this. Fortunately, studies have already
appendage (such as a leg), the rest of the mite can be used for other
shown that sequences obtained from specific regions of the
purposes. See the section on ‘CTAB genomic DNA extraction from
mitochondrial DNA (mtDNA) of varroa are useful for examining inter
adult bees’ of the BEEBOOK paper on molecular methods (Evans et al., and intra-species variation (Anderson and Fuchs, 1998; Anderson and 2013)) for extraction methods.
Trueman, 2000; Navajas et al., 2010).
2.4.2. DNA amplification
2.4.4. Species identification
DNA amplification requires a PCR machine (such as an Eppendorf
A 458 DNA base-pair fragment of varroa mtDNA cox1 gene has
Mastercycler®) and a set of specific forward and reverse primers. The proved useful in identifying mites to a particular species (Anderson machine is initially programmed to carry out a number of cycles to
and Trueman, 2000). To do this, a sequence of the fragment is
amplify the DNA (see the section ‘DNA methods’ of the BEEBOOK
obtained from a mite and compared to other sequences of the same
paper on molecular methods (Evans et al., 2013).
region deposited in the GenBank database. If this sequence shows
A commonly used method for amplifying Varroa spp. DNA consists of:
2% or less difference from the one in the database, then it is
1. PCR thermo-cycles of 5 min pre-denaturation at 94°C.
considered to be a member of this particular species. Fragments from
2. 35 cycles of denaturation at 94°C for 1 min.
each of the 4 recognized species differ from each other by about 6%
The COLOSS BEEBOOK: varroa
9
(Anderson and Trueman, 2000). Sequences of the cox1 gene
2.5. Perspectives on the taxonomy of Varroa spp.
fragment have been obtained from all Varroa spp. mites that have
More research is needed to clarify the taxonomy of varroa mites from
been identified to date by molecular methods. Hence, sequences of
A. cerana in the Philippines. This will require examinations of nuclear
this fragment should be incorporated into all new molecular studies on DNA sequences obtained from these mites, as their mtDNA sequences varroa mites, as it places this new work in context with what has gone do not provide the resolution needed to determine their identity (Fig. 5). before.
From published research, there are three distinct mite types in the Philippines, two from the northern island of Luzon and another from
2.4.5. Haplogroup and haplotype identification
the southern island of Mindanao (Anderson and Trueman, 2000).
The varroa cox1 gene marker is also useful for identifying mites of
These could well be distinct species. New varroa species may also yet
large discreet populations within a species (such as island populations) be found on other Asian honey bees, particularly on A. nigrocincta in (Anderson and Trueman, 2000). As smaller populations within these
Sulawesi, A. nuluensis in Borneo and A. indica from southern India.
larger populations can be identified by concatenated (joined)
An interesting feature of varroa mites on Asia honey bees is that
sequence data obtained from the mtDNA cox3, atp6 and cytb genes,
most of them lack the ability to reproduce on A. mellifera. This is not
the larger discreet populations have been referred to as ‘haplogroups’
from lack of trying though, for when A. mellifera colonies are introduced
and the smaller populations within them ‘haplotypes’ (Navajas et al.,
to different regions of Asia female mites that are indigenous to the
2010). The primer sequences for amplifying all these fragments,
local Asian honey bee readily invade the introduced colonies and enter
together with the size of fragments amplified, are shown in Table 1.
brood cells that are about to be capped, in preparation for reproduction.
As the varroa cox1 gene marker has proved useful for resolving
However, they do not go on to lay eggs or produce offspring. Since at
mites from haplogroups to a particular species it has also been useful
least the middle of the last century, only a few mite types have been
in phylogenetic studies. A phylogenetic tree of the all the currently
able to reproduce on A. mellifera, the most successful of which is the
known and published haplogroups with species is shown in Fig. 5 (see Korea type of V. destructor. This suggests that female varroa mites the section ‘Phylogenetic analysis of sequence data’ of the BEEBOOK
must recognize specific signals on the host bee in order to successfully
paper on molecular methods (Evans et al., 2013) for methods to
reproduce. Even though these signals may be fundamentally the same
perform phylogenetic analyses).
between different honey bee types and species, they may vary between honey bee populations. Identifying these signals and the
2.4.6. Kinship determination with microsatellites
genes that control them, could lead to the genes being targeted for
Microsatellites are useful markers for measuring kinship or paternity
particular purposes, such as control. This kind of research will require
relationships within varroa populations. These consist of repeating
a good understanding of both the parasite and host genomes. Even
sequence of base-pairs DNA (such as CACACA) at a single locus (see
though our understanding of the honey bee genome has improved in
the section ‘Microsatellites’ in the BEEBOOK paper on molecular
recent years, studies have only recently commenced on sequencing the
methods (Evans et al., 2013)). Loci with long repeats have more
varroa genome (Cornman et al., 2010). As our understanding of the
alleles than loci with short repeats and therefore often allow for a
varroa genome improves, too will our understanding of varroa
progenitor of a particular allele to be identified. Microsatellite loci in
taxonomy and ways by which the mite can be controlled on European
varroa have been published by Evans (2000) and Solignac et al. (2005). honey bees.
Table 1. Primer sequences (and their names) used in varroa research to amplify fragments of a particular size (base pairs) of mtDNA genes. From Anderson and Fuchs (1998); Navajas et al. (2010). mtDNA Gene
Fragment Size (bp)
Primer Sequence
Primer Name
Cox1
458
GG(A/G) GG(A/T) GA(C/T) CC(A/T) AAT (C/T)T(A/T) TAT CAAC
COXF
CCT GT(A/T) A(A/T)A ATA GCA AAT AC
COXRa
CTT GTA ATC ATA AGG ATA TTG GAAC
10KbCOIF1
AAT ACC AGT GGG AAC CGC
6,5KbCOIR
GAC ATA TAT CAG TAA CAA TGAG
16KbATP6F
GAC TCC AAG TAA TAG TAA AACC
16KbCOIIIR
GCA GCT TTA GTG GAT TTA CCT AC
10KbCytbF-1
CTA CAG GAC ACG ATC CCA AG
10KbCytbPRIM
Cox1
Atp6-cox3
Cytb
929
818
985
10
Fig. 5. A phylogenetic tree of all the currently known and published haplogroups.
Dietemann et al.
The COLOSS BEEBOOK: varroa
11
3. Laboratory techniques
3.1.2. Icing sugar
3.1. Collecting mites
jar (Macedo et al., 2002) or still in the colony.
Icing sugar can be used to detach mites from their host collected in a
There are several ways to collect varroa mites for experiments. Some
Material needed: a wide mouthed jar with a lid of which the
methods described below provide mites of unknown age, which have
centre part is replaced by a 2mm hardware cloth or mesh (Fig. 6a).
reproduced an unknown number of times. Other methods provide
1. Place 300 bees in the jar and close the lid.
mites in which oogenesis has been triggered. Which method is
2. Pour 1 heaping table spoon (at least 7g) of powdered sugar
adopted depends on the physiological state of mites needed for the experiment (see section 3.6. 'Bioassays').
through the mesh or cloth (Fig. 6a). 3. Roll the jar to cover all the bees with sugar (Fig. 6b). 4. Let stand for 1 min.
3.1.1. Manual collection
5. Turn jar upside down over a white surface (Fig. 6c).
Phoretic mites can be picked up by hand from their host with a fine
6. Shake for 1 min.
bristle brush or a small mouth aspirator.
7. Place the fallen mites and sugar (Fig. 6d) in a sieve and rinse with 1X phosphate-buffered saline (or other similar saline
1. Collect honey bees from a colony. Manual collection is easier
solution) to rid them of icing sugar particles (Fig. 6e).
when the colony is highly infested (see section 4.6. ‘Breeding
8. Place mites on absorbent paper to help them dry up (Fig. 6f).
mites in colonies’ for a method to obtain regular supply of
9. Place the mites collected in a mite-tight container to prevent
highly infested colonies), but to collect ‘healthy’ mites it is
them escaping.
recommended that the host colony does not have symptoms
Place a source of humidity in the container to prevent the
of extreme infestation such as crippled bees.
mites desiccating until they are used for experiments.
2. Catch honey bees one by one and examine them for the presence of mites. Mites may run freely over the bee's body or be hidden
This can also be done using the entire colony fitted with a mesh floor:
between two sternites. Finding and collecting them sometimes
1. Remove each frame containing adult bees.
necessitates grasping the bee by the thorax and sting
2. Sprinkle with icing sugar so that the frames are all covered.
apparatus with forceps to stretch the abdomen, thus making
3. Place back into the colony.
the mites visible and reachable.
4. Remove the excess icing sugar with the mites from the floor
3. Honey bees can be treated with CO2 or cooled down to
at 10-20 min intervals.
facilitate the physical collection. CO2 affects the bees'
5. Pour over a sieve to remove the sugar and collect the mites.
physiology (Czekońska, 2009), but recent results indicate that
6. Rinse with 1X phosphate-buffered saline (or other similar
a short treatment with CO2 does not affect fertility and
saline solution) to rid them of icing sugar particles.
fecundity of varroa female artificially introduced into brood
7. Place mites on absorbent paper to help them dry up (Fig. 6f).
cells (Rosenkranz et al., unpublished data). The effect of
8. Place the mites collected in a mite-tight container to prevent
cooling on mites is not known and might affect mite survival.
them escaping.
An alternative to CO2 and cooling treatment is: (i) to let the
Place a source of humidity in the container to prevent the
bees crawl out of their container one by one so they can be
mites desiccating.
caught easily or (ii) to cut off the head of the bees; mites tend to leave dead bees within a short time. 4. Place the mites collected in a mite-tight container with a
Pros: fast and allows for several hundreds of mites to be collected in short time. The treatment is bee-friendly since few individuals die
source of humidity (a wet cotton plug or ball of paper) to
during the process. Workers collected in the jars can be placed back
prevent the mites desiccating.
in their colonies where they will be cleaned by their nestmates. Cons: decreases lifespan of mites (Macedo et al., 2002). This can
Pros: allows for the collection of mites that have not been stressed by a treatment with water or powdered sugar (see sections
be a problem if they need to be used for long lasting experiments (> 3 days).
3.1.2. ‘Icing sugar’ and 3.1.3. ‘Washing with water’). This is advantage if mites are used in long lasting experiments. Cons: tedious, few mites can be sampled in a short time.
3.1.3. Washing with water 1. Collect bees from a colony in a bee tight container. 2. Fill the container with 1X phosphate-buffered saline (or other similar saline solution) to prevent the bees flying away and shake.
Dietemann et al.
12
Fig. 6. c. the jar is turned upside down and shaken to dislodge the mites.
Photo by V. Dietemann
Fig. 6. Collecting mites with icing sugar: a. a heaped table spoon of
Fig. 6. d. mites (2 darker points) and sugar fallen through the mesh
powdered sugar is poured on 300 honey bees kept in a jar through
on the paper.
the lid equipped with a mesh.
Photo by V. Dietemann
Photo by V. Dietemann 6. Place the mites collected in a mite-tight container with a humidity source to prevent the mites desiccating. Pros: fast and allows for several hundreds of mites to be collected in a short time. Cons: effect on lifespan of mites unknown; this can be a problem if they need to be used for long lasting experiments. The treatment it is not bee-friendly since many can die during the process. 3.1.4. Collecting mites from brood
3.1.4.1. Collecting mites from L5 larvae Mites at a similar physiological stage can be collected from recently
Fig. 6. b. rolling the jar on its side ensures that bees are covered with the sugar.
Photo by V. Dietemann
3. Pour the content of the container over a first sieve (aperture: 2000 Âľm) to collect all the bees. 4. Place a second sieve (aperture < 0.5 mm) underneath to collect the mites. 5. Place mites on absorbent paper immediately after washing them off to help them dry up (Fig. 6f).
capped brood cells (after Chiesa et al., 1989) 1. Remove a brood comb with L5 larvae ready to be capped in the evening of the day preceding the experiment. 2. Mark the capped cells with a convenient marker (e.g. correcting fluid, queen marker, felt pen). 3. Replace the comb in its colony of origin. Bees will continue capping mature cells. 4. The following morning, transfer the comb to the laboratory and unseal the unmarked cells that have been capped overnight.
The COLOSS BEEBOOK: varroa
13
Pros: easy collection, all mites are at the same physiological stage. Cons: there is no knowledge of the mite's age and of how many reproductive cycles she already performed.
3.1.4.2. Collecting mites from capped cells 3.1.4.2.1. Opening each cell Brood mites can be picked up by hand from their host with a fine bristle brush or a small mouth aspirator after opening the cells they infest and removing the pupa. To obtain mites at a given time during the reproductive cycle, the collection can be made from brood of known age (see the section ‘Obtaining brood and adults of known age’ in the BEEBOOK paper on miscellaneous methods (Human et al., 2013)). For this the queen is caged on an empty frame at the necessary date (see also section 4.6. ‘Breeding mites in colonies’). 1. Uncap the cell with fine forceps or scalpel. 2. Push away the cell walls to free the developing larva or pupa. 3. With soft forceps pull the larva or pupa out. 4. Carefully look on the larva or pupa and on the cell walls for mites. 5. Place the mites collected in a mite-tight container.
Fig. 6. e. the mites and sugar collected are placed in a sieve over
6. Place a source of humidity in the container to prevent the mites desiccating.
which saline solution is poured to rid the mites from sugar particles. Photo by V. Dietemann
Pros: This is the less damaging collection method for the mite. Cons: It is the most time consuming collection method.
3.1.4.2.2. Opening large number of cells and washing the brood A quicker method for collecting large numbers of live mites from capped brood cells it to uncap large quantities of brood and force the mites out by knocking them out of the cells or by washing them off the brood. For this: 1. Uncap a large number of cells. 2. Remove all developing bee brood. These two steps can be done at once using an uncapping fork
Fig. 6. f. the mites are placed on an absorbing paper to accelerate their drying.
Photo by V. Dietemann
used for honey extraction. 3. Turn the comb upside-down over a sheet of white paper. 4. Tap on its upper surface to dislodge mites from the cells. 5. Collect the dislodged mites, sometimes in the hundreds, from
5. Place the comb in an incubator at 34.5°C, 60-70% RH.
the paper.
6. Infested and non-infested larvae deprived of the capping spontaneously emerge from brood cells in a short time.
An alternative method to increase the number of mites sampled is to:
7. Collect mites that have fallen from their cells with their host.
1. Uncap the brood cells.
8. Place the mites collected in a mite-tight container to prevent
2. Flush the comb with lukewarm water that will dislodge the
them escaping. 9. Place a source of humidity in the container to prevent the mites desiccating.
brood and mites. 3. Collect dislodged brood and mites in a first sieve (5 mm mesh) that will retain the bees.
Dietemann et al.
14
4. Place a second sieve (0.5 mm mesh) underneath the first to retain mites.
alternative method includes the separate collection of bees and mites followed by the infestation of the bees with the collected mites. Mites
5. Flush with more water.
can be transferred onto the caged bees using a brush or, if mites
6. Dry the mites by placing them on absorbent paper (Fig. 6f).
were collected in a container, they can be introduced in a cage with bees. The mites readily spread across the bees within minutes. A
Pros: easy collection of high mite numbers (depending on colony infestation rate). Cons: mites of unknown physiological stage; possible shortening
primary benefit of the latter method is that it is feasible for a single, inexperienced experimenter to accomplish quickly. Additionally, this method obviates the need for maintaining colonies with high varroa
of life expectancy after washing from brood; a large number of mites
populations (which are preferred when infested bees are chosen
remain in the comb with the knocking method.
individually from frames, see section 4.6. ‘Breeding mites in colonies’). Collecting bees and mites:
3.2. Rearing mites in the laboratory
1. Collect worker bees from frames and place in cages as
It is relatively easy to maintain varroa mites during their phoretic
described in section ‘Cages to keep bees in vitro in the
phase (on honey bees or pupae) in the laboratory. Their maintenance
laboratory’ of the BEEBOOK paper on maintaining adult bees
in cages kept in incubator is necessary for screening of varroacides, or
in vitro (Williams et al., 2013)).
while marking before transfer to colonies for example. In contrast,
The number of bees placed in each cage can vary depending
few laboratory breeding methods for varroa are available. The conditions reigning in their breeding environment, i.e. in the cells in which honey bees develop, are so particular that it is very difficult to replicate them
on experimental requirements. 2. Collect mites using the methods described in section 3.1. ‘Collecting mites’.
artificially. Obtaining a full life cycle in the laboratory therefore remains a challenge that few overcame (Donzé and Guérin, 1994; Nazzi and
In vitro infestation of bees with varroa:
Milani, 1994). This section describes methods to keep or breed varroa
3. Add 5-10 mites to a small (5 cm) Petri dish containing a filter
in the laboratory. These methods do not yet allow their breeding in large quantities as would be desired for experimentation, but allow observation of mite behaviour and testing of products that may affect the mite's life cycle.
paper circle wetted with 1:1 sugar syrup (by volume) or water. 4. Place the Petri dish with mites on the bottom of the cage containing worker bees. 5. Tap the cage lightly against the laboratory bench or table to cause the bees to drop from the top of the cage to the bottom
3.2.1. Maintaining mites in the laboratory
and contact the mites.
3.2.1.1. Maintaining mites on adult honey bees
This artificial infestation procedure relies on the questing
Mites can be maintained on bees in hoarding cages (see section
behaviour of mites, which readily attach to bees that contact
‘Cages to keep bees in vitro in the laboratory’ in the BEEBOOK paper
them. The sugar syrup impregnated in the filter paper will
on maintaining adult bees in vitro (Williams et al., 2013)). A temperature
keep the bees for an increased duration at the bottom of the
of around 33ºC and RH of 60-70% is also adapted for mites. Mortality can be high in case phoretic mites are used. Their age is unknown at the time of collection and the variability in their life expectancy is therefore high. However, mites will commonly survive for 1 week or
cage to give more time for mites to find a host. 6. Remove the Petri dish after all of the mites have attached to bees. 7. Repeat steps 5-6 until the desired number of mites has been
longer in bee cages established in this way. It is recommended using
added to the cage. Partitioning the mite additions, rather than
mite-tight cages or keeping each cage in a dish to avoid any escaped
trying to add them all to the cup at one time, results in a
mites from entering another cage of a different treatment group. This
more even distribution of mites on bees. Be aware that some
procedure can be used in acaricide toxicity in vitro assays, in assays
bees will inevitably carry multiple mites and some bees will
where the investigator is attempting to trace the movement of a
have no mites.
compound (such as dsRNA) from a bee food (sugar water, pollen
More mites should be added to each cage than are needed for
patties, etc.), through bees, and into mites, or in other similar assays.
the experiment. For example, add 30 mites to a cage when
A common method for establishing in vitro studies with varroa-
the experiment calls for the live recovery of 25 mites later in
infested adult honey bees involves individually selecting worker bees
the study. This is necessary because some mites will fail to
carrying mites from combs/frames in colonies and placing them in
attach to any bee. Regardless, the number of varroa mites per
cups or cages. This method is relatively time-consuming and can be
cage or per bee can vary based on the predetermined
particularly difficult for researchers with limited bee experience. An
experimental criteria.
The COLOSS BEEBOOK: varroa
8. Add a sugar syrup feeder and water supply to the cage (see
15
necessary for the mite to reproduce successfully. However, in some
section ‘Cages to keep bees in vitro in the laboratory’ in the
cases reproduction rates close to the natural ones were obtained. In
BEEBOOK paper on maintaining adult bees in vitro (Williams
particular, Donzé and Guérin (1994, 1997) obtained complete reproductive
et al., 2013)) after the mites have been added.
cycles in artificial cells. The cells used where first kept in the hive until
Bees must stay hydrated and fed to ensure mite survival.
sealing, then brought to the laboratory and placed in an incubator. Despite the low acceptance and infestation rate of these cells, it allows
If keeping mites on brood is possible in Eppendorf tubes (see
using cells of natural size and naturally infested. Nazzi and Milani
section 3.2.1.2. ‘Maintaining mites on honey bee brood’), keeping
(1994) developed a method that allow normal mite reproduction under
mites on adult bees works better in hoarding cages. Ventilation within
laboratory conditions in cells in which larvae were introduced and
the Eppendorf tubes is poor and the health of the bees kept in them
which were infested artificially to allow more control on the process.
decreases rapidly.
3.2.2.1. Natural infestation 3.2.1.2. Maintaining mites on honey bee brood
Material needed: cylindrical transparent polystyrol cells (internal
Adult mites can be kept for many days on bee larvae or pupae in the
dimensions: 5.1 mm diameter x 14 mm length for workers and 6.7
laboratory, under standardized thermo- and hygrometric conditions
mm diameter x 16 mm long for drones)
necessary for the brood (34.5°C and 60-70% RH). Brood must be replaced regularly with younger individuals before they reach the adult stage (Beetsma and Zonneveld, 1992). Small Petri dishes with a few immature honey bees can be used for this purpose. In order to improve mite feeding and survival, a close contact between the mite and the brood item is desirable. Some authors confine mites
1. Incorporate the cells at an inclination of 5-10 degrees in groups of 60-70 in wax combs. 2. Coat with honey to increase acceptance by the workers and stimulate cleaning behaviour. 3. In a heavily varroa infested colony, confine the queen on the artificial cells for 12 h.
individually on a larva or pupa in smaller containers (1ml Eppendorf
4. Release the queen after this period.
tube). To increase humidity in the Eppendorf tube, a wet piece of
5. Record the time of cell capping at 1-2 h interval some 8.5 days
cotton wool is pushed into the bottom of the tube. Excess water accumulating on top of the cotton wool needs to be removed by shaking the tube to prevent mites from adhering to droplets. Piercing the lid with 1-2 holes (diameter < 1 mm) will improve ventilation and
after oviposition by the queen. 6. Remove the cells from the colony and the comb after they have been capped. 7. Place in an incubator at 34.5°C and 60-70% RH.
respiration. Up to 8 mites can be kept in one tube. Mites can be transferred into the Eppendorf tube using a brush. Once all mites are transferred, the pupa/larva can then be placed in the tube.
Pros: transparent cells allowing observation of behaviour, natural infestation, natural cell size. Cons: tedious, low acceptance and infestation rates.
Pros: easy for keeping mites alive. Cons: does not result in oviposition by the mites.
3.2.2.2. Artificial infestation 1. Collect mites and L5 bee larvae from natural brood combs as
3.2.1.3. Artificial diet To facilitate the keeping and rearing of the mite in the laboratory, attempts were made to develop rearing methods based on artificial diets that mites could suck through a synthetic membrane (Bruce et al.,
described in section 3.1.4. ’Collecting mites from brood’. 2. Place the larva in a gelatin cell by holding its dorsum between thumb and first finger to get it stretched. 3. Insert the mite with a fine paint brush.
1988; Bruce et al., 1991). Unfortunately, despite both membrane and
Gelatin cells of different diameters were tested; as a general
diet seeming suitable for the purpose, satisfactory survival and
rule, the narrower the cell diameter the higher the reproduction,
reproduction were not achieved.
but the higher the chance of injuring the larva while inserting into the cell; the best compromise is achieved with gelatin
3.2.2. Breeding mites in the laboratory
cells of 6.5 mm diameter.
In order to obtain the whole life cycle of varroa within the cells under
4. Place in an incubator at 34.5°C, 75% RH.
laboratory conditions for observations and experimentation, rearing
5. Place the cells so that pupae are laying on their back.
methods within artificial cells made of different materials were designed. Tested materials for cells include wax, glass, plastic, gelatin (Nazzi and Milani, 1994 and citations therein). In general, reproduction is very difficult to obtain, due to the seemingly high number of cues
Geotaxis is an important cue for varroa behaviour (Donzé and Guerin, 1994). 6. Fix the cell to a substrate to avoid rolling and manipulate only occasionally for observations.
Dietemann et al.
16
Pros: high percentage of fertile mites and offspring number close
7. Rinse with PBS buffer for 15 min.
to natural infestations in colonies can be obtained; transparent cells
8. Repeat rinsing twice more.
allow observation of behaviour; in vitro procedure allows complete
9. Verify the colouring of the oocytes under a microscope at
control over the infestation state of the bee since workers do not have
400x magnification.
the opportunity to remove infested brood. Cons: tedious; non-natural infestation; non-natural cell size.
Pros: easier and faster than the alternative histological method. Detects initiation of oogenesis with high resolution.
Perspectives: With the aim of developing a complete rearing
Cons: somewhat tedious; subjective grading of oocyte colour.
method for the mite, Nazzi and Milani (unpublished data) and Dietemann, Zheng and Su (unpublished data) carried out preliminary
3.4.2. Feeding site
trials aiming at obtaining several reproduction cycles in the laboratory, Varroa mothers pierce the cuticle of honey bee larvae and pupae on i.e. artificially breeding mites that were born under laboratory conditions. which they (Fig. 7a) and their offspring feed (Fig. 7b). In late pupae, Attempts were discouraging and continuing efforts are needed.
the wound can be seen under the binocular thanks to the scarring process of the cuticule (Fig. 7c). It can also be located by observation
3.3. Assessing reproduction in the laboratory
of the feeding mites, events that are relatively rare and need an
3.3.1. Assessing fertility
artificial in vitro system to be observed (see section 3.2.2. ‘Breeding
Assessing fertility of mites reproducing in artificial (see section 3.2.
mites in the laboratory’). In most cases, no wound can be seen on
‘Rearing mites in the laboratory’) or natural cells follows the same
larvae or pupae and a staining method is necessary to find it (Fig. 7d).
principle than described for field methods (see section 4.3.1.
The ability to locate the wound might be necessary for behavioural
‘Assessing reproductive success’). A difference is that if transparent
studies of feeding behaviour or reproduction or for secondary disease
cells are used (Donzé and Guérin, 1994; Nazzi and Milani, 1994), one
transmission studies (Kanbar and Engels, 2003). By extension, this
does not need to open the cell to count offspring. Offspring
method can also be used for all cases in which a perforation of the
production and survival can thus be monitored over time.
cuticle of immature honey bees has to be made visible (e.g. injection of pathogens or hormones).
3.3.2. Assessing oogenesis
Kanbar and Engels (2004) designed a vital staining method that
Assessing oogenesis of laboratory reared mites requires dissection of
allows the visualisation of feeding sites. They used Trypan blue, a dye
female mites and tissue dyeing (see the section on marking
that enters damaged cells (Roche, 1999), i.e. cells around the hole
techniques 3.4.1. ‘Oogenesis’).
pierced by mother mites in the late 5th instar larvae, prepupae or pupae cuticule. Feeding sites could thus be stained durably on live
3.4. Marking techniques
individuals and observed over time (Herrmann et al., 2005). Staining
3.4.1. Oogenesis
can be detected until the stage when the cuticule darkens to the point
Activation of the oocyte (i.e. oogenesis) is followed by the
of hiding the dyed blue cells. At this point the dyeing is not any longer
incorporation of euplasmatic material and/or yolk proteins. Marking a
necessary.
whole mount of the mites’ ovaries with toluidine blue is a rapid method to confirm such incorporation and therefore initiation of oogenesis (Garrido et al., 2000).
Staining method: 1. Sample larva, pre-pupae or pupae to be stained from varroa infested cells (see section 3.1. ‘Collecting mites’).
1. Remove ventral shield of the mites with thin dissecting forceps under a binocular microscope.
2. Immerse them for 30 min in a volume of Ringer-based staining medium sufficient to cover the major part of the body
2. Excise ovary together with spermatheca and lyrate organ.
surface.
3. Place in PBS buffer (phosphate buffered saline, pH 7.2–7.4).
The larvae and pupae survive this treatment (Kanbar and
4. Fix in formalin (4%) for 30 min.
Engels, 2003).
5. Wash three times with PBS buffer. 6. Incubate in toluidine blue (0.005%) for 30 min.
3. Rinse in pure Ringer solution for 3 min. Ringer solution: see Table 1 of the BEEBOOK paper on cell
The duration of incubation might need optimization, which can
cultures (Genersch et al., 2013) for a recipe.
be tested on the coloration of activated oocytes approximately
Vital staining medium: 100ml Ringer solution, 0.01 g Trypan
12 h after cell sealing.
blue adjusted to pH 6.8 with KOH (0.1M).
The COLOSS BEEBOOK: varroa
Fig. 7. a. Adult varroa mite sucking haemolymph of a pupa at the feeding site (black dot on top, left from centre).
17
Fig. 7. d. a feeding site (blue dot) on a white pupa after staining with Trypan blue.
Photos: Swiss Bee Research Institute.
3.4.3. Marking mites Varroa mites can be marked with paint markers, enamel paint for models, correction fluid polyester glitter or fluorescent pigment (Schultz, 1984; Harris, 2001; Kirrane et al., 2012). Methods with paint are faster to use and have been shown safer for the mites. Toxicity is mainly due to the solvents incorporated in the products. For paint application, soft tools are preferable to toothpick or other hard tools to avoid injuring the mites. A droplet of paint can be placed on a microscope slide and little quantities collected with a very thin paintbrush or a fishing line (Kirrane et al., 2012) for application on the mite. The hair of a paintbrush can be cut off leaving enough hair to obtain the desired size. The right size of the application tool is
Fig. 7. b. varroa nymph sucking haemolymph of a pupa atthe
obtained when the paint dot is visible, but does not impair the
feeding site (between the nymph's legs).
behaviour of the mite. If the mites are used for behavioural observations during the phoretic or reproductive stage, care should be taken to produce a flat paint mark that enables the mites to push herself between the bees' sternites and feed, or to allow the mite’s free movement within the restricted space between pupae and cell walls. Before use in large scale experiment, a toxicity test should be performed to ensure that the paint chosen is not toxic to the mite: marked and sham-treated mites should be kept in similar conditions and their longevity compared. Marked mites should live as long as unmarked mites. Refer to section 3.2. ‘Rearing mites in the laboratory’ for rearing methods. To minimise the risk of the paint dot coming off the cuticle and thus prevent recognition of the marked mite at the end of the experiment, preliminary tests with different brands should be made to select a long lasting paint.
Fig. 7. c. feeding site with melanisation (arrow). It is visible without staining. Such instances are more frequent in older pupae.
Dietemann et al.
18
3.5. Infecting varroa with secondary diseases
3.6.1.3. Mites to be used in the tests
3.5.1. Microinjection
In chemical ecology studies, the mites that are used in the bioassays
Microinjection techniques specific to varroa have not yet been
should be those involved in the process under study (e.g. if the study
developed. For basic microinjection techniques please refer to the
is about cell invasion, the mites that invade the brood cells are used).
BEEBOOK paper on miscellaneous methods (Human et al., 2013).
In efficacy study of acaricides, the life stage of mites tested must
Campbell et al. (2010) mention various problems when testing such
correspond to that that will be exposed to the product under scrutiny.
methods. The manipulation is laborious, requires specialised equipment and resulted in the death of most mites injected.
In contrast to many other arthropods whose ecology is studied by means of bioassays, no artificial rearing method is currently available for the varroa mite (see section 3.2. ‘Rearing mites in the laboratory’);
3.5.2. Dipping
thus standardisation is a difficult task when it comes to collecting
Dipping mites in a solution containing dsRNA resulted in gene
mites that are homogenous for age, physiological condition, mating
knockdown (Campbell et al., 2010), demonstrating the potential of
status etc. A solution to this problem is to use mites that are at the
this procedure as a way to infect or contaminate mites with micro-
same stage of their life cycle (see section 3.1. ‘Collecting mites’).
organisms or genetic material. This study showed that when proper osmolality of the dipping solution is established, a high number of
3.6.2. Bioassays in varroa chemical ecology
varroa mites (80%) can survive long immersion periods (14 h at 4°C)
Bioassays are a fundamental resource in the study of behaviour
that might be necessary for infection/contamination. To achieve the
modifying chemicals, all the way from the demonstration of their
right osmolality, 0.9% NaCl was used. Dipping methods have rarely
existence, through all steps of isolation, until the final confirmation of
been used for varroa, and optimisation work should be done to
their identity. Some of the bioassays used so far in varroa chemical
improve the survival of the mite after immersion.
ecology were simple adaptations of those already used for the study of arthropod semiochemicals (Baker and Cardé, 1984). In particular,
3.6. Bioassays
the response of the varroa mite towards different odour sources and
The influence of both physical and chemical factors on V. destructor
pure compounds was tested using several general purpose setups,
has been studied by means of different bioassays. So far, bioassays
including four-arms olfactometers (Le Conte et al., 1989), servospheres
have been essential in two fields of varroa research: the study of the
(Rickli et al., 1992), Y-mazes (Kraus, 1993), wind-tunnels (Kuenen
semiochemicals involved in the interactions between the mite and
and Calderone, 2002) and observation arenas (Rickli et al., 1994), in
honey bee and the study of mite resistance towards acaricides.
other cases, bioassays were specifically designed for the varroa mite. In this section, we will concentrate on the latter. The chemical stimuli
3.6.1. Experimental conditions
that influence the behaviour of the mite during the following stages of
The literature on the subject reveals some critical aspects that must
the mite’s biological cycle have been studied by means of bioassays:
be considered when conducting bioassays with varroa, including the
cell invasion, mating, oviposition, phoretic phase.
environment, the chemicals tested and the origin of mites.
3.6.2.1. Cell invasion 3.6.1.1. Environment
In this case, the attention is on the cues influencing the entrance of
The mite spends its life in the hive, under strictly controlled
the mite into the brood cell containing an L5 bee larvae (see the
environmental conditions; in order to get a realistic representation of
section ‘Obtaining brood and adults of known age’ in the BEEBOOK
the reactions of the mite towards a given chemical, this should be tested paper on miscellaneous methods (Human et al., 2013) for a description under the same conditions, that is a temperature around 32-35°C and of larval stages), in the 20-60 hours preceding capping (Rosenkranz a relative humidity around 70%.
et al., 2010). After the first studies with the star olfactometer (see Le Conte et al., 1989), bioassays better adapted to the varroa mite
3.6.1.2. Dosage of chemicals
were used; here a bioassay that appeared to be suitable to test both
In order to avoid any misjudgement about their real effect,
attractants linked to worker cell invasion (Rosenkranz, 1993; Nazzi et al.,
semiochemicals should be tested at doses that are close to their
2001; Nazzi et al., 2004; Aumeier et al., 2002) and repellents involved in
biological range. For example, most chemicals, when tested at too
the avoidance of queen cells (Nazzi et al., 2009) is presented.
high a dose, become repellent. Unfortunately, this aspect has often been overlooked in the study of varroa chemical ecology (for some
3.6.2.1.1. Mites to be used
examples see Milani, 2002). Dose-response studies, where the
What determines the end of the phoretic phase of mites is not known.
biological activity of a given compound is tested at different doses in a Using phoretic mites for this assay is therefore not ideal since the logarithmic scale, are mandatory in current research.
randomly sampled mites might not be 'motivated' to enter cells and
The COLOSS BEEBOOK: varroa
19
respond to the stimulus provided. It is therefore possible to use mites which have recently expressed this behaviour and will repeat it again given the right circumstances. However, several experiments confirm that during the season most of the phoretic mites are willing to reproduce (e.g. Rosenkranz and Bartalszky, 1996; Martin and Cook, 1996; Garrido and Rosenkranz, 2003; Frey et al., in preparation) and might also be used for these kinds of experiments (see section 3.1. ‘Collecting mites’ for a description of how to obtain them).
3.6.2.1.2. Experimental setup This bioassay was described by Nazzi et al. (2001) and represents a modification of the device used by Rosenkranz (1993). 1. Use an arena consisting of a glass plate with four wells (7 mm diameter; 8 mm deep) equidistant (1 cm) from the centre. 2. Mount a glass lid on a circular metal ring (5.6 cm diameter) to confine the mites in the arena. 3. Apply the treatment to two opposite wells while the other two
Fig. 8. Arena used for the bioassays on cell invasion behaviour.
wells are used as controls. 4. Place one bee larva or dummy into each well. 5. Place one adult female mite in the centre of the arena between the four wells with a fine paint brush (Fig. 8). 6. Keep the arenas in a chamber at 34.5°C and 60-70% RH for
studied using artificial brood cells made of different materials (e.g. wax, glass, gelatine) (Milani and Chiesa, 1990; Trouiller and Milani, 1999).
the duration of the bioassay. 7. Note the position of the mites every 5 min for 30 min.
3.6.2.2.1. Mites used in the bioassay
In order to obtain sufficient sample size, twenty arenas are used
To study the factors that affect oogenesis, mites that have not yet
at a time and tests are replicated on different days for several times
been stimulated to start oogenesis must be used. Indeed, if a mite
(typically a minimum of three) using a total of at least 60 mites.
has been in contact with a L5 larva for 0-6 h, oogenesis is initiated (Garrido et al., 2000). Phoretic mites must therefore be used.
3.6.2.1.3. Data analysis
However, not all phoretic mites will initiate reproduction and
A sampled randomization test is used because the distribution of the
oogenesis since they are of various age and physiological status. To
variables to be compared is unknown. Such test is preferred over a
study factors triggering oviposition once mite oogenesis has been
conventional parametric statistics since they often lead to an
activated and completed, mites must be collected at least 24 h after
overestimate of the significance of differences.
capping, but no later than 132 h (after which they stop reproducing,
For each arena, the number of times the mite is observed in the
Nazzi unpublished) and introduced in cells containing a pupa young
treated and control wells, respectively, over the 30 min period are
enough to allow the normal reproductive cycle. See section 3.1.4.2.1.
used as scores for the statistical analysis. This is done regardless of
‘Opening each cell’ for methods to obtain mites from their cells. For
whether the mite had changed wells between observations or just
these studies, the different phases of the mite´s ontogenetic
stayed in the same well. Then, a matrix is constructed with as many
development and the time-dependent course of the gonocycle must
rows as the number of mites used in the bioassay, and two columns
be considered (Steiner et al., 1994).
containing the scores for treated and control wells for each of the tested mites. The treated and control scores in a given set of data are compared by a sampled randomization test (Manly, 1997; Sokal and
3.6.2.2.2. Experimental setup to test the activation of oogenesis
Rohlf, 1995). The randomization distribution should be resampled a
Bioassay to assess the effect of volatile or non-volatile compounds for
6
sufficient number of times (e.g. 10 times).
their effect on oogenesis activation.
3.6.2.2. Oogenesis
3.6.2.2.2.1. In the field
About 70 h after cell sealing, the mite begin egg-laying, which continues at 30 h intervals until 5-7 offspring are produced (Rosenkranz et al., 2010). The cues influencing oviposition were
1. Treat brood cells in colonies with the stimulus under testing or treat mites. Beware of solvent toxicity for bees and mites. 2. Open cells a minimum of 70 h after mite introduction.
Dietemann et al.
20
3. Investigate the presence of eggs in the cells.
3.6.2.3.1. Mites to be used
Opening the cells later (e.g. between 7 and 10 days) will
Mites should be sampled from naturally infested cells at the stage at
facilitate detection of eggs and offspring, but increase the
which the behaviour under scrutiny is expressed (see section 3.1.
chances of removal by hygienic workers.
‘Collecting mites’).
Pros: less time consuming compared to laboratory bioassay (see
3.6.2.3.2. Experimental setup
section 3.6.2.2.2.2.). Many brood cells can be treated under natural
Donzé et al. (1998) used a modification of the bioassay described by
conditions.
Rickli et al. (1994) to study the chemicals inducing arrestment of the
Cons: stimuli cannot be tested independently from other factors (larvae, nurse bee activity).
mite. 1. Use a glass plate cleaned with acetone and pentane. 2. Draw three concentric circles with 12 and 24 and 36 mm
3.6.2.2.2.2. In the laboratory This protocol follows Garrido and Rosenkranz (2004) to test the effect of volatiles on activation of oogenesis: 1. Offer volatile compounds on a piece of filter paper placed in a 0.2 ml PCR tube.
diameter on the underside of the glass (Fig. 9). 3. Apply the compound tested on top of the glass plate on the ring delimited by the 12 and 24 mm circles. 4. Place a mite in the centre of the circles (mites not reaching the treated area within 300 s are not considered).
2. Add a female mite in the tube.
5. Observe the mite’s walking activity.
3. Prevent the mite reaching the filter paper with a plastic gauze.
6. Note the time spent in the treated area.
4. Remove the mites eight hours after the exposure to the putative triggering factor. 5. Dissect the reproductive tract of mites. 6. Dye the reproductive tract to determine the development
This time is used as a measure of the arrestment activity of the stimulus under testing. 7. Stop the assay when the mite crosses the outer 36 mm circle, or after 300 s.
stage of the terminal oocytes (see marking techniques section 3.4.1. ‘Oogenesis’).
3.6.2.3.3. Data analysis In order to check for significant differences between treatments and
Pros: test of single stimulus possible.
controls, the times spent inside the area treated with different stimuli
Cons: time consuming. Due to the lack of nutrition of the mite the are compared using the non-parametric tests of Mann–Whitney and test can only be performed for about 8 h.
Friedman (for simple and repeated experiments, respectively). Due to some unbalanced replications, a generalization of the Friedman test is
3.6.2.2.3. Experimental setup to test oviposition
used (Del Fabbro and Nazzi, 2008).
1. Treat the cell or the mite with the compound under testing. Beware of solvent toxicity for bees and mites. 2. Transfer the mites into cells containing a host at an early
3.6.2.4. Phoretic phase After emerging from the brood cell the varroa mite enters the phoretic
enough developmental stage, which allows reproduction by
phase, that is spent on adult bees and lasts until a new brood cell is
the mite to proceed normally.
invaded for reproducing. Bioassays have been used by several authors
3. Monitor reproduction after a given interval of time.
to work on the chemical cues affecting the mite on the adult bees.
When fecundity measurement is needed, the cell should be opened one day before emergence. This period can be shorter if only fertility (i.e. answering the reproduction yes or no) is of interest, but it must be passed 70 h after capping (Table 2).
3.6.2.3. Orientation inside the sealed cell Careful observations of the behaviour of the mite inside the brood cell carried out by Donzé and Guérin (1994) revealed a well-structured spatial and time allocation of its activity. The chemicals involved in this crucial stage of the mite’s life cycle were studied mostly using bioassays based on observation arenas (Donzé et al., 1998; Calderone and Lin, 2001).
Fig. 9. Test arena for arrestment bioassays.
The COLOSS BEEBOOK: varroa
21
Table 2. Minimal time after capping for which various mite reproduction parameters can be accurately measured. Adapted from Martin, 1994 and 1995a. *see Fig. 16 for a physogastric mite. In comparison, the segments of a non-physogastric mite appear connected and not separated by white borders (intersegmental membrane). Mite reproduction classification
Time from cell capping (hours)
Comments
abnormal
> 60
after first egg should have been laid
abnormal with only single male
> 140
after second egg should have hatched
30-50
if mother mite non-physogastric*
> 70
absence of eggs
mite dead trapped in cell wall
> 30
after cocoon spinning by larva is complete
mite dead in cell
>0
at any time
non-reproducing
Kraus (1994) used a simple two-choice bioassay to test several
7. Test 10 mites in different Petri dishes simultaneously and
chemicals for their effect on the mite as a screening procedure to
replicate 6 times.
identify possible substances to be used in biological control methods.
Alternate side of treated and control bees for each replicate to
He and others used laboratory bioassays to investigate the stimuli
control for the influence of external factors on mite
affecting the host choice by the mite (Hoppe and Ritter, 1988; Kraus,
locomotion.
1990, 1994; Del Piccolo et al., 2010). These bioassays are all based on the same kind of setup. Here the bioassay described by Del Piccolo 3.6.2.4.3. Data analysis
et al. (2010), that was used to study the preference of the varroa
For each Petri dish, a score is calculated summing the number of
mite for pollen and nurse bees, is presented.
mites that were found on the bees during the six observations. This figure can vary between 0 and 6 and is representative of the time the
3.6.2.4.1. Mites to be used
varroa mite spends on the bees. The score can thus be considered as
Mites are sampled with the host that carries them. Mites are
a measure of the preference of the mite for the stimulus under
separated from their host bee by means of a mouth aspirator or a
testing. Data from all the replicates are organized in a matrix with as
paintbrush. Collection of mites with sugar powder method is not
many rows as the number of mites used in the bioassay, and 2 columns
recommended given the possible effects of the sugar on mite vitality
containing the scores of the 2 stimuli to be compared. As the variables
(see section 3.1. ‘Collecting mites’).
under study have an unknown distribution, the scores of different stimuli in a data set are compared by a sample randomization test
3.6.2.4.2. Experimental setup 1. Clean a small glass Petri dish (60 mm diameter) with acetone and hexane or pentane. 2. Place 2 dead adult bees at 2 diametrically opposite sides of the Petri dish, close to the walls (Fig. 10). 3. Treat one bee with the substance tested, treat the other (control) bee with the solvent used to transfer the tested
(Sokal and Rohlf, 1995; Manly, 1997). The randomization distribution should be re-sampled a sufficient number of time (e.g. 106 times). Active chemicals identified by means of laboratory bioassays can be tested in the field. For methodologies see section 4.5.4. ‘Testing varroacides in the field’. This guideline describes the testing of acaricidal effects; however, it can also be used when using substances that do not kill mites, but disturb their orientation and reproduction.
substance on the first bee. Use a volume of solvent as small as possible to avoid perturbing the layer of cuticular hydrocarbons. In case of a removal / restoration bioassay the bees' cuticle need be washed with a solvent to remove the hydrocarbons before the tested profile is applied. 4. Place the Petri dishes in a thermostatic cabinet, in darkness, at 34.5°C and 60-70% RH. 5. Place one adult female mite in the centre of the Petri dish. 6. Note mite position every 10 min for 60 min. Three positions are considered: mite on the treated bee, mite on the control bee, mite not on bees.
Fig. 10. Test arena for phoretic mite attraction cues.
Dietemann et al.
22
Fig. 11. Ventral and dorsal views of developmental stages of Varroa destructor females (above) and males (below) on A. mellifera brood. Approximate developmental time is given above the horizontal lines of different thicknesses which delimit the stages. Solid lines denote mobile phases, dashed lines immobile phases prior moulting (after Donzé et al., 1994). Immobile and mobile phases can only be distinguished in live material, not in frozen samples.
Photos: R Nannelli and S J Martin
The effect expected is not mite death, but a reduction in mite
3.6.2.5.1. Mites used in the bioassay
population size in the colony which can also be detected with this
Adult males and all other relevant mite stages for the mating bioassay
method.
can be found in worker brood cells 8-9 days after cell capping. See section 3.1.4.2.1. ‘Opening each cell’ for the description of how to
3.6.2.5. Mating bioassays
collect mites from cells. Females shortly after the adult moult should
This bioassay allows the observation and analysis of the mating
be used for the general observation of the mating behaviour and
behaviour of mites under laboratory conditions and is also suitable for
disturbance experiments. Deutonymphs (Fig. 11) are not attractive for
testing substances which might stimulate or disturb the mating
males and can be used as “dummies” when stimulating cues are
behaviour.
tested.
The COLOSS BEEBOOK: varroa
23
Fig. 12. Development chart of varroa mites and their honey bee host, A. mellifera. The mites should be separated according to sex (see section 4.3.3.
6. Cover with a glass plate to prevent mites from escaping.
‘How to measure reproductive success’ and Figs 11 and 12) and kept
7. Record the male responses with e.g. the Observer software
in groups of maximum 5 individuals at 28-30°C in order to avoid unwanted copulations and a decrease of fitness.
(Noldus Information Technology) for 5 or 10 minutes. 8. Categorise male responses as follows: 1. movement around female; 2. mounting the female’s dorsum; and 3. copulation
3.6.2.5.2. Experimental setup
attempt on the female’s venter.
This bioassay is described by Ziegelmann et al. (2012). 1. Queen cell cups (e.g. Nicot system®) can be used as test arena.
3.6.3. Bioassays to quantify the susceptibility of the varroa mite to acaricides
It is recommended to embed the cell cups in a glass Petri dish Acaricide resistance represents a dramatic problem for apiculture and with wax. 2. Ensure a temperature of 28-30°C in the cell cup by placing the setup on a hotplate. 3. Transfer the relevant mite stages into the cell cup.
has been related to widespread losses of bee colonies. To reduce the impact of such losses, a prompt detection of resistant varroa population is vital and reliable methods for testing the susceptibility of the varroa mite to different acaricides are a fundamental resource,
When extracts or single substances are tested, follow steps 4
notwithstanding the possible use in basic research on the mode of
and 5, if only behaviour is observed, go to 6.
action of pesticides (Milani, 1999). There is also a need to discover
4. Apply volatile test substances to a piece of filter paper (size: 1.5 mm x 15 mm). 5. Place volatile substances in the vicinity of the female; apply
new varroacidal substances. For both purposes a simple and fast bioassay is necessary. A convenient bioassay was devised by Milani (1995) for the study of acaricides that are active by contact (i.e. the
non-volatile substances directly to the female mite.
active ingredient contaminates the cuticle of the bees and is taken up
For the application of test substance, chose a solvent which
by the mite by indirect contact). This is the case of most acaricides
does not harm or repel the female.
used currently (e.g. pyrethroids and some organic acids). The bioassay
Dietemann et al.
24
described has been used to test the activity of several acaricides
2. Apply the product to be tested and the control solution on the
including tau-fluvalinate, flumethrin (Milani, 1995), perizin and Cekafix
arena pieces.
(Milani and Della Vedova, 1996), oxalic and citric acids (Milani, 2001),
Various concentrations of the products are tested. See the
as well as for the study of reversion of resistance (Milani and Della
BEEBOOK paper on methods for toxicological studies
Vedova, 2002). Other acaricides that are widely used for the control
(Medrzycki et al., 2013) to define these concentrations.
of the varroa mite are air-borne and the bioassay above is not
The application of the active ingredient on the arena pieces
suitable. For these cases a new bioassay developed by the honey bee laboratory of the University of Udine is presented in section 3.6.3.3.
varies according to its physico-chemical properties. 2.1. For water soluble active ingredients (polar compound): 2.1.1. Mix the active ingredient with a convenient solvent.
3.6.3.1. Mites used in susceptibility bioassays
2.1.2. Spray the glass disks and ring with a solution of the
For this assay, mites that would be exposed to the product in colonies
compound as evenly as possible.
in the apiaries should be used. Some products affect only phoretic
This can be done by means of a “Potter precision spray
mites, others also affect mites in brood cells. Adult mites at the
tower” (e.g. Burkard Manufacturing Co; UK) (Milani, 2001).
reproductive stage might have different susceptibility compared to
To do so, the reservoir is loaded with 1 ml of solution; the
phoretic mites or to their offspring because their cuticle is not hardened
distance of the sprayed surface from the bottom end of the
or because of physiological differences. Milani (1995) and Milani and
tube is set at 11 mm and a nozzle 0.0275 inches is used.
Della Vedova (1996) tested compounds only affecting phoretic mites, but
The pressure is adjusted (usually in the range 350–500 hPa)
showed that mortality was more homogeneous in mites collected from
until the amount of solution deposited is 1 ± 0.05 mg/cm2.
the brood. This might be due to a more homogeneous physiological
Alternatively, if such piece of equipment is not available a
status compared to phoretic mites. It is therefore recommended to test
glass Petri dish can be used as arena. The solution (active
all life stages to obtain a complete picture of mite susceptibility.
ingredient in a solvent of low boiling point) is poured in the
When brood mites are tested, they are collected from combs (or
dish so as to cover the whole bottom of the dish and left to
pieces of comb) of infested colonies after opening and inspection of
evaporate under a fume hood. Depending on the surface
capped cells. Mites parasitizing brood of different developmental stage
tension of the active ingredient, this will result in an uniform
have different susceptibilities to acaricides (Milani and Della Vedova,
layer of substance at the bottom of the dish. Varroa mites
1996). For the tests, they are therefore grouped according to the age
can thus be exposed to the substance in the Petri dish. This
of their brood host and assayed separately. The age of larvae or pupae
method cannot be used when the surface tension of the
inhabiting these cells can be pre-determined by marking at the capping
ingredient is too high and droplets are formed on the Petri
stage and opening it at a given time. Alternatively, the approximate
dish.
age of the brood can be inferred on the basis of the morphology and pigmentation of the larva or the pupa (see section ‘Obtaining brood and adults of known age’ in the BEEBOOK paper on miscellaneous methods (Human et al., 2013)). Varroa mites from different brood stages can be pooled if previous results indicate no differences among development stages (Milani, 1995). Differences between mite developmental stages might also influence their susceptibility to active ingredients, independently of host development, but this has not been shown yet. Mites are kept on their host larva or pupa in glass Petri dishes
2.2. For lipid soluble (apolar compound) active ingredients: 2.2.1. Melt 10 g of paraffin wax (e.g. Merck 7151, melting point 46-48°C) in a glass container kept in a water bath at 60°C. 2.2.2. Dissolve the required amount of the active ingredient in a convenient solvent (e.g. hexane or acetone). 2.2.3. Add this solution to the melted wax. The solvent alone is added to the control wax. 2.2.4. Weigh glass disks and iron rings before coating it with the wax.
until a sufficient number is collected. This ensures they can feed if
2.2.5. Stir the mixture for 30 min.
hungry and the availability of their own host ensures that their
2.2.6. Immerse the steel rings in the molten paraffin wax,
physiological status is not changed. Since mites might stray from their
one side of the glass disks is coated by lowering the
host larva or pupa and climb onto another, only hosts at the same
disks onto the molten paraffin.
development stage should be kept in any given dish.
2.2.7. Weigh glass disks and iron rings after coating. Discard the arenas (ring + glass circles) with a total
3.6.3.2. Bioassays for contact substances 1. A stainless steel ring (56 mm inner diameter, 2–3 mm height) and 2 glass circles (62 mm diameter; Na-Ca glass) are cleaned with acetone and hexane or pentane to form the testing arena.
amount of coating outside the range 1.6-2.0 g. 2.2.8. Keep the arena pieces for at least 24 h at room temperature to allow for the solvent to evaporate. 2.2.9. Store at 32.5°C until they are used.
The COLOSS BEEBOOK: varroa
3. Place the ring between the glass circles so as to build a cage.
25
and keep different groups inside the closed container for 0,
The cages are used within 60 h of preparation, for not more
15, 30, 45, 90, 135 min at room temperature.
than three assays.
Mites of the same origin as for the bioassay for susceptibility
4. Introduce 10 to 15 varroa mites in this cage and bind the pieces together with droplets of melted wax. Mites collected from spinning larvae, stretched larvae, white eyed pupae and dark eyed with white and pale body are used.
to contact substances are used (see section 3.6.3.2. ‘Bioassays for contact substances’). 5. After each interval, transfer the group into small Petri dishes (diameter = 6 cm) with one bee larva for every five mites.
See the section ‘Obtaining brood and adults of known age’
6. Place in an incubator at 34.5°C and 60-70% RH.
estimating pupa age of the BEEBOOK paper on miscellaneous
7. Monitor mite survival at 48 hours.
methods (Human et al., 2013) for determining the age of pupae. 5. After 4 h transfer mites into a clean glass Petri dish (60 mm
3.6.3.4. Data analysis The data are analysed using the probit transformation. The natural
diameter) with two or three worker larvae taken from cells
mortality rate is taken into account using the iterative approach,
0–24 h after capping (obtained as described in section 3.1.4.
according to Finney (1949). The concentrations which kill a given
‘Collecting mites from the brood’) or with two or three white
proportion of mites and their fiducial limits are computed according to
eye pupae (4-5 days after capping).
Finney (1971). Refer to the BEEBOOK paper on toxicological methods
6. Observe the mites under a dissecting microscope, 4 (i.e. at
(Medrzycki et al., 2013) for these calculations.
the time of transfer into the Petri dish), 24 and 48 h after the beginning of the treatment and classify as: 6.1. Mobile: they walk around when on their legs, nonstimulated or after stimulation. 6.2. Paralysed: they move one or more appendages, non-
4. Field methods 4.1. Diagnostic techniques
stimulated or after stimulation, but they cannot move
The OIE manual describes three methods to diagnose the presence of
around.
varroa mites in colonies (OIE Terrestrial Manual 2008). Debris, adult
6.3. Dead: immobile and do not react to 3 subsequent
and brood examination are reported here.
stimulations. A clean tooth pick or needle can be used to stimulate the
4.1.1. Debris examination
mites by touching their legs. New tooth picks or cleaned
Hives must be equipped with a bottom board on which debris are
needles should be used for stimulating control groups to avoid collected. The board must be protected by a mesh to prevent bees their contamination with residues of active ingredients from
from discarding the dead mites. The mesh size should allow the mites
treated mites.
to fall through. To increase probability to detect mites, colonies can
The assays are carried out at 32.5°C and 60-70% RH. If the
be treated with a varroacide. After a few days, dead mites can be
mortality in the controls exceeds 30%, the replicate is excluded. Each
observed on the boards. In case a large quantity debris prevents easy
experiment is replicated with a sufficient number of series of cages.
detection of mites, debris can be cleaned from the varroa board and
To determine the sample size, refer to the BEEBOOK paper on
examined using a flotation procedure:
methods for toxicological studies (Medrzycki et al., 2013) and the
1. Dry debris for 24 h.
BEEBOOK paper on statistics (Pirk et al., 2013). If mites are scarce,
2. Flood with industrial grade alcohol.
more replications are carried out and more mites are assayed at doses
3. Stir continuously for 1 minute or up to 10-20 min if
around the median lethal density, to increase statistical resolution in this region.
debris contain wax or propolis particles. 4. Investigate the surface of the alcohol for the presence of mites.
3.6.3.3. Bioassays for volatile substances 1. Dissolve the active ingredient (e.g. thymol) in a suitable solvent (e.g. diethyl ether) at the concentration 0.5 g/ml. 2. Treat a circular area (diameter = 6 cm) of the inner side of
4.1.2. Brood examination Since varroa mites prefer drone brood, the probability to detect them on male pupae is higher than on worker brood. However, in absence
the lid of a glass Petri dish (diameter = 14 cm) with 250 µl of
of drone brood worker brood is used. When a large number of
the solution.
samples are examined, a rough determination of the degree of
3. Let the solvent evaporate. 4. Place 10 to 15 varroa mites on the bottom of the Petri dish
infection can be obtained. 1. Remove the cappings of the brood cells with a knife or fork.
Dietemann et al.
26
2. Flush the pupae out of the combs with a stream of warm water over a sieve (mesh width 2–3 mm).
results (Branco et al., 2006). For the adult infestation rate estimate, the sample size in relation to the level of precision required by the
3. Collect the mites in a second sieve (mesh width 1 mm) placed experimenter has been determined by Lee et al. (2010a). Their study below the first. 4. Examine the contents of the second sieve on a bright plate, where the mites can be easily identified and counted.
provides methods with different workloads permitting to achieve several levels of precision. We present here the method with optimal time and effort investment ratio that is necessary to reach the precision necessary to researchers. Since researchers are mostly interested in
When a smaller number of samples are examined,
the infestation rates of particular colonies rather than of whole apiaries,
1. Open individual cells.
we do not describe the latter method here, but refer to Lee et al.
2. Remove larva, pre-pupa or pupa.
(2010a) for the number of colonies to sample from in order to obtain
3. Examine cell walls using an appropriate source of light.
a representative figure at apiary level.
4. Identify infected cells by the presence of small white spots – the faeces of the mite (Fig. 3).
The methods based on mite fall or on evaluating infestation rates from adult or brood samples are only reliable for colonies with
5. Confirm the presence of the mites themselves in the cell or on medium to high infestation rate. The methods show imprecision when the brood.
colonies have less than 3,000 brood cells, when the brood infestation rate is < 2% (unless very large samples are taken, see the BEEBOOK
4.1.3. Bee examination 1. Collect 200–250 bees from both sides of at least 3 unsealed brood combs.
paper on statistics (Pirk et al., 2013)) or when the colony is collapsing (due to decreased amount of brood) (Branco et al., 2006; Lee et al., 2010a). In these cases, the acaricide treatment can be used. Using
2. Kill the bees in a container filled with alcohol.
synthetic acaricides to estimate parasite population size in the host is
3. Stir the container for 10 min.
reliable provided a product with high efficiency (> 95%, taking
4. Separate the bees from the mites by pouring the alcohol over
possible resistance by the mite into account) is used. However, it is
a sieve with a mesh size of approximately 2–3 mm.
destructive and can only be used for a quantification /diagnostic purpose. The mites being killed by the treatment and the hive being
4.2. Measuring colony infestation rate
contaminated with acaricide residues, the treated colony cannot be
Three methods to estimate colony infestation have been designed
used as source or host of mites.
(Ritter, 1981; De Jong et al., 1982b). Acaricides can be used to kill all mites in a colony. Mites will fall to the bottom of the hive and can be
4.2.1. Acaricide treatment
counted (Branco et al., 2006). Without the use of acaricides, the
Use an effective acaricide > 95% product as per manufacturer
natural mortality can be quantified from the bottom of the hive to
recommendation. Beware of resistance of mites to this product, see
determine the population size of the live mites. Alternatively, the
section '3.6.3. Bioassays to quantify the susceptibility of the varroa
infestation rates of adults and brood can be estimated from adult and
mite to acaricides ' for methods on how to test mite susceptibility to
brood samples. When the first two methods are used, ants must be
acaricides.
prevented access to bottom boards. Their scavenging habit will result
1. A protected bottom board should be used to prevent bees
in the disappearance of dead mites before they can be counted and
removing the fallen mites.
will thus bias the results (Dainat et al., 2011). Such a protection can
The protection is typically a wire screen with 3-4 mm holes
be obtained by preventing access to the whole hive or to the bottom
covering the whole surface of the board, leaving no access for
board. Hive protection can be achieved by using a stand with feet smeared with grease or resting in containers containing a liquid over which ants cannot walk (water or oil). Here it is important to regularly verify that dirt does not accumulate in the container or on the grease, allowing ants to reach the hive. Blades of grass can also form bridges
bees to the fallen mites. 2. Ant protection should be put in place to prevent their access to the hives and predation on fallen mites and therefore biasing the number of mites counted. 3. Given the rapid action of efficient acaricides and to ease
and should be cut in the surrounding of the hives. Alternatively, the
counting, mite fall should be assessed daily.
varroa board itself can be protected against ants. This is achieved by
See sections 4.2.4. ‘Natural mite fall’ and 4.2.5. ‘Sub-sampling
covering the board with sticky material (e.g. Vaseline, glue, absorbent
mites’, to count mites on a bottom board.
paper impregnated with vegetable oil). Such ‘sticky boards’ can be purchased or homemade. All three methods (using acaricides, monitoring natural mite fall and assessing infestation levels) were found to provide comparable
If the active ingredient used is persistent enough (i.e. the treatment still in place or if residues persist in the hive) and do not penetrate in the cell through the capping (e.g. most synthetic acaricides), the mites that entered cells just before the treatment
The COLOSS BEEBOOK: varroa
27
become exposed upon their emergence with their bee host and die
4.2.3. Measuring the infestation rate of brood and adult bees
within a few days. Mite fall should thus be counted for 3 weeks, this
4.2.3.1. Infestation rates of adult bees
period covering the development times of pupae and the time
4.2.3.1.1. Sampling
necessary for mite fall to decrease to pre-treatment levels. The same
Material: a rectangular graduated container in which 300 bees fit.
counting period should be covered if a non-persistent acaricide is used Three hundred bees occupy a volume of 100 ml water. Fill this volume that also kills mites in the cells (e.g. formic acid). Indeed, mites dead
of water in a container and mark a line at the water surface (Lee et al.,
in the cells will only be released and fall on the bottom board to be
2010b, www.beelab.umn.edu). Given that bee sizes change with race,
counted upon emergence of their host bee. In case the product is not
this volume should be verified and adapted for the particular bee
persistent and does not affect mites in cell (e.g. oxalic acid), colonies
under scrutiny.
without capped brood must be treated. Absence of capped brood can be obtained by caging the queen 22 days before the planned
1. Hold the frame at approximately 10 degrees from the vertical.
treatment. All mites being in the phoretic phase, mites should fall for
2. On the upwards facing side, slide the graduated container
a shorter period (since none are trapped in cells). Mite fall count can
downwards on the back of the bees so that they tumble in it,
therefore stop when it decreased to pre-treatment levels.
making sure the queen is not one of them.
Pros: efficient, relatively low workload. Cons: slow, dead mites, and in case of use of persistent acaricides, contaminated colonies cannot be used further; in case of queen caging, the development of varroa population before treatment can be slightly affected by the interruption of brood rearing.
3. Rap the cup on a hard surface to be sure the bees are at the marked line; add or subtract bees as needed. 4. Collect 3 x 300 workers from any three frames in the first brood box. Sampling such a large number of bees takes into account variations among frames to obtain an average infestation rate, and
4.2.2. Whole colony estimate
does not damage the colony if a non-destructive method is used to
This method requires killing the whole colony. This is necessary when
loosen the mites from the bees (see section 4.2.3.1.2.1. ‘Powdered
the real infestation rate of a colony is needed. Indeed, the use of
sugar’). Strong colonies (> 10,000 bees) are not dramatically affected
acaricides is under these circumstances not appropriate since their
by the removal of this amount of bees and will quickly recover.
efficiency is not 100%.
However, for analysing varroa population dynamics throughout the
1. When all foragers are in the colony (early in the morning, late
whole season with frequent and distructive sampling of bees (e.g. at
in the evening or at night) close the hive so that no bees can
3-week intervals), lower numbers of individuals (300 bees per sampling
escape.
date) should be used.
2. Place the whole colony in a freezer. Depending on nutritional status and size, colony survival in a
4.2.3.1.2. Dislodging mites from bees:
freezer will vary. To determine when the colony died, workers
There are several ways to dislodge the mites from the bees. Some
from the centre of the cluster can be sampled and left to
were already presented in section 3.1., but not all of them are
thaw. If they do not wake up, the whole colony can be
adapted to estimating the infestation rate of the colony. Indeed, these
considered dead and used for mite counts. In case the colony
methods must be standardised and deliver repeatable results.
is of large size, gazing with CO2 is required before freezing. This will prevent the bees thermoregulation and entering in
4.2.3.1.2.1. Powdered sugar
the cells. Thermoregulation extends the duration needed to
After step five of section 3.1.2. describing how to dislodge mites from
kill the colony and if bees get into the cells, they will be more
honey bees kept in a jar, perform the following steps:
difficult to collect for mite counting. 3. Refer to section 4.2.3. ‘Measuring the infestation rate of brood and adult bees’ for phoretic and brood infestation rate measurement.
6. Count the mites fallen out of the jar (e.g. 43). 7. Count the number of bees in the sample washed (e.g. 310) 8. Divide the number of mites counted by the number of bees in the sample (310) and multiply by 100 to determine the number of mites per 100 bees (e.g. (43/310)x100 = 14.3
If a measurement of total infestation rate is needed in summer,
mites per 100 bees).
the colony can be made broodless by caging the queen for three weeks. When all the brood runs out (after 21 days if only worker brood was present or 24 days if drone brood was present), all mites have
Pros: practical, low cost, non-destructive (the bees can be reintroduced in the colony and will be cleaned by their nestmates),
become phoretic. There is then no need to look for mites in the brood. environmentally friendly. Pros: provides the exact total number of mites in a colony. Cons: destructive, high workload, tedious.
Dietemann et al.
28
4.2.3.1.2.2. Ether wash: This method is modified from Ellis et al. (1988).
Pros: water based method: low environmental impact, low cost. Cons: not practical on remote apiaries (large amount of water for
Material needed: a jar with a screen raised 2-3 cm above the bottom,
rinsing and heat source needed); alcohol based: expensive,
automotive starter fluid
environmentally unfriendly.
1. Spray the jar for two seconds with starter fluid to kill bees and
None of these three methods is distinctly superior to the other
mites.
and they can all be considered as reliable given that mite separation is
Dying bees regurgitate consumed nectar or honey that will
done in a standardised manner (water always at the same temperature,
make the wall of the jar sticky.
or containing a standardized amount of soap etc.) and that the
2. Shake the jar for 1 min to dislodge the mites from the bees.
efficiency of the method is determined as described below.
3. Lay the jar sideways and roll three times completely along its vertical axis.
4.2.3.1.2.4. Assessing the efficiency of dislodging method
4. Count the mites stuck to the sides of the jar.
It is important to dislodge mites in all samples in a standardized
5. Count the number of bees in the sample washed.
manner so as to being able to compare the infestation rates measured
6. Divide the number of mites counted by the number of bees in
between samples. When comparisons of infestation rates between
the sample to determine the proportion of infested individuals. samples are aimed at, calculation of washing efficiency is not needed. 7. Multiply by 100 to obtain the number of mites per 100 bees. Caution: ether is highly flammable!
In contrast, when the absolute number of mites is important, the efficiency of the washing method should be assessed to correct the figure obtained for errors. In addition, it is necessary to obtain
Pros: fast, low workload.
absolute numbers in order to compare the figures obtained with other
Cons: environmentally unfriendly, expensive, destructive,
studies and therefore calculating efficiency in all cases is
dangerous.
recommended. 1. Perform additional washes (with same or other solvent) until
4.2.3.1.2.3. Warm/soapy water or ethanol (75%): This method follows the protocol by Fries et al. (1991a). Since mites do not have to be collected alive as allows the method described in section 3.1. ‘Collecting mites’, soap can be added to
no more mites are found (optional). 2. Check bees manually for the presence of mites after the wash(es) or sugar treatment. 3. Add mites found after repeated washes and/or manually (e.g. 1)
water or ethanol can be used to improve the efficiency of mite
to those of the first wash/sugar treatment to obtain the total
dislodging.
number of mites in the sample (e.g.10). 4. Divide number of mites of the first wash/sugar treatment by
1. Warm/soapy water or ethanol is added to jars to cover the 300 honey bees. 2. The jars are shaken for 20 s to dislodge the mites from the adult honey bees. 3. The content of the jar is poured over a first sieve (aperture: 3-4 mm) to collect all the bees. 4. Check the jar for mites sticking to the sides.
the total number of mites to obtain the method efficiency (10/11 = 0.91). 5. Repeat with 5-10 samples to obtain an average efficiency (e.g. 0.9). 6. Divide the number of mites obtained in samples of interest (X) by the average efficiency to obtain the corrected figure (Y) (Y = X/0.9).
5. Place a second sieve (aperture < 0.5 mm) underneath the first to collect the mites. 6. Flush the bees and mites with large amounts of warm water.
4.2.3.2. Infestation rates of brood 1. Cut out 200 randomly selected capped cells from a brood frame.
Strength of the water stream or volume of water used for
Sampling cells from several frames will account for the
rinsing as well as duration of rinsing should be standardised.
spatially irregular infestation by varroa.
7. Count the mites remaining on the second sieve (e.g. 13).
2. Open each cell and examine it for mite infestation.
8. Count the bees in the sample washed (e.g. 303).
Mite infestation can be diagnosed by observation of mites
9. Divide the number of mites counted by the number of bees in
themselves or of their dejection (white rubbery material
the sample to determine the proportion of infested individuals (13/303 = 0.043). 10. Multiply by 100 to obtain number of mites per 100 bees (4.3).
located most of the times on the two upper walls, towards the bottom of the cell, Fig. 3). 3. Count the total number of cells opened.
The COLOSS BEEBOOK: varroa
29
4. Count infested cells. 5. Divide the number of infested cells (e.g. 15) by the total number of opened cells (e.g. 212) to obtain the proportion of mite infested cells (0.071). 6. Multiply this figure by 100 to obtain the brood mite infestation rate in mites per 100 cells (7.1). Depending on the question addressed, more detailed observation of cell infestation can be done (see section 4.3.3. ‘How to measure reproductive success’)
4.2.3.3. Evaluation of total mite population size in the colony From the infestation rate of adult bees or from that of brood, it is possible to calculate the infestation rate of the whole colony (Martin, 1998). However, it is more accurate to assess both parameters based
Fig. 13. A guide is placed above the varroa bottom sheet to help guide the eye when counting and thus avoid double counts. Photo: Swiss Bee Research Centre
on samples and revert to the total for the colony after estimating the amount of adults and brood. 1. Measure colony strength (see the BEEBOOK paper on estimating colony strength by Delaplane et al. (2013)) on the
emerging infested brood (Lobb and Martin, 1997), but it is in general considered as a good indicator of colony infestation (see Branco et al.,
same dates as sampling for determining mite infestation rates, 2006). so as to accurately calculate the total colony infestation rate (Fries et al., 1991b).
Material needed: screened floor board, guide or sheet with checked pattern see 4.2.5. ‘Sub-sampling mites to count on a bottom
2. Multiply the total number of bees in the colony (e.g. 9,356) by board’. Note: make sure the hives are inaccessible to ants or use a the proportion of infested workers in the sample investigated
sticky board.
(e.g. 0.107) to obtain the size of the varroa population in the
1. Pull the bottom board from underneath the colony.
phoretic phase in the colony (1,001).
2. When using non-sticky boards, shelter from the wind to count.
3. Multiply the total number of sealed brood cells in the colony
3. Place a guide above the board to avoid counting the same
(e.g. 12,035) by the proportion of infested cells in the sample
mites (Fig. 13) or count mites from the selected squares on a
investigated (0.071) to obtain the size of the varroa
checkered board (see section 4.2.5. ‘Sub-sampling mites to
population in the reproductive phase in the colony (855).
count on a bottom board’).
4. Add adult and brood infestation numbers to obtain mite population size in the colony (1,001 + 855 = 1,856). With this information, the mite distribution between the phoretic
4. If dead bees are present on the board, check them as they act as magnets to fallen live mites. 5. Adapt counting frequency to mite fall rate since many mites
and reproductive phases can be determined as the proportion of
on the board are difficult to count and since increasing
either mites on adults, or mites in brood, in relation to the total mite
amount of debris accumulating over time makes counting
population within the colony (in our example 54 and 46% respectively).
difficult.
Mite distribution patterns can be used to determine the effect of
If frequency of visit cannot be increased and high mite
brood attractiveness on varroa for example.
numbers must be counted, use the checkered board method (see section 4.2.5. ‘Subsampling mites to count on a bottom
4.2.4. Natural mite fall This method is based on the quantification of naturally dead mites.
board’). 6. Collect data for 2 weeks, average the figure to obtain mean
Counting can be exhaustive (more accurate when done with a guide,
weekly mite fall.
Fig. 13) when mite fall is low to medium or can be sub-sampled
This period covers natural variation in mite fall due to
(using a checked pattern board; see section 4.2.5. ‘Subsampling mites
population dynamics cycles within the host.
to count on a bottom board’) when mite fall is high. In both cases, a
7. Calculate the total colony infestation rate from the weekly
formula needs to be applied to calculate the total infestation rate of
mite fall by multiplying the daily mite drop by 250–500 or 20-40
the colony. Various studies gave contradictory conclusions regarding
when brood is absent or present, respectively (Martin, 1998).
the accuracy of the natural fall method to determine total infestation
These correction factors are valid for central European
rate since natural mite fall is largely determined by the amount of
conditions.
Dietemann et al.
30
Pros: non-destructive/non-invasive, fast, no need to open the hive depending on design; reliable for non-collapsing colonies with brood; this is a method providing relative quantification that can be used for comparison between colonies within an experiment, not across studies. Cons: sometimes unreliable, death rate may vary according to colony status, season, bee race, climate (regional variations possible), amount of brood; little is known on the influence of these factors on mite death; specific equipment necessary. 4.2.5. Sub-sampling mites to count on a bottom board This method is useful when a high number of mites have to be counted on the board. However, it provides reliable counts for all mite densities on the board. If more than 1,000 mites are present, it is
Fig. 14. The ventral side of a physogastric varroa mite. The intersegmental
sufficient to count 22% of the cells to obtain a highly reliable figure
membranes are stretched due to the presence of oocytes in the mite’s
(Ostiguy and Sammataro, 2000).
reproductive tract, which becomes partially visible.
Material needed: a grid with 2 cm cells printed onto a floor board
Photo: Eva Frey
or sheet fitting the size of the board. Note: make sure the hives are inaccessible to ants or use a sticky board. 1. Cells are grouped into blocks of nine.
females each mother mite contributes to the population. Fecundity
2. Three cells per block are randomly selected and greyed (10%
does not necessarily contribute to the mite’s ability to reproduce
shade) to indicate the cells in which mites are to be counted.
successfully. Instead, it represents only the number of eggs laid
3. The number of mites in the shaded squares are counted.
without accounting for the age of the offspring or the likelihood of
4. The total number of mites is then divided by the number of
them reaching maturity. Therefore, fecundity may not be independent
cells counted and multiplied by the total number of cells on
from the incidence of delayed egg-laying since any mother mite that
the board.
begins laying eggs late may consequently lay fewer eggs.
5. The total number of mites is divided by the number of days the board was under the hive to obtain the mite fall per day.
Therefore, information on the following parameters are required to assess successful reproduction: the fertility (whether the mother
mite laid eggs); the presence or absence of male offspring; the Pros: can be more accurate than exhaustive counts when mite fall proportion of dead offspring; and the incidence of delayed egg-laying is high. by mother mites (identified by relating the developmental stage of Cons: need to design / build / buy the checkered board.
mite offspring to the developmental appearance and thus the determined age of the infested pupa; see the section ‘Obtaining brood
4.3. Estimating reproduction parameters
and adults of known age’ in the BEEBOOK paper on miscellaneous
4.3.1. Assessing reproductive success
methods (Human et al., 2013)). These are important since relatively
Mite reproductive success is defined as the ability of a mother mite to
small differences in reproductive factors can have a large effect on
produce at least one viable mated female offspring before the
the population dynamics at a population level (Martin and Medina,
developing bee pupa hatches as an adult. Successful mite reproduction 2004). requires the maturation of at least two eggs laid by a reproducing mother mite inside the brood cell: a male mite and a sister female
4.3.2. When to measure reproductive success
mite, which must mate together before emergence of the host bee.
The most accurate evaluation of mite reproductive success can be
The male mite offspring will die when the bee hatches from the cell,
obtained just prior to worker emergence. However, the hours before
but any mated mature daughter mites will enter the colony’s mite
emergence is not optimal since the last stage of bee development
population along with their mother to find a new brood cell for
makes mite recognition difficult. It is therefore recommended to
reproduction. A mother mite that lays no eggs, lays only one egg,
assess this parameter latest one day before emergence and to project
produces no male offspring, or begins egg-laying too late in relation
in the future the development of the varroa offspring by comparing
to larval development, will not contribute any progeny to the mite
the developmental stage of the pupae to the developmental stage of
population. The fecundity (number of eggs laid) is an additional
the mite offspring. If direct comparisons between studies for several
parameter that can determine variation in the number of viable
reproductive traits are required then the data must be collected over
The COLOSS BEEBOOK: varroa
the same time period. That is, fecundity cannot be accurately
31
3. Record its developmental stage based on the appearance
measured until 220 hours after cell capping in workers and 240 hours
description given in Fig. 12.
in drone cells, as it is only after this period that all the potential eggs
It is important to examine the pupae under a stereomicroscope
may be laid. It is only possible to determine various abnormal
once it is removed from the cell to make sure that mite progeny
reproductive patterns 60 hours post capping. Table 2 gives the time
are not discarded with the pupae. Cell walls should also be
after capping for which several traits related to reproductive success
inspected meticulously for mites and exuviae. The use of an
can be accurately measured.
optic fibre light source is particularly suitable to direct the
To obtain a high amount of brood of relevant age in which reproductive success of the mite can be evaluated, cage the queen of a highly infested colony on an empty frame for several hours at the appropriate time before measurement.
beam to the bottom of the cell and inspecting it after the removal of the pupa. 4. Remove complete mite families together with exuviae from their cells and pupae using a fine brush. 5. Examine under a stereomicroscope.
Pros: mites are easily recognisable on the pupae. Cons: a drawback is that the male or the daughters might die
6. Classify all female offspring into developmental stage groups using Figs. 11 and 12 as a guide.
before emergence and been counted as part of reproductive success;
Protonymphs can be distinguished from similar looking young
determining of pupal age based on appearance is approximate.
deutonymphs by the number of hair in the intercoxal region (between the 4 pairs of legs on the ventral side). Male and
4.3.3. How to measure reproductive success
female protonymph have 3 and 4 pairs of hair, respectively,
The reproductive success of a mite is assessed by reconstructing the
whereas deutonymphs have 5-6 pairs (see drawings pp 55-57
mite family in infested cells (Martin, 1994, 1995a). See section 4.3.2.
in Fernandez and Coineau, 2007). This information allows the
’When to measure reproductive success’ for the optimal time when to
mite family to be reconstructed in birth order or to check for
measure this parameter.
multiple infestation and normality of development.
It is important to examine cells infested by single mother mites as
Protonymphs are usually not sexed, but the number of hairs
opposed to multiply infested cells since multiple infestations add an
on the intercoxal region and the patchy hair pattern on the
additional effect on the success of mite reproduction. Whether only
dorsum of males compared to the homogeneous and dense
one ‘mother’ mite reproduces can be tricky to ascertain in cells with
pattern of females provide recognition traits (Fernandez and
multiple red mites, but using the mite development guide (Figs. 11
Coineau, 2007). For the number of eggs laid by mites and to
and 12) will indicate what is expected and give a good idea of the
allow a more accurate comparison between studies, only
number of mother mites present. For statistical significance, at least
mites that laid two or more eggs are compared. Mites that
30 single mite infested cells per colony should be examined.
produce no eggs (non-reproductive) or one egg (single male)
Different aspects of mite reproduction can be measured. Within
are considered as distinct reproductive categories (see b and c
each pupal cell, the following information can be collected: sex,
below). The mortality of the mite offspring in worker and
developmental stage and vitality. Live or dead mites are easily identified
drone cells is calculated by comparing the number of live and
if fresh material is used. If frozen material is used, mite appearance
dead offspring at each position in birth order, i.e. first offspring,
must be relied on. A shrivelled individual or abnormal appearance
second offspring, etc. Then the average number of surviving
means it was dead prior to freezing. This characteristic can also be
females (unfertilised and fertilised) is calculated using only the
used to distinguish a dead individual from an individual in an immobile
levels of offspring mortality.
developmental stage in live samples. In addition, death rate can be
7. All infested cells are analysed by placing the mother mites into
estimated indirectly by comparing the developmental stages obtained
one of the following six categories:
with the reference: the development of any dead individual is prematurely
a) mother dead
arrested and can therefore be identified with the help of Figs. 11 and 12.
b) mother (alive), no offspring c) mother plus only male offspring
1. Using forceps, carefully open each capped cell by peeling back its top, papery seal and push away the walls of the cell. 2. Remove the pupa from the cell.
d) mother plus (live) mature male and female offspring so mating is assumed e) mother plus (live) female offspring and dead male
This is best done by sliding the forceps each side of the neck
offspring
between head and thorax and gently lifting up. When getting
These female offspring might remain unfertilised since the
the pupa out of cell, place it on a microscope slide next to the
male might have died before they were mated (Harris and
cell to avoid mites dropping in the comb.
Harbo, 1999). Dissection of the spermatheca and microscopic
Dietemann et al.
32
examination of its content can help determine their mating status (see Steiner et al., 1994 for pictures of reproductive tract with spermatheca). f) mother without (live) female offspring. When working with frozen material, beware of repeated freezing and thawing cycles since this damages the samples. Only take out of the freezer the amount of material can be dealt with at a given time. Pros: if this type of data is collected it can be compared with previous studies (e.g. Martin, 1994, 1995a, b; Medina and Martin, 1999; Martin and Kryger, 2002), where the same data for reproductive parameters of susceptible mites were obtained by using the exact same methodologies. Cons: tedious, time consuming. 4.3.4. Assessing oogenesis For estimates of oogenesis in mites, refer to section on marking methods 3.4.1. ‘Oogenesis’.
4.4. Estimating damage thresholds This section describes methods used to measure varroa damage at the colony level and to associate that damage with economic damage thresholds. One of the goals of varroa Integrated Pest Management (IPM) is the reduction of beekeeper reliance on pesticides in the bee hive. Mite eradication is not a necessary goal, as IPM philosophy recognizes that Fig. 15. Adult bees with their phoretic mites from several colonies are eradication may require practices that are excessively toxic, invasive,
mixed to homogenise the starting infestation level in the replicates.
or impractical. Varroa IPM places a premium on non-chemical
Photo: Keith Delaplane
management practices that eliminate mites from a colony (such as drone brood trapping) or slow the rate of mite population growth
density at which point the grower is experiencing economic loss. The
(such as genetic host resistance). The most promising varroa IPM
goal is to prevent this level from happening, in other words, to
practices have been reviewed by Rosenkranz et al. (2010). Unfortunately, identify an earlier and lower pest density at which point a treatment it has been shown anecdotally as well as in computer simulations
could prevent reaching the EIL. This lower pest density is named
(Hoopingarner, 2001; Wilkinson et al., 2001) that few if any of these
variously the economic threshold, treatment threshold, action threshold,
practices can by themselves or indefinitely keep mites at non-damaging or damage threshold. Implicit in the use of damage thresholds is the levels. Thus at this point it seems best to think of IPM as a means to
recognition that some pest levels are tolerable and do not warrant the
delay, not necessarily eliminate, the application of acaricides
use of a pesticide. A good damage threshold will not only distinguish
(Delaplane, 2011). Many benefits accrue if the time between chemical damaging from non-damaging pest densities, but also accommodate treatments is delayed – namely, reduced toxin delivery to bees and
local variations due to geography and biology of host and parasite.
the environment, reduced chemical residues in honey, and relaxed
Thresholds are simply a form of applied population modelling, and like
selection pressure for chemical resistance and the conservation of
any model, they are only as good as the data, detail, and specificity
susceptible alleles in the mite population that prolong the commercial
applied to their construction.
life of an acaricide. Since the focus of IPM is not mite eradication, but rather mite
4.4.1. How to estimate damage thresholds
management, the whole system hangs on the existence of criteria
The following instructions are a synthesis from the field-derived
that can distinguish mite densities that are tolerable from those that
damage thresholds of Delaplane and Hood (1997, 1999) and
are approaching damaging levels. Classical IPM tenets (Luckmann and Delaplane et al. (2010) for the south-eastern USA, Strange and Metcalf, 1982) identify the economic injury level (EIL) as that pest
Sheppard (2001) for the north-western USA, and Currie and Gatien
The COLOSS BEEBOOK: varroa
33
(2006) for Manitoba, Canada. All of these studies used a design in which colonies of uniform strength and mite density are experimentally set up, applications of acaricide made at different times to create a spread of mite history and colony condition, and samples taken regularly to document mite levels and colony condition. With some, negative controls are present as colonies that are never treated, and positive controls present as colonies that are treated continuously. Thus, a range of mite densities exists across the experiment in space and time, and every colony has a history of known mite levels and colony strength at the time it was treated.
4.4.1.1. Colony establishment 1. Equalize field colonies in regard to bees, brood, food resources (see section 1.2.2.1 ‘Setting up experimental
Fig. 16. Boxes are pre-stocked with near-equal amounts of brood, honey, pollen, and empty cells to host the experimental colonies. Photo: Keith Delaplane
colonies of uniform strength’ of the BEEBOOK paper on estimating colony strength (Delaplane et al., 2013)) and mites within units of higher-order experimental replication, i.e. blocks or whole plots, usually based on geography. At least two more source colonies than the target number of experimental colonies should be used to account for bee loss through death or flight. 2. Collect adult bees and phoretic mites for experimental set-up by shaking workers from a diversity of source colonies into one large, common cage, allowing workers (and mites) to freely mix (Harbo, 1993) (Fig. 15). 3. Maintain the cage in cool conditions to prevent bee death from over-heating for at least 24 hours to allow thorough admixing of bees and mites, resulting in a uniformly heterogeneous mixture.
Fig. 17. Number of bees and mites are counted to obtain a measure of initial density of phoretic mites.
Photo: Keith Delaplane
4. Distribute worker cohorts of equal size (preferably by weight,
ca. 1 kg) into hive boxes pre-stocked with near-equal amounts of brood, honey, pollen, and empty cells (Fig. 16). 5. Provide each colony a sister queen reared from the same mother and open-mated in the same vicinity to minimize variation due to bee genetics. 6. Collect a sub-sample of ca. 300 workers from each incipient colony. 7. Weigh the samples. 8. Count the number of bees to derive a colony-specific measure of average fresh bee weight (mg). 9. Divide initial cohort size (kg) by average fresh weight of individuals (mg) to obtain initial bee population.
Fig. 18. Measuring the beginning quantity of sealed brood. Photo: Keith Delaplane
10. Collect a sample of ca. 300 worker bees (can be the same sample as above after it is weighed fresh) to obtain a measure of initial density of phoretic mites. 11. Separate the mites from the bees, see section 4.2.3.1. ‘Infestation rates of adult bees’ (Fig. 17). 12. Count the number of bees and number of mites to derive a colony-specific measure of mite / bee density.
13. Multiply this number by initial bee population to obtain phoretic mite population. 14. Store the samples in alcohol for future reference. 15. Collect brood for incipient experimental colonies from the same source colonies used to collect adults.
Dietemann et al.
34
16. Assign a near-equal quantity of brood to experimental colonies without regard to source (see section 1.2.2.1.1. ‘Classical objective mode’ of the BEEBOOK paper on estimating colony strength (Delaplane et al., 2013)). 17. Measure the beginning quantity of sealed brood to calculate
4.4.1.2 Experimental treatments ,sample size, and colony arrangements 1. Create a range of varroa colony densities by treating sets of colonies with acaricide at different points of a season, bracketing as widely as possible the months of bee activity
beginning mite populations.
particular to one’s region. At the very least, one treatment
This is done by overlaying on each side of every brood comb
should be early in the season when bees are emerging from
a grid pre-marked in cm2 and visually summing the area of
winter senescence; one treatment should be at the peak of
sealed brood (Fig. 18).
the active season, and another should occur in autumn which
2
18. Convert the area (cm ) of sealed brood to cells of sealed
is typically the period of highest ratio of mites : bees. More
brood by multiplying cm2 by the average cell density per cm2
intervals will improve the resolution of the resulting model. It
(see section 1.2.2.1.1. ‘Classical objective mode’ of the
is imperative that the design include a negative control – a set
BEEBOOK paper on estimating colony strength (Delaplane
of colonies left untreated, and it is highly recommended that
et al., 2013)).
the design include a positive control – a set of colonies treated 2
Cell density per cm varies by geography; in the south-eastern
continuously (Table 3). Including both controls will provide
USA conversion factors between 3.7 and 3.9 are used
the widest range of varroa densities possible within which the
(Delaplane and Harbo, 1987; Harbo, 1993). This value should
investigator can retrospectively search for mite densities that
be verified with the honey bee lineage used for the experiment. 19. Measure incipient mite population in brood by opening at least
are damaging or non-damaging. 2. Use an average sample size (initial number of colonies per treatment) of 11.
200 cells of sealed brood per experimental colony and
The literature indicates a range 7-20. Studies using sample
examining under strong light and magnification to see and
sizes within this range never failed to detect treatment effects
count sclerotized mites (see section 4.2.3.2. ‘Infestation rates of brood’). 20. Multiply the mite/cell density by cells of sealed brood to obtain the mite population in cells. 21. Sum phoretic mites + mites in cells to obtain the beginning total mite population. 22. Take corrective action should initial measures expose outliers in initial populations of bees, brood, or mites.
for at least some dependent variables (Table 3). 3. Stick to one mite control product. This avoids the risk of experimental confounding error due to variation in acaricide efficacy or unknown sublethal effects on host bees (investigators sometimes included different acaricides in their treatments, apparently with a view to finetuning control recommendations for their region). 4. Take into account resistance of mites to acaricides when
In general, corrections aimed at minimizing experimental error
choosing the treatment.
are permissible until the point at which treatments are begun.
Whether the population is resistant to a particular product can
23. Once colonies are established and queens released and
be tested following the method described in section 3.6.3.
confirmed laying, it is recommended to collect one or more
‘Bioassays to quantify the susceptibility of the varroa mite to
beginning relative mite measures. The most commonly
acaricides’.
recognized relative measures are mites recovered per 24 h on
5. Control or at least monitor colony spatial arrangement.
bottom board sheets (see section 4.2.4. ’Natural mite fall’)
Varroa mites can spread horizontally through infested workers
and mites per adult bee recovered from samples (as described
and drones drifting between colonies (Greatti et al., 1992;
in section 4.2.3.1.2. ‘Dislodging mites from bees’). It is to be
Frey et al., 2011) and exert a strong influence on results.
hoped that these relative measures will correspond closely to
Depending on one’s objectives, one can set up apiaries to
real colony mite populations, and the investigator is
encourage drift (assign treatments within the same apiary) or
encouraged to check the validity of the relative measures with
discourage drift (assign treatments by apiary). The first
regression analyses against total mite population.
scenario acknowledges that immigration may confound
24. Colony maintenance should include control of non-target
results, yet this condition is presumed more “real world”
diseases and disorders, swarm prevention, and feeding as
because modern beekeeping often encourages mite horizontal
necessary.
transmission with high-density apiaries. This option is however
The goal of these manipulations is to decrease experimental
not relevant if treatments are made with persistent active
residual error.
ingredients that are distributed by contact between bees (e.g. fluvalinate). Drifters could contaminate colonies with different
The COLOSS BEEBOOK: varroa
35
Table 3. Experimental treatments, sample size, and colony spatial arrangements recommended and found in the literature on field-derived damage thresholds. a All studies cited here were performed in the Northern Hemisphere, so early season is Feb-May and autumn Sep-Oct; b initial colonies per treatment; c Delaplane and Hood (1997);
d
Delaplane and Hood (1999); e fluvalinate year 1 and thymol year 2; f Delaplane
et al. (2010); g Strange and Sheppard (2001); h 10 each for May, 7 for Sep; i Currie and Gatien (2006). Experimental treatmentsa
nb
Colony spatial arrangement
1. acaricide X early in the season
12
according to objective (see step 5, section 4.4.1.2. )
18
divided equally between 2 states (ca. 120 km apart), treatments applied
Reference recommended
2. acaricide X at peak of season 3. acaricide X end of season 4. untreated colonies (negative control) 5. acaricide X continuous treatment (positive control) 1. fluvalinate Jun. 2. fluvalinate Aug.
c
by apiary within state (minimize drift effect)
3. fluvalinate Oct. 4. no treatment 1. fluvalinate Feb.
12
2. fluvalinate Aug.
divided equally between 2 states, treatments applied within apiary within
d
state (maximize drift effect)
3. fluvalinate Feb.+Aug. 4. continuous fluvalinate 5. no treatment 1. fluvalinate Feb.
8
2. fluvalinate Aug.
divided equally between 2 states, treatments applied by apiary within state
d
(minimize drift effect)
3. fluvalinate Feb.+Aug. 4. continuous fluvalinate 5. no treatment 1. continuous treatmente beginning Jun.
20
2. treatment Aug.
divided equally between 2 states, treatments applied within apiary within
f
state (maximize drift effect)
3. treatment Oct. 1. fluvalinate Apr.
8
2. fluvalinate Aug.
divided equally among groups (circles) of 8, each circle 15 m apart
g
(minimize drift effect)
3. fluvalinate Oct. 4. fluvalinate Apr.+Oct. 5. continuous fluvalinate 6. no treatment 7. coumaphos Apr. 1. fluvalinate May
10
divided equally between 2 apiaries 8 km apart, within apiary colonies
2. fluvalinate Sep.
or
further subdivided into “low” initial varroa density or “moderate” initial
3. 4 formic 4 d apart May
7h
density
7
treatments applied within 1 apiary of “high” initial varroa density
i
4. 4 formic 4 d apart Sep. 5. 4 formic 10 d apart May 6. 4 formic 10 d apart Sep. 7. coumaphos May 8. coumaphos Sep. 9. no treatment 1. fluvalinate May 2. 5 formic 1 week apart May 3. 1 formic slow release May
i
Dietemann et al.
36
treatment regimes (Allsopp, 2006). The second scenario, in contrast, gives a more uncluttered description of the effects of delayed mite treatment. Including both conditions permits a test of the assumption that thresholds occur earlier under conditions of high mite immigration. In either case, it is recommended that the objective be explicit and the spatial arrangement designed accordingly: 1. if immigration is to be minimized then assign all colonies within one apiary the same treatment and space apiaries as widely apart as possible; or 2. if immigration is to be maximized then assign all treatments within the same apiary. Other drift-minimizing practices, such as painting symbols at hive entrances or arranging colonies in circles, will not substitute for wide spatial distances between colonies of different treatments.
4.4.1.3 Dependent variables and sampling protocols A variety of parameters is measured to relate to damage thresholds of the colonies hosting different parasite population sizes (Table 4). For some of the most invasive measures, i.e., measures of bees or brood (Table 4), it is common during the mid-experiment sampling intervals to sample only a subset of colonies in each treatment. These numbers have ranged from 3 (Delaplane and Hood, 1999) to 4 (Delaplane and Hood, 1997) to 2 (Strange and Sheppard, 2001). It is important to remember that these mid-experiment measures are made not in pursuit of statistic differences, per se, but to provide a retrospective snapshot of colony condition at time of treatment or when threshold was achieved. They will also slightly increase within group variability
Fig. 19. The whole hive is weighed in the field to obtain final colony
of the parameters measured. All colonies are dismantled and fully
bee population.
Photo: Keith Delaplane.
measured at the end of the study when statistical rigor is desirable to identify the treatment regimens that optimized colony condition. 1. Place bottom board sheets under a wire mesh and positioned under the colony (see section 4.2.4. ‘Natural mite fall’).
BEEBOOK paper on estimating colony strength (Delaplane et al., 2013), or from a variation from this method using net
2. Remove the sheet after 24-48 h.
colony bee weight (kg) and average fresh bee weight (mg):
3. Count number of mites and adjust number to mites recovered
8.1. Obtain net colony bee weight by first closing the colony
per 24 h. 4. Collect samples of 300-900 adult bees. 5. Count the number of mites and number of bees (see section 4.2.3.1. ‘Infestation rates of adult bees’). 6. Report the data as mites / 100 bees. 7. Derive fresh bee weight (mg) by sampling live bees off the
entrance with a ventilated screen in the evening or early morning before sampling to trap all bees inside. 8.2. Weigh the whole hive in the field (Fig. 19). 8.3. Open the hive. 8.4. Brush all bees off every comb and surface (usually into a temporary holding hive).
comb into pre-weighed, or tared, containers, weighing the
8.5. Re-weigh the hive without bees.
container, subtracting container weight to get net bee weight,
8.6. Calculate the difference in weight, which is the net
counting bees, and dividing by net bee weight to get mg per bee. This sampling can be combined with sampling for mites per adult bee as described above. 8. Obtain ending colony bee population according to the methods described under section 1.2.2.2. ‘Measuring colony strength at end of experiment: objective mode’ of the
weight of bees. 8.7. Divide this number by fresh bee weight to derive colony bee population. 9. Count the number of sealed brood cells as described in section 4.4.1.1., steps 17 and 18. 10. Colony mite population is derived from the methods described in section 4.4.1.1.
The COLOSS BEEBOOK: varroa
37
Table 4. Dependent variables and sampling protocols recommended and employed in the literature on field-derived damage thresholds. Months have to be considered according to the season at the location of the study. a Delaplane and Hood (1997); b Delaplane and Hood (1999); c
fluvalinate year 1 and thymol year 2; d derived from regression predictions based on sticky board mite counts; e Delaplane et al. (2010); f
Strange and Sheppard (2001); g Currie and Gatien (2006). Experimental treatments
Dependent variables measured in each treatment group
1. acaricide X early in the season
1. mites / 24 h on bottom sheets
2. acaricide X at peak of season
2. mites / 300 bees
3. acaricide X end of season
3. fresh bee weight (mg)
4. untreated colonies (negative
4. colony bee populations
control)
5. number sealed brood cells
5. acaricide X continuous treatment
6. colony mite populations
(positive control)
7. visible brood disorders and other diseases
Sampling intervals
Reference
at regular intervals
recommended
in the year at mid-season
8. colony honey yield (kg) 9. subjective “survivability” score at beginning of the season of following year 1. fluvalinate Jun.
1. mites / 18 h on sticky sheets
2. fluvalinate Aug.
2. mites / 300 bees
3. fluvalinate Oct.
3. fresh bee weight (mg)
4. no treatment
4. colony bee populations
Jun., Aug., Oct., Dec.
a
Feb., May., Aug., Sep.-
b
5. number sealed brood cells 6. colony mite populations 7. visible brood disorders (Dec only) 1. fluvalinate Feb.
1. mites / 20 h on sticky sheets
2. fluvalinate Aug.
2. mites / 300 bees
3. fluvalinate Feb.+Aug.
3. fresh bee weight (mg)
4. continuous fluvalinate
4. colony bee populations
5. no treatment
5. number sealed brood cells
Oct.
6. colony mite populations 7. visible brood disorders (Sep.-Oct. only) 8. subjective “survivability” score (following Jan only) 1. continuous treatmentc beginning Jun.
1. mites / 100 bees
2. treatment Aug.
2. fresh bee weight (mg) (Dec only)
3. treatment Oct.
3. colony bee populations
Aug., Oct., Dec.
e
Jun., Aug., Oct., Nov.,
f
4. colony weight (kg) (Dec only) 5. cm2 brood (all stages) 6. colony mite populationsd 7. % bees infected with Acarapis woodi (Dec. only) 1. fluvalinate Apr.
1. mites / 20 hr on sticky sheets
2. fluvalinate Aug.
2. mites / 300 bees
3. fluvalinate Oct.
3. fresh bee weight (mg)
4. fluvalinate Apr.+Oct.
4. colony bee populations
5. continuous fluvalinate
5. number sealed brood cells
6. no treatment
6. colony mite populations
Apr.
7. coumaphos Apr. 1. fluvalinate May
1. mites per bee
At pre-treatment (May
2. fluvalinate Sep.
2. colony honey yield (kg) (Aug. only)
and Sep.), then post-
3. 4 formic 4 d. apart May
treatment weekly for 3
4. 4 formic 4 d. apart Sep.
weeks (spring) then
5. 4 formic 10 d. apart May
biweekly thereafter
6. 4 formic 10 d. apart Sep. 7. coumaphos May 8. coumaphos Sep. 9. no treatment
g
Dietemann et al.
38
Once the investigator knows ending bee population, phoretic mites per bee, number of sealed brood cells, and mites per sealed brood cell, then one can extrapolate to (phoretic mite population + mite population in brood) = total colony mite population. 11. Quantify visible brood disorders. Brood disorders are sometimes associated with varroa parasitism (Shimanuki et al., 1994) and can contribute to colony damage. 11.1. Select two relatively contiguous patches of brood in the late larval – capped stages (stages more likely to express visible symptoms). 11.2. Overlay on each patch a 10-cm horizontal transect and
Fig. 20. Selecting and inspecting brood cells for diseases. Photo: Keith Delaplane
10 cm vertical transect intersecting at the centre (Fig. 20). 11.3. Examine along each transect every cell of brood under strong light and magnification for visible disorders, i.e.,
mite populations (see step 10 of section 4.4.1.3.) along with more
symptoms typical of American foulbrood (see the
user-friendly relative measures such as varroa board counts (see
BEEBOOK paper by de Graaf et al., 2013), European
section 4.2.4. ‘Natural mite fall’) and mites per 100 bees (see section
foulbrood (see the BEEBOOK paper by Forsgren et al.,
4.2.3.1.2. ‘Dislodging mites from bees’), then it is desirable to test the
2013), sacbrood (see the BEEBOOK paper on honey bee
rigor of the relative measures at predicting real mite populations
viruses by de Miranda et al., 2013), or chalkbrood (see
through the use of regression analyses testing linear, quadratic, and
the BEEBOOK paper on fungal diseases by Jensen et al., cubic terms. Ultimately, the investigator would like to deliver to 2013).
beekeeper clients a user-friendly relative measure that accurately
11.4. Report the parameter as percentage of brood expressing predicts real colony mite populations. visible disorders. 12. When honey yield needs be considered as a parameter of the
This analysis will permit the investigator to compare end-ofseason colony condition across the various treatment regimens (times
economic threshold, calculate colony yield (kg) by weighing
of acaricide application). The damage threshold is determined
honey supers before and after they are placed on colonies
retrospectively as the highest average colony mite density at time of
during a nectar flow.
treatment associated with colony condition significantly non-different
13. Measure the infestation rate by Acarapis woodi in the colonies. from positive controls at season’s end. In one real example, the This rate could be affected by the presence of varroa and its
threshold was defined as conditions that prevailed when colonies were
measure might be needed as economically relevant. For this
treated in August because August-treated colonies fared as well
sample collect 50 workers per colony and place in alcohol. See statistically at season’s end as colonies treated continuously the BEEBOOK paper on tracheal mites (Sammataro et al., 2013) (Delaplane and Hood, 1999). The mid-season samplings permit the for the method to detect the presence of these mites.
investigator to describe mite populations, user-friendly relative mite measures, and colony strength parameters that prevailed at the time
4.4.1.4 Analyses, interpretation, and pitfalls
thresholds were achieved. The highest, rather than lowest, retrospective
The designs featured in this section lend themselves to a straightforward mite density is used because of the conservative emphasis of IPM on analysis of variance testing the effect of date of treatment on colony
prolonging the interval between treatments as long as possible. A low
strength parameters at the end of the study (Table 4). Depending on
or zero pest tolerance is rare, unnecessary in the varroa / Apis
the presence of higher-order replications such as blocks, the
mellifera IPM system, and more commonly associated with cropping
investigator should be alert to interactions between treatments and
systems for which pest-induced cosmetic damage is a problem with
the blocking factor which, if present, prescribe that the investigator
consumers.
test main treatments separately by block. The number of surviving
This analysis will likewise identify mite densities that are
colonies by the end of the study (n) may differ across treatments, so
irrecoverably damaging, in other words, mite densities at which point
it may be necessary to accommodate unequal sample sizes through
in time treatment does not prevent comparative colony deterioration
use of harmonic means transformation or lsmeans. Treatment means
by the end of the study. In another real example, it was shown that
are separated (α ≤ 0.05) by a conventional test such as Tukey’s or
mite densities that prevailed in October exceeded a recoverable level
Student-Newman-Keuls. If the investigator procured whole colony
because at season’s end the October-treated colonies were in
The COLOSS BEEBOOK: varroa
39
significantly worse condition than continuously-treated colonies
when choosing an acaricide for this purpose (see section 3.6.3.
(Delaplane and Hood, 1997).
‘Bioassays to quantify the susceptibility of the varroa mite to
Alternatively, Strange and Sheppard (2001) defined damage
acaricides’ for methods to test for resistance). The efficacy of the
threshold as: 1. the mite levels corresponding to colony treatment
treatment should be checked, as well as putative re-infestations from
groups at season’s end with weight of bees less than initial starting
neighbouring apiaries (Greatti et al., 1992).
2
levels (0.92 kg in this case); and 2. colonies with < 1150 cm sealed brood – a number derived from regression analyses predicting the
Depending on the experiment planned, residues left behind by such treatment could bias the results by provoking delayed mortalities
amount of brood that should be present in colonies with 0.92 kg bees. of mites. In such cases, residue free oxalic acid treatment can be With these boundary conditions the authors were able to retrospectively used on swarms. No capped brood or frames with L5 larvae (see the identify legacy mite levels that were either tolerable or irrecoverably
section ‘Obtaining adults and brood of known age’ of the BEEBOOK
high.
paper on miscellaneous methods (Human et al., 2013)) should be
One pitfall in the field studies described here is a confounding
carried to the experimental hives in order not to bring in mites. Formic
effect, inherent to the design, between season (time of treatment)
acid treatment can also be used on entire colonies with brood since
and colony mite densities. Mite population growth is regulated by
the acid affects mites under the cell capping (Adelt and Kimmich,
length of brood-rearing season, ratio of worker brood to drone brood,
1986; Koeniger et al., 1987; Fries, 1991; Calis et al., 1998). However,
and number of brood cells (Fries et al., 1994) and tends to increase
these two methods are only 95% efficient on average, which can
over the course of the active season. Delaplane and Hood (1997)
influence the planed experiment. Oxalic and formic acid based
pointed out this confounding issue when they said, “Thus, our treatment products are available on the market and should be used as per threshold is reliable for August colonies meeting the conditions described in [the table showing retrospective colony descriptions], but
manufacturer recommendations. In such experiment, a control group of colonies treated
may not be reliable for August colonies with significantly different
continuously might be necessary. Such colonies need be separated
amounts of bees or brood.” A more highly-resolved field model would
from the experimental group since drifting and robbing bees could
replicate each of these terms independently within month of
contaminate the test apiary (especially and mostly with synthetic
treatment.
acaricides; Allsopp, 2006). For the same reason, the control and
Another pitfall comes from the emerging realization that honey
experimental apiary need be separated by the same distance (~2km)
bee morbidity is not always the product of a simple linear process or
from neighbouring uncontrolled apiaries. However, a compromise
one factor, but rather a web of interacting factors (vanEngelsdorp
distance between control and experimental apiaries needs be found
et al., 2009). More sophisticated damage thresholds are needed that
so that both are still subjected to equivalent environmental
can integrate more than one morbidity factor and account for their
conditions.
possible interactions.
4.5.1.2. Obtaining residue free hives Pros: allows the definition of damage thresholds as basis of IPM implementation. Cons: high workload, tedious.
The presence of long lasting acaricide residues (Bogdanov et al., 1998) in wax combs or honey can influence the results of experiments in which the survival of mites is a parameter of importance. Several methods to replace contaminated wax by residue free wax exist for
4.4.2. Regional variations in reported damage thresholds.
beekeepers to switch to biological apiculture (Imdorf et al., 2004).
Table 5 gives some published field-derived damage thresholds and
The method described here allows the decrease of residues below
their geography of origin.
detectable levels within 1 year. This does not mean that all residues have disappeared, but that they have been diluted enough not to
4.5. Standardising field trials
represent a problem for the quality of hive products. Whether the minimal quantities still present in the wax affect mite survival is
4.5.1. Starting conditions
however uncertain. This method based on comb removal can
4.5.1.1. Obtaining mite free colonies
nevertheless be used to decrease the amount of residues in the wax
Mite free colonies can be obtained from varroa free areas. These
for research purpose.
colonies will also be residue free since acaricides are not used. Obtaining such colonies is usually not possible so the varroa population of the
Complete removal of combs is best done at beginning of the bee season when comb is rapidly built by workers.
experimental colonies needs to be removed using a highly effective control method adapted to the region in which the study takes place.
1. Split the colony.
The occurrence of resistant populations needs to be taken into account
2. Out of a split, create a broodless swarm with the old queen.
Dietemann et al.
40
Table 5. Field-derived varroa damage thresholds and month of occurrence at various locations. aDelaplane and Hood (1999); bDelaplane et al. (2010); cStrange and Sheppard (2001); dCurrie and Gatien (2006); eGatien and Currie (2003). Varroa damage thresholds and month of occurrence
Location
Feb.
Aug.
1. colony mite population: 7-97
1. colony mite population: 3172-4261
2. 0.4 mites per 100 bees
2. 13 mites per 100 bees
3. mites on overnight bottom
3. mites on overnight bottom board sheets: 59-187
Reference
Southeastern USA
a
Southeastern USA
b
Northwest USA
c
board sheets: 0.6-10 1. colony mite population: 1111 2. 20 mites per 100 bees Apr.
Aug.
1. 1 mite per 100 bees
1. 5 mites per 100 bees
2. mites on 48 hr bottom board
2. mites on 48 hr bottom board sheets: 46
sheets: 24 May
Late Aug. – mid Sep.
1. 2 mites per 100 bees (to
1. 4 mites per 100 bees (to prevent winter loss)
Manitoba, Canada
d
1. 5-8 mites per 100 bees
Manitoba, Canada
e
prevent honey loss)
3. Scrape all propolis and wax, wash with soda and surface burn
4. Remove old combs.
with a flame used hive parts to remove residues before
5. Replace with residue free wax foundations.
introducing the colony; alternatively, use new hive parts.
6. Feed the colony.
4. Place swarm on residue free foundation (originating from location where no persistent miticides are used and
Pros: decreases acaricide residues below detectable levels.
originating from wax correctly sterilised by melting >121°C
Cons: whether putative, but minimal residues remaining have a
for >30 min).
biological effect is unknown.
5. Feed this first split. 6. In the other split, let the brood run out and a new queen be produced. 7. When the majority of the brood has emerged and the queen has started laying, remove all old combs. 8. Replace with residue free wax foundation.
4.5.2. Artificial mite infestations
4.5.2.1. How many mites to introduce The number of mites to introduce in colonies depends on the experiment performed. There are several factors to take into account:
paper (Pirk et al., 2013)).
It is also possible to let bees build new combs from their own wax production rather than giving wax foundations.
The statistical relevancy: a minimum number of successful infestations must be obtained (see the BEEBOOK statistics
9. Feed the second split.
A higher number of mites introduced decreases the importance of resident residual/local mites.
Alternatively, the following can be done at the end of the bee
season on whole colonies.
The infestation level depends on how long the colony should survive: the more mites are introduced, the quicker susceptible colonies might collapse.
1. Trap the queen in a large cage made out of queen excluder allowing for the passage of workers.
The method of introduction: introducing mites on the top of frames might result in high losses, but is easy. Alternatively,
2. Let the brood run out.
placing them on bees decreases this loss and allows a
3. Scrape all propolis and wax, wash with soda and surface burn
reduction in the number of mites used. Introducing mites in
with a flame used hive parts to remove residues before
cells is a highly controlled method that requires few mites, but
introducing the colony; alternatively, use new hive parts.
it is tedious.
The COLOSS BEEBOOK: varroa
41
The rejection rate of mites by workers by grooming or
the status of the cell. Important: bees covering the combs used for
hygienic behaviour.
artificial transfers must be carefully removed with a brush and not by
The sterility of some mites.
shaking, which could damage pupae and mites. An opened and empty
The old age of mites of uncontrolled origin.
marked cell means that the workers removed the larva and the mite.
The availability of mites.
Workers might also discard the old capping and reseal the cell without
In general, the number of mites to be introduced in experimental
removing the larva. This can be recognised by a fresh capping
colonies should be overestimated to guarantee a sufficient sample size. deprived of cocoon layer. In this case the mite might have escaped or have been removed before resealing.
4.5.2.2. How to introduce varroa mites in colonies There are two ways to obtain infested colonies: mites obtained from
4.5.2.3.2. Natural infestation
other colonies can be introduced or the existing mite population can
Boot et al. (1992) designed a method that allows locating naturally
be measured and the colony manipulated to obtained the desired
infested cells. It is based on a one sided comb of which the cell walls
infestation level. Bees can be taken out of a colony and the mite
where cut away from the bottom. The walls were then melted on a
directly placed on its host. This can be done by pouring the collected
transparent sheet. These combs are consolidated by workers when
mites on top of the workers in a cage or by picking mites up one by
replaced in the colonies and were accepted for oviposition by the
one with a paintbrush and placing directly on a worker. Time should
queens. It might be necessary to cover the exposed side of the
be allowed for the mite to take refuge under the bees' abdominal
transparent sheet to prevent the bees building on it. Beetsma et al.
plates before placing the latter back in its colony. This method is more (1994) also describe single rows of cells with two transparent walls efficient than dropping the mites onto the top of the frames since
that help locating and observing natural infestations.
more mites can get attached on their host. Alternatively and if the level of infestation desired is not too different from the initial level of
4.5.3. Field bioassays of semiochemicals
the colony, the latter can be split to obtain the desired level. If the
Semiochemicals for which an effect on mite behaviour or physiology is
level of infestation is above the desired level, brood combs (in which
proven in laboratory assays need to be tested under natural conditions
mites are trapped) can be removed.
in the hive. For example, semiochemicals involved in cell invasion and reproduction were tested with such method (Milani et al., 2004).
4.5.2.3. How to introduce varroa mites in cells An advantage of introducing mite directly in cells is to be able to
4.5.3.1. Cell invasion
monitor the events occurring in this particular cell. Cells can be
In the case of the compounds affecting cell invasion (either
manually infested or can be left to natural infestation if the infested
attractants or repellents), field testing involves treating brood cells
cells can later be recognised. We here describe such artificial
with the chemical under study and evaluating the number of mites
infestation methods.
that entered the cell after it has been sealed. 1. Dissolve the compound to be tested in 1 µl of de-ionised
4.5.2.3.1. Manual infestation
water or other appropriate solvent.
1. Using recently capped brood i.e. within 6 hours (see section
The dose used for the field bioassay is normally the most
‘Obtaining brood and adults of known age’ of the BEEBOOK
active in the laboratory bioassay. Beware that the solvent
paper on miscellaneous methods (Human et al., 2013)) make a small hole in the side of the capping. 2. Introduce the mite using a fine wetted paint brush. 3. Close and reseal the hole by pushing the capping down. Workers will seal the hole when the frame is reintroduced in the colony. Using melted wax to prevent the mite escaping is not recommended since it could damage the fragile larva. 4. Mark the location of the cell on a transparent sheet placed above the comb. This method needs practice. From an initial 20% acceptance of artificially infested brood, one can rapidly reach 80%. This rate is
might dissolve the wax of the cell walls. 2. Select a highly infested colony. 3. Identify cells containing L5 larvae (see the section on obtaining brood and adults of known age in the BEEBOOK paper on miscellaneous methods (Human et al., 2013)). 4. Apply the solution to these cells' walls with a 10 µl Hamilton syringe. 5. Treat an equal number of cells with 1 µl of solvent as a control. 6. Mark the position of the cells on a transparent sheet for subsequent tracking.
however variable according to colony and experimenter. The success
7. Open the sealed cells 18 h after treatment.
rate can be checked by removing frame after few hours and verifying
8. Inspect the cells for the presence of mites and count mites.
Dietemann et al.
42
4.5.3.1.1. Data analysis
In particular, the number of offspring and the number of mated
The proportion of treated and control cells that were infested are
daughters (i.e., the number of adult daughters in cells containing an
compared using the Mantel-Haenszel method after testing the
adult male), are considered.
homogeneity in the odds ratios of the replicated 2 × 2 tables. Any test
The effects of the solvent on the reproduction of V. destructor are
that is suitable for comparing proportions could be used instead.
studied by comparing the reproduction of mites in cells injected with
However, if there are more replicates, using a certain number of cell
1 µl solvent and in sham-treated infested cells (syringe was
each time, it is recommended to use a test that allows the analysis of
introduced, but no solvent was injected). Proportions of reproducing
strata. The number of mites in treated and control brood cells, in the
mites out of the total mites found in cells are compared using G-tests
hive bioassay, can be compared by a stratified sampled randomization (with the Williams’ correction). The number of offspring and that of test.
mated daughters per mother mite in treated and control groups can be compared using a two-sample randomisation test. The randomization
4.5.3.2. Mite reproduction
distribution should be resampled an adapted number of times (e.g.
In the case of the compounds affecting mite reproduction, field
106 times).
testing involves treating brood cells with the chemical under study and evaluating both the fertility and fecundity of the mites
4.5.4. Testing varroacides in the field
reproducing in the cell.
The European medicines agency has issued recommendations for the development of anti varroa treatment. These guidelines have been
1. Chose combs containing brood close to being capped.
built on the knowledge accumulated by the Concerted Action 3686
2. Mark all the capped cells on a transparent sheet placed over
(Commission of the European Communities European), which
the comb. 3. Replace the comb in the colony for two hours for workers to carry on capping cells.
developed the commonly named ‘alternative varroa control methods’ based on the use of organic acids and essential oils. The aim of the guideline is to test and demonstrate the efficacy and safety of new
4. Bring the combs to the laboratory after the two hours.
miticides with the purpose of facilitating homologation. The original
5. Dissolve the compound in an appropriate solvent.
document (EMA/CVMP/EWP/459883/2008) should be consulted for
The dose used for the field bioassay is normally the most
legal issues and test for applicability of the treatment in various
active in the laboratory bioassay.
climatic regions. We here summarize and adapt the experimental
6. Treat groups of freshly capped (unmarked) worker cells by
design for research purposes at the local scale. Acaricides are considered
injecting 1 µl of the solution with a 10 µl Hamilton syringe
efficient if the proportion of mites killed is at least 95% for synthetic
under the capping.
substances and at least 90% for non-synthetic substances.
Do not insert the syringe too deep into the cell to avoid hurting the larva. Beware that the solvent could dissolve the
4.5.4.1. Preliminary tests
wax of the cell walls.
To facilitate and optimize efficacy test, it is recommended to perform
7. Treat an equal number of cells with 1 µl of the solvent as a control. 8. Choose groups of control and treated cells on both side of the
dose finding and tolerance test on caged bees under controlled conditions in the laboratory. See section 3.6.3. ‘Bioassays to quantify the susceptibility of the varroa mite to acaricides’ and the BEEBOOK
comb, separated by at least one cell, which is left untouched
paper on toxicology methods (Medrzykci et al., 2013). The highest
to avoid contaminations.
concentration/quantity tolerated by the honey bees can be used as an
9. Mark the position of the control and experimental cells on a transparent sheet placed over the comb. 10. Return the combs to the hive within 3 h.
indication for concentrations or quantities that can be used in subsequent dose-titration as well as dose-confirmation or field studies. Dose-titration studies should aim at identifying the minimum
11. Bring the comb to the laboratory 11 days later, when the bees effective and maximum tolerated levels of active substance reaching are about to emerge.
bees and parasites and thus help establishing the dosage and dosing
12. Identify treated and control cells using the transparent sheet.
interval of the product. Implementation of dose-finding studies, carried
13. Count, uncap and inspect intact cells.
out under controlled laboratory conditions is preferred, e.g. using 10
14. Note the condition of the infested pupae.
workers per cage, 3 cages per concentration, 3 untreated controls and
15. Collect mother mites and their offspring.
one replicate, i.e. the studies should be carried out twice. See the
16. Mount on microscope slides and identify developmental stages BEEBOOK paper on toxicological methods (Medrzycki et al., 2013). as described in section 4.3.3. ‘How to measure reproductive success’
Small scale outdoor pilot studies to confirm dose, efficacy and tolerance should be considered before large scale field studies are
The COLOSS BEEBOOK: varroa
performed. It is thus possible to validate the results obtained in the
43
6. Initial varroa infestation level should be high enough (> 300
laboratory in a situation closer to that of the field, but with a high
mites per colony) to be able to measure mite drop.
reproducibility since variables can be better controlled in these small
It should however be below damage thresholds (e.g. for
units compared to full size colonies. It also allows for troubleshooting
central Europe: < 3,000 mites per colony, see also Table 5
before the investment in the full scale test is done. A minimum of five
and section 4.4. ‘Estimating damage thresholds’) and
untreated control and five treated test colonies should be used. To
comparable between hives included in the study.
ensure reproducibility in the pilot studies, colonies should be comparable
7. Treatment history should be similar for all colonies to equalize
with respect to environment, type and size of hive, level of varroa
the effect of past treatments on the results (e.g. type and
infestation, treatment history, age of queen, relatedness of queens
amount of acaricide residues present in the wax); when
(sister queens can be used to decrease variability between replicates,
possible use residue free wax.
in contrast, unrelated queens can be used to consider a wider range of genotypes), presence of brood, and age distribution of worker bees.
4.5.4.2.4. Location 1. Apiaries tested should be sufficiently distant from neighbouring apiaries to avoid disturbance and reduce risk for
4.5.4.2. Efficacy tests
re-infestation.
4.5.4.2.1. Statistical analysis
Type and availability of food sources should be recorded.
Primary and secondary outputs, hypotheses, and statistical methods
2. As a general principle, if studies are carried out at different
should be specified and justified in a protocol before beginning the
apiaries, habitats should be comparable (access to similar
experiments. Sample sizes, in terms of hives per area for
forage and exposure to similar climatic conditions).
climatologically different regions (when relevant), should be large
If these conditions are not met the sample size should be
enough to provide sufficient statistical power. Whenever possible,
adapted (number of apiaries increased) to take these
results of the analyses should be accompanied by confidence
differences into account.
intervals. Refer to the BEEBOOK paper on statistics (Pirk et al., 2013)
3. Depending on the mode of dispersion of the product, control
and to the CVMP guideline on Statistical Principles for Veterinary
and test apiaries should be distant enough to prevent the
Clinical Trials (EMEA/CVMP/816/00).
contamination of control groups by the tested product by drifting foragers and drones or robbers.
4.5.4.2.2. Hives 1. Type of hives should be homogenized.
Synthetic acaricides have been shown to contaminate control hives placed in the same apiary (Allsopp, 2006)
2. Ant protected varroa boards should be installed under the hives for mite counting (see section 4.2.4. ‘Natural mite fall’). 3. Temperature and relative humidity inside the hive(s) as well as exposure to solar radiation can be recorded, if they can influence the performance of the product.
4.5.4.2.5. Treatment The following parameters should be defined, as determined in the preliminary tests: 1. Treatment period. Treatment should preferably be carried out at outdoor
4.5.4.2.3. Colonies The following parameters should be taken into account: 1. Do not include weak colonies or colonies affected by diseases other than varroa in the study. 2. Equalize or randomize bee breed depending on the aim of the test regarding genetic diversity.
temperatures > 5°C. 2. Number of treatments, if more than one treatment is carried out. 3. Treatment intervals, if more than one treatment is carried out. 4. Include an untreated control group in the study to establish the effect of handling and of natural variations on the level of
3. Select sister queens or unrelated queens of same age.
infestation and thus to confirm that a decrease in mite
4. Measure and equalize colony strength (see the BEEBOOK
population size observed is indeed due the product under
paper on estimating colony strength (Delaplane et al., 2013)).
investigation.
5. Measure and equalize the amount of brood (see the BEEBOOK paper on estimating colony strength (Delaplane et al., 2013)). 4.5.4.2.6. Observations and parameters Presence and type of brood is determined by the mode of
Studies should encompass a pre-treatment, a treatment and a post-
action of the product. The tests should thus be performed in
treatment period. Monitoring begins with the pre-treatment 14 days
the absence of sealed brood, unless the product is intended to before the first treatment is carried out. The post-treatment period be effective on mites in capped cells.
should extend > 14 days after the last treatment. These periods
Dietemann et al.
44
encompass the pupal development time and allow taking into account
The use of dead-bee traps is recommended (see section 2.
the mites that are enclosed in the cells. The post-treatment period
‘Estimating the number of dead bees expelled from a colony’
might need being prolonged, depending on the mode of action and
of the BEEBOOK paper on miscellaneous methods (Human
persistence of the product tested.
et al., 2013)). 2. Monitor the morbidity, mortality, as well as the size and
4.5.4.2.6.1. Assessment of efficacy 1. Count dead mites on the bottom boards at regular intervals
development of surviving colonies at the time of the first flight in spring and thereafter (see the BEEBOOK paper on
before, during and after treatment.
estimating colony strength (Delaplane et al., 2013)) if
The primary variable is mite mortality. During the treatment
applicable (envisaged therapeutic use in autumn or winter).
period dead mite counts should be carried out every 1-2 days given the high mortality expected. Pre- and post-treatment
3. Measure flight activity of bees during the trial (see the
BEEBOOK paper on behavioural methods.
counts should be made 1-2 times per week depending on
This verifies whether the product influences foraging activity
amount of mites falling, see section 4.2.4. ‘Natural mite fall’ and
of the treated colonies.
4.2.5. ‘Sub-sampling mite fall’. This allows the verification of efficacy since mite drop should peak during the treatment period. 2. Determine the amount of mites surviving the treatment with the product under investigation using a follow-up treatment
4. Measure honey production. This verifies whether the product influences the productivity of the treated colonies 5. Quantify brood area of test colonies during the three phases
with a chemically unrelated substance with > 95%
and compare to the control group (see the BEEBOOK paper
documented efficacy.
on estimating colony strength (Delaplane et al., 2013)).
Follow-up treatment should be carried out in tested and control groups at the same time. This follow-up treatment
In cases in which the product is intended for use in colonies with
should take place shortly after treatment with the test product, brood, the demonstration of safety for all stages of brood should be in order to keep the re-infestation level (and therefore the
carried out (see the BEEBOOK article on toxicology methods by
biasing of results) low when test apiaries and groups are not
Medrzycki et al. (2013)). An additional method to determine effect of
isolated by enough distance from neighbouring apiaries or
the product tested on brood is to determine which of feeding
hives. However, it is necessary to wait until mite drop
incompetence of worker bees and direct adverse effects on eggs and
returned to pre-treatment level in order to measure the full
larvae occurred. For this:
effect of the treatment and dissipation of the delayed mite
1. Leave frames with eggs and larvae to develop in the hive until
mortality. This period is at least 14 days if the product kills
a chosen stage of the larval stage after applying therapeutic
mites in the cells or not. It is only after adult bee emergence
doses of the test product.
that these mites will be released and fall on the bottom board
2. Monitor feeding behaviour of these larvae by measuring the
or that they will get into contact with the product if the latter
amount of food found in their cells.
did not penetrate into the cell.
By comparing development of brood and amount of larval
3. Count dead mites every 1-2 days in the week after follow-up
food and taking into account the ratio between quantity of
treatment and 1-2 per week until mite drop returns to pre-
brood and number of worker bees between control and test
treatment values.
groups, it is possible to differentiate between effects of
4. Calculate treatment efficacy as follows: % mite reduction = (number of mites in test group killed by treatment x 100) / (number of mites in test group killed by
feeding incompetence of worker bees and direct adverse effects on eggs and larvae after application of the product. 3. Verify the presence of the live queen at the end of the
treatment + number of mites killed in test group by follow-up
experiment.
treatment)
A significant difference in queen survival between test and
Do not use data from colonies with abnormally high bee
control groups indicates an effect of the treatment.
mortality in the efficacy evaluation. 5. Compare mite fall after treatment with untreated control to verify that the fall measured was not a natural phenomenon.
4.5.4.3. Resistance pattern The possibility of resistance emerging after several treatments should be monitored. The product applications should cover several
4.5.4.2.6.2. Assessment of safety of product for honey bees 1.
reproductive cycles of the parasite to show the development of
Record bee mortality inside and adjacent to the hive daily
resistance and the rate of such development. Such studies can be
or at least three times a week throughout the three
performed under laboratory (see section 3.6.3. ‘Bioassays to quantify
stages of the experiment.
the susceptibility of the varroa mite to acaricides’) and/or field
The COLOSS BEEBOOK: varroa
conditions. Not only mites, but also bees might develop resistance against miticides after regular use for several bee generations. This translates in a change in dose-lethality relationship of the product or active substance(s) and therefore affects the safety of the product for bees which increases. See the BEEBOOK paper on toxicology methods (Medrzycki et al., 2013) to evaluate acaricide toxicity for honey bees.
45
At day 22, all the brood present at day 1 will have emerged. 6. Day 12: prepare the trapping comb: 6.1. Select a strong colony (brood provider) with an actively laying queen. 6.2. Cage the queen on an empty dark comb (that queens prefer for egg-laying) and placed in the brood nest of her colony.
4.6. Breeding mites in colonies
7. Day 13: after 24 h, remove the queen from the cage, but
A common problem for varroa research is obtaining mites in sufficient
leave the comb in the cage to prevent further egg-laying by
quantities for experiments. It is desirable to obtain mites already early
the queen.
in the season when their numbers in the colonies is still low and in
This comb contains brood of similar age in which varroa mites
large quantities for as long as possible thereafter. The method
will later be trapped. To increase chances of obtaining enough
described here allows, within a short time, the regular harvesting of a
brood for trapping, queens of several colonies can be caged
high number of phoretic mites early in and throughout the season.
and the comb with the most brood is used.
The method is based on the trapping comb originally designed to control the mite (Fries and Hansen, 1993; Maul et al., 1998). It consists in caging the queen from an infested colony, and letting all the brood emerge. Once the colony is broodless and all mites are in the phoretic stage, a comb of open brood is introduced. Just before capping, most of the phoretic mites looking for reproduction opportunities will enter the cells provided. Once the brood is capped,
8. Day 19: 8.1. Transfer the trapping comb that now contains 7 days old brood to the varroa rearing colony, of which the brood has emerged. 8.2. Release the queen of the rearing colony so that she can resume her egg-laying activity. 9. Day 22: the brood cells of the trapping comb have been
the comb is removed and placed in an incubator until the bees
capped.
emerge. The newly emerged non-flying and non-stinging bees will be
9.1. Remove the comb from the rearing colony.
highly infested with varroa, making mite harvesting easy and fast. The
9.2. Transport to the laboratory.
infested comb can also be retrieved at any time to obtain mites at a
9.3. Place in a well-ventilated bee tight box.
particular developmental stage. This method is further developed to
9.4. Keep in an incubator at 34.5°C with 60-70% relative
optimise logistical aspects according to the following protocol:
humidity until adult worker emergence. The comb should contain sufficient pollen and honey supplies
1. Prepare several hives as breeder colonies during the season preceding the experiments. 2. Adjust varroa treatment during the season preceding the
so that the emerging bees can feed. Is it not the case, food should be supplied. Work on the rearing apiary should end with the collection of
experiments to ensure the survival of the colonies, but to also
the trapping comb so that it does not remain for too long
allow the survival of a relatively high number of mites over
outside the colony before being placed in the incubator. To
the winter.
avoid damage to the brood transport should be done in a
This makes it possible to keep a starter mite population for a
thermoregulated and moist container.
fast growth in parasite numbers following the winter. 3. In the next year, when the colonies are well developed, the weekly natural mite fall is counted over a brood cycle (3 weeks). 4. Rank the colonies according to their mite load and strength.
10. Day 33: Start collecting mites from the infested workers emerging this and the following day. For mite collection, bees can be held with forceps and the mites caught with a size 00 paintbrush or a mouth aspirator.
The most infested hives should be used first since they are susceptible to collapse before less infested colonies. The
During the rearing cycle, the colony experiences 2 to 3 weeks
parasite population can still be left to grow in the less infested without brood. After two subsequent brood cycles, the colony has colonies until they are used for mite collection. Among several usually regained strength and the varroa population will have increased hives with the same range of infestation, those closer to
again. Given that the varroa natural fall indicates a sufficiently large
swarming stage can be used first. This makes it possible to
varroa population, the same colony can be used again to harvest
prevent swarming and the loss of mites.
mites. Furthermore, depending on the amount of mites needed,
The breeding cycle can start:
several colonies can be used at a time to increase the harvest.
5. Day 1: cage the queen from the colonies selected for mite
Breeding cycles on new colonies can be started every week. Thus,
rearing.
after 5 weeks, batches of mites can be harvested weekly. The
Dietemann et al.
46
Fig. 21. Timeline of the rearing cycle. An additional cycle is depicted below the main timeline to illustrate how the various tasks (symbolized by arrows) can be combined between different rearing cycles to optimize the process.
Fig. 22. A schematic of a method used to appraise varroa attraction to brood from different queen lines (modified from Ellis and Delaplane, 2001). additional time axis shown at the bottom of Fig. 21 illustrates how most of the working days can be combined for colonies or groups of
Cons: logistic intensive; if mites are collected from emerged workers older mother and young daughter mites are not separated.
colonies at different stages in the cycle. By starting on a Thursday for example, no work on a Wednesday, Friday or weekend day is necessary and mite collection always occurs on a Tuesday.
4.7. Brood attractiveness Varroa mites prefer drone over worker brood (Fuchs, 1990;
Pros: the method allows the collection of mites indoors rather
Rosenkranz, 1993; Boot et al., 1995). Honey bee lineages also vary in
than on the apiary, prevents the danger of robbing by neighbouring
the attractiveness of their brood for the mites (BĂźchler, 1990; De
colonies since the colonies do not remain open for mite sampling,
Guzman et al., 1995; Guzman-Novoa et al., 1996). We here present a
necessitates few visits to the breeding apiary, allows the collection of
bioassay destined to compare brood attractiveness in comparable
mites on a particular day, facilitates sampling as the density of mite
condition, i.e. in the same colony. This method is adapted from those
per emerging bee is high.
of Ellis and Delaplane (2001) and Aumeier et al. (2002).
The COLOSS BEEBOOK: varroa
4.7.1. Procedure to test brood attractiveness 1. Queens from four different lines (Fig. 22, Step 1) tested are
47
5. Acknowledgements
placed individually on a drawn, empty comb contained in a
We are grateful to Diana Sammataro and Marla Spivak for their
queen excluder cage.
comments on an earlier version of this paper. We also acknowledge
2. Allow queens to oviposit for 24 h.
Anton Imdorf for letting us benefit from his experience on methods
3. Twenty four hours later, the queens are removed from the
for varroa research and R. Nannelli for providing pictures of the
combs, but the combs are left in the cages.
immature stages of the mite.
This limits further queen oviposition in the target combs. 4. Leave each comb with eggs is in its respective line colony for 6 or 7 days (for worker / drone brood respectively). 5. After this, cut out of the comb squares or circles of comb
6. References
containing L4 larvae (see the section on obtaining brood and
ADELT, B; KIMMICH, K H (1986) Die Wirkung der Ameisensäure in die
adults of known age in the BEEBOOK paper on miscellaneous
verdeckelte Brut. Allgemeine Deutsche Imkerzeitung 20: 382-385.
methods (Human et al., 2013)) using a sharp knife or a metal spatula (Fig. 22, Step 2). 6. Take one section of larvae from each of the lines to be tested and randomly combine the sections of different lines in the
AKRATANAKUL, P; BURGETT, M (1975) Varroa jacobsoni: a prospective pest of honey bees in many parts of the world. Bee
World 56: 119-121. ALLSOPP, M (2006) Analysis of Varroa destructor infestation of
centre of a fully drawn comb in which squares or circles of
Southern African honey bee populations. Dissertation, University
fitting sizes have been removed.
of Pretoria. 285 pp.
Each frame now contains one brood section from each of the four genetic line colonies (Fig. 22, Step 3). 7. Prepare a varroa receiver colony (Fig. 22, Step 4) by removing the open brood in the colony to decrease target brood (the frame just created having the various queen lines represented on one comb) competition with the colony’s own brood for the varroa present in the colony. Alternatively, the queen in the receiver colony could be caged 22 or 25 days earlier to let all worker and drone brood, respectively, emerge. 8. Introduce each reconstituted comb holding eggs from each
ANDERSON, D L (2000) Variation in the parasitic bee mite Varroa
jacobsoni Oud. Apidologie 31: 281-292. http://dx.doi.org/10.1051/apido:2000122 ANDERSON, D L; FUCHS, S (1998) Two genetically distinct populations of Varroa jacobsoni with contrasting reproductive abilities on Apis
mellifera. Journal of Apicultural Research 37: 69-78. ANDERSON, D L; TRUEMAN, J W H (2000) Varroa jacobsoni (Acari: Varroidae) is more than one species. Experimental and Applied
Acarology 24: 165-189. http://dx.doi.org/10.1023/A:1006456720416 AUMEIER, P; ROSENKRANZ, P; FRANCKE, W (2002) Cuticular volatiles, attractivity of worker larvae and invasion of brood cells
genetic line into a receiver varroa infested colony (Fig. 22,
by varroa mites: a comparison of Africanized and European honey
Step 4).
bees. Chemoecology 12: 65–75.
The colony can receive up to four frames generated from the procedure if the varroa populations are high enough. Mites invade worker cells from 15–50 h preceding cell capping (depending on the sex of the larvae). 9. Fifty hours post cell capping, remove the sections of capped pupae from the colonies. 10. If necessary chill in a freezer. 11. Assess varroa infestation rates (see section 4.2.3. ‘Measuring the infestation rate of brood and adult bees’).
http://dx.doi.org/10.1007/s00049-002-8328-y AVISE, J C (2004) Molecular markers, natural history and evolution
(Second Edition). Sanauer; Sunderland, MA, USA. 684 pp. BAKER, T C; CARDÉ, R T (1984) Techniques for behavioural bioassays. In H Hummel; T A Miller (Eds). Techniques in
Pheromone Research. Springer-Verlag; New York, USA. pp. 45-73. BEETSMA, J; ZONNEVELD, K (1992) Observation on the initiation and stimulation of oviposition by the varroa mite. Experimental and
Applied Acarology 16: 303- 312. BEETSMA, J; BOOT, W J; CALIS, J N M (1994) Special techniques to
Pros: brood attractiveness is assessed in comparable condition, i.e. in the same mite provider colony.
make detailed observations of varroa mites staying on bees and invading honey bee brood cells. In L J Connor et al. (Eds). Asian
apiculture. Wicwas Press; Cheshire, USA. pp. 510-520.
Dietemann et al.
48
BOGDANOV, S; KILCHENMAN, V; IMDORF, A (1998) Acaricide
CHIESA, F; MILANI, N; D’AGARO, M (1989) Observations of the
residues in some bee products. Journal of Apicultural Research
reproductive behaviour of Varroa jacobsoni Oud.: techniques and
37: 57-67.
preliminary results. In R Cavalloro (Ed.). Proceedings of the
BOOT, W J; CALIS, J N M; BEETSMA, J (1992) Differential periods of varroa mite invasion into worker and drone cells of honey bees.
Experimental and Applied Acarology 16: 295-301. BOOT, W J; SCHOENMAKER, J; CALIS, J N M; BEETSMA, J (1995)
Meeting of the EC-Experts’ Group, Udine 1988. CEC; Luxembourg. pp. 213–222. COMMISSION OF THE EUROPEAN COMMUNITIES [2002] Concerted Action 3686: "Coordination in Europe of research on integrated
Invasion of Varroa jacobsoni into drone brood cells of the honey
control of varroa mites in honey bee colonies". Technical
bee. Apidologie 26: 109–118.
guidelines for the evaluation of treatments for control of varroa
http://dx.doi.org/10.1051/apido:19950204
mites in honey bee colonies, Recommendations from the CA3686.
BRANCO, M R; KIDD, N A C; PICKARD, R S (2006) A comparative
Document prepared during discussions within the CA3686 working
evaluation of sampling methods for Varroa destructor (Acari:
group: "Evaluation of treatment for control of varroa mites in
Varroidae) population estimation. Apidologie 37: 452-461.
honey bee colonies".
http://dx.doi.org/10.1051/apido:2006010 BRODSCHNEIDER, R; MOOSBECKOFER, R; CRAILSHEIM, K (2010)
CORNMAN, R S; SCHATZ, M C; JOHNSTON, J S; CHEN, Y-P; PETTIS, J; HUNT, G; BOURGEOIS, L; ELSIK, C; ANDERSON, D;
Surveys as a tool to record winter losses of honey bee colonies: a
CROZINGER, C M; EVANS, J D (2010) Genomic survey of the
two year case study in Austria and South Tyrol. Journal of
ectoparasitic mite Varroa destructor, a major pest of the honey
Apicultural Research 49(1): 23-30.
bee Apis mellifera. BMC Genomics 11: 602.
http://dx.doi.org/10.3896/IBRA.1.49.1.04
http://dx.doi.org/10.1186/1471-2164-11-602
BRUCE, W A; CHIESA, F; MARCHETTI, S; GRIFFITHS, D A (1988)
CURRIE, R W; GATIEN, P (2006) Timing acaricide treatments to
Laboratory feeding of Varroa jacobsoni Oudemans on natural and
prevent Varroa destructor (Acari: Varroidae) from causing
artificial diets (Acari: Varroidae). Apidologie 19: 209-218.
economic damage to honey bee colonies. Canadian Entomologist
BRUCE, W A; HENEGAR, R B; HACKETT, K J (1991) An artificial membrane for in vitro feeding of Varroa jacobsoni and Acarapis
woodi, mite parasites of honey bees. Apidologie 22: 503-507. BÜCHLER, R (1990) Possibilities for selecting increased varroa tolerance in central European honey bees of different origins.
Apidologie 21:365–367. CALDERONE, N W; LIN, S (2001) Arrestment activity of extracts of honey bee worker and drone larvae, cocoons and brood food on female Varroa destructor. Physiological Entomology 26: 341–350. CALIS, J N M; BOOT, W J; BEETSMA, J; VAN DEN EIJNDE, J H P M;
138: 238-252. http://dx.doi.org/10.4039/n05-024 CVMP [2001] CVMP guidelines on 'Statistical principles for veterinary
clinical trials' (EMEA/CVMP/816/00). CZEKOŃSKA, K (2009) The effect of different concentrations of carbon dioxide (CO2) in a mixture with air or nitrogen upon the survival of the honey bee (Apis mellifera). Journal of Apicultural Research 48: 67-71. http://dx.doi.org/10.3896/IBRA.1.48.1.13 DAINAT, B; KUHN, R; CHERIX, D; NEUMANN, P (2011) A scientific note on the ant pitfall for quantitative diagnosis of Varroa
DE RUIJTER, A; VAN DER STEEN, J J M (1998) Control of varroa
destructor. Apidologie 42: 740-742.
by combining trapping in honey bee worker brood with formic acid
http://dx.doi.org/10.1007/s13592-011-0071-3
treatment of the capped brood outside the colony: putting
DAHLE, B (2010) The role of Varroa destructor for honey bee colony
knowledge on brood cell invasion into practice. Journal of
losses in Norway. Journal of Apicultural Research 49(1): 124-125.
Apicultural Research 37: 205-215.
http://dx.doi.org/10.3896/IBRA.1.49.1.26
CAMPBELL, E M; BUDGE, G E; BOWMAN, A S (2010) Gene-knockdown DE GRAAF, D C; ALIPPI, A M; ANTÚNEZ, K; ARONSTEIN, K A; BUDGE, in the honey bee mite Varroa destructor by a non-invasive
G; DE KOKER, D; DE SMET, L; DINGMAN, D W; EVANS, J D;
approach: studies on a glutathione S-transferase. Parasites and
FOSTER, L J; FÜNFHAUS, A; GARCIA-GONZALEZ, E; GREGORC, A;
Vectors 3: 73. http://dx.doi.org/10.1186/1756-3305-3-73
HUMAN, H; MURRAY, K D; NGUYEN, B K; POPPINGA, L; SPIVAK,
CHAUZAT, M-P; CARPENTIER, P; MADEC, F; BOUGEARD, S;
M; VANENGELSDORP, D; WILKINS, S; GENERSCH, E (2013)
COUGOULE, N; DRAJUNEL, P; CLEMENT, M-C; AUBERT, M;
Standard methods for American foulbrood research. In V
FAUCON, J-P (2010) The role of infectious agents and parasites in
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
the health of honey bee colonies in France. Journal of Apicultural
Volume II: standard methods for Apis mellifera pest and pathogen
Research 49(1): 31-39.
research. Journal of Apicultural Research 52(1):
http://dx.doi.org/10.3896/IBRA.1.49.1.05
http://dx.doi.org/10.3896/IBRA.1.52.1.11
The COLOSS BEEBOOK: varroa
DE GUZMAN, L I; RINDERER, T E; LANCASTER, V A (1995) A short
49
DELAPLANE, K S; HOOD, W M (1999) Economic threshold for Varroa
test evaluating larval attractiveness of honey bees to Varroa
jacobsoni Oud. in the south-eastern USA. Apidologie 30: 383-395.
jacobsoni. Journal of Apicultural Research 34: 89–92.
http://dx.doi.org/10.1051/apido:19990504
DE GUZMAN, L I; DELFINADO-BAKER, M (1996) A new species of
DELAPLANE, K S; ELLIS, J D; HOOD, W M (2010) A test for
Varroa (Acari: Varroidae) associated with Apis koschevnikovi
interactions between Varroa destructor (Acari: Varroidae) and
(Apidae: Hymenoptera) in Borneo. International Journal of Acarology
Aethina tumida (Coleoptera: Nitidulidae) in colonies of honey bees
22: 23-27. http://dx.doi.org/10.1080/01647959608684077
(Hymenoptera: Apidae). Annals of the Entomological Society of
DE GUZMAN, L I; RINDERER, T E; STELZER, J A (1997) DNA evidence of the origin of Varroa jacobsoni Oudemans in the Americas.
America 103: 711-715. http://dx.doi.org/10.1603/AN09169 DELAPLANE, K S; VAN DER STEEN, J; GUZMAN, E (2013) Standard
Biochemical Genetics 35: 327-335.
methods for estimating strength parameters of Apis mellifera
http://dx.doi.org/10.1023/A:1021821821728
colonies. In V Dietemann; J D Ellis; P Neumann (Eds) The
DE GUZMAN, L I; RINDERER, T E; STELZER, J A (1999) Occurrence of
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
two genotypes of Varroa jacobsoni Oud. in North America.
research. Journal of Apicultural Research 52(1):
Apidologie 30: 31-36. http://dx.doi.org/10.1051/apido:19990104
http://dx.doi.org/10.3896/IBRA.1.52.1.03
DE GUZMAN, L; RINDERER, T E; STELZER, J A; ANDERSON, D (1998)
DELFINADO-BAKER, M; AGGARWAL, K (1987) A new Varroa (Acari:
Congruence of RAPD and mitochondrial DNA markers is assessing
Varroidae) from the nest of Apis cerana (Apidae). International
Varroa jacobsoni genotypes. Journal of Apicultural Research 37:
Journal of Acarology 13: 233-237.
49-51. DE JONG, D; DE ANDREA, R D; GONCALVES, L S (1982) A comparative analysis of shaking solutions for the detection of
DELFINADO-BAKER, M D; BAKER, E W (1974) Varroidae, a new family of mites on honey bees (Mesostigmata: Acarina). Journal of the
Washington Academy of Sciences 64: 4-10.
Varroa jacobsoni on adult honey bees. Apidologie 13: 297-304.
DIETEMANN, V; PFLUGFELDER, J; ANDERSON, D; CHARRIÈRE, JD;
DE JONG, D D; MORSE, R A; EICKWORT, G C (1982) Mite pests of
CHEJANOVSKY, N; DAINAT, B; DE MIRANDA, J; DELAPLANE, K;
honey bees. Annual Review of Entomology 27: 229-252. DE MIRANDA, J R; BAILEY, L; BALL, B V; BLANCHARD, P; BUDGE, G;
DILLIER, F-X; FUCHS, S; GALLMANN, P; GAUTHIER, L; IMDORF, A; KOENIGER, N; KRALJ, J; MEIKLE, W; PETTIS, J; ROSENKRANZ,
CHEJANOVSKY, N; CHEN, Y-P; GAUTHIER, L; GENERSCH, E; DE
P; SAMMATARO, D; SMITH, D; YAÑEZ, O; NEUMANN, P (2012)
GRAAF, D; RIBIÈRE, M; RYABOV, E; DE SMET, L; VAN DER
Varroa destructor: research avenues towards sustainable control.
STEEN, J J M (2013) Standard methods for virus research in Apis
Journal of Apicultural Research 51: 125-132.
mellifera. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.22 DEL FABBRO, S; NAZZI, F (2008) Repellent effect of sweet basil
http://dx.doi.org/10.3896/IBRA.1.51.1.15 DONZÉ, G; GUÉRIN, P M (1994) Behavioural attributes and parental care of varroa mites parasitizing honey bee brood. Behavioural
Ecology and Sociobiology 34: 305-319. DONZÉ, G; GUÉRIN, P M (1997) Time-activity budgets and space
compounds on Ixodes ricinus ticks. Experimental and Applied
structuring by the different life stages of Varroa jacobsoni in
Acarology 45: 219-228.
capped brood of the honey bee, Apis mellifera. Journal of Insect
DEL PICCOLO, F; NAZZI, F; DELLA VEDOVA, G; MILANI, N (2010) Selection of Apis mellifera workers by the parasitic mite Varroa
Behaviour 10: 371-393. DONZÉ, G; SCHNEYDER-CANDRIAN, S; BOGDANOV, S; DIEHL, P A;
destructor using host cuticular hydrocarbons. Parasitology 137:
GUÉRIN, P M; KILCHENMANN, V; MONACHON, F (1998) Aliphatic
967-973.
alcohols and aldehydes of the honey bee cocoon induce
DELAPLANE, K S (2011) Integrated pest management in varroa. In N
arrestment behaviour in Varroa jacobsoni (Acari: Mesostigmata),
L Carreck (Ed.). Varroa - still a problem in the 21st Century?
an ectoparasite of Apis mellifera. Archives of Insect Biochemistry
International Bee Research Association; Cardiff, UK, pp. 43-51. DELAPLANE, K S; HARBO, J R (1987) Effect of queenlessness on
and Physiology 37: 129–145. ELLIS, J D; DELAPLANE, K S (2001) A scientific note on Apis mellifera
worker survival, honey gain and defence behaviour in honey bees.
brood attractiveness to Varroa destructor as affected by the
Journal of Apicultural Research 26: 37-42.
chemotherapeutic history of the brood. Apidologie 32: 603–604.
DELAPLANE, K S; HOOD, W M (1997) Effects of delayed acaricide treatment in honey bee colonies parasitized by Varroa jacobsoni
http://dx.doi.org/10.1051/apido:2001105 ELLIS, M D; NELSON, R; SIMMONDS, C (1988) A comparison of the
and a late season treatment threshold for the south-eastern
fluvalinate and ether roll methods of sampling for varroa mites in
United States. Journal of Apicultural Research 36: 125-132.
honey bee colonies. American Bee Journal April: 262-263.
Dietemann et al.
50
EVANS, J D (2000) Microsatellite loci in the honey bee parasitic mite
GARRIDO, C; ROSENKRANZ, P (2004) Volatiles of the honey bee larva
Varroa jacobsoni. Molecular Ecology 9: 1436-1438.
initiate oogenesis in the parasitic mite Varroa destructor.
http://dx.doi.org/10.1046/j.1365-294x.2000.00998-3.x
Chemoecology 14: 193–197.
EVANS, J D; CHEN, Y P; CORNMAN, R S; DE LA RUA, P; FORET, S; FOSTER, L; GENERSCH, E; GISDER, S; JAROSCH, A; KUCHARSKI,
http://dx.doi.org/10.1007/s00049-004-0278-0 GARRIDO, C; ROSENKRANZ, P; STÜRMER, M; RÜBSAM, R; BÜNING, J
R; LOPEZ, D; LUN, C M; MORITZ, R F A; MALESZKA, R; MUÑOZ,
(2000) Toluidine blue staining as a rapid measure for initiation of
I; PINTO, M A; SCHWARZ, R S (2013) Standard methods for
oocyte growth and fertility in Varroa jacobsoni Oud. Apidologie
molecular research in Apis mellifera. In V Dietemann; J D Ellis; P
31: 559–566. http://dx.doi.org/10.1051/apido:2000146
Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
GATIEN, P; CURRIE, R W (2003) Timing of acaricide treatments for
methods for Apis mellifera research. Journal of Apicultural
control of low-level populations of Varroa destructor (Acari:
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.11
Varroidae) and implications for colony performance of honey
FERNANDEZ, N: COINEAU, Y (2007) Varroa, the serial bee killer mite. Atlantica; Biarritz, France. 264 pp. FINNEY, D J (1949) The estimation of the parameters of tolerance distributions. Biometrika 36: 139-256. FINNEY, D J (1971) Probit Analysis (3rd Ed.). Cambridge University Press; Cambridge, USA. 333 pp. FORSGREN, E; BUDGE, G E; CHARRIÈRE, J-D; HORNITZKY, M A Z (2013) Standard methods for European foulbrood research. In V
Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK:
bees. The Canadian Entomologist 135: 749-763. http://dx.doi.org/10.4039/n02-086 GENERSCH, E; GISDER, S; HEDTKE, K; HUNTER, W B; MÖCKEL, N; MÜLLER, U (2013) Standard methods for cell cultures in Apis
mellifera research. InV Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.02 GENERSCH, E; VON DER OHE, V; KAATZ, H-H; SCHROEDER, A;
Volume II: Standard methods for Apis mellifera pest and
OTTEN, C; BÜCHLER, R; BERG, S; RITTER, W; MÜHLEN, W;
pathogen research. Journal of Apicultural Research 52(1):
GISDER, S; MEIXNER, M; LIEBIG, G; ROSENKRANZ, P (2010) The
http://dx.doi.org/10.3896/IBRA.1.52.1.12
German bee monitoring project: a long term study to understand
FREY, E; SCHNELL, H; ROSENKRANZ, P (2011) Invasion of Varroa
destructor mites into mite-free honey bee colonies under the controlled conditions of a military training area. Journal of
Apicultural Research 50(2): 138-144. http://dx.doi.org/10.3896/IBRA.1.50.2.05 FRIES, I (1991) Treatment of sealed honey bee brood with formic
periodically high winter losses of honey bee colonies. Apidologie 41: 332-352. http://dx.doi.org/10.1051/apido/2010014 GREATTI, M; MILANI, N; NAZZI, F (1992) Reinfestation of an acaricide-treated apiary by Varroa jacobsoni Oud. Experimental
and Applied Acarology 16: 279-286. GUZMÁN-NOVOA, E; SANCHEZ, A; PAGE, J R R; GARCÌA, T (1996)
acid for control of Varroa jacobsoni. American Bee Journal 131:
Susceptibility of European and Africanized honey bees (Apis
313-314.
mellifera L) and their hybrids to Varroa jacobsoni Oud. Apidologie
FRIES, I; HANSEN, H (1993) Biotechnical control of varroa mites in cold climates. American Bee Journal 133: 435–438.
27: 93–103. http://dx.doi.org/10.1051/apido:19960204 GUZMÁN-NOVOA, E; ECCLES, L; CALVETE, Y; MCGOWAN, J; KELLY P
FRIES, I; CAMAZINE, S; SNEYD, J (1994) Population dynamics of
G; CORREA-BENÌTEZ, A (2010) Varroa destructor is the main
Varroa jacobsoni: a model and a review. Bee World 75: 5-28.
culprit for the death and reduced populations of overwintered
FRIES, I; AARHUS, A; HANSEN, H; KORPELA, S (1991a) Comparisons of diagnostic methods for detection of Varroa jacobsoni in honey bee (Apis mellifera) colonies at low infestation levels.
Experimental and Applied Acarology 10: 279-287. FRIES, I; AARHUS, A; HANSEN, H; KORPELA, S (1991b) Development of early infestations of Varroa jacobsoni in honey bee (Apis
mellifera) colonies in cold climates. Experimental and Applied Acarology 11: 205-214. FUCHS, S (1990) Preference for drone brood cells by Varroa jacobsoni Oud. in colonies of Apis mellifera carnica. Apidologie 21: 93–99. GARRIDO, C; ROSENKRANZ, P (2003) The reproductive program of female Varroa destructor mites is triggered by its host, Apis
honey bee (Apis mellifera) colonies in Ontario, Canada. Apidologie 41: 443-450. http://dx.doi.org/10.1051/apido/2009076 HARBO, J R (1993) Worker-bee crowding affects brood production, honey production, and longevity of honey bees (Hymenoptera: Apidae). Journal of Economic Entomology 86: 1672-1678. HARRIS, J W (2001) A technique for marking individual varroa mites.
Journal of Apicultural Research 40: 35-37. HARRIS, J W; HARBO, J R (1999) Low sperm counts and reduced fecundity of mites in colonies of honey bees (Hymenoptera: Apidae) resistant to Varroa jacobsoni (Mesostigmata: Varroidae).
Journal of Economic Entomology 92: 83-90. HERRMANN, M; KANBAR, G; ENGELS, W (2005) Survival of honey bee
mellifera. Experimental and Applied Acarology 31: 269–273
(Apis mellifera) after with trypan blue staining of wounds caused
http://dx.doi.org/10.1023/B:APPA.0000010386.10686.9f
by Varroa destructor mites or artificial perforation. Apidologie 36: 107-111. http://dx.doi.org/10.1051/apido:2004074
The COLOSS BEEBOOK: varroa
51
HOOPINGARNER, R (2001) Biotechnical control of varroa mites. In T C KRAUS, B (1994) Screening of substances for their effect on Varroa
Webster; K S Delaplane (Eds). Mites of the honey bee. Dadant;
jacobsoni: attractiveness, repellency, toxicity and masking effects
Hamilton, USA. pp. 197–204.
of ethereal oils. Journal of Apicultural Research 33: 34-43.
HOPPE, H; RITTER, W (1988) The influence of Nasonov pheromone
KRAUS, B; HUNT, G (1995) Differentiation of Varroa jacobsoni Oud.
on the recognition of house bees and foragers by Varroa
populations by random amplification of polymorphic DNA (RAPD).
jacobsoni. Apidologie 19: 165–172.
Apidologie 26: 283-290.
HUMAN, H; BRODSCHNEIDER, R; DIETEMANN, V; DIVELY, G; ELLIS, J; FORSGREN, E; FRIES, I; HATJINA, F; HU, F-L; JAFFÉ, R; KÖHLER, A; PIRK, C W W; ROSE, R; STRAUSS, U; TANNER, G; TARPY, D R; VAN DER STEEN, J J M; VEJSNÆS, F; WILLIAMS, G R; ZHENG, H-Q (2013) Miscellaneous standard methods for Apis
http://dx.doi.org/10.1051/apido:19950402 KUENEN, L P S; CALDERÓNE, N W (2002) Positive anemotaxis by varroa mites: responses to bee odour plumes and single clean-air puffs. Physiological Entomology 23: 255–264. LE CONTE, Y; ARNOLD, G; TROUILLER, J; MASSON, C; CHAPPE, B;
mellifera research. In V Dietemann; J D Ellis; P Neumann (Eds)
OURISSON, G (1989) Attraction of the parasitic mite varroa to the
The COLOSS BEEBOOK, Volume I: standard methods for Apis
drone larvae of honey bees by simple aliphatic esters. Science
mellifera research. Journal of Apicultural Research 52(4):
245: 638–639.
http://dx.doi.org/10.3896/IBRA.1.52.4.10 IMDORF, A; BOGDANOV, S; KILCHENMANN, V (2004)
LEE, K; MOON, R D; BURKNES, E C; HUTCHINSON, W D; SPIVAK, M (2010a) Practical sampling plans for Varroa destructor (Acari:
Wachsumstellung im Rahmen der Bioimkerei. Schweizerische
Varroidae) in Apis mellifera (Hymenoptera: Apidae) colonies and
Bienen-Zeitung 127: 15-18.
apiaries. Journal of Economic Entomology 103: 1039-1050.
JENSEN, A B; ARONSTEIN, K; FLORES, J M; VOJVODIC, S; PALACIO, M A; SPIVAK, M (2013) Standard methods for fungal brood
http://dx.doi.org/10.1603/EC10037 LEE, K; REUTER, G S; SPIVAK, M (2010b) Sampling colonies for
disease research. In V Dietemann; J D Ellis, P Neumann (Eds) The
Varroa destructor. Poster #168 www.extension.umn.edu/honey
COLOSS BEEBOOK: Volume II: Standard methods for Apis
bees
mellifera pest and pathogen research. Journal of Apicultural
Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.13 KANBAR, G; ENGELS, W (2003) Ultrastructure and bacterial infection of wounds in honey bee (Apis mellifera) pupae punctured by
LINDQUIST, E E; KRANTZ, G W; WALTER, D E (2009) Order Mesostigmata. In G W Krantz; D E Walter (Eds). A manual of
acarology. Lubbock; Texas, USA. LO, N; GLOAG, R S; ANDERSON, D L; OLDROYD, B P (2010) A
varroa mites. Parasitology Research 90: 349–354.
molecular phylogeny of the genus Apis suggests that the giant
http://dx.doi.org/10.1007/s00436-003-0827-4
honey bee of the Philippines, A. breviligula Maa, and the plains
KANBAR, G; ENGELS, W (2004) Visualisation by vital staining with trypan blue of wounds punctured by Varroa destructor mites in pupae of the honey bee (Apis mellifera). Apidologie 35: 25-29. http://dx.doi.org/10.1051/apido:2003057 KIRRANE, M J; DE GUZMAN, L I; RINDERER, T E; FRAKE, A M;
honey bee of southern India, A. indica Fabricius, are valid species.
Systematic Entomology 35: 226-233. http://dx.doi.org/10.1111/j.1365-3113.2009.00504.x LOBB, N; MARTIN, S J (1997) Mortality of the mite Varroa jacobsoni during or soon after the emergence of worker or drone honey
WAGNITZ, J; WHELAN, P M (2012) A method for rapidly marking
bees. Apidologie 28: 367-374.
adult varroa mites for use in brood inoculation experiments.
http://dx.doi.org/10.1051/apido:19970604
Journal of Apicultural Research 51(2): 212-213. http://dx.doi.org/10.3896/IBRA.1.51.2.10 KOENIGER, N; FUCHS, S; RAFIROIU, R (1987) Ameisensäure zur Behandlung von verdeckelter Brut. Biene 123: 286-289. KOENIGER, G; KOENIGER; N; ANDERSON, D L; LEKPRAYOON, C;
LUCKMANN, W H; METCALF, R L (1982) The pest-management concept. In R L Metcalf; W H Luckmann (Eds). Introduction to
insect pest management (2nd Ed.). John Wiley and Sons; New York, USA. pp. 1-31. MACEDO, P A; WU, J; ELLIS, M D (2002) Using inert dusts to detect
TINGEK, S (2002) Mites from debris and sealed brood cells of Apis
and assess varroa infestations in honey bee colonies. Journal of
dorsata colonies in Sabah (Borneo) Malaysia, including a new
Apicultural Research 41: 3-7.
haplotype of Varroa jacobsoni. Apidologie 33 (2002) 15–24. http://dx.doi.org/10.1051/apido:2001005 KRAUS, B (1990) Effect of honey-bee alarm pheromone compounds on the behaviour of Varroa jacobsoni. Apidologie 21: 127-134. KRAUS, B (1993) Preferences of Varroa jacobsoni for honey bees Apis
mellifera L. of different ages. Journal of Apicultural Research 32: 57-64.
MANLY, B F J (1997) Randomization, bootstrap and Monte Carlo
methods in biology. Chapman and Hall; London, UK. 480 pp. MARTIN, S J (1994) Ontogenesis of the mite Varroa jacobsoni Oud. in worker brood of the honey bee Apis mellifera L. under natural conditions. Experimental and Applied Acarology 18: 87-100. http://dx.doi.org/10.1007/BF000550033
Dietemann et al.
52
MARTIN, S J (1995a) Ontogenesis of the mite Varroa jacobsoni Oud.
MILANI, N (1999) The resistance of Varroa jacobsoni Oud. to
in the drone brood of the honey bee Apis mellifera L. under
acaricides. Apidologie 30: 229-234.
natural conditions. Experimental and Applied Acarology 19(4): 199
http://dx.doi.org/10.1051/apido:19990211
-210. http://dx.doi.org/10.1007/BF00130823 MARTIN, S J (1995b) Reproduction of Varroa jacobsoni in cells of Apis
mellifera containing one or more mother mites and the distribution of these cells. Journal of Apicultural Research 34: 187-196. MARTIN, S J (1998) A population model for the ectoparasitic mite
Varroa jacobsoni in honey bee (Apis mellifera) colonies. Ecological Modelling 109: 267–281. http://dx.doi.org/10.1016/S0304-3800(98)00059-3 MARTIN, S J; COOK, C (1996) Effect of host brood type on the
MILANI, N (2001) Activity of oxalic and citric acids on the mite Varroa
destructor in laboratory assays. Apidologie 32: 127–138. http://dx.doi.org/10.1051/apido:2001118 MILANI, N (2002) Chemical communication in the honey bee - varroa relationship. In R Jones (Ed.). Proceedings of the sixth European
Bee Conference “Bees without frontiers, Cardiff, UK, 1-5 July 2002. pp 74–85. MILANI, N; CHIESA, F (1990) Some stimuli inducing oviposition in
Varroa jacobsoni Oud. In Proceedings of the International
number of offspring laid by the honey bee parasite Varroa
Symposium on recent research on bee pathology, Gent, Belgium.
jacobsoni. Experimental and Applied Acarology 20: 387-390.
pp. 34-36.
http://dx.doi.org/10.1007/BF00130551 MARTIN, S J; KRYGER, P (2002) Reproduction of Varroa destructor in South African honey bees: does cell space influence varroa male survivorship? Apidologie 33: 51-61. http://dx.doi.org/10.1051/apido: 2001007 MARTIN, S J; MEDINA, L M M (2004) Africanized honey bees possess
MILANI, N; DELLA VEDOVA, G (1996) Determination of the LC50 in the mite Varroa jacobsoni of the active substances in Perizin and Cekafix. Apidologie 27: 175–184. http://dx.doi.org/10.1051/apido:19960306 MILANI, N; DELLA VEDOVA, G (2002) Decline in the proportion of mites resistant to fluvalinate in a population of Varroa destructor
unique tolerance to varroa mites. Trends in Parasitology. 20: 112-
not treated with pyrethroids. Apidologie 33: 417–422.
114. http://dx.doi.org/10.1016/j.pt.2004.01.001
http://dx.doi.org/10.1051/apido:2002028
MARTIN, S J; HIGHFIELD, A C; BRETTELL, L; VILLALOBOS, E M; BUDGE, G C; POWELL, M; NIKAIDO, S; SCHROEDER, D C (2012) Global honey bee viral landscape altered by a parasitic mite.
Science 336: 1304-1306. http://dx.doi.org/10.1126/science.1220941 MAUL, V; KLEPSCH, A; ASSMANN-WERTHMÜLLER, U (1988) Das Bannwabenverfahren als Element Imkerlicher Betriebweise bei
MILANI, N; DELLA VEDOVA, G; NAZZI, F (2004) (Z)-8-Heptadecene reduces the reproduction of Varroa destructor in brood cells.
Apidologie 35: 265-273. NAVAJAS, M; ANDERSON, D L; DE GUZMAN, L I; HUANG, Z Y; CLEMENT, J; ZHOU, T; LE CONTE, Y (2010) New Asian types of
Varroa destructor: a potential new threat for world apiculture. Apidologie 41: 181-193. http://dx.doi.org/10.1051/apido:2009068
starkem Befall mit Varroa jacobsoni Oud. Apidologie 19: 139–154. NAZZI, F; MILANI, N (1994) A technique for reproduction of Varroa MEDINA, L M M; MARTIN, S J (1999) A comparative study of Varroa
jacobsoni reproduction in worker cells of honey bees (Apis
jacobsoni Oud. under laboratory conditions. Apidologie 25: 579-584 NAZZI, F; MILANI, N; DELLA VEDOVA, G; NIMIS, M (2001)
mellifera) in England and Africanized bees in Yucatan, Mexico.
Semiochemicals from larval food affect the locomotory behaviour
Experimental and Applied Acarology 23: 659-667.
of Varroa destructor. Apidologie 32: 149–155.
http://dx.doi.org/10.1023/A:1006275525463
http://dx.doi.org/10.1051/apido:2001120
MEDRZYCKI, P; GIFFARD, H; AUPINEL, P; BELZUNCES, L P;
NAZZI, F; MILANI, N; DELLA VEDOVA, G (2004) A semiochemical
CHAUZAT, M-P; CLAßEN, C; COLIN, M E; DUPONT, T; GIROLAMI,
from larval food influences the entrance of Varroa destructor into
V; JOHNSON, R; LECONTE, Y; LÜCKMANN, J; MARZARO, M;
brood cells. Apidologie 35: 403–410.
PISTORIUS, J; PORRINI, C; SCHUR, A; SGOLASTRA, F; SIMON
http://dx.doi.org/ 10.1051/apido:2004023
DELSO, N; STEEN VAN DER, J; WALLNER, K; ALAUX, C; BIRON, D NAZZI, F; BORTOLOMEAZZI, R; DELLA VEDOVA, G; DEL PICCOLO, F; G; BLOT, N; BOGO, G; BRUNET, J-L; DELBAC, F; DIOGON, M; EL
ANNOSCIA, D; MILANI, N (2009) Octanoic acid confers to royal
ALAOUI, H; TOSI, S; VIDAU, C (2013) Standard methods for
jelly varroa-repellent properties. Naturwissenschaften 96: 309-
toxicology research in Apis mellifera. In V Dietemann; J D Ellis; P
314. http://dx.doi.org/10.1007/s00114-008-0470-0
Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
NAZZI, F; BROWN, S P; ANNOSCIA, D; DEL PICCOLO, F; DI PRISCO,
methods for Apis mellifera research. Journal of Apicultural
G; VARRICCHIO, P; DELLA VEDOVA, G; CATTONARO, F; CAPRIO,
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.14
E; PENNACCHIO, F (2012) Synergistic parasite-pathogen
MILANI, N (1995) The resistance of Varroa jacobsoni Oud. to
interactions mediated by host immunity can drive the collapse of
pyrethroids - a laboratory assay. Apidologie 26: 415–429.
honey bee colonies. PLoS Pathogens 8(6): e1002735.
http://dx.doi.org/10.1051/apido:19950507
http://dx.doi.org/10.1371/journal.ppat.1002735
The COLOSS BEEBOOK: varroa
OIE (2008) Chapter 2.2.7. Varoosis of honey bees. In OIE. Manual of
53
SCHÄFER, M O; RITTER, W; PETTIS, J S; NEUMANN, P (2010) Winter
Diagnostic Tests and Vaccines for Terrestrial Animals (mammals,
losses of honey bee colonies (Apis mellifera): The role of
birds and bees), vol. 1, OIE, (Sixth Edition). Paris, France. pp 424-430.
infestations with Aethina tumida and Varroa destructor. Journal of
OLDROYD, B P (1999) Co-evolution while you wait: Varroa jacobsoni,
Economic Entomology 103: 10-15.
a new parasite of western honey bees. Trends in Ecology and
http://dx.doi.org/10.1603/EC09233
Evolution 14: 312-315. http://dx.doi.org/10.1016/S0169-5347(99)01613-4 OLDROYD, B P; WONGSIRI, S (2006) Asian honey bees: biology,
conservation and human interactions. Harvard University Press. OSTIGUY, N; SAMMATARO, D (2000) A simplified technique for counting Varroa jacobsoni Oud. on sticky boards. Apidologie 31: 707-716. http://dx.doi.org/10.1051/apido:2000155 OUDEMANS, A C (1904) Note VIII. On a new genus and species of parasitic Acari. Notes Leyden Museum 24: 216-222. PIRK, C W W; DE MIRANDA, J R; FRIES, I; KRAMER, M; PAXTON, R; MURRAY, T; NAZZI, F; SHUTLER, D; VAN DER STEEN, J J M; VAN DOOREMALEN, C (2013) Statistical guidelines for Apis mellifera
SHIMANUKI, H; CALDERONE, N W; KNOX, D A (1994) Parasitic mite syndrome: the symptoms. American Bee Journal 134: 827-828. SOKAL, R R; ROHLF, F J (1995) Biometry: the principles and practice
of statistics in biological research (3rd Ed.). Freeman and Co; New York, USA. 887 pp. SOLIGNAC, M; CORNUET, J-M; VAUTRIN, D; LE CONTE, Y; ANDERSON, D; EVANS, J; CROS-ARTEIL, S; NAVAJAS, M (2005) The invasive Korea and Japan types of Varroa destructor, ectoparasitic mites of the western honey bee (Apis mellifera), are two partly isolated clones. Proceeding of the Royal Society B 272: 411-419. http://dx.doi.org/10.1098/rspb.2004.2853 STEINER, J; DITTMANN, F; ROSENKRANZ, P; ENGELS, W (1994) The
research. In V Dietemann; J D Ellis; P Neumann (Eds) The
first gonocycle of the parasitic mite (Varroa jacobsoni) in relation
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
to preimaginal development of its host, the honey bee (Apis
research. Journal of Apicultural Research 52(4):
mellifera carnica). Invertebrate Reproduction and Development.
http://dx.doi.org/10.3896/IBRA.1.52.4.13
25: 175-183.
RICKLI, M; DIEHL, P A; GUÉRIN, P M (1994) Cuticle alkanes of honey
STRANGE, J P; SHEPPARD, W S (2001) Optimum timing of miticide
bee larvae mediate arrestment of bee parasite Varroa jacobsoni.
applications for control of Varroa destructor (Acari: Varroidae) in
Journal of Chemical Ecology 20: 2437–2453.
Apis mellifera (Hymenoptera: Apidae) in Washington state, USA.
RICKLI, M; GUÉRIN, P M; DIEHL, P A (1992) Palmitic acid released
Journal of Economic Entomology 94: 1324- 1331.
from honey bee worker larvae attracts the parasitic mite Varroa
TOPOLSKA, G; GAJDA, A; POHORECKA, K; BOBER, A; KASPRZAK, S;
jacobsoni on a servosphere. Naturwissenschaften 79: 320–322.
SKUBIDA, M; SEMKIW, P (2010) Winter colony losses in Poland.
RITTER, W (1981) Varroa disease of the honey bee Apis mellifera.
Bee World 62: 141-153. ROCHE LEXICON MEDIZIN (1999) Trypanblau, engl. trypan blue, zur
Vitalprüfung (4th Ed.). Urban & Fischer Verlag; München, Germany. ROSENKRANZ, P (1993) A bioassay for the test of the host finding behaviour of Varroa jacobsoni. Apidologie 24: 486–488. ROSENKRANZ, P; AUMEIER, P; ZIEGELMANN, B (2010) Biology and control of Varroa destructor. Journal of Invertebrate Pathology 103: S96-S119. http://dx.doi.org/10.1016/j.jip.2009.07.016 ROSENKRANZ, P; BARTALSKY, H (1996) Reproduction of varroa
Journal of Apicultural Research 49: 126-128. http://dx.doi.org/10.3896/IBRA.1.49.1.27 TROUILLER, J; MILANI, N (1999) Stimulation of Varroa jacobsoni Oud. oviposition with semiochemicals from honey bee brood. Apidologie 30: 3–12. VANENGELSDORP, D; HAYES JR, J; UNDERWOOD, R M; CARON, D; PETTIS, J (2011) A survey of managed honey bee colony losses in the USA, fall 2009 to winter 2010. Journal of Apicultural Research 50: 1-10. http://dx.doi.org/10.3896/IBRA.1.50.1.01 VANENGELSDORP, D; EVANS, J D; SAEGERMAN, C; MULLIN, C;
females after long broodless periods of the honey bee colony
HAUBRUGE, E; NGUYEN, B K; FRAZIER, M; FRAZIER, J; COX-
during summer. Apidologie 27: 288-289.
FOSTER, D; CHEN, Y; UNDERWOOD, R; TARPY, D R; PETTIS, J S
SAMMATARO, D; DE GUZMAN, L; GEORGE, S; OCHOA, R (2013) Standard methods for tracheal mites research. In V Dietemann; J
D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.20 SCHULZ, A E (1984) Reproduction and population dynamics of the
(2009) Colony Collapse Disorder: A descriptive study. PLoS ONE 4 (8): e6481. http://dx.doi.org/10.1371/journal.pone.0006481 WARRIT, N; LEKPRAYOON, C (2011) Asian honey bee mites. In R
Hepburn; S Radloff (Eds). Honey bees of Asia. Springer; Heidelberg, Germany. pp 347-368 WARRIT, N; SMITH, D R; LEKPRAYOON, C (2006) Genetic subpopulations of varroa mites and their Apis cerana hosts in
parasitic mite Varroa jacobsoni Oud. and its dependence on the
Thailand. Apidologie 37: 19-30.
brood cycle of its host Apis mellifera L. [in German]. Apidologie
http://dx.doi.org/10.1051/apido:2005051.
15: 401-420. http://dx.doi.org/10.1051/apido:19840404.
Dietemann et al.
54
WILKINSON, D; THOMPSON, H M; SMITH, G C (2001) Modelling
ZIEGELMANN, B; LINDENMAYER, A; STEIDLE, J; ROSENKRANZ, P
biological approaches to controlling varroa populations. American
(2012). The mating behaviour of Varroa destructor is triggered by
Bee Journal 141: 511–516.
a female sex pheromone. Part 1: Preference behaviour of male
WILLIAMS, G R; ALAUX, C; COSTA, C; CSÁKI, T; DOUBLET, V; EISENHARDT, D; FRIES, I; KUHN, R; MCMAHON, D P; MEDRZYCKI, P; MURRAY, T E; NATSOPOULOU, M E; NEUMANN, P; OLIVER, R; PAXTON, R J; PERNAL, S F; SHUTLER, D; TANNER, G; VAN DER STEEN, J J M; BRODSCHNEIDER, R (2013) Standard methods for maintaining adult Apis mellifera in cages under in
vitro laboratory conditions. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.04
mites in a laboratory bioassay. Apidologie. http://dx.doi.org/10.1007/s13592-012-0182-5
Journal of Apicultural Research 52(1): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.1.10
REVIEW ARTICLE
Standard methods for wax moth research
James D Ellis1*, Jason R Graham1 and Ashley Mortensen1 1
Honey Bee Research and Extension Laboratory, Department of Entomology and Nematology, University of Florida, Steinmetz Hall, Natural Area Dr., P.O. Box 110620, Gainesville, FL, 32611, USA. Received 7 July 2012, accepted subject to revision 16 July 2012, accepted for publication 14 November 2012. *Corresponding author: Email: jdellis@ufl.edu
Summary Greater (Lepidoptera: Pyralidae, Galleria mellonella) and Lesser (Lepidoptera: Pyralidae, Achroia grisella) wax moths are ubiquitous pests of honey bee colonies globally. The economic importance of wax moths has led to a number of investigations on wax moth life history, biology, behaviour, ecology, molecular biology, physiology, and control. Despite the importance of wax moths to the apicultural industry, they are investigated considerably more as a model organism for studies in insect physiology, genomics, proteomics, etc. Those studying wax moths from an apicultural perspective typically use only a small number of the total available research methods outlined in the literature. Herein, we describe methods associated with wax moth research that we feel are important from an apicultural research perspective. Ultimately, we hope that this paper will revitalize research on wax moths, since they remain both an important honey bee colony pest and an interesting colony symbiont.
Métodos estándar para la investigación de la polilla de la cera Resumen Las polillas de la cera grande (Lepidoptera: Pyralidae, Galleria mellonella) y pequeña (Lepidoptera: Pyralidae, Achroia grisella) son una plaga ubicua de las colonias de abejas al nivel mundial. La importancia económica de las polillas de la cera ha dado lugar a una serie de investigaciones sobre la historia de la vida de la polilla de la cera, la biología, el comportamiento, la ecología, la biología molecular, la fisiología y su control. A pesar de la importancia de la polilla de la cera en la industria apícola, se ha investigado mucho más como un organismo modelo para estudios de fisiología de insectos, genómica, proteómica, etc. Aquellos que estudian las polillas de la cera desde una perspectiva apícola suelen utilizar sólo un reducido número de métodos de investigación del total descrito en la literatura. En este documento, se describen los métodos asociados a la investigación de la polilla de la cera que creemos que son importantes desde una perspectiva de investigación apícola. En última instancia, esperamos que este documento revitalice la investigación sobre las polillas de la cera, ya que siguen siendo una plaga importante de las colonias de la abeja de la miel y un interesante simbionte de las colonias.
蜡螟研究的标准方法 大蜡螟(Lepidoptera: Pyralidae, Galleria mellonella)和小蜡螟(Lepidoptera: Pyralidae, Achroia grisella)是全球范围内蜂群中普遍存在的害 虫。其重要的经济价值引起了在蜡螟生活史、生物学、行为学、生态学、分子生物学、生理学以及控制方法方面的研究。尽管蜡螟对养蜂业有重 要影响,但它们还是更多的被用作模式昆虫研究昆虫生理学、基因组学、蛋白质组学等。从养蜂业的角度研究蜡螟仅涉及了大量文献中的少数研 究方法。因此,我们挑选了我们认为对养蜂业而言十分重要的研究蜡螟的方法,希望能够促进对蜡螟的研究。至今,蜡螟仍是重要的蜂群害虫和 蜂群共生生物。 Keywords: wax moth, Galleria mellonella, Achroia grisella, rearing, identification, control, BEEBOOK, COLOSS, honey bee
Footnote: Please cite this paper as: ELLIS, J D; GRAHAM, J R; MORTENSEN, A (2013) Standard methods for wax moth research. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.10
Ellis et al.
2
1.
Introduction
2.1. Wax moth eggs
Greater (Lepidoptera: Pyralidae, Galleria mellonella) and Lesser
Greater wax moth eggs are pearly white to light pink in colour and have
(Lepidoptera: Pyralidae, Achroia grisella) wax moths are ubiquitous
a rough texture due to wavy lines running diagonally at regular intervals
pests of honey bee (Apis mellifera) colonies globally. The larvae of
(Figs. 1 and 2). The surface texture of greater wax moth eggs differs
both moths are pests of honey bee colony wax combs, especially in
from that of lesser wax moth eggs (Fig. 1; Table 1) and can be used
stressed colonies, and can cause significant damage to stored
as a diagnostic between the two. Other comparisons between eggs of
beekeeping equipment. The economic importance of wax moths has
the two species are made in Table 1. In most cases, greater wax
led to a number of investigations on wax moth life history, biology,
moth females oviposit in clumps of 50-150 eggs (Williams, 1997).
behaviour, ecology, molecular biology, physiology, and control.
Throughout development, the egg changes from white to a yellowish
Despite the importance of wax moths to the apicultural industry,
colour. At approximately 4 days prior to hatching, the greater wax
they are investigated considerably more as a model organism for
moth larva is visible as a dark ring within the egg. Twelve hours prior
studies in insect physiology, genomics, proteomics, etc. This is
to hatching, the fully formed larva is visible through the egg chorion
especially true for greater wax moths. Consequently, there are
(Paddock, 1918). According to Williams (1997), greater wax moth eggs
thousands of literature references on wax moths and, correspondingly, develop quickly at warm temperatures (29°C-35°C) and more slowly possibly hundreds of research techniques associated with the insect.
by about 30 days at cold temperatures (18°C). Eggs will not survive in
Those studying wax moths from an apicultural perspective typically
extreme cold (at or below 0°C for 4.5 hours) or extreme heat (at or
use only a small number of the total available research methods
above 46°C for 70 minutes). SEM images comparing the eggs of the
outlined in the literature.
lesser and greater wax moths are available in Arbogast et al. (1980)
Herein, we describe research methods commonly used by people
and in Fig. 1.
investigating wax moths from an apicultural perspective. It is important to note that developing a compendium of all methods related to wax moth research is beyond the scope and purpose of this paper. There simply are too many methods and manuscripts to include in such a reference. Indeed, research methods related to wax moths could be outlined in an entire book dedicated to the subject. Instead, we describe methods we feel are important from an apicultural research perspective. We hope that this paper will revitalize research on wax moths, since they remain both an important honey bee colony pest and an interesting colony symbiont.
2. Identification of greater and lesser wax moths “Wax moth” is the common name for a variety of moths that invade, occupy and damage bee hives, though two species are known to impact honey bee colonies specifically. The wax moth has also been called the bee moth, the wax (or bee) miller, the waxworm or
Fig. 1. The eggs of the greater and lesser wax moths. Lesser wax moth egg lateral view: A. magnification = 110x; and B. close up of micropylar area, magnification = 560x. Greater wax moth egg lateral view: C. magnification = 110x); and D. close up of micropylar area, magnification = 560x. From Arbogast et al., 1980: original images provided by T Arbogast.
webworm. The greater wax moth is the more destructive and common comb pest whilst the lesser wax moth is both less prevalent and less
2.2. Wax moth larvae
destructive. Both wax moth species undergo complete metamorphosis. Upon hatching, the greater wax moth larva is an off-white colour and They have four stages of development: egg; larva; pupa; and adult.
1-3 mm in length (Table 1; Fig. 2). The newly hatched larva immediately
With proper training, one can recognize the differences between
begins to eat and spin webbing (Fig. 3). The head capsule is yellowish
greater and lesser wax moths of all life stages. Most of our discussion
and smaller than the more pronounced prothoracic segment (Paddock,
of wax moth in this document concerns the greater wax moth, since it is 1918). The presence of stemmata on the head (Fig. 4) and the the more investigated of the two species. Nevertheless, we do include
appearance of the spiracles (Fig. 5) can be used to differentiate
information on lesser wax moths where known and appropriate,
between greater and lesser wax moth larvae. The thoracic legs are
especially in Table 1 where diagnostic characteristics between greater
well developed when the larva first emerges but the abdominal legs
and lesser wax moths are listed.
are not visible until the larva is about 3 days old. A greater wax moth larva moults 7 times throughout its development.
The COLOSS BEEBOOK: wax moths
3
Table 1. General characteristics of greater and lesser wax moth life stages. Lesser Wax Moth Eggs size description
0.41 ± 0.02 × 0.31 ± 0.01 mm (l × w) nearly spherical creamy-white in color
Greater Wax Moth Eggs
1
0.44 ± 0.04 × 0.36 ± 0.02 mm (l × w)1
2
spheroid to ellipsoid, ovoid or obovoid, pink-cream white in clusters of 50-150 eggs2
length in life stage
7-22 days, depending on environmental conditions; 7.1 ± 1.0 days3
3 - 30 days depending on environmental conditions2
diagnostic characters
“Reticulation limited to anterior end, carinae surrounding primary cells conspicuously broader around outer margins of cells”1 (Fig. 1)
“Reticulation at least faintly visible over entire surface, carinae surrounding primary cells of uniform width”1 (Fig. 1)
Lesser Wax Moth Larvae
Greater Wax Moth Larvae
1-20 mm long; fully grown = 18.8 ± 0.4 mm (length)3
first instar = 1-3 mm (length) fully grown = 12-20 mm (length), 5-7 mm diameter2
description
narrow white bodies with brown heads and pronotal shields2
creamy-white with gray to dark gray markings, a small slightly pointed, reddish head2 (Figs. 6, 7, and 9)
length in life stage
6-7 weeks at 29° to 32°C; 30.10 ± 2.5 days3
6-7 weeks at 29° to 32°C2
diagnostic characters
“Stemmata absent (Fig. 4); spiracle with black peritreme thicker on caudal margin”4 (Fig. 5)
“Head with 4 stemmata on each side (Fig. 4); spiracle with yellowish peritreme of uniform thickness”4 (Fig. 5)
Size
Lesser Wax Moth Pupae
Greater Wax Moth Pupae 3
12-20 mm in length & 5-7 mm in width2
Size
11.3 ± 0.4mm in length & 2.80 ± 1.89 mm in width
description
yellow-tan pupa in a white cocoon often covered in frass and other debris2
dark reddish brown pupa in an off-white, parchment-thick cocoon2 (Fig. 9)
length in life stage
37.3 ± 1.2 days3
6-55 days depending on environmental conditions2
Lesser Wax Moth Adults
Greater Wax Moth Adults
size
male = 10 mm long female = 13 mm long
15 mm (length) with a 31 mm average wingspan
description
small, silver-bodied with a conspicuously yellow head, oval heavy-bodied, reddish brown with mottled forewings and shaped forewings and heavily fringed hind wings2 pale cream-colored lightly fringed hind wings2
lifespan
female = 6.90 ± 1.135 days male = 12.90 ± 1.30 days3
female = ~ 12 days male = ~ 21 days2
diagnostic characters
“Forewing breadth less than 5 mm; termen of forewing convex (hindwing of male with concave termen); Cu of hindwing apparently 3-branched; labial palps conspicuous though short (length not exceeding diameter of eye); labial palps of male transversely incurved, pincerlike”4 (Figs. 11 and 12)
“Forewing breadth 5 to 7 mm; termen of forewing concave; Cu of hindwing apparently 4-branched; labial palp long (about as long as longest leg spur) and protruding” (Figs. 11 and 12)4
1
Arbogast et al. 1980 Williams, 1997 3 Sharma et al. 2011 4 Ferguson, 1987 2
Most of the growth and size increase happens during the final 2 instars. Larval development lasts 6-7 weeks at 29°-32°C and high humidity. A mature greater wax moth larva (Figs. 6 and 7) is approximately 20 mm in length (Paddock, 1918). Its body is grey in colour with a brown prothoracic shield having a broad band across it. The head is slightly pointed, small, and reddish with a v-shaped line opening towards the front of the head (Paddock, 1918). A greater wax moth larva goes through 8-9 stages (moults) over the course of its development at 33.8°C (Chase, 1921; Charriere and Imdorf, 1999). Mature greater wax moth larvae are capable of boring into wood and often make boat-shaped indentations in the woodenware of the hive body or frames (Fig. 8). After finding a place in the hive to pupate,
Fig. 2. Greater wax moth eggs (cream-coloured, globular structures,
the larva begins spinning silk threads that will become the cocoon
left arrow) and 1st instar larva (right arrow).
(Fig. 9), which they attach to the excavated indentations (Paddock,
Photograph: Lyle Buss, University of Florida. 1918). One often finds many of the cocoons congregated in areas
Ellis et al.
4
Fig. 3. Greater wax moth damage to wax comb. Note the larval frass and webbing.
Photograph: Lyle Buss, University of Florida.
Fig. 6. Greater wax moth larva in a wax cell from the brood nest. Photograph: Lyle Buss, University of Florida.
Fig. 4. Diagnostic characteristics on the head of greater and lesser wax moth larvae: A. The greater wax moth larvae head has four stemmata on both sides (small, pale ovals are arrowed); B. is redrawn from Ferguson 1987 and shows the location of the four stemmata. The lesser wax moth head: C. does not have the four stemmata (also shown in D. redrawn from Ferguson, 1987). Photographs (A and C): Lyle Buss, University of Florida.
Fig. 7. Greater wax moth larvae eating wax comb down to the plastic foundation. Notice the characteristic webbing and frass associated with the feeding behavior. Photograph: Lyle Buss, University of Florida.
Fig. 5. Diagnostic characteristics on the spiracle of greater and lesser wax moth larvae: A. The greater wax moth larvae spiracle has a yellowish peritreme (arrowed, pale) of uniform thickness (also shown in the inset image redrawn from Ferguson 1987); B. The lesser wax moth spiracle Fig. 8. Wax moth damage to woodenware. The larvae excavate furrows has a black peritreme that is thicker on the caudal margin (arrowed,
in the wood and they attach their cocoons to these furrows. Notice
also shown in the inset image redrawn from Ferguson 1987).
the boat-shaped indentations in the wall of the hive.
Photographs: Lyle Buss, University of Florida.
Photograph: Ashley Mortensen, University of Florida.
The COLOSS BEEBOOK: wax moths
5
Fig. 10. Greater wax moth pupal cocoons. They are clumped together on the side wall of a brood super. Photograph: Lyle Buss, University of Florida.
Fig. 9. Greater wax moth larvae (top), pupa (middle), and cocoon (bottom).
Photograph: Lyle Buss, University of Florida.
around the perimeter of the bee nest in high infestations (Fig. 10). After hardening, the outer layer of the cocoon is somewhat tough
Fig. 11. Greater (left) and lesser (right) wax moth adults. (upper left)
while the inside remains soft and padded. Cocoon construction times
greater wax moth male, (lower left) greater wax moth female, (upper
can be variable due to temperature and humidity though the average
right) lesser wax moth male, (lower right) lesser wax moth female.
cocoon construction takes 2.25 days to complete (Paddock, 1918).
Photograph is to scale. Photographs: Lyle Buss, University of Florida.
The larva becomes less active as the cocoon is constructed. The larva creates an incision point in the cocoon near the head through which
greater wax moths varies with season and temperature from 6 to 55
to escape as a fully formed adult (Paddock, 1918). Greater wax moth
days (Williams, 1997).
larvae tend to congregate in the hive whereas the lesser wax moth larvae are more likely to be found individually in tunnels within the
2.4. Wax moth adult
comb (Williams, 1997).
The adult greater wax moth is approximately 15 mm long with a 31 mm average wingspan. The wings are grey in colour, though the hind
2.3. Wax moth pupae
third of the wing, normally hidden, is bronze coloured (Fig. 11). The
The developmental time of greater wax moths from larvae to pupae
wing venation patterns can be used as a diagnostic between greater
within the cocoon ranges from 3.75 days to 6.4 days depending on
and lesser wax moths (Ferguson, 1987; Fig. 12). Male greater wax
temperature. Inside the cocoon, the newly formed pupa is white and
moths are slightly smaller than females, lighter in colour, and have an
becomes yellow after ~ 24 hours (Paddock, 1918). After 4 days have
indented, scalloped front wing margin in contrast to the females that
passed, the pupa becomes a light brown that gradually darkens, becoming have a straight front wing margin (Paddock, 1918). The female antennae dark brown by the end of pupation (Fig. 9). Pupae of the greater wax
are 10-20% longer than those of the male (Paddock, 1918). Greater
moth range in size from 5 mm to 7 mm in diameter and 12 mm to 20
wax moths emerge as adults in early evening and find a protected
mm in length (Paddock, 1918). A row of spines develops from the
place to expand and dry their wings. Greater wax moths do not feed
back of the head to the fifth abdominal segment and the bodyline
as adults and the females live ~12 days while the males live ~21 days
curves downward (Paddock, 1918). The pupal development stage of
(Paddock, 1918).
Ellis et al.
6
the initial moths can be obtained from infested honey bee colonies or purchased commercially. Outlined here is the general rearing method of wax moths with modifications for method improvement indicated where appropriate.
3.1. Natural rearing method 1. Create a bee-free hive with frames of pulled, dark comb (dark comb is comb in which brood has been reared) containing honey and pollen. 2. Introduce three, late instar larval wax moths per frame to ensure wax moth presence (Hood et al., 2004). 3. The hive and combs should be covered and under some type
Fig. 12. The fore- and hind wings of the greater: A. forewing; B.
of shelter to protect it from rain. Darkness, warmth, and lack
hind wing; and lesser: C. forewing; D. hind wing wax moths. The
of ventilation promote colonization.
forewing breadth is 5-7 mm for greater wax moths. The termen of the greater wax moth forewing is concave while the Cu of the hind wing is 4-branched. The forewing breadth is less than 5 mm for the lesser
4. Unattended (bee-free) hives will be highly attractive to adult wax moths if they are present in the area (Hood et al., 2004) 5. Provide additional used honeycomb containing honey and
wax moth. The lesser wax moth forewing termen is convex and the
pollen as diet for rearing program as the food supply in the
Cu of the hind wing is 3-branched. Figure text and redrawn images
box is exhausted.
are from Ferguson 1987.
6. Moth eggs, larvae, pupae and adults can be collected from the hive with an aspirator, forceps, or a small, soft paintbrush.
2.5. Wax moth mating behaviour
The latter should be used for the immature wax moth stages
Mating occurs shortly after adult emergence. Both the lesser and
since they can be damaged easily.
greater wax moth males attract the females by producing short ultrasonic signals. The male calls promote wing fanning by the females. This
3.2. in vitro rearing of wax moths
wing fanning causes pheromone release by males, leading to approach Most in vitro lab rearing techniques follow a simple series of events: by females prior to copulation (Spangler, 1984, 1985, 1987; Jones et al.,
1. Place wax moth eggs on new diet.
2002).
2. Allow resulting larvae to feed on diet. 3. Harvest late instar larvae or pupa and place into a second
2.6. Wax moth oviposition
container.
Female greater wax moths search for a crevice in which to lay their
4. Allow late instar larva to pupate or pupa to emerge as adults.
eggs. When a suitable location is found, the female extends her body
5. Allow adults to mate and allow females to lay eggs.
in order to reach her ovipositor as deep into a crevice as possible. In
6. Place eggs on new diet.
laboratory studies, the females continued oviposition from 3-13 days
Methods to accomplish these steps are described in subsequent
(Paddock, 1918). The female greater wax moth can oviposit over
sections.
2,000 eggs in her lifetime, though the average is ~700 eggs (Warren and Huddleston, 1962). The female lesser wax moth will oviposit
3.2.1. Diet
250-300 eggs during her 7 day adult lifespan (Williams, 1997).
Both the greater and lesser wax moths feed only in the larval life stage. In nature, the larvae develop in bee colonies and feed on pollen,
3. Rearing wax moths
honey, cast larval skins and other debris incorporated into the wax
Wax moth rearing methods are used in a variety of fields from molecular
them with sections of wax comb. This is useful because it provides the
genetics and physiology to the simple production of wax moth larvae
moths with what they ordinarily use. However, the production and use
for reptile, bird food, and fish bait. Consequently, there are countless
of wax comb can be expensive and unsustainable if a large number of
rearing methods available in the scientific literature as well as on
wax moths are desired.
hobbyist web sites, making it difficult to recognize a “standard” rearing method. Nevertheless, most rearing methods are very similar and
comb. One method for feeding wax moth larvae is simply to provide
Correspondingly, many variations on a generalized artificial diet have been developed. We include three here. The first two are reported
share common components. We do our best to summarize a “standard” frequently in the literature while the third was provided by a reviewer method for rearing greater wax moths. To begin a rearing programme, with experience using the diet.
The COLOSS BEEBOOK: wax moths
Diet 1:
7
wood, cardboard, and paperboard should be avoided as the larvae
1. Blend a mixture of:
can chew through them.
1.1.
white honey (150 ml),
1.2.
glycerine (150 ml)
3.2.4. Container sterilization
1.3.
tap water (30 ml).
The containers should be sterilized before and between uses by boiling
2. Add 420 g pablum (bran).
or autoclaving. Proper cleaning and sterilization of the cages will help
3. Add 20 g ground brood comb.
to reduce the incidence of disease. Rearing wax moths in several
The resulting diet has the consistency of damp sawdust (Bronskill,
containers will allow for infested batches to be discarded without
1961). Coskun et al., (2006) provide an analysis of this diet with
shutting down overall production. It is best to discard containers with
several modifications resulting in larval weight gain or loss based on
serious problems rather than attempt to salvage them. Cheap containers,
the modifications.
such as those used commonly in kitchens to store food, can be
Diet 2: (Jones et al., 2002)
discarded after first use.
1. Mix 300 ml liquid honey with
2. 400 ml glycerol,
3.2.5. Eggs
3. Mix with 200 ml milk powder,
Multiple male and female moths should be placed in containers having
4. 200 g whole-meal coarse flour
diet mixtures. Females will begin laying eggs within hours of mating.
5. 100 g dried brewer’s yeast,
Consider the temperature when designing an oviposition chamber to
6. 100 g wheat germ,
speed or slow egg development. Eggs develop quickly at warmer
7. 400 g bran.
temperatures (29°C-35°C) and slowly (up to 30 days or more) at
Diet 3:
colder temperatures (18°C, Williams, 1997). The female will lay eggs
1. Mix seven parts (by volume) dry dog kibble,
on any surface but prefer surfaces that seem to protect the eggs and
2. One part water,
will preferentially lay in cracks and crevices. Several rearing programs
3. Two parts honey.
recommended using crimped wax paper held together with a paper
4. You can adjust the vitamin A content to produce whitish
clip, as the eggs can be easily removed from the surface of the wax
larvae.
paper once unfolded (as in Burges and Bailey, 1968). About 1,000 eggs placed with about 1-1/2 pounds of diet should yield about 500 mature
3.2.2. Environment
larvae (Marston et al., 1975).
Wax moths, as adults, are nocturnal insects that fly at night and hide in dark places during the day. Wax moths thrive in dark, warm, poorly 3.2.6. Larva ventilated areas that are not well defended by honey bees. As such,
Crumpled paper towels, wax paper or corrugated cardboard can be
~30°C, ~70% RH and constant darkness are recommended in most
added to the larval container after the first mature larvae begin to
manuscripts where rearing is discussed. Warren and Huddleston
spin cocoons. The mature larvae will migrate to these materials to
(1962) discuss the effect of humidity and temperature on various life
spin their cocoons. Eischen and Dietz (1990) observed prepupa spinning
stages of greater wax moths.
their cocoon inside cut soda straws, which facilitated subsequent handling, storing, and collection of the pupa. Pupae can be safely
3.2.3. Containers
stored for 2-3 months at 15.5°C and 60% humidity (Jones et al., 2002).
Several types of containers are recommended for use in rearing wax 3.2.7. Pupa
moths.
Larval chamber - containing the eggs, developing larvae, and
If virgin females are needed, it is best to separate the females from
diet
males during the pupal stage as mating can occur shortly after adult
Mating chamber – where adults emerge from their pupal skins emergence. The antennal and wing characteristics used to separate and cocoons and mate
males and female adults (Table 1 and Section 2.4.) can also be seen
Oviposition chamber - where female moths will lay eggs
in the pupal skins upon close examination. Smith (1965) provided two
The size of the containers and method used will largely depend on pupal characteristics which separate greater wax moth males and the scope of the rearing program and the number of wax moths needed. females: Marston et al., (1975) proposed a large mass-rearing program that spanned multiple rooms with diet prepared in a cement mixer and eggs collected by sieve. Waterhouse (1959) used plastic bags sealed with a paper clip. Metal, glass or plastic containers can be used, but
1. The mesowing demarcation has a notch in the apical margin of male pupal cases and is straight in female pupal cases. 2. The sclerite of the 8th abdominal sternum is cloven in the female but not in the male pupal cases.
Ellis et al.
8
3.2.8. Adult The adult will emerge from the cocoon. There are several helpful characteristics that can be used to distinguish between male and female greater wax moths (Table 1 and Section 2.4.). Adult moths will mate within hours of emergence and the mated females will begin egg-laying after mating (Jones et al., 2002).
4. Quantification / qualification of wax moth damage and population 4.1. Qualification of wax moth damage in honey
Fig. 13. Bald brood. Wax moth larvae tunnel under cell cappings, causing worker bees to remove the damaged cappings. Larval tunnels follow a definable pattern along rows of brood cells. Photograph: Ashley Mortensen, University of Florida
bee colonies and stored equipment 4.1.1. Damage to combs Wax moth larvae feed on wax combs, cast larval skins, pollen, and
larvae will chew away wood to create an area for cocoon attachment
some honey (Shimanuki et al., 1992). Dark comb (comb in which
(Williams, 1997). This chewed area can be minor excavations or large
brood has been reared) is preferred by the moth and subsequently
holes (Fig. 8). Such damage is characteristic of wax moths and can
suffers the most damage. The feeding habits of the larvae can reduce
weaken the structural integrity of the woodenware.
the wax combs to a pile of debris, wax moth frass, and webbing (Figs. 3 and 7).
4.2. Quantification of wax moth damage in honey bee colonies and stored equipment
4.1.2. Galleriasis Greater wax moth larvae can tunnel and feed to the midrib of the wax comb. The midrib is the base of the comb on which the cells are
1. Cut a piece of plexi glass or wire mesh with desired mesh size (1 cm for example) to the size of frames or combs being used in the experiments (Hood et al., 2003).
constructed. The feeding larvae produce silken threads that can trap
2. Scribe the plexi glass with a 1 cm grid.
developing honey bee brood in the cells. Trapped bees will uncap
3. Hold the plexi glass grid over both sides of all exposed frames
their brood cell when ready to emerge as adults but will be unable to
4. Quantify the total cm2 of damage (see Section 4.1.).
emerge. The result is a comb containing uncapped bees that struggle to emerge, a condition called galleriasis. Williams (1997) states that
4.3. Quantification of wax moth population
“entire combs of worker bees that have developed from brood of
drawn frames of comb
nearly the same age may be observed trapped in this way”.
1. Carefully dissect comb to recover all larvae, pupae, and adults
4.1.3. Bald brood
2. Quantify number of each life stage present and whether they
(James, 2011). Lesser wax moths (and to a lesser extent greater wax moths) can
are dead or alive.
cause “bald brood” in infected colonies. Lesser wax moth larvae will
Note: If mortality counts are not of interest, frames may be frozen
tunnel just below the surface of brood cells. The cells are uncapped
and stored for later dissection.
and the developing bee pupae inside exposed (Fig. 13). This condition can be confused with general hygienic behaviour where adult bees
4.4. Quantification of wax moth populations in
detected disease / pest-compromised brood and uncap the cells.
whole colonies
However, bald brood usually occurs over multiple cells in a linear
We could not find detailed instructions for quantifying the population
pattern: uncapped brood cells that are adjacent to one another. The
of wax moths in living colonies. The default method would be to
line of damage may turn in any direction based on the tunnelling
freeze the entire colony for at least one week, to ensure wax moth
habits of the larva. There may also be wax moth larva faecal pellets
death, and then dissect the combs (section 4.3.) for careful inspection
on the heads of the developing bee brood.
for and collection of the various wax moth life stages. This procedure likely could be modified by removing the bees from the colony (via
4.1.4. Damage to woodenware
shaking or brushing the combs) prior to freezing the combs. However,
Greater wax moth larvae can cause extensive damage to colony
removing bees from the combs carries with it the added risk of shaking
woodenware, including the frames and supers. After the moth larvae
moth eggs, young larvae, or adults from the comb, thus making it
finish feeding, they look for a place attach their cocoons. Some moth
impossible to quantify the moth populations accurately.
The COLOSS BEEBOOK: wax moths
5. Techniques associated with wax moth control
9
needle, insert the needle into the lateral integument about halfway down the body (be careful not to damage internal organs).
Beekeepers attempt to control wax moth populations in many ways.
Note: Alternatively, microliter cemented needle syringes fitted
This section is not intended to outline all the methods related to
with a 26 gauge needle may be used for microinjections.
controlling wax moths since these vary by region/country. Rather, this
4. Inject a consistent, desired volume into each larva.
section focuses on techniques that are useful for purposes of studying
5. Repeated injections are discouraged because of the size of
wax moth control, i.e. these methods can be used to investigate potential methods of controlling wax moths.
the insect and possible associated damage (Stephens, 1959). 6. Observe specimens for desired change (see Section 5.1. for parameters).
5.1. Physiological parameters measured Wax moths typically are considered a secondary pest of honey bee
Considerations: In microinjection experiments, care should be taken to
colonies. Consequently, there are comparatively fewer investigations
maintain a clean workspace and equipment to limit physiological change
on wax moth control than on more significant honey bee pests such
due to contamination rather than the experimental treatment. One
as Varroa destructor (see the BEEBOOK paper on varroa, Dietemann
should also include controls for the study which include moths injected
et al., 2013), Aethina tumida (see the BEEBOOK paper on small hive
with Ringers solution. Solutions should be prepared so they are
beetles, Neumann et al., 2013), Acarapis woodi (see the BEEBOOK
physiologically compatible with the larval hemocoel. It is possible for
paper on tracheal mites, Sammataro et al., 2013), etc. Most
large injection volumes to cause non-treatment associated effects. West
investigations on wax moth control determine the efficacy of the
and Briggs (1968) had successful results injecting 20 ml bolus volumes
control based on its effects on the following measurable, physiological though a range of injection volumes are reported in the literature. changes in the organism:
Mortality: Death of the wax moth at any life stage. Sufficient
5.3. Incorporation of test compound into the wax
time (a few hours to a few days depending on the target
moth artificial diet
control method) must be allowed in an appropriate rearing
1. Prepare the treatment diet by adding the compound of choice
environment to determine mortality in eggs and pupae.
to the wax moth artificial diet (Burges and Bailey, 1968;
Diet consumption: The amount of diet consumed by developing
Eischen and Dietz, 1987). The diet should be prepared per
larvae. It is ideal for test larvae to be housed individually if
Section 3.2.1. and the compound of interest added as experimental
diet consumption is to be measured.
conditions necessitate.
Changes in development: This includes weight gain (i.e. daily,
2. Obtain moth eggs are by creating an egg laying surface for
weekly, per instar), developmental time (oviposition to egg
mature females (per Section 3.2.5.) out of a piece of wax
hatch, instar to instar, pupation to adult emergence, and/or
paper. The wax paper is folded back and forth, making tight
total time from egg to adult), successful adult emergence, etc.
folds (accordion style), and held closed on the end by a paper
Sterility: Daily and total fecundity of mated females.
clip. The female moths will oviposit in the folds.
Post injection paralysis: The inability of a larva to return to a
3. Once eggs are laid, remove the folded wax paper.
dorsal-ventral position when placed on its dorsum 30 min
4. Tap the eggs into a vial with no food.
after injection.
5. As larvae hatch, move them carefully using a fine brush to a new vial provisioned with either treatment of control artificial
5.2. Injection of test substances into the hemocoel Potential wax moth control agents can be injected directly into the larval hemocoel (West and Briggs, 1968). Possible treatment
diet. 6. Monitor larvae can be for physiological change at set times throughout their development.
compounds include bacterial toxins (such as Bacillus thuringiensis), fungal toxins (i.e. Vilcinskas et al., 1997), insecticides, plant resins,
Considerations: First instar larvae are very small and quite active. It is
etc. This procedure also can be used to initiate immune responses in
important that lids to containers housing individual larvae and eggs be
wax moths and for other purposes beyond simple pest control.
secured tightly to prevent escape. The egg container should be monitored
1. Raise larvae per Section 3 to 100-200 mg/individual.
regularly for newly emerged larvae. The first instar larvae will starve
2. Prepare solutions (treatment and control) per the needs and
quickly without food, and larvae that emerge or die overnight should
conditions of the experiment. 3. Using a calibrated microinjection apparatus with a 27 gauge
be removed from the container each morning.
Ellis et al.
10
5.4. Comb treatment
This can be done either by removing one wax comb from the
The compound(s) of interest can be directly incorporated into melted
box and putting a frame cage (Section 6.7.1.) containing older
wax prior to mill rolling of foundation sheets or applied to previously
moth larvae, pupae and/or adults in its place or by placing
milled foundation (Burges and Bailey, 1968; Burges, 1976; Vandenberg
eggs and young larvae in dish cages (Section 6.7.2.) on top of
and Shimanuki, 1990; Hood et al., 2003, Ellis and Hayes, 2009).
the combs.
1. Application to wax comb foundation: Based on the available form of the compound of interest, it may be sprayed, dipped, aerosolized, or dusted onto previously milled foundation
2. Place an additional open Petri dish containing the fumigant of choice on top of the frames. 3. Insert the super into a sealable container. The container must
sheets per the needs of the experiment. In the past, fogging
be large enough to prevent the death of the wax moths due
(or aerosols) has been shown to be a less effective method
to a build up of CO2. This can be a large plastic container or
for effective application - Vandenbergi and Shimanuki (1990).
even a plastic trash bag. The container should be sealed
2. Once dried, use treated foundation in experiments as is or sandwiched between untreated sheets of foundation and remilled to prevent direct exposure of honey bees in the colony to the test compound in the treated foundation. 3. Insert frames containing treatment and control foundation into healthy colonies for comb construction. The colonies may need to be fed a sucrose solution to encourage bees to construct comb on the foundation.
after the super is inserted. 4. Using silicone rubber and tape, fit one corner of the container with a plastic tube that has a removable, air tight cap. This is done easier if using a plastic bag as the container. 5. Remove the removable cap daily for the insertion of a Drager tube to measure the concentration of the fumigating agent. 6. At the end of the trial, the moth life stages should be monitored for mortality and physiological change (see Section 5.1.).
4. Once drawn, remove the experimental frames from the nest and any honey extracted from the comb. 5. Place newly hatched wax moth larvae (reared per Section 3)
Considerations: A spacer must be used to prevent the trash bag or container lid from lying directly on top of the specimen and fumigation
singly on a small piece of treated or control comb (comb produced dishes. Fumigation efficacy is affected by gas leakage; care should be on untreated foundation) in a dish container,
taken to control for this through diligent sealing of the container
6. Incubate at 34°C,
(Goodman et al., 1990). The investigator can determine compound,
7. Monitor for physiological changes.
dose, temperature, and time effects on moth mortality.
Alternatively, hive boxes containing frames of treated comb, but no bees, can be inoculated with wax moths and the level of damage 5.5.2. Controlled release of liquid or crystalline compounds assessed (per Section 4). Considerations: Compound concentrations should be determined for drawn comb after removal from the colony as honey bees will
Per Burgett and Tremblay (1979).
5.5.2.1. Construction of dispersal packs 1. The test compound can exist as a crystal or be a liquid
distribute wax from foundation throughout the comb (Burges and
impregnated onto a piece of fibreboard or similar material.
Bailey, 1968). Test compound impacts on honey bee colony fitness
2. Seal the compound, either in crystal or impregnated fibreboard
and/or behaviour should be accessed. Recommended methods for
form, in small packets of porous materials.
measuring colony strength parameters can be found in the BEEBOOK paper on measuring colony strength parameters (Delaplane et al., 2013). If incorporating the compound directly into melted wax prior to milling, one must know heat impacts on the compound. The average
5.5.2.2. Determination of the permeation rate 1. Hang dispersal packets in a controlled environmental chamber and monitor for weight loss.
temperature used to melt wax for milling machines has been reported
2. Calculate permeation rate = packet weight loss/elapsed time.
to range from 77-99°C (Burges and Bailey, 1968).
3. Obtain and average multiple permeation rates for each packet. Burgett and Tremblay (1979) monitored three test packets for
5.5. Fumigation control 5.5.1. Standard crystal fumigation Per Goodman et al. (1990). Beekeepers often use a similar method to protect stored combs against wax moths. 1. Prepare a super (a honey bee colony hive box) without bees, containing frames of drawn, empty comb with wax moth larvae.
each compound and weighed each packet a minimum of 5 times.
5.5.2.3. Larval Bioassay (per dispersal packet to be tested) 1. Insert various stages of moth development (reared and collected per Section 3) into a standard nucleus or full size honey bee colony with a dispersal packet (see Section 5.5.2.1.) and placed into a controlled environmental chamber.
The COLOSS BEEBOOK: wax moths
11
Alternatively, individual dish containers (see Section 6.7.2.) of wax Considerations: The method could be adapted to fit other forms of moths can be placed within hive boxes or stacks of boxes to
gaseous treatment, i.e. carbon dioxide. Ozone is acutely toxic to humans
simulate anticipated use by beekeepers.
and only should be used in sealed fumigation chambers (James, 2011).
2. Monitor the wax moths for physiological change (see Section 5.1.).
5.6. Gamma–ray irradiation and sterilization Considerations: Permeation rate varies with temperature, so it must
The ideal moth developmental stage for irradiation is the pharate
be determined for the same temperature at which the experiment will
adult (see Section 3). During this stage, the somatic cells have fully
be conducted. Under changing temperature regimens, mathematically differentiated and germ cells are most actively dividing (Jafari et al., weighted averages (estimated permeation rates based on the
2010). Not only does irradiation at this time minimize the likelihood of
proportional amount of time spent at each temperature) approximate
adult abnormalities like deformed wings (which would keep them from
the actual dispersal packet weight loss + 5% (Burgett and Tremblay,
being useful in sterile male release campaigns), but the specimen is
1979).
also very easy to handle without risk of escape or damage (North, 1975). Males are more resistant to gamma ray sterilization than females
5.5.3. Ozone Treatment
(Carpenter et al., 2005) and the effective irradiation doses are 350 Gy
Per Cantwell et al. (1972) and James (2011).
and 200 Gy, respectively (Flint and Merkle, 1983; Jafari et al., 2010). Specific methodologies for irradiation facilities and techniques are
5.5.3.1. Equipment needed
somewhat standard and will not be described beyond the parameters
1. Ozone generator – The size and type of generator used will
presented above.
vary based on what level of ozone is desired/needed for the
5.7. Entomopathogenic control of wax moths
experiment. 2. Fumigation Chamber.
Many species of entomopathogenic nematodes can be reared and
3. Ozone Analyser (Low Concentration Analyser). It must be able cause mortality in wax moth larvae. The moth larvae, in turn, can be to detect and quantify the amount of ozone created by the
infected with nematodes using various methods. The techniques described
ozone generator.
below can be used to test exposure time (how long the wax moth
4. Data logger to measure temperature and humidity.
larva is exposed to nematodes), nematode dose (often measured in
5. Ozone Destructor - eliminates ozone from the test facility.
nematode “IJs” or infective juveniles), exposure temperature, and
Ozone is potentially fatal to humans so care must be taken
many other factors on infection and mortality rates of wax moths.
during its use.
These same techniques are used by nematologists to investigate nematode biology, though the end result often is moth mortality, making the
5.5.3.2. Equipment establishment 1. Ozone is produced externally by the ozone generator and pumped into the fumigation chamber.
methods applicable to apicultural research. There can be some concern over non-target effects, including on bees, but these can be minimized with proper screening.
2. Measure ozone concentration, temperature, and humidity in the chamber by the ozone analyser and data logger. 3. Continually exhaust gas from the chamber via the ozone destructor.
5.7.1. Infecting single greater wax moth larvae with entomopathogenic nematodes Per Molyneux (1985) and Fan and Hominick (1991). The method below can be used to screen for entomopathogenic nematodes that show
5.5.3.3. Sample Protocol
action against wax moths. Though nematodes possibly can be used in
1. Expose multiple moth life stages, contained in dish containers (Section 6.7.2.), to a range of ozone concentrations 3
(measured in mg O3/m ) for a range of timed durations. 2. Exposure temperature may also be assessed for effect on
wax moth control programs, the methods outlined below are also useful for nematologists who need an effective method for rearing nematode species of interest. 1. Wash sand with distilled water.
treatment efficacy by incubating at multiple temperatures
2. Autoclave
during fumigation.
3. Oven-dry.
3. It is best to recreate the environment under which the treatment, when applied by beekeepers, would normally occur.
4. Filter through a 1.18 mm sieve. 5. Moisten the filtered sand with 1 ml of distilled water for every
For example, all moth life stages will be in and among the wax combs
25 ml of sand (4% V/V).
to be treated. So, it is best to place the dish of moths among combs,
6
Place 25 ml of moistened sand in a 30 ml plastic tube.
or in hive bodies as would be experienced in normal circumstances.
7. Pipette nematodes diluted in 1 ml of water (per producer’s instructions or experimental needs) into the sand in the tube.
Ellis et al.
12
The nematode/water solution brings the V/V content to 8%. Any
5.8. Protecting stored combs from wax moths
desired number of nematodes can be introduced to the soil in this
Wax moths are major pests of stored wax combs. Stored combs can
way, though including more infective juveniles in the inoculum
be protected and/or made moth free using a number of techniques.
typically results in greater infestation with nematodes. 8. Invert (turn upside down) the tube multiple times to disperse the nematodes in the sand.
5.8.1. Protecting stored combs via freezing 1. Freeze supers of combs or individual combs (≤ 0°C) for > 24
9. Place a single wax moth larva on the sand surface in the tube (late instar larvae are 250-350 mg).
hours. Other times/freezing temperatures include 2 hours at 15°C, 3 hours at -12°C, and 4.5 hours at -7°C (Charriere and
10. Replace the tube lid and invert the tube.
Imdorf, 1999).
11. Leave the tube inverted for set time periods and temperatures per the needs of the study.
2. Once thawed, place the combs in plastic bags for storage or on strong colonies for protection from bees.
12. Recover the wax moth larva and wash it three times with
Note: Combs that are thawing need to be inaccessible to wax
distilled water.
moths. Combs must be dry before bagging. Otherwise they can
13. Process (dissect, etc.) the larvae immediately or maintain on
mold. Combs containing honey and/or pollen should remain in the
moistened filter paper at 20°C for a period of time before use.
freezer until use or placed on colonies for further protection from bees (see section 5.8.3.). This method can be used to start colonies
5.7.2. Recovery of entomopathogenic nematodes from soil
“free” of wax moths (see section 6.8.).
using greater wax moth larvae Per Fan and Hominick (1991), this method can be used to screen local 5.8.2. Protecting stored combs via climate manipulation soils for the occurrence of entomopathogenic nematodes that infest
1. Stored combs that are free of honey and/or pollen in supers.
wax moths.
2. Stack the supers in an “open shed” (a covered pavilion with
1. Collect soil of interest for use. 3
2. Place 200-250 cm of soil in a plastic or glass dish (~300 cm
only 1-3 walls). 3
in volume). 3. Place five late instar G. mellonella larvae (late instar larvae are 250-350 mg) on the soil surface.
3. Stack the supers in a crisscross pattern. To do this, place a super on a solid surface (such as a hive lid) that is situated on the ground. Place another super of combs on the one on the ground, orienting it at a 90° angle from the bottom super.
4. Seal the dish with a tight lid to limit larvae escape.
Repeat this pattern until the stack of supers is a desirable
5. Incubate the dish at 20°C.
height (a maximum height of 2 m is recommended).
6. Replace the larvae (alive or dead) every 4-6 days. This should be done until larvae in the dish no longer die (i.e. all the living The open shed and super stacking pattern ensure that light and air nematodes in the soil are “harvested”). 7. Dissect all harvested larvae in saline 8. Quantify the number of nematode adults.
will penetrate the supers. This minimizes wax moth attraction since the moths do not like light/airflow. Modifications of this method include stacking the supers in a climate controlled room with cool (0-15°C) temperatures, an oscillating fan,
5.7.3. Recovery of entomopathogenic nematodes from
and constant light. This method is best used to protect white combs
inoculated sand using greater wax moth larvae
(combs in which no brood has been reared). Dark combs (combs in
Per (Fan and Hominick, 1991) and similar to the method outlined in
which brood has been reared) is best protected in a freezer (see section
5.7.2., wax moth larvae can be used to recover entomopathogenic
5.8.1.) or on strong bee colonies (5.8.3.). Heat treatment is also possible.
nematodes from inoculated sand.
The combs must be stored for 80 minutes at 46°C or 40 minutes at
1. Prepare sand and plastic tubes according to the protocol
49°C (Charrière and Imdorf, 1999).
outlined in 5.7.1. 2. Inoculate the soil with any nematode species and/or any number of IJs of interest. 3. Add single wax moth larvae (late instar larvae are 250-350 mg) to the soil.
5.8.3. Protecting stored combs using strong colonies Place supers of combs (containing no honey or pollen residues) directly onto strong colonies. Strong colonies can protect combs from wax moth infestation/damage. It is best if the stored combs contain no
4. Keep the tubes at 20°C.
honey and/or pollen. Otherwise, the combs may be vulnerable to
5. Replace the wax moth larva in the tube with a new individual
damage caused by small hive beetles (see the BEEBOOK paper on
weekly. This should be done until added larvae no longer die, indicating that no nematodes remain in the soil. 6. Dissect all harvested larvae in saline or maintain on moistened filter paper at 20°C for a period of time before use.
small hive beetles, Neumann et al., 2013).
The COLOSS BEEBOOK: wax moths
13
6. Miscellaneous techniques
6.2.2. Avoiding prophenoloxidase (PPO) activation while collecting
6.1. Field collection of various wax moth life
Per Kopáček et al. (1995):
stages 1. Establish supers of moth-free, drawn, dark wax comb per Section 6.8. 2. Once the wax moth population has been established, collect all moth life stages present as described in Section 4.3.
haemolymph 1. Precool the larvae for 15 min at 4°C. 2. Collect the haemolymph per Section 6.2.1. 3. Flush the haemolymph from the capillary into an Eppendorf tube kept on ice. 4. Add ice cold CA-CAC buffer (20 mM CaCl2 and 10 mM Na-cacodylate, pH 6.5).
6.2. Collecting greater wax moth haemolymph
5. Vigorously agitate the tube.
Numerous investigations in the literature call for the collection and
6. Freeze immediately in liquid nitrogen.
manipulation of wax moth haemolymph. Though the methods outlined
7. Store the frozen haemolymph at -20°C.
to do this may not be immediately useful to those studying wax moths from an apiculture perspective, we feel that it is helpful to include
6.2.3. Removing haemocytes from haemolymph
methods related to haemolymph collection in this manuscript since it
Per Fröbius et al. (2001):
is such a popular technique and it is a technique used to answer many
1. Collect haemolymph from wax moth larvae per Section 6.2.1.
fundamental questions about wax moths. A method for collecting
2. Transfer the haemolymph to chilled tubes. The tubes should
honey bee haemolymph is described in the BEEBOOK paper on physiology
contain a few crystals of phenylthiourea to prevent melanization
methods (Hartfelder et al., 2013).
(Vilcinskas et al., 1997; Wedde et al., 1998). 3. Centrifuge the haemolymph twice at 100 g for 10 min to
6.2.1. Method for collecting haemolymph From Stephens (1962):
remove the haemocytes. 4. Store the supernatants at -20°C until needed.
1. Larvae can be field-collected (see Section 6.1.) or reared in
vitro (Section 3).
6.3. Eliciting immune responses in wax moth larvae
2. Anaesthetize the larvae with CO2 until visible movement ceases. Per Wedde et al. (1998) and Fröbius et al. (2001): This makes it easier to handle larvae since they are other wise quite active. 3. Surface sterilize the larvae per Section 6.6. or with a hypo
1. Suspend 20 mg zymosan A (Sigma) in 1 ml of sterile, physiological saline (172 mM KCl, 68 mM NaCl, 5 mM NaHCO3, pH 6.1, adjusted with HCl).
chlorite solution (24 ml Millendo bleach in 1 l distilled water)
2. Homogenize the mixture with a vortex.
for 5 minutes.
3. Centrifuge at 10,000 g for 5 min.
4. Rinse the larvae twice with distilled water. 5. Dry the larvae on sterile blotters at 30°C until normal movement
4. Inject the supernatant and solubilized content at 10 µl supernatant/larva following Section 5.2.
resumes. 6. Wax moth larvae can be bled by cutting a proleg from the
6.4. Alternative method for eliciting immune
body or puncturing the proleg with a sterile needle and collecting
responses in wax moth larvae
the haemolymph that pools at the wound.
Per Schuhmann et al. (2003):
7. Collect haemolymph by capillary action into sterile capillary
1. Inject per Section 5.2. last instar larvae (250-350 mg) with 10 µl
tubes. Larvae from which only a small amount of haemolymph
of bacterial lipopolysaccharide suspension (2 mg/ml in water;
is collected can survive, complete their development, and
Sigma, Deisenhofen, Germany).
reproduce normally.
2. Keep the larvae at 30°C for desired amount of time. Schuhmann et al. (2003) allowed them to sit for 4, 6, and 8 h
Modifications
– per desired experimental conditions.
The haemolymph can be transferred to pre-cooled Eppendorf tubes containing a few crystals of phenylthiourea. This prevents
6.5. Collecting greater wax moth larva cuticle
melanization (Vilcinskas et al., 1997, Wedde et al., 1998).
Per Samšiňáková et al. (1971). Samšiňáková et al. (1971) collected
1 ml aliquots can be centrifuged twice at 10,000 g for 5 min
the cuticle from the greater wax moth on which they tested the action
to remove haemocytes (Wedde et al., 1998).
of enzymatic systems of Beauveria bassiana. The cuticle was collected
Ellis et al.
14
two ways. In the first method, all of the accompanying biological
Considerations: Frame caging is not ideal for bioassays involving eggs
material was removed from the cuticle (see section 6.5.1.). For the
and early larvae. Dish containers (see Section 6.7.2.) are ideal for egg
second method, the authors attempted to keep the cuticle as natural
and early instar larval assays.
as possible, leaving the deteriorated cuticle with adjacent epidermis (6.5.2.).
6.7.2. Dish caging Per Goodman et al. (1990).
6.5.1. Complete isolation of the larval cuticle
1. Place eggs and early instar larvae (collected per Section 3) in
1. Euthanize fully grown greater wax moth larvae with ether.
a small specimen tube. Goodman et al. (1990) used one that
2. Boil them in 5% KOH for 3 h.
was 25 x 75 mm, with diet medium (for newly hatched larvae
3. Wash the larvae with water.
– prepared per Section 3.2.1.). The vial opening should be
4. Place overnight in 2% pancreatin at pH 8.5 and 37°C.
covered with 24 mesh/10 mm (or similar) wire gauze. First
5. Wash the remaining material with water.
instar moth larvae are small so care should be taken to limit
6. Remove any remaining tissues.
their escape from the dish cages.
7. Immerse the cuticle in boiling water for 20 min.
2. Larvae, pupae, adults: a 13 mm hole is bored in the lid of an
8. Centrifuge to remove excess water.
85 mm diameter (or similar sized) plastic Petri dish. The hole
9. Dry the cuticle in a stream of hot air to constant weight.
is covered with 11.5 mesh/10 mm (or similar) wire gauze. Specimens are placed in the Petri dish with diet medium (diet
6.5.2. Rough isolation of the larval cuticle
prepared per Section 3.2.1.).
1. Euthanize the wax moth larva. 2. Dissect away the larva’s head.
6.8. Creating wax moth free combs
3. Press the larva with a glass rod from the posterior end to the
Per Hood et al. (2003):
anterior end. This squeezes out the larva’s viscera.
1. Remove drawn comb for honey bee colonies.
4. Rinse the remaining integument with distilled water
The comb should be dark (i.e. comb that has had brood reared in it at
5. Dry the integument carefully.
some point). 2. Extract any honey present.
6.6. Surface sterilization of wax moth larvae Per Reddy et al. (1979): 1. Surface sterilize wax moth larvae with a wash (whole body) or rub (target body part) of 70% ethanol. 2. Manipulate (including dissection) the sterilized individual in sterile insect Ringers solution.
3. Expose comb to foraging bees to remove any remaining honey residues. 4. Place all comb in a standard freezer (≤ 0°C) for at least 24 h to kill all wax moth life stages present (for more freezing tem peratures and times, see section 5.8.1.). 5. Examine all frames, and select frames with no signs of wax moth activity for experimental trials.
6.7. Containment of various moth life stages 6.7.1. Frame caging Per Burgett and Tremblay (1979):
7. Conclusion
1. Construct circular cages by replacing the metal sealing lid of 2 Although we include a number of methods associated with the study Mason® jar screw caps with 11.5 mesh/10 mm wire gauze
of wax moths in this paper, there remain methodological gaps for this
and taping the two open sides together.
important pest of honey bees. For example, we failed to find a method
2. Place contains diet medium (section 3.2.1.) in each cage.
to artificially infest field colonies with wax moths. Such a method may
3. Place wax moths (life stage dependent on the project goals)
seem intuitive, (just open the colony and insert moths), but it is not
in each cage. 4. Secure up to nine cages, in rows of three, with large rubber
considering the natural tendency for adult bees to eject immature moths from colonies. We also discovered no methods related to marking/
bands in a standard “deep” Langstroth hive frame (480 × 29
recapturing the various moth life stages, or how to determine damage
× 230 mm; l × w × h) with no comb or foundation. Up to six
thresholds for the moths. These are but a sample of methods that
cages, in rows of tree, can be secured to a standard “medium” would prove useful to researchers, especially those investigating wax Langstroth honey frame (480 × 29 × 160; l × w × h) with no comb or foundation. 5. The wax moth frame may be inserted into a nucleus or full sized brood box for trials.
moths from an apicultural perspective. In sharp contrast to applied methods related to wax moth research, there are a plethora of research methodologies related to basic investigations on wax moths. This is especially true of investigations
The COLOSS BEEBOOK: wax moths
focused on wax moth physiology, genomics, and proteomics. We
15
CHASE, R W (1921) The length of the life of the larva of the wax moth,
considered adding these methods to our paper, but soon realized that
Galleria mellonella L., in its different stadia. Transactions of the
an entire book (similar to the BEEBOOK) could be written just about
Wisconsin Academy of Sciences, Arts and Letters 20: 263-267.
wax moth research methods. Including a comprehensive bibliography
COSKUN, M; KAYIS, T; SULANC, M; OZALP, P (2006) Effects of different
of the wax moth literature seemed to be a good compromise, but we
honeycomb and sucrose levels on the development of greater wax
discovered that this could include many thousands of references. Such
moth Galleria mellonella larvae. International Journal of Agriculture
an inclusion would be beyond the scope of this paper, but we hope such a bibliography will be published in the future. In conclusion, wax moths remain a vexing problem for beekeepers
and Biology 8(6): 855-858. DELAPLANE, K S; VAN DER STEEN, J; GUZMAN, E (2013) Standard methods for estimating strength parameters of Apis mellifera
and honey bee colonies around the globe. The number of investigations
colonies. In V Dietemann; J D Ellis; P Neumann (Eds) The
related to wax moth control has dropped significantly, largely due to
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
the perception of wax moths as a secondary pest of bee colonies.
research. Journal of Apicultural Research 52(1):
Regardless, they remain an important test model for entomologists,
http://dx.doi.org/10.3896/IBRA.1.52.1.03
physiologists, and investigators from other disciplines. Based on current DIETEMANN, V; NAZZI, F; MARTIN, S J; ANDERSON, D; LOCKE, B; trends in wax moth research, we expect that wax moth usefulness to
DELAPLANE, K S; WAUQUIEZ, Q; TANNAHILL, C; FREY, E;
investigators will continue into perpetuity.
ZIEGELMANN, B; ROSENKRANZ, P; ELLIS, J D (2013) Standard methods for varroa research. In V Dietemann; J D Ellis; P
References ARBOGAST, R T; LEONARD LECATO, G; VAN BYRD, R (1980) External morphology of some eggs of stored-product moths (Lepidoptera:
Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.09 EISCHEN, F A; DIETZ, A (1987) Growth and survival of Galleria
Pyralidae, Gelechiidae, Tineidae). International Journal of Insect
mellonella (Lepidoptera: Pyralidae) larvae fed diets containing
Morphology and Embryology 9(3): 165-177. ISSN: 0020-7322
honey bee-collected plant resins. Annals of the Entomological
http://dx.doi.org/10.1016/0020-7322(80)90013-6
Society of America 80: 74-77.
BRONSKILL, J F (1961) A cage to simplify the rearing of the greater
EISCHEN, F; DIETZ, A (1990) Improved culture techniques for mass
wax moth, Galleria mellonella (Pyralidae). Journal of the Lepidopterists’
rearing Galleria mellonella (Lepidoptera: Pyralidae). Entomological
Society 15(2): 102-104.
News 101: 123-128.
BURGES, H; BAILEY, L (1968) Persistence of Bacillus thuringiensis in
ELLIS, A M; HAYES, G W (2009) Assessing the efficacy of a product
foundation beeswax and beecomb in beehives for the control of
containing Bacillus thuringiensis applied to honey bee
Galleria mellonella. Journal of Invertebrate Pathology 28(2): 217-
(Hymenoptera: Apidae) foundation as a control for Galleria
222. http://dx.doi.org/10.1016/0022-2011(76)90125-7
mellonella (Lepidoptera: Pyralidae). Journal of Entomological
BURGES, H; BAILEY, L (1968) Control of the greater and lesser wax moths (Galleria mellonella and Achroia grisella) with Bacillus
Science 44(2): 158-163. FERGUSON, D C (1987) Lepidoptera. In J R Borham (Ed.). Insect and
thuringiensis. Journal of Invertebrate Pathology 11(2): 184-195.
mite pests in food: an illustrated key. USDA Agriculture Handbook
http://dx.doi.org/10.1016/0022-2011(68)90148-1
655: 231-244.
BURGETT, D M; TREMBLAY, A (1979) Controlled release fumigation of FLINT, H; MERKLE, J (1983) Mating behaviour, sex pheromone responses, the greater wax moth. Journal of Economic Entomology 72: 616-617. CANTWELL, G E; JAY, E; PEARMAN Jr, G P; THOMPSON, J (1972) Control of the greater wax moth, Galleria mellonella (L.), in comb
and radiation sterilization of the greater wax moth (Lepidoptera: Pyralidae). Journal of Economic Entomology 76: 467-472. FRÖBIUS, A C; KANOST, M R; GÖTZ, P; VILCINSKAS, A (2000) Isolation
honey with carbon dioxide: Part I. American Bee Journal 112:
and characterization of novel inducible serine protease inhibitors
302-303.
from larval haemolymph of the greater wax moth Galleria
CARPENTER, J; BLOEM, S; MAREC, F (2005) Inherited sterility in insects. In V A Dyck; J Hendrichs; A S Robinson (Eds) Sterile Insect
mellonella. European Journal of Biochemistry 267(7): 2046-2053. http://dx.doi.org/10.1046/j.1432-1327.2000.01207.x
Technique pp. 115-146. http://dx.doi.org/10.1007/1-4020-4051-2_5 GOODMAN, R; WILLIAMS, P; OLDROYD, B; HOFFMAN, J (1990) CHARRIERE, J-D; IMDORF, A (1999) Protection of honey combs from wax moth damage. American Bee Journal 139(8): 627-630.
Studies on the use of phosphine gas for the control of greater wax moth (Galleria mellonella) in stored honey bee comb. American
Bee Journal 130: 473-477.
Ellis et al.
16
HARTFELDER, K; GENTILE BITONDI, M M; BRENT, C; GUIDUGLI-
REDDY, G; HWANG-HSU, K; KUMARAN, A K (1979) Factors influencing
LAZZARINI, K R; SIMÕES, Z L P; STABENTHEINER, A; DONATO
juvenile hormone esterase activity in the wax moth, Galleria
TANAKA, É; WANG, Y (2013) Standard methods for physiology
mellonella. Journal of Insect Physiology 25: 65-71.
and biochemistry research in Apis mellifera. In V Dietemann; J D
Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume I:
http://dx.doi.org/10.1016/0022-1910(79)90038-6 SAMSINAKOVA, A; MISIKOVA, S; LEOPOLD, J (1971) Action of enzymatic
standard methods for Apis mellifera research. Journal of
systems of Beauveria bassiana on the cuticle of the greater wax
Apicultural Research 52(1):
moth larvae (Galleria mellonella). Journal of Invertebrate Pathology
http://dx.doi.org/10.3896/IBRA.1.52.1.06
18: 322-330. http://dx.doi.org/10.1016/0022-2011(71)90033-4
HOOD, W M; HORTON, P M; MCCREADIE, J W (2003) Field evaluation SAMMATARO, D; DE GUZMAN, L; GEORGE, S; OCHOA, R (2013) of the red imported fire ant (Hymenoptera: Formicidae) for the
Standard methods for tracheal mites research. In V Dietemann; J
control of wax moths (Lepidoptera: Pyralidae) in stored honey bee
D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II:
comb. Journal of Agricultural and Urban Entomology 20(2): 93-103.
Standard methods for Apis mellifera pest and pathogen research.
JAFARI, R; GOLDASTEH, S; AFROGHEH, S (2010) Control of the wax moth Galleria mellonella L. (Lepidoptera: Pyralidae) by the male
Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.20
sterile technique (MST). Archives of Biological Sciences 62(2): 309 SCHUHMANN, B; SEITZ, V; VILCINSKAS, A; PODSIADLOWSKI, L (2003) -313. http://dx.doi.org/10.2298/ABS1002309J JAMES, R R (2011) Potential of ozone as a fumigant to control pests
Cloning and expression of gallerimycin, an antifungal peptide expressed in immune response of greater wax moth larvae, Galleria
in honey bee (Hymenoptera: Apidae) hives. Journal of Economic
mellonella. Archives of Insect Biochemistry and Physiology 53:
Entomology 104: 353-359. http://dx.doi.org/10.1603/EC10385
125-133. http://dx.doi.org/10.1002/arch.10091
JONES, G; BARABAS, A; ELLIOTT, W; PARSONS, S (2002) Female
SHARMA, V; MATTU, V K; THAKUR, M S (2011) Infestation of Achoria
greater wax moths reduce sexual display behaviour in relation to
grisella F. (wax moth) in honey combs of Apis mellifera L. in
the potential risk of predation by echolocating bats. Behavioural
Shiwalik Hills, Himachal Pradesh. International Journal of Science
Ecology 13(3): 375-380. http://dx.doi.org/10.1093/beheco/13.3.375 KOPÁCEK, P; WEISE, C; GÖTZ, P (1995) The prophenoloxidase from
and Nature 2(2): 407-408. SHIMANUKI, H; KNOX, D; FURGALA, B; CARON, D; WILLIAMS, J (1992) Diseases and pests of honey bees In J M Graham (Ed.).
the wax moth Galleria mellonella: Purification and characterization
The hive and the honey bee. Dadant and Sons; Hamilton, IL, USA.
of the proenzyme. Insect Biochemistry and Molecular Biology 25:
pp. 1083-1151.
1081-1091. http://dx.doi.org/10.1016/0965-1748(95)00040-2
SMITH, T L (1965) External morphology of the larva, pupa and adult
MARSTON, N L; CAMPBELL, B; BOLDT, P (1975) Mass producing eggs
of the wax moth Galleria mellonella L. Journal of the Kansas
of the greater wax moth, Galleria mellonella (L.). Agricultural
Entomological Society 38: 287-310.
Research Service, US Department of Agriculture Technical Bulletin SPANGLER, H G (1984) Attraction of female lesser wax moths 1510: 15 pp. MOLYNEUX, A S (1985) Survival of infective juveniles of Heterorhabditis spp., and Steinernema spp. (Nematoda: Rhabditida) at various temperatures and their subsequent infectivity for insects. Revue
De Nématologie 8: 165-170. NEUMANN, P; PIRK C W W; SCHÄFER, M O; ELLIS, J D (2013) Stand-
(Lepidoptera: Pyralidae) to male-produced and artificial sounds.
Journal of Economic Entomology 77: 346-349. SPANGLER, H G (1985) Sound production and communication by the greater wax moth (Lepidoptera: Pyralidae). Annals of the
Entomological Society of America 78: 54-61. SPANGLER, H G (1987) Acoustically mediated pheromone release in
ard methods for small hive beetle research. In V Dietemann; J D
Galleria mellonella (Lepidoptera: Pyralidae). Journal of Insect
Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II:
Physiology 33: 465-468.
Standard methods for Apis mellifera pest and pathogen research.
http://dx.doi.org/10.1016/0022-1910(87)90109-0
Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.19 NORTH, D T (1975) Inherited sterility in Lepidoptera. Annual Review
of Entomology 20: 167-182. PADDOCK, F B (1918) The beemoth or waxworm. Texas Agricultural Experiment Station; USA. 44 pp.
STEPHENS, J M (1959) Immune responses of some insects to some bacterial antigens. Canadian Journal of Microbiology 5(2): 203-228. http://dx.doi.org/10.1139/m59-025 STEPHENS, J M (1962) Bactericidal activity of the blood of actively immunized wax moth larvae. Canadian Journal of Microbiology 8: 491-499. http://dx.doi.org/10.1139/m62-064
The COLOSS BEEBOOK: wax moths
VANDENBERG, J; SHIMANUKI, H (1990) Application methods for
17
WEDDE, M; WEISE, C; KOPACEK, P; FRANKE, P; VILCINSKAS, A (1998)
Bacillus thuringiensis used to control larvae of the greater wax
Purification and characterization of an inducible metalloprotease
moth (Lepidoptera: Pyralidae) on stored beeswax combs. Journal
inhibitor from the haemolymph of greater wax moth larvae,
of Economic Entomology 83: 766-771.
Galleria mellonella. European Journal of Biochemistry 255: 535-543.
VILCINSKAS, A; MATHA, V; GÖTZ, P (1997) Effects of the
http://dx.doi.org/10.1046/j.1432-1327.1998.2550535.x
entomopathogenic fungus Metarhizium anisopliae and its secondary WEST, E J; BRIGGS, J D (1968) In vitro toxin production by the fungus metabolites on morphology and cytoskeleton of plasmatocytes
Beauveria bassiana and bioassay in greater wax moth larvae.
isolated from the greater wax moth, Galleria mellonella. Journal
Journal of Economic Entomology 61: 684-687.
of Insect Physiology 43: 1149-1159. http://dx.doi.org/10.1016/S0022-1910(97)00066-8 WARREN, L; HUDDLESTON, P (1962) Life history of the greater wax moth, Galleria mellonella L., in Arkansas. Journal of the Kansas
Entomological Society 35: 212-216. WATERHOUSE, D (1959) Axenic culture of wax moths for digestion studies. Annals of the New York Academy of Sciences 77: 283-289. http://dx.doi.org/10.1111/j.1749-6632.1959.tb36909.x
WILLIAMS, J L (1997) Insects: Lepidoptera (moths). In R Morse; K
Flottum (Eds). Honey bee pests, predators, and diseases. The AI Root Company; Ohio, USA. pp. 121-141. XUEJUAN, F; HOMINICK, W M (1991) Efficiency of the galleria (wax moth) baiting technique for recovering infective stages of entomopathogenic rhabditids (Steinernematidae and Heterorhabditidae) from sand and soil. Revue Nématol 14: 381-387.
Journal of Apicultural Research 52(1)
© IBRA 2013
Journal of Apicultural Research 52(1): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.1.11
REVIEW ARTICLE
Standard methods for American foulbrood research
Dirk C de Graaf1*, Adriana M Alippi2, Karina Antúnez3, Katherine A Aronstein4, Giles Budge5, Dieter De Koker1 §, Lina De Smet1, Douglas W Dingman6, Jay D Evans7, Leonard J Foster8, Anne Fünfhaus9, Eva Garcia-Gonzalez9, Aleš Gregorc10, Hannelie Human11, K Daniel Murray12, Bach Kim Nguyen13, Lena Poppinga9, Marla Spivak14, Dennis vanEngelsdorp15, Selwyn Wilkins5 and Elke Genersch9 1
Ghent University, Laboratory of Zoophysiology, K.L. Ledeganckstraat 35, B-9000 Ghent, Belgium. Universidad Nacional de La Plata, Facultad de Ciencias Agrarias y Forestales, Centro de Investigaciones de Fitopatología, calles 60 y 118, c.c. 31, 1900 La Plata, Argentina. 3 Instituto de Investigaciones Biológicas Clemente Estable, Department of Microbiology, Avda. Italia 3318, 11600 Montevideo, Uruguay. 4 USDA-ARS, Honey Bee Research Unit, Kika de la Garza Subtropical Agricultural Center, 2413 E. Hwy 83, 78596 Weslaco TX, USA. 5 National Bee Unit, Food and Environment Research Agency, Sand Hutton, YO41 1LZ York, UK. 6 The Connecticut Agricultural Experiment Station, Department of Biochemistry and Genetics, New Haven CT 06504, USA. 7 USDA-ARS, Bee Research Lab, BARC-E Bldg 476, Beltsville MD 20705, USA. 8 University of British Columbia, Department of Biochemistry & Molecular Biology, 2125 East Mall, V6T 1Z4 Vancouver BC, Canada. 9 Institute for Bee Research, Friedrich-Engels-Str. 32, 16540 Hohen Neuendorf, Germany. 10 Agricultural Institute of Slovenia, Hacquetova 17, 1000 Ljubljana, Slovenia. 11 University of Pretoria, Department of Zoology and Entomology, Pretoria, South Africa. 12 South Texas College, Biology Department, 400 N. Border, 78596 Weslaco TX, USA. 13 Université de Liège, Gembloux Agro-Bio Tech, Entomologie fonctionnelle & évolutive, Passage des Déportés 2, B-5030 Gembloux, Belgium. 14 University of Minnesota, Department of Entomology, 219 Hodson Hall, 1980 Folwell Ave., 55108 St. Paul MN, USA. 15 University of Maryland, Department of Entomology, 3136 Plant Sciences, College Park, MD 20742, USA 2
§ in memoriam: ° July 24, 1987 - † May 30, 2012 Received 10 April 2012, accepted subject to revision 18 June 2012, accepted for publication 5 November 2012. *Corresponding author: Email: Dirk.deGraaf@UGent.be
Summary American foulbrood is one of the most devastating diseases of the honey bee. It is caused by the spore-forming, Gram-positive rod-shaped bacterium Paenibacillus larvae. The recent updated genome assembly and annotation for this pathogen now permits in-depth molecular studies. In this paper, selected techniques and protocols for American foulbrood research are provided, mostly in a recipe-like format that permits easy implementation in the laboratory. Topics covered include: working with Paenibacillus larvae, basic microbiological techniques, experimental infection, and “’omics” and other sophisticated techniques. Further, this chapter covers other technical information including biosafety measures to guarantee the safe handling of this pathogen.
Métodos para la investigación de la loque americana Resumen La loque americana es una de las enfermedades más devastadoras de la abeja melífera, causada por el bacilo, formador de esporas Grampositivo Paenibacillus larvae. El reciente ensamblaje y anotación del genoma de este patógeno permite actualmente la realización de profundos estudios moleculares. En este trabajo, se proporcionan técnicas y protocolos seleccionados para la investigación de la loque americana, principalmente bajo la forma de protocolos de trabajo con una estructura similar al de las recetas, para facilitar su implementación en el laboratorio. Los temas desarrollados incluyen: el trabajo con Paenibacillus larvae, técnicas básicas microbiológicas, la infección experimental, y "'ómicas" y otras técnicas sofisticadas. Además, este capítulo abarca otro tipo de información técnica, incluyendo medidas de bioseguridad para garantizar la seguridad en el manejo de este patógeno. Footnote: Please cite this paper as: DE GRAAF, D C; ALIPPI, A M; ANTÚNEZ, K; ARONSTEIN, K A; BUDGE, G; DE KOKER, D; DE SMET, L; DINGMAN, D W; EVANS, J D; FOSTER, L J; FÜNFHAUS, A; GARCIA-GONZALEZ, E; GREGORC, A; HUMAN, H; MURRAY, K D; NGUYEN, B K; POPPINGA, L; SPIVAK, M; VANENGELSDORP, D; WILKINS, S; GENERSCH, E (2013) Standard methods for American foulbrood research. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.11
de Graaf et al.
2
美洲幼虫腐臭病研究的标准方法 美洲幼虫腐臭病是最具毁灭性的疾病之一,由革兰氏阳性杆状菌 Paenibacillus larvae 引起。近年来,随着基因组学的开展,该病原体的基因组 组装和注释已成为开展,深入的分子研究成为可能。本文提供了经选择的美洲幼虫腐臭病研究技术和实验程序,大多数以“食谱”的格式给出, 很容易在实验室开展操作。覆盖的主题包括:Paenibacillus larvae 的处理技术,基本微生物技术、实验感染技术、“组学”以及其他的一些复杂技 术。此外,本章还包含了生物安全的评价方法,以确保安全的开展该病原体的研究
Key words: honey bee, American foulbrood, Paenibacillus larvae, brood, disease, pathogen, technique, BEEBOOK, COLOSS Page No.
Table of Contents
Page No.
1.
Introduction
3
4.2.1.
Inoculation with known spore concentration solution
15
2.
Working with Paenibacillus larvae
3
4.2.2.
Inoculation with diseased brood
15
2.1.
Biosafety measures
3
4.3.
Measuring colony resistance to AFB
15
2.2.
Strains
3
4.3.1.
Surveying inoculated colonies
15
2.3.
Sampling for AFB monitoring or diagnosis
3
4.3.2.
Colony Resistance
15
3.
Basic microbiological techniques
3
5.
‘omics and other sophisticated techniques
16
3.1.
Cultivation
3
5.1.
Paenibacillus larvae gene expression
16
3.2
Identification
6
5.1.1.
Reference gene selection
16
3.2.1.
Bacterial DNA extraction
7
5.1.1.1.
Sample collection and storage
16
3.2.2.
Polymerase chain reaction
7
5.1.1.2.
RNA and cDNA preparation
16
3.3.
Genotyping
7
5.1.1.3.
Primer design and secondary structures
16
3.3.1.
PCR amplification of repetitive elements
8
5.1.1.4.
qRT-PCR reactions
16
3.3.2.
Pulsed-field gel electrophoresis
8
5.1.1.5.
qRT-PCR program
16
3.3.2.1
Preparation of genomic DNA agarose plugs
8
5.1.1.6.
qRT-PCR analysis
16
3.3.2.2.
Restriction enzyme digestion
9
5.1.2.
Differential gene expression
16
3.3.2.3.
Gel loading and electrophoresis
9
5.2.
Comparative genome analysis within the species Paenibacillus larvae using suppression subtractive hybridization
16
3.4.
In vitro sporulation of Paenibacillus larvae
9
5.3.
Conventional proteomics using two-dimensional gel electrophoresis
18
3.4.1.
Sporulation of solid growth medium
10
5.4.
Differential proteomics of Paenibacillus larvae
19
3.4.2.
Sporulation in liquid growth medium
10
5.4.1.
Sample preparation
20
3.5.
Long term conservation of vegetative cells
10
5.4.1.1.
Extract proteins
20
3.5.1.
Short-term preservation
11
5.4.1.2.
Reduce, alkylate and digest proteins to peptides
20
3.5.2.
Preservation via ultra-low freezing
11
5.4.1.3.
Clean up peptides
20
3.5.3.
Preservation via lyophilization
11
5.4.1.4.
Label peptides with stable isotopes
20
3.6.
Measuring susceptibility/resistance to antibiotics of
11
5.4.1.5.
Clean up peptides
20
3.6.1.
Determination of minimal inhibitory concentrations (MICs) 12
5.4.1.6.
Mass spectrometry analysis
20
3.6.2.
Determination of antibiotic susceptibility testing by the disc diffusion method
12
5.5.
Expression of heterologous proteins in Paenibacillus
21
3.6.2.1.
Preparation of discs
13
5.5.1.
Transformation of Paenibacillus larvae
21
3.6.2.2.
Preparation of plates
13
5.5.2.
Detection of GFP-expression
21
3.6.2.3.
Determination of resistance/susceptibility
13
5.6.
Fluorescent in situ hybridization for the detection of
22
4.
Experimental infection
13
5.6.1.
Preparation and embedding of larval tissues
22
4.1.
Infection of in vitro reared larvae for the analysis of virulence and pathomechanisms of Paenibacillus larvae
13
5.6.2.
Performing fluorescence in situ hybridization
22
4.1.1.
Protocol for exposure bioassays
14
6.
Final remarks
22
4.1.2.
Analysis of generated data
14
7.
Acknowledgements
23
4.2.
Experimental infection of a bee colony
15
8.
References
23
Paenibacillus larvae
larvae
Paenibacillus larvae
The COLOSS BEEBOOK: American foulbrood
1.
Introduction
3
(http://www.biosafety.be/) - that should be considered when manipulating P. larvae for research or diagnosis. It should be noted
American foulbrood (AFB) is a devastating brood disease of the honey that P. larvae has been safely cultured in the laboratory for decades bee caused by the spore-forming, Gram-positive rod-shaped
using only standard bacteriological procedures (i.e. aseptic handling
bacterium Paenibacillus larvae. AFB is one of the bee diseases listed in techniques and careful decontamination of biological waste), and to the OIE (Office International des Epizooties – the World Organization
date, no known AFB outbreaks due to intentional/accidental
for Animal Health) Terrestrial Animal Health Code (2011) and member laboratory release of this organism have been reported. countries and territories are obliged to report its occurrence. In 2006, a draft of the P. larvae genome was published at an estimated 5-6x
2.2. Strains
coverage (Qin et al., 2006). Last year, this coverage was further
Various P. larvae strains can be obtained from bacterial culture
extended and the genome sequence was further annotated with a
collections. However, many of these collection agencies store exactly
combination of bioinformatics and proteomics (Chan et al., 2011).
the same strains but with their own strain designations. This fact is
These efforts will certainly help to usher in the next level of research
relevant when comparing different P. larvae strains for research
for this economically important pathogen, ultimately allowing us to
purposes, or when using strains as positive controls in diagnosis or
better understand the intimate relationship between the pathogen and species identification. Table 2 shows many of the important strains its host. More generally, the honey bee / AFB system provides a
that are available in these culture collections and shows some
wealth of opportunities and tools for addressing basic questions
alternate designations. With regard to obtaining strains, it should be
regarding microbe-microbe interactions, host immunity, strain
noted that certain countries have import/export and interstate
virulence, and horizontal transmission, among others.
transport shipping regulations regarding the movement and storage of
In the present paper, selected techniques and protocols in
this pathogen (http://www.biosafety.be/RA/Class/ListBact.html).
American foulbrood research are provided, mostly in a recipe-like format that permits easy implementation in the laboratory. The
2.3. Sampling for AFB monitoring or diagnosis
different topics that are covered include: working with Paenibacillus
Testing for the presence of P. larvae may be carried out for different
larvae, basic microbiological techniques, experimental infection and
reasons – for example either as part of national monitoring or
“’omics” and other sophisticated techniques. Thus, the chapter covers
prevention programmes, or as part of scientific research projects such
a broad set of technical information going from biosafety measures to
as epidemiological studies. The proper collection procedure depends
guarantee the safe handling of this pathogen to the expression of
on whether the testing is to be carried out following the observation
heterologous proteins in P. larvae. Techniques exclusively related to
of suspected clinical signs of AFB, or the testing is part of general
the diagnosis of AFB are not included as they have been reviewed
surveillance to identify a potential sub-clinical presence of P. larvae in
elsewhere (de Graaf et al., 2006a; OIE, 2008).
colonies within a population. These considerations are addressed in the OIE Manual of Diagnostic Tests and Vaccines for Terrestrial
Animals vol.1 (OIE, 2008), and we advise readers to consult the AFB
2. Working with Paenibacillus larvae
chapter in that resource.
2.1. Biosafety measures In some countries, microbial species are categorized in different classes based on biosafety risk. Each biosafety risk class has its own
3. Basic microbiological techniques
recommendations with respect to facility design, safety equipment,
3.1. Cultivation
and working practices (de Graaf et al., 2008). This classification
As P. larvae is a spore-forming bacterium, its isolation from biological
mostly takes into account the risk for human health, potential for
samples is typically preceded by a heat treatment step to kill all
dispersal of the disease, and the potential economic impact of the
vegetative microorganisms. This step significantly reduces the risk
disease. However, a generally accepted biosafety risk classification
that P. larvae colonies will be masked by competitors. Different
has not been prescribed for P. larvae. Consideration of the severity of
genotypes of P. larvae show variation in germination ability, and their
clinical American foulbrood infections in honey bee colonies, the
response to heat treatment is variable (Forsgren et al., 2008). MYPGP
contagiousness, the longevity of the spores, the legal context of AFB
agar (Dingman and Stahly, 1983) is routinely used to cultivate P.
(a notifiable disease), and the economic value of honey bee
larvae for AFB diagnosis. This medium makes incubation under CO2
pollination services, justifies P. larvae classification as an organism
unnecessary although the presence of 5% CO2 significantly increases
with ‘high biosafety risk for animals’. Table 1 summarizes basic
germination (Nordstrom and Fries, 1995). Contaminants of the genera
biosafety practices - mainly in accordance with the Belgian model
Bacillus and Brevibacillus, as well as other Paenibacillus species, are
de Graaf et al.
4
Table 1. Biosafety rules mainly in accordance to the Belgian model; http://www.biosafety.be/. As this model is very restrictive, we have indicated the rules that are minimally (M) required. The other biosafety rules should be considered optional depending on the demands of the responsible authority. Topic
Measurement - The laboratories are physically separated from other work areas in the building. - The access to the laboratories are locked if the zone or corridor access is not reserved. The doors have automatic closing if they open directly into a public area.
Facility design
- (M) The furniture has been designed to allow easy cleaning and disinfection, and easy insect and rodent control. - (M) There is a sink for washing and decontamination of hands in the laboratory. - (M) There are coat hooks or a dressing room equipped with protective clothing. Normal clothing and protective clothing should remain separated. - (M) The tables are easy to clean, water impermeable and resistant to acids, alkalis, organic solvents, disinfectants and decontamination
- If the laboratory is equipped with a microbiological safety cabinet (MSC) of class II, it must be localized as such that it does not disturb Safety equipment
the air flow in the room. It should be kept at a sufficient distance from windows, doors, and places with frequent passage, vents for air intake or outlet. The MSC should be checked and certified upon purchase or relocation, as well as at least once a year afterward. - There is an autoclave available in the building if the biological waste and/or biological residues shall be inactivated by steam sterilization. - The centrifuge that will be used is available in the containment zone. If this is not the case, and centrifugation is done outside the - Access to laboratories is restricted to persons approved by the responsible authority, and these persons have been informed of the biological risk. - Laboratory doors should display: the biohazard sign, the containment level (if applicable), the coordinates of the controller. - (M) Protective clothing is worn. This protective clothing should not be worn outside the laboratory. - There are gloves available for staff. - The windows must remain closed during experiments. - (M) Viable (micro-) organisms must be physically contained in closed systems (tubes, boxes, etc.), when they are not being manipulated. - (M) Splashes or aerosols should be minimized, and their spread must be controlled by appropriate equipment and work practices. - In no case may a horizontal laminar flow cabinet used for manipulation of pathogenic organisms. - (M) Mechanical pipetting is required. Pipetting by mouth is prohibited.
Working
- (M) Drinking, eating, smoking, use of cosmetics, handling contact lenses and storage of food for human consumption is prohibited in
practices
the laboratories. - A register of all manipulated or stored pathogenic organisms should be kept. - The control measures and equipment should be inspected regularly and in an appropriate manner. - (M) Hands should be washed when leaving the laboratory, when another activity is started, or when deemed necessary. - (M) After completion of the work, or when biological material has been spilled, the work surfaces should be disinfected. - There is a note available for the staff describing the correct use of the disinfectants. This memo specifies for a given purpose, the disinfectant that must be used, the necessary concentration and contact time. - The staff is trained in relation to biosafety issues and is regularly monitored and retrained. - A biosafety manual has been written and adopted. The staff is informed of the potential risks and must read the biosafety regulations that are applicable. Instructions that must be followed in case of accident should be posted in the laboratory. - The biohazard sign is posted in incubators, freezers, and nitrogen tanks containing biological material ‘high biosafety risk for animals’. - An effective insect and rodent control program is applied. - (M) Contaminated biological waste and/or biological residues and contaminated disposable equipment should be inactivated by an
Waste
appropriate, validated method before it is discharged--e.g., by autoclaving or by incineration. The incineration is performed by an authorized
management
company. The waste is collected in secure and hermetically sealable containers. These should be closed for transport. - (M) Contaminated material (glassware, etc.) is inactivated by an appropriate, validated method before cleaning, reuse and/or destruction.
inhibited by nalidixic acid (Hornitzky and Clark, 1991) and pipemidic
taking twice samples with a sterile swab from a brood comb
acid (Alippi, 1991; 1995). Apart from brood samples, food stores
(each time multiple brood cells should be sampled), and
(honey, pollen and royal jelly), adult workers, and wax debris can also
subsequently suspending them in 5 ml of phosphate buffered
be used to detect the presence of P. larvae spores. The outline of the cultivation procedure starting from brood samples is as follows: 1. Prepare an aqueous solution containing P. larvae spores by
saline (PBS). 2. Incubate different aliquots of the spore suspension at 80, 85, 90, 95 and 100°C for 10 min (Forsgren et al., 2008).
P. larvae occurs in two forms: vegetative cells and spores. Only
The COLOSS BEEBOOK: American foulbrood
5
Table 2. Strains of Paenibacillus larvae. Species
Paenibacillus larvae
Old subsp. classification
larvae
Strain no.
Other designation
Source
ATCC 9545T
Foulbrood of honey bees
DSM 7030
LMG 9820T
T
NRRL B-2605T LMG 15969
E C Holst #846
T
Paenibacillus larvae
larvae
LMG 14425
ATCC 25747
Ohio, USA, diseased honey bee larvae
Paenibacillus larvae
larvae
LMG 15969T
See LMG 9820T
See LMG 9820T
Paenibacillus larvae
larvae
LMG 16245
NRRL B-3650
Diseased honey bee larvae L Bailey, Rothamsted Expt. Station, Harpenden, UK. strain Australia (“Victoria”)
Paenibacillus larvae
larvae
LMG 18149
Hornitzky 89/2302/4
Victoria, Australia, honey bee
ATCC 13537 DSM 3615
T
Dead larvae honey bee
T
IFO 15408T NCIMB 11201T
Paenibacillus larvae
pulvifaciens
LMG 6911
T
NRRL B-3688T NRRL B-3685T NRRL B-3670T LMG 16248T LMG 15974T
Paenibacillus larvae
pulvifaciens
LMG 14427
Paenibacillus larvae
pulvifaciens
LMG 14428
ATCC 25367
Unknown
ATCC 25368 T
Unknown T
See LMG 6911T
Paenibacillus larvae
pulvifaciens
LMG 15974
Paenibacillus larvae
pulvifaciens
LMG 16247
NRRL B-3687
(1949), honey bee larvae, H Katznelson #754
Paenibacillus larvae
pulvifaciens
LMG 16248T
See LMG 6911T
See LMG 6911T
Paenibacillus larvae
pulvifaciens
LMG 16250
NRRL B-14154
Unknown
CCM 38
Unknown
See LMG 6911
CCUG 7427
Paenibacillus larvae
Paenibacillus larvae
pulvifaciens
pulvifaciens
LMG 16251
LMG 16252
NCFB 1121 NRRL NRS-1283
Powdery scale, H Katznelson #113
DSM 8443
Dead honey bee larvae
NRRL NRS-1684
spores are infectious to honey bees. While P. larvae sporulates and
PLA agar (Schuch et al., 2001) and T-HCl-YGP agar (Steinkraus and
grows efficiently in the haemolymph of bee larvae, most strains grow
Morse, 1996). PLA medium shows superior plating efficacy and also
poorly in artificial media. Different culture media have been developed the advantage of inhibiting the majority of micro-organisms normally for P. larvae cultivation. MYPGP agar (Dingman and Stahly, 1983)
present in the hive and in bee products. T-HCl-YGP agar is the
yielded the highest percentage of spore recovery, while J-agar
medium of choice for cultivation P. larvae starting from honey
(Hornitzky and Nicholls, 1993), brain heart infusion agar (BHI)
(Steinkraus and Morse, 1996). When starting from diseased larvae,
(Gochnauer, 1973), Columbia sheep blood agar (CSA) (Hornitzky and
nalidixic acid is necessary to avoid growth of P. alvei. When starting
Karlovskis, 1989) proved to be less efficient in this respect (Nordström from other sources (e.g. honey), pipemidic acid prevents contamination and Fries, 1995). Other media used for the cultivation of P. larvae are
with other spore-forming bacteria.
de Graaf et al.
6
MYPGP agar (per litre):
All solid media are sterilized at 121°C for 15 min. After the three
10 g Mueller-Hinton broth (Oxoid CM0405)
molten media are combined 30 ml of 50% egg-yolk suspension is
15 g yeast extract
added to form the PLA medium.
3 g K2HPO4
Cool the media to 50°C and add the antibiotics to a final
1 g Na-pyruvate
concentration of 20 µg/ml for nalidixic acid and 10 µg/ml for pipemidic
20 g agar
acid.
Autoclave at 121°C/15 min.
Add 20 ml 10% glucose (autoclaved separately).
Nalidixic acid stock solution (1 mg/ml) is prepared by dissolving 0.1 g in 2 ml of 1 M NaOH and diluting to 100 ml with 0.01 M phosphate buffer (pH 7.2).
BHI agar:
Pipemidic acid stock solution (2 mg/ml) is prepared by dissolving 0.2 g in 2 ml of 1 M NaOH and then diluting to 100
Suspend 47 g brain heart infusion agar (Oxoid CM1136) in 1
ml with 0.01 M phosphate buffer (pH 7.2).
litre of distilled water.
Autoclave at 121°C for 15 min.
Add 1 mg thiamine hydrochloride per litre.
The medium is poured (20 ml) into sterile Petri dishes and plates
Both antibiotic solutions are filter sterilized.
are dried before use (15 min). CSA-agar:
Plates inoculated with 150 µl heat-shocked spore suspension are
Dissolve 39 g Columbia blood agar base (Oxoid CM0331) in 1
incubated at 35°C up to 6 days in either aerobic conditions or under
litre distilled water.
an atmosphere of 5-10% CO2. Vegetative bacteria are grown
Autoclave at 121°C/15 min.
overnight at 35°C without heat-shock treatment.
Supplement with 50 ml sterile defibrinated blood (at 50°C).
The outline of the procedure starting from honey samples is as follows:
T-HCl-YGP (per litre):
15 g yeast extract
1 g pyruvic acid
200 ml 0.1 M Tris-HCl, pH 7.0
20 g agar
Autoclave at 121°C/15 min.
Add 40 ml 10% glucose (autoclaved separately).
1. Dilute 20 g of honey in 20 ml PBS. 2. Shake vigorously. 3. Centrifuge the suspension 40 min at 6,000 x g to harvest the spores. 4. Resuspend the pellet in 1 ml of PBS. 5. Heat treat and plate this spore containing aqueous solution as described above.
J agar (per litre):
3.2. Identification
5 g tryptone
Often the first step in the identification of P. larvae growing on solid
3 g K2HPO4
media is the verification of its growth rate and colony morphology.
15 g yeast extract
Visible colonies may appear on the second day of incubation.
20 g agar
However, if no colonies emerge it is advisable to extend the
Adjust pH to 7.3 to 7.5.
incubation time for a few more days. Two serial subcultures should be
Autoclave at 121°C/15 min.
grown to insure culture purity. Pure P. larvae colonies have a
Add 20 ml 10% glucose (autoclaved separately).
characteristic morphology but this appears to be highly dependent on the medium that was used (see OIE, 2008). Using P. larvae reference
PLA medium consists of three different media supplemented with egg yolk. Equal quantities (100 ml) of sterile, molten Bacillus cereus
strains is highly advisable. Some non-molecular identification protocols exist and provide a
selective agar base (Oxoid CM617), trypticase soy agar (Merck 5458)
good alternative for diagnostic purposes when sophisticated
and supplemented nutrient agar (SNA) are combined and mixed. SNA
equipment is lacking (see OIE, 2008). However, for research purposes
is composed of (per litre):
we recommend a PCR-based identification of P. larvae. Several PCR
23 g nutrient agar
methods have been described (reviewed by de Graaf et al., 2006a),
6 g yeast extract
but one in particular based on the 16S rRNA gene (Dobbelaere et al.,
3 g meat extract
2001) has proven its robustness in the past decade. A detailed
10 g NaCl
description is given here below. Primers are listed in Table 3.
2 g Na2HPO4
Adjust pH to 7.4 ± 0.2.
The COLOSS BEEBOOK: American foulbrood
7
Table 3. Primer sets for identification and genotyping of P. larvae by PCR. Name
Sequence
AFB-F
5'-CTTGTGTTTCTTTCGGGAGACGCCA-3'
AFB-R
5'-TCTTAGAGTGCCCACCTCTGCG-3'
Primer 1
5’-AAGTCGAGCGGACCTTGTGTTTC-3’
Primer 2
5-’TCTATCTCAAAACCGGTCAGAGG-3’
ERIC1R
5´-ATGTAAGCTCCTGGGGATTCAC-3´
ERIC2
5´-AAGTAAGTGACTGGGGTGAGCG-3´
BOXA1R MBO-REP1
PCRproduct size 1106 bp
973 bp
Reference Dobbelaere et al., 2001 Govan et al., 1999
Several amplicons
Versalovic et al., 1994
5´-CTACGGCAAGGCGACGCTGACG-3
Several amplicons
Versalovic et al., 1994
5´-CCGCCGTTGCCGCCGTTGCCGCCG-3
Several amplicons
Versalovic et al., 1994
3.2.1. Bacterial DNA extraction
restriction endonuclease fragment patterns (Djordjevic et al., 1994;
Bacterial DNA extraction can be done using commercialized kits/
Alippi et al., 2002), pulsed-field gel electrophoresis (Wu et al., 2005;
matrices (InstaGene matrix, Bio-Rad, Genersch and Otten, 2003;
Genersch et al., 2006), amplified fragment length polymorphism (de
Genome DNA Extraction kit, Sigma, Antúnez et al., 2007). However,
Graaf et al., 2006b), ribotyping and denaturing gradient gel
heating the bacterial suspension at 95°C for 15 min works also fine
electrophoresis (Antúnez et al., 2007). Nevertheless, some of these
for simple species identification.
techniques differentiating P. larvae genotypes, have not been adopted by the scientific community.
3.2.2. Polymerase chain reaction
An appropriate genotyping method should be highly discriminatory,
PCR reactions (modified from Dobbelaere et al., 2001) are set up as but also demonstrate interlaboratory and intralaboratory reproducibility. 50 µl mixtures containing:
It should be easy to use and interpret (Genersch and Otten, 2003).
1-5 µl template DNA
For these reasons, the most utilized method is rep-PCR, or PCR
50 pmol forward (AFB-F) and reverse primer (AFB-R);
amplification of repetitive elements (Versalovic et al., 1994), although
(primers used by Govan et al., 1999 also work well)
presently its reproducibility in other labs has not been proven. There
10 nmol of each dNTP
are three sets of repetitive elements randomly dispersed in the
1-2.5 U of Taq polymerase in the appropriate PCR buffer
genome of bacteria, enterobacterial repetitive intergenic consensus
containing 2 mM MgCl2.
(ERIC) sequences, repetitive extragenic palindromic (REP) elements,
Use the following PCR conditions: a 95°C (1-15 min) step; 30
and BOX elements (which includes boxA, boxB, and boxC). Primers to
cycles of 93°C (1 min), 55°C (30 sec), and 72°C (1 min); and a final
amplify those elements have been reported and proved to be useful
cycle of 72°C (5 min).
for subtyping of Gram-positive and Gram-negative bacteria (Versalovic
et al., 1994; Olive and Bean, 1999).
3.3. Genotyping The availability of standardized techniques that allow the
rep-PCR has been widely used for the study of P. larvae (Alippi and Aguilar, 1998a, 1998b; Genersch and Otten, 2003; Alippi et al.,
discrimination of different P. larvae strains is essential for studying the 2004; Antúnez et al., 2007; Peters et al., 2006; Loncaric et al., 2009). epidemiology of AFB. This will allow scientists to identify outbreaks of
The most useful pair of primers are ERIC1R-ERIC2, which allowed the
the disease, determine the source of infection, determine the
differentiation of four different genotypes (ERIC I, II, III and IV)
relationship between outbreaks, recognize more virulent strains, and
(Genersch et al., 2006). Genotypes ERIC I and II corresponds to the
monitor prevention and treatment strategies.
former subspecies P. l. larvae while genotypes ERIC III and IV
To date different techniques have been used in order to evaluate the diversity of P. larvae isolates. Some of them are based on the analysis of phenotypic characteristics, such as study of cell and colony
corresponds to the former subspecies P. l. pulvifaciens (Genersch, 2010).
P. larvae genotype ERIC I is the most frequent genotype and is
morphology, analysis of whole bacterial proteins by SDS-PAGE or
present in Europe and in America, genotype ERIC II seems to be
biochemical profile, among others (Hornitzky and Djordevic, 1992;
restricted to Europe and genotypes ERIC III and IV have not been
Neuendorf et al., 2004; de Graaf et al., 2006a; Genersch et al., 2006;
identified in field for decades, but exist as few isolates in culture
Antúnez et al., 2007). During the last decade methods based on
collections (Genersch, 2010). In order to enhance the discrimination
genetic analysis have gained more attention. Different strategies have of strains, the analysis using ERIC primers can be complemented with been used to evaluate the genetic diversity of P. larvae, including
the use of other primers. The use of BOXA1R primer allowed the
de Graaf et al.
8
discrimination of four banding patterns in America, all of them
Modifications of the present protocol, such as those reported by Alippi
belonging to genotype ERIC I (Alippi et al., 2004; Antúnez et al., 2007) et al. (2004) or Antúnez et al. (2007) also resulted useful, allowing and three in Europe (Genersch and Otten, 2003; Peters et al., 2006;
the differentiation of P. larvae genotypes.
Loncaric et al., 2009). Primers BOX B1 and BOX C1 did not amplify
Interpretation of the results:
P. larvae DNA (Genersch and Otten, 2003). When REP primers were
III and IV) can be distinguished (Genersch et al., 2006).
used, four banding patterns were found in America and Europe although results could not be compared since different pairs of
ERIC1R-ERIC2 primers: four different genotypes (ERIC I, II,
BOXA1R primers: three different patterns can be found in Europe
primers (REP1R-I and REP2-I and MBO REP1 primers) were used
patterns
(Alippi et al., 2004; Kilwinski et al., 2004; Loncaric et al., 2009). Protocols for subtyping of P. larvae are provided below.
can be found in America (A, B, C and D) (Alippi et al., 2004).
Restriction fragment length polymorphic (RFLP) analysis of
MBO REP1 primers: four band patterns can be found in Europe (B, b, β, Б) (Peters et al., 2006).
bacterial genomes, as visualized via pulsed-field gel electrophoresis (PFGE), is also a very effective procedure for bacterial genotyping
3.3.2. Pulsed-field gel electrophoresis
(PFGE-typing). PFGE-typing of 44 P. larvae isolates, obtained from
3.3.2.1. Preparation of genomic DNA agarose plugs
honey bee larval smears and honey samples collected in Australia and
1. Culture an isolate of P. larvae on an MYPGP agar plate for 48 h
from Argentinean honey, has demonstrated resolution of this bacterium into 12 distinct genotypes when using restriction
at 37°C. 2. Suspend a loopful of bacteria (2-3 colonies from an isolated
endonuclease XbaI (Wu et al., 2005). Outlined below is a PFGE-typing
area on the plate) into 500 µl MYPGP broth and centrifuge for
procedure for P. larvae. This procedure is presented as a three-part
1 min at RT.
operation of genomic DNA preparation, restriction digestion of DNA,
3. Remove the broth, suspend the pellet with 1 ml washing
and then electrophoresis of the digested DNA. Performance of PFGE-
buffer (see recipe below), and centrifuge for 1 min at RT.
typing is labour intensive. Also, many factors can contribute to an
4. Remove the washing buffer.
unsuccessful electrophoresis run. Therefore, troubleshooting PFGE
5. Completely suspend the bacterial cell pellet in 0.30 ml
and helpful hints for performing this technique can be found in the
washing buffer + 0.05 ml Proteinase K (0.5 mg/ml).
protocols section of the Bio-Rad website (http://www.bio-rad.com/
6. Warm the suspension to 50°C.
evportal/en/US/LSR/Solutions/LUSORPDFX/Pulsed-Field-Gel-
7. Mix the suspension with an equal volume of melted 2%
Electrophoresis).
SeaKem Gold agarose (prepared in washing buffer; Cambrex Bio Science Rockland, Inc., ME) at 50°C.
3.3.1. PCR amplification of repetitive elements
8. Quickly pipette into two wells of a plug mold (Bio-Rad
Polymerase chain reaction (according to Genersch and Otten, 2003): 1. Carry out PCR reactions in a final volume of 25 μl consisting of
Laboratories, Inc.) warmed to 37°C. 9. Solidify the plugs at 4°C for 30 min.
1 × reaction buffer and a final concentration of 2.5 mM MgCl2,
10. Remove the two plugs from the mold.
250 μM of each dNTP, 10 μM of primer, and 0.3 µg of Hot
11. Add plugs to 5 ml preheated Proteinase K Solution in a 50 ml
start Taq polymerase. Five to ten µl of template DNA is added to the reaction.
plastic culture tube. 12. Incubate overnight at 50°C with gentle agitation (shaker
2. The cycling conditions are: an initial activation step at 95°C for 15 min, 35 cycles at 94°C for 1 min, 53°C for 1 min, and
water bath). 13. Preheat 10 ml H2O and 40 ml TE80 buffer (see recipe below)
at 72°C for 2.5 min, and a final elongation step at 72°C for 10 min.
to 50°C. 14. Wash plugs (use a sterile BioRad green screened caps; part
3. Analyse five µl of the PCR reaction by electrophoresis on 0.8% agarose gel in TAE or TBE buffer.
#170-3711) with 10 ml 50°C H2O (add, swirl, and drain). 15. Wash plugs with 10 ml 50°C TE80 buffer 4X (15 min for each
4. Stain the amplified bands by incubation of the agarose gel in ethidium bromide (0.5 μg/ml in water) for 30 min.
wash with gentle shaking). 16. Add 5 ml RT TE80 buffer to the plugs in the 50 ml culture
5. Visualize under UV light and photograph using a digital
tube and store at 4°C. Plugs are good for approximately 2 months in TE80 buffer at 4oC.
camera. 6. Compare obtained fingerprints visually or using specific analysis programs. Independent PCR reactions should be performed using primers ERIC1R/ERIC2, BOXA1R and MBO-REP1 (Table 3).
Wash Buffer (100 ml):
200 mM NaCl (4.0 ml of 5 M stock)
10 mM Tris-HCl (pH 7.5) (1.0 ml of 1 M stock)
100 mM EDTA (20.0 ml of 0.5 M stock)
The COLOSS BEEBOOK: American foulbrood
9
Proteinase K Solution (100 ml):
5. Allow gel to solidify for a minimum of 30 min.
50 mM EDTA (10.0 ml of 0.5 M stock)
6. Add remaining 2.2 litres of 0.5X TBE buffer to the CHEF
1.0 g N-lauroylsarcosine
50 mg Proteinase K (final 0.5 mg/ml)
50 mg Lysozyme (final 0.5 mg/ml)
electrophoresis box. 7. Chill the buffer to 14°C by circulation through the chiller-pump unit. 8. Adjust flow rate of buffer through the chiller-pump unit to
TE80 Buffer (100ml):
10 mM Tris-HCl (pH 8.0) (1.0 ml of 1 M stock)
1 mM EDTA (0.2 ml of 500 mM stock)
between 0.75 and 1.0 l/min. 9. Once gel has solidified and the comb is removed, remove a digested plug slice from the microcentrifuge tube. 10. Place the slice onto inner surface of sterile Petri dish.
3.3.2.2. Restriction enzyme digestion 1. Aseptically remove a plug from the TE80 buffer and place onto the inner surface of a sterile petri dish. 2. Using a plastic ruler under the petri dish, cut two 2 mm slices from the plug with a sterile razor blade. 3. Place the two plug slices into 1 ml TE80 buffer in a 1.5 ml microcentrifuge tube. 4. Wash the slices 2X with 1 ml TE80 buffer (30 min for each wash with gentle agitation). 5. Quickly rinse the slices with 500 µl restriction digestion buffer (without restriction enzyme). 6. Add 100 µl of XbaI Digestion Mixture (see recipe below) and incubate 3 h at 37°C with gentle agitation. 7. Remove digestion mixture solution. 8. Rinse slices 2X with 1 ml 0.5X TBE Buffer (see recipe below). 9. Suspend the plug slices in 1 ml 0.5X TBE Buffer.
11. Carefully slide the plug slice onto the side of a sterile razor blade using a sterile microspatula. 12. Holding the razor blade (with the plug slice sticking to the side) at the edge of a well, carefully use the microspatula to slide the plug slice into the well. Use care not to introduce air bubbles in the well. 13. Wash and flame sterilize the razor blade and microspatula for continued loading of wells with other prepared DNA plug slices. 14. Add low range molecular size standards (4.9-120 kb) (Bio-Rad) to outer wells. 15. Seal the wells with the saved SeaKem Gold agarose. Use care not to introduce any air bubbles during sealing and fill any wells that do not contain slices. 16. Place the gel into the circulating pre-cooled buffer within the CHEF electrophoresis box.
10. Store overnight at 4°C.
17. Allow the gel to cool for 15 min prior to beginning
XbaI Digestion Mixture (10 samples):
18. Perform electrophoresis in the Bio-Rad CHEF DR III system
electrophoresis.
10X New England BioLabs Buffer 4 (100 µl)
using the following electrophoresis run parameters:
100X BSA (10 µl)
Switch angle: 120°
XbaI enzyme (20 µl) New England BioLabs (20,000 U/ml)
Switch time: 1-6 sec
H2O (870 µl)
Voltage: 6 V/cm
Temperature: 14°C
Run time: 16 hours
5X TBE Buffer (500 ml):
Tris Base (54 g)
Boric Acid (27.5 g)
dark with Sybr Green (Molecular Probes, Inc., Eugene, OR)
0.5 M EDTA (pH 8.0) (20 ml)
(30 µl of 10,000X concentrate diluted into 300 ml TE pH 7.5)
H2O to 500 ml volume
19. Following electrophoresis, remove and stain the gel in the
at RT for 45 min. 20. Photodocument the gel via UV transillumination/epi-illumination
3.3.2.3. Gel loading and electrophoresis
(254 nm).
1. Make 2.3 litres of 0.5X TBE buffer (230 ml 5X TBE + 2070 ml H2O). 2. Add 1.0 g Seakem Gold agarose to 100 ml 0.5X TBE Buffer.
3.4. In vitro sporulation of Paenibacillus larvae Paenibacillus larvae and Paenibacillus popilliae, “catalase-minus”
3. Carefully melt agarose in microwave oven. Save 5 ml (at 55°C) paenibacilli as defined by the loop test (i.e. scraping growth from a to seal the wells. 4. Assemble the gel forming tray, assure that the tray is level with the well comb in place, and pour melted agarose into
slant or plate with an inoculating loop, placing into 3% H2O2, and examining for bubble formation), have the characteristic of sporulating efficiently in their insect hosts, but usually exhibit very
forming tray (cool melted agarose to 55-60°C before pouring). poor sporulation when general in vitro growth conditions are used.
de Graaf et al.
10
For P. larvae, suppression of in vitro sporulation has been postulated
11. Store at 4°C. Note: Spores must be removed from the solid
to result from oxygen toxicity (Dingman and Stahly, 1984). Growth of
growth medium for preservation. When left on the agar plates
strain NRRL B-3650 under limiting O2 improves sporulation in liquid
for extended time, heat-resistant counts decline rapidly
culture. Also, nutrient availability at time of sporulation has been
(Dingman, 1983). Also, long-term survival of washed spores
shown to influence spore production (Dingman and Stahly, 1983).
that have been desiccated is not known.
Procedures promoting effective sporulation of P. larvae on solid, and in liquid, growth media have been developed (Dingman, 1983). By limiting colony number, many strains have been observed to sporulate well on MYPGP agar plates (see section 3.1. for recipe). However, Mueller-Hinton broth – one of its ingredients – was
12. Obtain spore concentration by heating a portion of the spore stock at 65°C for 15 min. 13. Perform serial-dilution plating onto MYPGP or T-HCl-YGP (Steinkraus and Morse, 1996) agar plates. 14. Incubate inoculated plates 6-7 days at 37°C to determine
inhibitory to sporulation of strain NRRL B-3650 in liquid culture,
colony counts (i.e., spore counts). Alternatively, determine
rendering use of this growth medium in liquid form ineffective for
spore number by direct microscopic counting. Note: The latter
sporulation. Development of a liquid growth medium (TMYGP; 1.5%
will give an overestimation. Heat resistant spore counts are
Difco yeast extract; 0.4% glucose; 0.1% sodium pyruvate; 0.03M Tris
usually about 6% of direct microscopic spore counts
-maleate, pH 7.0; in distilled water) and conditions that aided
(Dingman and Stahly, 1983).
sporulation of P. larvae NRRL B-3650 has been reported (Dingman and Stahly, 1983). Unfortunately, other strains of this bacterium sporulated poorly, if at all, in this medium. However, Genersch et al.
3.4.2. Sporulation in liquid growth medium 1. Inoculate TMYGP broth (6 ml in a 20 x 150 mm loosely
(2005) reported using the liquid part of Columbia sheep-blood agar
capped screw-cap glass culture tube, see section 3.1. for
slants for production of endospores from different P. larvae strains.
recipe) with P. larvae NRRL B-3650. Note: Other bacterial
Following are protocols using solid and liquid media growth conditions
strains must be tested separately because they may sporulate
for in vitro sporulation of P. larvae.
poorly in this medium and under these growth conditions. 2. Incubate the culture at 37°C in a rotary incubator shaker
3.4.1. Sporulation on solid growth medium 1. Create a 2-fold dilution series of the P. larvae bacterial culture being studied using MYPGP broth and spread each dilution onto several MYPGP agar plates (see section 3.1. for recipe). 2. Incubate plates at 37°C for 6-7 days and select plates
adjusted to 195 rpm. The culture tube is held at a 45° angle in a wire test tube rack during incubation and aeration. 3. Incubate for 3 to 4 days while microscopically monitoring cellular growth and sporulation. Other strains of P. larvae may require a longer incubation time for sporulation to occur.
exhibiting 50 to 5,000 colonies per plate. Note: When high
Alternatively, see Genersch et al. (2005) for sporulation of P.
numbers of colonies are present on a plate, sporulation
larvae in the liquid part of Columbia sheep-blood agar slants.
efficiency can decline. Also, maximum sporulation obtained in
4. Collect and concentrate spores via centrifugation.
relation to the plate colony number will vary between bacterial
5. Wash the spores four times with 30 ml cold sterile H2O (as
strains. 3. During the 6-7 days of incubation, microscopically monitor cellular growth and sporulation via single colony analysis. 4. After incubation, remove spores from the surface of the agar medium by washing three times (5 ml sterile H2O per wash). 5. Combine the three washes. Once H2O is added to a plate, use gentle rubbing of the agar surface with the sterile glass pipette to loosen spores from the surface. 6. To produce a spore stock following removal of spores from a
described in section 3.4.1.). 6. Suspend the washed spores in a final volume of 5 ml cold H2O. 7. Store at 4°C. 8. Obtain spore counts (i.e. heat resistant counts) by serialdilution plating of the spore suspension onto MYPGP plates following heating of the suspension at 65°C for 15 min or determine counts by direct microscopic counting. Note: Heat resistant spore counts are usually about 6% of direct microscopic spore counts (Dingman and Stahly, 1983).
plate surface, concentrate the spore suspension via centrifugation (12,000 x g, 15 min, 4°C).
3.5. Long term conservation of vegetative cells
7. Discard the supernatant.
Experimental work using P. larvae requires a readily available source
8. Suspend the resulting spore pellet in 30 ml cold sterile H2O.
of this bacterium in culture. However, P. larvae quickly dies in culture
9. Perform alternate centrifugation and pellet suspension four
and some means of preserving an isolate must be used. Although
times. 10. Suspend the spore pellet in a final volume of 5 ml cold sterile H2O.
short-term preservation works (see section 3.5.1.), long-term conservation is required to maintain the genetic integrity of the original isolate.
The COLOSS BEEBOOK: American foulbrood
Production of frozen endospore stock suspensions is a very good procedure for long-term preservation. However, some isolates may not sporulate well in vitro and the slow rate of spore germination can
11
To prepare lyophilization vials: 1. Cut Pyrex glass tubing (6 mm diameter glass with 1 mm wall thickness) 15 cm long and seal one end by melting.
hamper the start of experiments. Methods employing ultra-low
2. Plug the open ends of the vials with cotton.
freezing and lyophilization of vegetative cells (see sections 3.5.2. and
3. Autoclave. Note: Ampules using rubber septa and aluminium
3.5.3. below) are suitable for long-term storage of this microbe. Use of ultra-low freezing of P. larvae in glycerol has been routinely used and cultures exceeding five years of storage at -80°C remain viable (Douglas W Dingman; personal observations). No known
sealing rings may be used as an alternative to the above three steps. However, use of these ampules increase costs and the vacuum may be lost over time. 4. After 2-3 days incubation of the bacterium from an agar slant/
research regarding preservation of P. larvae by lyophilization has
plate, wash with sterile bovine serum (e.g. Colorado Serum Co.,
been published. However, Haynes et al. (1961) developed a method
Denver, CO).
to preserve P. popilliae by lyophilization and Gordon et al. (1973) imply that this method can be used for P. larvae. The protocol long
5. Place 0.1 ml aliquots of the cell/serum suspension into the sterilized vials, label, date.
used to preserve P. larvae strains at the National Center for Agricultural
6. Attach the vials to a lyophilizer apparatus.
Utilization Research (USDA-ARS Culture Collection; NRRL) is similar to
7. Lower the vials into a solution of 50% ethylene glycol and 50%
that described by Haynes et al. (1961) for P. popilliae.
water (chilled to -50°C with dry ice) to freeze the cell suspensions.
3.5.1. Short-term preservation 1. Weekly transfer of an isolate onto fresh growth medium. 2. Incubate for two days at 37°C. 3. Store at 4°C.
8. Turn on the lyophilizer vacuum pump. 9. Evacuate for 3 hours while letting the temperature of the glycol/water bath gradually warm to -4°C. 10. Lift the vials from the glycol/water bath. 11. Allow the outer surfaces to dry for 1 hour at RT.
3.5.2. Preservation via ultra-low freezing 1. Inoculate MYPGP broth (see section 3.1. for recipe) using a fresh culture of P. larvae. 2. Grow overnight at 37°C with moderate aeration. 3. Growth in the morning should show light to moderate
12. Carefully cut the vials from the lyophilizer apparatus using a dual tip burner, running on natural gas and oxygen, to melt the upper portion of the glass vial while sealing the contents under vacuum. 13. Store sealed vials refrigerated in the dark.
turbidity. Note: Turbidity should not reach the point where the culture has become opaque. A light turbidity will place the
3.6. Measuring susceptibility/resistance to
culture in early to mid-exponential growth. Also, growth can
antibiotics of Paenibacillus larvae
be washed from the surface of a solid medium using fresh
In some countries, the antibiotic oxytetracycline (OTC) has been used
liquid medium.
by beekeepers for decades to prevent and control AFB in honey bee
4. Examine the culture microscopically to gauge contamination while chilling the culture on ice (optional). 5. Add an appropriate volume of a sterile solution of 100%
colonies as an alternative to the burning of infected beehives in areas where disease incidence is high. However, the intensive use of tetracyclines in professional beekeeping resulted in tetracycline-
glycerol to the culture to produce a bacterial suspension
resistant (TcR) and oxytetracycline-resistant (OTCR) P. larvae isolates.
containing 20% glycerol (i.e. 0.25 ml of glycerol per 1.0 ml of
There is now general concern about widespread resistance involving
culture).
horizontal-transfer via non-genomic (i.e. plasmid or conjugal
6. Aliquot 0.5 ml of the bacterial / glycerol suspension into
transposon) routes and also induced resistance by the presence of
cryovials. Snap-top microcentrifuge tubes also work, but may
sub-inhibitory concentrations of tetracycline (Alippi et al., 2007).
result in faster loss of viability during storage.
P. larvae highly resistant phenotypes have been correlated with the
7. Label and date the vials.
presence of natural plasmids carrying different Tc resistance
8. (Optional) Quickly freeze the aliquots in an ethanol/dry ice
determinants, including tetK and tetL genes (Murray and Aronstein,
bath. 9. Place the bacterial suspensions in a pre-chilled storage box and store at -80°C.
2006; Alippi et al., 2007; Murray et al., 2007). Most Paenibacillus species, including P. larvae, are highly susceptible to tetracyclines; it has been reported that the growth of
P. larvae strains is inhibited at concentrations as low as 0.012 µg of 3.5.3. Preservation via lyophilization
oxytetracycline per ml of culture medium. Alternatively, when a disc
(J. Swezey, USDA-ARS Culture Collection (NRRL), Peoria , IL; personal containing 5 µg of oxytetracycline is placed on an agar plate previously communication)
spread with a bacterial suspension, the clear zones formed by the
de Graaf et al.
12
sensitive strains usually average 50 mm in diameter including the disc
9. Dry the plates in a sterile laminar flow cabinet so that no
(Shimanuki and Knox, 2000). Any reduction of the inhibition zone or
drops of moisture remain on the surface of the agar; do not
an increase in the minimal inhibitory concentration (MIC) required to
over-dry plates.
prevent the growth of P. larvae would be evidence of the development of resistant strains.
10. Incubate each P. larvae strain to be tested on MYPGP agar for 48 h at 36°C to obtain mainly vegetative cells. 11. Adjust the bacterial suspension until the OD620 (density of a
3.6.1. Determination of minimal inhibitory concentrations (MICs)
culture determined spectrophotometrically by measuring its
Microorganisms can be tested for their ability to produce visible
optical density at 620 nm) is about 0.4.
growth on a series of agar plates (agar dilution), in tubes with broth
12. Each bacterial suspension of each strain must be inoculated
(broth dilution), or in microplate wells of broth (broth microdilution)
onto the surface of the culture medium by adding drops of 5 µl
containing dilutions of an antimicrobial agent. Additionally, gradient
each by means of an automatic micropipette (usually 15-20
MIC tests are also commercially available. MIC is defined as the
drops per plate).
lowest antibiotic concentration that prevents visible growth of
It is possible to test different strains on the same plate. This
bacteria. MIC methods are widely used in the comparative testing of
procedure must be repeated at least twice for each strain and
new agents, or when a more accurate result is required for clinical
tetracycline concentration, and control plates without
management. As there are no CLSI (formerly NCCLS) (www.clsi.org)
antibiotic must be used. It is strongly recommended to include
nor EUCAST (www.eucast.org) recommendations for the
control strains with known MICs in each batch.
determination of MICs of P. larvae, MIC values of tetracycline and other antibiotics can be determined by the agar dilution method using
13. Place the plates open into a sterile laminar flow cabinet until the drops are absorbed.
MYPGP as basal medium (see section 3.1. for recipe) as described as
14. Incubate the plates in inverted position at 36°C ± 1 for 48 h.
follows:
15. After incubation, ensure that each tested strain has grown on
1. Obtain antimicrobial powders directly from the manufacturer or from commercial sources. The agent must be supplied with
the antibiotic-free plate control. 16. Read the MIC endpoint for each strain as the lowest
a stated potency (mg or International Units per g powder, or
concentration of antibiotic at which there is no visible growth.
as percentage potency).
The growth of one or two colonies or a fine film of growth
2. Store powders in sealed containers in the dark at 4°C with a desiccant unless otherwise recommended by the manufacturer. 3. Prepare antibiotic stock solutions by using the following formula:
should be disregarded. Interpretation: for tetracyclines, P. larvae isolates should be considered as ”susceptible” when there MICs are <4 µg/ml, ”intermediate” for MICs between 4-8 µg/ml and ”resistant”’ for MICs
Weight of powder (mg)
≥16. Examples of acceptable MIC values for control strains are:
= Volume of solvent (ml) X Concentration (µg/ml)
Pseudomonas aeruginosa (ATCC 27853): between 16-32 µg/ml
Potency of powder (µg /mg)
(resistant); Escherichia coli (ATCC 25922): between 0.5-2 µg/ml (susceptible); Staphylococcus aureus (ATCC 29213): between 0.12-1
4. It is recommended that concentrations of stock solutions
µg/ml (susceptible) and Enterococcus faecalis (ATCC 29212): between
should be 1,000 µg/ml or greater. In the case of tetracyclines, 16-32 µg/ml (resistant). the tested concentrations can be achieved by using two stock
When examining a population of bacteria, it is suggested to calculate
solutions of 5,000 µg/ml and 1,000 µg tetracycline/ml in
their values of MIC50 and MIC90 (minimum concentration necessary to
ethanol, stored at -20°C in darkness until used.
inhibit the growth of 50 and 90% of microorganisms tested respectively).
5. Prepare MYPGP agar flasks and maintain them at 45°C until the antibiotic solutions are incorporated. 6. Pour 25 ml of culture medium onto each Petri dish of 90 mm
3.6.2. Determination of antibiotic susceptibility testing by the disc diffusion method
in diameter to give a level depth of 4 mm ± 0.5 mm. If using
The disc diffusion method of antibiotic susceptibility testing is the most
150 mm diameter Petri dishes, 70 ml of culture medium
practical method for determining antibiotic susceptibility/resistance of
should be dispensed.
microorganisms to different antimicrobial agents. The accuracy and
7. Prepare plates with increasing concentrations of tetracycline
reproducibility of this test are dependent on maintaining standard
i.e.: 0.03, 0.06, 0.125, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and
procedures. As there are no CLSI (formerly NCCLS) (www.clsi.org) nor
128 µg/ml. For the controls, MYPGP agar without antibiotic is
EUCAST (www.eucast.org) recommendations for the determination of
used.
susceptibility/resistance of P. larvae by the disc diffusion method, a
8. Allow the plates to set at RT before moving them.
method developed for this species is described below.
The COLOSS BEEBOOK: American foulbrood
13
For determining tetracycline resistance, the agar diffusion procedure
plate; in this case, discs should be spaced so that zones of
can be employed, using MYPGP agar (see section 3.1. for recipe) and
inhibition in susceptible isolates do not overlap. Overlapping
5 µg tetracycline discs (Oxoid® or BBL®). The discs can also be
will impede the measurement of zone diameters.
®
prepared in the laboratory by using S & S or similar sterile discs (6 mm in diameter) impregnated with 5 µg tetracycline per disc.
8. Apply the “15-15-15 rule”: Use the inoculum within 15 min of preparation and never beyond 60 min. Apply discs within 15 min of inoculating plates. Start incubation within 15 min of
3.6.2.1. Preparation of discs 1. Prepare a stock ethanol solution containing 500 µg/ml of tetracycline as explained in section 3.6.1.
application of discs. 9. Incubate the plates inverted at 36°C ± 1 during 72 h. 10. Measure the resulting inhibition zone (clear area without
2. Pipette 10 µl of the stock solution onto each sterile disc.
bacterial growth including the disc) by using a calliper or an
3. Dry the discs in a sterile laminar flow cabinet.
automated zone reading. Read the plates from the back
4. Store in sterile containers at -20°C in darkness until used. Note: Other tetracyclines (e.g., oxytetracycline) can be tested in
against a black background illuminated with reflected light. 11. A correct inoculum and satisfactorily spread plates will result
the same way. Discs containing antibiotics other than tetracyclines
in a confluent lawn of growth in the absence of antibiotic. It is
should be prepared at the concentrations suggested by CLSI or EUCAST.
important that there is an even lawn of growth to achieve uniformly circular inhibition zones. If individual colonies can be
3.6.2.2. Preparation of plates 1. Dispense MYPGP-agar cooled below 50°C into sterile Petri dishes to give a level depth of 4 mm ± 0.5 mm (25 ml in 90 mm diameter Petri dish, 70 ml in 150 mm diameter Petri dish).
seen, the inoculum is too light and the test must be repeated. In case of distinct colonies within zones, subculture the colonies, check purity and repeat the test if necessary. Interpretation: for tetracyclines, an inhibition zone of less than 20
2. Allow the agar to set before moving the plates.
mm in diameter (including the disc) is considered as the separation
3. Prepared plates can be stored at 4-8°C in sealed plastic no
point between resistant and susceptible strains as follows: ”resistant”
more than 7 days before using.
≤ 14 mm; ”intermediate”: between 15-19 mm and ”susceptible”: ≥20
The surface of the agar should be dry before use.
mm (Alippi et al., 2007).
4. No drops of water should be visible on the surface of the agar when the plates are used. Plates must not be over-dried.
It is strongly recommended to use reference standard strains according to the indications of NCCLS or EUCAST with the only difference that MYPGP agar (see section 3.1. for recipe) should be
3.6.2.3. Determination of resistance/susceptibility
used as basal medium.
1. Incubate vegetative cells of each P. larvae strain to be tested on MYPGP agar for 48 h at 36°C ± 1. 2. Suspend the cells directly from MYPGP in screw capped tubes containing sterile distilled water or sterile saline. 3. Adjust the bacterial suspension until the OD620 is in the range of 0.4. Alternatively, individual colonies of each strain can be
4. Experimental infection 4.1. Infection of in vitro reared larvae for the
to 75 h until the OD is in the range of 0.5. Optimally, use the
analysis of virulence and pathomechanisms of Paenibacillus larvae
adjusted suspension within 15 min of preparation and always
Exposure bioassays (Genersch et al., 2005) are a reliable approach to
within 60 min.
determine virulence of different P. larvae strains in the laboratory.
incubated at 36°C ± 1 in 2 ml aliquots of MYPGP broth for 26
4. Vortex for 3 minutes. 5. Dip a sterile cotton swab in the bacterial suspension and remove excess fluid on the swab by turning it against the inside of the tube. 6. Spread the inoculum evenly over the entire surface of the plate prepared in 3.6.2.2. by inoculating in three directions. 7. Place antibiotic discs (pre-warmed to RT) on the plate. Discs should be in firm, even contact with the surface of the medium. At least three replications for each bacterial strain is recommended. It is possible to apply more than one disc per
Briefly, this experiment consists in: 1. Rear first-instar larvae from various colonies in 24-well plates, with 10 larvae per well. 2. Provide larvae with larval food mixed with a determined quantity of infectious spores during the first 24 hours. Afterwards, larvae will receive normal food every day for the rest of the experiment. A control group receives normal larval diet throughout. 3. Each day dead larvae are recorded and examined for AFB infection.
de Graaf et al.
14
Table 4. Estimated LC50 and LT100 values (min-max) for ERIC I and ERIC II. (Genersch et al., 2005).
9. After 24 hours of infection, transfer larvae to a pre-warmed, fresh normal larval diet plate.
Genotype
LC50 (CFU ml-1 larval diet)
LT100 (days p.i.)
ERIC I
<<100-800
7-10
ERIC II
<<100-620
10-138.9
Use a different grafting tool for each treatment group to avoid reinfection. Thereafter, every treatment group receives fresh larval diet every 24 hours. 10. Analyze the plates each day under a stereo microscope to determine the health status of the larvae.
Spore preparations for experimental infection can be performed as described under section 3.4. or as described below (Genersch et al., 2005):
11. Transfer remaining (living) larvae to a new plate containing pre-warmed fresh larval diet. 12. Proceed with experiment until day 14.
1. Resuspend around 100 P. larvae colonies in 300 µl of brain heart infusion broth (BHI). 2. Inoculate on Columbia sheep blood agar (CSA) slants. 3. Incubate slants containing bacterial suspension at 37°C for 10 days or until sporulation has occurred.
Since larvae increase in size during the experiment, the number of larvae per well must be decreased accordingly. 13. After defecation (at day 7-8, when light yellow secretion can be observed surrounding the larvae), transfer larvae to pupation plates. Prepare pupation plates by lining every well
4. Collect medium containing spores.
with laboratory tissues, leaving 6 wells free for double distilled
5. Calculate spore concentration in the medium in colony
water.
forming units after plating different dilutions of the collected medium. 6. Count colonies after 6 days of incubation.
14. Larvae are classified as dead when they stop breathing (movement of tracheal openings stops) and lose body elasticity. The number of dead larvae should be reported every day.
4.1.1. Protocol for exposure bioassays 1. For grafting of larvae, dispense 300 µl of larval feed per well
15. To determine whether P. larvae infection caused the death of a larva, dead larvae are plated out on Columbia sheep blood
in a 24-well plate. Leave 6 wells empty (A1, A3, A5, D2, D4
agar (CSA) plates. Plates are incubated overnight at 37°C to
and D6) and fill them with 500 µl of double distilled water to
allow the growth of vegetative bacteria only (spores need
avoid desiccation.
about 3 days to germinate under these conditions). Positive
2. Incubate plates 30 min at 35°C to warm them up. 3. Graft the larvae by inserting a grafting tool under the back of the larvae floating in royal jelly without touching it, and carefully deposit it on the surface of the larval feed prepared
AFB infection will be confirmed by growth of P. larvae (see section 3.2.). 16. Further confirmation is provided by performing P. larvaespecific PCR-analysis of colonies grown from larval remains.
in the well plate. Deposit ten larvae per well. Note: Graft only
16.1. Pick one colony.
L1 instar larvae, under 12 hours of age from hatching.
16.2. Dissolve it in 25 µl of double distilled water.
Collecting larvae from as many different populations as
16.3. Boil at 95° for 10 minutes.
possible will ensure randomization, achieve homogenous
16.4. Centrifuge for 10 minutes at 9,500 rcf.
treatment groups, and avoid population-specific variations.
16.5. Supernatant can be used as template for PCR (see
4. For starting the experimental phase, aliquot larval feed and
section 3.2.2.).
add the necessary volume of spore suspension, which needs to contain a defined concentration of spores to adjust a defined 4.1.2. Analysis of generated data final spore concentration in the larval feed, e.g., to the desired In order to evaluate compiled experimental data, two different lethal concentration (LC) for the infection group (Table 4).
analyses to measure virulence can be performed. The first virulence
5. Dispense 300 µl per well of the spore-contaminated larval diet indicator is the lethal concentration (LC) value (Thomas and Elkinton, in 3 different wells. Leave 3 wells for the control group
2004), which indicates the spore concentration at which 50% (LC50)
receiving non-spore contaminated larval diet during the entire
or 100% (LC100) of the individuals are killed. To calculate this
experiment.
measure, the proportion of dead larvae from the number of exposed
6. Set ten larvae per well.
larvae is plotted against spore concentration. From such graphs, one
7. Incubate plates at 35°C for 24 hours.
can to estimate the spore concentration needed to kill a given
8. Groups of 30 larvae (in 3 wells) are treated as one replicate
proportion of the exposed population. These graphs also allow to
and at least three independent replicates should be performed deduce - for a certain analysed strain - the approximate spore for statistical analysis (see the BEEBOOK paper on statistics
concentration present when a specific percentage of the exposed
(Pirk et al., 2013)).
population is dead.
The COLOSS BEEBOOK: American foulbrood
15
Another measure of virulence is the lethal time (LT) (Thomas and
4.3. Measuring colony resistance to AFB
Elkinton, 2004) which is the time it takes the pathogen to kill 50%
4.3.1. Surveying inoculated colonies
(LT50) or 100% (LT100) of the infected animals. In order to obtain this
1. Inspect colonies every two weeks to assess disease levels and
measure, the time course of infection must be determined.
colony growth, and to ensure that all colonies were
Cumulative mortality per day is calculated as percentage of all
successfully inoculated.
individuals which died from P. larvae infection during the course of
2. Approximately 90 days after colony establishment, colony
the experiment (total number of P. larvae-killed animals until the end
growth can be measured by removing individual frames and
of the experiment). Average values are calculated every day from at
estimating the area of sealed immature brood (see the
least three independent replicates, and plotted against every time
BEEBOOK paper on methods for estimating strength
point (day post-infection).
parameters (Delaplane et al., (2013)). Simultaneously, the level of foulbrood disease can be determined by making a
4.2. Experimental infection of a bee colony
visual inspection of all brood (immature larval and pupal
Colony assays of AFB prevalence can be used to determine the
honey bees) for evidence of infection. Severity of AFB
efficacies of antibiotics and other treatments as well as the resistance
infection can be quantified using a modification of a standard
traits of specific colonies.
scoring method (Hitchcock et al., 1970). Each frame with brood is rated on a 0-3 scale as to AFB infection:
4.2.1. Inoculation with known spore concentration solution
0 = no visible signs of disease
Below is one protocol for a field evaluation of AFB prevalence, derived
1 = less than 10 cells/frame with visible AFB
from Evans and Pettis (2005):
2 = 11-100 cells with AFB
3 = greater than 100 cells with AFB
1. Establish clean colonies of equal strength by placing 1.2 kg of worker bees and a marked queen (from resistant or
A composite disease score is then generated by summing
susceptible stock, if desired) into a standard (e.g. Langstroth)
across all frames for each colony.
hive body.
3. An overall severity score for each colony on each inspection
2. Following establishment and the initiation of brood rearing
date can be obtained by calculating the mean (± s.d.) of the
(ca. 1 month), inoculate each colony twice (2-4 weeks apart)
individual frame scores. An overall score of 1 corresponds to a
with spores from a fresh field isolate of P. larvae.
colony with only slight clinical symptoms, possibly not noted
3. Inoculate by spraying approximately 2,000 immature bees
by cursory inspection. An overall score of 2 would indicate
(eggs, embryos, and first-and second-instar larvae) with a
noticeable symptoms, and a score of 3 corresponds to a
sucrose-water (1:10 weight/volume) suspension containing
highly symptomatic colony.
ca. 200 million P. larvae spores. Sufficient inoculant for > 50 colonies is prepared by
4.3.2. Colony resistance
macerating and suspending ca. 100 scales (dried larval
It is important to test the viability of the AFB spores used to challenge
remains) collected from symptomatic colonies.
the colony. A lack of clinical symptoms after challenge may be due to
4. Spray inoculation is effective at initiating AFB infection in colonies, with ca. 50% of managed colonies exhibiting AFB disease one month following a single inoculation, and nearly
colony resistance (Spivak and Reuter, 2001) or the use of non-viable spores.
An indirect way to test for colony resistance to AFB is to assay
all of susceptible colonies showing symptoms by three weeks
the colony for hygienic behaviour using the 24 h freeze-killed
after the second inoculation.
brood test, as outlined in the BEEBOOK paper on queen rearing and selection (Büchler et al., 2013). Colonies that
4.2.2. Inoculation with diseased brood
remove > 95% of the freeze-killed brood within 24 hours,
If it is not important to inoculate colonies with a known quantity of
over two repeated tests, are likely to demonstrate resistance
spores (e.g. if the goal of the experiment is simply to induce clinical symptoms of AFB), a comb section (15 cm x 15 cm) can be cut from
to AFB.
It has not been established whether colonies that remove > 95%
frames containing infective AFB scales (dried spores). At least 50% of
of pin-killed brood (another assay for hygienic behaviour) are
the cells should contain scale. Introduce the comb sections with AFB
also likely to be resistant to AFB. This needs to be tested.
scale into the middle frame in each colony.
de Graaf et al.
16
5. ‘omics and other sophisticated techniques 5.1. Paenibacillus larvae gene expression
5.1.1.4. qRT-PCR reactions For a single reaction, assemble the following components (total volume: 15 µl/reaction):
7.5 µl 2x Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen)
P. larvae gene expression under different experimental conditions can be investigated at the transcriptional level by making use of
0.03 µl of 100 µM forward and reverse primer each
quantitative reverse transcriptase polymerase chain reactions (qRT-PCR).
1.0 µl cDNA template
The state-of-the-art-analysis of qRT-PCR data relies on normalized
6.5 µl distilled water
and calibrated relative quantities (Vandesompele et al., 2002; Hellemans et al., 2007). In order to normalize the qRT-PCR data on
5.1.1.5. qRT-PCR program
target genes, normalization factors (NFs), based on the geometric
Set program as follows:
mean of converted threshold cycle values (Ct-values), need to be
50°C, 2 min, 1 cycle
calculated for each sample. Before calculating NFs, one has to decide
95°C, 2 min, 1 cycle
how many reference genes should be included in this calculation. This
[95°C, 20 sec; 60°C, 40 sec] 40 cycles
decision is based on the expression stability of candidate reference
After PCR amplification, perform a melt curve analysis by
genes under all examined experimental conditions. Therefore, the
measuring fluorescence after each temperature increase of 0.5°C for
protocol below describes how to select reference genes for P. larvae.
5 sec over a range from 65°C to 95°C.
5.1.1. Reference gene selection
5.1.1.6. qRT-PCR analysis
5.1.1.1. Sample collection and storage
Analyze the reference gene stability with geNormPLUS within qBasePLUS
1. Grow at least ten independent P. larvae cultures for each condition to be analysed with qRT-PCR.
(Vandesompele et al., 2002; Hellemans et al., 2007) using targetspecific amplification efficiencies.
2. Centrifuge cultures for 5 min at 8,000 x g and 4°C. 3. Pour off the supernatant.
5.1.2. Differential gene expression
4. Resuspend the bacterial pellet in RNAlater solution (Ambion).
Sample collection and storage (except for the recommendation of ten
5. Incubate for approximately half an hour on ice.
cultures), RNA and cDNA synthesis, in silico primer design and
6. Divide the suspension in aliquots.
secondary structure evaluation, and qPCR experimental procedures
7. Centrifuge aliquots for 2 min at 8,000 x g and 4°C.
(reactions, program and analysis, except for geNormPLUS analysis)
8. Store at -80°C.
are essentially the same for the study of differential gene expression by qRT-PCR as described in section 5.1.1. for reference gene
5.1.1.2. RNA and cDNA preparation
selection.
1. Centrifuge thawed aliquots for 2 min at 6,500 x g and 4°C. 2. Resuspend bacterial pellets in TE buffer with Lysozyme (15 mg/ml) and Proteinase K (Qiagen).
5.2. Comparative genome analysis within the species Paenibacillus larvae using suppression
3. Vortex for 10 sec.
subtractive hybridization
4. Incubate 10 min at RT with constant shaking.
Suppression subtractive hybridization (SSH) is a powerful tool for
5. Isolate RNA with RNeasy Plus Mini Kit and protocol
elucidating genomic sequence differences among closely related
“Purification of Total RNA for Animal Cells” (with on-column
bacteria. SSH is a PCR-based DNA subtraction method which was
DNase I treatment).
originally developed for generating differentially regulated or tissue-
6. Elute RNA with 30 µl RNase-free water.
specific cDNA probes and libraries (Diatchenko et al., 1996). However,
7. Store at -80°C.
it has also been successfully adapted for bacteria, especially for the
8. Convert RNA to cDNA with RevertAid First Strand cDNA
identification of genes that contribute to the virulence of bacterial
Synthesis Kit (Fermentas), using random hexamer primers.
organisms (Akopyants et al., 1998). For example, SSH has been successfully employed to compare genomes of pathogenic and non-
5.1.1.3. Primer design and secondary structures
pathogenic (Janke et al., 2001; Reckseidler et al., 2001) or virulent
Design primers (80 – 150 bp) with Primer3Plus (Untergasser
and avirulent strains of bacterial pathogens (Zhang et al., 2000). SSH
et al., 2007).
has also led to the identification of pathogenicity islands (Hacker et al.,
Evaluate secondary structures of amplicon with MFold (Zuker,
1997) in infectious bacteria (Agron et al., 2002). Recently, SSH
2003) for 60°C, 50 mM Na+ and 3 mM Mg2+. Selected
analysis of all four genotypes of P. larvae led to the identification of
candidate reference genes for P. larvae are listed in Table 5.
putative virulence factors like potent antibiotics belonging to the class
The COLOSS BEEBOOK: American foulbrood
17
Table 5. Reference genes for P. larvae. Name
Sequence
Predicted gene product
AFB_rpoD_fw
5'-AACTTGCCAAACGGATTGAG-3'
AFB_rpoD_rv
5'-AAGCCCCATGTTACCTTCCT-3'
AFB_gyrA_fw
5'-ATGCGGTCATCCCTATTGAG-3'
AFB_gyrA_rv
5'-GGTCATCTTCCCGCAAATTA-3'
AFB_cmk_fw
5'-GTACAGGGCGATTACCTGGA-3'
AFB_cmk_rv
5'-GCCATCAACGAATACCTGCT-3'
AFB_sucB_fw
5'-ATTGCCAAGGGTGTTGTAGC-3'
AFB_sucB_rv
5'-TTCAGCCCGGATTCATTTAG-3'
AFB_eftu_fw
5'-TAACATCGGTGCCCTTCTTC-3'
AFB_eftu_rv
5'-CCACCCTCTTCGCTAGTCAG-3'
AFB_fum _fw
5'-CCAAAATATGCGGAGCTGAT-3'
AFB_fum _rv
5'-GTGAACCGCAATTTCCCTTA-3'
AFB_purH_fw
5'-TTCTCTCGGGGCTTTTGATA-3'
Bifunctional phosphoribosyl aminoimidazole
AFB_purH_rv
5'-CTACTGTTGGCTCACGGTCA-3'
carboxamide formyltransferase / IMP cyclohydrolase
AFB_adk_fw
5'-TCAACAGGTGATGCTTTTCG-3'
AFB_adk_rv
5'-TGTGATTTCGTCAGGAACCA-3'
AFB_gapdh_fw
5'-TGTTGAAGCTGGTGAAGGTG-3'
AFB_gapdh_rv
5'-TCCGCTTTTTCTTTTGCAGT-3'
RNA polymerase sigma factor RpoD
DNA gyrase subunit A
Cytidylate kinase
Succinyl-CoA synthetase subunit β
Elongation factor Tu
Fumarate hydratase
Adenylate kinase
Glyceraldehyde-3-phosphate dehydrogenase
of non-ribosomal peptides and polyketides as well as several toxins
a recognition sequence of only four bases.
and cytolysins (Fünfhaus et al., 2009).
Since this sequence occurs often in the genome of P. larvae, a
The principle of any SSH analysis is that one genome putatively containing additional genes (the so-called ‘driver’) is subtracted from the other genome (‘tester’) with the result that the additional
high fragmentation of the bacterial DNA (100 to 1000 bp) with blunt ends is achieved. 2. After purification of the fragmented DNA with the MinElute
sequences specific to the tester remain and can be visualized via PCR.
Cleanup Kit (QIAGEN) according to the manufacturer’s
For SSH analysis, genomic DNA of P. larvae grown in liquid culture of
protocol, divide the DNA of the tester strain into two pools
brain heart infusion broth (BHI broth, see section 3.1. for recipe) is
which are ligated with either Adaptor 1 (5’–
used. Since the quality of the genomic DNA is of crucial importance,
CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-
special kits for DNA extraction of Gram-positive bacteria (e.g.
3’) or Adaptor 2R (5’–
MasterPure Gram Positive DNA Purification Kit, Epicentre
CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT-3’),
Biotechnologies) to isolate P. larvae DNA are recommended. The
catalysed by T4 DNA ligase.
following protocol for SSH is based on the protocols published by
The ends of the adaptors lack a phosphate group, so only one
Akopyants et al. (1998) using the PCR-Select Bacterial Genome Subtraction Kit (BD Clontech). SSH consists of two consecutive phases, the hybridization and the amplification. Within the phase of hybridization, the genomic DNA extracted from the ‘driver’ strain is hybridized with DNA extracted from the ‘tester’ strain. Sequences that are present in the tester strain but missing in the driver strain are
strand of each can be ligated to the 5’ end of the tester DNAs. 3. For the first round of hybridization, mix each pool of adaptorligated tester-fragments with a 50-100-fold excess of driverfragments. 4. Incubate the mixed samples at 98°C for 90 sec. (denaturation).
then isolated in the amplification phase in which target genomic DNA
5. Incubate at 65°C for 90 min (annealing).
fragments are amplified, while amplification of non-target DNA is
6. In the second round of hybridization, mix both pools without
simultaneously suppressed using the suppression PCR effect (Siebert
et al., 1995). The protocol for the comparison of P. larvae genotypes involves the following steps: 1. Following the manufacturer’s protocol, digest the isolated DNA from both genomes using restriction enzyme RsaI, which has
denaturation. 7. Incubate overnight at 65°C to allow free tester-fragments from both pools to form heterohybrids (hybridization of complementary tester DNAs with different adaptors (Akopyants et al., 1998)). 8. Add freshly denatured driver to the mixture.
de Graaf et al.
18
9. Allow the samples to hybridize.
genome and the proteome of an organism. For example, protein
During this step, hybrid molecules are formed, but only DNA
modifications and relative concentration of proteins cannot be
fragments which are exclusively present in the sample of the
determined by genomic analysis (Pandey and Mann, 2000).
tester strain are amplified in the subsequent amplification
Furthermore, the DNA sequences give no information about conditions
phase.
and time for translation as well as effects of up or down regulation of
10. For amplification, perform a nested PCR with adaptor specific
gene expression (Humphery-Smith et al., 1997). Therefore,
primers.
predictions on the basis of genetic information should be completed
For the first PCR, the primer 1 (5'-
by expression data at the level of the transcriptome and the
CTAATACGACTCACTATAGGGC-3') is used. For the second PCR, proteome. By means of proteome analysis, a holistic approach of the nested primer 1 (5'-TCGAGCGGCCGCCCGGGCAGGT-3')
protein expression under specific conditions is possible. The classical
and the nested primer 2R (5'-AGCGTGGTCGCGGCCGAGGT-3')
method of proteomics is the two-dimensional (2D) gel electrophoresis
are used.
(O’Farrell, 1975; Klose, 1975). Recently, it was successfully used for a
11. To obtain a library of tester-specific sequences, secondary PCR products - i.e., clone tester specific DNA fragments - are then cloned into appropriate vectors (e.g. pCR2.1TOPO vector, Invitrogen, containing an ampR gene). 12. Transform into competent E. coli (e.g. TOP10 cells, Invitrogen) following the manufacturer’s instructions. 13. Plate transformation mixes on agar plates supplemented with Ampicillin (100 µg/ml)
comparison of the P. larvae genotypes ERIC I and II (Fünfhaus and Genersch, 2012). Sample preparation for 2D electrophoresis uses the following protocol (Fünfhaus and Genersch, 2012): 1. Cultivate P. larvae strains to be analysed on Columbia sheep blood agar (CSA; see section 3.1. for recipe) plates for three days at 37°C. 2. To obtain a pre-culture, inoculate 3 ml brain heart infusion
14. Incubate overnight at 37°C.
broth (BHI, see section 3.1 for recipe) with one bacterial
15. Pick and grow clones individually overnight in Luria broth in
colony and the cells are grown overnight at 37°C with shaking
the presence of Ampicillin (100 µg ml/ml) at 37°C and 300 rpm. 16. Extract plasmid DNA from these overnight cultures (e.g. by using the Qiagen plasmid mini kit). 17. The presence of inserted P. larvae DNA can be verified by
at 200 x g. 3. To obtain a 10 ml main culture, inoculate 9 ml BHI with a preculture to achieve a final OD600 of 0.01 after adjustment to a final volume of 10 ml with BHI. 4. Incubate at 37°C with shaking at 200 x g.
restriction digestion. In the case of pCR2.1TOPO, perform
5. Monitor growth continuously by measuring OD600.
digestion with EcoRI.
6. Stop growth in the late exponential phase (OD600 0.65) by
18. Sequence detected inserts from positive clones using
harvesting the cells via centrifugation (20 min, 5,000 x g, 4°C).
appropriate primers.
7. Wash the bacterial cell pellets three times with ice-cold PBS.
For pCR2.1TOPO, use primers M13 uni (-21)
8. Resuspended in 1 ml lysis buffer (7 M urea, 2M thiourea, 4%
5’-TGTAAAACGACGGCCAGT-3’ and M13 rev (-29) CAGGAAACAGCTATGACC. 19. To verify the specificity of the DNA fragments for the tester
(w/v) CHAPS, complete protease inhibitor cocktail (Roche)). 9. Disrupt cells by using a sonicator, e.g. ranson Sonifier 250 (duty control: 10%; output control: 1). Repeated sonication
strain, perform a PCR with fragment specific PCR primers on
cycles (ten times for 30 sec) are interrupted by cooling phases
DNA from the tester strain and related P. larvae strains (i.e.,
for 60 sec.
representatives of the same genotype). In each subtraction, all controls recommended by the manufacturer must be performed and all must test positive. Analysis
10. Incubate samples for 1 h at RT to facilitate dissolving the proteins. 11. Separate crude protein extracts from cellular debris by
of the tester-specific sequences is performed with BLASTx (Altschul et al.,
centrifugation at 16,100 x g for 25 min at 4°C.
1990, 1997) followed by functional annotation based on the COG
The resulting supernatant contains the cytosolic proteins but
(cluster of orthologous groups) classification (Tatusov et al., 1997,
also salts and other small charged molecules which need to
2003).
be removed from the solution by precipitation. 12. Precipitate the cytosolic proteins of P. larvae with one volume
5.3. Conventional proteomics using twodimensional gel electrophoresis Genomic sequences are not sufficient for explaining biological functions because there is no strict linear correlation between the
20% TCA, 2% Triton X-100 overnight at 4°C. 13. Pellet the precipitated proteins by centrifugation (16,100 x g, 25 min, 4°C). 14. Wash the pellets with 80% acetone to remove residual TCA.
The COLOSS BEEBOOK: American foulbrood
15. Resuspend the washed pellet in 200 µl sample buffer (7 M urea,
19
26. Block free SH-groups of the separated proteins by
2M thiourea, 4% (w/v) CHAPS, 100 mM DTT, 1% Bio-Lyte
equilibrating the IPG strips in equilibration buffer II (6M urea,
Ampholyte (Bio-Rad), complete protease inhibitor cocktail
30% (v/v) glycerol, 5% (w/v) SDS, 0.05 M Tris pH 8.8, 5% (w/v)
(Roche)). 16. Vortex for 1 h at RT.
iodoacetamide) for 10 min. 27. For the SDS-PAGE as second dimension a 12% polyacrylamide
17. Separate the insoluble material from the soluble proteins by
gel run at 35 mA in a PROTEAN II XL Cell (Bio-Rad) proved to
centrifugation (15,000 x g, 1 h, 15°C) to obtain the soluble cytoplasmic fraction.
be suitable. 28. Gels are stained with Coomassie (Page Blue Protein Solution, Fermentas) according to standard protocol (see the BEEBOOK
18. Determine the protein concentration by performing the ®
Pierce 660 nm Protein Assay (Thermo Scientific) according to
paper on physiological and biochemical methods (Hartfelder
the manufacturer’s protocol.
et al., 2013)).
19. Store samples at -80°C until further analysis.
Analysis of the 2D gels can be performed by using software
These protein samples are then subjected to 2D-gel
PDQuest 8.0 (Bio-Rad). Protein identification can be achieved by mass
electrophoresis with the isoelectric focussing (IEF) as the first
spectrometric analysis followed by comparison of peptide masses and
dimension followed by SDS-PAGE analysis as second dimension. sequence information of the sample with different databases (see the 20. Dilute the samples with rehydration buffer (7 M urea, 2 M
BEEBOOK paper on physiological and biochemical methods (Hartfelder
thiourea, 1% (w/v) CHAPS, 10 mM DTT, 0.25% Bio-Lyte
et al., 2013) and the BEEBOOK paper on chemical ecology (Torto et al.,
Ampholyte (Bio-Rad)).
2013)).
21. Determine the amount of protein to load on IPG strip according to the sample, the pH range, the length of the IPG
5.4. Differential proteomics of Paenibacillus larvae
strip and the staining method.
Liquid chromatography coupled directly to mass spectrometry
22. Focussing of proteins is best performed in commercially
provides another means for monitoring a proteome or changes in a
available, immobilized pH gradient strips (IPG strips) selecting proteome. Such global monitoring of changes in levels of proteins in a suitable pH gradient. For the analysis of P. larvae proteins
response to a stimulus (e.g. a pathogen such as P. larvae) can
IPG strips with a pH gradient 5-8 and a length of 7 cm (Bio-Rad) provide very direct insight into the molecular mechanisms employed proved to be useful. 23. Load 60 µg cytosolic P. larvae proteins in a total rehydration volume of 125 µl on the IPG strips.
to respond to that challenge. For example, bee larvae up-regulate expression and activation of phenoloxidase in response to a P. larvae challenge (Chan et al., 2009). Mass spectrometry is currently the
The following protocol for IEF is adapted to the PROTEAN IEF Cell favoured detection method for monitoring the entire protein (Bio-Rad) at 20°C:
component of a system (i.e. the proteome), and various methods
24. Load the samples on the IPG strips by an active in-gel
exist for comparing protein expression in one state to that in another.
rehydration for 18 h at 50 V followed by a voltage profile with
The most quantitative approach involves the use of stable isotopes to
increasing values:
introduce a ‘mass tag’ into the proteins from two or more different
linear increase from 50 – 200 V for 1 min.
conditions and then in subsequent mass spectrometric analyses, the
200 V for 200 Vh.
intensities of the differently tagged forms reflect the relative
linear increase from 200 – 500 V for 1 min.
quantities in the original sample. Several such labelling methods exist
500 V for 500 Vh.
and are reviewed elsewhere (Ong et al., 2003), so here we focus on
linear increase from 500 – 1000 V for 1 min.
the method that has been used most extensively in honey bee
1000 V for 1000 Vh.
proteomics. It involves the reductive dimethylation of primary amines
linear increase from 1000 – 2000 V for 1 min.
in peptides using formaldehyde isotopologues.
2000 V for 2000 Vh.
linear increase from 2000 – 4000 V for 1 min.
designed to compare untreated bees/cells to equivalent samples
4000 V for 4500 Vh.
treated with a stimulus or challenged with a pathogen. If the following
25. Subsequently, saturate the proteins separated in the IEF gel with SDS by equilibrating the IPG strips in equilibration buffer
Assumptions: a suitable, controlled experiment should be
steps cannot be carried out immediately, then samples can typically be stored as a cell pellet, tissue, or whole bee at -80˚C for weeks or
I (6M urea, 30% (v/v) glycerol, 5% (w/v) SDS, 0.05 M Tris pH months without protein degradation. 8.8, 1% (w/v) DTT) for 10 min.
de Graaf et al.
20
5.4.1. Sample preparation
5.4.1.1. Extract proteins Extract proteins into 50 mM NH4HCO3 (pH 8.0) with 1% sodium
5.4.1.4. Label peptides with stable isotopes 1. Add 20 μl of 100 mM triethylammonium bicarbonate to each tube of dried peptides.
deoxycholate (ABC/DOC).
2. Sonicate for 5 min to solubilize peptides.
Option 1: For cultured or primary cells:
3. Add 20 μl of formaldehyde isotopologues to respective
1. Wash cells first in PBS.
samples.
2. Pellet at 600 x g.
200 mM CH2O (L)-light to the first sample.
3. Remove supernatant.
200 mM C2H2O (M)- medium to the second sample.
4. Solubilize the pellet in ABC/DOC at a ratio of 100 µl per
200 mM
2E+07 cells. The final protein concentration, measured by the BCA method, should be approximately 1 µg/µl. Option 2: For any bee tissues: 1. Place the material in a beadmill tube with enough 6 M urea, 2 M thiourea and 50 mM Tris (pH 8.0) to fully immerse the tissue. 2. Pulverize the tissue in a beadmill.
13 2
C H2O – heavy (H) to the third sample).
4. Add 2 μl of 1 M light ALD solution (sodium cyanoborohydride) to the first (L) sample and second (M) sample. 5. Add 2 μl of 1 M heavy ALD solution (sodium cyanoborodeuteride) to the third (H) sample. 6. Sonicate for 5 min. 7. If required, centrifuge for 1 min at low speed to collect all of the solution at the bottom.
Determine the specific conditions empirically for each tissue
8. Leave at ambient temperature in the dark for 90 min.
and beadmill type.
9. Add 20 μl of 3.0 M NH4Cl.
3. After milling, pellet insoluble material at 16,000 x g for 10 min at 4°C.
10. Leave at ambient temperature in the dark for 10 min. 11. Add acetic acid until pH < 2.5.
4. Move the supernatant to a clean tube. 5. Precipitate the proteins in the supernatant by adding four volumes of 100% ethanol, 20 µg of molecular biology-grade glycogen and 50 mM sodium acetate (pH 5, from a 2.5 M stock solution). 6. Allow the solution to stand at RT for 90 min.
5.4.1.5. Clean up peptides 1. From the final step in paragraph 5.4.1.4. ‘Label peptides with stable isotopes’, combine the two (for duplex labelling) or three (for triplex labelling) into a single tube. 2. Repeat all steps from paragraph 5.4.1.3. ‘Clean up peptides’
7. Pellet the proteins by centrifuging for 10 min at 16,000 x g.
above, eluting the peptides in step 5 into a 96-well microwell
8. Resuspend the pellet from this final step in ABC/DOC to bring
plate.
the protein concentration to 1 µg/µl.
5.4.1.6. Mass spectrometry analysis 5.4.1.2. Reduce, alkylate and digest proteins to peptides 1. For each sample, add 1 µg dithiothreitol (from a stock solution of 1 µg/µl) to 50 µg total protein.
1. Analyze the combined sample with at least a two-hour gradient into a liquid chromatography-tandem mass spectrometry system (LC-MS/MS).
2. Incubate the solution for 30 min at 37°C.
Most labs will access such a system through a core facility
3. Add 5 µg iodoaccetamide (from a stock solution of 5 µg/µl).
rather than operating the system themselves. Interested
4. Incubate for 20 min at 37°C.
readers are referred elsewhere for details on setting up such a
5. Add 1 µg trypsin (mass spectrometry-grade, Promega).
system (Forner et al., 2007).
6. Incubate overnight at 37°C.
2. Search the LC-MS/MS data against a protein database using MaxQuant (Cox and Mann, 2008), Proteome Discoverer (from
5.4.1.3. Clean up peptides 1. Adjust pH of overnight digestion to ~2 using 10% acetic acid.
ThermoFisher) or SpectrumMill (from Agilent). Background on the principles underlying such database searching
2. For each sample, prepare a STAGE tip (Rappsilber et al., 2007) has been covered elsewhere (Forner et al., 2007). The database by pushing 20 µl methanol through, followed by 20 µl 0.5%
should contain all protein sequences from all species that might be in
acetic acid.
the sample. For example, if the experiment has involved infecting
3. Push 10 µg total peptide mass (based on original 50 µg input) bees with P. larvae, the database should contain all A. mellifera and through the STAGE tip.
all P. larvae sequences available from their respective genome project
4. Wash each tip with 20 µl 0.5% acetic acid.
pages in GenBank. The search engines mentioned above should also
5. Elute the peptides from each tip into a clean microfuge tube
report the isotope ratios representing the relative amounts of each
with 10 µl 80% acetonitrile, 0.5% acetic acid. 6. Evaporate the solvent from each sample in a vacuum centrifuge.
protein detected among the different samples.
The COLOSS BEEBOOK: American foulbrood
5.5. Expression of heterologous proteins in
Paenibacillus larvae The understanding of phenotypic differences within the species P. larvae (Genersch and Otten, 2003; Genersch et al., 2005; Neuendorf et al., 2004; Rauch et al., 2009) and the role of genotype-specific putative
21
4. Resuspend the final bacterial pellet in 1/500 of the initial culture volume. 5. Store at -80°C in 40 µl aliquots. Electrocompetent P. larvae cells can then be transformed with a plasmid containing a GFP-gene like pAD43-25 using the following
virulence factors (Fünfhaus et al., 2009; Fünfhaus and Genersch, 2012) protocol: have been hampered by the lack of molecular tools allowing genetic
1. For pAD43-25 transformation, thaw competent cells at 4°C.
manipulation of this pathogen.
2. Add 500 ng of pAD43-25 in a maximum volume of 10 µl.
To functionally analyse putative virulence factors during bacterial pathogenesis, the corresponding genes need to be disrupted, manipulated, or labelled for specific visualisation. Likewise, the expression of homologous or heterologous proteins in P. larvae would be a valuable tool to further study the molecular pathogenesis of
3. During an incubation time of 15-20 min gently mix each transformation tube every 5 min. 4. Pulse probes in ice cold 1 mm electroporation cuvettes (Eppendorf). 5. The best transformation results can be achieved with 9 kV/cm
P. larvae infections. Recently, the first protocol for the expression of a
for representatives of the genotype ERIC I and 10 kV/cm for
foreign protein (green fluorescent protein, GFP) in P. larvae has been
representatives of the genotype ERIC II. An average of
described (Poppinga and Genersch, 2012). Since GFP expression is
1.8E+04 and 1.1E+06 transformants per 0.5 µg DNA
one of the most successful molecular tools to specifically label
(3.6E+04 and 2.2E+06 transformants per µg DNA) for ERIC I
proteins and to visualize them under native conditions (Tsien, 1998), this can be considered a breakthrough in AFB research. Constitutive expression of GFP in P. larvae will help to visualize and quantify
and ERIC II, is obtained using these conditions. 6. Immediately transfer transformation tubes containing shocked cells to 960 µl pre-warmed MYPGP broth.
bacterial cells in larval experiments. Additionally, GFP-fused virulence
7. Incubated at 37°C for 16 hours with shaking (350 x g).
factors that are expressed during infection can be detected and
8. Dilute regenerated transformation mixes.
visualised in and/or outside the bacterial cell.
9. Plate on MYPGP agar supplemented with 5 µg/ml chloramphenicol.
5.5.1. Transformation of Paenibacillus larvae
10. Incubate agar plates at 37°C.
For this purpose plasmid pAD43-25 (BGSC, Bacillus Genetic Stock
11. Determine the number of colony forming units (cfu) after 3 days.
Center), carrying the gene sequence for a GFP variant (gfpmut3a), was transformed into wild type P. larvae strains ATCC9545 and 04-309 5.5.2. Detection of GFP-expression representing both relevant genotypes ERIC I and ERIC II, respectively For GFP detection in the vegetative recombinant P. larvae isolates (Genersch et al., 2005, 2006). Plasmid pAD43-25 functions as an E.
ATCC9545 (ERIC I) + pAD43-25 and P. larvae 04-309 (ERIC II) +
coli/Gram-positive shuttle vector and enables bacteria to constitutively pAD43-25, clones can be cultivated and analysed during different express the GFP variant gfpmut3a (Dunn and Handelsman, 1999).
stages of growth in liquid MYPGP media (Dingman and Stahly, 1983),
High level constitutive expression of mutant GFP in vegetative cells is
supplemented with 5 µg/ml chloramphenicol. In each bacterial stage
facilitated by the Bacillus cereus UW85 Pupp promoter upstream of
of growth, 10 µl aliquots of the suspension are analysed bright field
gfpmut3a. Mutant gfpmut3a has an optimal excitation wavelength of
microscopically using differential interference contrast (DIC).
498 nm and the plasmid contains a chloramphenicol resistance cassette. Fluorescence activity is detected by a FITC filter block (e.g. Nikon Ti-E The first critical step of the molecular manipulation of P. larvae is
Inverted Microscope). All stages of growth are analysed and it can be
the uptake of foreign DNA, e. g. plasmid DNA. Because P. larvae is a
observed that the rate of gfpmut3a expressing P. larvae clones
gram-positive bacterium, transformation needs a high voltage electric
remains stable throughout the logarithmic as well as the stationary
pulse for a successful uptake of foreign plasmid DNA. For this purpose growth phase, indicating that plasmid pAD43-25 is correctly replicated electrocompetent bacterial cells need to be prepared as described by Murray and Aronstein (2008): 1. Grow P. larvae cultures to early exponential phase (OD600 0.3).
throughout bacterial growth. Expression of GFP remained stable even after sporulation and germination. This is an essential prerequisite for using recombinant bacteria in infection assays because only spores can be used for
2. Harvest by centrifugation.
infection, and the vegetative bacteria inside the larvae should still
3. Wash bacterial pellets three times using 0.625 M sucrose.
carry and express the introduced gene.
de Graaf et al.
22
5.6. Fluorescent in situ hybridization for the detection of Paenibacillus larvae
5.6.2. Performing fluorescence in situ hybridization 1. Sections should be rehydrated and prepared for hybridization
Recently, Yue and collaborators (Yue et al., 2008) described a P. larvae
as follows in order to improve permeability:
specific method based on a previously described general technique of
1.1. Wash slides with xylene 3 x 10 min.
fluorescence in situ hybridization (FISH) (Moter et al., 1998). FISH
1.2. Wash slides with 100% ethanol 3 x 3 min.
methods are based on specific binding of fluorescent-labelled
1.3. Wash slides with 90% ethanol 2 x 3 min.
oligonucleotide probes to complementary sequences in fixed and
1.4. Wash slides with 80% ethanol 2 x 3 min.
permeabilized sections (Itzkovitz and van Oudenaarden, 2011). This
1.5. Wash slides with 70% ethanol 1 x 3 min.
approach provides a highly specific method to visualize P. larvae in
1.6. Wash slides with 50% ethanol 2 x 3 min.
infected larval histological sections, thereby allowing disease
1.7. Wash slides with double distilled water (DEPC) 2 x 3 min.
monitoring and observation of the life cycle of the bacterium inside
1.8. Incubate slides with 1 mg/ml Proteinase K in 0.2M Tris-HCl
the host. P. larvae FISH methodology uses a specific complementary
(pH 7.9) for 5 min at 37°C in a humid chamber.
P. larvae 16S rRNA targeted oligonucleotide probe coupled with
1.9. Incubate slides with 1 mg/ml lysozyme in DEPC double-
fluorescein isothiocyanate (FITC), that specifically binds to P. larvae
destilled water for 15 min at 37°C in a humid chamber.
rRNA. Since bacterial cells are filled with ribosomes, this technique allows the ”staining“ of the vegetative bacteria. In order to
1.10. Wash slides three times with 1X PBS. 2. Incubate slides with 100 ng of each probe (specific bacterial
simultaneously visualize the cytoplasm of larval cells, cyanine Cy3-
16S rRNA-probe and universal eukaryotic 18S rRNA-probe)
labeled oligonucleotides universally detecting conserved 18S rRNA
diluted in 20 µl of FISH-hybridization buffer (20% (v/v)
eukaryotic sequences are used. Finally, 4',6-diamidino-2-phenylindole
deionized formamide, 0.9 M NaCl, 20 mM Tris-HCl pH 7.9,
(DAPI), a fluorescent dye that binds A-T rich regions of DNA, is employed to visualize cell nuclei. The following protocol provides a method to fix and embed larval tissues, in order to obtain histological sections, as well as for further processing these sections by fluorescence in situ hybridization.
0.01% (m/v) SDS). 3. Cover with slip and transfer to a Corning chamber. 4. Dispense double-distilled water into the cavities of the chamber and close it. 5. Incubate in a humid chamber at 46°C from 4 h to overnight. 6. Carefully remove cover slip in 1X PBS.
5.6.1. Preparation and embedding of larval tissues
7. Wash slides three times with 1X PBS.
1. Perform infection assays as described in section 4.1.
8. Add 50 µl of DAPI solution (1 µg/ml in methanol) to each slide.
2. Wash each larva for 5 seconds with 100% ethanol.
9. Cover again.
3. Fix larvae by overnight incubation with 4% Roti Histofix (Roth,
10. Incubate at RT for 10 min.
Karlsruhe) at 4°C at 20 rpm. 4. Wash samples overnight with 1X PBS solution containing 6.8% sucrose under the same conditions.
11. Remove cover slip in 1X PBS and wash slides three times with 1X PBS. 12. Mount slides with antifade reagent.
5. Wash samples with 100% acetone. During the first five minutes, change acetone until the solution becomes clear. 6. Incubate with the final change of acetone for 1 hour under the same conditions. 7. Mix equal volumes of 100% acetone and Technovit 8100 solution (Heraeus Kulzer, Wehrheim). 8. Incubate samples for 2 hours with this solution under previous conditions. 9. Perform infiltration and embedding using Technovit 8100 according to manufacturer´s instructions. 10. Cut 4 µm-sections using a microtome, straighten them with warm sterile water on slides. 11. Store slides at 4°C until further use.
6. Final remarks In the past decade, different basic issues related to American foulbrood have been addressed, including the reclassification of its aetiological agent (Genersch et al., 2006; Ashiralieva and Genersch, 2006), the development of methods for genotyping (Genersch and Otten, 2003; Alippi et al., 2004; Genersch et al., 2006; Antúnez et al., 2007) and the annotation of its genome sequence (Qin et al., 2006; Chan et al., 2011). The latter permitted the introduction of techniques for studying the bacterial transcriptome and proteome. Candidate reference genes and the methods to select them have been described in this paper. The availability of a protocol for heterologous expression of foreign proteins in P. larvae can be considered a great breakthrough
The COLOSS BEEBOOK: American foulbrood
23
in AFB research (Poppinga and Genersch, 2012). Nevertheless, we are ALIPPI, A M; LÓPEZ, A C; REYNALDI, F J; GRASSO, D H; AGUILAR, O M only at the start of understanding the intimate relationship between
(2007) Evidence for plasmid-mediated tetracycline resistance in
P. larvae and its host. We hope that methods that are presented in
Paenibacillus larvae, the causal agent of a honey bee larval disease.
this paper can help scientists to further explore the secrets of
Veterinary Microbiology 125: 290-303.
American foulbrood disease in honey bees.
http://dx.doi.org/10.1016/j.vetmic.2007.05.018 ALIPPI, A M; REYNALDI, F J; LÓPEZ, A C; DE GIUSTI, M R; AGUILAR, O M (2004) Molecular epidemiology of Paenibacillus larvae larvae
7. Acknowledgements
and incidence of American foulbrood in Argentinean honeys from Buenos Aires Province. Journal of Apicultural Research 43: 135-143.
We mourn the passing of Drs. Dieter De Koker who contributed to this ALTSCHUL, S F; GISH, W; MILLER, W; MYERS, E W; LIPMAN, D J chapter. Dieter was a talented PhD student at Ghent University. Our thoughts are with his family and friends. DCdG and LDS gratefully acknowledge the Research Foundation of Flanders (FWO-Vlaanderen; G.0163.11) for financial support.
(1990) Basic local alignment search tool. Journal of Molecular
Biology 215(3): 403-410. http://dx.doi.org/10.1006/jmbi.1990.9999 ALTSCHUL, S F; MADDEN, T L; SCHÄFFER, A A; ZHANG, J; ZHANG, Z; MILLER, W; LIPMAN, D J (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic
Acids Research 25(17): 3389-3402.
8. References AGRON, P G; MACHT, M; RADNEDGE, L; SKOWRONSKI, E W; MILLER,
http://dx.doi.org/10.1093/nar/25.17.3389 ANTUNEZ, K; PICCINI, C; CASTRO-SOWINSKI, S; ROSADO, A S; SELDIN, L; ZUNINO, P (2007) Phenotypic and genotypic
W; ANDERSEN, G L (2002) Use of subtractive hybridization for
characterization of Paenibacillus larvae isolates. Veterinary
comprehensive surveys of prokaryotic genome differences. FEMS
Microbiology 124: 178-183.
Microbiology Letters 211: 175–182.
http://dx.doi.org/10.1016/j.vetmic.2007.04.012
http://dx.doi.org/10.1111/j.1574-6968.2002.tb11221.x AKOPYANTS, N S; FRADKOV, A; DIATCHENKO, L; HILL, J E; SIEBERT,
ASHIRALIEVA, A; GENERSCH, E (2006) Reclassification, genotypes and virulence of Paenibacillus larvae, the etiological agent of
P D; LUKYANOV, S; SVERDLOV, E; BERG, D E (1998) PCR-based
American foulbrood in honey bees – a review. Apidologie 37(4):
subtractive hybridization and differences in gene content among
411-420. http://dx.doi.org/10.1051/apido:2006028
strains of Helicobacter pylori. Proceedings of the National
BÜCHLER, R; ANDONOV, S; BIENEFELD, K; COSTA, C; HATJINA, F;
Academy of Sciences USA 95 (22): 13108-13113.
KEZIC, N; KRYGER, P; SPIVAK, M; UZUNOV, A; WILDE, J (2013)
http://dx.doi.org/10.1073/pnas.95.22.13108
Standard methods for rearing and selection of Apis mellifera
ALIPPI, A M (1991) A comparison of laboratory techniques for the
queens. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS
detection of significant bacteria of the honey bee Apis mellifera L.
BEEBOOK, Volume I: standard methods for Apis mellifera research.
in Argentina. Journal of Apicultural Research 30(2): 75–80.
Journal of Apicultural Research 52(1):
ALIPPI, A M (1995) Detection of Bacillus larvae spores in Argentinian honeys by using a semi-selective medium. Microbiologia SEM 11: 343–350. ALIPPI, A M; AGUILAR, O M (1998a) Characterization of isolates of
Paenibacillus larvae subsp. larvae from diverse geographical origin by the polymerase chain reaction and BOX primers. Journal of
http://dx.doi.org/10.3896/IBRA.1.52.1.07 CHAN, Q W T; MELATHOPOULOS, A P; PERNAL, S F; FOSTER, L J (2009) The innate immune and systemic response in honey bees to a bacterial pathogen, Paenibacillus larvae. BMC Genomics 10: 387. http://dx.doi.org/10.1186/1471-2164-10-387 CHAN, Q W T; CORNMAN, R S; BIROL, I; LIAO, N Y; CHAN, S K;
Invertebrate Pathology 72: 21-27.
DOCKING, T R; JACKMAN, S D; TAYLOR, G A; JONES, S J M; DE
http://dx.doi.org/10.1006/jipa.1998.4748
GRAAF, D C; EVANS, J D; FOSTER, L J (2011) Updated genome
ALIPPI, A M; AGUILAR, O M (1998b). Unique fingerprints of
assembly and annotation of Paenibacillus larvae, the agent of
Paenibacillus larvae subsp. larvae strains. Journal of Apicultural
American foulbrood disease of honey bees. BMC Genomics 12: 450.
Research 37: 273-280.
http://dx.doi.org/10.1186/1471-2164-12-450
ALIPPI, A M ; LOPEZ, A C; AGUILAR, O M (2002) Differentiation of
DE GRAAF, D C; ALIPPI, A M; BROWN, M; EVANS, J D; FELDLAUFER, M;
Paenibacillus larvae subsp. larvae, the cause of American
GREGORC, A; HORNITZKY, M A Z; PERNAL, S F; SCHUCH, D M T;
foulbrood of honey bees, by using PCR and restriction fragment
TITERA, D; TOMKIES, V; RITTER, W (2006a) Diagnosis of
analysis of genes encoding 16S rRNA. Applied and Environmental
American foulbrood in honey bees: a synthesis and proposed
Microbiology 68(7): 3655-3660.
analytical protocols. Letters in Applied Microbiology 43: 583-590.
http://dx.doi.org/10.1128/AEM.68.7.3655-3660.2002
http://dx.doi.org/10.1111/j.1472-765X.2006.02057.x
de Graaf et al.
24
DE GRAAF, D C; DE VOS, P; HEYNDRICKX, M; VAN TRAPPEN, S;
FORSGREN, E; STEVANOVIC, J; FRIES, I (2008) Variability in
PEIREN, N; JACOBS, F J (2006b) Identification of Paenibacillus
germination and in temperature and storage resistance among
larvae to the subspecies level: an obstacle for AFB diagnosis.
Paenibacillus larvae genotypes. Veterinary Microbiology 129: 342-349.
Journal of Invertebrate Pathology 91(2): 115-123. http://dx.doi.org/10.1016/j.jip.2005.10.010 DE GRAAF, D C; BRUNAIN, M; JACOBS, F J (2008) Implementation of
http://dx.doi.org/10.1016/j.vetmic.2007.12.001 FÜNFHAUS, A; ASHIRALIEVA, A; BORRISS, R; GENERSCH, E (2009) Use of suppression subtractive hybridization to identify genetic
quality control and biosafety measurements in the diagnosis of
differences between differentially virulent genotypes of
honey bee diseases. Journal of Apicultural Research 47(2): 151-153.
Paenibacillus larvae, the etiological agent of American foulbrood of
DELAPLANE, K S; VAN DER STEEN, J; GUZMAN, E (2013) Standard methods for estimating strength parameters of Apis mellifera colonies. In V Dietemann; J D Ellis; P Neumann (Eds) The
honey bees. Environmental Microbiology Reports 1(4): 240-250. http://dx.doi.org/10.1111/j.1758-2229.2009.00039.x FÜNFHAUS, A; GENERSCH, E (2012) Proteome analysis of
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
Paenibacillus larvae reveals the existence of a putative S-layer
research. Journal of Apicultural Research 52(1):
protein. Environmental Microbiology Reports 4: 194-202.
http://dx.doi.org/10.3896/IBRA.1.52.1.03
http://dx.doi.org/10.1111/j.1758-2229.2011.00320.x
DIATCHENKO, L; LAU, Y F; CAMPBELL, A P; CHENCHIK, A;
GENERSCH, E; OTTEN, C (2003) The use of repetitive element PCR
MOQADAM, F; HUANG, B; LUKYANOV, S; LUKYANOV, K;
fingerprinting (rep-PCR) for genetic subtyping of German field
SVERDLOV, E D; SIEBERT, P D (1996) Suppression subtractive
isolates of Paenibacillus larvae subsp. larvae. Apidologie 34: 195-
hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proceedings of the
206. http://dx.doi.org/10.1051/apido:2003025 GENERSCH, E; ASHIRALIEVA, A; FRIES, I (2005) Strain- and genotype
National Academy of Science USA 93(12): 6025-6030.
-specific differences in virulence of Paenibacillus larvae subsp.
http://dx.doi.org/10.1073/pnas.93.12.6025
larvae, a bacterial pathogen causing American foulbrood disease
DINGMAN, D W (1983) Bacillus larvae: parameters involved with sporulation and characteristics of two bacteriophages. PhD thesis, University of Iowa, Iowa City, Iowa, USA. DINGMAN, D W; STAHLY, D P (1983) Medium promoting sporulation
in honey bees. Applied and Environmental Microbiology 71: 75517555. http://dx.doi.org/10.1128/AEM.71.11.7551-7555.2005 GENERSCH, E; FORSGREN, E; PENTIKÄINEN, J; ASHIRALIEVA, A; RAUCH, S; KILWINSKI, J; FRIES, I (2006) Reclassification of
of Bacillus larvae and metabolism of medium components. Applied
Paenibacillus larvae subsp. pulvifaciens and Paenibacillus larvae
and Environmental Microbiology 46: 860–869.
subsp. larvae as Paenibacillus larvae without subspecies
DINGMAN, D W; STAHLY, D P (1984) Protection of Bacillus larvae
differentiation. International Journal of Systematic and Evolutionary
from oxygen toxicity with emphasis on the role of catalase.
Microbiology 56(3): 501-511.
Applied and Environmental Microbiology 47: 1228-1237.
http://dx.doi.org/10.1099/ijs.0.63928-0
DOBBELAERE, W; DE GRAAF, D C ; PEETERS, J E; JACOBS, F J (2001) GENERSCH, E (2010) American foulbrood in honey bees and its Development of a fast and reliable diagnostic method for
causative agent, Paenibacillus larvae. Journal of Invertebrate
American foulbrood disease (Paenibacillus larvae subsp. larvae)
Pathology 103 Suppl. 1: 10-19.
using a 16S rRNA gene based PCR. Apidologie 32: 363-370.
http://dx.doi.org/10.1016/j.jip.2009.06.015
DJORDJEVIC, S; HO-SHON, M; HORNITZKY, M A Z (1994) DNA
GOCHNAUER, T A (1973) Growth, protease formation, and sporulation
restriction endonuclease profiles and typing of geographically
of Bacillus larvae in aerated broth culture. Journal of Invertebrate
diverse isolates of Bacillus larvae. Journal of Apicultural Research
Pathology 22: 251-257.
33(2): 95-103. DUNN, A K; HANDELSMAN; J (1999) A vector for promoter trapping in
Bacillus cereus. Gene 226: 297-305. http://dx.doi.org/10.1016/S0378-1119(98)00544-7 EVANS, J D; PETTIS, J S (2005) Colony-level impacts of immune responsiveness in honey bees, Apis mellifera. Evolution 59: 22702274. http://dx.doi.org/10.1554/05-060.1 FORNER, F; FOSTER, L J; TOPPO, S (2007) Mass spectrometry data
GORDON, R E; HAYNES, W C; PANG, C H (1973) The genus Bacillus. Agriculture handbook no. 427, Agricultural Research Service, US Dept. of Agriculture, Washington, DC, USA. GOVAN, V A; ALLSOPP, M H; DAVISON, S (1999) A PCR detection method for rapid identification of Paenibacillus larvae. Applied and
Environmental Microbiology 65: 2243-2245. HACKER, J; BLUM-OEHLER, G; MUHLDORFER, I; TSCHAPE, H (1997) Pathogenicity islands of virulent bacteria: structure, function and
analysis in the proteomics era. Current Bioinformatics 2(14): 63-93.
impact on microbial evolution. Molecular Microbiology 23: 1089–
http://dx.doi.org/10.2174/157489307779314285
1097. http://dx.doi.org/10.1046/j.1365-2958.1997.3101672.x
The COLOSS BEEBOOK: American foulbrood
HARTFELDER, K; GENTILE BITONDI, M M; BRENT, C; GUIDUGLI-
25
KLOSE, J (1975) Protein mapping by combined isoelectric focusing
LAZZARINI, K R; SIMÕES, Z L P; STABENTHEINER, A; DONATO
and electrophoresis of mouse tissues. A novel approach to testing
TANAKA, É; WANG, Y (2013) Standard methods for physiology
for induced point mutations in mammals. Humangenetik 26(3):
and biochemistry research in Apis mellifera. In V Dietemann; J D
Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume I:
231-243. LONCARIC, I; DERAKHSHIFAR, I; OBERLERCHNER, J T;
standard methods for Apis mellifera research. Journal of Apicultural
KÃGLBERGER, H; MOOSBECKHOFER, R (2009) Genetic diversity
Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.06
among isolates of Paenibacillus larvae from Austria. Journal of
HAYNES, W C; ST JULIAN, G; SHEKLETON, M C; HALL, H H; TASHIRO, H (1961) Preservation of infectious milky disease bacteria by lyophilization. Journal of Insect Pathology 3: 55-61. HELLEMANS, J; MORTIER, G; DE PAEPE, A; SPELEMAN, F;
Invertebrate Pathology 100(1): 44-46. http://dx.doi.org/10.1016/j.jip.2008.09.003 MOTER, A; LEIST, G; RUDOLPH, R; SCHRANK, K; CHOI, B K; WAGNER, M; GÖBEL, U B (1998) Fluorescence in situ
VANDESOMPELE, J (2007) qBase relative quantification framework
hybridization shows spatial distribution of as yet uncultured
and software for management and automated analysis of real-time
treponemes in biopsies from digital dermatitis lesions.
quantitative PCR data. Genome Biology 8: R19.
Microbiology 144(9): 2459-2467.
http://dx.doi.org/10.1186/gb-2007-8-2-r19 HITCHCOCK, J D; MOFFETT, J O; LACKETT, J J; ELLIOTT, J R (1970) Tylosin for control of American foulbrood disease in honey bees.
Journal of Economic Entomology 63: 204–207. HORNITZKY, M A Z; CLARK, S (1991) Culture of Bacillus larvae from
MURRAY, K D; ARONSTEIN, K A (2006) Oxytetracycline-resistance in the honey bee pathogen Paenibacillus larvae is encoded on novel plasmid pMA67. Journal of Apicultural Research. 45: 207-214. MURRAY, K D; ARONSTEIN, K A; DE LEÓN, J H (2007) Analysis of pMA67, a predicted rolling-circle replicating, mobilizable,
bulk honey samples for the detection of American foulbrood.
tetracycline-resistance plasmid from the honey bee pathogen,
Journal of Apicultural Research 30: 13–16.
Paenibacillus larvae. Plasmid 58: 89-100.
HORNITZKY, M A Z; DJORDEVIC, S (1992). Sodium dodecyl sulphate polyacrylamide profiles and Western blots of Bacillus larvae.
Journal of Apicultural Research 31(1): 47-49. HORNITZKY, M A Z; KARLOVSKIS, S (1989) A culture technique for the detection of Bacillus larvae in honey bees. Journal of
Apicultural Research 28(2): 118–120. HORNITZKY, M A Z; NICHOLLS, P J (1993) J-medium is superior to
http://dx.doi.org/10.1016/j.plasmid.2007.02.001 MURRAY, K D; ARONSTEIN, K A (2008) Transformation of the Grampositive honey bee pathogen, Paenibacillus larvae, by electroporation. Journal of Microbiological Methods 75: 325-328. http://dx.doi.org/10.1016/j.mimet.2008.07.007 NEUENDORF, S; HEDTKE, K; TANGEN, G; GENERSCH, E (2004) Biochemical characterization of different genotypes of Paenibacillus
sheep blood agar and brain heart infusion agar for the isolation of
larvae subsp. larvae, a honey bee bacterial pathogen. Microbiology
Bacillus larvae from honey samples. Journal of Apicultural Research
150(7): 2381-2390. http://dx.doi.org/10.1099/mic.0.27125-0
32: 51–52. HUMPHERY-SMITH, I; CORDWELL, S J; BLACKSTOCK, W P (1997) Proteome research: Complementarity and limitations with respect to the RNA and DNA worlds. Electrophoresis 18(8): 1217-1242. http://dx.doi.org/10.1002/elps.1150180804 ITZKOVITZ, S; VAN OUDENAARDEN, A (2011) Validating transcripts
NORDSTRÖM, S; FRIES, I (1995) A comparison of media and cultural conditions for identification of Bacillus larvae in honey. Journal of
Apicultural Research 34: 97-103. O’FARRELL, P H (1975) High resolution two-dimensional electrophoresis of proteins. Journal of Biological Chemistry 250 (10): 4007-4021.
with probes and imaging technology. Nature Methods 8: S12-S19. OIE (2008) Chapter 2.2.2. American foulbrood. In OIE Manual of http://dx.doi.org/10.1038/NMETH.1573 JANKE, B; DOBRINDT, U; HACKER, J; BLUM-OEHLER, G (2001) A subtractive hybridization analysis of genomic differences between the uropathogenic E. coli strain 536 and the E. coli K-12 strain
Diagnostic Tests and Vaccines for Terrestrial Animals (mammals, birds and bees), vol. 1 (Sixth Edition). OIE; Paris, France. pp 395404. OIE (2011) Chapter 9.2. American foulbrood. In OIE Terrestrial
MG1655. FEMS Microbiology Letters 199: 61–66.
Animal Health Code, vol. 2 (Twentieth Edition). OIE; Paris, France.
http://dx.doi.org/10.1111/j.1574-6968.2001.tb10651.x
pp 504-506.
KILWINSKI, J; PETERS, M; ASHIRALIEVA, A; GENERSCH, E (2004)
OLIVE, D M; BEAN, P (1999) Principles and applications of methods
Proposal to reclassify Paenibacillus larvae subsp. pulvifaciens DSM
for DNA-based typing of microbial organisms. Journal of Clinical
3615 (ATCC 49843) as Paenibacillus larvae subsp. larvae. Results
Microbiology 37(6): 1661-1669.
of a comparative biochemical and genetic study. Veterinary
ONG, S E; FOSTER, L J; MANN, M (2003) Mass spectrometric-based
Microbiology. 104: 31-42.
approaches in quantitative proteomics. Methods. 29(2): 124-30.
http://dx.doi.org/10.1016/j.vetmic.2004.08.001
http://dx.doi.org/10.1016/S1046-2023(02)00303-1
de Graaf et al.
26
PANDEY, A; MANN, M (2000) Proteomics to study genes and genomes. SPIVAK, M; REUTER, G S (2001) Resistance to American foulbrood
Nature 405(6788): 837-846. PETERS, M; KILWINSKI, J; BERINGHOFF, A; RECKLING, D; GENERSCH, E (2006) American foulbrood of the honey bee: Occurrence and distribution of different genotypes of Paenibacillus
larvae in the administrative district of Arnsberg (North Rhine-
disease by honey bee colonies, Apis mellifera, bred for hygienic behaviour. Apidologie 32: 555-565. STEINKRAUS, K H; MORSE, R A (1996) Media for the detection of
Bacillus larvae spores in honey. Acta Biotechnologica 16: 57-64. TATUSOV, R L; KOONIN, E V; LIPMAN, D J (1997) A genomic
Westphalia). Journal of Veterinary Medicine 53(2): 100-104.
perspective on protein families. Science 278(5338): 631-637.
http://dx.doi.org/10.1111/j.1439-0450.2006.00920.x
http://dx.doi.org/10.1126/science.278.5338.631
PIRK, C W W; DE MIRANDA, J R; FRIES, I; KRAMER, M; PAXTON, R;
TATUSOV, R L; FEDOROVA, N D; JACKSON, J D; JACOBS, A R;
MURRAY, T; NAZZI, F; SHUTLER, D; VAN DER STEEN, J J M; VAN
KIRYUTIN, B; KOONIN, E V; KRYLOV, D M; MAZUMDER, R;
DOOREMALEN, C (2013) Statistical guidelines for Apis mellifera
MEKHEDOV, S L; NIKOLSKAYA, A N; RAO, B S; SMIRNOV, S;
research. In V Dietemann; J D Ellis; P Neumann (Eds) The
SVERDLOV, A V; VASUDEVAN, S; WOLF, Y I; YIN, J J; NATALE, D A
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
(2003) The COG database: an updated version includes
research. Journal of Apicultural Research 52(4):
eukaryotes. BMC Bioinformatics 4: 41.
http://dx.doi.org/10.3896/IBRA.1.52.4.13
http://dx.doi.org/10.1186/1471-2105-4-41
POPPINGA, L; GENERSCH, E (2012) Heterologous expression of green THOMAS, S R; ELKINTON, J S (2004) Pathogenicity and virulence. fluorescent protein in Paenibacillus larvae, the causative agent of
Journal of Invertebrate Pathology 85: 146-151.
American foulbrood of honey bees. Journal of Applied Microbiology
http://dx.doi.org/10.1016/j.jip.2004.01.006
112: 430-435. http://dx.doi.org/10.1111/j.1365-2672.2011.05214.x TORTO, B; CARROLL, M J; DUEHL, A; FOMBONG, A T; NAZZI, F, QIN, X; EVANS, J D; ARONSTEIN, K A; MURRAY, K D; WEINSTOCK,
GOZANSKY, K T; SOROKER, V, TEAL, P E A (2013) Standard
G M (2006) Genome sequences of the honey bee pathogens
methods for chemical ecology research in Apis mellifera. In V
Paenibacillus larvae and Ascosphaera apis. Insect Molecular
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
Biology 15(5): 715-718.
Volume I: standard methods for Apis mellifera research. Journal
http://dx.doi.org/10.1111/j.1365-2583.2006.00694.x
of Apicultural Research 52(4):
RAPPSILBER, J; MANN, M; ISHIHAMA, Y (2007) Protocol for micro-
http://dx.doi.org/10.3896/IBRA.1.52.4.06
purification, enrichment, pre-fractionation and storage of peptides TSIEN, R Y (1998) The green fluorescent protein. Annual Review of for proteomics using StageTips. Nature Protocols 2(8): 1896-906. http://dx.doi.org/10.1038/nprot.2007.261 RAUCH, S; ASHIRALIEVA, A; HEDTKE, K; GENERSCH, E (2009)
Biochemistry 67: 509-44. http://dx.doi.org/10.1146/annurev.biochem.67.1.509 UNTERGASSER, A; NIJVEEN, H; RAO, X; BISSELING, T; GEURTS, R;
Negative correlation between individual-insect-level virulence and
LEUNISSEN, J A M (2007) Primer3plus, an enhanced web
colony-level virulence of Paenibacillus larvae, the etiological agent
interface to primer3. Nucleic Acids Research 35: W71-W74.
of American foulbrood of honey bees. Applied and Environmental
http://dx.doi.org/10.1093/nar/gkm306
Microbiology 75: 3344-3347. http://dx.doi.org/10.1128/AEM.02839-08 RECKSEIDLER, S L; DESHAZER, D; SOKOL, P A; WOODS, D E (2001)
VANDESOMPELE, J; DE PRETER, K; PATTYN, F; POPPE, B; VAN ROY, N; DE PAEPE, A; SPELEMAN, F (2002) Accurate normalization of realtime quantitative RT-PCR data by geometric averaging of multiple
Detection of bacterial virulence genes by subtractive hybridization:
internal control genes. Genome Biology 3(7): 0034.1.
identification of capsular polysaccharide of Burkholderia
http://dx.doi.org/10.1186/gb-2002-3-7-research0034
pseudomallei as a major virulence determinant. Infection and Immunity 69: 34–44. http://dx.doi.org/10.1128/IAI.69.1.34-44.2001 SCHUCH, D M T; MADDEN, R H; SATTLER, A (2001) An improved method for the detection and presumptive identification of
Paenibacillus larvae subsp larvae spores in honey. Journal of Apicultural Research 40: 59–64. SHIMANUKI, H; KNOX, D A (2000) Diagnosis of honey bee diseases. USDA Agricultural Handbook No. H-690, Washington DC, USA. 61 pp. SIEBERT, P D; CHENCHIK, A; KELLOGG, D E; LUKYANOV, K A; LUKYANOV, S A (1995) An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Research 23: 1087-1088. http://dx.doi.org/10.1093/nar/23.6.1087
VERSALOVIC, J; SCHNEIDER, M; DE BRUIJN, F J; LUPSKI, J R (1994). Genomic fingerprinting of bacteria using repetitive sequencebased polymerase chain reaction. Methods in Molecular and
Cellular Biology 5: 25-40. WU, X Y; CHIN, J; GHALAYINI, A; HORNITZKY, M A Z (2005) Pulsedfield gel electrophoresis typing and oxytetracycline sensitivity of
Paenibacillus larvae subsp. larvae isolates of Australian origin and those recovered from honey imported from Argentina. Journal of
Apicultural Research 44: 87-92.
The COLOSS BEEBOOK: American foulbrood
27
YUE, D; NORDHOFF, M; WIELER, L H; GENERSCH, E (2008)
ZHANG, Y L; ONG, C T; LEUNG, K Y (2000) Molecular analysis of
Fluorescence in situ hybridization (FISH) analysis of the
genetic differences between virulent and avirulent strains of
interactions between honey bee larvae and Paenibacillus larvae,
Aeromonas hydrophila isolated from diseased fish. Microbiology
the causative agent of American foulbrood of honey bees (Apis mellifera). Environmental Microbiology 10: 1612-1620. http://dx.doi.org/10.1111/j.1462-2920.2008.01579.x
146: 999–1009. ZUKER, M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research 31: 3406-3415. http://dx.doi.org/10.1093/nar/gkg595
Journal of Apicultural Research 52(1)
© IBRA 2013
Journal of Apicultural Research 52(1): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.1.12
REVIEW ARTICLE
Standard methods for European foulbrood research Eva Forsgren1*, Giles E Budge2, Jean-Daniel Charrière3 and Michael A Z Hornitzky4 1
Department of Ecology, Swedish University of Agricultural Sciences, PO Box 7044, SE-75007 Uppsala, Sweden. National Bee Unit, Food and Environment Research Agency, Sand Hutton, York, YO41 1LZ, UK. 3 Swiss Bee Research Center, Agroscope Liebefeld-Posieux (ALP), Schwarzenburgstr. 161, 3003 Bern, Switzerland. 4 New South Wales, Department of Primary Industries, Elizabeth Macarthur Agricultural Institute, PB 4008, Narellan NSW 2567, Australia. 2
Received 30 March 2012, accepted subject to revision 26 April 2012, accepted for publication 12 September 2012. *Corresponding author: Email: eva.forsgren@slu.se
Summary European foulbrood (EFB) is a severe bacterial honey bee brood disease caused by the Gram-positive bacterium Melissocccus plutonius. The disease is widely distributed worldwide, and is an increasing problem in some areas. Although the causative agent of EFB was described almost a century ago, many basic aspects of its pathogenesis are still unknown. Earlier studies were hampered by insensitive and unspecific methods such as culture based techniques. Recent advances in molecular technology are making it increasingly easy to detect and characterize microbes, and nucleic acid detection technologies are quickly displacing the traditional phenotypic assays in microbiology. This paper presents selected methodologies which focus on EFB and its causative agent M. plutonius.
Métodos estándar para la investigación sobre la loque europea Resumen La loque europea (LE) es una grave enfermedad bacteriana de la cría de la abeja de la miel causada por la bacteria Gram-positiva
Melissococcus plutonius. La enfermedad se encuentra ampliamente distribuida en todo el mundo y es un problema creciente en algunas áreas. Aunque el agente causante de la LE fue descrito hace casi un siglo, muchos aspectos básicos de su patogénesis son aún desconocidos. Estudios anteriores se vieron obstaculizados por métodos poco sensibles e inespecíficos, tales como las técnicas basadas en cultivos. Los recientes avances en la tecnología molecular están haciendo cada vez más fácil la detección y caracterización de los microbios, y las tecnologías de detección de ácidos nucleícos están desplazando rápidamente a los ensayos fenotípicos tradicionales de microbiología. Este artículo presenta algunas metodologías seleccionadas que se centran en LE y en su agente causal M. plutonius.
欧洲幼虫腐臭病研究的标准方法 欧洲幼虫腐臭病是蜜蜂幼虫病中较为严重的细菌病,由革兰氏阳性细菌Melissocccus plutonium 引起。欧洲幼虫腐臭病在世界范围内广泛分布, 成为一些地区日益突出的主要病害。虽然一个世纪前就已有相关病原体的描述,但早期研究受实验技术不灵敏、特异性不好的限制(比如细菌培 养的技术),其发病机理至今未能全面揭示。近年来随着分子技术的发展检测微生物日益容易,核酸检测技术快速替换了传统的微生物学表型实 验。本文展示了近期开展欧洲幼虫腐臭病及其病原体 M. plutonius方面的常用技术。
Keywords: honey bee, European foulbrood, Melissococcus plutonius, brood disease, methodologies, BEEBOOK, COLOSS
Footnote: Please cite this paper as: FORSGREN, E; BUDGE, G E; CHARRIÈRE, J-D; HORNITZKY, M A Z (2013) Standard methods for European foulbrood research. In V Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.12
Forsgren et al.
2
1. Introduction
changes from pearly white to pale yellow, often accompanied by a
1.1. Background
further colour changes to brown and greyish black (Fig. 1), sometimes
European foulbrood (EFB) is a bacterial brood disease caused by the
ultimately leaving a dark scale (Fig. 2) that is more malleable than
Gram positive bacterium Melissococcus plutonius. EFB is listed in the
those typically found with American foulbrood (AFB).
loss in segmentation. More advanced symptoms can manifest as
OIE Terrestrial Animal Health Code (2011), but, unlike American foulbrood; it is not notifiable in all countries. The disease occurs in honey bees throughout the world, and may cause serious losses of brood and colony collapse. In many areas, the disease is endemic with occasional seasonal outbreaks, but, in a few countries, the scenario is different. In Switzerland, the incidence of EFB has increased dramatically since the late 1990s; it has become the most widespread bacterial brood disease in the UK, and Norway reported a regional outbreak of EFB during 2010 after a 30 year period of absence. Geographically, the disease appears to vary in severity from being relatively benign in some areas but increasingly severe in others (Wilkins et al., 2007; Dahle et al., 2011; Grangier, 2011; Arai et al., 2012). Virulence tests on individual larvae using exposure bioassays (see section 9), shows that M. plutonius strains collected in different geographic European locations vary in their ability to cause larval
Fig. 2. The infected larva loses its internal pressure and becomes
mortality (Charrière et al., 2011).
flaccid, ultimately leaving a dark scale.
Photo by Kaspar Ruoff
1.2. Disease symptoms The field diagnosis of EFB is based on the visual inspection of brood
1.3. Secondary bacteria
combs and detection of diseased larvae (see section 4). The general
Several other bacteria such as: Enterococcus faecalis; Achromobacter
symptoms observed in a colony suffering from EFB are irregular
euridice; Paenibacillus alvei and Brevibacillus laterosporus may be
capping of the brood; capped and uncapped cells being found scattered associated with EFB (Forsgren, 2010). Although the presence of irregularly over the brood frame (known as pepper pot brood). The
P. alvei - like spores of E. faecalis has been considered presumptive
youngest larvae that die from the infection cover the bottom of the
evidence of European foulbrood, the role of such secondary bacterial
cell and are almost transparent, with visible trachea. Older larvae die
invaders in disease development has been poorly investigated.
malpositioned and flaccid in their cells; twisted around the walls or
A. euridice is frequently isolated in mixed culture with M. plutonius
stretched out lengthways (Fig. 1). The colour of affected larvae
and EFB symptoms in larvae may be more easily induced with inoculate containing M. plutonius in combination with A. euridice or
P. alvei (Bailey, 1957). However, a more recent study from Switzerland showed that the simultaneous or 3 days delayed inoculation of P. alvei had no influence on the virulence of M. plutonius in individual larvae (Charrière et al., 2011; see section 9.2). This paper will focus solely on techniques for diagnosis and research of the causative agent of EFB, M. plutonius.
1.4. Diagnosis Symptoms of EFB may easily be confused with other diseases or abnormalities in the brood, making diagnosis difficult. The diagnosis in the field can be further verified by microscopic examination of brood smear preparations (see section 6; Hornitzky and Wilson, 1989; Hornitzky and Smith, 1998), and a field test kit (see section 7.2) for
Fig. 1. Malpositioned and discoloured larvae in brood with symptoms
the detection of M. plutonius in larval extracts is also available
of European foulbrood.
(Tomkies et al., 2009). Analysing pooled samples of bees from the
Photo by Eva Forsgren
The COLOSS BEEBOOK: European foulbrood
3
Table 1. Reference strains of M. plutonius. species
strain no.
Melissococcus plutonius
LMG 20360
other designation = ATCC 35311
source Honey bee larvae, UK
= CIP 104052 = LMG 15058 = LMG 19520 = LMG 20206 = LMG 21267 = NCDO 2443 NCIMB 702439
Honey bee larvae, India
NCIMB 702440
Honey bee larvae, Brazil
NCIMB 702441
Honey bee larvae, Tanzania
NCIMB 702442
Honey bee larvae, Australia
NCIMB 702443
Honey bee larvae, UK
brood nest by PCR (see section 8) may be an alternative or complement infection, and further guidance on bio-safety recommendations can be to visual inspection (Roetschi et al., 2008), although false negatives
found in the American foulbrood paper of the BEEBOOK (de Graaf et al.,
may sometimes occur (Budge et al., 2010). Sensitive detection
2013).
methods are required to ensure the absence of the bacterium from bee products and for the confirmation of the visual diagnosis made in the field or for research purposes. Pure isolates of M. plutonius may sometimes be desirable for various research purposes (see section 5).
3. Reference strains of
There are selective media for the cultivation of M. plutonius (Bailey,
Melissococcus plutonius
1957; Bailey, 1983; Bailey and Collins, 1982; Hornitzky and Wilson,
Type or reference strains of M. plutonius are available at culture
1989; Hornitzky and Karlovskis, 1989), but to culture the bacterium
collections, such as the Belgian Co-ordinated Collections of
can be difficult and there is some evidence that M. plutonius samples
Microorganisms, BCCM/LMG (Table 1). A type strain (or a prototype
from different regions have a differential response to culturing
strain) is a nomenclatural type of a species or a subspecies. Authors
(Allen and Ball, 1993; Arai et al., 2012). Immunology-based tests such who propose new bacterial names are supposed to deposit type as enzyme linked immuno-sorbent assay (ELISA) (Pinnock and
strains in two publicly accessible recognized culture collections in two
Featherstone, 1984) have been published and used for the detection
different countries. Type strains are also useful in validation work.
and quantification of M. plutonius (see section 7.1), but DNA amplification using the polymerase chain reaction (PCR) provides lower thresholds of detection than ELISA, and has been successfully used for the detection of M. plutonius since the late 1990s (see
4. Sampling
section 8).
Methods can be grouped into those looking to confirm the presence of
This paper therefore aims to present selected protocols useful for
the disease by testing an individual symptomatic larva for M. plutonius,
diagnosis and research on the honey bee brood disease European
and those that hope to confirm the presence of M. plutonius in
foulbrood.
asymptomatic material, such as in bulk samples of adult bees or disease-free colonies in proximity to disease. When considering the latter, it is important to consider the within-hive distribution of the
2. Bio-safety recommendations
pathogen and also how the sample size may affect the power of the
It is important to appreciate that there is no internationally accepted
50,000 individuals, sampling 5 adult bees provides a 95% confidence
biohazard classification for the handling of M. plutonius for diagnostic
of detecting a pathogen with a minimum prevalence of 50%, whereas
or research purposes. Restrictions on the handling of the bacterium
sampling 60 adult bees increases the power of the testing regime to
and diseased material vary significantly between countries, and any
enable a more meaningful minimum pathogen detection of 5%
laboratory should check national policies for guidance before handling
prevalence. No single study has provided the necessary detail to make
subsequent test. For example, when assuming a hive population of
material. In those countries where M. plutonius is not notifiable, there definitive recommendations on sample location and size, therefore is still a strong need for precautionary measures to reduce the risk of
this chapter concentrates on summarizing the sampling methods and
Forsgren et al.
4
A
B
Fig. 3. Estimates of the log amount of M. plutonius (MNE) in samples of larvae (A) and adult bees (B) probability of the honey bee colony being symptomatic for EFB. Data from 2006 are from Budge et al. (2010), and those from 2007 previously unpublished findings from follow up work. The plots represent estimates and corresponding 95% confidence limits from a generalized linear model constructed using qPCR data (see Budge et al., 2010). knowledge to date (See also de Graaf et al., 2013; Human et al., 2013). 100 bees have been used for DNA extraction (Roetschi et al., 2008; Storage temperature is not crucial. All sample types can be refrigerated Budge et al., 2010); however, adult bees show more variation in the for several hours and stored at -20ÂşC for longer periods.
amount of M. plutonius detected than samples of larvae (Fig. 3).
4.1. Brood
4.3. Honey and pollen
Upon visual inspection in the field, large pieces of symptomatic brood
Brood nest honey, bulk honey and pollen have to some extent been
may be cut out and sent to the laboratory (a piece of 10 x 10 cm cuts
used to confirm the presence of bacteria using culture methods
through the metal wires of the brood frame) for further examination
(see section 5) and PCR (see section 8) in both diseased and healthy
and confirmation of the diagnosis. Correct sampling of brood is
looking colonies (Hornitzky and Smith, 1998, McKee et al., 2003). For
important because even within the same brood frame, M. plutonius is
further sampling instructions see the American foulbrood paper of the
mainly found in larvae with visual disease symptoms (Forsgren et al.,
BEEBOOK (De Graaf et al., 2013).
2005). Alternatively, and in cases of lower severity, diseased larvae can be smeared on a microscope slide and submitted to the laboratory (see section 6). M. plutonius can survive for over three
5. Cultivation of M. plutonius
years on such slide preparations (Bailey, 1960), and 6 years within
For many experiments, it is imperative to use bacterial cultures in
Lateral Flow Devices (Budge, unpublished data), and so culturing
which all cells are genetically identical. Since all cells in a colony
often remains a viable option many years after diagnosis.
develop from one single cell, a single isolated colony of M. plutonius is
It is possible to identify the presence of M. plutonius in the
an excellent source of a genetically pure bacterial stock. In order to
absence of disease symptoms by collecting bulk samples of 100
propagate any bacterium, it is necessary to provide the appropriate
larvae, taken at random from across the brood nest and subjecting
biochemical and biophysical environment to encourage bacterial
the samples to qPCR (Budge et al., 2010; see also the molecular
growth. The biochemical or nutritional environment is provided as a
methods paper of the BEEBOOK (Evans et al., 2013). This method
culture medium based on special needs for particular bacteria, and
provided robust quantification of M. plutonius and is a potentially
can be used for isolation and maintenance of bacterial cultures.
useful tool to help predict the risk of a colony either prior to disease
Bacterial culture media can be classified based on consistency. Liquid
development or in the absence of an inspection to confirm disease
media are sometimes referred to as “broths� where bacteria grow
(Fig. 3).
uniformly, and tend to be used when a large quantity of bacteria have to be grown. Moreover, liquid media can be used to obtain a viable
4.2. Adults
bacterial count i.e. to physically quantify the amount of organism
Analysis of worker bees indicates that individuals from the brood nest
present (see section 9.1.1). Any liquid media can be solidified by the
contain more bacteria than bees from flight entrances; therefore, it
addition of agar (e.g. Oxoid Technical Agar No. 1) at a concentration
was suggested that samples of bees are preferably collected from the
of 1-3%. Although M. plutonius can be isolated from honey and
brood nest (Roetschi et al., 2008). This result has not been replicated
diseased brood by cultivation, bacterial culture methods seem to be
by others, where the amount of M. plutonius in foragers equalled that
very insensitive detecting less than 0.2% of the bacterial cells
found in nurse bees (Budge, unpublished data). Pooled samples of
(Djordjevic et al., 1998; Hornitzky and Smith, 1998).
The COLOSS BEEBOOK: European foulbrood
5
4. Adjust the final volume to 1000 ml. 5. Sterilize by autoclaving at 115˚C for 15 minutes. Optional; in order to prevent growth of secondary bacteria, filter-sterilized nalidixic acid (dissolved in 0.1 M NaOH may be added to a final concentration of 3 µg per ml after autoclaving. For liquid cultures, the starch may be replaced with saccharose, making the medium clear. This will facilitate when checking the turbidity or the cloudiness of the cell suspension, e.g. to see if there is any bacterial growth. 6. Incubate the plates for 7 days at 35°C anaerobically. Colonies about 1 mm in diameter will appear after 4-7 days (Figs 4 a, b), and can be further confirmed by staining, LFI or PCR (see sections 6.1, 7.2 and 8). Single bacterial colonies can be screened using real-time PCR / conventional PCR by simply touching a small (10 µl) tip directly onto the colony of interest, touch the tip onto some agar to sub-culture if
Fig 4a. Agar plate (basal medium) with colonies of M. plutonius. The yellow bar represents 5 mm. Photo by Lena Lundgren and Karl-Erik Johansson
required, before placing the tip directly into the PCR mastermix (see section 8).
5.2. M110 agar (from BCCM/LMG bacteria catalogue) 5.2.1. Agar base
2.5 g of peptone (Oxoid L37) 10 g of glucose 2 g of soluble starch 2.5 g of yeast extract (Oxoid L21) 5 g of neopeptone (Difco 0119) 2 g of trypticase (BBL211921) 50 ml of 1 M phosphate buffer (pH 6.7) = 49.7 ml of 1M K2HPO4 + 50.3 ml of 1M KH2PO4. 1. Mix all ingredients and make up to 1000 ml with distilled
Fig 4b. Colony morphology of M. plutonius on basal medium. The bar represents 1 mm.
Photo by Eva Forsgren
water. 2. Adjust to pH 7.2 with 5M KOH. 3. Add agar (Difco or Oxoid No 1) to a 1.5% final concentration. For 250 ml amounts of agar base, weigh 3.75 g of agar into
5.1. Basal medium (modified from Bailey, 1957) 1. Dissolve the following components in approximately 800 ml deionized water:-
10 g of yeast extract 10 g of glucose 10 g of starch 0.25 g L-cysteine 20 g of agar 2. Add 100 ml of 1M KH2PO4 (pH 6.7) 3. Adjust the pH to 6.6 using 2.5 M KOH.
the 250 ml Duran flasks, for 500 ml, 7.5 gram. Dispense the correct amount of made up and pH corrected broth into the Duran flask. 4. Mix well before dispensing broth into Duran flasks with agar, the soluble starch settles out quite quickly. 5. Sterilize by autoclaving at 115°C for 15 minutes. Higher temperature autoclaving will tend to caramelize the agar (make it darker). 6. Add cysteine hydrochloride H2O to a final concentration of 0.025%. NOTE: Cysteine hydrochloride reduces the oxygen content in the agar
Forsgren et al.
6
more efficiently if added just before the agar is to be used. If the agar is made up in 250 or 500 ml amounts, then autoclaved, this base can be kept for quite a long time (2-3 months or longer), but if the cysteine is added before autoclaving, the base will only keep a week at the most. 5.2.2. Agar plates 1. Melt the agar base in a steamer and cool to 46°C. 2. Add 625 µl of a freshly made 0.2 µm filter sterilized 10% solution of cysteine hydrochloride (does NOT keep at all) to 250 ml of the agar base, or 1.25 ml for 500 ml of base. Make sure the agar is mixed well, but not bubbly as soluble starch settles out. 3. Pour immediately into petri-dishes. 4. Cool and dry in the lamina flow for 20 minutes.
Fig 5a. Early infection- only Melissocoocus plutonius. Arrow indicates
5. Use the plates as soon as possible.
a mass of coccoid/lanceolate M. plutonius organisms. Photo by Michael Hornitzky
It is not advised to keep unused plates to use another day.
5.3. Anaerobic incubation 1. Seal in an anaerobic jar as soon as possible with an anaerobic indicator (Oxoid BR055B) and Oxoid AnaeroGen anaerobic generator sachet (appropriate size for anaerobic jar volume. AnaeroGen AN025A for 2.5 l jar, AnaeroGen AN035A for 3.5 l jar). 2. Incubate for about a week at 35°C. The anaerobic indicator should go colourless from pink after a few hours incubation. If it does not, the jar has failed to achieve anaerobic conditions.
5.4. Medium for long-term storage Freezing is an effective long-term storage of M. plutonius as well as
Fig 5b. Infiltration of secondary invader Paenibacillus alvei. Arrow
other bacterial isolates. Broth cultures are mixed with chemicals such
indicates one of the many vegetative P. alvei cells. Photo by Michael Hornitzky
as glycerol or DMSO to limit damage upon freezing. It is possible to use proprietary cryopreservation kits which can even specialize in the preservation of anaerobic organisms (e.g. PROTECT system from
6.1. Carbol fuchsin staining
Thermo Fisher Scientific). Using such proprietary kits, pure cultures of
Prepare the carbol fuchsin stain by mixing the following 2 solutions.
M. plutonius are added to a tube containing cryopreservation liquid
Solution A: 0.2 g basic fuchsin and 10 ml 95% ethanol.
and ceramic beads. After temperature controlled freezing, cultures
Solution B: 5 g phenol and 90 ml distilled water.
can be recovered by removing a single ceramic bead and plating
Procedure:
directly onto selective media. Results to date indicate 100% successful recovery after 6 months storage at -80°C (Budge, unpublished data).
1. Select larvae and/or pupae showing signs of European foulbrood and place them on a microscope slide. 2. Using a swab or stick, pulp the larvae together and spread over the slide pushing any excess off one end, to leave a thin smear. Allow the smears to dry before processing.
6. Microscopy
3. Heat fix by flaming the slide over a burner a few times.
The laboratory diagnosis of European foulbrood is based on the
4. Flood with 0.2% carbol fuchsin for 30 seconds.
identification of M. plutonius in affected brood. One method for the
5. Wash off the stain and either air dry or gently blot dry before
identification M. plutonius is the microscopy of smears prepared from diseased brood.
microscopic examination at 1000 times magnification. A diagnosis of European foulbrood is made if examination revealed M.
The COLOSS BEEBOOK: European foulbrood
7
Decolourizer (ethanol + acetone) Safranin (the counter stain)
Procedure: 1. Mount and heat fix the specimen (about 6 times through the flame). 2. Flood (cover completely) the entire slide with crystal violet. 3. Let the crystal violet stand for about 60 seconds. 4. Flood your slide with the iodine solution. 5. Let it stand for 60 seconds. 6. Rinse the slide with water for 5 seconds and immediately
Fig 5c. Proliferation of P. alvei spores to the virtual exclusion of M. plutonius. Arrow indicates one of the many P. alvei spores. Photo by Michael Hornitzky
proceed to next step. 7. Rinse the slide with decolourizer for 20-60 seconds. 8. Rinse the slide carefully with water for about 5 seconds. 9. Apply the counter stain, safranin, by flooding the slide with the dye. 10. Let it stand for about 10-15 seconds. 11. Rinse with water for 5 seconds. 12. Dry the slide with paper or allow it to air dry. 13. View it under the microscope at 1,000 times magnification (Fig. 6).
7. Immunology-based methods Various laboratory techniques based on the use of antibodies to visualize or distinguish between microorganisms exist. The key component in any of the vast array of methods used is the antibody.
Fig. 6. Gram staining of Melissococcus plutonius. The coccoid-shaped Polyclonal antibodies against M. plutonius can be prepared by bacteria forming pairs or even chains are clearly visible.
injection of washed cultures of M. plutonius into rabbits either by
Photo by Lena Lundgren and Karl-Erik Johansson intravenous injections (Bailey and Gibbs, 1962) or by a single intramuscular injection of 1ml M. plutonius suspension mixed with an
plutonius-like organisms. Organisms are considered to be M. plutonius equal volume of Freund´s incomplete adjuvant (OIE, 2008). if they are lanceolate cocci, approximately 0.5 x 1.0 µm. E. faecalis is
Monoclonal antibodies can be prepared by injecting mice as described
very like M. plutonius in appearance and has frequently been
by Tomkies et al. (2009).
confused as being the causative agent (Bailey and Gibbs, 1962; Hornitzky and Wilson, 1989) (Figs 5 a, b, c). An alternative to the 0.2% carbol fuchsin stain is the Gram stain, useful mainly when the Gram positive feature of M. plutonius needs to be confirmed.
7.1. ELISA (Enzyme Linked Immuno Sorbent Assay) The enzyme-linked immunosorbent assay (ELISA) is a common serological test for particular antigens or antibodies. There are two
6.2. Gram staining
forms of the test: i. the direct ELISA employs antibodies to detect
Gram-staining is a four part procedure which uses certain dyes to
presence of a particular antigen in a samples and; ii. the indirect
make a bacterial cell stand out against its background. The reagents
ELISA is usually used to detect specific antibodies in a specimen such
you will need are:
as blood serum. However, the indirect ELISA method can also be
Crystal violet (the primary stain)
applied for detection of antigens as described in section 7.1.3. The
Iodine solution (the mordant)
ELISA method described by Pinnock and Featherstone (1984) is
Forsgren et al.
8
unable to detect bacterial levels less than 105 cells per ml.
12. Cover the plate and incubate for 2 hours at room
7.1.2. Sample processing
13. Wash the plate three times with PBS.
Individual or pooled samples of bees, larvae or pupae (sampled and
14. Add 100 µl of the secondary, conjugated antibody diluted
temperature.
stored at -20ºC) can be crushed in phosphate buffered saline, PBS,
according to the manufacturer´s instruction.
pH 7.4 (for the recipe, see Table 1 of the cell culture paper of the
15. Cover the plate.
BEEBOOK (Genersch et al., 2013)) , the homogenate centrifuged for
16. Incubate for 1 hour at room temperature.
10 sec at 10,000 g and the supernatant stored at -20°C or used
17. Wash four times with washing solution.
directly in an ELISA.
18. Dispense 100 µl per well of the substrate solution. 19. Incubate for 15 min in room temperature (dark).
7.1.3. Indirect ELISA
20. Add equal volume of the stop solution (2 M H2SO4).
The reagents needed to perform the ELISA are:
21. Read the optical density at 450 nm using a plate reader.
Bicarbonate / carbonate coating buffer, 100 mM, pH 9.6.
Compare the density reads of unknown samples against
Phosphate buffered saline, PBS, pH 7.4.
standards (e.g. suspensions of known concentrations of M.
Blocking solution (PBS with 1-2% BSA). Washing buffer (PBS with 0.05% Tween 20).
plutonius). To ensure accuracy, include standards and at least one blank sample to each plate.
Primary antibody (rabbit, chicken, mouse).
7.2. Lateral flow immunoassay (LFI)
Peroxidase or alkaline phosphatase-conjugated secondary
A commercially available lateral flow device for the detection of
antibody (anti-rabbit, anti-chicken; anti-mouse).
Substrate for peroxidase alkaline phosphatase-conjugated
M. plutonius using specific monoclonal antibodies is available. The kit was designed primarily for the confirmation of disease symptoms in
secondary antibody (e.g. TMB (3,3´,5,5´- tetramethylbenzidine)). the field, but may also be used in the laboratory (Tomkies et al., 2009).
Stop solution (0.5 M H2SO4).
The kit is produced by Vita (Europe) Ltd and the protocols available
Microtiter plates.
at: http://www.vita-europe.com. Using LFIs gives an instant result
Microtiter plate reader. Many different types of enzymes can be used for detection. Peroxidase-conjugated secondary antibodies and TMB (3,3´,5,5´tetramethylbenzidine) are commonly used and accessible.
(meaning no time delay between disease suspicion and treatment), no expensive equipment required and is relatively cheap compared to posting the samples to the laboratory for diagnosis. However, it works only on single larvae and requires field knowledge to select the correct/infected larvae in a brood sample (see section 1.2).
Procedure: 1. Dilute the bee homogenates in coating buffer. The total protein concentration should not exceed 20 µg per
8. PCR-based methods
ml.
Detection of infectious microorganisms has been revolutionized by the
2. Coat the wells of a microtiter plate with 100 µl per well of the antigen dilution.
polymerase chain reaction (PCR), and has increasingly been described as the “gold standard” for detecting some microbes. Theoretically, a
3. Cover the plate using an adhesive plastic.
single target DNA molecule is sufficient for detection, making PCR one
4. Incubate for 2 hours at room temperature or at 4°C over
of the most sensitive biological techniques ever described. For a more
night.
generic overview on PCR-based methods and other molecular biology
5. Remove the coating buffer.
methodologies used in A. mellifera research see the molecular
6. Wash the plates two times filling the wells with washing
methods paper of the BEEBOOK (Evans et al., 2013).
buffer. 7. Block the remaining protein-binding sites by adding 200 µl blocking solution to the wells. 8. Incubate for 2 hours at room temperature or at 4°C over night.
8.1. Processing Samples can be homogenized with glass beads in mechanical ‘bead mills’, in mesh bags (e.g. Bioreba, Neogen) using a grinding pestle, a
9. Wash the plate two times with washing solution.
stomacher (e.g. Seward Ltd UK) or in microfuge tubes with a
10. Add 100 µl of the M. plutonius specific antibody diluted in
micropestle. The choice depends on sample size and type. Individuals
blocking solution. 11. The optimal dilution should be determined using a dilution assay.
can be extracted in the manufacturer´s buffer directly, but for bulk samples a primary extract may be necessary (see section 8.2.1).
The COLOSS BEEBOOK: European foulbrood
9
Table 2. PCR-based methods for the detection of M. plutonius. publication
primers
Sequence (5’-3’)
Size (bp)
method and target
Govan et al., 1998
Primer 1 Primer 2
GAAGAGGAGTTAAAAGGCGC TTATCTCTAAGGCGTTCAAAGG
831
PCR, 16S rRNA gene
Djordjevic et al., 1998
MP1 MP2 MP3
CTTTGAACGCCTTAGAGA ATCATCTGTCCCACCTTA TTAACCTCGCGGTCTTGCGTCTCTC
486 276
hemi-nested PCR, 16S rRNA gene
Roetschi et al., 2008
MelissoF MelissoR Probe
CAGCTAGTCGGTTTGGTTCC TTGGCTGTAGATAGAATTGACAAT FAM-CTTGGTTGGTCGTTGAC-MBGNFQ
79
real-time PCR, sodA gene
Budge et al., 2010
EFBFor EFBRev2 Probe
TGTTGTTAGAGAAGAATAGGGGAA CGTGGCTTTCTGGTTAGA FAM-AGAGTAACTGTTTTCCTCGTGACGGT-TAMRA
69
real-time PCR, 16S rRNA gene
8.2. DNA extraction
10. For manual DNA-extraction: Use DNeasy® Plant Mini Kit (QIAGEN). Follow the protocol for plant tissue (Mini Protocol).
Cellulose-based affinity columns such as QIAGEN, or generic
For automated DNA extraction using a QiaCube® (QIAGEN);
equivalents are most practical for obtaining clean DNA preparations.
follow the purification of total DNA from plant tissue standard
They are reliable and yield good quality DNA. Magnetic bead-based
protocol.
purification also works well (e.g. Budge et al., 2010). Since samples of
11. Use the DNA templates directly in a PCR or store in –20ºC
adult bees contain more secondary metabolites and phenolics than
until needed.
larvae, including a QiaShredder in the protocol will yield purer nucleic
1
acid (DNeasy® Plant Mini Kit) and prevent inhibition of the PCR
nuclease free water, 5.3 ml 1M Tris-Cl (pH 7.6), 5.3 ml 0.2 M
reaction. This is also recommended when extracting bacterial DNA
EDTA. Stir until completely solved and store at 4ºC.
GITC = for 100 ml, add 50 g guanidine thiocyanate, 50 ml
from honey. The columns can be used for manual DNA extraction or in a QiaCube® (QIAGEN) for automated extraction. There are two
8.2.2. Larvae / pupae
options when considering extraction controls for the quantification of
Procedure:
M. plutonius in honey bee samples. First, it is possible to monitor
1. Place the larva / pupa in an Eppendorf tube.
extraction efficiency using a honey bee reference gene (e.g. 18S;
2. Add 0.5 ml grinding buffer (e.g. GITC).
Budge et al., 2010). Alternatively extraction failures or PCR
3. Ground with a micropestle.
amplification inhibition can be monitored by amending the sample
4. Centrifuge for 10 min at 7,500 g.
with a known amount of Staphylococcus aureus before extraction
5. Discard the supernatant.
(Grangier, 2011). It is also recommended to include a negative
6. Resuspend the pellet in 180 µl enzymatic lysis buffer
extraction control (e.g. water) to check for possible contamination during the extraction process (Bustin et al., 2009). For further
(DNeasy® Blood and Tissue kit, QIAGEN). 7. Use the Qiacube and the DNeasy® Blood and Tissue kit
information on nucleic acid extraction see the molecular methods
protocol for enzymatic lysis of Gram + bacteria for automated
paper of the BEEBOOK (Evans et al., 2013).
purification. 8. Use the DNA templates directly in a PCR or store in –20ºC
8.2.1. Adults
until needed.
Procedure: 1. Place adult bees in filter grinding bag (Neogen™, Bioreba).
8.2.3. Honey
2. Add 0.5 ml grinding buffer (e.g. GITC1) per bee.
Procedure:
3. Crush the bees.
1. Heat 5 ml of honey to 40ºC.
4. Transfer 1.5 ml of the supernatant to a 2 ml Eppendorf tube.
2. Mix thoroughly with an equal volume of PBS.
OR; include a “crude” centrifugation step for bigger volumes.
3. Centrifuge at 27,000 g for 20 minutes.
5. Centrifuge at 2,000 g for 10 minutes.
4. Discard the supernatant.
6. Transfer 1.5 ml to an Eppendorf tube.
5. Resuspend the pellet in the manufacturer`s lysis buffer
7. Centrifuge at 20,000 g for 2 minutes.
(DNeasy® Plant Mini Kit, QIAGEN).
8. Discard the supernatant.
Follow the protocol for plant tissue (Mini Protocol).
9. Resuspend the pellet in the manufacturer’s lysis buffer (DNeasy® Plant Mini Kit, QIAGEN).
6. Use the DNA templates directly in a PCR or store in -20ºC until needed.
Forsgren et al.
10
8.3. PCR
2-5 µg of Taq DNA polymerase.
When PCR is used solely for detecting the presence or absence of a
2. Conditions for amplification consist of:
specific DNA signature, it is referred to as qualitative PCR (yes or no
initial denaturation at 95o C for 2 min,
answer). The qualitative PCR detects only the end product whereas
40 cycles of denaturation (95o C, 30 s),
the real-time PCR detects the amplicon as it accumulates and determines the number of new DNA molecules formed in each
primer annealing (61o C, 15 s),
reaction. The amount of the target molecule can be quantified (qPCR)
primer extension (72o C, 60 s),
either relatively or as absolute values or numbers (for further general
final extension cycle (72o C, 5 min).
information see the molecular methods paper of the BEEBOOK (Evans
et al., 2013)).
3. Amplification products are analysed by electrophoresis (55 V, 1.5 h) through 1.0-1.5% (wt / vol) agarose containing
Four protocols for the detection and quantification of M.
ethidium bromide. A 486 bp PCR product is produced from
plutonius using PCR have been published to date (Table 2). Two
primers MP1 and MP2. To ensure test specificity; a second
protocols for qualitative PCR; one for detection in diseased larvae
PCR following the same protocol (using primers MP1 and MP3)
(Govan et al., 1998) and a hemi-nested PCR assay (Djordjevic et al.,
is conducted, and a specific 276 bp hemi-nested product is
1998).The latter method was further developed for the detection of
amplified from the 486 bp template.
M. plutonius in larvae, adult bees, honey and pollen (McKee et al., 2003; see section 8.3.1). The results obtained indicate: 1. that the
8.3.2. Quantitative PCR, qPCR
PCR assay is far more sensitive than culture; 2. that not all the M.
Procedure (after Budge et al., 2010):
plutonius detected is viable or amenable to culturing; and 3. that
1. Genomic DNA is amplified in a 25 µl reaction comprising:
honey samples may be a useful tool for detecting sources of M.
1 x buffer A (Applied Biosystems),
plutonius.
0.025 U/μl AmpliTaq Gold,
Real-time PCR assays for the quantification (qPCR) of M.
plutonius (Roetschi et al., 2008; Budge et al., 2010) have been used to analyse pooled samples of brood nest workers from several
0.2 mM each dNTP, 5.5 mM MgCl2,
colonies within an apiary as a suggested alternative to routine visual
300 nM of each primer,
brood control (Roetschi et al., 2008). However, more recent results
100 nM probe,
suggest the amount of M. plutonius in adult bees provides a less
10 μl of nucleic acid extract.
stable estimate of the likelihood of finding disease than using larvae
2. PCR reactions are carried out in duplicate or triplicate wells
(Budge et al., 2011). The qPCR method can also be used to attribute
and plates cycled using generic system conditions:
a risk of EFB infection to collected samples measured as probability of
95ºC for 10 min,
the sample showing clinical symptoms and providing a trigger for later inspection of apiaries at risk (Budge et al., 2010; Grangier, 2010).
40 cycles of 60ºC for 1 min,
This may provide a definitive diagnosis of EFB, based on a
95ºC for 15 sec.
combination of the presence of clinical disease and the confirmed
in a 7900 Sequence Detection System (Applied Biosystems;
presence of M. plutonius. However, in some territories, the costs of
Branchburg, New Jersey, USA) or equivalent with real-time
such preliminary screening using real-time PCR may not be economically viable (Grangier, 2011).
data collection. 3. Quantification of M. plutonius in each sample can be achieved using the standard curve method (Anon, 1997) with assay EFBFor/EFBRev2/EFBProbe (M. plutonius 16S; Budge et al.,
8.3.1. Qualitative PCR
2010; Table 2) as the target and assay AJ307465-
Procedure (after McKee et al., 2003):
955F/1016R/975T (A. mellifera 18S; Budge et al., 2010) as
1. Genomic DNA (5-30 ng) is amplified using a thermal cycler in a 50 µl reaction comprising:
the reference assay. 4. As fluorescence increases in the presence of the target, the
4 mM MgCl2 ,
change in fluorescence (DRn) enters an exponential phase.
200 µM of each deoxyribonucleotide triphosphate,
The quantification cycle (Cq) is defined as midway through
100 ng of primers MP1 and MP2 (Table 2), 5 µl of 10 x PCR buffer (100 mM tris-HCl, pH 8.3; 500 mM KCL),
the exponential phase of this amplification curve (Bustin et al., 2009). It is often required to manually move the threshold of measurement manually to intercept midway through the
The COLOSS BEEBOOK: European foulbrood
11
exponential phase of the amplification curve and obtain an
culture (broth). Dilute the suspension to a dilution factor of 10
appropriate Cq.
-6
5. To account for variation in extraction efficiency between samples, the result can be expressed as a ratio of the number of M. plutonius and A. mellifera cells.
(a million-fold dilution).
2. Spread out aliquots using a sterile bacterial spreader (0.1 ml) of each dilution onto 3 agar plates. 3. Incubate the plates for 4-7 days as previously described in section 5.3.
9. Exposure bioassays using in
vitro rearing of larvae
4. Count the number of bacterial colonies that appear on each of the plates that has between 30 and 200 colonies. Any plate which has more than 200 colonies is designated as
Bioassays can be used to determine the biological activity of a
"too numerous to count”. Plates with fewer than 30 colonies
substance by its effects on a test organism. Differences in virulence of
do not have enough individuals to be statistically acceptable.
a pathogen are best analysed in exposure bioassays, and such
5. To compute the estimated number of bacteria on the surface
methods involving in vitro rearing of honey bee larvae (see the in vitro
that you tested, use the following formula: B = N/d
rearing paper of the BEEBOOK (Crailsheim et al., 2013)) have been
where: B = number
of bacteria; N = average number of
used for both Paenibacillus larvae and M. plutonius (McKee et al., 2004; colonies counted on three plates; d = dilution factor. Genersch et al., 2005; Giersch et al., 2009). Virulence tests using this
Example: Plate 1: 56 CFU; Plate 2: 75 CFU; Plate 3: 63 CFU; Average
technique show that M. plutonius strains collected in different
(N) = 64.7; Dilution (d ) = 1/1,000; B = (64.7 x 1,000) = 64,700
geographic places in Europe present important variations in the
bacteria in 0.1 ml, 647,000 bacteria per ml.
mortality rate and how fast the larvae die (Charrière et al., 2011). Three common measurement results can be obtained from
9.1.2. Total or microscopic count
exposure bioassays: the dose (LD50) or concentration (LC50) of the
A direct microscopic or total count is the enumeration of bacteria
pathogen it takes to kill 50% of the hosts tested, and the time (LT50)
found within a demarcated region of a slide, a counting chamber. The
required for killing 50% of infected individuals. For the purpose of
slide is placed under a microscope, preferably with phase contrast.
determining the LD50 or LC50, a reliable estimation of the concentration For counting bacteria, an oil immersion lens is usually required (1000 of bacterial cells used in the exposure bioassay is crucial.
x magnification). For the procedure description refer to the section on hemocytometer counting in the miscellaneous methods paper of the
9.1. Estimating the concentration of bacteria
BEEBOOK (Human et al., 2013).
The plate (viable) count method is an indirect measurement of bacterial cell density as it only detects live (or cultivable) bacteria
9.2. Protocol for inducing EFB infection in honey
whereas the microscopic (total) count includes all bacterial cells,
bee larvae reared in vitro
cultivable or not (see the miscellaneous methods paper of the
A protocol for inducing EFB involves grafting an individual larva (less
BEEBOOK (Human et al., 2013)).
than 24 hours old) into a single well in a micro-titer plate (for detailed protocols see the in vitro rearing paper of the BEEBOOK (Crailsheim
9.1.1. Plate count
et al., 2013)). Older larvae may also become infected but are less
The plate count method means diluting bacteria with a diluent
susceptible. Each larva is fed 10 µl of larval diet (Crailsheim et al., 2013)
solution (e.g. sterile saline) until the bacteria are dilute enough to
containing a defined number of M. plutonius cells (e.g. 500,000; see
count accurately when spread on a plate. The assumption is that
section 9.1.2). From 72 hours post grafting, the larvae are examined
each viable bacterial cell will develop into a single colony. Bacterial
for mortality and fed uninfected feed daily, following the feeding
cell numbers need to be reduced by dilution, because more than 200
regime recommended in Crailsheim et al. (2012). The mortality of the
colonies on a standard 9 cm plate are likely to produce colonies too
larvae can be evaluated using a microscope or by eye. Dead larvae
close to each other to be distinguished as distinct colony-forming
are distinguished by the lack of respiration and loss of body elasticity.
units (CFUs). The materials needed to perform a plate count are:
The ability of M. plutonius to produce symptoms in the absence of secondary bacteria such as P. alvei seems to differ regionally. In
Sterile 0.9% NaCl (sterile saline)
Australia, feeding only M. plutonius has been demonstrated not to
Sterile tubes, tips and spreaders
produce the typical clinical signs of EFB, but in Europe, M. plutonius
Agar plates (three per sample) Procedure: 1. Make a ten-fold dilution serial dilution of your bacterial
was capable of inducing significant mortality in isolation (Charrière
et al., 2011). When infecting with M. plutonius in combination with P. alvei, the larval colour changes to a greyish brown rather than a yellowish colour and the gut content of infected larvae turns watery
Forsgren et al.
12
rather than pasty. Infecting larvae with M. plutonius and subsequently et al., 2013; Evans et al., 2013)) could be adapted to M. plutonius and feeding P. alvei (e.g. 60,000 spores in 10 Âľl larval diet) after 72 hours
EFB research. Moreover, new technologies may also be useful tools to
may produce signs typical of that seen in field cases of EFB (Giersch
study interactions between secondary bacteria and the causative
et al., 2010). The simultaneous or 3 days delayed inoculation of
agent and to fully understand their role in symptomatology.
P. alvei has, however, been demonstrated not to influence the
Molecular diagnostic methods such as PCR are also widely
virulence of some European strains of M. plutonius (Charrière et al.,
employed for EFB diagnosis. The PCR method is user-friendly and
2011). The feeding of P. alvei in addition to M. plutonius has no
theoretically, a single target DNA molecule is sufficient for detection,
influence on larval mortality as such, but may be important for the
making it one of the most sensitive biological techniques ever
presence of all the typical EFB-symptoms, and the saprophyte P. alvei
described. Considering this, we might ask whether a positive PCR
is probably important for the presence of some of the clinical
result is always biologically relevant. Low levels of M. plutonius can be
symptoms in the field.
found in apiaries where no symptoms of disease are present and the PCR will also detect non-viable bacterial cells. However, it is clear that
10. Measuring susceptibility / resistance to antibiotics of
Melissococcus plutonius Due to the fastidious culture requirements and slow growing nature of
M. plutonius, measuring antibiotic susceptibility of this organism using traditional techniques such as a disc diffusion assay, which is a test that uses antibiotic - impregnated discs to determine whether particular bacteria are susceptible to specific antibiotics, is not possible. Oxytetracycline hydrochloride (OTC) is the antibiotic of choice for the treatment of EFB. However, only two reports of the sensitivity of
M. plutonius to this antibiotic have been published (Waite et al., 2003; Hornitzky and Smith, 1999) and both these studies indicated that all strains tested were sensitive to OTC. In both studies an agar plate method was used. This involves incorporating antibiotic at decreasing concentrations into culture plates (see section 5) of EFB culture medium, to determine the lowest concentration at which growth
M. plutonius is still below the level of detection in honey bee colonies located in some geographical areas (Budge et al., 2010). Future work should help understand whether this observation is due to the genetics of the honey bees from these areas, unfavourable meteorological conditions, lower apiary density, gut microbiota unfavourable to disease development, or simply down to an absence of movement of the causative organism. Infectivity tests causing disease at the colony level using both cultured M. plutonius and extracts from diseased larvae were carried out during the 1930s (Tarr, 1936) and the 1960s (Bailey, 1960; Bailey, 1963; Bailey and Locher, 1968), but not much has been published since. This is an area of research where new information can be obtained by a combination of colony level infection experiments and modern diagnostic methods. Such advances would benefit from cross country collaborations, where advanced diagnostics from one country may complement field trials in another country where there may be less stringent rules governing EFB control.
would occur. This methodology would be suitable for testing the susceptibility of M. plutonius to other antibiotics.
12. References 11. Conclusions The pathogenic mechanisms of EFB are poorly understood, and the factors and timescales leading to overt symptomatology remain
ANON (2012) User Bulletin #2: ABI PRISM 7700 Sequence Detection, December 11, updated 10/2001:1-36. ARAI, R; TOMINAGA, K; WU, M; OKURA, M; ITO, K; OKAMURA, N;
enigmatic. Molecular tools will open new possibilities for the
ONISHI, H; OSAKI, M; SUGIMURA, Y; YOSHIYAMA, M;
identification of putative virulence factors in both the bacterium as
TAKAMATSU, D (2012) Diversity of Melissococcus plutonius from
well as the host in order to unravel some of the pathogenic
honey bee larvae in Japan and experimental reproduction of
mechanisms. To date, there are no published methods for genotyping
European foulbrood with cultured atypical isolates. PLoS ONE 7
and molecular differentiation of M. plutonius strains, but the nucleotide sequence of the bacterial genome was recently deposited in the DNA Database of Japan under accession no. AP012200 and AP012201 (Okomura et al., 2011), and it is likely that new molecular methods such as genotyping will be developed in the near future.
(3): e33708. http://dx.doi.org/10.1371/journal.pone.0033708 BAILEY, L (1957) The isolation and cultural characteristics of
Streptococcus pluton and further observations on "Bacterium eurydice". Journal of General Microbiology 17(2): 39-48. BAILEY, L (1960) The epizootiology of European foulbrood of the
Moreover, research fields and methods already in use for research on
larval honey bee, Apis mellifera Linneaus. Journal of Insect
P. larvae such as selection of reference genes, quantifying and
Pathology 2: 67-83.
knocking down gene expression (see designated parts in the American BAILEY, L (1963) The pathogenicity for honey bee larvae of foulbrood and molecular protocols papers of the BEEBOOK (deGraaf
microorganisms associated with European foulbrood. Journal of
Insect Pathology 5: 198-205.
The COLOSS BEEBOOK: European foulbrood
BAILEY, L (1983) Melissococcus pluton, the cause of European
13
DE GRAAF, D C; ALIPPI, A M; ANTÚNEZ, K; ARONSTEIN, K A; BUDGE,
foulbrood of honey bees (Apis spp.). Journal of Applied
G; DE KOKER, D; DE SMET, L; DINGMAN, D W; EVANS, J D;
Bacteriology 55(1): 65-69.
FOSTER, L J; FÜNFHAUS, A; GARCIA-GONZALEZ, E; GREGORC, A;
BAILEY, L; COLLINS, M D (1982) Reclassification of 'Streptococcus
HUMAN, H; MURRAY, K D; NGUYEN, B K; POPPINGA, L; SPIVAK,
pluton' (White) in a new genus Melissococcus, as Melissococcus
M; VANENGELSDORP, D; WILKINS, S; GENERSCH, E (2013)
pluton nom. rev.; comb. nov. Journal of Applied Bacteriology 53
Standard methods for American foulbrood research. In V
(2): 215-217.
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
BAILEY, L; GIBBS, A J (1962) Cultural characters of Streptococcus
pluton and its differentiation from associated Enterococci. Journal of General Microbiology 28: 385-391. BAILEY, L; LOCHER, N (1968) Experiments on the etiology of
Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.11 DJORDJEVIC, S P; NOONE, K; SMITH, L; HORNITZKY, M A Z (1998)
European foulbrood of the honey bee. Journal of Apicultural
Development of a hemi-nested PCR assay for the specific detection
Research 7: 103-107.
of Melissococcus pluton. Journal of Apicultural Research 37: 165-174.
BUDGE, G E; JONES, B; POWELL, M; ANDERSON, L; LAURENSSON, L; EVANS, J D; CHEN, Y P; CORNMAN, R S; DE LA RUA, P; FORET, S; PIETRAVALLE, S; MARRIS, G; HAYNES, E; THWAITES, R; BEW, J;
FOSTER, L; GENERSCH, E; GISDER, S; JAROSCH, A; KUCHARSKI, R;
WILKINS, S; BROWN, M A (2011) Recent advances in our
LOPEZ, D; LUN, C M; MORITZ, R F A; MALESZKA, R; MUÑOZ, I;
understanding of European Foulbrood in England and Wales. In
PINTO, M A; SCHWARZ, R S (2013) Standard methodologies for
Proceedings of the COLOSS Workshop; The future of brood
molecular research in Apis mellifera. In V Dietemann; J D Ellis; P
disease research – guidelines, methods and development,
Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
Copenhagen, Denmark, 10-12 April, 2011, p 7.
methods for Apis mellifera research. Journal of Apicultural
BUDGE, G E; BARRETT, B; JONES, B; PIETRAVALLE, S; MARRIS, G; CHANTAWANNAKUL, P; THWAITES, R; HALL, J; CUTHBERTSON,
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.11 FORSGREN, E (2010) European foulbrood in honey bees. Journal of
A G S; BROWN, M A (2010) The occurrence of Melissococcus
Invertebrate Pathology 103(Suppl. 1): S5-S9.
plutonius in healthy colonies of Apis mellifera and the efficacy of
http://dx.doi.org/10.1016/j.jip.2009.06.016
European foulbrood control measures. Journal of Invertebrate
Pathology 105: 164-170. http://dx.doi.org/10.1016/j.jip.2010.06.004 BUSTIN, S A; BENES, V; GARSON, J A; HELLEMANS, J; HUGGETT, J; KUBISTA, M; MUELLER, R; NOLAN, T; PFAFFL, M W; SHIPLEY, G L; VANDESOMPELE, J; WITTWER, C T (2009) The MIQE guidelines:
FORSGEN, E; LUNDHAGEN, A C; IMDORF, A; FRIES, I (2005) Distribution of Melissococcus plutonius in honey bee colonies with and without symptoms of European foulbrood. Microbial Ecology 50: 369-374. http://dx.doi.org/10.1007/s00248-004-0188-2 GENERSCH, E; ASHIRALIEVA, A; FRIES, I (2005) Strain and genotype-
Minimum information for publication of quantitative real-time PCR
specific differences in virulence of Paenibacillus larvae subsp.
experiments. Clinical Chemistry 55: 611-622.
larvae, a bacterial pathogen causing American foulbrood disease
http://dx.doi.org/10.1373/clinchem.2008.112797
in honey bees. Applied and Environmental Microbiology 71: 7551-
CHARRIÈRE, J-D; KILCHENMANN, V; ROETSCHI, A (2011) Virulence
7555. http://dx.doi.org/10.1128/AEM.71.11.7551-7555.2005
of different Melissococcus plutonius strains on larvae tested by an GENERSCH, E; GISDER, S; HEDTKE, K; HUNTER, W B; MÖCKEL, N;
in vitro larval test; In Proceedings of the 42nd International
MÜLLER, U (2013) Standard methods for cell cultures in Apis
Apicultural Congress, Buenos Aires 2011: p 158.
mellifera research. InV Dietemann; J D Ellis; P Neumann (Eds)
CRAILSHEIM, K; BRODSCHNEIDER, R; AUPINEL, P; BEHRENS, D;
The COLOSS BEEBOOK, Volume I: standard methods for Apis
GENERSCH, E; VOLLMANN, J; RIESSBERGER-GALLÉ, U (2013)
mellifera research. Journal of Apicultural Research 52(1):
Standard methods for artificial rearing of Apis mellifera larvae. In
http://dx.doi.org/10.3896/IBRA.1.52.1.02
V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, GOVAN, V A; BROZEL, V; ALLSOPP, M H; DAVIDSON, S (1998) A PCR Volume I: standard methods for Apis mellifera research. Journal
detection method for rapid identification of Melissococcus pluton
of Apicultural Research 52(1):
in honey bee larvae Applied and Environmental Microbiology 64
http://dx.doi.org/10.3896/IBRA.1.52.1.05
(5): 1983-1985.
DAHLE, B; SØRUM, H; WEIDEMANN, J E (2011) European foulbrood
GRANGIER, V (2011) Early detection of European foulbrood using
in Norway: How to deal with a major outbreak after 30 years
real-time PCR. PhD thesis, Vetsuisse faculty, University of Bern,
absence. In Proceedings of the COLOSS Workshop: The future of
Switzerland.
brood disease research – guidelines, methods and development, Copenhagen, Denmark, 10-12 April, 2011, p 8.
HORNITZKY, M A Z; SMITH, L (1999) The sensitivity of Australian
Melissococcus pluton isolates to oxytetracycline hydrochloride. Australian Journal of Experimental Agriculture 39(7): 881-883.
Forsgren et al.
14
HORNITZKY, M A Z; WILSON; S (1989) A system for the diagnosis of
PINNOCK, D E; FEATHERSTONE, N E (1984) Detection and
the major bacterial brood diseases. Journal of Apicultural
quantification of Melissococcus pluton infection in honey bee
Research 28: 191-195.
colonies by means of enzyme-linked immunosorbent assay.
HUMAN, H; BRODSCHNEIDER, R; DIETEMANN, V; DIVELY, G; ELLIS, J; FORSGREN, E; FRIES, I; HATJINA, F; HU, F-L; JAFFÉ, R;
Journal of Apicultural Research 23: 168-170. ROETSCHI, A; BERTHOUD, H; KUHN, R; IMDORF, A (2008) Infection
KÖHLER, A; PIRK, C W W; ROSE, R; STRAUSS, U; TANNER, G;
rate based on quantitative real-time PCR of Melissococcus
TARPY, D R; VAN DER STEEN, J J M; VEJSNÆS, F; WILLIAMS, G
plutonius, the causal agent of European foulbrood, in honey bee
R; ZHENG, H-Q (2013) Miscellaneous standard methods for Apis
colonies before and after apiary sanitation. Apidologie 39: 362-371.
mellifera research. In V Dietemann; J D Ellis; P Neumann (Eds)
http://dx.doi.org/10.1051/apido: 200819
The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.10 McKEE, B A; DJORDJEVIC, S P; GOODMAN, R D; HORNITZKY, M A Z
TARR, H L A (1936) Studies on European foulbrood of bees II. The production of the disease experimentally. Annals of Applied
Biology 23: 558-584. TOMKIES, V; FLINT, J; JOHNSSON, G; WAITE, R; WILKINS, S;
(2003) The detection of Melissococcus pluton in honey bees (Apis
DANKS, C; WATKINS, M; CUTHBERTSON, A G S; CARPANA, E;
mellifera) and their products using a hemi-nested PCR. Apidologie
MARRIS, G; BUDGE, G; BROWN, M A (2009) Development and
34: 19-27. http://dx.doi.org/10.1051/apido: 2002047
validation of a novel field test kit for European foulbrood.
McKEE, B A; GOODMAN, R D; HORNITZKY, M A Z (2004) The transmission of European foulbrood (Melissococcus plutonius) to
Apidologie 40(1): 63-72. http://dx.doi.org/10.1051/apido:2008060 WAITE, R; JACKSON, S; THOMPSON, H (2003) Preliminary
artificially reared honey bee larvae (Apis mellifera). Journal of
investigations into possible resistance to oxytetracycline in
Apicultural Research 43: 93-100.
Melissococcus plutonius, a pathogen of honey bee larvae. Letters
OIE (2008) Chapter 9.3. European foulbrood of the honey bees. In
OIE Manual of diagnostic tests and vaccines for terrestrial animals (mammals, birds and bees) (6th Ed.), Vol. 1. OIE; Paris, France. pp 405-409. OIE (2011) Chapter 9.3. European foulbrood. In OIE Terrestrial
animal health code, vol. 2 (20th Ed.). OIE; France. pp 507-508. OKOMURA, K; ARAI, R; OKURA, T; TAKAMATSU, D; OSAKI, M; MIYOSHI-AKIYAMA, T (2011) Complete genome sequence of
Melissococcus plutonius ATCC 35311. Journal of Bacteriology 193: 4029-4030. http://dx.doi.org/10.1128/JB.05151-11
in Applied Microbiology 36: 20-24. http://dx.doi.org/10.1046/j.1472-765X.2003.01254.x WILKINS, S; BROWN, M A, CUTHBERTSON, A G S (2007) The incidence of honey bee pests and diseases in England and Wales.
Pest Management Science 63: 1062-1068. http://dx.doi.org/10.1002/ps.1461
Journal of Apicultural Research 52(1): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.1.13
REVIEW ARTICLE
Standard methods for fungal brood disease research
Annette Bruun Jensen1*, Kathrine Aronstein2, José Manuel Flores3, Svjetlana Vojvodic4, María Alejandra Palacio5 and Marla Spivak6 1
Department of Plant and Environmental Sciences, University of Copenhagen, Thorvaldsensvej 40, 1817 Frederiksberg C, Denmark. Honey Bee Research Unit, USDA-ARS, 2413 E. Hwy. 83, Weslaco, TX 78596, USA. 3 Department of Zoology, University of Córdoba, Campus Universitario de Rabanales (Ed. C-1), 14071, Córdoba, Spain. 4 Center for Insect Science, University of Arizona, 1041 E. Lowell Street, PO Box 210106, Tucson, AZ 85721-0106, USA. 5 Unidad Integrada INTA – Facultad de Ciencias Ags, Universidad Nacional de Mar del Plata, CC 276,7600 Balcarce, Argentina. 6 Department of Entomology, University of Minnesota, St. Paul, Minnesota 55108, USA. 2
Received 1 May 2012, accepted subject to revision 17 July 2012, accepted for publication 12 September 2012. *Corresponding author: Email: abj@life.ku.dk
Summary Chalkbrood and stonebrood are two fungal diseases associated with honey bee brood. Chalkbrood, caused by Ascosphaera apis, is a common and widespread disease that can result in severe reduction of emerging worker bees and thus overall colony productivity. Stonebrood is caused by Aspergillus spp. that are rarely observed, so the impact on colony health is not very well understood. A major concern with the presence of
Aspergillus in honey bees is the production of airborne conidia, which can lead to allergic bronchopulmonary aspergillosis, pulmonary aspergilloma, or even invasive aspergillosis in lung tissues upon inhalation by humans. In the current chapter we describe the honey bee disease symptoms of these fungal pathogens. In addition, we provide research methodologies and protocols for isolating and culturing, in vivo and in vitro assays that are commonly used to study these host pathogen interactions. We give guidelines on the preferred methods used in current research and the application of molecular techniques. We have added photographs, drawings and illustrations to assist bee-extension personnel and bee scientists in the control of these two diseases.
Métodos estándar para la investigación de enfermedades fúngicas de la cría Resumen La ascosferiosis (o cría yesificada) y cría de piedra son dos enfermedades fúngicas asociadas con la cría de la abeja melífera. La ascosferiosis, causada por el hongo Ascosphaera apis, es una enfermedad común de amplia distribución que puede resultar en una severa disminución en el número de obreras emergentes y por lo tanto afecta la productividad de la colonia. La cría de piedra es causada por
Aspergillus spp. los cuales son raramente observados y su impacto en la salud de la colonia no está esclarecido. El mayor problema con la presencia de Aspergillus en abejas es la producción de conidios aéreos, que pueden llevar a aspergillosis broncopulmonares alérgicas, aspergilomas pulmonares o aun aspergilosis invasivas en tejidos pulmonares en humanos luego de inhalarlos. En este capítulo describimos los síntomas de las enfermedades producidas por estos patógenos fúngicos. Además proveemos metodologías de investigación y protocolos para su aislamiento y cultivo, ensayos in vivo e in vitro que son comúnmente usados para estudiar las interacciones de estos patógenos con su hospedero. Damos una guía sobre los métodos preferidos utilizados en la investigación actual y la aplicación de técnicas de moleculares. Hemos añadido fotografías, dibujos e ilustraciones para ayudar al personal.
Footnote: Please cite this paper as: JENSEN, A B; ARONSTEIN, K; FLORES, J M; VOJVODIC, S; PALACIO, M A; SPIVAK, M (2012) Standard methods for fungal brood disease research. In V Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.13
Jensen et al.
2
幼虫真菌病研究的标准方法 白垩病和曲霉病是蜜蜂幼虫相关的真菌病,白垩病由蜜蜂球囊菌Ascosphaera apis引起,分布较广,可造成工蜂羽化数量和蜂群生产力的急剧下 降。蜜蜂曲霉病由Aspergillus spp.引起,由于较少观察到,所以其对蜂群健康状况的影响研究的不够深入。蜜蜂中Aspergillus引起之所以引起关 注,是因为风媒分生孢子,这种孢子可通过吸入引起人肺组织的多种疾病,如过敏性支气管曲菌病,肺曲菌球病,甚至侵袭性曲霉病。本章我们 描述了这些真菌病原体的在蜂群中的疾病症状。此外,还提供了开展寄主/病原体相互作用研究中常用的病原菌分离及培养技术、体内和体外测 定技术。并给出了最新研究中用到的首选方法以及分子技术应用方面的指导方针。增加了照片、插图和注释以帮助推广人员和研究者控制这两种 疾病。
Keywords: Ascosphaera, Ascosphaerales, Aspergillus, chalkbrood, diagnostics, methods, recommendations, stonebrood, COLOSS, BEEBOOK, honey bee
Introduction
productivity by lowering the number of newly emerged bees, and in
Insect pathogenic fungi can be found throughout the fungal kingdom
honey bee brood in most regions of the world, including warm and
(Humber, 2008), all being capable of invading their hosts and
dry climates. Clinical symptoms of chalkbrood often appear for only a
overcoming their immune systems. Two fungal genera (Ascosphaera
short time, typically under cold and damp weather conditions
and Aspergillus) are known to infect honey bee brood, causing
(Aronstein and Murray, 2010).
chalkbrood and stonebrood diseases. Both are ascomycetes within the
some cases may lead to colony losses. The disease is found infecting
The genus Ascosphaera spp. comprises species that are adapted
Eurotiomycetes. The fungus causing chalkbrood in honey bees has a
to eusocial and solitary bees and their habitats. Some of the species
narrow host range and a unique infection route, it relies solely on
are saprophytic, growing on nest materials, such as stored food,
sexual reproduction and has many host-specific adaptations. Therefore faecal matter, and nest debris; others have evolved as opportunistic many methods known from common insect pathogenic fungi are not
and / or obligate bee pathogens (Bissett, 1988). In honey bees
easily adopted to study chalkbrood.
Ascosphaera major and Arrhenosphaera cranae (both belonging to
In contrast, the fungi causing stonebrood are facultative pathogens Ascospheraceae) have been reported only a few times from with a broad host range, they produce asexual conidia and their
chalkbrood infected colonies, but Koch’s Postulates have never been
infection biology resemble many well-known insect pathogenic fungi,
demonstrated for them, so they might be secondary invaders.
like Beauveria and Metarhizium; so several standard insect pathological
Ascosphaera apis primarily infects honey bee brood by entering
methods can be directly transferred to this system. In the current
the host through the gut lining. In an infected larva, hyphae penetrate
chapter, we compile, discuss and provide detailed protocols for
the gut wall, and mycelium develops inside the body cavity. After a
various methods to assist beekeepers and bee scientists entering this
few days, mycelium breaks out of the posterior end of the larva
area of research.
leaving the head unaffected (Maurizio, 1934). Fruiting bodies with the
In addition to fungal pathogens causing chalkbrood and stonebrood, new ascospores are formed on aerial hyphae outside the dead larvae. two species of microsporidia, Nosema apis and Nosema ceranae, are
The ascospores are a result of sexual reproduction of fungal mycelia
known to infect adult honey bees. Although recently suggested to be
with the opposite sex, unlike most other insect pathogenic fungi
fungi at the very base of the fungal tree (James et al., 2006), these
where asexually conidia are the infective units, as e.g. seen in
intracellular pathogens have a very different biology and are
Aspergillus. Ascospores of A. apis (hereafter referred to as spores) are
considered in a separate paper in the BEEBOOK (Fries et al., 2013).
believed to be adapted to the harsh gut environment of the host.
Ascosphaera apis infect the host larvae if ingested, unlike other insect pathogenic fungi which mainly infect through the external cuticle.
1. Chalkbrood
Spores of A. apis can stay dormant and viable for years, but upon
1.1. introduction
swelling and subsequently germ tube formation that extends to form
Chalkbrood, the most common fungal bee brood disease, is caused
hyphae (Bamford and Heath, 1989). Presumably, CO2 produced by
exposure to CO2 the spores becomes activated, resulting in spore
primarily by the fungus Ascosphaera apis (Maassen ex Claussen) Olive the larval tissues accumulates in the closed hindgut of the larvae and Spiltoir (Spiltoir, 1955). It was recognized in the honey bee in the
aiding in spore germination (Heath and Gaze, 1987). However
early 20th Century (Maassen, 1913). The field diagnosis of chalkbrood additional factors that may be involved in spore germination within is based on visual detection of diseased, mummified brood, commonly the host still remain to be discovered. In addition, it has been shown known as “chalkbrood mummies”. Chalkbrood can reduce colony
that chilling of the brood below the optimal rearing temperature
The COLOSS BEEBOOK: fungal brood diseases
3
increases the number of diseased larvae (Vojvodic et al., 2011a; Flores et al., 1996a). All these specific adaptations have to be taken into account when working with A. apis, and specific protocols have been developed.
1.2. Diagnostics and qualitative detection 1.2.1 Morphological description
1.2.1.1. Macroscopic diagnosis The typical symptoms observed in a colony affected by chalkbrood are irregular wax cappings over the brood and uncapped cells scattered over the brood frames (Fig. 1). The cell capping may also have small holes or appear slightly flattened. Chalkbrood mummies can often be
Fig. 2. Dark and white chalkbrood mummies. The black mummies
seen in the combs, at the hive entrance or found on the bottom board contain millions of new infective spores.
Photo: A B Jensen
(Fig. 2). Observation of combs may reveal different stages of the disease; fresh larval cadavers covered with white cotton-like mycelium 1988). As mentioned above, this is a heterothallic fungus with two and desiccated mummies that appear as white, dark or a combination
mating types and only when + and - strains are grown in close
of white and dark solid clumps. White desiccated mummies look like
proximity does the formation of fruiting bodies occur. The fruiting
small pieces of chalk giving rise to the name of the disease and dark
bodies are spherical spore cysts (47 – 140 µm in diameter; Fig. 3a)
mummies are coloured by fungal fruiting bodies.
which contain numerous spore balls (9-19 µm, Fig. 3b) composed of
Diagnosis in the field is generally based on the presences of chalkbrood mummies (as described above). Following field diagnosis,
hyaline spores (2.7 – 3.5 x 1.4 – 1.8 µm, Fig. 3c) (Skou, 1972; Bissett, 1988).
a microscopic examination is usually required to confirm the presence of spore cysts in the samples using the microscope slide smear
1.2.1.3. Biological diagnosis
technique. The spores can be mounted on a microscope slide with a
Identification of the vegetative stages of the fungus can be done by a
drop of distilled water and observed at 100-400 x magnification.
mating test with two reference strains (AFSEF 7405 and ARSEF 7406). Production of spore cysts with one of the reference strains would prove the identify of A. apis mating. The mating test is described under paragraph 1.4.1.4. Production and quality of inoculums.
1.2.2. Molecular methods The Polymerase Chain Reaction (PCR) has increasingly been used for detection of microorganisms. The internal transcribed spacer (ITS) region of the nuclear ribosomal repeat unit is the locus most often used for molecular identification of fungal species (Nilsson et al., 2008) and it is now accepted as the general fungal barcode marker (Schoch
et al., 2012). Almost no variation between A. apis strain was detected in the ITS region (Anderson et al., 1998; Jensen et al., 2012) and several A. apis species specific primers have been designed targeting Fig. 1. A brood frame from a honey bee colony with clinical symptoms the ITS (Table 1). Irrespective of which primers are used, the of chalkbrood and a close up insert of fresh mummies. In many cells
presence of a band from PCR amplification indicates the presence of
chalkbrood mummies have been partly removed by the worker bees.
A. apis DNA.
Photo: F Padilla, J M Flores and A B Jensen
DNA can be extracted with standard kits like DNeasy® Plant Mini Kit (Qiagen), Ultra Clean plant DNA isolation kits (Mo Bio Laboratories)
1.2.1.2. Microscopic diagnosis
or PrepMan Ultra reagent (Applied Biosystems) using the
Ascosphaera apis has septate hyphae (2.5 – 8.0 µm in diameter)
manufacturers’ protocols (for other protocols of DNA extractions
which show pronounced dichotomous branching (Spiltoir, 1955; Skou,
consult the BEEBOOK paper on molecular methods (Evans et al., 2013)
Jensen et al.
4
A
B
C
Fig. 3. Scanning electron microscope pictures of Ascosphaera apis fruiting body. A. Spherical fruiting body; B. Cracked fruiting body with sporeballs; C. Sporeballs with multiple ascospores.
Photos: J Bresciani and A B Jensen
1.2.2.1 PCR for species identification
1.3. Quantitative detection
Genomic DNA can be amplified in a 25 µl reaction containing:
1.3.1. Quantify the level of fungal infection in bee colonies
1. 2.5 μl Taq polymerase buffer (100 mM tris-HCl, pH 8.3; 500 mM KCL)
Different methods have been used to assess the level of chalkbrood infection in the honey bee hive, but none of the methods are
2. 2 U of Taq DNA polymerase
completely reliable. The most direct method is to remove brood
3. 1.5-2.5 mM MgCl2
combs from the hives and count the number of mummies inside
4. 250 µM of each deoxyribonucleotide triphosphate
capped and uncapped cells. These values can be added to the number
5. 0.25 μM of an forward and reverse primer (Table 1)
of mummies found on the bottom board of the hive. It is however
6. 1 µl of DNA
important to add an entrance hive trap like a pollen trap (see the
BEEBOOK paper on miscellaneous methods (Human et al., 2013) or a Reaction conditions are as follows:
screened bottom board (Flores, unpublished data), to hinder the bees
1. initial denaturing for 10 min at 94°C
from removing mummies from the hive.
2. 30 cycles of 45 s denaturing at 94°C
Assessing chalkbrood infection by counting mummies has
3. 45 s annealing at 62-65°C
important drawbacks: it does not include the number of mummies
4. 1 min extension at 72°C
inside capped cells, unless all capped cells are opened and inspected;
5. final extension for 5 min at 72°C.
and it does not include the mummies that are removed from the hive
Results are visualised using Gel Doc (BioRad) or any other DNA
in small pieces by worker bees which are thus not collected by the
imaging systems. We would recommend that the primer pair 3-F1 and entrance traps. Furthermore, these counting methods are heavily 3-R1 (Table 1) (James and Skinner, 2005) be used as a standard for
influenced by environmental conditions. High nectar flow induces
identification of A. apis. Both primers are A. apis specific as opposed
higher removal of mummies (Thompson, 1964; Momot and
to the primer pair in Murray et al. (2005). Furthermore, 3-F1/3-R1
Rothenbuhler, 1971) and during a nectar flow more mummies may be
amplifies a longer PCR product that could be very useful for sequencing recovered in the traps, leading to possible error in the estimation of efforts (James and Skinner, 2005). The PCR protocol described above can be optimised depending on the type of equipment and reagents used in the laboratory. We would recommend sequencing the PCR
disease prevalence. For the above reasons, we propose that the level of colony infection be evaluated by chilling the brood to 25ºC (Flores et al.,
product as a quality control, the first time the protocol is implemented 1996a). The number of mummified larvae after chilling allows for an in a new laboratory (for more information on sequencing consult the
assessment of the degree of potential infection in bee colonies. This
BEEBOOK paper on molecular methods (Evans et al., 2013).
method has also been used to compare the degree of infection among
Table 1. List of Ascosphaera apis specific primers. * Primer pair recommended to be used as standard. Annealing temp. (°C)
Primer sequence
Citation
3-F1*
62
TGTCTGTGCGGCTAGGTG
James and Skinner, 2005
3-F2
62
GGGTTCTCGCGAGCCTG
James and Skinner, 2005
3-R1*
62
CCACTAGAAGTAAATGATGGTTAGA
James and Skinner, 2005
AscoF3
64
GCACTCCCACCCTTGTCTA
Murray et al., 2005
AapisR3
64
CCCACTAGAAGTAAATGATGGTTA
Murray et al., 2005
Primer name
The COLOSS BEEBOOK: fungal brood diseases
5
colonies before and after a treatment or as a routine colony inspection
4.0 g peptone
(Flores et al., 2001; 2004a). To minimize the effects of brood removal
3.0 g yeast extract
by workers, it is important to place the brood comb in an incubator,
200.0 g glucose
as described in paragraph 1.3.1.1.
20.0 g agar
2. Adjust the final volume to 1000 ml.
1.3.1.1. Procedure for quantifying the level of colony infection:
3. Autoclave at 115°C for 15 minutes.
th
1. Remove one brood comb from the hive containing 5 instar larvae that have not yet been sealed (i.e., the larvae are close 1.4.1.2. Isolation of A. apis strains to being capped with wax) 2. Mark on a plastic transparency the area with these unsealed
Ascosphaera apis can be isolated from fresh mummies or dry mummies collected directly from brood frames or mummies from the bottom
larvae (this step is only important if the frame also contains
board or hive entrance. Both white and dark mummies can be used,
capped brood)
but it is generally easier with white mummies, since the latter will
3. Return the brood comb to the colony
often readily produce spore cysts following incubation when
4. Remove the brood comb from the hive a maximum of 20 hours + and - strains come into contact. later 5. Cut a piece of comb containing at least 100 recently capped cells (capped within the last 20 hours). These larvae can be
1. Surface sterilize the mummy in 10% sodium hypochlorite for 10 min
identified using the plastic transparency. (It is best to remove
2. Rinse the mummy twice in sterile distilled water for 2 min
unsealed brood from the comb before placed in the incubator)
3. Cut the mummy into smaller pieces, place the pieces on an
6. Place one or more pieces of comb with capped cells in an
agar plate (SDA, PDA,YGPSA or MY20)
incubator at 25ºC at approximately 65% humidity for 5 days.
4. Incubate the plate in dark at 30-34°C
The chilling will ensure disease development. An open water
5. Hyphal growth is visible usually within 2–4 days
bottle placed in the incubator will provide sufficient humidity
Addition of antibacterial compounds (e.g. chloramphenicol,
7. After 5 days, open all capped cells and record the results
cycloheximide, streptomycin or dodine) in the media can be
8. Repeat the experiment three times to obtain individuals from
advantageous to prevent bacterial growth. Ascosphaera apis growth
enough patrilines and cover the variation in individual
will often be inhibited, but once transferred back to non-antibiotic
susceptibility to the fungus.
media it can be quickly recovered.
1.3.2. Molecular methods qPCR
1.4.1.3. Hyphal tip isolation of A. apis strains
In recent years, real-time PCR (RT-PCR) has been used to identify and A single honey bee larva can ingest a large number of fungal spores, quantify viral, bacterial and microsporidial pathogens in the honey bee thus to ensure that the isolate is composed of a single strain, hyphal (see the BEEBOOK papers on nosema (Fries et al., 2013), European foulbrood (Forsgren et al., 2013), viruses (de Miranda et al., 2013) and molecular methods (Evans et al., 2013)). There are, however, no
tip isolation is preferred (Fig. 4). 1. Place a dissecting microscope in a sterile hood and wipe with 70% ethanol
methods yet available to quantify A. apis spores or the A. apis hyphal
2. Use a fresh A. apis isolate (approx. 4 cm in diameter)
biomass.
3. Find a single hypha at the edge of the culture under the microscope, and cut a hyphal tip just before the last
1.4. Production and quality of inoculums
branching point using a scalpel and a minutien pin
1.4.1. Isolation techniques
4. Transfer the tip to a new culture plate
1.4.1.1. Growth media
5. Incubate the plate in darkness at 30-34°C
In culture, A. apis isolates can grow on many different media such as potato-dextrose agar (PDA), yeast-glucose-starch agar (YGPSA), and
1.4.1.4. Mating test
Sabouraud dextrose agar) (Bailey, 1981; Heath, 1982; Anderson and
Once a single isolate is obtained, the mating type can be determined
Gibson, 1998; Hornitzky, 2001), but they grow very well on media
using a sexual compatibility test. We recommend that the two
with high sugar content like MY-20 (Udagawa and Horie, 1974).
reference strains (AFSEF 7405 and ARSEF 7406) be used in the mating tests.
MY-20: 1. Dissolve the following components in approximately 750 ml deionised water:
1. Cut agar plugs from the border of well growing isolates
Jensen et al.
6
10% sodium hypochlorite 10 min
Sterile Water 2 min
Sterile Water 2 min
Cut the mummy into pieces Incubate at 34ºC
Mycelium after 2-4 days
Cut a hyphal tip after a dichotomous branch
Transfer to a new plate and incubate at 34ºC
Fig. 4. Hyphal tip isolation of Ascosphaera apis.
2. Place the plugs of the new isolate between agar plugs of the two reference strains with a distance of approximately 4 cm
(Table 2). The advantages of DNA sequences of polymorphic loci with specific primers over the PCR fingerprinting and microsatellite markers
3. Incubate the plate in darkness at 30-34°C
is that the sequences produced in one study can easily be compared
4. After 5-7 days the presence of dark spore cysts (Fig. 5)
with those in another study.
normally can be observed as a black zone where hyphae of two strains with opposite mating types meet, indicating
1.4.2.1. PCR
successful reproduction
Genomic DNA can be amplified in a 50 µl reaction containing:
5. If the test isolates are sexually compatible with the reference + strain, the other is the – mating type, or vice versa On a standard agar plate (diameter 9 cm) 4 new isolates can be tested simultaneously (Fig. 5).
1. 10 μl of 5x HF buffer (1.5 mM MgCL2) 2. 1 U of Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Inc) 3. 200 µM of each deoxyribonucleotide triphosphate 4. 1 μM forward and reverse primer (Table 2)
1.4.2. PCR for strain differentiation
5. 1 µl of DNA
Genetic variation is crucial for strain differentiation, and the arms race in host-pathogen relationships has been recorded with genetically
Reaction conditions:
different A. apis strains (Vojvodic et al., 2011b). The PCR
1. initial denaturing for 30 s
fingerprinting method, using BOX, REP, and ERIC as random primers
2. denaturing at 98°C
(Reynaldi et al., 2003), has been used to identify A. apis isolates, and
3. 10 touchdown cycles: 98°C for 30 s, 70-60°C (decrease of 1°
microsatellite markers have been developed (Rehner and Evans, 2009).
C per cycle) for 30 s, and 72°C for 30 s,
Recently several sequences of intergenetic regions or introns were
4. 30 cycles of 98°C for 30 s, 60°C for 30 s, and 7 °C for 30 s;
screened. Three loci were found to be highly variable and can be used
5. 10 min extension at 72°C.
in identifying and differentiating A. apis strains (Jensen et al., 2012)
The COLOSS BEEBOOK: fungal brood diseases
7
Table 2. List of qRT-PCR primers developed for targeting A. apis transcripts. The first three primer sets target genes that are involved in fungal mating and reproduction. Actin can be used as a reference gene. Primer name Mat1-2-1 F Mat1-2-1 R Ste11-like F Ste11-like R Htf F Htf R Actin_Aapis F Actin_Aapis R
Annealing temp. (°C) 62 62 62 62 62 62 58 58
Primer sequence
Citation
AAAATACCAAGGCCACCGA GGAGCATATTGGTAATTTGG GGGAAGATTGCCAGGCC CAAACTTGTAGTCCGGATG AAAATCCCAAGGCCTCGTA CTGGTAGCGGTAGTCAGG CATGATTGGTATGGGTCAG CGTTGAAGGTCTCGAAGAC
Aronstein et al., 2007 Aronstein et al., 2007 Aronstein et al., 2007 Aronstein et al., 2007 Aronstein et al., 2007 Aronstein et al., 2007 Aronstein et al., 2007 Aronstein et al., 2007
Amplified products can be analysed on a 1.5% (wt/vol) agarose gel
cryopreservation (Jensen et al., 2009a) and propagation on Integral
stained with ethidium bromide or EZ-vision dye. Alternatively, PCR
Rice Kernels (IRK) (Palacio et al., 2007). Contamination during
results could be visualised using DNA imaging. Sharp bands can be
storage seems to be less risky during cryopreservation at -80°C,
sequenced directly (further advice on sequencing and analyses can be however for larger quantities and for laboratories not equipped with found in the BEEBOOK paper on molecular methods (Evans et al., 2013). cryopreservation capacity, the use of rice kernels is a great alterative. Note: Alternatively another polymerase can be used and the touch down step can be replaced by adding five normal cycles; however, it will require some optimization.
1.4.3.1. Cryopreservation in glycerol at -80°C 1. Cut three plugs from the border of a growing agar colony and put the plugs in a cryogenic vial containing 1 ml 10% sterile
1.4.3. Preservation of in vitro cultures An A. apis isolate starts to show signs of aging after 30 days of
glycerol 2. Place the vials in a Cryo 1°C Freezing container, “Mr. Frosty”
growth (Ruffinengo et al., 2000) and thus requires monthly transfer.
(Nalgene Co; Rochester, NY). Mr. “Frosty” ensures a 1°C /min
However, frequent culture transfers are expensive, time consuming
cooling rate
and increase the risk of contamination. In addition, A. apis isolates, as seen for many other microbes, can lose virulence when kept in culture
3. Set the “Mr. Frosty” at 5°C for 4 hours and then in -80°C for 24 hours
with repeated transfers, thus it is important to utilize a long term
4. After 24 hours transfer the vials to standard freezer boxes
storage method soon after an isolate is obtained. Two different
5. Store at -80°C until use
culture preservation methods have been successfully used:
6. Upon use, thaw the vial in a 34°C water bath and place the hyphal plugs on new agar plates
B Fig. 5. Ascosphaera apis mating test and production of inoculums. A. Mating test with four isolates of unknown mating types. Unknown 1 mates with ARSEF 7405 (+) and therefore harbours the opposite mating type (-). B. Production of inoculums between two isolates of opposite mating types. Fruiting bodies with spores inside are formed where the hyphae meet (black zone).
Photo: A B Jensen
Jensen et al.
8
1.4.3.2. Integral Rice Kernels (IRK) storage 1. Autoclave (1 atmosphere and 120°C for 15 min) 25 g moistened IRK (2:1 wt/vol) in Petri dishes (9-cm diameter) 2. Inoculate the IRK with 4-mm diameter plugs from the border of a growing agar colony
7. Add 50 µl sterile water and grind again 1 min 8. Add 200 µl sterile water to the mortar 9. Pipette spores from the mortar into an 1.5 ml Eppendorf tube 10. Add additional 750 µl water to get a medium density of spores 11. Let large particles, unbroken sporocysts, spore clumps etc. in
3. Incubate at 30°C for 15 days
the suspension settle for 30 min
4. Store the IRK at 19°C until use
12. Pipette, from just below the surface, approximately 500 µl into a new tube, which should contain mostly released
1.4.4. Spore production
individual spores
Ascosphaera apis spores are the only infective units of chalkbrood. It
13.Prepare a dilution series to 10-2 or 10-3 for counting and
is essential to have a high quantity and quality of spores for
calculating the concentration of the undiluted suspension with
experiments; e.g. for testing antifungal compounds or for breeding
a haemocytometer (refer to the BEEBOOK paper on
experiments. Spores can be retrieved from black mummies or
miscellaneous methods (Human et al., 2013).
produced in vitro. From a standardization point of view, the use of in
vitro spores from reference strains are strongly recommended, but
1.4.4.2. Harvest of in vivo spores
spores retrieved from black mummies might be chosen in certain
1. Mix black mummies with 5 ml of sterile distilled water
situations. Ascosphaera apis will mate on various media but the yield
2. Shake for 5 min
of spores is increased on malt yeast with 20% dextrose agar (MY20)
3. Homogenize the spore solution with a glass tissue grinder for 5
(Ruffinengo et al., 2000). It is recommended that a fresh spore solution be made for every experiment.
min 4. Centrifuge to spin-dry at 3500 rpm for 5 min 5. Discard the supernatant
1.4.4.1. Production and harvest of in vitro spores 1. Cut agar plugs from the border of well-growing isolates with different mating types
6. Add 5 ml iodine-povidone (50% in distilled sterile water). Iodine-povidone is added to avoid bacterial contamination 7. Shake for 10 min
2. Place the plugs of the + and – strain a distance of approximately 4 cm on MY20 agar (see paragraph 1.4.1.1.) 3. Incubate the plate in the dark at 30-34°C at least 3 weeks to ensure production of mature spores
8. Centrifuge to spin-dry at 3500 rpm for 5 min 9. Discard the supernatant 10. Wash three times by adding 5 ml of sterile distilled water 11. Shake for 5 min
4. Use a scalpel to scrape off the spore cysts from the black mating stripes
12.Spin-dry at 3500 rpm for 5 min 13.Add 1 ml water
5. Transfer them to a glass mortar with a ground-glass pestle (glass tissue grinder; Fig. 6a and b)
14. Prepare a dilution series to 10-2 or 10-3 for counting and calculating the concentration of the undiluted suspension with
6. Add 5-10 µl sterile water and grind the suspension 1 min to release spores from the spore cysts and balls
a haemocytometer (refer to the BEEBOOK paper on miscellaneous methods (Human et al., 2013).
A
B
C
D
E
F
Fig. 6. Spore germination test: A & B. First grind the sporocysts to release spores from cysts and balls; C & D. incubate the spores in liquid medium and flush with CO2 incubate the spores 32 hours at 34°C; E & F. check for spore enlargement.
Photos: A B Jensen
The COLOSS BEEBOOK: fungal brood diseases
9
Spores from mummies can also be harvested using the in vitro
1.4.6. Availability and recommended reference isolates
harvest method described above. To get a better homogenization,
Microbial isolates including fungi are deposited and stored in several
scrape the spore cysts from the outside of the mummy before grinding. culture collections around the world. They are available for both
In vivo spores must be used the same day they are prepared, due to
commercial and scientific use. Isolates can be ordered from the
the presence of other microorganisms on the mummies even though
culture collection for a fee that is usually lower for non-profit
the broad-spectrum bactericide iodine-povidone is used to avoid
organizations. We would recommend that researchers deposit isolates
bacterial contamination in the spore solution preparation. Dry dark
that have been used in publications in one of these culture collections,
mummies with viable spores can be preserved for several years (at
so that they can be retrieved for future research.
least 9 years) when stored dry in a closed bottle (Flores, pers. comm.)
Different strains of A. apis have shown variable virulence towards honey bees (Vojvodic et al., 2011a) and may also vary in other
1.4.5. Quality test of inoculums
biological traits. Thus to be able to compare different studies we
Chalkbrood spores can contaminate all surfaces of the bee hive and
recommend to always use AFSEF 7405 and ARSEF 7406 as reference
accumulate in hive products. They are very resistant to the
isolates. These two isolates have been involved in the A. apis genome
environment and can remain viable and infective for more than 15
sequencing project (Qin et al., 2006); they represent each of the two
years (Toumanoff, 1951). However, spore viability will decline over
mating types and both can readily be retrieved from either the USDA-
time and this will vary from isolate to isolate and from batch to batch.
ARSEF or the ATCC culture collections.
Thus it is important to check spore viability prior to an experiment.
Below is the list of the three most important culture collections we recommend for retrieving A. apis isolates:
1.4.5.1. Spore viability and germination test (Fig. 6) 1. Place a sterile Teflon coated slide in a sterile petri dish lined with wet filter paper
USDA-ARSEF; ARS Collection of Entomopathogenic Fungi (7 isolates deposited, March 2012) http://www ars usda gov/Main/docs htm?docid=12125
7
2. Prepare a concentration of 2.0 x 10 spores per ml 3. Mix 100 µl spore suspension with 500 µl GLEN (see recipe below) 4. Place 10 µl of the GLEN / spore mix onto the spot of the Teflon coated slides 5. Place the petri dish in an airtight container and flush with CO2 30 sec to ensure a minimum of 10% CO2
ATCC; American Type Culture Collection (9 isolates deposited, March 2012) http://www lgcstandards-atcc org/ CBS; Centraalbureau voor Schimmelcultures (7 isolates deposited, March 2012) http://www cbs knaw nl/
1.5. Infection bioassays
6. Incubate 32 hours at 34°C
A bioassay is a measurement of the effect of a substance on living
7. Add a cover slip and count the spores directly on the Teflon
organisms. Bioassays with A. apis can be conducted using in vitro
slide under a microscope at 400 magnification 8. Evaluate 100 spores for enlargement or germ tube formation in three different fields of view on the slide
reared larvae or directly in colonies. An in vitro bioassay has very important advantages over the whole colony bioassay; mainly, it excludes the effects of social immunity and allows for replicable
The AnaeroGen system (Oxoid; Basingstoke, UK) has been used with
experiments in controlled environment. However, to address
success in cases where the laboratory is not equipped with CO2. A
questions related to hygienic behaviour, bioassays must be conducted
packet is placed together with the petri dish in a sealed jar and will
directly within honey bee colonies.
generate 9 to 13% CO2.
1.5.1. Infection bioassays using in vitro rearing of larvae 1.4.5.2. GLEN medium 1. Dissolve the following components in approximately 900 ml
Difficulties associated with controlling experimental conditions using honey bee colonies prompted the development of in vivo rearing
deionised water:
conditions that allow rearing honey bee larvae in the laboratory and
4.000 g glucose-dextrose
also a way to test the effects of pathogens, toxins and drugs. Refer to
7.680 g natrium chloride
the BEEBOOK paper on larval rearing for a detailed protocol (Crailsheim
6.500 g lactalbumin hydrolysate
et al., 2013). Exposure bioassays of in vitro reared larvae have been
5.000 g yeast extract
used to test differences in virulence of various A. apis strains (Vojvodic
1.952 g MES-buffer (2-(N-morpholino)ethanesulfonic acid)
et al., 2011b), to compare the temperature response of chalkbrood
2. Adjust the pH to 7.0 using 1 M NaOH
and stonebrood (Vojvodic et al., 2011a), to test susceptibility of
3. Readjust the volume to 1000 ml
various honey bee subspecies towards A. apis (Jensen et al., 2009b),
4. Sterilize by autoclaving at 121˚C for 20 minutes.
to test virulence of A. apis with or without presence of other
Jensen et al.
10
Ascosphaera species commonly associated with solitary bees
5. Place the food near the mouthpart. Use extreme care to avoid
(Vojvodic et al., 2012) and to explore the host response to infection of
touching the larvae and confirm consumption by direct
A. apis at the molecular level (Aronstein et al., 2010).
observation
Ascosphaera apis spores have to be ingested by the larvae, hence they must be incorporated in the larval food. There are two ways spores can be administered - either the larvae can be fed a small quantity (5 µl) of spore contaminated diet, which they will ingest quickly, or the larvae can be fed spore-contaminated diet ad libitum
6. Immediately after feeding, store the pieces of comb for 2 hours at 25ºC 7. Return the comb to the hive so that the bees will cap the cells containing the inoculated larvae 8. Remove the comb a maximum of 20 hours later and store it
for a certain period. The advantage of feeding small quantities is that
at 25ºC and approximately 65% humidity for 5 days. The
the exact dose per larvae can be controlled, and if fed with different
chilling of the larvae will ensure disease development. An open
dosages an exact LD50 can be calculated (Jensen et al., 2009b).
water bottle placed in the incubator will provide sufficient
Depending on the larval ages, additional feeding has to be done on
humidity
the same day, approximately 2 hours later, after the first 5 µl is
9. After 5 days open all cell cappings and record the results.
consumed. However if the aim is to produce a high numbers of
(See paragraph 3.1. Quantify infection degree in colonies)
infected individuals it can be more efficient to use surplus diet, as it is less time consuming. All larval instars can be infected by A. apis (Jensen, unpublished),
1.5.2.2. Infection of colonies with a water spore suspension 1. Prepare a spore solution of 1.25 x 107 spores/ml in sterile
but it is recommended to use 2nd-4th instar larvae. When using 5th
distilled water. (See paragraph 1.4. Production and quality of
instar larvae, the A. apis spores have a limited time period in the gut
inoculums)
for germination and penetration of the gut wall before the bee defecates, and 1st instar larvae are very fragile.
2. Spray 10 ml on the each brood comb surface This quantity has been used successfully on colonies with 8-10 combs (Flores et al., 2004a).
1.5.2. Infection bioassay of colonies When it is necessary to provoke chalkbrood infection in bee colonies, it may be sufficient to infect a group of larvae, or it may be necessary
1.5.2.3. Infection of colonies with spores in pollen 1. Prepare a spore solution of 1.25 x 107 spores/ml in sterile
to cause widespread disease in the colony. The procedure differs for
distilled water. (See paragraph 1.4.3. and 1.4.4. Production
each case. In the first case, the larvae are directly fed spore-
and quality of inoculums)
contaminated food. In the second case, the entire colony is exposed
2. Add 100 ml spore solution to 150 g pollen
to spores either by spraying, feeding sugar/honey with spores or
3. Distribute the mixture on the top of the combs
feeding pollen patties with spores (Moffett et al., 1978; Flores et al.,
An alternative method, if spore concentration is not very important, is
2004a). Flores et al. (2004a) evaluated different ways to inoculate
to homogenize 15 black mummies and mix with 150 g pollen.
colonies with A. apis spores using pieces of comb containing bee brood that have been subjected to controlled chilling. A mummification
1.6. Expression of fungal genes
of 90.63% of the brood was reached by spraying water containing
Studies investigating host-pathogen interactions have taken a new
spores over combs, and colonies fed spore-pollen mixtures reached
dimension utilizing mRNA quantification (qRT-PCR). Here we describe
86.32% infection. The use of sugar syrup with spores only reached
qRT-PCR approach used for identification of A. apis mating type
60.13% mummification and proved to be less effective. We recommend idiomorphs and quantification of A. apis transcripts in culture and in spraying or feeding inoculated pollen since these methods have proven host tissue (Aronstein et al., 2007). to be most effective.
Total RNA can be isolated using standard kits, TRIzol (Invitrogen; Carlsbad, California) and RNeasyR Mini Kit (Qiagen; Valencia CA).
1.5.2.1. Direct exposure of individual larvae 1. Prepare a spore solution of 2 x 108 spores/ml in sterile distilled water. 2. Mix (1:1, v:v) of the solution with honey food (50% honey :
These reagents have been used successfully to make cDNA from mycelia or honey bee larvae (Aronstein et al., 2007; 2010), for RNA extraction method, see the BEEBOOK paper on molecular methods (Evans et al., 2013)
50% distilled sterile water) 3. Remove sections of comb containing 5th instar larvae from the hive. 4. Supply each of the 5th instar larvae with 5 µl of contaminated
1.6.1. qRT-PCR for quantification of A. apis transcripts 1. cDNA can be amplified in a 20 µl reaction containing, 1.1.
food (equals a dose of 5 x 105 spores per larvae)
1.0 U of GoTaq® Flexi DNA polymerase (Promega Co; Madison, WI),
1.2.
5 x GoTaq® Flexi buffer,
The COLOSS BEEBOOK: fungal brood diseases
11
Table 3. List of qRT-PCR primers developed for targeting A. apis transcripts. The first three primer sets target genes that are involved in fungal mating and reproduction. Actin can be used as a reference gene.
Mat1-2-1 F
Annealing temp. (°C) 62
AAAATACCAAGGCCACCGA
Aronstein et al., 2007
Mat1-2-1 R
62
GGAGCATATTGGTAATTTGG
Aronstein et al., 2007
Ste11-like F
62
GGGAAGATTGCCAGGCC
Aronstein et al., 2007
Ste11-like R
62
CAAACTTGTAGTCCGGATG
Aronstein et al., 2007
Htf F
62
AAAATCCCAAGGCCTCGTA
Aronstein et al., 2007
Htf R
62
CTGGTAGCGGTAGTCAGG
Aronstein et al., 2007
Actin_Aapis F
58
CATGATTGGTATGGGTCAG
Aronstein et al., 2007
Actin_Aapis R
58
CGTTGAAGGTCTCGAAGAC
Aronstein et al., 2007
Primer name
Primer sequence
Citation
1.3.
0.25 mM dNTP mix,
resistance to chalkbrood. However, researchers and beekeepers
1.4.
2.5 mM MgCl2,
cannot assume that the ability of a colony to remove dead brood
1.5.
0.3 µM of each primer,
within a certain time will ensure colony-level resistance to chalkbrood.
1.6.
0.75 µl of a 1/1000 stock dilution of SYBR-Green
It is very important, especially for breeding purposes, to directly
(Invitrogen Corp),
challenge colonies with A. apis in addition to the freeze-kill or pin-kill
1 µl of cDNA
brood assay (See paragraph 1.5.1. Infection bioassay of colonies) and
1.7.
2. Reaction conditions are as follows: o
2.1.
Initial denaturing at 95 C for 3 min,
2.2.
40 cycles at 95oC (20 s), 58-62oC (30 s) depending on the gene (Table 3) and 72oC (30 s).
subsequent observation of the bees’ response to the challenged brood (Palacio et al., 2010).
1.8. Olfactory detection
Negative controls (all reaction components except the
Bees from hygienic colonies are particularly responsive to olfactory-
DNA which is replaced with water) must be included in
based stimuli associated with diseased brood. All bees can perform
each run.
uncapping and removal behaviours, but bees that detect abnormal
3. For standardization and normalization against housekeeping
brood odours at a low stimulus level may rapidly initiate uncapping
genes and data analysis, see the BEEBOOK paper on
behaviour, resulting in the removal of diseased brood before it
molecular methods (Evans et al., 2013).
becomes infectious (Wilson-Rich et al., 2009). Individual bees from rapid-hygienic line breeds exhibited significantly increased sensitivity
1.7. Hygienic behaviour
to the odour of chalkbrood disease at lower concentrations compared
Hygienic behaviour is defined as the bees’ ability to detect and
with bees from the slow-hygienic line, based on electrophysiological
remove diseased brood from the nest (Rothenbuhler, 1964). Hygienic
recordings of nerve impulses from the antennae (EAG), by proboscis-
behaviour was first described in the 1930s when researchers sought
extension response conditioning (PER), and by isolation of volatiles
to determine the mechanism by which some honey bee colonies were
from chalkbrood–infected larvae for use in field bioassays (see detailed
resistant to American foulbrood (reviewed in Spivak and Gilliam, 1993).
methods in: Masterman et al., 2000, 2001; Gramacho and Spivak,
In the 1980s, it was shown that hygienic behaviour was also the
2003; Spivak et al., 2003; Swanson et al., 2009; and general methods
primary mechanism of resistance to chalkbrood (Gilliam et al., 1983),
of EAG and collection of volatiles in the BEEBOOK paper on chemical
although resistance to this disease involves other factors as well, such ecology methods (Torto et al., 2013) and of PER in the BEEBOOK as differences in the susceptibility of different colonies or even
paper on behavioural methods (Scheiner et al., 2013)).
between patrilines within colonies (Invernizzi et al., 2009; Jensen et al., 2009b). Hygienic behaviour assays, involving killing brood by freezing or
1.9. Inhibitory assays against chalkbrood For both fundamental and applied research it can be important to test
by piercing pupae with a pin (methods described in the BEEBOOK
the inhibitory effects of certain chemicals, plant extracts, propolis,
paper on queen rearing and selection (Büchler et al., 2013)) are
probiotic bacteria or hemolymph against chalkbrood. These substances
indirect, and record the proportion of dead brood removed by a
can be tested for their direct effect on spore germination and on
colony after a particular amount of time. Most, but not all colonies,
hyphal growth, or they can be used to test their effect on the ability
show a good correlation between removal of freeze-killed brood and
of the fungus to infect individual bees in vitro or in a colony context.
Jensen et al.
12
such as hygienic removal of larvae. The degree of infection would most probably be related to the dynamics of A. apis spore load in the colony. Evaluation of the level of infection in the colony before and after treatment is therefore recommended.
1.10. Minimizing chalkbrood in experimental colonies The main techniques for chalkbrood control lie in management Fig. 7. Zone of inhibition assay of different compounds against
Ascosphaera apis: A. MY-20 medium with spores spread on the entire surface and with a central hole for the test compound; B. The zone of inhibition was recorded daily by drawing on the Petri dish, a line over the border of the mycelium (each day a different colour) and the antifungal property was assessed as daily inhibition zone using an image analyser.
Photos: J M Flores
practices that reduce spore concentration in the colonies and that avoid stress (in particular chilling) of susceptible brood. 1.10.1. Breeding for resistance Gilliam et al., (1983) and Taber (1986) demonstrated that it is possible to select and breed honey bees for resistance to chalkbrood disease. Spivak and Reuter (2001) demonstrated that colonies selected for rapid removal of freeze-killed brood showed resistance to chalkbrood in field experiments. Palacio et al. (2000) observed that
1.9.1. Inhibition of spore germination and hyphae (zone of
hygienic colonies had a lower frequency of brood diseases including
inhibition)
chalkbrood. Commercial queen breeders in the US and Denmark have
1. Prepare MY20 medium (see paragraph 1.4.1.1.) in petri dishes found that if they have “zero-tolerance” for chalkbrood; i.e. they (15 cm)
never raise queens from a colony that has had clinical symptoms of 7
2. Spread 2 ml of a spore solution (9.0 x 10 spores/ml) on the 6
2
surface of the medium, approximately 10 spores/cm
3. Make a central hole (7 mm) in the MY20 medium (Fig. 7A)
chalkbrood and they simultaneously select for rapid hygienic behaviour then they get rather chalkbrood resistant lines (Spivak and Jensen, unpublished).
4. Place 0.5 ml of the test product into the hole 5. Incubate the cultures (30ºC, 12% CO2, 65% relative humidity) 1.10.2. Management and treatment 6. Measure the fungal growth (or the zone of inhibition) (Fig. 7B) There are a number of management’s techniques that can be used to Measure the fungal growth (or the zone of inhibition) daily using a stereoscopic microscope magnification (X 20 to 40). Mycelium growth can be seen within the medium before emerging at the surface
minimize the effects of chalkbrood in infected colonies: 1. Reduce volume of the brood chamber for the overwintering (Seal, 1957)
(Puerta et al., 1990). An Image Analyzer can be used to measure the
2. Enlarge colony entrance to aid ventilation (Gochnauer et al., 1975)
diameter of the zone of inhibition.
3. Replace old combs (Betts, 1951) 4. Heat treatment of the wax (Flores et al., 2005a)
1.9.2. Inhibition in colonies
5. Requeen affected colonies (Lunder, 1972)
1. Assess the degree of infection in colonies before treatment, as To date, there is no effective chemical treatment against this disease. described in paragraph 1.3.1. (Quantify infection degree in
Nevertheless in vitro (Puerta et al., 1990; Flores et al., 1996b) and in
colonies)
vivo (Flores et al., 2001) techniques have been used to evaluate
2. Increase colony infection with A. apis as described in paragraph chemical treatments for chalkbrood control. 1.5.2. (Infection bioassay of colonies) 3. Apply the test item to the colony 4. Assess the level of infection in the colony, as described in paragraph 1.3.1. (Quantify infection level in colonies) the next
2. Stonebrood
day after treatment and repeat the assessment depending of
2.1. Introduction
the aim of the experiment.
Stonebrood is a very rare honey bee brood disease caused by several
We propose an indirect assessment of in vivo treatments because
fungi from the genus Aspergillus. The disease was first described by
quantifying the disease by counting mummies is very difficult and
Massen (1906) and has since then been found worldwide. Aspergillus
inaccurate. If the disease is increasing in the colony, the spore
flavus has most frequently been reported, followed by Asp. fumigatus,
numbers will also increase; likewise, if the disease is decreasing, the
but also Asp. niger and other species can kill honey bees (Gilliam and
spore number will be lower due to the natural behaviours of the bees
Vandenberg, 1997). Aspergillus is able to infect the host through the
The COLOSS BEEBOOK: fungal brood diseases
gut if the spores are ingested, but also through the cuticle. Therefore,
13
adults as well as larvae and pupae can become infected. In addition, most species of Aspergillus produce aflatoxins that have been
bench becomes efficient
suggested to be the primary cause of death in stonebrood infected honey bees (Burnside, 1930). However, a non-aflatoxin producing
Asp. flavus strain has been observed to induce stonebrood symptoms
Plan and lay out work in a logical order so the work in the Minimize personnel traffic and unnecessary movements around the work area
Routine cleaning of difficult-to-access areas to prevent build up of dust and debris
equally well in in vitro reared honey bee larvae as afaltoxin producing
Aspergillus spp. produce airborne conidia which represent a potential
strains (Vojvodic, unpublished).
risk for the experimenter, but no additional attention has to be taken
Aspergillus spp. are cosmopolitan filamentous fungi often found in as long as good microbiological practice and containment are followed. soil, where they thrive as saprophytes, but occasionally they do infect
In particular, it is important that the cultures grown on agar plates are
living hosts including, plants, insects and mammals. Aspergillus can
only opened in a sterile bench and that conidia are only handled
infect human lungs, eyes, pharynx, skin and open wounds, but most
outside the bench if they are in a liquid suspension.
commonly this has been observed in immune deprived individuals (Gefter, 1992; Germaud and Tuchais, 1995; Denning, 1998;
If conducting a bioassay with Aspergillus spp. on in vitro reared larvae or in cages on adult honey bees, it is important that the
Galimberti et al., 1998; Garret et al., 1999). In addition, the alfatoxins assessment is done in a sterile bench or a fume hood once the are carcinogenic if inhaled or ingested; therefore precautions need to
Aspergillus start to sporulate. Dead infected bees can be removed
be taken when stonebrood disease occurs in honey bees principally to
with forceps to avoid production of numerous new conidia.
protect beekeepers and consumers. In several countries stonebrood is
In several countries, permission from the authorities is required to
a notifiable disease that has to be reported to the authorities if it
work experimentally with stonebrood fungi, in particular if it is an
occurs.
outdoor experiment. If Aspergillus spp. are used for experiments in bee colonies we recommend using a mask and safety glasses for
2.2. Biohazards
protection while conducting the experiments.
Working with fungi requires good microbiological practice and containment, irrespective of whether they possess a potential risk for
2.3. Diagnostics and qualitative detection
the environment or human, since proliferation on the growth medium
2.3.1 Morphological description
of contaminants always poses a potential risk. Good microbiological
The typical symptoms observed in a colony affected by stonebrood
practice is in principle the handling of a microorganism in a "test tube" are not very different from chalkbrood symptoms and includes without any other organisms entering and contaminating it.
irregular capping of the brood. Infected brood, also called "mummies”,
Containment is in principle the handling of a microorganism with
can be seen in the combs. Stonebrood mummies turn hard and they
emphasis on safety of the laboratory worker and the environment.
resemble small stones, not sponge-like as chalkbrood mummies.
Good microbiological practice and containment involves:
Stonebrood mummies are difficult to remove from the cells with
Aseptic techniques
forceps and removal by the worker bees is also difficult. Infected
Limit the open time of “test tube”
brood becomes covered with powdery yellow, brown, green or black
Open tubes or plates only in bio-safe cabinet/bench to avoid
fungal spores depending on the species. In some cases infected or
contamination
deceased larvae looked dry, but they do not produce visible conidia
Only use sterile tools (e.g. pipette tips or loops)
within a 48 hrs after pathogen inoculation (Vojvodic, unpublished)
Avoid casual contact with the bench, fingers, or outside of the
Stonebrood can be diagnosed by its gross symptoms, but positive
bottle
identification requires its cultivation in the laboratory and subsequent
Dispose or decontaminate tools immediately after use
microscopic examination. Structures of the conidiophores (spore
Personal hygiene and dress
forming structures) are very important for identification of Aspergillus spp.
Wash hands prior to and following manipulations
The conidiophores originate from a basal cell located on the supporting
Wear appropriate personal protective equipment (gloves,
hyphae and terminate in a vesicle (Fig. 8). The morphology, colour
clean lab coats)
and roughness of the conidiophores vary from species to species.
Do not touch the skin, face, or unclean non-sterile surfaces
Additionally, the position of the flask-shaped phialides (spore
Confine loose or long hair and keep fingernails short
producing cells) on the vesicle is an important character. The phialides
Area cleanliness and organization
can cover the vesicle surface entirely ("radiate" head) or partially
Disinfect work area before and after work with 70% Ethanol
("columnar" head) and the phialids can be attached to the vesicle
Immediately clean spills, and then disinfect the work surface
directly (uniseriate) or attached via a supporting cell, called metula
Keep only items important for the task in progress in the bench (biseriate). The phialides produce round conidia (2-5 µm in diameter)
Jensen et al.
14
Table 4. Microscopic characters of three Aspergillus species most often reported to cause stonebrood. Species
Asp. flavus Asp. fumigatus
Conidia colour
Conidiophores
Phialides
Vesicle
Yellow-green
Colourless. Rough Short (<300µm), smooth,
Uni/biseriate
Round, radiate head
Uniseriate
Round, columnar head
Biseriate
Round, radiate head
Blue-green to grey
Asp. niger
Black
colourless-green Long, smooth, colourless or brown
that form radial chains (Fig. 8). The conidia of the different species
within the various Aspergillus sections (Balajee et al., 2007)
can have different colours (Table 4) (See Fig. 9 for Asp. flavus in vitro (see primers in Table 5). infected larvae). We however recommend contacting a mycologist for correct species identification of the Aspergillus specimens.
Aspergillus DNA can, as for Ascosphaera, be extracted with standard kits (see also the BEEBOOK paper on molecular methods (Evans et al., 2013)
2.3.2 Molecular methods There is no single method (morphological, physiological or molecular)
2.4. Production and quality of inoculums
that can be used to recognize all of the approximately 250 Aspergillus
2.4.1. Isolation techniques
species. Using a multi-locus approach will give a lot of information,
Aspergillus grows readily on many different standard media e.g. SDA,
but it also requires certain skills and equipment not always present in
PDA, but Czapek-Dox medium, which contain sucrose as carbon
diagnostic laboratories (Geiser et al., 2007). A two-step barcoding has source and nitrate as the nitrogen source should be very suitable. been suggested for identification of Aspergillus species in a clinical
Czapek-Dox medium with addition of yeast extract (5.0 g/l) is
setting. The ITS regions can be used for inter-section level
recommended (Frisvad, pers. comm.). All these three media can be
identification and the β-tubulin for identification of individual species
purchased premixed and easily prepared. E.g. to prepare 1 l of SDA medium, suspend 65 g SDA (Merck) in 1 l of demineralized water and autoclave 15 min at 121°C.
2.4.1.1. Aspergillus spp. can be isolated from sporulating mummies. 1. Put a sterile microbial loop in an area with many conidia 2. Streak on agar plates 3. If the plates become contaminated with other microbes, repeat the procedure. Once a clean culture is established, proceed with single spore isolation described below.
2.4.1.2. Single spore isolation 1. Add 10 ml 0.05% Triton-X on the culture agar plate 2. Rub its surface gently with a sterile Drigalski spatula to loosen the conidia 3. Transfer the suspension conidia into a 15-50 ml sterile tube 4. Wash the suspension twice (to remove agar and hyphal fragments) 4.1.
Centrifuge 3 min at 7000 g for 3 min
4.2.
Discharge the supernatant and add 10 ml 0.005% Triton-X
4.3.
Centrifuge 3 min at 7000 g for 3 min
4.4.
Discharge the supernatant and add 10 ml 0.005% Triton-X
5. Prepare a serial dilution (remember to whirl mix before pipetting)
Fig. 8. Structures of importance for identification of Aspergillus species.
The COLOSS BEEBOOK: fungal brood diseases
15
Table 5. List of primers used to be used in the two-step DNA barcoding of Aspergillus spp. for the ITS region and part of the β-tubulin gene. Annealing temp (°C)
Annealing temperature (°C)
Citation
ITS 1
55
TCCGTAGGTGAACCTGCGG
White et al., 1990
ITS 4
55
TCCTCCGCTTATTGATATGC
White et al., 1990
Bt2a (β-tubulin)
58
GGTAACCAAATCGGTGCTGCTTTC
Glass and Donaldson, 1995
Bt2b (β-tubulin)
58
ACCCTCAGTGTAGTGACCCTTGGC
Glass and Donaldson, 1995
Primer name
6. Count the spore concentration in a haemocytometer
2.5.2. Availability and recommended reference isolates
(described in the BEEBOOK paper on miscellaneous methods
Aspergillus has been deposited in various fungal culture collections,
(Human et al., 2013))
such as USDA-ARSEF, ATCC and CBS (see link below). None of the 2
7. Transfer 100 µl of a spore solution at 5 X 10 spore per ml to a new plate
isolates deposited so far have been isolated from honey bees, neither larvae nor adults, but from sources such as plant material, soil,
8. Incubate at 25°C for two-four days
vertebrates and invertebrates. USDA-ARSEF is a collection of
9. Transfer a single small colony to a new plate
Entomopathogenic fungi, thus the majority of isolated deposited there
To harvest conidia for experimental purposes the above procedure
originate from insects or other arthropods. It is possible to retrieve
can be used (minus step 6-8). It is important to use Triton-X or
Aspergillus isolates from hymenoptera; solitary megachilid bees
another detergent to avoid spore clumping.
(Osmia lignaria and Megachile rotundata) and formicine ants (Anoplolepsis longipes and Solenopsis invicta).
2.4.2. Preservation of in vitro cultures
Limited work has been performed with stonebrood, thus it is
Aspergillus has been observed to lose sporulation capacity and
difficult to recommend a specific reference strain. A reference strain
virulence after a couple of transfers on a standard medium (Scully and can be chosen based on its pathobiological properties (to honey bees Bidochka, 2006). Therefore we recommend long-term storage of the
or at least Hymenoptera); as in Vojvodic et al. (2011a) where an Asp.
isolates during the first transfers. Several long-term storage methods
flavus strain isolated from an infected honey bee larvae was used to
can be used: frozen in skim milk, refrigerated with silica gel, or freeze
infect in vitro reared honey bee larvae. This particular strain is
dried. It is possible to successfully recover various Aspergillus species
unfortunately lost. However, the reference strain could be based on
(e.g. Asp. flavus, Asp. parasiticus and Asp. niger), stored in 10%
its geographical origin or type specimen.
glycerol at -80°C for more than a year, using the same method which
USDA-ARSEF; ARS Collection of Entomopathogenic Fungi (83 isolates
we recommend for A. apis (see paragraph 1.4.3.1. Cryopreservation
deposited, 15 Asp. flavus, 7 Asp. niger April 2012)
in glycerol at -80°C).
http://www.ars.usda.gov/Main/docs.htm?docid=12125 ATCC; American Type Culture Collection (1618 isolates deposited, 180
Asp. favus, 111 Asp. fumingatus, 117 Asp. niger; April 2012)
2.5. Quality test of inoculums Viability testing of Aspergillus spp. can be performed using the
http://www.lgcstandards-atcc.org/
standard insect pathology methods, which are briefly described below. CBS; Centraalbureau voor Schimmelcultures (1055 isolates deposited, 47 Asp. flavus, 147 Asp. fumigatus, 7 Asp. niger; April 2012) http://www.cbs.knaw.nl/
2.5.1. Spore viability and germination test 5
1. Transfer 10 µl of a spore solution at 5 x 10 spore per ml to an agar plate 2. Spread the spore solution over the entire ager plate with a sterile Digralski spatula 3. Incubate at 25°C for 24 hour
Aspergillus is classified as an opportunistic human pathogen, and thus some countries will need an import permit and proof that the laboratory is accredited to handle it.
4. Place three cover slips on the plate
2.6. Infection bioassays
5. Place the agar plate under the microscope and count the
Exposure bioassays with Aspergillus spp. can potentially be carried
proportion of germinated spores out of 100 spores under each out, using in vitro reared larvae (Fig. 9), caged bees or colonies, due of the three cover slips
to its ability to infect larvae, pupae and adults. A bioassay with in vitro
It is recommended to use only new fresh spore solution for each
reared larvae has been conducted showing that stonebrood and
experiment because the shelf life of Aspergillus spores in a water
chalkbrood had opposite temperature-dependent responses in
solution is about 3 days (Vojvodic, unpublished).
virulence. Chilling of chalkbrood exposed larvae increased the
Jensen et al.
16
outbreaks (Hedtke et al., 2011). Such a correlation needs experimental confirmation, but it elucidates the complexity of the host-pathogeninteraction in honey bee colonies. Research on the interaction with other pathogens and stressors, such as sublethal concentration of various chemicals, is also warranted.
Aspergillus research is mostly focused on human health and food spoilage due to aflatoxin contamination of grains. Stonebrood outbreaks are rarely observed in honey bee colonies, but should not be underestimated. Their rarity could be a result of honey bees removing the stonebrood infected individuals very quickly, an area of research that has not been previously investigated. Furthermore, the basic biology of stonebrood is still poorly understood, and several studies elucidating stonebrood etiology are still to be performed.
Aspergillus spp. spores are present everywhere and a high virulence towards honey bee larvae have been shown. Even though stonebrood is rarely reported, it would be interesting to understand which factors
Fig. 9. In vitro reared honey bee larvae infected with Aspergillus flavus: and mechanisms might play a role in the establishment and resistance the bottom left cell contains larvae in an early stage of disease visible
of this disease.
by the change in larval colour; bottom right cell contains later stage of the diseases with the visible fungal body and conidia protruding out of the larval cuticle. The two upper cells contain healthy larvae.
Photo: S Vojvodic
References ANDERSON, D L; GIBSON, N L (1998) New species and isolates of
pathogen virulence; whereas chilling of stonebrood exposed larvae
spore-cyst fungi (Plectomycetes: Ascosphaerales) from Australia.
increased larval survival (Vojvodic et al., 2011a). For infection of in
Australian Systematic Botany 11: 53-72.
vitro bee larvae with Aspergillus spp. the same precautions must be
http://dx.doi.org/10.1071/SB96026
taken as described in paragraph 1.5.1. for A. apis. Few experiments with caged bees have been conducted (Gilliam
ANDERSON, D L; GIBBS, A J; GIBSON, N L (1998) Identification and phylogeny of sporecyst fungi (Ascosphaera spp ) using ribosomal
and Vandenberg, 1997). Infecting individual larvae while still in the
DNA sequences. Mycological Research 102: 541–547.
brood frame is possible by placing the spore suspensions to be
http://dx.doi.org/10.1017/S0953756297005261
ingested in front of the larvae (Vojvodic unpublished).
ARONSTEIN, K A; MURRAY, K D; DE LEON, J; QIN, X; WEINSTOCK, G (2007) High mobility group (HMG-box) genes in the honey bee fungal pathogen Ascosphaera apis. Mycologia 99: 553–561.
3. Future perspectives
http://dx.doi.org/10.3852/mycologia.99.4.553 ARONSTEIN, K A; MURRAY, K D (2010) Chalkbrood disease in honey
Chalkbrood and stonebrood diseases have been recognized for more
bees. Journal of Invertebrate Pathology 103: 20-29.
than a century, but there is still much that remains to be discovered
http://dx.doi.org/10.1016/j.jip.2009.06.018
regarding these diseases and their impact on the general health status ARONSTEIN, K A; MURRAY, K D; SALDIVAR, E (2010) Transcriptional of honey bees. The numbers of studies of the two diseases reflects
responses in Honey bee larvae infected with chalkbrood fungus. BMC
their frequency and abundance, with a magnitude difference in favour
Genomics 11: 391. http://dx.doi.org/10.1186/1471-2164-11-391
of chalkbrood. The genome of A. apis was published in 2006 (Qin et al., 2006), and although the full annotation is still lacking, it will be useful for
BAILEY, L (1981) Honey bee pathology. Academic Press; London, UK. pp. 40–44. BAMFORD, S; HEATH, L A F (1989) The effects of temperature and
future research investigations on the expression of genes important
pH on the germination of spores of the chalkbrood fungus,
for the infection and virulence of A. apis. Chalkbrood is a stress
Ascosphaera apis. Journal of Apicultural Research 28: 36–40.
related disease and a recent longitudinal cohort study based on
BALAJEE, S A; HOUBRAKEN, J; VERWEIJ, P E; HONG, S-B; YAGUCHI,
monitoring data collected over six years indicated that colonies with
T; VARGA, J; SAMSON, R A (2007). Aspergillus species
high numbers of varroa mites in the same season or Nosema ceranae
identification in the clinical setting. Studies in Mycology 59: 39–46.
infection in the spring had significantly higher chances of chalkbrood
http://dx.doi.org/10.3114/sim.2007.59.05
The COLOSS BEEBOOK: fungal brood diseases
BETTS, A D (1951) The diseases of bees: their signs, causes and
treatment. Hickmott: Camberley, UK. BISSETT, J (1988) Contribution toward a monograph of the genus
Ascosphaera. Canadian Journal of Botany 66: 2541–2560. BURNSIDE, C E (1930) Fungous diseases of the honey bee. US
Department of Agriculture Technical Bulletin 149. BÜCHLER, R; ANDONOV, S; BIENEFELD, K; COSTA, C; HATJINA, F; KEZIC, N; KRYGER, P; SPIVAK, M; UZUNOV, A; WILDE, J (2013)
17
FLORES, J M; PUERTA, F; GUTIÉRREZ, I; ARREBOLA, F (2001) Estudio de la eficacia del Apimicos-b® en el control y la prevención de la ascosferiosis en la abeja de la miel. Revista
Iberoamericana de Micología 18: 187-190. FLORES, J M; GUTIÉRREZ, I; PUERTA, F (2004a) A comparison of methods to experimentally induce chalkbrood disease in honey bees. Spanish Journal of Agricultural Research 2: 79-83. FLORES, J M; GUTIÉRREZ, I; PUERTA, F (2004b) Oxytetracycline as a
Standard methods for rearing and selection of Apis mellifera
predisposing condition for chalkbrood in honey bee. Veterinary
queens. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS
Microbiology 103: 195-199.
BEEBOOK, Volume I: standard methods for Apis mellifera research.
http://dx.doi.org/10.1016/j.vetmic.2004.07.012
Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.07 CRAILSHEIM, K; BRODSCHNEIDER, R; AUPINEL, P; BEHRENS, D; GENERSCH, E; VOLLMANN, J; RIESSBERGER-GALLÉ, U (2013) Standard methods for artificial rearing of Apis mellifera larvae. In
FLORES, J M; SPIVAK, M; GUTIÉRREZ, I (2005a) Spores of
Ascosphaera apis contained in wax foundation can infect honey bee brood. Veterinary Microbiology 108: 141-144. http://dx.doi.org/10.1016/j.vetmic.2005.03.005 FORSGREN, E; BUDGE, G E; CHARRIÈRE, J-D; HORNITZKY, M A Z
V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
(2013) Standard methods for European foulbrood research. In V
Volume I: standard methods for Apis mellifera research. Journal
Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK:
of Apicultural Research 52(1):
Volume II: Standard methods for Apis mellifera pest and pathogen
http://dx.doi.org/10.3896/IBRA.1.52.1.05
research. Journal of Apicultural Research 52(1):
DE MIRANDA, J R; BAILEY, L; BALL, B V; BLANCHARD, P; BUDGE, G;
http://dx.doi.org/10.3896/IBRA.1.52.1.12
CHEJANOVSKY, N; CHEN, Y-P; VAN DOOREMALEN, C; GAUTHIER, FRIES, I; CHAUZAT, M-P; CHEN, Y-P; DOUBLET, V; GENERSCH, E; L; GENERSCH, E; DE GRAAF, D; KRAMER, M; RIBIÈRE, M;
GISDER, S; HIGES, M; MCMAHON, D P; MARTÍN-HERNÁNDEZ, R;
RYABOV, E; DE SMET, L VAN DER STEEN, J J M (2013) Standard
NATSOPOULOU, M; PAXTON, R J; TANNER, G; WEBSTER, T C;
methods for virus research in Apis mellifera. In V Dietemann; J D
WILLIAMS, G R (2013) Standard methods for nosema research. In
Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II:
V Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK:
standard methods for Apis mellifera pest and pathogen research.
Volume II: Standard methods for Apis mellifera pest and pathogen
Journal of Apicultural Research 52(4):
research. Journal of Apicultural Research 52(1):
http://dx.doi.org/10.3896/IBRA.1.52.4.22
http://dx.doi.org/10.3896/IBRA.1.52.1.14
DENNING, D W (1998) Invasive aspergillosis. Clinical Infectious
Diseases 26: 781-803. http://dx.doi.org/10.1086/513943 EVANS, J D; CHEN, Y P; CORNMAN, R S; DE LA RUA, P; FORET, S; FOSTER, L; GENERSCH, E; GISDER, S; JAROSCH, A; KUCHARSKI, R; LOPEZ, D; LUN, C M; MORITZ, R F A; MALESZKA, R; MUÑOZ, I; PINTO, M A; SCHWARZ, R S (2013) Standard methodologies for molecular research in Apis mellifera. In V Dietemann; J D Ellis; P
Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.11 FLORES, J M; RUIZ, J A; RUZ, J M; PUERTA, F; BUSTOS, M; PADILLA, F; CAMPANO, F (1996a) Effect of temperature and humidity of sealed brood on chalkbrood development under controlled
GALIMBERTI, R; KOWALCZUK, A; PARRA, I H; RAMOS M G; FLORES, V (1998) Cutaneous aspergillosis: a report of six cases. British
Journal of Dermatology 139: 522-526. http://dx.doi.org/10.1046/j.1365-2133.1998.02424.x GARRETT, D O; JOCHIMSEN, E; JARVIS, W (1999) Invasive
Aspergillus spp. infections in rheumatology patients. Journal of Rheumatology 26: 146-149. GEFTER, W B (1992) The spectrum of pulmonary aspergillosis. Journal
of Thoracic Imaging 7: 56-74. GERMAUD, P; TUCHAIS, E (1995) Allergic bronchopulmonary aspergillosis treated with itraconazole. Chest 107: 883. http://dx.doi.org/10.1378/chest.107.3.883 GEISER, D M; KLICH, M A; FRISVAD, J C; PETERSON, S W; VARGA, J;
conditions. Apidologie 27: 185-192.
SAMSON, R A (2007) The current status of species recognition
http://dx.doi.org/10.1051/apido:19960401
and identification in Aspergillus. Studies in Mycology 59: 1-10.
FLORES, J M; RUÍZ, J A; RUZ, J M; PUERTA, F; BUSTOS, M; PADILLA,
http://dx.doi.org/10.3114/sim.2007.59.01
F; CAMPANO, F (1996b) Estudio in vivo e in vitro para el control
GILLIAM, M; TABER, S; RICHARDSON, G V (1983) Hygienic behaviour
de la ascosferiosis en apis mellifera. Revista Iberoamericana de
of honey bees in relation to chalkbrood disease. Apidologie 14: 29-39.
Micología 13: 292-295.
http://dx.doi.org/10.1051/apido:19830103
Jensen et al.
18
GILLIAM, M; VANDENBERG, J (1997) Fungi. In Morse, R A; Flottum, K JAMES, R R; SKINNER, J S (2005) PCR diagnostic methods for
(Eds). Honey bee pests, predators, & diseases (3rd Edition). A I
Ascosphaera infections in bees. Journal of Invertebrate Pathology
Root Co.; Medina, USA. pp. 81-110.
90: 98–103. http://dx.doi.org/10.1016/j.jip.2005.08.004
GLASS, N L; DONALDSON, G C (1995) Development of primer sets
JAMES, T Y; KAUFF, F; SCHOCH, C; MATHENY, P B; HOFSTETTER, V;
designed for use with the PCR to amplify conserved genes from
COX, C J; CELIO, G; GEUIDAN, C; FRAKER, E; MIADLIKOWSKA, J;
filamentous ascomycetes. Applied and Environmental Microbiology
LUMBSCH, H T; RAUHUT, A; REEB, V; ARNOLD, A E; AMROFT, A;
61: 1323–1330.
STAJICH, J E; HOSAKA, K; SUNG, G -H; JOHNSON, D; O’ROURKE,
GOCHNAUER, T A; FURGALA, B; SHIMANUKI, H (1975) Diseases and
B; CROCKETT, M; BINDER, M; CURTIS, J M; SLOT, J C; WANG, Z;
enemies of the honey bee. In Grout R (Ed.) The hive and the
WILSON, A W; SCHÜßLER, A; LONGCORE, J E; O’DONNELL, K;
honey bee (3rd Ed.). Dadant and Sons; Hamilton, USA. pp. 615-621.
MOZLEY-STANDRIDGE, S;. ORTER, D; LETCHER, P M; POWELL, M
GRAMACHO, K P; SPIVAK, M (2003) Differences in olfactory sensitivity
J; TAYLOR, J W; WHITE, M M; GRIFFITH, G W; DAVIES, D R;
and behavioural responses among honey bees bred for hygienic
HUMBER, R A; MORTON, J B; SUGIYAMA, J; ROSSMAN, A;
behaviour. Behavioural Ecology and Sociobiology 54: 472-479.
ROGERS, J D; PFISTER, D H; HEWITT, D; HANSEN, K;
http://dx.doi.org/10.1007/s00265-003-0643-y
HAMBLETON, S; SHOEMAKER, R A; KOHLMEYER, J; VOLKMANN-
HEATH, L A F (1982) Development of chalkbrood in a honey bee colony: a review. Bee World 63: 119-130. HEATH, L A F; GAZE, B M (1987) Carbon dioxide activation of spores
KOHLMEYER, B; SPOTTS, R A; SERDANI, M; CROUS, P W; HUGHES, K W; MATSUURA, K; LANGER, E; LANGER, G; UNTEREINER, W A; LÜCKING, R; BÜDEL, B; GEISER, D M;
of the chalkbrood fungus Ascosphaera apis. Journal of Apicultural
APTROOT, A; DIEDERICH, P; SCHMITT, I; SCHULTZ, M; YAHR, R;
Research 26(4): 243–246.
HIBBETT, D S; LUTZONI, F; MCLAUGHLIN, D J; SPATAFORA, J W;
HEDTKE, K; JENSEN, P M; JENSEN, A B; GENERSCH, E (2011)
VILGALYS, R (2006) Reconstructing the early evolution of Fungi
Evidence for emerging parasites and pathogens influencing
using a six-gene phylogeny. Nature 443: 818–822.
outbreaks of stress-related diseases like chalkbrood. Journal of
http://dx.doi.org/10.1038/nature05110
Invertebrate Pathology 108:167-73. http://dx.doi.org/10.1016/j.jip.2011.08.006 HORNITZKY, M (2001) Literature review of chalkbrood. A report for the RIRDC. Publication No. 01/150, Kingston, ACT, Australia. HUMAN, H; BRODSCHNEIDER, R; DIETEMANN, V; DIVELY, G; ELLIS, J; FORSGREN, E; FRIES, I; HATJINA, F; HU, F-L; JAFFÉ, R;
JENSEN, A B; JAMES, R R; EILENBERG, J (2009a) Long-term storage of Ascosphaera aggregata and A. apis, pathogens of the leafcutting bee (Megachile rotundata) and the honey bee (Apis
mellifera). Journal of Invertebrate Pathology 101: 157–160. http://dx.doi.org/10.1016/j.jip.2009.03.004 JENSEN, A B; PEDERSEN, B V; EILENBERG, J (2009b) Differential
KÖHLER, A; PIRK, C W W; ROSE, R; STRAUSS, U; TANNER, G;
susceptibility across honey bee colonies in larval to chalkbrood
TARPY, D R; VAN DER STEEN, J J M; VEJSNÆS, F; WILLIAMS, G
resistance. Apidologie 40: 524-534.
R; ZHENG, H-Q (2013) Miscellaneous standard methods for Apis
mellifera research. In V Dietemann; J D Ellis; P Neumann (Eds)
http://dx.doi.org/10.1051/apido/2009029 JENSEN, A B; WELKER, D L; KRYGER, P; JAMES, R R (2012)
The COLOSS BEEBOOK, Volume I: standard methods for Apis
Polymorphic DNA sequences of the fungal honey bee pathogen
mellifera research. Journal of Apicultural Research 52(4):
Ascosphaera apis. FEMS Microbiology Letters 330: 17-22.
http://dx.doi.org/10.3896/IBRA.1.52.4.10
http://dx.doi.org/10.1111/j.1574-6968.2012.02515.x
HUMBER, R A (2008) Evolution of entomopathogenicity in fungi.
Journal of Invertebrate Pathology 98: 262–266. http://dx.doi.org/10.1016/j.jip.2008.02.017 INVERNIZZI, C; PENAGARICANO, F; TOMASCO, I H (2009)
LUNDER, R (1972) Undersøkelse av kalkyngel i 1971 [Investigation on chalkbrood in 1971]; Birøkteren 88: 55–60. MAASSEN, A (1913) Weitere Mitteilungen uber der seuchenhaften Brutkrankheiten der Bienen [Further communication on the
Intracolonial genetic variability in honey bee larval resistance to
epidemic brood disease of bees]. Mitteilungen aus der
the chalkbrood and American foulbrood parasites. Insectes
Kaiserlichen Biologischen Anstalt fur Land- und Forstwirtscshaft
Sociaux 56: 233–240. http://dx.doi.org/10.1007/s00040-009-0016-2
14: 48-58.
The COLOSS BEEBOOK: fungal brood diseases
MASTERMAN, R; SMITH, B H; SPIVAK M (2000) Brood odour
19
REHNER, S A; EVANS, J D (2009) Microsatellite loci for the fungus
discrimination abilities in hygienic honey bees (Apis mellifera L)
Ascosphaera apis: cause of honey bee chalkbrood disease.
using proboscis extension reflex conditioning. Journal of Insect
Molecular Ecology Resources 9: 855–858.
Behaviour 13(1): 87-101. http://dx.doi.org/10.1023/A:1007767626594 MASTERMAN, R; ROSS, R; MESCE, K; SPIVAK, M (2001) Olfactory and
REYNALDI, F J; LOPEZ, A C; ALBO. G N; ALIPPI, A M (2003) Differentiation of Ascosphaera apis isolates by rep-PCR fingerprinting and determination of chalkbrood incidence in
behavioural response thresholds to odours of diseased brood
Argentinean honey samples. Journal of Apicultural Research 42:
differ between hygienic and non-hygienic honey bees (Apis
68–76.
mellifera L.). Journal of Comparable Physiology A 187:441-452. http://dx.doi.org/10.1007/s003590100216 MAURIZIO, A (1934) Uber die Kaltbrut (Pericystis-Mykose) der Bienen.
Archiv Bienenkunde 15: 165–193.
ROTHENBUHLER, W C (1964) Behaviour genetics of nest cleaning in honey bees. IV. Responses of F1 and backcross generations to disease-killed brood. American Zoologist 4(2): 111-123. http://dx.doi.org/10.1016/0003-3472(64)90082-X
MOFFETT, J O; WILSON, W T (1978) Feeding commercially purchased RUFFINENGO, S; PEÑA, N I; CLEMENTE, G; PALACIO, M A; ESCANDE, pollen containing mummies caused chalkbrood. American Bee
R (2000) Suitability of culture media for the production of
Journal 118: 412-414.
ascospores and maintenance of Ascosphaera apis. Journal of
MOMOT, J P; ROTHENBUHLER, W C (1971) Behaviour genetics of
Apicultural Research 39(3/4): 143-148.
nest cleaning in honey bees. VI. Interactions of age and genotype SCHEINER, R; ABRAMSON, C I; BRODSCHNEIDER, R; CRAILSHEIM, K; of bees, and nectar flow. Journal of Apicultural Research 10: 11-21. MURRAY, K D; ARONSTEIN, K A; JONES, W A (2005) A molecular
FARINA, W; FUCHS, S; GRÜNEWALD, B; HAHSHOLD, S; KARRER, M; KOENIGER, G; KOENIGER, N; MENZEL, R; MUJAGIC, S;
diagnostic method for selected Ascosphaera species using PCR
RADSPIELER, G; SCHMICKLl, T; SCHNEIDER, C; SIEGEL, A J;
amplification of internal transcribed spacer regions of rDNA.
SZOPEK, M; THENIUS, R (2013) Standard methods for
Journal of Apicultural Research 44: 61-64.
behavioural studies of Apis mellifera. In V Dietemann; J D Ellis; P
NILSSON, H; KRISTIANSSON, E; RYBERG, M; HALLENBERG, N; LARSSON, K H (2008) Intraspecific ITS variability in the kingdom Fungi as expressed in the International Sequence Databases and its implications for molecular species identification. Evolutionary
Bioinformatics Online 4: 193–201. PALACIO, M A; FIGINI, E; RODRIGUEZ, E; RUFFINENGO, S;
Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.04 SCHOCH, C L; SEIFERT, K A; HUHNDORFC, S; ROBERT, V; SPOUGE, J L; LEVESQUEB, C A; CHEN, W; (FUNGAL BARCODING CONSORTIUM) (2012) Nuclear ribosomal internal transcribed spacer (ITS) region
BEDASCARRASBURE, E; DELHOYO, M (2000) Changes in a
as a universal DNA barcode marker for Fungi. Proceedings of the
population of Apis mellifera selected for its hygienic behaviour.
National Academy of Sciences 109: 6241-6246.
Apidologie 31:471-478. http://dx.doi.org/10.1051/apido:2000139 PALACIO, M A; PEÑA, N; CLEMENTE, G; RUFFINENGO, S; ESCANDE, A
www.pnas.org/cgi/doi/10.1073/pnas.1117018109 SCULLY, L R; BIDOCHKA, M J (2006) A cysteine/methionine auxotroph of the opportunistic fungus Aspergillus flavus is associated with
(2007) Viability and pathogenicity of Ascosphaera apis preserved
host-range restriction: a model for emerging diseases. Microbiology
in integral rice culture. Journal of Agricultural Research 5(4): 481-
152: 223–232. http://dx.doi.org/10.1099/mic.0.28452-0
486. PALACIO, M A; RODRIGUEZ, E; GONCALVES, L; BEDASCARRASBURE,
SEAL, D W A (1957) Chalk brood disease of bees. New Zealand
Journal of Agriculture 6: 562.
E; SPIVAK, M (2010) Hygienic behaviours of honey bees in
SKOU, J P (1972) Ascosphaerales. Friesia 10(1): 1–24.
response to brood experimentally pin-killed or infected with
SKOU, J P (1988) More details in support of the class
Ascosphaera apis. Apidologie 41: 602-612. http://dx.doi.org/10.1051/apido/2010022 PUERTA, F; FLORES, J M; TARÍN, R; BUSTOS, M; PADILLA, F, HERMOSO DE MENDOZA, M (1990) Actividad antifúngica de productos seleccionados contra Ascosphaera Apis. Estudios in
vitro. Revista Iberoamericana de Micología 7: 103-106. QIN, X; EVANS, J D; ARONSTEIN, K A; MURRAY, K D; WEINSTOCK, G M (2006) Genome sequences of the honey bee pathogens
Ascosphaeromycetes. Mycotaxon 31(1): 191–198. SPILTOIR, C F (1955) Life cycle of Ascosphaera apis (Pericystis apis).
American Journal of Botany 42(6): 501-508. http://dx.doi.org/10.2307/2438686 SPIVAK, M; GILLIAM, M (1993) Facultative expression of hygienic behaviour of honey bees in relation to disease resistance. Journal
of Apicultural Research 32: 147-157. SPIVAK, M; REUTER, G S (2001) Resistance to American foulbrood
Paenibacillus larvae and Ascosphaera apis. Insect Molecular
disease by honey bee colonies, Apis mellifera, bred for hygienic
Biology 15(5): 715-718.
behaviour. Apidologie 32: 555-565.
http://dx.doi.org/10.1111/j.1365-2583.2006.00694.x
http://dx.doi.org/10.1051/apido:2001103
Jensen et al.
20
SPIVAK, M; MASTERMAN, R; ROSS, R; MESCE, K A (2003) Hygienic behaviour in the honey bee (Apis mellifera L.) and the modulatory role of octopamine. Journal of Neurobiology 55: 341–354. http://dx.doi.org/10.1002/neu.10219 SWANSON, J; TORTO, B; KELLS, S; MESCE, K; TUMLINSON, J; SPIVAK, M (2009) Odorants that induce hygienic behaviour in
UDAGAWA, S; HORIE, Y (1976) A new species of Emericella.
Mycotaxon 4: 535-539. VOJVODIC, S; BOOMSMA, J J; EILENBERG, J; JENSEN, A B (2012) Virulence of mixed fungal infections in honey bee brood.
Frontiers in Zoology 9:5. http://dx.doi.org/10.1186/1742-9994-9-5 VOJVODIC, S; JENSEN, A B; JAMES, R R; BOOMSMA, J J; EILENBERG,
honey bees: Identification of volatile compounds in chalkbrood-
J (2011a). Temperature dependent virulence of obligate and
infected honey bee larvae. Journal of Chemical Ecology 35: 1108-
facultative fungal pathogens of honey bee brood. Veterinary
1116. http://dx.doi.org/10.1007/s10886-009-9683-8
Microbiology 149: 200-205.
TABER, S (1986) Breeding bees for resistance to chalkbrood disease.
American Bee Journal 126: 823-825. THOMPSON, V C (1964) Behaviour genetics of nest cleaning in honey
http://dx.doi.org/10.1016j.vetmic.2010.10.001 VOJVODIC, S; JENSEN, A B; MARKUSSEN, B; EILENBERG, J; BOOMSMA, J J (2011b) Genetic variation in virulence among
bees. III. Effect of age of bees of a resistant line on their response
chalkbrood strains infecting honey bees. PLoS ONE 6(9): e25035.
to disease-killed brood. Journal of Apicultural Research 3: 25-30.
http://dx.doi.org/10.1371/journal.pone.0025035
TORTO, B; CARROLL, M J; DUEHL, A; FOMBONG, A T; NAZZI, F.,
WHITE, T; BURNS, T; LEE, S; TAYLOR, J (1990) Amplification and
GOZANSKY, K T; SOROKER, V; TEAL, P E A (2013) Standard
direct sequencing of fungal ribosomal RNA genes for
methods for chemical ecology research in Apis mellifera. In V
phylogenetics. In Innis, M A; Gelfand, D H; Sninsky, J J; White, T
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
J (Eds). PCR protocols. A guide to methods and applications.
Volume I: standard methods for Apis mellifera research. Journal
Academic Press, Inc.; Sand Diego, USA. pp. 315–322.
of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.06 TOUMANOFF, C; (1951) Les Maladies des Abeilles [The diseases of bees]. Revue Française d’Apicculture numéro spécial 68: 1-325.
WILSON-RICH, N; SPIVAK, M; FEFFERMAN, N H; STARKS, P T (2009) Genetic, individual, and group facilitation of disease resistance in insect societies. Annual Review of Entomology 54: 405-423. http://dx.doi.org/10.1146/annurev.ento.53.103106.093301
Journal of Apicultural Research 52(1): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.1.14
REVIEW ARTICLE
Standard methods for Nosema research
Ingemar Fries1*, Marie-Pierre Chauzat2, Yan-Ping Chen3, Vincent Doublet4, Elke Genersch6, Sebastian Gisder6, Mariano Higes7, Dino P McMahon5, Raquel Martín-Hernández7, Myrsini Natsopoulou4, Robert J Paxton4,5, Gina Tanner8, Thomas C Webster9 and Geoffrey R Williams8 1
Department of Ecology, Swedish University of Agricultural Sciences, 75007 Uppsala, Sweden. Anses, Unit of honey bee pathology, 105 route des Chappes, BP 111, F06 902 Sophia Antipolis cedex, France. 3 Bee Research Laboratory, USDA-ARS, Beltsville, MD, USA. 4 Institute for Biology, University of Halle-Wittenberg, 06099 Halle (Saale), Germany. 5 School of Biological Sciences, Queen's University Belfast, Belfast BT9 7BL, UK. 6 Department for Molecular Microbiology and Bee Diseases, Institute for Bee Research Hohen Neuendorf, 16540 Hohen Neuendorf, Germany. 7 Centro Apícola de Castilla-La Mancha, Laboratorio de Patología, San Martín s/n, 19180 Marchamalo, Spain. 8 Swiss Bee Research Centre, Agroscope Liebefeld-Posieux Research Station ALP-HARAS, Bern, Switzerland. 9 Land Grant Program, Kentucky State University, Frankfort, KY 40601, USA. 2
Received 10 April 2012, accepted subject to revision 14 June 2012, accepted for publication 29 October 2012. *Corresponding author: Email: Ingemar.Fries@slu.se
Summary Methods are described for working with Nosema apis and Nosema ceranae in the field and in the laboratory. For fieldwork, different sampling methods are described to determine colony level infections at a given point in time, but also for following the temporal infection dynamics. Suggestions are made for how to standardise field trials for evaluating treatments and disease impact. The laboratory methods described include different means for determining colony level and individual bee infection levels and methods for species determination, including light microscopy, electron microscopy, and molecular methods (PCR). Suggestions are made for how to standardise cage trials, and different inoculation methods for infecting bees are described, including control methods for spore viability. A cell culture system for in vitro rearing of
Nosema spp. is described. Finally, how to conduct different types of experiments are described, including infectious dose, dose effects, course of infection and longevity tests.
Métodos estándar para la investigación sobre Nosema Resumen Se describen procedimientos para trabajar con Nosema apis y Nosema ceranae en el campo y en el laboratorio. Para el trabajo de campo, se describen diferentes métodos de muestreo para determinar infecciones al nivel de colonia en un momento determinado, y también para el seguimiento de la dinámica temporal de infección. Se hacen sugerencias para la forma de estandarizar los ensayos de campo para evaluar los tratamientos y el impacto de la enfermedad. Los métodos de laboratorio descritos incluyen diferentes formas de determinar los niveles de infección al nivel de colonia y de abeja individual, y los métodos para la determinación de las especies, incluyendo microscopía óptica, microscopía electrónica y métodos moleculares (PCR). Se hacen sugerencias para estandarizar los ensayos con cajas, y se describen diferentes métodos de inoculación para infectar abejas, incluyendo métodos de control para la viabilidad de las esporas. Se describe un sistema de cultivo celular para la cría in vitro de Nosema spp. Finalmente, se describe cómo llevar a cabo diferentes tipos de experimentos, incluyendo la dosis infecciosa, efectos de la dosis, curso de la infección y las pruebas de longevidad.
Footnote: Please cite this paper as: FRIES, I; CHAUZAT, M-P; CHEN, Y-P; DOUBLET, V; GENERSCH, E; GISDER, S; HIGES, M; MCMAHON, D P; MARTÍNHERNÁNDEZ, R; NATSOPOULOU, M; PAXTON, R J; TANNER, G; WEBSTER, T C; WILLIAMS, G R (2013) Standard methods for nosema research. In V Dietemann; J D Ellis, P Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 51(5): http://dx.doi.org/10.3896/IBRA.1.52.1.14
Fries et al.
2
孢子虫研究的标准方法 本文描述了实验室及野外实验中关于孢子虫Nosema apis 和 Nosema ceranae 的研究方法。对于野外实验,本文列举了多种取样方法,用于研究 特定时间段内,蜂群群体感染水平,以及随后开展长期感染规律的研究。同时也对如何标准化评估蜂场治疗效果、感病程度及选用哪些指标用于 标准化评估提出了建议。实验室方法包括,确定蜂群感染水平及个体蜜蜂感染水平的方法以及测定孢子虫种类的方法,如光学显微镜法,电子显 微镜法以及分子方法(PCR)。对于如何标准化蜂笼实验的各项指标提出了建议,并描述了感染蜜蜂的不同接种方法,包括孢子生存能力的对比 法。描述了孢子虫的一种体外细胞培养体系。最后描述了如何进行不同类型的实验,包括感染剂量、剂量效能、感染过程以及寿命试验。
Keywords: Nosema apis, Nosema ceranae, field methods, laboratory methods, sampling methods, infection dynamics, infection level, microscopy, species identification, standardised cage trials, inoculation methods, spore viability, cell culture, infectious dose, dose effects, course of infection, longevity tests, honey bee, BEEBOOK, COLOSS
Table of Contents
Page No.
1.
Introduction
3
2.2.3.1.
Source of bees
12
2.
Method type
3
2.2.3.1.1.
Source colonies
12
2.1.
Field methods
3
2.2.3.1.2.
Age of bees
12
2.1.1.
Colony level infection
3
2.2.3.2.
Type of cages
12
2.1.1.1
Sampling
4
2.2.3.3.
Type of food
13
2.1.1.2.
Sample size
4
2.2.3.4.
Incubation conditions
13
2.1.1.3
Clinical signs and symptoms of infection
4
2.2.4.
Inoculation methods
13
2.1.2
Colony level infection dynamics
4
2.2.4.1.
Spore source
13
2.1.2.1.
Sampling period and sampling frequency
4
2.2.4.2.
Spore suspension
14
2.1.3.
Standardising field trials
5
2.2.4.2.1.
Purification
14
2.1.3.1.
Selection of colonies
5
2.2.4.2.1.1.
Centrifugation
14
2.1.3.2
Behaviour of infected bees
5
2.2.4.2.1.2.
Triangulation
14
2.1.3.3.
Parameters to record
5
2.2.4.2.1.3.
Density Gradient
14
2.2
Laboratory methods
5
2.2.4.2.2.
Spore suspension concentration
14
2.2.1.
Colony and individual level infection
5
2.2.4.2.3.
Storage of stock suspension
15
2.2.1.1.
Spore counts
5
2.2.4.3.
Handling of bees
15
2.2.1.2.
Individual bees or pooled samples
5
2.2.4.4.
Individual feeding
15
2.2.1.3.
Parts to examine
6
2.2.4.5.
Group feeding
16
2.2.2.
Nosema species identification
6
2.2.5.
Viability control of Nosema spores
16
2.2.2.1.
Light microscopy (LM)
6
2.2.5.1.
Colouration test for spore viability
16
2.2.2.1.1.
Giemsa staining
7
2.2.5.2.
In vivo test for spore viability
17
2.2.2.1.2.
Toluidine staining
7
2.2.5.3.
In vitro test for spore viability
17
2.2.2.2.
Transmission electron microscopy (TEM)
8
2.2.6.
In vitro rearing of Nosema spp.:cell culture systems
17
2.2.2.3.
Molecular detection of Nosema spp. (N. apis , N. ceranae 8 and N. bombi)
2.2.6.1.
Infection of primary honey bee ventricular cells
17
2.2.2.3.1.
Nosema DNA extraction
9
2.2.6.2.
Infection of heterologous lepidopteran cell lines
18
2.2.2.3.2.
Multiplex PCR for detection of Nosema and differentiation between N. apis, N. bombi and N. ceranae
10
2.2.7.
Experiment type
19
2.2.2.3.2.1.
PCR reaction mix
10
2.2.7.1.
Determination of infectious does
19
2.2.2.3.2.2.
Visualization
10
2.2.7.1.1.
Study of dose effects
20
2.2.2.3.2.3.
Controls
10
2.2.7.1.2.
Effects of different infection doses
20
2.2.2.3.3.
Realtime PCR for quantification of N. apis and N. ceranae
11
2.2.7.2.
Course of infection in individual bees
20
2.2.2.3.3.1.
PCR reaction mix
11
2.2.7.3.
Longevity of infected bees
20
2.2.2.3.3.2.
Quantification
11
3.
Future perspectives
20
2.2.2.3.3.3.
Controls
11
4.
Acknowledgements
21
2.2.3.
Standardising cage trails
12
5.
References
21
Page No.
The COLOSS BEEBOOK: nosema
3
Introduction
Similarly, laboratory tests using bees in cages are often employed to
Since the description of Nosema apis in the early part of the last
2010; Martín-Hernández et al., 2009; Forsgren and Fries, 2010),
century (Zander, 1909), nosema disease, or nosemosis of honey bees
effects of parasitism on host mortality (e.g. Paxton et al., 2007),
has been regarded as a serious obstacle for profitable beekeeping in
immunity (e.g. Antúnez et al., 2009), and physiology (e.g. Dussaubat
investigate Nosema intra-host development (e.g. Higes et al., 2007;
temperate climates (Fries, 1993). With the detection of the new parasite et al., 2010; Mayack and Naug, 2009; Martín-Hernández et al., 2011),
Nosema ceranae, originally described from the Asian honey bee
as well as for testing the efficacy of potential control treatments (e.g.
Apis cerana (Fries et al., 1996), in European honey bees (Higes et al.,
Maistrello et al., 2008; Higes et al., 2011). When designing cage
2006) the need for research in this field has become urgent. In
experiments, researchers typically must control for a number of
particular, since early reports on the effects of this new parasite
variables, ranging from selection of study subjects (e.g. parasite and
suggested a more severe impact on colony health compared to infections host strains) to experimental environment (e.g. growth chamber by N. apis (Higes et al., 2008a). Following the COLOSS workshop
conditions, food quality and quantity). Although decisions typically do
“Nosema disease: lack of knowledge and work standardization” in
not jeopardize the scientific rigor of a study, they may profoundly
Guadalajara (19-22 October, 2009) data were collected on the
affect results, and may make comparisons with similar, independent
heterogeneity of methods used in Nosema research in different
studies difficult. An important consideration is that most current data
laboratories in Europe and in the USA. This survey showed the widely
on Nosema were collected from experiments with N. apis. The same
heterogeneous experimental conditions applied in the nine different
research is now needed for N. ceranae in order to assess the
participating laboratories. Even if common sense implies that some
similarities and differences between the two species.
conditions should be applied in all cases, their costs and the availability
Here we discuss some important factors that researchers must
of these analyses have to be taken into account. For example, one
consider when studying the Nosema-honey bee system using field as
could be tempted to assert that virus presence has to be checked in
well as laboratory cage experiments. This will allow researchers to
colonies providing honey bees for Nosema experiments, but some
make informed choices when developing experimental protocols and
laboratories are not equipped with virus diagnostics, and this could
will increase confidence when comparing results among studies.
restrict these teams from performing experiments on Nosema without controlling for confounding viral infections. The level and extent of diagnosis should also be specified: which viruses should be studied, is viral detection sufficient, or should virus quantification be included? Here we attempt to standardize study of the microsporidians
Nosema apis and Nosema ceranae. Nosema apis, the historical
2. Method type 2.1. Field methods 2.1.1. Colony level infection
microsporidian parasite of European honey bees, can decrease worker The degree of Nosema spp. infection in a colony has most commonly longevity and cause considerable winter colony losses (Fries, 1993),
been described through the average number of spores per bee in a
whilst N. ceranae, probably introduced into European honey bees
pooled sample (Cantwell, 1970; OIE, 2008). However, some studies
from its Asian congener (Apis cerana) within the last few decades
suggest that the best way to determine the degree of infection is to
(Higes et al., 2006; Martín-Hernández et al., 2007; Klee et al., 2007;
estimate the proportion of infected bees in the colony (L’Arrivee, 1963;
Paxton et al., 2007; Chen et al., 2008; Williams et al., 2008; Invernizzi Doull, 1965; Higes et al., 2008a; Botías et al., 2012a). Nevertheless,
et al., 2009; Currie et al., 2010; Botías et al., 2011), is associated with
there is a good correlation between the proportion of infected bees
colony depopulation and collapse in warmer areas of Europe (Higes et al., and the average number of spores in a pooled sample of bees (Fries 2008a), but not in northern parts of Europe (Gisder et al., 2010a), in
et al., 1984), but not in all cases (Higes et al., 2008a). Evaluating the
North America (Guzman-Nova, 2010; Williams et al., 2010) or in
proportion of infected bees is much more laborious than to count the
South America (Invernizzi et al., 2009). Yet because detection of
number of spores in a pooled sample, so pooled sampling will probably
N. ceranae in European honey bees coincided with recent large-scale
remain an important tool for quantifying infections in colonies.
honey bee colony losses throughout the world, data on the pathology
Because there is a wide variation in the numbers of spores found in
and management of this parasite are of significant interest.
individual bees in pooled samples, when the highest precision is
When working in the field with full-sized colonies, several
needed, it may still be motivating to investigate the proportion of
considerations need to be made, such as where to sample, how often
infected bees. The highest proportion of infected bees are found in
to sample and also the size of samples. We find, for example, that
foraging bees (Higes et al., 2008a, b; Botías et al., 2012a,b; Meana
sample sizes are often too small to satisfy a statistically reasonable
et al., 2010; Smart and Sheppard, 2011), as is the greatest infection
level of diagnostic precision (Fries et al., 1984). Please refer to the
(spores per bee) (El-Shemy and Pickard, 1989). Recent studies
section on statistics in the BEEBOOK paper on miscellaneous methods
suggest the importance of determining the proportion of infected
(Human et al., 2013) to determine sample size.
house bees to establish the viability and impact from infection on
Fries et al.
4
colonies (BotĂas et al., 2012a). Considerations regarding pooled
surrounded by only young bees have been observed in southern
sampling versus individual bee diagnosis are discussed in section
Europe (Higes et al., 2006; 2008; 2009), whereas such severe
2.2.1.2.
symptoms or effects have not been described from more temperate climates (Gisder et al., 2010a) nor from South (Invernizzi et al., 2009)
2.1.1.1. Sampling
or North (Williams et al., 2011; Guzman-Novoa et al., 2010) America.
For the diagnosis and detection of Nosema spp.-infected colonies, the
Possibly, differences in honey bee subspecies, foraging conditions,
oldest honey bees should be the target population, since they are
agricultural practices, differences in hive management practices, or
more frequently infected compared to younger bees (Meana et al., 2010; other abiotic or biotic factors may contribute to the variation in Smart and Sheppard, 2011). Forager bees can be sampled outside the symptoms described for N. ceranae infections in different regions of entrance. This method is useful in all areas during flight and foraging
the world. Further research efforts using standardized methodologies
conditions. Caution should be taken to avoid collection of young bees
are most certainly warranted.
performing their orientation flights. The time of the day of these flights could change in different geographic areas. Bees that conduct
2.1.2. Colony level infection dynamics
their orientation flights are easily recognized by the hovering
The temporal dynamics of N. apis infections in temperate climates
behaviour in large numbers outside the entrance. When this behaviour have been described by many authors (White, 1919; Borchert, 1928; is seen, attempts to sample for foragers should be avoided. During non-flight conditions, old bees may still be the target
Michailoff, 1928; Bailey, 1955; Furgala and Hyser, 1969; Furgala and Mussen, 1978), with a similar pattern in both northern and southern
population for diagnosis. To avoid sampling of newly emerged,
hemispheres (Doull and Cellier, 1961). In short, the typical infection
uninfected bees, the samples can either be taken from peripheral
exhibits low prevalence during the summer, a small peak in the
combs in the brood area, without hatching bees, or in a super above a autumn, and a slow rise of infection during the winter. In the spring, queen excluder. The variation introduced by not sampling flight bees
infections increase rapidly as brood rearing starts while flight
is unfortunate, because it reduces the possibility for meaningful
possibilities are still limited. There are few data on the temporal
comparisons between sites. Nevertheless, when samples are taken
dynamics on N. apis infections in tropical or sub-tropical climates, but
during late autumn or winter or during the active season outside of
the infection appears to be present but with low impact on colony
foraging conditions (e.g. study of infection development across the
fitness (Wilson and Nunamaker, 1983) and probably without the
year), bees from within the hive must be sampled.
pronounced temporal dynamics observed in temperate climates (Fries
To determine the degree of infection within colonies, both pooled sampling or individual sampling of bees can be used (see section
et al., 2003). For N. ceranae, few long-term studies have been performed on the temporal dynamics of this infection in honey bee
2.2.1.2). Samples should preferably be stored in the deep freezer until colonies. Studies from central Spain suggest much less variation in further processing.
infection prevalence over the season for N. ceranae compared to what has been described for N. apis (Higes et al., 2008a). However, a clear
2.1.1.2. Sample size
seasonal effect on disease prevalence, with higher prevalence and
Please refer to the statistics section in the BEEBOOK paper on
infection levels in the early season has been documented in eastern
miscellaneous methods (Human et al., 2013).
USA (Traver and Fell, 2011; Traver et al., 2012) and in untreated colonies in maritime Canada (Williams et al., 2010; 2011). There is an
2.1.1.3. Clinical signs and symptoms of infection
urgent need for long-term studies of the temporal dynamics of
The effects from N. apis infections on honey bee colonies have been
N. ceranae infections under different climatic conditions.
extensively documented (Fries, 1993). This disease is characterized (in acute forms) by the trembling of honey bee workers or dead bees
2.1.2.1. Sampling period and sampling frequency
around the hive. Bees may also exhibit a dilated abdomen and brown
To gain information on how amounts and prevalence of infections
faecal marks on the comb and the front of the hives are often found.
change over time, it is necessary to monitor changes over more than
Further, heavily infected colonies have a decrease in brood production one year. Samples should be taken with at least monthly intervals and slow colony growth, particularly in spring (Bailey, 1955; OIE, 2008). during the period when colonies can be opened without adverse Although N. apis is correlated with winter mortality of infected
effects on colony survival. For higher resolution of the temporal
colonies, the disease also appears without causing losses of infected
dynamics of infections, sampling must be bi-weekly or even weekly
colonies (Bailey, 1955). Colony level symptoms produced by
during periods of rapid change of infection prevalence, as described
N. ceranae infections have been described to be different from N. apis for N. apis during early spring. Refer to section 2.1.1.1. sampling symptoms (Higes et al., 2008; 2009). A gradual depopulation of adult honey bees. bees, higher autumn / winter colony mortality, and finally the queen
The COLOSS BEEBOOK: nosema
5
2.1.3. Standardising field trials
always report on certain standard parameters if possible, for
2.1.3.1. Selection of colonies
interpretation of the data. Such parameters include:
A main problem with field trials using free flying honey bee colonies is
Intra-hive mortality (dead bee traps; see the BEEBOOK paper
the large natural variation in size, productivity or behaviour between colonies. In comparative field trials, it is therefore advisable to minimize such variations, and if considerable variation is expected,
on miscellaneous methods (Human et al., 2013))
Colony size and population dynamics (number of bees and amount of brood, see the BEEBOOK paper on estimating
then increase the number of colonies involved. This can be achieved by using:
Artificial swarms from healthy colonies Sister queens mated the same way or instrumentally inseminated (see BEEBOOK papers on queen rearing and selection (Büchler et al., 2013) and on instrumental insemination (Cobey et al., 2013))
Adding a controlled degree of infection at the onset of the
colony strength (Delaplane et al., 2013)
Clinical signs of any diseases (see Volume II of the BEEBOOK) Varroa mite infestation (see the BEEBOOK paper on varroa (Dietemann et al., 2013))
Honey production Climatic conditions during the experiment Subspecies of honey bees used (see the BEEBOOK paper on characterising subspecies and ecotypes (Meixner et al., 2013))
experiment Adding a controlled degree of infection at the onset of the experiment
Specific management practices
can be achieved by adding a known number of bees with a documented degree of infection, either from naturally infected colonies, or from
2.2. Laboratory methods
colonies where infections have been propagated for this purpose.
2.2.1. Colony and individual level infection
Spores can also be sprayed onto combs and bees in sugar solution as
2.2.1.1. Spore counts
is done with American foulbrood spores (see the BEEBOOK paper on
To determine the degree of infection of Nosema spp. in a sample it
American foulbrood (de Graaf et al., 2013)).
has been suggested that subjective judgement on an arbitrary
Naturally infected colonies can also be used for comparative
infection scale can be used (Doull and Eckert, 1962; Gross and Ruttner,
studies after careful documentation of infection prevalence (see
1970). However, for research purposes, such estimations should not
section 2.1.1.).
be employed if some degree of precision is required. The easiest way to count Nosema spp. spores is to use a
2.1.3.2. Behaviour of infected bees
traditional haemocytometer as described in the miscellaneous
There is a need to study if the impact on behaviour and physiology
methods paper of the BEEBOOK (Human et al., 2013) and Cantwell
described from infections with N. apis also occurs during infections
(1970).
with N. ceranae. In particular, we need to find out:
Do honey bees infected by N. ceranae start their foraging activities at a younger age compared to uninfected bees, as is
Although yeast and Nosema spores reflect light differently in regular light microscopy, the use of phase contrast microscopy will avoid any misidentification (see section 2.2.2.1).
the case for N. apis infections (Hassanein, 1953)?
Do infections with N. ceranae cause a faster physiological aging of the bees, as is the case for N. apis infections (Wang and Muller, 1970)?
Do bees infected by N. ceranae feed the queen less frequently compared to uninfected bees, as is the case for N. apis infections (Wang and Muller, 1970)?
Are queen bees infected by N. ceranae superseded, as is the case for N. apis infections (Farrar, 1947)?
2.2.1.2. Individual bees or pooled samples To determine the degree of infection in colonies from pooled samples of bees, the required precision of the diagnosis should first be determined (see section 2.1.1.2). 1. Measure 1 ml of water per bee in the pooled sample. 2. Grind the required number of bees, their abdomen or ventriculus (see section 2.2.1.3.) thoroughly in water (1/3 of the measured amount) in a mortar with a pestle. 3. Add the remaining water and mix thoroughly. 4. Add a small droplet to a haemocytometer and allow spores to
2.1.3.3. Parameters to record The type of data to be collected during field experiments will vary
settle before counting (see the miscellaneous methods paper of the BEEBOOK (Human et al., 2013).
depending on the objective of the study. Field studies often involve
By examining infection in each bee in a sample, the proportion of
observing colonies and the development of disease in relation to
infected bees can be determined. For N. apis, this is a better
different treatments or management practices. It is thus advisable to
measurement than the average spore count per bee in a pooled
Fries et al.
6
sample (pool of individual bees), if the objective is to measure the influence of infection on honey yield (Fries et al., 1984). To determine the proportion of infected bees within a colony, individual bees must be examined. 1. Use 1 ml of water per bee. If other amounts of water are used it is necessary that the dilution factor is stated. Depending on the content of the bees’ intestine with sometimes massive pollen amounts, dilution may be necessary to actually see the spores in light microscopy. 2. Grind each bee, their abdomen or ventriculus separately (see section 2.2.1.3.) thoroughly in water in a mortar with a pestle. 3. Look for the presence of spores in the macerate under a microscope (see section 2.2.2.1.). The use of 96-well PCR plates with a single bee or abdomen or
Fig. 1. Posterior section of the worker honey bee alimentary canal
ventriculus per well for maceration can be useful for high throughput
and sting apparatus: A = sting apparatus; B = rectum; C = small
analysis. If using a 96-well plate, a system (manual or automatic) to
intestine; and D = ventriculus (midgut). Line = 2 mm (Dade, 2009).
guarantee that every bee or abdomen is completely macerated to release the spores to be detected needs to be developed.
It should be noted that this procedure is difficult to perform on bees
Nevertheless, there is a highly significant and positive correlation
that have been frozen and thawed.
between the proportion of infected bees and average spore counts
Because of the labour involved, the use of the ventriculus for spore
per bee. Thus, under most circumstances, the less labour intensive
counts is generally more suitable for laboratory cage experiments. For
use of pooled samples can be used, rather than determining the
field investigations of colonies, it is recommended to use samples of
infection status of at least 59 individual bees (see section 2.1.1.2. and whole bees, or abdomens of adult bees. the statistics paper of the BEEBOOK (Human et al., 2013)). Use of dead bees from the floor board of live colonies should be
2.2.2. Nosema species identification
avoided, since the correlation with the health status of the live bees is 2.2.2.1. Light microscopy (LM) too low (Fries et al., 1984).
A compund microscope using 400 X magnification is sufficient for
It remains to be determined whether the relations described here observing Nosema spp. spores in macerated bee preparations. Use of are the same for N. ceranae.
phase contrast light microscopy facilitates distinguishing spores of microsporidia from yeast or other particles.
2.2.1.3. Parts to examine
Although the differences in spore size between N. ceranae and
Although molecular evidence of N. ceranae DNA in other tissues than
N. apis are not immediately apparent in light microscopy, there is a
the ventriculus have been described, no spore production has been
consistent difference. Spores of N. ceranae are clearly smaller
demonstrated outside the epithelial cells of the ventriculus for either
compared to spores of N. apis. Fresh, unfixed spores of N. apis
of the two microsporidians concerned (Chen et al., 2009; Bourgeois
measure approximately 6 x 3 µm (Zander and Böttcher, 1984);
et al., 2012). Thus, for spore counts, the ventriculus is ideal since the
whereas, fresh spores of N. ceranae measure approximately 4.7 x 2.7 µm
amount of surplus debris is low compared to using the entire
(Fries et al., 1996) (Fig. 2). Although there is a slight overlap, with the
abdomen or the whole bee in mash preparations.
smallest N. apis spores being smaller than the largest N. ceranae spores, the average spore size of N. apis is approximately 1 µm larger
Dissecting the ventriculus: With some training, it is easy to pull the ventriculus out from CO2
in length (Fig. 2). In contrast to spores of N. apis, the spores of N. ceranae are
immobilized bees (see the section on anesthetising bees in the
often slightly bent, and appear less uniform in shape compared to
BEEBOOK paper on miscellaneous research methods (Human et al.,
N. apis spores (Fries et al., 1996; Fig. 2). Although the difference in
2013)) using forceps.
the size of spores between these species is clear, it may still be
1. Grip over the A7 abdominal dorsal and ventral segments with the forceps 2. Hold the abdomen in the other hand
difficult to detect the difference in routine diagnosis of infected bees using light microscopy. This is particularly true because mixed infections of both species can occur (Chen et al., 2009), even in
3. Slowly pull apart; the posterior portion of the alimentary canal individual bees (Burgher-MacLellan et al., 2010). comes out, sometimes with, sometimes without, the honey sac attached to the anterior end of the ventriculus (Fig. 1).
Because of their light refractive properties, spores of Nosema spp. are easily seen without contrast colouring in the light microscope in
The COLOSS BEEBOOK: nosema
7
2.2.2.1.2. Toluidine staining Toluidine staining (Fig. 3) is applied to semi thin sections of epoxy embedded tissue (section 2.2.2.2). The stained sections can be used to determine the area of interest for further processing, but also for LM observations. Toluidine stock solution is obtained from commercial sources. The 1% toluidine blue and 2% borate in distilled water needed is obtained by mixing:
1 g toluidine blue O 2 g sodium borate (borax) 100 ml distilled water 1. Dissolve the sodium borate in the water 2. Add the toluidine blue powder 3. Stir until dissolved 4. Filter the stain solution (use syringe filter) before use Note: The borax makes the stain alkaline so it will help penetrating to the epoxy sections Staining process 1. Cut semi-thin sections at 0.5 - 1.0 μm 2. Transfer sections to a drop of distilled water on a glass slide 3. Dry sections on a glass slide on a slide warmer or over a 40 W
Fig. 2. Spores of Nosema ceranae (A) and Nosema apis (B) in light
lamp
microscopy squash preparations. Bars = 5 mm. From Fries et al., 2006.
water squash preparations at 200-400 X magnifications. Methanolfixed smears contrast coloured using Giemsa staining is the standard technique for microsporidians and is described in section 2.2.2.1.1. However, the nuclei are not revealed because of the staining of the spore contents. Giemsa staining can be useful to visualize infection in tissue preparations. Another method to identify Nosema species with LM is to mount sections of material embedded for electron microscopy (section 2.2.2.2) for light microscopy after contrast colouring with toluidine blue (section 2.2.2.1.2). For a further range of colouring techniques for microsporidians see Vavra and Larsson (1999).
2.2.2.1.1. Giemsa staining Giemsa’s stain stock solution is obtained from commercial sources. The prepared staining solution is prepared fresh by diluting the stock solution 1:9 using PBS buffer (pH 7.4). 1. Apply smear onto microscope slide 2. Allow to air dry 3. Flood with 95% methanol for 5 minutes, then pour off 4. Flood with 10% buffered Giemsa (pH7.4) for 10 minutes 5. Wash carefully using tap water
Fig. 3. Toluidine staining of a semi thin section of epoxy embedded
6. Dry using filter paper
ventricular tissue.
Fries et al.
8
The number of polar filament coils is one tool that helps to differentiate between species of Nosema (Burges et al., 1974). In
N. ceranae, the number of filament coils varies between 20 and 23 in mature spores (Fries et al., 1996), whereas the number of polar filament coils in spores of N. apis is always larger and often more than 30 (Fries, 1989). The immature spores, where the filament is still developing, can be distinguished from mature spores on the less developed spore wall.
2.2.2.3. Molecular detection of Nosema spp. (N. apis , N. ceranae and N. bombi) In addition to the microscopic techniques described above, various molecular methods have been developed for the detection and identification of Nosema spp. because such molecular methods are more sensitive and species specific (Klee et al., 2006; 2007). As a consequence, it is possible to confirm the presence of Nosema (and other disease organisms) in bees using molecular techniques even when visual detection suggests its absence. Care must be exercised, though, in interpretation of results from molecular detection. Nosema may be detected molecularly in a bee, though very few spores are present in the bee and the pathogen has little or no impact on its
Fig. 4. Transmission electron micrograph of N. ceranae infected
host. In addition, vegetative forms of Nosema as well as spores can
tissue: host nucleus (HN); healthy tissue (HT); infected cell (IC);
be detected using molecular methods, whereas only spores can be
dividing stages (DS); immature spore (IS). Bar= 10 mm.
detected using visual methods. A further advantage of molecular methods, is that their extreme sensitivity of detection may provide insights into hitherto unknown modes of transmission of pathogens.
4. Cover section with staining solution (with the heat source still on) for 1-2 minutes 5. Rinse off excess stain with distilled water and air dry
The molecular techniques developed for detection of Nosema spp. in bees (i.e. N. apis, Nosema bombi, found to date only in bumble bees, and N. ceranae) are usually PCR-based (i.e. uniplex or multiplex PCR, PCR-RFLP, qPCR; see the BEEBOOK paper on molecular methods
2.2.2.2. Transmission electron microscopy (TEM)
(Evans et al., 2013), and a wide range of species-specific PCR primer
Several fixation procedures are available for studies of microsporidia
sets for these Nosema species can be found in the literature (Table 1).
infections. The following methodology has been widely used with
A test of the specificity and detection limits of nine of these primer
good results for both N. apis (Fries, 1989; Fries et al., 1992) and
sets suggests that some of them may lack specificity or exhibit low
N. ceranae (Fries et al, 1996, Fig. 4):
sensitivity (Erler et al., 2011). In addition, the use of different
1. Prefix tissue specimens for transmission electron microscopy
molecular methods or conditions across laboratories can lead to
using 4%. glutaraldehyde (v/v) in 0.067 M cacodylate buffer,
inconsistencies. For this reason, it is recommended that PCR-based
pH 7.4, for 3 days to three weeks.
screening protocols be optimized and adjusted to fit each individual
2. Keep material refrigerated (+7°C) during prefixation.
laboratory’s conditions, research and monitoring questions. To allow
3. Wash in cacodylate buffer.
comparisons across laboratories, we recommend analysis of the same
4. Post fix for 2 hours in 2% OsO4 (w/v) in 0.1 M S-colloidine buffer. homogenates of infected bees in each laboratory to account for 5. Dehydrate through ethanol series at room temperature:
differences in sensitivity, or for threshold sensitivities of detection to
5.1. 5 min. in 30% EtOH,
be reported per laboratory in terms of minimum number of spores per
5.2. 5 min. in 50% EtOH,
bee that can be detected by molecular markers.
5.3. 5 min. in 75% EtOH,
Whilst most primers are designed for conventional PCR, real time
5.4. 5 min. in 95% EtOH,
PCR (qPCR or quantitative PCR, see the BEEBOOK paper on molecular
5.5. 3 X 10 min. in 100% EtOH,
methods (Evans et al., 2013)) primers and protocols for quantification
5.6. 3 X 10 min. in 100% propylene oxide.
of N. ceranae and N. apis have also been developed (Table 1),
6. Embed in epoxy resin (Agar 100) by routine procedures for
including primers that quantify both species in one reaction
electron microscopy.
(Martín-Hernández et al., 2007). As for standard PCR, primer sets for
The COLOSS BEEBOOK: nosema
9
Table 1. List of primer sets available for the detection of Nosema spp. in bees by PCR. Fragment size (bp) Name
Source
218MITOC
Martín-Hernández et al. 2007
321APIS
Martín-Hernández et al. 2007
BOMBICAR
Plischuk et al. 2009
ITS
Klee et al. 2006
N.b.a
Erler et al. 2011
Nbombi-SSU-J
Klee et al. 2006
NOS
Higes et al. 2006
NosA
Webster et al. 2004
SSU-res
Klee et al. 2007
NaFor NcFor UnivRev
Forsgren and Fries 2010
Nosema
Chen et al. 2008
N. ceranae
Chen et al. 2008
N. apis
Chen et al. 2008
Nos-16S
Stevanovic et al. 2011
Mnceranae-F Mnapis-F Mnbombi-F Muniv-R SSUrRNA-f1b SSUrRNA-r1b
This report
Tay et al 2005
Primer sequence (5’-3’) fwd rev fwd rev fwd rev fwd rev fwd rev fwd rev fwd rev fwd rev fwd rev fwd(a) fwd(c) Urev fwd rev fwd rev fwd rev fwd rev fwd fwd fwd Urev Ufwd Urev
CGGCGACGATGTGATATGAAAATATTAA CCCGGTCATTCTCAAACAAAAAACCG GGGGGCATGTCTTTGACGTACTATGTA GGGGGGCGTTTAAAATGTGAAACAACTATG GGCCCATGCATGTTTTTGAAGATTATTAT CTACACTTTAACGTAGTTATCTGCGG GATATAAGTCGTAACATGGTTGCT CATCGTTATGGTATCCTATTGATC TGCGGCTTAATTTGACTC GGGTAATGACATACAAACAAAC CCATGCATGTTTTTGAAGATTATTAT CATATATTTTTAAAATATGAAACAATAA TGCCGACGATGTGATATGAG CACAGCATCCATTGAAAACG CCGACGATGTGATATGAGATG CACTATTATCATCCTCAGATCATA GCCTGACGTAGACGCTATTC GTATTACCGCGGCTGCTGG CTAGTATATTTGAATATTTGTTTACAATGG b TATTGTAGAGAGGTGGGAGATT GTCGCTATGATCGCTTGCC GGCAGTTATGGGAAGTAACA GGTCGTCACATTTCATCTCT CGGATAAAAGAGTCCGTTACC TGAGCAGGGTTCTAGGGAT CCATTGCCGGATAAGAGAGT CACGCATTGCTGCATCATTGAC CGTAGACGCTATTCCCTAAGATT CTCCCAACTATACAGTACACCTCATA CGTTAAAGTGTAGATAAGATGTT GCATGTCTTTGACGTACTATG TTTATTTTATGTRYACMGCAG GACTTAGTAGCCGTCTCTC CACCAGGTTGATTCTGCCT TGTTCGTCCAGTCAGGGTCGTCA
N.a.
N.b.
locus
use
SSU rRNA
qPCR
SSU rRNA
qPCR
SSU rRNA
PCR
ITS region
PCR
SSU rRNA/ITS
PCR
511
SSU rRNA
PCR
323
SSU rRNA
PCR
240
SSU rRNA
PCR
209
SSU rRNA
PCR
402
LSU rRNA
qPCR
278
N.c. 218-219
321 101 120
120
120
252
402
402
316 SSU-rRNA
generic
208
SSU-rRNA
PCR
SSU-rRNA
PCR
401a
SSU rRNA
PCR
488
SSU rRNA
PCR
212 250a
488
143 171 224 SSU rRNA
generic
ca.
ITS: internal transcribed spacer region; SSU: small subunit rRNA (16S rRNA); N.a.: Nosema apis; N.b.: Nosema bombi; N.c.: Nosema ceranae. a
Fragment size could not be verified. bSequence modified to complement original GenBank entry U97150.
Use: PCR, standard PCR (for the detection of different Nosema spp.); qPCR, for quantitative or real time PCR (for the quantification of different Nosema spp.) and standard PCR (for the detection of different Nosema spp.); generic, primers amplify all known Nosema spp. or all Microsporidia without differentiating among species. qPCR need to be tested in each laboratory for sensitivity and reliability 2.2.2.3.1. Nosema DNA extraction (see also Bourgeois et al., 2010; Burgher-MacLellan et al., 2010;
DNA extraction can be performed from specific tissue (e.g. ventriculus,
Hamiduzzaman et al., 2010; Traver and Fell, 2012 and the molecular
rectum, fat body), subdivided bee sections (e.g. metasoma), whole
paper of BEEBOOK by Evans et al., 2013).
bees, or homogenates from pooled samples (see the BEEBOOK paper
Here we report the use of a multiplex PCR-based method that is able to detect and differentiate simultaneously the three Nosema species of high prevalence in European bee populations (N. apis,
on bee anatomy and dissection (Carreck et al., 2013)).
Nosema DNA extraction from bee homogenates: 1.
Crush fresh or flash frozen tissue to generate a homogeneous
N. bombi and N. ceranae) using genomic DNA. Microsporidia from
homogenate of bee/bee guts. For example,
genera other than Nosema are known from bees, where they can be
1.1. place a maximum of 30 bees in a filter grinding bag (e.g.
very abundant (see Paxton et al., 1997; Li et al., 2012). To capture all
extraction bags from BIOREBA AG, Switzerland).
of these Microsporidia, it is advisable to PCR amplify microsporidian
1.2. Add 0.5 ml (DNAase/RNAase free) ddH2O per bee.
DNA using ‘generic’ primers (see Table 1) and then sequence PCR
1.3. homogenize the mixture using a homogenizer (e.g.
products, which can be laborious and expensive. Here we present a much faster and cheaper method in which we combined multiple primers based on the 16S ribosomal rRNA gene into a single reaction to simultaneously detect N. apis, N. bombi and N. ceranae in bees.
Homex6 from BIOREBA AG; Switzerland). 1.4. Flash-freeze in liquid nitrogen is possible prior to homogenization to aid in mechanically breaking open cells. 1.5. Crush the sample.
Fries et al.
10
Without access to a robot, one can use a pestle to crush the bee
1 μl of DNA extract (ca. 1 ng)
tissue. 2. Transfer 100 µl of the liquid homogenate into a microcentrifuge tube and centrifuge for 3 min at 16,100 g to precipitate the microsporidia and other cellular material. 3. Discard the supernatant. 4. Freeze the pellet by using liquid nitrogen. 5. Crush using a pestle until pulverized (in order to break open
Nosema spore walls). 6. Repeat steps 4 and 5 two or three times so that Nosema DNA goes into solution. 7.
2.2.2.3.2.1. PCR reaction mix
Use the DNeasy® Plant Mini kit protocol (Qiagen) following the Mini protocol for plant tissue to extract DNA from the homogenate.
Other non-proprietary DNA extraction protocols (e.g. those using phenol/chloroform; chelex resin; Tay et al. 2005) were used with poor success, possibly because bee guts contain plant secondary compounds and tissue may be in a state of decay due to poor preservation. Research on other extraction techniques (e.g. using CTAB) is needed to provide cheaper yet efficient methods for the extraction of Nosema DNA from bees. 8. Complete the final elution step in 100 µl of 0.01M Tris (pH 7.5) buffer. The same Qiagen protocol can also be implemented in the QiaCube (Qiagen) for automated DNA extraction.
2.2.2.3.2. Multiplex PCR for detection of Nosema and differentiation between N. apis, N. bombi and N. ceranae For multiplex PCR amplification of partial 16S rRNA (= SSU rRNA)
0.5 U of GoTaq® polymerase (Promega) 2x GoTaq® reaction buffer (3mM MgCl2 final concentration, Promega)
0.3 mM of each dNTP (dNTP mix from Promega) 0.4 μM of Mnceranae F 0.4 μM of MnapisF 0.5 μM of Mnbombi-F 0.5 μM of Muniv-R H2O as required, to make up to a 10 μl total volume. Amplification is carried out on a thermocycler (e.g. TProfessional Biometra) using the following conditions: 1. Initial denaturation step of 95oC for 2 min, 2. 35 cycles of (95oC for 30 s, 55oC for 30s and 72oC for 60 s), 3. Final extension step of 72oC for 5 min. Each laboratory might have to optimise de novo primers, protocols and PCR conditions. 2.2.2.3.2.2. Visualization 1. Resolve the amplification products 2. Visualize in a QIAxcel electrophoresis system with a QIAxcel DNA high resolution kit (QIAGEN) 3. Analyse using the QIAxcel ScreenGel software (v1.0.0.0).
gene fragments, we recommend the following primer combination, though others from Table 1 (standard or qPCR primers) may be more suitable for different purposes and in different laboratories:
The resolution method is:
OM700 (3-5 bp), QX DNA Size Marker: 25 bp-450 bp,
Primers were designed based on alignment of all available sequence data in GenBank of the 16S rRNA gene from N. apis, N. bombi and
N. ceranae.
QX Alignment Marker: 15 bp/400 bp. Typical results are presented in Fig. 5. As a cheaper alternative, PCR products can be resolved in a 1-2%
Mnapis-F
forward primer: 5’-GCATGTCTTTGACGTACTATG-3’
Mnbombi-F
forward primer: 5’-TTTATTTTATGTRYACMGCAG-3’
Mnceranae-F
forward primer: 5’- CGTTAAAGTGTAGATAAGATGTT-3’
Muniv-R:
reverse primer: 5’- GACTTAGTAGCCGTCTCTC-3’
Note that the Mnbombi-F primer contains variable sites to account for the sequence diversity observed for this species. PCR product size:
for N. ceranae: 143 bp
agarose gel with suitable size marker and then visualised by staining with ethidium bromide and photographing on a u/v transilluminator (see the BEEBOOK paper on molecular methods (Evans et al., 2013). 2.2.2.3.2.3. Controls Attention needs to be given to the use of controls when undertaking DNA extractions and PCR amplifications to avoid false positives (detection of a band of the appropriate size when a Nosema species was not present) and false negatives (absence of a band of the appropriate size because of poor extraction or poor PCR set-up despite a Nosema species being present). We recommend using
for N. bombi: 171 bp
newly emerged honey bees as ‘negative controls’ because such bees
for N. apis: 224 bp
are not infected with N. apis or N. ceranae at emergence although for
The COLOSS BEEBOOK: nosema
11
Fig. 5. PCR products of Nosema-infected bees from which DNA has been extracted and amplified by PCR using the multiplex primer mix Mnapis F, Mnbombi F, Mnceranae F and Muniv-R to reveal N. apis, N. bombi and N. ceranae: 1. N. apis + N. bombi + N. ceranae; 2. N. apis +
N. ceranae; 3. N. apis + N. bombi; 4. N. ceranae + N. bombi; 5. N. apis; 6. N. bombi; 7. N. ceranae; 8. Control, no template; 9. Apis mellifera negative control; 10. Bombus spp. negative control; 11. size ladder.
N. ceranae vertical transmission of infection has recently been
mastermix as below for quantification of N. ceranae for each sample,
suggested (Traver and Fell, 2012). Greater care needs to be given to
using either NaFor or NcFor respectively.
negative controls for N. bombi in bumble bees as this microsporidian
SsoFastTM EvaGreen® Supermix (BioRad) 1 x
may be transmitted transovarially from queen to offspring (Rutrecht
NaFor or NcFor primer
0.4 µM
UnivRev primer
0.4 µM
H20
6.4 µl
Sample DNA extract
2 µl (ca. 2 ng DNA)
and Brown, 2008). For positive controls, it is best to use adult bees that have been experimentally infected with spores and to confirm visually that spores are present in the homogenate before DNA extraction.
2.2.2.3.3.2. Quantification
2.2.2.3.3. Realtime PCR for quantification of N. apis and Amplification and data acquisition are carried out in a MiniOpticon® N. ceranae Molecular quantification of N. apis and N. ceranae allows both relative (Bio-Rad) real-time PCR machine using the following program: quantification of the two Nosema species or their absolute quantification per bee or per sample, which can be of considerable interest for studies of the interactions between these two pathogens. However, molecular quantification requires use of a real-time PCR
1. Initial enzyme activation step: a. 98°C for 15 min 2. Followed by 40 cycles of:
machine; these machines are currently relatively expensive and they
a. denaturation at 98°C for 5 sec
require calibration with dilution series of N. apis and N. ceranae to
b. annealing/extension at 63°C for 10 sec
generate accurate quantification.
c. melt curve analysis from 65-95°C (in 0.5°C increments)
Several realtime PCR machines are on the market, each
10 sec/step
employing different fluorophore chemistries for molecular quantification. Here we present a method based on Forsgen and Fries
Specificity and the absence of non-specific amplification are
(2010) that uses a BioRad MiniOpticon real-time PCR machine and
determined based on the melting temperature (Tm) of the amplified
EvaGreen chemistry for quantification as it has functioned well in
products (see also molecular methods paper of the BEEBOOK (Evans
several laboratories.
et al., 2013)).
2.2.2.3.3.1. PCR reaction mix
2.2.2.3.3.3. Controls
PCRs use a 20 µl final volume and should be set up as follows for the
For controls, the criteria and warnings provided previously for
quantification of either N. apis or N. ceranae using primers from
standard PCR for the detection of Nosema spp. are applicable
Forsgen and Fries (2010) in Table 1. Set up one mastermix as below
(section 2.2.2.3.2.3). For quantification, N. apis and N. ceranae
for quantification of N. apis for each sample and set up another
recombinant amplicons should be used as external standards. Set up
Fries et al.
12
a standard curve using serial dilutions of recombinant target DNA -2
those pollinating agricultural crops, should not be used. Nosema also
-8
fragments ranging from 10 to 10 and include them as quantification interacts with viruses (Bailey et al., 1983; Costa et al., 2011); but standards in every PCR run (see also the BEEBOOK paper on
because colonies with asymptomatic viral infections are nearly
molecular methods (Evans et al., 2013)).
ubiquitously distributed (e.g. Tentcheva et al., 2004; Williams et al., 2009), colonies without symptomatic individuals will suffice. If
2.2.3. Standardising cage trials
possible, titre levels of common honey bee viruses, in particular
This section contains information on methodologies specifically for
deformed wing and black queen cell viruses, should be quantitatively
performing laboratory investigations of the adult European honey
assayed in bees from potential source colonies, as described by de
bee-Nosema system. Additional details on general methodologies for
Miranda et al. (2013) in the virus paper of the BEEBOOK.
maintaining European honey bees in the laboratory are described by Williams et al. (2013) in the laboratory cages paper of the BEEBOOK.
2.2.3.1.2. Age of bees The age when honey bees are inoculated with Nosema spores may
2.2.3.1. Source of bees
also influence parasite development and virulence due to changes in
General details on selecting bees and colonies for experiments can be
honey bee immune response (Amdam et al., 2005) and morphology
found in the BEEBOOK papers by Williams et al. (2013) and Human
(Rutrecht et al., 2007) as bees grow older. However, no such
et al. (2013). Details specific to Nosema investigations are discussed
influence has been studied for Nosema spp. to our knowledge, and
here. See the BEEBOOK paper on maintaining bees in cages (Williams
handling of very young bees for spore inoculation may damage the
et al., 2013) for information on how to obtain honey bees for
bees and reduce longevity. It is generally advisable to initiate inoculations
experiments.
when the bees are a few days old (2-5 days).
For every experiment state:
2.2.3.2. Type of cages
1. The subspecies of European honey bee used because of there Numerous cage designs exist for maintaining honey bees in the may be genetic variation for disease resistance (Evans and
laboratory and for performing experiments (see Williams et al. (2013)
Spivak, 2010).
in the BEEBOOK). Despite this diversity, it is necessary that cages
2. The time of year the experiment was performed because bee physiology can differ seasonally, in particular between summer and winter (Fluri et al., 1977), but also when brood rearing declines (Amdam et al., 2009). Further considerations: 1. Cage replicates should be performed during the same season to allow for easier comparison of data. 2. Bees from multiple colonies should be used to ensure that the
meet basic criteria described by Williams et al. (2013).
Vital for Nosema studies, cages must be used once and discarded, or sterilized if used multiple times, to prevent contamination by Nosema spores. Multiple-use cages should be made from materials that are easily autoclaveable such as stainless steel and glass because spores of N. ceranae in PBS can only be confidently destroyed by exposure to 121°C for
particular question being asked is relevant to honey bees in
30 minutes (Fenoy et al., 2009). Dry sterilisation of wooden
general (see Human et al. (2013) and Williams et al. (2012)).
cages (i.e., 80°C for 1 hr.) destroys viability of N. apis spores
3. Use a sufficient number of replicate cages per treatment (see
(Cantwell and Shimanuki, 1969); this method is also probably
Human et al. (2013) and Williams et al. (2012)). Bees from all colonies should be homogenized among cages to
effective for N. ceranae, although it remains to be verified.
To reduce risk of contamination by Nosema spores among
eliminate effect of ‘colony’, thereby leaving only ‘cage’ as a random
individuals differentially treated and maintained in the same
factor.
incubator, cages should be placed sufficiently apart. If screens or holes are used to provide ventilation, they should face in
2.2.3.1.1. Source colonies
opposite directions.
Colonies should be ‘healthy’, and quantitatively and qualitatively assessed, as described above and elsewhere in the BEEBOOK (the
Additional materials, such as comb (e.g. Czekońska, 2007) and plastic
paper on estimating colony strength (Delaplane et al., 2013)), to
strips for releasing queen mandibular pheromone (e.g. Alaux et al.,
demonstrate zero or low infection of major pathogens or parasites,
2010a), are sometimes used during laboratory experiments. Although
including N. apis, N. ceranae (this paper), and the mite Varroa
queen mandibular pheromone probably promotes honey bee health
destructor (see the BEEBOOK paper on varroa (Dietemann et al., 2013)). and reduces stress of the caged individuals, its effect on Nosema Because Nosema interacts with pesticides (Alaux et al., 2010a),
development is not understood and therefore its use should be
colonies likely to be exposed to high levels of agro-chemicals, such as
avoided until our knowledge is improved.
The COLOSS BEEBOOK: nosema
13
2.2.3.3. Type of food
conditions can have a large influence on both host susceptibility and
Because diet can affect honey bee longevity (Schmidt et al., 1987),
parasite virulence (e.g. Kraus and Velthuis, 1997; Ferguson and Read,
immune response to Nosema infection (Alaux et al., 2010b), as well
2002; McMullan and Brown, 2005). Although few data exist on the
as spore development (Porrini et al., 2011), it is important to carefully effects of specific temperatures on Nosema parasitism in honey bees, consider food provided to experimental bees. Generally, researchers
it is clear that intra-host development of both parasites in European
should attempt to maintain their honey bees as healthy as possible.
honey bees, as well as spore viability, can be affected by temperature
Honey bees are capable of surviving for long periods of time on
(e.g. Malone et al., 2001; Fenoy et al., 2009; Martín-Hernández et al.,
50% (weight/volume) sucrose solution (Barker and Lehner, 1978); however, to ensure normal development of internal organs and glands
2009; Fries, 2010; Higes et al., 2010). Adult workers should be maintained in complete darkness at 30°C
(Pernal and Currie, 2000), as well as proper immune response (Alaux
and approximately 60-70% RH in a growth chamber or incubator with
et al., 2010b), supplementing a strict carbohydrate diet with protein,
adequate ventilation. A data logger should be used to record both
and even nutrients such as vitamins and minerals, is recommended
temperature and relative humidity within the incubator during the
for maintaining honey bees in the laboratory. Bee-collected pollen
course of each experiment. These data will ensure adequate conditions
provides an adequate medium for providing protein and nutrients
were maintained, and may explain deviations from expected results
(Brodschneider and Crailsheim, 2010); however, such material may be during changes in incubator conditions as a result of mechanical contaminated with Nosema spores (Higes et al., 2008b) or pesticides
problems or changes in ambient conditions. See the BEEBOOK chapter
(Pettis et al., 2012). Additionally, it is possible that pollen may stimulate on maintaining workers in cages (Williams et al., 2013) for more
N. ceranae development by promoting bee health (Porrini et al., 2011). details. Therefore, in addition to ad libitum 50% (weight/volume) sucrose solution (i.e. 100 g table sugar dissolved in 100 ml tap water),
2.2.4. Inoculation methods
individuals should be provided with an easily accessible source of
2.2.4.1. Spore source
multi-floral, radiation sterilised, bee-collected pollen ad libitum as
As with other parasites (Ferguson and Read, 2002), including
described by Williams et al. (2013) and Human et al. (2013) in the
N. bombi in bumble bees (Bombus spp.) (Tay et al., 2005) and
BEEBOOK.
bacterial diseases in honey bees (Genersh et al., 2005; Charriere et al,
Further studies are needed to investigate the effects of commercial pollen substitutes on Nosema development and individual
2011), it is possible that genetic variants detected in both N. apis and
N. ceranae (Williams et al., 2008; Chaimanee et al., 2010; Sagastume
bee health before they should be considered as a replacement for bee et al., 2011) may at least partially explain differences in host collected pollen. To sterilize for N. apis spores, pollen can be exposed to ≥0.2x106 rads gamma radiation from cobalt-60 (Katznelson and Robb, 1962) or
susceptibility and parasite virulence. Future studies should seek to identify genes responsible for Nosema epidemics (Chen and Huang, 2010). Based on differences in reported pathology of Nosema species
heat treated at 49°C for 24 hours (Cantwell and Shimanuki, 1969). On around the world, researchers should state the region and country the other hand, very little is known about the factors responsible for
spores originated from. It is recommended that spores be sourced
making N. ceranae spores non-viable in bee products. N. ceranae will
from multiple colonies.
lose viability during freezing (Forsgren and Fries, 2010), but it is more
When creating inoculums, it is important to use fresh spores
resistant to heat than its congener (Fenoy et al., 2009). It is likely
because their viability is lost over time when spore suspensions are
that temperatures and/or exposures higher than required for N. apis
stored. In particular, this is true for N. ceranae isolates, which rapidly
spore destruction will also render N. ceranae spores non-viable. As a
lose viability in the refrigerator and almost completely lose infection
result, a combination of heating and freezing pollen may be possible
capacity after freezing of spores (Fenoy et al., 2009; Fries, 2010). See
to develop as an alternative to radiation for sterilising bee-collected
section 2.2.5. for viability test procedures. Group feeding of caged
pollen of Nosema spores. Specific protocols need to be developed for
bees using crushed bees infected with the respective Nosema spp. in
this purpose because to date we only know that one week of freezing
sugar solution is a good way to propagate spores for experiments
kills approximately 80% of N. ceranae spores (Fries, 2010), and we
(see sections 2.2.4.4. and 2.2.4.5. for details on individual and group
do not know what temperatures will reduce the nutritive value of
feeding, respectively). After 10-12 days, spore-inoculated bees from
pollen.
cages maintained in appropriate conditions (section 2.2.3.4) can be extracted and the ventriculi used for preparations of spore suspensions
2.2.3.4. Incubation conditions
according to methods described previously (section 2.2.1 and 2.2.4.2).
Researchers should attempt to maintain their experimental bees in
Molecular assays previously described (section 2.2.2.3) should be
optimal conditions for both host and parasite, and should consider the employed to ensure the proper species of spore is used for inoculations possible effects of growth chamber conditions, as environmental
because mixed infections occur, even in naturally-infected individual
Fries et al.
14
bees (Burgher-MacLellan et al., 2010). Prepared spore suspensions can
3. Centrifuge supernatant for five minutes at 300 G to pellet the
be used the next day when kept in sugar solution in the refrigerator
spores, and again transfer supernatant fluid to another tube
(section 2.2.4.2.3).
and resuspend the lower stationary phase. 4. Repeat procedure three times.
2.2.4.2. Spore suspension
5. Combine resuspended lower strata created from each
A suspension of spores obtained as described previously (e.g. 1 infected
centrifugation to yield a spore suspension with a purity
bee ventriculus in 1 ml water; section 2.2.1.) can be filtered using
greater than 99% (Cole, 1970).
sterile 74 Âľm sized mesh to remove large pieces of host materials. After filtration, 1-5 mM pH 9.0-buffered ammonium chloride (NH4Cl)
2.2.4.2.1.3. Density gradient
can be added to the filtrate to inhibit spore germination.
The most commonly used density gradient substrates used for
However, sometimes a high purity of spores is needed. Purification microsporidian spore purification are sucrose, sodium chloride, cesium can remove unwanted host tissues and microbial contaminants that
chloride, and two silica colloids: Ludox HS40 and Percoll. The density
may confound experimental data, and can also facilitate accurate
gradient can be continuous or discontinuous (i.e. stratified), heaviest
microscopic counting.
at the bottom and lightest at the top, thus allowing purified particles to be located at specific regions of the density gradient. Among all
2.2.4.2.1. Purification
density gradient media, Percoll is frequently used for Nosema spore
The purpose of purifying a spore suspension is to remove unwanted
purification because it offers many advantages, including: 1. Ease of
host tissues and microbial contaminants that may confound
preparation; 2. Low viscosity, permitting rapid sedimentation at low
experimental data. A high purity of spores can facilitate accurate
speed centrifugation; 3. Low osmolarity and no toxicity; 4. Excellent
microscopic counting and is an important quality assurance parameter stability under any autoclaving sterilization conditions (Fig. 6). in pathological studies. A number of purification methods describe below give high purity preparations, and the choice of purification method depends upon the specific requirements and applications of
Purification procedure with Percoll substrate 1. Gently overlay the Nosema spore suspension on a
spore suspension. For in vivo feeding assays, it is sufficient to purify
discontinuous Percoll (Sigma-Aldrich; St. Louis, USA) gradient
spores using filtration and centrifugation techniques. Alternatively,
consisting of 10 ml each of 25, 50, 75, and 95% Percoll
methods of triangulation or density gradient purification, in addition to
solution from top to bottom, respectively.
initial filtration, are recommended for experiments that require a very
2. Centrifuge the column at 10,000 G for 20 minutes at 4oC.
high level of spore purity. Note that amount of water added to
3. Discard the supernatant.
resuspend the pellet will affect the spore concentration and the final
4. Re-suspend the pellet in sterile water.
concentration of the inoculum must therefore be checked using a
5. Repeat the process 3 times.
haemocytometer (see section 2.2.1.1. and the BEEBOOK paper on
6. Overlay the spore suspension on 20 ml 100 % Percoll
miscellaneous methods (Human et al., 2013).
solution. 7. Centrifuging the column at 3,000 G for 2-3 minutes to pellet
2.2.4.2.1.1. Centrifugation
the lighter cellular debris and leave the spores on the top of
1. Centrifuge spore suspension at 5,000 G for five minutes to produce a pellet of spores.
Percoll solution. 8. Dilute the 100% Percoll solution by adding the equal amount
2. Discard supernatant containing tissue debris that is lighter
of water and pellet the spores by centrifugation at 10,000 G
than spores. 3. Resuspend the pelleted spores in distilled water by vortexing
for 15 minutes. 9. Re-suspend the spore pellet in 2-5 ml sterile water to produce
for five seconds.
a spore suspension with a purity of greater than 99% (Chen
et al., 2009).
Repeat the centrifugation 2-3 times to wash spores and to create a
Nosema spore suspension with over 85% purity level. 2.2.4.2.2. Spore suspension concentration 2.2.4.2.1.2. Triangulation
Dilution of the purified spore suspension to the desired concentration
1. Centrifuge spore suspension at 300 G for five minutes to form can be performed using the formula: C1V1 = C2V2 where: C1 = initial a spore pellet which contains two strata, the upper
concentration; V1 = initial volume; C2 = final concentration; V2 = final
supernatant fluid and the lower stationary phase containing
volume.
most of spores. 2. Transfer supernatant fluid to another tube using a pipette, and resuspend lower stationary phase using sterile water.
For example, if you want to feed 10,000 Nosema spores in 10 Âľl 50% (weight/volume) sucrose solution, you must, as determined by proportions, create a final spore concentration of 1,000,000 spores / ml
The COLOSS BEEBOOK: nosema
15
to create a final spore suspension in approximately 50% sucrose solution. Example 2. 12,456,000 spores/ml water, then 0.8 ml of initial spore suspension must be added to 9.2 ml 54.3% (w/v) sucrose solution. Control suspensions to infected control bees should be created using uninfected individuals from the same colonies the spores were sourced from.
2.2.4.2.3. Storage of stock suspension It should be emphasised that for infection experiments, newly made up spore suspensions should be used, prepared the same day or the day before the experiment and kept in the refrigerator. For N. apis, storage of spores for later preparations of new suspensions can be made by freezing adult infected bees or already prepared spore suspensions. For N. ceranae the situation is drastically different since the spores rapidly loose viability if frozen (Fenoy et al., 2009; Fries, 2010). A protocol needs to be developed whereby infective spores of Fig. 6. The Percoll gradient will be constructed by layering 95%, 75%, 50% and 25% Percoll solution from bottom to top in a 50 ml ultracentrifuge tube. The spore suspension will be overlayed onto the gradient and centrifuged. After centrifugation, the supernatant will be removed and the spore pellet will be suspended in sterile water. After two or three times purification on Percoll gradient, the resulting pellet will contain very pure spores.
N. ceranae can be reliably stored over longer periods without serious loss of viability.
2.2.4.3. Handling of bees Bee caste, activity level, and personal comfort level will dictate what devices are used to manipulate bees. Most importantly, bees should not be crushed, so particular attention must be placed on ensuring sensitive and more fragile parts of the bee such as the abdomen, antennae, eyes, and mouthparts, are not disturbed or damaged. A
of 50% (w/v) sucrose solution. To create 10 ml of this final spore suspension in 50% sucrose solution when your initial spore suspension is:
honey bee that is damaged or has stung should be replaced. In most cases, use of anaesthesia to handle honey bees is not
Example 1. 10,000,000 spores/ml water, then 1 ml of initial spore
required, and generally not recommended because of the difficulty of
suspension must be added to 9 ml 55.6% (w/v) sucrose solution. See
ensuring a consistent dosage is given to bees and because of possible
below for specific details:
effects on the behaviour, physiology, and development of insects (Czekonska, 2007; Ribbands, 1950; Rueppell et al., 2010). If
Calculating initial volume of spore-water suspension needed
anaesthesia is used, a consistent dosage should be provided to all
1. C1V1 = C2V2
experimental bees. Further details on handling and anaesthetising
2. V1 = C2V2/C1
bees are provided in the BEEBOOK chapter on miscellaneous methods
3. V1 = 1,000,000 spores per ml X 10 ml / 10,000,000
Human et al. (2013).
spores per ml 4. V1 = 1 ml
2.2.4.4. Individual feeding
Calculating initial concentration of spore-free sucrose solution
Many Nosema laboratory experiments individually feed bees with an
needed*
inoculum to ensure that bees are exposed to a known quantity of
1. C1V1 = C2V2
spores (e.g. Higes et al., 2007; Paxton et al., 2007; Maistrello et al.,
2. C1 = C2V2 / V1
2008; Forsgren and Fries, 2010). The volume of the inoculum can be
3. C1 = 50 g sucrose per 100 ml water X 10 ml final sucrose
5 to 10 ml, amounts that are readily consumed by bees. Individual
solution / 9 initial sucrose solution 4. 55.56 g sucrose per 100 ml water
feeding of spores produces significantly lower variation in response infection level compared to group feeding of spores (Furgala and
*An initial concentration of spore-free sucrose solution of 50% is
Maunder, 1961) and should be preferred for most experimental
generally adequate when a low volume of spore suspension is added
purposes until further investigations comparing group versus individually
Fries et al.
16
fed honey bees occurs. As with other laboratory procedures concerning
caged individuals because of unequal distribution of the inoculum
Nosema, it is important to minimize chances of contamination by
among individuals over time (Furgala and Maunder, 1961).
setting up sterile feeding stations unique to each treatment group. To
Preliminary studies suggest group feeding is as effective at infecting
individually inoculate honey bees with Nosema spores, refer to the
caged bees as individual inoculation (Tanner et al., 2012). Greater
BEEBOOK chapter on maintaining bees in vitro (Williams et al., 2013).
cage replicates per treatment group may be required if group feeding
Specifically for Nosema studies, experimental bees should be
of inoculum is used. Group inoculation of a spore suspension
starved in hoarding cages for two to four hours by removing all
containing 10,000 and 33,300 spores per bee is sufficient to infect
feeding devices to ensure that the entire inoculum is ingested quickly
caged individuals (Webster, 1994; Pettis et al., 2012).
(e.g. Fries et al., 1992; Malone and Stefanovic, 1999; Higes et al., 2007;
Further details on group feeding are provided in the BEEBOOK
Maistrello et al., 2008). Bees destined for each treatment group
chapter on maintaining bees in cages (Williams et al., 2013). For
should be maintained in separate hoarding cages to avoid the
Nosema, for example, to mass inoculate 100 honey bees with
possibility of contamination during the removal of individuals for
approximately 10,000 Nosema spores per bee:
feeding. Because feeding can require considerable time depending on the number of bees to be inoculated and the number of persons available to feed spores, it may be necessary to house bees for each
1. Provide 1,000,000 spores in 4 ml 50% (w/v) sucrose solution to guarantee that the entire volume will be consumed within approximately 24 hours.
treatment group in multiple cages that can be starved in different
This short time period will ensure a similar initial inoculation period for
time blocks to ensure that all individuals are without food for a similar
all individuals, and help prevent bacterial degradation of unconsumed
period of time. Pre-trials will determine how much time is required for
spores from occurring.
feeding, but generally it should take one to two minutes per bee.
2. Top up the feeder with 50% (w/v) sucrose solution when the
Additionally, and depending on the time required to feed all
inoculation solution is close to empty so that the caged honey
experimental bees, it may be prudent to rotate feeding amongst
bees do not go without food.
treatment groups so that, for example, not all bees from one
To ensure all spores are ingested, small volumes can be regularly
treatment group are fed in the morning whereas bees from a second
added throughout the day until one is confident that most spores
treatment group are fed in the afternoon. See previously discussed
have been consumed.
subsections within section 2.2.4., as well as section 2.2.7., for creating and choosing specific spore suspensions.
When cultivating Nosema spores, live bees can be killed 10 to 14 days post-inoculation, approximately when a full N. apis infection is
Once inoculated, bees can be placed into a 1.5 ml microcentrifuge reached (Fries, 1988), using methods described by Human et al. (2013) tube with a breathing hole at the end in suitable growth chamber
in the BEEBOOK.
conditions in detail below for 20 to 30 minutes to ensure that spores are not transferred among bees (see Williams et al., 2012) (Kellner
2.2.5. Viability control of Nosema spores
and Jacobs, 1978; Verbeke et al., 1984). Afterwards, the bee can be
The viability of spores to be tested is rarely checked, although it is a
placed in an appropriate treatment hoarding cage. The provided
crucial point to ensure the reliability and reproducibility of the results.
description can be applied to inoculating all castes. However, drones
In particular regarding N. ceranae, it can be considered as a key point
and queens can be transferred to appropriate treatment cages
because of the high sensibility to cold temperatures of N. ceranae,
immediately after feeding because they are only recipients during
spores (Forsgren and Fries, 2010). N. apis spores also loose infectivity
trophallaxis (Crailsheim, 1998)..Future studies should determine
after freezing, but in a matter of years (Bailey, 1972) rather than a
whether this is required as some debate exists regarding the
week as shown for N. ceranae (Fries, 2010).
frequency that newly emerged bees in cages engage in trophallaxis (Crailsheim, 1998).
Spore viability can be tested using three methods: colouration and infectivity tests (in vivo and in vitro). The advantage of colouration is that suspensions can be checked before use, in vivo tests are useful
2.2.4.5. Group feeding
for confirmation of spore viability used for infection experiments.
In contrast to inoculating individual bees with Nosema spores as described above, inoculation can also occur by providing a group of caged bees with a spore suspension in one or more common feeding devices that may be fed on ad libitum. This method allows for
2.2.5.1. Colouration test for spore viability 1. Add 50 ml of spores in H2O at a concentration of 5 x 105 spores / ml to 1 mM of Sytox green (Molecular Probes, Inc.).
individuals to be inoculated relatively quickly, and without the
2. Incubate for 20 minutes at room temperature.
logistical and time constraints associated with individual feeding.
3. Centrifuge for 3 minutes at 1600 x g and discard the supernatant.
Although not well studied, the primary disadvantage of group feeding
4. Homogenize the pellet 1.5.
of Nosema spores is the greater variance of Nosema intensity among
5. in H2O and centrifuge for 3 minutes at 1600 x g.
The COLOSS BEEBOOK: nosema
17
6. Discard the supernatant.
and their target cells have been hampered in the past by the
7. Add 100 ml 4’,6-diamidino-2-phenylindole (DAPI) at 2 mg/ml.
complete lack of permanent bee cell lines. Recently, protocols for the
8. Incubate for 30 minutes in room temperature.
prolonged although limited maintenance of primary honey bee cells
9. Centrifuge for 3 minutes at 1600 x g and discard the supernatant. have been described (Bergem et al., 2006; Hunter, 2010), but these 10. Homogenize the pellet in H2O and centrifuge for 3 minutes at 1600 x g and discard the supernatant.
cells have not been used for infection experiments. Several hundreds of non-honey bee insect cell lines are commercially available (Lynn,
11. Add 50 ml H2O and apply aliquots if 15 ml onto glass slides.
2007; van Oers and Lynn, 2010) and have been proven to be valuable
12. Allow to dry in room temperature and view under oil in a
tools for elucidating attachment, entry, and replication of several
fluorescent microscope.
intracellular insect pathogens and for analysing cellular reactions towards infection (Smagghe et al., 2009; van Oers and Lynn, 2010).
Dead spores are identified as yellow-green ovals through the 470- to
However, these cell lines were considered unsuitable for the study of
490-nm excitation wavelength filter, and living spores are coloured
bee pathogens due to the assumed host specificity of bee pathogenic
with turquoise ovals through the 395- to 415-nm excitation
viruses and microsporidia. We here describe both, the infection of
wavelength filter. To differentiate extruded spores not visible by either primary ventricular cells established from honey bee pupae as well as Sytox green or DAPI staining, white-light microscopy, where extruded
the infection of commercially available insect cell lines established
polar filaments can be seen (Fenoy et al., 2009). The colouration test
from several lepidoptera with N. ceranae and N. apis. General
for viability has not yet been evaluated with the ultimate test - in vivo
techniques for cell cultures are described by Genersch et al. (2013) in
tests in live bees.
the BEEBOOK.
2.2.5.2. In vivo test for spore viability
2.2.6.1 Infection of primary honey bee ventricular cells
Experimentally, the viability of N. apis spores can be assessed by feeding suspensions with different spore concentrations to groups of newly emerged adult honey bees (see section 2.2.7.1). Honey bees exposed to spores can be collected 10 days post infection when the infection appears to be almost fully developed for both Nosema spp.
1. Isolate pupal gut cells from 10 days old pupae as described in detail in the BEEBOOK paper on cell culture techniques (Genersch et al., 2013). 2. Transfer approximately 5E+7 Nosema spp. spores in AEbuffer (Qiagen) into chamber slides (2 well glass slide, VWR).
(Higes et al., 2007; Martin-Hernandez et al., 2011; Forsgren and
3. Air dry for 3 hours at room temperature.
Fries, 2010) and the ventriculus examined for the presence of spores.
4. Initialize spore-germination with 50 µl 0.1M Sucrose in PBS-
If spores are seen in the light microscope, the bee is recorded as
buffer (BDH, Laboratory Supplies).
infected (Malone et al., 2001) and the viability of the spores in the
5. Immediately resuspend 500 µl primary cell suspension in fresh
suspension used can be calculated based on the ID50 and the ID100
L15 medium ( 1.49% L-15, 0.4% Glucose, 0.25% Fructose,
obtained (see section 2.2.7.1).
0.33% Prolin, 3% Sucrose, all w/v, pH 7.2; for a recipe see Table 2) with the germinating spores.
2.2.5.3. In vitro test for spore viability
6. Incubate the spore-cell suspension at 33°C for 20 min.
In vitro germination of spores of both Nosema spp. can also be
7. Add 1 ml of fresh and pre-warmed (37°C) BM3 medium (L 15
triggered by a procedure that mimics the natural conditions for the
medium + 0.075% Pipes, 3% inactivated FCS, 1.2%
germination of environmental spores. Since the germination is the
Yeastolate, 10% antimycotic/antibiotic solution from Sigma-
first step in the infection process, this test gives data on spore
Aldrich, pH 6.7; for a recipe see Table 2).
infectivity ability (Gisder et al. 2010b) but the in vitro test for spore viability has not yet been evaluated with the ultimate test - in vivo
8. Long time incubation is performed in a cooling incubator (Thermo Fisher) at 33°C for 144 hours.
tests in live bees. See section 2.2.6. for details on in vitro rearing of
9. Remove the supernatant by aspiration.
Nosema.
10. Fix cells with 500 µl of 4% formalin solution (Roth) for 24 hours. 11. Identify infected cells by microscopic analysis (Figs 7A & B).
2.2.6. In vitro rearing of Nosema spp.: cell culture systems Cell and tissue cultures are indispensable for the propagation and
Although the infection of primary pupal cells can be achieved, this
study of obligate intracellular pathogens like viruses and microsporidia. approach is time consuming, does not easily lead to reproducible Bee pathogens comprise viruses and microsporidia as obligate
results, and is accompanied by the problem of seasonal dependency
intracellular parasites. However, studies on cellular and molecular
because sufficient numbers of pupae are only available during the
aspects of pathogen-host interactions of these pathogens
brood rearing period.
Fries et al.
18
Table 2. Recipes for media used for infection of cultured primary
Table 3. Maintained insect cell lines which can be infected with
honey bee ventricular cells with Nosema spp.
Nosema spp. FCS = fetal calf serum; w/o = without.
BM 3 medium pH 6.7
L 15 medium pH 7.2
cell line
cell growth
Medium
FCS
time of passage
14.9 g L-15 powder, 4.0 g glucose, 2.5 g
MB-L2
mostly adherent
Insect-Xpress (Lonza)
w/o
every 5 days
fructose,
Sf-158
adherent
Insect-Xpress (Lonza)
5%
every 6 days
Sf-21
adherent
Insect-Xpress (Lonza)
5%
every 6 days
SPC-BM-36
mostly adherent
TC-100 (Invitrogen)
12%
every 7 days
IPL-LD-65Y
suspension
TC-100 (Invitrogen)
11%
every 7 days
adherent
Sf-900 II (Invitrogen)
w/o
every 5 days
1000 ml L 15 medium + 0.75 g Pipes, 30 ml FCS (inactivated), 12 g Yeastolate
3.3 g prolin, 30 g sucrose, ad 1000 ml bidest
2.2.6.2. Infection of heterologous lepidopteran cell lines Most of the commercially available, permanent insect cell lines are derived from Lepidoptera. Several lepidopteran cell lines are described
BTI-Tn-5B1-4
to support propagation of homologous microsporidia (where the source species of the cell line is the original host), as well as microsporidia originally infecting other hosts (Jaronski, 1984). Likewise, several lepidopteran cell lines have proved to be susceptible to N. apis and N. ceranae infection. Susceptibility could recently be demonstrated for the following cell lines (Gisder et al., 2010b): MB-L2 (Mamestra brassicae), Sf-158 and Sf-21 (Spodoptera
frugiperda), SPC-BM-36 (Bombyx mori), and IPL-LD-65Y (Lymantria dispar), and BTI-Tn-5B1-4 (Trichoplusia ni) which can all be obtained through national cell culture collections together with protocols how to maintain and passage the cell lines. It is recommended to maintain
4. Centrifuge at 210xg for 5 min. (Eppendorf 5810 R, rotor F34-6-38). 5. Remove medium by aspiration. 6. Wash the cell pellet twice with 1 ml of freshly prepared 0.1 M sucrose in PBS-buffer. 7. Dilute the cells to a final concentration of 2E+06 cells per ml in 0.1 M sucrose solution. 8. Transfer approximately 5E+07 freshly prepared spores (see above), diluted in AE-buffer (Qiagen), were into a chamber slide (VWR, 4 chambers each slide) for infection.
the cell lines for routine culture in 75 cm2 cell culture flasks (e.g.
9. Air dry for 3 hours at room temperature.
Roth) in a cooling incubator (e.g. Thermo Fisher) at 27°C, and supply
10. Initialize infection by adding 100 µl 0.1 M sucrose in PBS buffer
them with their individual medium composition (Table 3).
to the dried spores, so that spore germination is triggered. 11. Immediately add 50 µl of cell suspension (2.5E+05 cells) to
Approximately 2E+05 cells per ml should be used to establish the next passage (Table 3). For infection of these insect cell lines with germinating Nosema spp. spores (after Gisder et al., 2010b): 1. Prepare a pre-culture 2. Incubate the cells to their exponential growth phase. 3. Harvest the cells growing in exponential phase
the germinating spores. 12. Resuspend the spore-cell suspension (150 µl) thoroughly. 13. Incubate at room temperature for 5 minutes. 14. Add 350 µl medium with 250 µg ml-1 penicillin/streptomycin (Roth) and 125 µl antimycotic/antibiotic solution (SigmaAldrich) to the spore-cell suspension to a final volume of 500µl. 15. Incubate the cells at 27°C up to 10 days.
Fig. 7 A-C. Infection assay with Nosema spp. and primary pupal gut cells: A. infected primary ventricular cell; B. dissolving primary cell releasing new spores; C. in situ-hybridization (ISH) of infected ventricular cells, infected cells are stained blue. Specific hybridization was performed with 16S rRNA (SSU) probes coupled with digoxigenin and colour reaction to detect hybridized probes. Bars (A, B) represent 10 μm and bar in C represents 50 μm.
The COLOSS BEEBOOK: nosema
19
Fig. 8. In situ-hybridization (ISH) of Nosema spp. infected lepidopteran cell lines 72 hours post infection. Infected cells are stained dark blue. Specific hybridization was performed with 16S rRNA (SSU) probes coupled with digoxigenin and subsequent colour reaction to detect hybridized probes.
For in situ-hybridization (ISH) or fluorescence in situ-hybridization
2.2.7.1. Determination of infectious dose
(FISH) medium was aspirated and cells were fixed on glass slides with The infectious dose (the dose that infects half of inoculated bees 4% formalin (e.g. Roth) up to 24 hours. (Fig. 7c) ISH or FISH were
(ID50) or 100% (ID100) can be calculated relatively precisely when
performed according to recently published protocols (Gisder et al.,
experimental bees are individually inoculated as described in section
2010b; Yue et al., 2007, see also the BEEBOOK paper on molecular
2.2.4.4. and incubated in hoarding cages. The proportion of infected
methods (Evans et al., 2013)).
bees given different doses is then examined after 7-10 days. Usually, inoculums are prepared from a stock suspension of spores that is
Six lepidopteran cell lines could be infected successfully (Fig. 8) as
subsequently diluted (section 2.2.4.2.2). The final quantity of spores
demonstrated by in situ-hybridization performed 72 hours post
given to bees is therefore theoretical (= calculated). Under some
infection. For a detailed analysis of the life cycle of Nosema spp. in
circumstances and when the protocol is adapted to the goal of the
infected cells, IPL-LD-65Y cells were chosen and analysed by
study, the technique of group feeding can be used and gives reliable
fluorescence in situ-hybridization (FISH, see the BEEBOOK paper on
results (Pettis et al., 2012; Tanner et al. (2012)). When the bees are
molecular methods (Evans et al., 2013)). Although these newly
mass fed, the quantity of spores given to each bee is an average
developed cell culture models are valuable tools for studying
count calculated from the overall quantity distributed to a given
pathogen-host interactions on cellular and molecular level (Troemel,
number of bees, but it should be noted, that group feeding is likely to
2011), the protocol does not yet allow the continuous propagation of
yield an uneven distribution of spore dose among bees (section
Nosema spp. in cell culture and, hence, is not yet suitable to replace
2.2.4.5.). Similar to pesticide studies, where the lethal dose to 50%
infection of bees for the production of spore suspensions.
(LD50) or 100% (LD100) of tested insects are used to describe toxicity, the infectious dose can be described as the dose that produces
2.2.7. Experiment type
infection in 50% (ID50) or 100% of exposed insects (ID100). For N. apis,
Prior to any experiment with induced Nosema spp. infections, the
ID50 has been determined to roughly 100 spores per bee (Fries, 1988),
infection level in the source colonies for bees to be used should be
with 10,000 spores producing infection in all exposed honey bees
assessed prior to experimentation (see section 2.2.1). This is
(Czekonska, 2007; Fries, 1988). Recently, similar experiments were
advisable also when bees for infection experiments are hatched in
performed that compared N. apis and N. ceranae. Results revealed a
incubators.
slightly lower ID50 for N. ceranae (Forsgren and Fries, 2010). It should
Fries et al.
20
be noted that little is known about possible variations in infectivity
initiated no earlier than 4 days post infection. With a 2 day time
between parasite isolates and/or different levels of susceptibility
interval between sampling, a relatively detailed data set on spore
between host strains and, thus, infectious dose experiments need to
development can be accomplished. Because of variations in spore
be repeated using different bees and different spore sources.
development between different bees, the sample size should never be below 3-4 bees per cage and treatment, and for statistical reasons,
2.2.7.1.1. Study of dose effects
the more bees used, the better (see the statistics section in the
Although the doses of 10,000 and 33,000 spores per bee have been
BEEBOOK paper on miscellaneous methods (Human et al., 2013)).
shown to produce infection in all exposed bees, it is common to use much higher doses, even an order of magnitude higher or more, to
2.2.7.3. Longevity of infected bees
ensure infection (Alaux et al., 2010a; Alaux et al., 2010b, Paxton et al., There is a surprising lack of data on the actual longevity of infected 2007; Malone and Stefanovic, 1999; Higes et al., 2007; Porrini et al.,
honey bees, probably because the mortality is rarely assessed per se.
2010; Webster et al., 2004; Woyciechowski and Moron, 2009).
When the mortality takes place 10 to 14 days or more after the
Depending on the type of experiment, it is often best not to use
exposure to the spores, the researchers usually decide to sacrifice the
higher spore doses than is necessary to produce infection in individual tested honey bees. For N. ceranae, 100% mortality of infected bees bees, because when high spore doses are used, non-germinated
have been reported within this time frame (Higes et al., 2007; Martin-
spores may be retrieved and counted as spores produced from
Hernandez, et al., 2011), but significantly lower mortality rates have
infection.
also been observed (Dussaubat et al., 2010; Forsgren and Fries, 2010;
Honey bee queens become infected by both N. apis and N. ceranae. Paxton et al., 2007; Porrini et al., 2010). There is a profound need for As with workers, a range of different doses have been used to study
more mortality data from Nosema spp. infections, to better
effects of infection on queens individually fed, although again, more
understand the impact from infection on colony viability. Possibly,
spores were provided than were required (Alaux et al. 2010c;
cage experiments are less well suited for such tests because cage
Webster, 2008). Using individual feeding, queens and worker bees
effects on longevity cannot be excluded, even if proper controls are
have become infected using similar spore doses (Webster et al.,
used. An alternative would be to use marked bees, with and without
2004), but the infectious doses for queens have never been
infection, and introduce them to small functioning colonies and then
established for either of the two microsporidian infections discussed.
study the rate at which such honey bees disappear compared to uninfected bees (see the section on statistics for survival analyses in
2.2.7.1.2. Effects of different infection doses
the BEEBOOK paper on miscellaneous methods (Human et al., 2013)).
It is necessary to test serial quantities of spores if the interest of the
Only a few studies have investigated the longevity of queens
experiment is to investigate the effect of infection dose. In this case,
when infected with N. apis. spores. Young infected queens that were
for more precision, honey bees should always be individually fed the
allowed to lay eggs all died about 50 days after the onset of oviposition,
spore suspensions. The quantities of spores given to bees could
with an average age when found dead or removed by the bees of
increase by a factor of 10 (Forsgren and Fries, 2010; Malone et al.,
about 25 days (Loskotova et al., 1980). The impact from infection on
2001), but other increments can also be used (Martin-Hernandez
queen as well as colony performance also need further studies to
et al., 2011).
assess the impact on colony performance from these infections.
2.2.7.2. Course of infection in individual bees The course of infection is checked in individual bees or in a group of tested bees. The time lap between spore counts has been highly
3. Future perspectives
variable between different authors and the goal of the experiment
The Nosema spp. parasites in honey bees still remain largely
(Alaux et al., 2010a; Alaux et al., 2010b; Czekonska, 2007; Forsgren
enigmatic. The described field symptoms differ between the parasites
and Fries, 2010; Malone and Stefanovic, 1999; Paxton et al., 2007).
(Fries et al., 2006), as do the seasonal prevalence (Higes et al., 2008a, b).
Generally speaking, a greater sample size and increased frequency of
These observations suggest that the main mode of transmission
sampling will allow for more confidence in the data. Since individual
between bees could differ between N. apis and N. ceranae. Faecal
feeding of honey bees is time consuming, the interval between
deposition within bee hives is associated with N. apis infections, but
sampling and the number of bees investigated must, nevertheless, be
this is not the case with N. ceranae (Fries et al., 2006). The main
limited. Because N. apis spores are not produced from new infections
mode of parasite transmission for N. apis is believed to be a faecal-
until at least 3 days post infection (Fries, 1988 ; Fries et al., 1996;
oral route through soiled comb (Bailey, 1953). There is a need to
Forsgren and Fries, 2010), with the first spores of N. ceranae
elucidate the main mode of transmission for N. ceranae to understand
produced slightly later (Forsgren and Fries, 2010), sampling should be more of the epidemiology of this parasite. There is also a profound
The COLOSS BEEBOOK: nosema
lack of data on differences in susceptibility of both parasites among
21
ALAUX, C; FOLSCHWEILLER, M; MCDONNELL, C; BESLAY, D;
different honey bee strains. Using standardized laboratory infectivity
COUSIN, M; DUSSAUBAT, C; BRUNET, J L; LE CONTE, Y (2010c)
tests, it is probably possible to find differences in susceptibility to
Pathological effects of the microsporidium Nosema ceranae on
infection, both within and between strains of bees. With such
honey bee queen physiology (Apis mellifera). Journal of
information, breeding for resistance can be undertaken and genetic
Invertebrate Pathology 106(3): 80-385.
markers for resistance could possibly be located for genetic marker
http://dx.doi.org/10.1016/j.jip.2010.12.005
aided selection for disease resistance. As with differences in resistance ALLEN, M D (1959) Respiration rates of worker honey bees of in the host, it is likely that different isolates of the parasites differ in
different ages and at different temperatures. Journal of
infectivity as well as in virulence. Although such differences have
Experimental Biology 36(1): 92-101.
never been documented, along with differences in host susceptibility,
AMDAM, G V; AASE, A L T O; SEEHUUS, S-C; FONDRK, M K;
they could complicate interpretations of experiments and possibly
NORBERG, K; HARFELDER, K (2005) Social reversal of
explain some contradictory results published on parasite virulence.
immunsenescence in honey bee workers. Experimental
Ring tests among laboratories would be very useful for the scientific community but remain to be organized and funded. The use of cell culture for studying the Nosema parasites is still in
Gerontology 40(12): 939-947. http://dx.doi.org/10.1016/j.exger.2005.08.004 AMDAM, G V; RUEPPELL, O; FONDRK, M K; PAGE, R E; NELSON, C M
its infancy. With further developments, where continuous propagation
(2009). The nurse’s load: early-life exposure to brood-rearing
of Nosema spp. in cell cultures becomes possible, new insights into
affects behaviour and lifespan in honey bees (Apis mellifera).
infection biology may be gained. Also, there is a need to develop a
Experimental Gerontology 44(6-7): 467-471.
reliable method for the long term storage of infective N. ceranae
http://dx.doi.org/10.1016/j.exger.2009.02.013
spores. Lastly, a further complication when studying the Nosema parasites
ANTĂšNEZ, K; MARTIN-HERNANDEZ, R; PRIETO, L; MEANA, A; ZUNINO P; HIGES M (2009) Immune suppression in the honey
in honey bees is the associated virus infections. Infection with N. apis
bee (Apis mellifera) following infection by Nosema ceranae
is associated with three unrelated viral infections; black queen cell
(Microsporidia). Environmental Microbiology 11(9): 2284-2290.
virus (BQCV), bee virus Y (BVY) and filamentous virus (FV).
http://dx.doi.org/10.1111/j.1462-2920.2009.01953.x
A combination of N. apis and BQCV is distinctly more harmful than either infection alone, infection with BVY adds to N. apis virulence, whereas no such influence is seen with FV infections (Bailey et al., 1983). Interestingly, N. ceranae infections have been shown to be negatively correlated with deformed wing virus (DWV) (Costa et al., 2011).
BAILEY, L (1953) The transmission of nosema disease. Bee World 34: 171-172. BAILEY, L (1955) The epidemiology and control of Nosema disease of the honey-bee. Annals of Applied Biology 43(1-2): 379-389. BAILEY, L (1972) The preservation of infective microsporidan spores.
Journal of Invertebrate Pathology 20(3): 252-254. http://dx.doi.org/10.1016/0022-2011(72)90152-8 BAILEY, L; BALL, B V; PERRY, J N (1983) Association of viruses with 2
4. Acknowledgements
protozoal pathogens of the honey bee. Annals of Applied Biology
The 7th framework project BEE DOC and the Ricola foundation
http://dx.doi.org/10.1111/j.1744-7348.1983.tb02735.x
supported this work period.
103(1): 3-20. BARKER, R J; LEHNER, Y (1978) Laboratory comparison of high fructose corn syrup, grape syrup, honey, and sucrose syrup as
5. References
maintenance food for caged honey bees. Apidologie 9(2): 111-116. http://dx.doi.org/10.1051/apido:19780203
ALAUX, C; BRUNET, J L; DUSSAUBAT, C; MONDET, F; TCHAMITCHAN, BERGEM, M; NORBERG, N; AAMODT, R A (2006) Long-term S; COUSIN, M; BRILLARD, J; BALDY, A; BELZUNCES, L P;
maintenance of in vitro cultured honey bee (Apis mellifera)
LE CONTE, Y (2010a) Interactions between Nosema microspores
embryonic cells. BMC Developmental Biology 6(Article 17).
and a neonicotinoid weaken honey bees (Apis mellifera).
http://dx.doi.org/10.1186/1471-213X-6-17
Environmental Microbiology 12: 774-782. http://dx.doi.org/10.1111/j.1462-2920.2009.02123.x ALAUX, C; DUCLOZ, F; CRAUSER, D ; LE CONTE, Y (2010b) Diet
BOURGOIS, A L; BEARMAN, L D; HOLLOWAY, B; RINDERER, T E (2012) External and internal detection of Nosema ceranae on honey bees using real-time PCR. Journal of Invertebrate
effects on honey bee immunocompetence. Biology Letters 6(4):
Pathology 109(3): 323-325.
562-565. http://dx.doi.org/10.1098/rsbl.2009.0986
http://dx.doi.org/10.1016/j.jip.2012.01.002
Fries et al.
22
BOURGEOIS, L A; RINDERER, T E; BEAMAN, L D; DANKA, R G (2010)
BURGES, H D; CANNING, E U; HULLS, I K (1974) Ultrastructure of
Genetic detection and quantification of Nosema apis and N. ceranae
Nosema oryzaephili and the taxonomic value of the polar filament.
in the honey bee. Journal of Invertebrate Pathology 103(1): 53-58.
Journal of Invertebrate Pathology 23(2): 135-139.
http://dx.doi.org/10.1016/j.jip.2009.10.009
http://dx.doi.org/10.1016/0022-2011(74)90176-1
BORCHERT, A (1928) Beiträge zur Kenntnis der Bienen Parasiten
CANTWELL, G E (1970) Standard methods for counting nosema
Nosema apis. Archive für Bienenkunde 9: 115-178.
spores. American Bee Journal 110(6): 222-223.
BOTÍAS, C; MARTÍN-HERNÁNDEZ, R; BARRIOS, L; GARRIDO-BAILÓN, CANTWELL, G E, SHIMANUKI, H (1969) Heat treatment as a means of E; NANETTI, A; MEANA, A; HIGES, M (2012b) Nosema spp.
eliminating nosema and increasing production. American Bee ®
parasitization decreases the effectiveness of acaricide strips (Apivar )
Journal 109(2): 52-54.
in treating varroosis of honey bee (Apis mellifera iberiensis)
CARRECK, N L; ANDREE, M; BRENT, C S; COX-FOSTER, D; DADE, H A;
colonies. Environmental Microbiology Reports 4(1): 57-65.
ELLIS, J D; HATJINA, F; VANENGELSDORP, D (2013) Standard
http://dx.doi.org/10.1111/j.1758-2229.2011.00299.x.v
methods for Apis mellifera anatomy and dissection. In V Dietemann;
BOTÍAS, C; MARTÍN-HERNÁNDEZ, R; DIAS, J; GARCÍA-PALENCIA, P;
J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume I:
MATABUENA, M; JUARRANZ, A; BARRIOS, L; MEANA, A;
standard methods for Apis mellifera research. Journal of
NANETTI, A; HIGES, M (2012a) The effect of induced queen
Apicultural Research 52(4):
replacement on Nosema spp. infection in honey bee (Apis
http://dx.doi.org/10.3896/IBRA.1.52.4.03
mellifera iberiensis) colonies. Environmental Microbiology 14(4): 845-859. http://dx.doi.org/10.1111/j.1462-2920.2011.02647.x BOTÍAS, C; MARTÍN-HERNÁNDEZ, R; GARRIDO-BAILÓN, E; GONZÁLEZ PORTO, A, MARTÍNEZ-SALVADOR, A, DE LA RÚA, P, MEANA, A; HIGES, M (2011) The growing prevalence of Nosema
CHAIMANEE, V; WARRIT, N; CHANTAWANNAKUL, P (2011) Infections of Nosema ceranae in four different honey bee species. Journal of
Invertebrate Pathology 105(3): 207-210. http://dx.doi.org/10.1016/j.jip.2011.05.012 CHARRIÈRE, J-D; KILCHENMANN, V; RÖTSCHI, A (2011) Virulence of
ceranae in honey bees in Spain, an emerging problem for the last
different Melissococcus plutonius strains on larvae tested by an in
decade. Research in Veterinary Sciences 93(1): 150-155.
vitro larval test; In Proceedings of the 42nd International
http://dx.doi.org/10.1016/j.rvsc.2011.08.002
Apicultural Congress, Buenos Aires, Argentina. p 158.
BOURGOIS, A L; BEARMAN, L D; HOLLOWAY, B; RINDERER, T E
CHEN, Y; EVANS, J D; MURPHY, C; GUTELL, R; ZUKER, M;
(2012) External and internal detection of Nosema ceranae on
GUNDENSEN-RINDAL, D; PETTIS, J S (2009) Morphological,
honey bees using real-time PCR. Journal of Invertebrate Pathology
molecular, and phylogenetic characterization of Nosema ceranae,
109(3): 323-325. http://dx.doi.org/10.1016/j.jip.2012.01.002
a microsporidian parasite isolated from the European honey bee,
BOURGEOIS, L A; RINDERER, T E; BEAMAN, L D; DANKA, R G (2010) Genetic detection and quantification of Nosema apis and N. ceranae
Apis mellifera. Journal of Eukaryotic Microbiology 56(2): 142-147. http://dx.doi.org/10.1111/j.1550-7408.2008.00374.x
in the honey bee. Journal of Invertebrate Pathology 103(1): 53-58. CHEN, Y; EVANS, J D; SMITH, I B; PETTIS, J S (2008) Nosema http://dx.doi.org/10.1016/j.jip.2009.10.009 BRODSCHNEIDER, R; CRAILSHEIM, K (2010) Nutrition and health in
ceranae is a long-present and widespread microsporidian infection of the European honey bee (Apis mellifera) in the United States.
honey bees. Apidologie 41(3): 278-294.
Journal of Invertebrate Pathology 97(2): 186-188.
http://dx.doi.org/10.1051/apido/2010012
http://dx.doi.org/10.1016/j.jip.2007.07.010
BÜCHLER, R; ANDONOV, S; BIENEFELD, K; COSTA, C; HATJINA, F;
CHEN, Y P; HUANG, Z Y (2010) Nosema ceranae, a newly identified
KEZIC, N; KRYGER, P; SPIVAK, M; UZUNOV, A; WILDE, J (2013)
pathogen of Apis mellifera in the USA and Asia. Apidologie 41(3):
Standard methods for rearing and selection of Apis mellifera
364-374. http://dx.doi.org/10.1051/apido/2010021
queens. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS
COBEY, S W; TARPY, D R ; WOYKE, J (2013) Standard methods for
BEEBOOK, Volume I: standard methods for Apis mellifera research.
instrumental insemination of Apis mellifera queens. In V Dietemann;
Journal of Apicultural Research 52(1):
J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume I:
http://dx.doi.org/10.3896/IBRA.1.52.1.07
standard methods for Apis mellifera research. Journal of Apicultural
BURGHER-MACLELLAN, K L; WILLIAMS, G R; SHUTLER, D; ROGERS,
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.09
R E L; MACKENZIE, K (2010) Optimization of duplex real-time PCR COLE, R J (1970) Application of triangulation method to purification of with melting curve analysis for detection of microsporidian
Nosema spores from insect tissues. Journal of Invertebrate
parasites Nosema apis and Nosema ceranae in Apis mellifera.
Pathology 15(2): 193-195.
Canadian Entomologist 142(3): 271-283.
http://dx.doi.org/10.1016/0022-2011(70)90233-8
http://dx.doi.org/10.4039/n10-010
The COLOSS BEEBOOK: nosema
COLTON, T (1974) Statistics in medicine. Little, Brown and Company; Boston, USA. 372 pp. COSTA, C; TANNER, G; LODESANI, M; MAISTRELLO, L; NEUMANN, P
23
DIETEMANN, V; NAZZI, F; MARTIN, S J; ANDERSON, D; LOCKE, B; DELAPLANE, K S; WAUQUIEZ, Q; TANNAHILL, C; ZEGELMANN, B; ROSENKRANZ, P; ELLIS, J D (2013) Standard methods for varroa
(2011) Negative correlation between Nosema ceranae spore loads
research. In V Dietemann; J D Ellis; P Neumann (Eds) The
and deformed wing virus infection levels in adult honey bee
COLOSS BEEBOOK, Volume II: standard methods for Apis
workers. Journal of Invertebrate Pathology 108(3): 224-225.
mellifera pest and pathogen research. Journal of Apicultural
http://dx.doi.org/10.1016/j.jip.2011.08.012
Research 52(1):
CRAILSHEIM, K (1991) Interadult feeding of jelly in honey bee (Apis
http://dx.doi.org/10.3896/IBRA.1.52.1.09
mellifera L) colonies. Journal of Comparative Physiology B 161(1): DOULL, K M (1965) The effects of time of day and method of 55-60. http://dx.doi.org/10.1007/BF00258746 CRAILSHEIM, K (1998) Trophallactic interactions in the adult honey bee (Apis mellifera L.). Apidologie 29(1-2): 97-112. http://dx.doi.org/10.1051/apido:19980106 CURRIE, R W; PERNAL, S F; GUZMAN-NOVOA, E (2010) Honey bee colony losses in Canada. Journal of Apicultural Research 49(1): 104-106. http://dx.doi.org/10.3896/IBRA.1.49.1.18 CZEKONSKA, K (2007) Influence of carbon dioxide on Nosema apis infection of honey bees (Apis mellifera). Journal of Invertebrate
sampling on the determination of nosema disease in bee hives.
Journal of Invertebrate Pathology 7(1): 1-4. http://dx.doi.org/10.1016/0022-2011(65)90143-6 DOULL, K M, CELLIER, K M (1961) A survey of the incidence of
Nosema disease (Nosema apis Zander) in honey bees in South Australia. Journal of Insect Pathology 3(3): 280-288. DOULL, K M; ECKERT, J E (1962) A survey of the incidence of Nosema disease in California. Journal of Economic Entomology 55(3): 313-317. DUSSAUBAT, C; MAISONNASSE, A; ALAUX, C; TCHAMITCHAN, S;
Pathology 95(2): 84-86.
BRUNET, J L; PLETTNER, E; BELZUNCES, L P; LE CONTE, Y (2010)
http://dx.doi.org/10.1016/j.jip.2007.02.001
Nosema spp. Infection alters pheromone production in honey
DADE, H A (2009) Anatomy and dissection of the honey bee (Revised edition). International Bee Research Association; Cardiff, UK. 196 pp.
bees (Apis mellifera). Journal of Chemical Ecology 36(5): 522-525. http://dx.doi.org/10.1007/s10886-010-9786-2
DE GRAAF, D C; ALIPPI, A M; ANTÚNEZ, K; ARONSTEIN, K A; BUDGE, EL-SHEMY, A A M; PICKARD, R S (1989) Nosema apis Zander G; DE KOKER, D; DE SMET, L; DINGMAN, D W; EVANS, J D; FOSTER, L J; FÜNFHAUS, A; GARCIA-GONZALEZ, E; GREGORC, A; HUMAN, H; MURRAY, K D; NGUYEN, B K; POPPINGA, L; SPIVAK,
infection levels in honey bees of known age. Journal of Apicultural
Research 28(2): 101-106. ERLER, S; LOMMATZSCH, S; LATTORFF, H (2012) Comparative
M; VANENGELSDORP, D; WILKINS, S; GENERSCH, E (2013)
analysis of detection limits and specificity of molecular diagnostic
Standard methods for American foulbrood research. In V
markers for three pathogens (Microsporidia, Nosema spp.) in the
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
key pollinators Apis mellifera and Bombus terrestris. Parasitology
Volume II: standard methods for Apis mellifera pest and pathogen
Research 110(4): 1403–1410.
research. Journal of Apicultural Research 52(1):
http://dx.doi.org/10.1007/s00436-011-2640-9
http://dx.doi.org/10.3896/IBRA.1.52.1.11 DELAPLANE, K S; VAN DER STEEN, J; GUZMAN, E (2013) Standard
EVANS, J D; SPIVAK, M (2010) Socialized medicine: individual and communal disease barriers in honey bees. Journal of Invertebrate
methods for estimating strength parameters of Apis mellifera
Pathology 103(S): S62-S72.
colonies. In V Dietemann; J D Ellis; P Neumann (Eds) The
http://dx.doi.org/10.1016/j.jip.2009.06.019
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera EVANS, J D; CHEN, Y P; CORNMAN, R S; DE LA RUA, P; FORET, S; research. Journal of Apicultural Research 52(1):
FOSTER, L; GENERSCH, E; GISDER, S; JAROSCH, A; KUCHARSKI,
http://dx.doi.org/10.3896/IBRA.1.52.1.03
R; LOPEZ, D; LUN, C M; MORITZ, R F A; MALESZKA, R; MUÑOZ, I;
DE MIRANDA, J R; BAILEY, L; BALL, B V; BLANCHARD, P; BUDGE, G;
PINTO, M A; SCHWARZ, R S (2013) Standard methodologies for
CHEJANOVSKY, N; CHEN, Y-P; VAN DOOREMALEN, C; GAUTHIER,
molecular research in Apis mellifera. In V Dietemann; J D Ellis; P
L; GENERSCH, E; DE GRAAF, D; KRAMER, M; RIBIÈRE, M;
Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
RYABOV, E; DE SMET, L VAN DER STEEN, J J M (2013) Standard
methods for Apis mellifera research. Journal of Apicultural
methods for virus research in Apis mellifera. In V Dietemann; J D
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.11
Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II:
FARRAR, C L (1947) Nosema losses in package bees as related to
standard methods for Apis mellifera pest and pathogen research.
queen supersedure and honey yields. Journal of Economic
Journal of Apicultural Research 52(4):
Entomology 40(3): 333-338.
http://dx.doi.org/10.3896/IBRA.1.52.4.22
Fries et al.
24
FENOY, S; RUEDA, C; HIGES, M; MARTÍN-HERNÁNDEZ, R; DEL
GENERSCH, E; GISDER, S; HEDTKE, K; HUNTER, W B; MÖCKEL, N;
AGUILA, C (2009) High-level resistance of Nosema ceranae, a
MÜLLER, U (2013) Standard methods for cell cultures in Apis
parasite of the honey bee, to temperature and desiccation.
mellifera research. In V Dietemann; J D Ellis; P Neumann (Eds)
Applied and Environmental Microbiology 75(21): 6886-6889.
The COLOSS BEEBOOK, Volume I: standard methods for Apis
http://dx.doi.org/10.1128/AEM.01025-09
mellifera research. Journal of Apicultural Research 52(1):
FERGUSON, H M; READ, A F (2002) Genetic and environmental determinants of malaria parasite virulence in mosquitoes.
http://dx.doi.org/10.3896/IBRA.1.52.1.02 GISDER, S; HEDTKE, K; MÖCKEL, N; FRIELITZ, M C; LINDE, A;
Proceedings of the Royal Society London B 269(1497): 1217-
GENERSCH, E (2010a) Five-year cohort study of Nosema spp. in
1224. http://dx.doi.org/10.1098/rspb.2002.2023
Germany: climate shape virulence and assertiveness of Nosema
FLURI, P (1977) Juvenile hormone, vitellogenin and haemocyte composition in winter worker honey bees (Apis mellifera).
ceranae? Applied and Environmental Microbiology 76(9): 30323038. http://dx.doi.org/10.1128/AEM.03097-09
Experientia 33(9): 1240-1241. http://dx.doi.org/10.1007/BF01922354 GISDER, S; MÖCKEL, N; LINDE, A; GENERSCH, E (2010b) A cell FORSGREN, E; FRIES, I (2010) Comparative virulence of Nosema
culture model for Nosema ceranae and Nosema apis allows new
ceranae and Nosema apis in individual European honey bees.
insights into the life cycle of these important honey bee-
Veterinary Parasitology 170(3-4): 212-217.
pathogenic microsporidia. Environmental Microbiology. 13(2): 404
http://dx.doi.org/10.1016/j.vetpar.2010.02.010
-413. http://dx.doi.org/10.1111/j.1462-2920.2010.02346.x
FRIES, I (1988) Infectivity and multiplication of Nosema apis Z. in the GROSS, K P; RUTTNER, F (1970) Entwickelt Nosema apis Zander eine ventriculus of the honey bee. Apidologie 19(3): 319-328.
Resistenz gegenüber dem Antibiotikum Fumidil B? Apidologie 1
http://dx.doi.org/10.1051/apido:19880310
(4): 401-422. http://dx.doi.org/10.1051/apido:19700403
FRIES, I (1989) Observations on the development and transmission of GRÜNEWALD, B; WERSING, A (2008) An ionotropic GABA receptor in
Nosema apis Z. in the ventriculus of the honey bee. Journal of
cultured mushroom body Kenyon cells of the honey bee and its
Apicultural Research 28(2): 107-117.
modulation by intracellular calcium. Journal of Comparative
FRIES I (1993) Nosema apis - a parasite in the honey bee colony. Bee
World 74(1): 5–19. FRIES, I (2010) Nosema ceranae in European honey bees (Apis
melllifera). Journal of Invertebrate Pathology 103(S): S73-S79. http://dx.doi.org/10.1016/j.jip.2009.06.017 FRIES, I; EKBOHM, G; VILLUMSTAD, E (1984) Nosema apis, sampling
Physiology A Neuroethology Sensory Neural and Behavioural Physiology 194(4): 329-340. http://dx.doi.org/10.1007/s00359-007-0308-9 GUZMAN-NOVOA, E; CORREA-BENITEZ, A; ECCLES, L; CALVETE, Y; MCGOWAN, J; KELLY, P G (2010) Varroa destructor is the main culprit for the death and reduced populations of overwintered
techniques and honey yield. Journal of Apicultural Research 23(2):
honey bee (Apis mellifera) colonies in Ontario, Canada. Apidologie
102-105.
41(4): 443-450. http://dx.doi.org/10.1051/apido/2009076
FRIES, I; FENG, F; SILVA, A; DA SLEMENDA, S B; PIENIAZEK, N J
HAMIDUZZAMAN, M M; GUZMAN-NOVOA, E; GOODWIN, P H (2010) A
(1996) Nosema ceranae n. sp. (Microspora, Nosematidae),
multiplex PCR assay to diagnose and quantify Nosema infections
morphological and molecular characterization of a microsporidian
in honey bees (Apis mellifera). Journal of Invertebrate Pathology
parasite of the Asian honey bee Apis cerana (Hymenoptera,
105(2): 151-155. http://dx.doi.org/10.1016/j.jip.2010.06.001
Apidae). European Journal of Protistology 32(3): 356-365. FRIES, I; GRANADOS, R R; MORSE, R A (1992) Intracellular
HASSANEIN, M H (1953) The influence of infection with Nosema apis on the activities and longevity of worker honey bees. Annals of
germination of spores of Nosema apis Z. Apidologie 23(1): 61-71.
Applied Biology 40(2): 418-423.
http://dx.doi.org/10.1051/apido:19920107
http://dx.doi.org/10.1111/j.1744-7348.1953.tb01093.x
FRIES, I; MARTIN, R; MEANA, A; GARCIA-PALENCIA, P; HIGES, M
HIGES, M; GARCÍA-PALENCIA, P; BOTÍAS, C; MEANA, A; MARTÍN-
(2006) Natural infections of Nosema ceranae in European honey
HERNÁNDEZ, R (2010) The differential development of
bees. Journal of Apicultural Research 45(4): 230-233.
microsporidia infecting worker honey bee (Apis mellifera) at
FURGALA, B; HYSER, R A (1969) Minnesota Nosema survey. American
Bee Journal 109(12): 460-461. FURGALA, B, MAUNDER, M J (1961) A simple method of feeding Nosema
increasing incubation temperature. Environmental and
Microbiology Reports 2(6): 745-748. http://dx.doi.org/10.1111/j.1758-2229.2010.00170x
apis inoculum to individual honey bees. Bee World 42(10): 249-252. HIGES, M; GARCÍA-PALENCIA, P; MARTÍN-HERNÁNDEZ, R; MEANA, A FURGALA, B; MUSSEN, E C (1978) Protozoa. In Morse, R A;
(2007) Experimental infection of Apis mellifera honey bees with
Nowogrodzki, R (Eds) Honey bee pests, predators, and diseases.
Nosema ceranae (Microsporidia). Journal of Invertebrate
Cornell University Press; Ithaca, USA. pp. 48-63.
Pathology 94(3): 211-217. http://dx.doi.org/10.1016/j.jip.2006.11.001
The COLOSS BEEBOOK: nosema
HIGES, M; MARTIN-HERNANDEZ, R; BOTIAS, C; BAILON, E G;
25
KATZNELSON, H; ROBB, J A (1962) The use of gamma radiation from
GONZALES-PORTO, A V; BARRIOS, L; DEL NOZAL, M J; BERNAL,
cobalt-60 in the control of diseases of the honey bee and the
J L; JIMENEZ, J J; PALENCIA, P G; MEANA, A (2008a) How natural
sterilization of honey. Canadian Journal of Microbiology 8(2): 175-179.
infection by Nosema ceranae causes honey bee colony collapse.
KELLNER, N; JACOBS, F J (1978) In hoeveel tijd bereiken de sporen
Environmental Microbiology 10(10): 2659–2669.
van Nosema apis Zander de ventriculus van de honingbij (Apis
http://dx.doi.org/10.1111/j.1462-2920.2008.01687.x
mellifera L.)? Vlaams Diergeneeskundig Tijdschrift 47(3): 252-259.
HIGES, M; MARTÍN-HERNÁNDEZ, R; GARRIDO-BAILÓN, E; GARCÍA-
KLEE, J; BESANA, A M; GENERSCH, E; GISDER, S; NANETTI, A; TAM,
PALENCIA, P; MEANA, A (2008b) Detection of infective Nosema
D Q; CHINH, T X; PUERTA, F; RUZ, J M; KRYGER, P; MESSAGE, D;
ceranae (Microsporidia) spores in corbicular pollen of forager
HATJINA, F; KORPELA, S; FRIES, I; PAXTON, R J (2007)
honey bees. Journal of Invertebrate Pathology 97(1): 76-78.
Widespread dispersal of the microsporidian Nosema ceranae, an
http://dx.doi.org/10.1016/j.jip.2007.06.002
emergent pathogen of the western honey bee, Apis mellifera.
HIGES, M; MARTIN-HERNANDEZ, R; MEANA, A (2006) Nosema
ceranae, a new microsporidian parasite in honey bees in Europe. Journal of Invertebrate Pathology 92(2): 93-95. http://dx.doi.org/10.1016/j.jip.2006.02.005 HIGES, M; NOZAL, M J; ALVARO, A; BARRIOS, L; MEANA, A; MARTINHERNANDEZ, R; BERNAL, J L; BERNAL, J (2011) The stability and effectiveness of fumagillin in controlling Nosema ceranae (Microsporidia) infection in honey bees (Apis mellifera) under
Journal of Invertebrate Pathology 96(1): 1-10. http://dx.doi.org/10.1016/j.jip.2007.02.014 KLEE, J; TAY, W T; PAXTON, R J (2006) Specific and sensitive detection of Nosema bombi (Microsporidia : Nosematidae) in bumble bees (Bombus spp.; Hymenoptera : Apidae) by PCR of partial rRNA gene sequences. Journal of Invertebrate Pathology 91(2): 98-104. http://dx.doi.org/10.1016/j.jip.005.10.012 KRAUS, B; VELTHUIS, H H W (1997) High humidity in the honey bee
laboratory and field conditions. Apidologie 42(4): 364-377.
(Apis mellifera L.) brood nests limits reproduction of the parasitic
http://dx.doi.org/10.1007/s13592-011-0003-2
mite Varroa jacobsoni Oud. Naturwissenschaften 84(5): 217-218.
HIGES, M; PILAR, G P; MARTIN-HERNANDEZ, R; ARANZAZU, M (2007) Experimental infection of Apis mellifera honey bees with Nosema
http://dx.doi.org/10.1007/s001140050382 KREISSL, S; BICKER, G (1992) Dissociated neurons of the pupal
ceranae (Microsporidia). Journal of Invertebrate Pathology 94(3):
honey bee brain in cell culture. Journal of Neurocytology 21(8):
211-217. http://dx.doi.org/10.1016/j.jip.2006.11.001
545-556. http://dx.doi.org/10.1007/BF01187116
HUMAN, H; BRODSCHNEIDER, R; DIETEMANN, V; DIVELY, G; ELLIS, J; L'ARRIVEE, J C M (1963) Comparison of composite versus individual FORSGREN, E; FRIES, I; HATJINA, F; HU, F-L; JAFFÉ, R; KÖHLER, A; PIRK, C W W; ROSE, R; STRAUSS, U; TANNER, G; VAN DER STEEN, J J M; VEJSNÆS, F; WILLIAMS, G R; ZHENG, H-Q (2013)
bee sampling for Nosema apis Zander. Journal of Insect Pathology 5(4): 349-355. LI, J; CHEN, W; WU, J; PENG, W; AN, J; SCHMID-HEMPEL, P;
Miscellaneous standard methods for Apis mellifera research. In V
SCHMID-HEMPEL, R (2012) Diversity of Nosema associated with
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
bumble bees (Bombus spp.) from China. International Journal of
Volume I: standard methods for Apis mellifera research. Journal of
Parasitology 42(1):49-61.
Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.10 HUNTER, W B (2010) Medium for development of bee cell cultures (Apis mellifera: Hymenoptera: Apidae). In Vitro Cell Developmental
Biology Animal 46(2): 83-86. http://dx.doi.org/10.1007/s11626-009-9246-x INVERNIZZI, C; ABUD, C; TOMASCO, I H; HARRIET, J; RAMALLO, G; CAMPA, J; KATZ, H; GARDIOL, G; MENDOZA, Y (2009) Presence
http://dx.doi.org/10.1016/j.ijpara.2011.10.005 LINDER, A (1947) Über das Auswerten zahlenmässiger Angaben in der Bienenkunde. Beihefte zur Schweizerischen Bienen-Zeitung 2: 77-138. LYNN, D E (2007) Available lepidopteran insect cell lines. In
Murhammer, D W (Ed.) Methods in molecular biology 388. Humana Press Inc.; Totowa, NJ, USA. pp. 117-138. LOSKOTOVA, J; PEROUTKA, M; VESLEY, V (1980) Nosema disease of
of Nosema ceranae in honey bees (Apis mellifera) in Uruguay.
honey bee queens (Apis mellifica L.). Apidologie 11(2): 153-161.
Journal of Invertebrate Pathology 101(2): 150-153.
http://dx.doi.org/10.1051/apido:19800205
http://dx.doi.org/10.1016/j.jip.2009.03.006 JARONSKI, S T (1984) Microsporidia in cell culture. Advances in Cell
Culture 3: 183-229.
MAISTRELLO, L; LODESANI, M; COSTA, C; LEONARDI, F; MARANI, G; CALDON, M; MUTINELLI, F; GRANATO, A (2008) Screening of natural compounds for the control of nosema disease in honey bees. Apidologie 39(4): 436-445. http://dx.doi.org/10.1051/apido:2008022
Fries et al.
26
MALONE, L A; GATEHOUSE, H S; TREGIDGA, E L (2001) Effects of
PAXTON, R J; FRIES, I; PIENIAZEK, N J; TENGÖ, J (1997) High
time, temperature, and honey on Nosema apis (Microsporidia:
incidence of infection of an undescribed microsporidium
Nodematidae) a parasite of the honey bee, Apis mellifera
(Microspora) in the communal bee Andrena scotica
(Hymenoptera: Apidae). Journal of Invertebrate Pathology 77(4):
(Hymenoptera, Andrenidae) in Sweden. Apidologie 28: 129-141.
258-268. http://dx.doi.org/10.1006/jipa.2001.5028
http://dx.doi.org/10.1051/apido:19970304
MALONE, L A; STEVANOVIC, D (1999) Comparison of the responses
PAXTON, R J; KLEE, J; KORPELA, S; FRIES, I (2007) Nosema ceranae
of two races of honey bees to infection with Nosema apis Zander.
has infected Apis mellifera in Europe since at least 1998 and may
Apidologie 30(5): 375-382.
be more virulent than Nosema apis. Apidologie 38(6): 558-565.
http://dx.doi.org/10.1051/apido:19990503
http://dx.doi.org/10.1051/apido:2007037
MARTÍN-HERNÁNDEZ, R; BOTIAS, C; BARRIOS, L; MARTINEZSALVADOR, A; MEANA, A; MAYACK, C; HIGES, M (2011) Comparison of the energetic stress associated with experimental
Nosema ceranae and Nosema apis infection of honey bees (Apis
PERNAL, S F; CURRIE, R W (2000) Pollen quality of fresh and 1-yearold single pollen diets for worker honey bees (Apis mellifera L.).
Apidologie 31(3): 387-409. http://dx.doi.org/10.1051/apido:2000130 PETTIS, J S; VANENGELSDORP, D; JOHNSON, J; DIVELY, G (2012)
mellifera). Parasitology Research 109(3): 605-612.
Pesticide exposure in honey bees results in increased levels of the
http://dx.doi.org/10.1007/s00436-011-2292-9
gut pathogen Nosema. Naturwissenschaften 99(2): 153–158.
MARTÍN-HERNÁNDEZ, R; MEANA, A; GARCÍA-PALENCIA, P; MARÍN, P; BOTÍAS, C; GARRIDO-BAILÓN, E; BARRIOS, L; HIGES, M (2009).
http://dx.doi.org/10.1007/s00114-011-0881-1 PORRINI, M P; AUDISIO, M C; SABATE, D C; IBARGUREN, C; MEDICI,
Effect of temperature on the biotic potential of honey bee
S K; SARLO, E G; GARRIDO, P M; EGUARAS, M J (2010) Effect of
microsporidia. Applied and Environmental Microbiology 75(8):
bacterial metabolites on microsporidian Nosema ceranae and on
2554-2557. http://dx.doi.org/10.1128/AEM.02908-08
its host Apis mellifera. Parasitology Research 107(2): 381-388.
MARTÍN-HERNÁNDEZ, R; MEANA, A; PRIETO, L; MARTINEZSALVADOR, A; GARRIDO-BAILÓN, E; HIGES, M (2007) Outcome
http://dx.doi.org/10.1007/s00436-010-1875-1 PORRINI, M P; SARLO, E G; MEDICI, S K; GARRIDO, P M; PORRINI, D
of colonization of Apis mellifera by Nosema ceranae. Applied and
P; DAMIANI, N; EGUARAS, M J (2011) Nosema ceranae
Environmental Microbiology 73(20): 6331-6338.
development in Apis mellifera: influence of diet and infective
http://dx.doi.org/10.1128/AEM.00270-07 MAYACK, C; NAUG, D (2009) Energetic stress in the honey bee Apis
mellifera from Nosema ceranae infection. Journal of Invertebrate Pathology 100(3): 185-188. http://dx.doi.org/10.1016/j.jip.2008.12.001 MCMULLAN, J B; BROWN, M J F (2005) Brood pupation temperature affects the susceptibility of honey bees (Apis mellifera) to
inoculum. Journal of Apicultural Research 50(1): 35-41. http://dx.doi.org/10.3896/IBRA.1.50.1.04 RIBBANDS, C R (1950) Changes in the behaviour of honey bees following their recovery from anaesthesia. Journal of Experimental
Biology 27(3-4): 302-310. RUEPPELL, O; HAYWORTH, M K; ROSS, N P (2010) Altruistic self-
infestation by tracheal mites (Acarapis woodi). Apidologie 36(1):
removal of health-compromised honey bee workers from their
97-105. http://dx.doi.org/10.1051/apido:2004073
hive. Journal of Evolutionary Biology 23(7): 1538-1546.
MEANA, A; MARTÍN-HERNÁNDEZ, R; HIGES, M (2010) The reliability of spore counts to diagnose Nosema ceranae infections in honey bees. Journal of Apicultural Research 49(2): 212-214. MEIXNER, M D; PINTO, M A; BOUGA, M; KRYGER, P; IVANOVA, E; FUCHS, S (2013) Standard methods for characterising subspecies and ecotypes of Apis mellifera. In V Dietemann; J D Ellis; P
http://dx.doi.org/10.1111/j.1420-9101.2010.02022.x RUTRECHT, S T; BROWN, M J F (2008) Within colony dynamics of
Nosema bombi infections: disease establishment, epidemiology and potential vertical transmission. Apidologie 39(5): 504-514. http://dx.doi.org/10.1051/apido:2008031 RUTRECHT, S T; KLEE, J; BROWN, M J F (2007) Horizontal
Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
transmission success of Nosema bombi to its adult bumble bee
methods for Apis mellifera research. Journal of Apicultural
hosts: effects of dosage, spore source and host age. Parasitology
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.05 MICHAILOFF, A S (1928) Statistische Untersuchungen über Nosema
134: 1719-1726. SAGASTUME, S; DEL ÁGUILA, C; MARTÍN-HERNÁNDEZ, R; HIGES, M;
an der Tulaer Versuchsstation für Bienenzucht. Archive für
HENRIQUES-GIL, N (2011) Polymorphism and recombination for
Bienenkunde 9: 89-114.
rDNA in the putatively asexual microsporidian Nosema ceranae, a
OFFICE INTERNATIONAL DES EPIZOOTIES (OIE) (2008) Nosemosis of honey bees. [WWW document].URL http://www.oie.int/eng/ normes/mmanual/2008/pdf/2.02.04_NOSEMOSIS.pdf
pathogen of honey bees. Environmental Microbiology 13(1): 84-95. http://dx.doi.org/10.1111/j.1462-2920.2010.02311.x SCHMIDT, J O; THOENES, S C; LEVIN, M D (1987) Survival of honey bees,
Apis mellifera (Hymenoptera: Apidae), fed various pollen sources. Annals of the Entomological Society of America 80(2): 176-183.
The COLOSS BEEBOOK: nosema
SMAGGHE, G; GOODMAN, C L; STANLEY, D (2009) Insect cell culture
27
WANG, D-I, MOELLER, F E (1970) The division of labor and queen
and applications to research and pest management. In Vitro Cell
attendance behaviour of nosema-infected worker honey bees.
Developmental Biology Animal 45(3-4): 93-105.
Journal of Economic Entomology 63(5): 1539-1541.
http://dx.doi.org/10.1007/s11626-009-9181-x SMART, M D; SHEPPARD, W S (2011) Nosema ceranae in age cohorts of the western honey bee (Apis mellifera). Journal of Invertebrate
Pathology 109(1): 148-151. http://dx.doi.org/10.1016/j.jip.2011.09.009. TAY, W T; O’MAHONEY, E M; PAXTON, R J (2005) Complete rRNA
WEBSTER, T C (1994) Fumagillin effects on Nosema apis and honey bees (Hymenoptera: Apidae). Journal of Economic Entomology 87 (3): 601-604. WEBSTER, T C (2008) Nosema apis infection in honey bee (Apis
mellifera) queens. Journal of Apicultural Research 47(1): 53-57. WEBSTER, T C; POMPER, K W; HUNT, G; THACKER, E M; JONES, S C
gene sequences reveal that the microsporidium Nosema bombi
(2004) Nosema apis infection in worker and queen Apis mellifera.
infects diverse bumble bee (Bombus spp.) hosts and contains
Apidologie 35(1): 49-54. http://dx.doi.org/10.1051/apido:2003063
multiple polymorphic sites. Journal of Eukaryotic Microbiology 52 (6): 505-513. http://dx.doi.org/10.1111/j.550-7408.2005.00057.x TANNER, G; WILLIAMS, G R; MEHMANN, M; NEUMANN, P (2012)
WHITE, G F (1919) Nosema disease. US Department of Agriculture
Bulletin 780. WILLIAMS, G R; SHAFER SHAFER, A B A; ROGERS, R E L; SHUTLER, D;
Comparison of mass versus individual inoculation of worker honey
STEWART, D T (2008) First detection of Nosema ceranae, a
bees with Nosema ceranae. In Proceedings of the 8th COLOSS
microsporidian parasite of European honey bees (Apis mellifera),
Conference / MC meeting FA0803. Halle-Saale, Germany, 1-3
in Canada and central USA. Journal of Invertebrate Pathology 97
September 2012. p 59. TENTCHEVA, D; GAUTHIER, L; ZAPPULLA, N; DAINAT, B;
(2): 189-192. http://dx.doi.org/10.1016/j.jip.2007.08.005 WILLIAMS, G R; ALAUX, C; COSTA, C; CSÁKI, T; DOUBLET, V;
COUSSERANS, F; COLIN, M E; BERGOIN, M (2004) Prevalence
EISENHARDT, D; FRIES, I; KUHN, R; MCMAHON, D P; MEDRZYCKI,
and seasonal variations of six bee viruses in Apis mellifera L. and
P; MURRAY, T E; NATSOPOULOU, M E; NEUMANN, P; OLIVER, R;
Varroa destructor mite populations in France. Applied and
PAXTON, R J; PERNAL, S F; SHUTLER, D; TANNER, G; VAN DER
Environmental Microbiology 70(12): 7185-7191.
STEEN, J J M; BRODSCHNEIDER, R (2013) Standard methods for
http://dx.doi.org/0.1128/AEM.70.12.7185-7191.2004
maintaining adult Apis mellifera in cages under in vitro laboratory
TRAVER, B E; FELL, R D (2011) Prevalence and infection intensity of
conditions. In V Dietemann; J D Ellis; P Neumann (Eds) The
Nosema in honey bee (Apis mellifera L.) colonies in Virginia.
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
Journal of Invertebrate Pathology 107(1): 43-49.
research. Journal of Apicultural Research 52(1):
http://dx.doi.org/10.1016/j.jip.2011.02.003
http://dx.doi.org/10.3896/IBRA.1.52.1.04
TRAVER, B E; FELL, R D (2012) Low natural levels of Nosema ceranae WILLIAMS, G R; ROGERS, R E L; KALKSTEIN, A L; TAYLOR, B A; in Apis mellifera queens. Journal of Invertebrate Pathology 110(3):
SHUTLER, D; OSTIGUY, N (2009) Deformed wing virus in western
408-410. http://dx.doi.org/10.1016/j.jip.2012.04.001
honey bees (Apis mellifera) from Atlantic Canada and the first
TRAVER, B E; WILLIAMS, M R; FELL, R D (2012) Comparison of within
description of an overtly-infected emerging queen. Journal of
hive sampling and seasonal activity of Nosema ceranae in honey
Invertebrate Pathology 101(1): 77-79.
bee colonies. Journal of Invertebrate Pathology 109(2): 187-193.
http://dx.doi.org/10.1016/j.jip.2009.01.004
http://dx.doi.org/10.1016/j.jip.2011.11.001 TROEMEL, E R (2011) New models for microsporidiosis: infections in
WILLIAMS, G R; SHUTLER, D; ROGERS, R E L (2010) Effects at Nearctic north-temperate latitudes of indoor versus outdoor
zebrafish, C. elegans and honey bee. PLoS Pathology 7(2):
overwintering on the microsporidium Nosema ceranae and
e1001243. http://dx.doi.org/10.1371/journal.ppat.1001243
western honey bees (Apis mellifera). Journal of Invertebrate
VAN OERS, M M; LYNN, D E (2010) Insect cell culture. eLS. Wiley online Library. http://dx.doi.org/10.1002/9780470015902.a0002574.pub2 VAVRA, J; LARSSON, R (1999) Structure of the microsporidia. In
Pathology 104(1): 4-7. http://dx.doi.org/10.1016/j.jip.2010.01.009 WILLIAMS, G R; SHUTLER, D; LITTLE, C M; BURGHER-MACLELLAN,
Wittner, M; Weiss [initials?] (Eds) The microsporidia and
K L; ROGERS, R E L (2011) The microsporidian Nosema ceranae,
microsporidiosis. ASM Press; Washington D C; USA. pp. 7-84.
the antibiotic Fumagilin-B®, and western honey bee (Apis mellifera)
VERBEKE, M; JACOBS, F J; DE RYCKE, P H (1984) Passage of various particles through the ventriculus in the honey bee (Apis mellifera L.). American Bee Journal 123(6): 468-470.
colony strength. Apidologie 41(1): 15-22. http://dx.doi.org/10.1051/apido/20100230. WILSON, W T; NUNAMAKER, R A (1983) The incidence of Nosema
apis in honey bees in Mexico. Bee World 64(3): 132-136.
Fries et al.
28
WOYCIECHOWSKI, M; MORON, D (2009) Life expectancy and onset of foraging in the honey bee ( Apis mellifera). Insectes Sociaux 56 (2): 193-201. http://dx.doi.org/10.1007/s00040-009-0012-6 YUE, C; SCHRÖDER, M; GISDER, S; GENERSCH, E (2007) Verticaltransmission routes for deformed wing virus of honey bees (Apis
mellifera). Journal of General Virology 88: 2329-2336. http://dx.doi.org/10.1099/vir.0.83101-0
ZANDER, E (1909) Tierische Parasiten als Krankenheitserreger bei der Biene. Münchener Bienenzeitung 31, 196-204. ZANDER, E; BÖTTCHER, F K (1984) Krankheiten der Biene, 7:e.
edition. Verlag Eugen Ulmer, Stuttgart, Germany. 408 pp.
Journal of Apicultural Research 52(4): (2013)
© IBRA 2013
DOI 10.3896/IBRA.1.52.4.22
REVIEW ARTICLE
Standard methods for virus research in Apis mellifera
Joachim R de Miranda1*, Lesley Bailey2, Brenda V Ball2, Philippe Blanchard3, Giles E Budge4, Nor Chejanovsky5, Yan-Ping Chen6, Laurent Gauthier7, Elke Genersch8, Dirk C de Graaf9, Magali Ribière3, Eugene Ryabov10, Lina De Smet9 and Jozef J M van der Steen11 1
Department of Ecology, Swedish University of Agricultural Sciences, PO Box 7044, Uppsala, 750-07 Sweden. AgroEcology Department, Rothamsted Research, Harpenden, Hertfordshire, AL5 2JQ, UK. 3 Anses, Sophia-Antipolis Laboratory, Bee Diseases Unit, BP 111, Sophia Antipolis, 06902 France. 4 National Bee Unit, Food and Environment Research Agency, Sand Hutton, York, YO41 1LZ, UK. 5 Agricultural Research Organization, The Volcani Center, PO Box 6, Bet Dagan, 50250 Israel. 6 USDA-ARS, Bee Research Lab, BARC-E Bldg 306, Beltsville, MD 20705, USA. 7 Swiss Bee Research Center, Agroscope Liebefeld-Posieux (ALP), Schwarzenburgstr. 161, Bern, CH-3003 Switzerland. 8 Institute for Bee Research, Friedrich-Engels-Str. 32, Hohen Neuendorf, 16540 Germany. 9 Laboratory of Zoophysiology, Department of Physiology, Ghent University, Ghent, B-9000 Belgium. 10 School of Life Sciences, University of Warwick, Coventry CV4 7AL, UK. 11 Plant Research International, Wageningen University and Research Centre, Business Unit Biointeractions and Plant Health, Box 16, Wageningen, 6700AA The Netherlands. 2
Received 27 April 2012, accepted subject to revision 19 July 2012, accepted for publication 20 February 2013. *Corresponding author: Email: joachim.de.miranda@slu.se
Summary Honey bee virus research is an enormously broad area, ranging from subcellular molecular biology through physiology and behaviour, to individual and colony-level symptoms, transmission and epidemiology. The research methods used in virology are therefore equally diverse. This article covers those methods that are very particular to virological research in bees, with numerous cross-referrals to other BEEBOOK papers on more general methods, used in virology as well as other research. At the root of these methods is the realization that viruses at their most primary level inhabit a molecular, subcellular world, which they manipulate and interact with, to produce all higher order phenomena associated with virus infection and disease. Secondly, that viruses operate in an exponential world, while the host operates in a linear world and that much of the understanding and management of viruses hinges on reconciling these fundamental mathematical differences between virus and host. The article concentrates heavily on virus propagation and methods for detection, with minor excursions into surveying, sampling management and background information on the many viruses found in bees.
Métodos estándar para la investigación de virus en Apis mellifera Resumen La investigación de los virus de la abeja de la miel es un área sumamente amplia, que abarca desde la biología molecular subcelular hasta la fisiología y el comportamiento, desde síntomas al nivel de individuo hasta al nivel de la colmena, transmisión y epidemiología. Los métodos de investigación en virología son, por tanto, diversos. Este artículo incluye aquellos métodos específicos de la investigación virológica en las abejas, con numerosas referencias cruzadas con otros artículos del BEEBOOK y otros más generales, usados tanto en virología como en otras disciplinas. La base de estos métodos es la comprensión de los virus en su nivel primario de hábitat molecular, ambiente subcelular, que manipulan y con el que interactúan, para producir otros fenómenos de orden superior asociados a la infección del virus y la enfermedad. En segundo lugar, estos virus actúan en un mundo exponencial, mientras que los hospedadores actúan en un mundo lineal y gran parte del entendimiento y manejo de los virus depende de los fundamentos matemáticos de las diferencias entre el virus y el hospedador. El artículo se centra principalmente en la propagación de virus y en los métodos para su detección, con inclusiones menores en su estudio, el manejo del muestreo y la información general sobre los numerosos virus que se encuentran en las abejas.
Footnote: Please cite this paper as: DE MIRANDA, J R; BAILEY, L; BALL, B V; BLANCHARD, P; BUDGE, G; CHEJANOVSKY, N; CHEN, Y-P; GAUTHIER, L; GENERSCH, E; DE GRAAF, D; RIBIÈRE, M; RYABOV, E; DE SMET, L; VAN DER STEEN, J J M (2013) Standard methods for virus research in Apis mellifera. In V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK, Volume II: standard methods for Apis mellifera pest and pathogen research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.22
2
de Miranda et al.
西方蜜蜂病毒研究的标准方法 摘要 蜜蜂病毒研究是一个非常广阔的领域,涉及亚细胞分子生物学、生理学和行为学、个体和蜂群症状、传播和流行病学。因此病毒学研究中用到的 方法种类繁多。本文涵盖了蜜蜂病毒学研究中特有的一些方法。其中涉及大量在病毒学和其它研究中都有用到的方法,在BEEBOOK关于普通方 法的章节中已有介绍。这些方法的根源是认识到病毒归根到底生活于一个分子和亚细胞世界,它们操控和作用于这一环境,以产生和病毒感染与 疾病相关的更高级别的现象。其次,病毒在指数世界运行,而宿主在线性世界运行,理解和控制病毒很大程度上依赖于协调病毒和宿主之间的这 些基本数学差异。本文重点针对病毒复制和病毒检测方法,也提及调查、取样操作及蜜蜂上发现的一些病毒的背景信息。
Keywords: COLOSS BEEBOOK, honey bee, virus, sampling, purification, assays, standardisation
The COLOSS BEEBOOK: virus methods
Table of Contents
3
Page No.
Page No.
1.
Introduction
5 4.4.
Sample transport
13
1.1
Honey bee viruses
5 4.4.1.
Freezing
13
1.1.1.
Acute bee paralysis virus / Kashmir bee virus / Israel acute paralysis virus
5 4.4.2.
Ice
13
1.1.2.
Black queen cell virus
5 4.4.3.
Live transport
13
1.1.3.
Aphid lethal paralysis virus & Big Sioux River virus
5 4.4.4.
Chemical stabilizers
13
1.1.4.
Deformed wing virus / kakugo virus / Varroa destructor virus-1 / Egypt bee virus
5 4.4.5.
Sample collection cards
14
1.1.5.
Sacbrood virus / Thai sacbrood virus
8 4.5.
Long-term sample storage
14
1.1.6.
Slow bee paralysis virus
8 5.
Virus propagation
14
1.1.7.
Chronic bee paralysis virus / satellite virus
8 5.1.
Introduction
14
1.1.8.
Cloudy wing virus
8 5.2.
Starting material
14
1.1.9.
Bee virus X / bee virus Y
8 5.3.
Oral propagation
14
1.1.10.
Lake Sinai virus-1 / Lake Sinai virus-2
8 5.3.1.
Larvae
14
1.1.11.
Arkansas bee virus & Berkeley bee virus
9 5.3.2.
Adults
14
1.1.12
Apis mellifera filamentous virus
9 5.4.
Injection propagation
15
1.1.13.
Apis iridescent virus
9 5.4.1.
Pupae
15
1.2.
Definitions: pathogenicity vs virulence; incidence vs prevalence
9 5.4.2.
Adults
17
1.3.
Virus replication and variation
10 5.5.
Tissue culture
19
1.3.1.
The mathematics of virus replication and transmission
10 5.5.1.
Virus infection
19
1.3.2.
Virus variability and evolution
10 5.6.
Full-length infectious virus clones
20
2.
Virus surveys
10 5.6.1.
Full-length viral RNA synthesis strategies
20
2.1.
Introduction
10 5.6.2.
Protocol
20
2.2.
Types of survey
11 5.6.2.1.
Full-length reverse transcription
20
2.2.1.
Passive surveillance
11 5.6.2.2.
Amplifying full-length viral RNAs
21
2.2.2.
Active surveillance
11 5.6.2.3.
Cloning full-length viral RNAs
21
3.
Statistical aspects
11 5.6.2.4.
Confirmation of full-length clones
21
3.1.
Introduction
11 5.6.2.5.
Synthesizing full-length viral RNA
22
3.2.
Statistical distribution of virus data
11 5.6.2.6.
Confirmation of Full-length Viral RNA
22
3.2.1.
Log-transformation
11 6.
Virus infectivity assays
22
3.2.2.
Zero values
11 7.
Virus purification
22
4.
Virus sample management
12 7.1.
Introduction
22
4.1.
Introduction
12 7.2.
Protocols
22
4.2.
What, where and when to sample
12 7.2.1.
Primary extract
22
4.2.1.
What to sample?
12 7.2.2.
High speed centrifugation
23
4.2.2.
Where to sample?
12 7.2.3.
Gradient centrifugation
23
4.2.3.
When to sample?
12 7.2.3.1.
Sucrose gradients
23
4.3.
Sample collection
12 7.2.3.2.
Caesium chloride gradients
23
4.3.1.
Adult bees
13 7.2.3.3.
Fractionation
24
4.3.2.
Pupae
13 8.
Virus sample processing
24
4.3.3.
Larvae
13 8.1.
Introduction
24
4.3.4.
Eggs
13 8.2.
Sample homogenisation
24
4.3.5.
Extracted guts
13 8.2.1.
Bead-mill homogenizers
24
4.3.6.
Drone endophallus and semen
13 8.2.2.
Blender
24
4.3.7.
Faeces
13 8.2.3.
Mortar and pestle
24
4.3.8.
Dead colonies
13 8.2.4.
Mesh bags
24
de Miranda et al.
4
Table of Contents cont’d
Page No.
Page No.
8.2.5.
Micropestle
24 10.2.4.
Removal of tagged-cDNA primers from the cDNA reaction
32
8.2.6.
Robotic extraction
24 10.2.5.
Inactivating tagged-cDNA primers in the cDNA reaction
33
8.3.
Nucleic acid extraction
25 10.2.6.
Dilution
34
8.3.1.
Protocol 1 – affinity column purification
25 10.2.7.
Strand-specific real-time RT-qPCR
34
8.3.2.
Protocol 2 – TRIzol extraction and isopropanol precipitation
25 10.2.8.
Protocols
34
8.4.
Nucleic acid quality assessment
25 10.2.8.1.
High temperature reverse transcription
34
9.
Virus detection
25 10.2.8.2.
Exonuclease-I digestion of tagged primer
35
9.1.
Introduction
25 10.2.8.3.
Column purification of cDNA
35
9.2.
Enzyme-Linked ImmunoSorbent Assay (ELISA)
26 10.2.8.4.
OneStep PCR
35
9.2.1.
Normal ELISA
26 10.2.8.5.
Real-time qPCR
35
9.2.2.
Sandwich ELISA
26 10.2.9.
Controls
35
9.2.3.
Protocols
26 10.3.
Multiplex Ligation-dependent Probe Amplification (MLPA)
36
9.2.3.1.
Sample preparation
26 10.3.1.
Introduction
36
9.2.3.2.
ELISA
27 10.3.2.
Protocol
36
9.2.3.3.
Sandwich ELISA
27 10.3.2.1.
Primer and probe mixtures
36
9.2.3.4.
Development
27 10.3.2.2.
Reverse transcription
36
9.2.3.5.
Controls
27 10.3.2.3.
Hybridisation of MLPA half-probes
38
9.3.
RT-(q)PCR
28 10.3.2.4.
Ligation of MLPA half-probes
38
9.3.1.
Primer design
28 10.3.2.5.
PCR amplification of MLPA probes
38
9.3.1.1.
What do we want to detect?
28 10.3.3.
Fragment analysis
38
9.3.1.2.
Where in the genome?
28 10.3.4.
Controls
38
9.3.1.3.
Primer annealing temperature, length and composition
28 11.
Virus variation
38
9.3.1.4.
Primer-dimer and other PCR artefacts
28 11.1.
Introduction
38
9.3.1.5.
Fragment length
28 11.2.
Protocols
39
9.3.2.
Detection and analysis of PCR products
28 11.2.1.
Nuclease protection assays (RPAs and SNPAs)
39
9.3.2.1.
“End-point” vs “real-time” detection
28 11.2.2.
Gel retardation assays (SSCP and DGGE)
39
9.3.2.2.
Cycles and thresholds
29 11.2.3.
High Resolution Melting (HRM) analysis
39
9.3.2.3.
Detection chemistry
29 11.2.4.
Sequencing
40
9.3.3.
Assay optimization
29 12.
Quality control
40
9.3.3.1.
Reverse transcription
29 12.1.
Introduction
40
9.3.3.2.
One-Step/Two-Step RT-PCR
29 12.2.
Assay selection and validation
41
9.3.4.
Protocols
29 12.2.1.
Analytical specificity
41
9.3.4.1.
Reverse transcription
29 12.2.1.1.
Analysis in silico
41
9.3.4.2.
Two-Step RT-qPCR
30 12.2.1.2.
Experimental specificity
41
9.3.4.3.
One-Step RT-qPCR
30 12.2.2.
PCR detection limit
41
9.3.5.
Quantitation controls
30 12.2.3.
qPCR dynamic range and quantitation limit
41
9.3.5.1.
External reference standards
30 12.3.
Method validation
42
9.3.5.2.
Internal reference standards
30 12.3.1.
Method detection limit
42
9.3.6.
Multiple assays
31 12.3.2.
Method diagnostic sensitivity and diagnostic specificity
42
9.3.7.
Multiplex RT-(q)PCR
31 12.3.3.
Method quantitation limit & accuracy profile
42
9.4.
Microarrays
31 12.4.
Laboratory Validation
42
10.
Virus replication
31 12.4.1.
Training and accreditation
42
10.1.
Introduction
31 12.4.2.
Inter-laboratory proficiency testing
42
10.2.
Strand-specific RT-qPCR
32 13.
Future perspectives
43
10.2.1.
Thermostable reverse transcriptases
32 14.
Acknowledgements
44
10.2.2.
Chemical blocking of RNA 3’ ends
32 15.
References
44
10.2.3.
Tagged cDNA primers
32
The COLOSS BEEBOOK: virus methods
5
1. Introduction
very rapidly; 3-5 days after inoculation with sufficient virion loads.
1.1. Honey bee viruses
by varroa, since infected pupae fail to complete development,
There are currently about 24 viruses identified in honey bees, whose
preventing the release of infectious mites from the pupal cells
This exerts a strong negative selection pressure on the transmission
physical and biological properties are described in Table 1 and Table 2 (Sumpter and Martin, 2004). The association of these viruses with respectively. Most of these were discovered by Bill Bailey, Brenda Ball
varroa infestation is therefore unstable and much influenced by the
and colleagues at Rothamsted Experimental Station, UK during the
presence of other viruses that are better adapted to transmission by
1960s-1980s (Bailey and Ball, 1991; Ribière et al., 2008). More recent
varroa.
additions have come mostly from mass sequencing of RNA and DNA from whole bee extracts (Fujiyuki et al., 2004; Cox-Foster et al.,
1.1.2. Black queen cell virus
2007; Cornman et al., 2010; Runckel et al., 2011), and it may well be
The main symptoms for black queen cell virus (BQCV) consist of
that there is overlap between the traditionally described viruses and
blackened cell walls of sealed queen cells, containing dead pro-pupae
these newly described viral sequences. Several viruses are also closely (Bailey and Ball, 1991; Leat et al., 2000). Diseased larvae have a pale enough related to be regarded as members of a single species
yellow appearance and tough sac-like skin, much like sacbrood. The
complex (DWV/VDV-1/EBV; ABPV/KBV/IAPV; SBV/TSBV; BVX/BVY and virus is present in adult bees but without obvious symptoms. LSV-1/LSV-2), reducing the total to around 16-18 truly unique viruses. Although some viruses produce recognizable symptoms at sufficiently elevated titres, honey bee viruses generally persist
1.1.3. Aphid lethal paralysis virus & Big Sioux River virus Aphid lethal paralysis virus (ALPV) is a common intestinal dicistrovirus
naturally in honey bee populations at low levels, without causing overt of several major agricultural aphid pests, associated with aphid symptoms, using a variety of transmission routes (Fig. 1; Table 2).
population declines (van Munster et al., 2002 Laubscher and von
Symptoms are, however, still the principal method by which diseases
Wechmar, 1992; 1993). Big Sioux River virus (BSRV) is closely related
are diagnosed in the apiary. The advantages of symptom-based
to Rhopalosiphum padi virus (RhPV; Moon et al., 1998), another
diagnosis are that it is robust, simple, fast and cheap and for some
common intestinal Dicistrovirus that uses the plant vascular system to
diseases accurate. The major disadvantages are that:
transmit horizontally between aphids (Gildow and D’Arcy, 1990). Both
many virus infections do not present visible symptoms at all
can be detected infrequently at very low background levels in adult
times
honey bees throughout the year, with a sharp quantitative increase
not all life stages present symptoms
during late summer (Runckel et al., 2011) when bees often feed on
often different viruses produce similar symptoms
honeydew (aphid excreta) during low nectar flows. It is unclear
(e.g. paralysis)
therefore whether these viruses are incidental or truly infectious in
a single virus may present different symptoms (e.g. CBPV)
bees. Either of these may be related to Berkeley bee picorna-like virus
symptoms can be confounded if multiple virus infections are
(BBPV; Lommel et al., 1985), which has not yet been sequenced.
present All viruses are asymptomatic at lower levels of infection and most
1.1.4. Deformed wing virus /kakugo virus /Varroa destructor
shorten the life span of bees to varying degrees. The diagnostic
virus-1 /Egypt bee virus
symptoms for the major virus diseases have been described in detail
The symptoms for deformed wing virus (DWV) consist of bees with
by Bailey and Ball (1991) and can be summarized as follows:
crumpled and/or vestigial wings and bloated abdomen and infected bees die soon after emergence. Asymptomatic bees can also be
1.1.1. Acute bee paralysis virus /Kashmir bee virus /Israeli
heavily infected, though with lower titres than symptomatic bees
acute paralysis virus
(Bowen-Walker et al., 1999; Lanzi et al., 2006; Tentcheva et al.,
Acute bee paralysis virus (ABPV), Kashmir bee virus (KBV) and Israeli
2006). The virus is detected in all other life stages as well, but without
acute paralysis virus (IAPV) are three closely related viruses (de Miranda obvious symptoms (Chen et al., 2005a; 2005b; Yue and Genersch
et al., 2010a) that are largely symptomless, but they can be lethal at
2005; Lanzi et al., 2006; Tentcheva et al., 2006; Fievet et al., 2006;
individual and colony level (Allen and Ball, 1995; Todd et al., 2007),
Yue et al., 2006; de Miranda and Genersch, 2010). ‘kakugo’ virus (KV;
particularly when transmitted by Varroa destructor (Ball, 1985; 1989;
Fujiyuki et al., 2004; 2006) and other strains of DWV (Terio et al.,
Ball and Allen, 1988) which is an active vector of these viruses (Chen
2008) have been associated with elevated aggression in bees,
et al., 2004a; Shen et al., 2005a; 2005b; DiPrisco et al., 2011). These although naturally aggressive bee races are not more infected with viruses are characterized by the ability to kill both pupae (after
DWV than gentle bee races (Rortais et al., 2006). DWV also affects
injection; Bailey, 1967; Bailey and Ball, 1991) and adult bees (after
sensory response, learning and memory in adults (Iqbal and Müller,
injection or feeding: Maori et al., 2007a; 2009; Hunter et al., 2010)
2007).
de Miranda et al.
6
Table 1. Summary of the physical properties, such as particle shape, size, capsid protein profile, genome type and length and taxonomy, of the currently known honey bee viruses. Adapted from Bailey and Ball (1991). PHYSICAL PROPERTIES VIRUS
SHAPE
SIZE
CAPSID PROTEINS
NUCLEIC ACID
GENOME SIZE
TAXONOMY
Acute bee paralysis virus
ABPV
icosahedral
30nm
35-9-33-24kDa
ssRNA
~9.5kb
Dicistroviridae
Kashmir bee virus
KBV
icosahedral
30nm
37-6-34-25kDa
ssRNA
~9.5kb
Dicistroviridae
Israeli acute paralysis virus
IAPV
icosahedral
30nm
35-7-33-26kDa
ssRNA
~9.5kb
Dicistroviridae
Black queen cell virus
BQCV
icosahedral
30nm
31-14-29-30kDa
ssRNA
~9.5kb
Dicistroviridae
Aphid lethal paralysis virus
ALPV
icosahedral
30nm
25-7-32-28kDa*
ssRNA
~10kb
Dicistroviridae
Big Sioux River virus
BSRV
icosahedral
30nm
28-5-29-30kDa
ssRNA
~10kb
Dicistroviridae
Deformed wing virus
DWV
icosahedral
30nm
32-2-44-28kDa
ssRNA
~10kb
Iflaviridae
Varroa destructor virus-1
VDV-1
icosahedral
30nm
32-2-46-28kDa
ssRNA
~10kb
Iflaviridae
Egypt bee virus
EBV
icosahedral
30nm
30-2-41-25kDa
ssRNA
?
Iflaviridae
Sacbrood virus
SBV
icosahedral
30nm
31-2-32-30kDa
ssRNA
~9kb
Iflaviridae
Thai/Chinese sacbrood virus
TSBV
icosahedral
30nm
31-2-32-30kDa
ssRNA
~9kb
Iflaviridae
Slow bee paralysis virus
SBPV
icosahedral
30nm
27-2-46-29kDa
ssRNA
~9.5kb
Iflaviridae
Chronic bee aralysis virus
CBPV
anisometric
30~60nm
23-(30/50/75?)kDa
ssRNA
~2.3kb/~3.7kb
unclassified
Chronic bee paralysis satellite virus
CBPSV
icosahedral
17nm
15kDa
ssRNA
(3x)~1.1kb
satellite
Cloudy wing virus
CWV
icosahedral
17nm
19kDa
ssRNA
~1.4kb
?
Bee virus-X
BVX
icosahedral
35nm
52kDa
ssRNA
?
?
Bee virus-Y
BVY
icosahedral
35nm
50kDa
ssRNA
?
?
Lake Sinai Virus-1
LSV-1
?
?
63kDa*
ssRNA
~5.5kb
unclassified
Lake Sinai Virus-2
LSV-2
?
?
57kDa*
ssRNA
~5.5kb
unclassified
Arkansas bee virus
ABV
icosahedral
30nm
43kDa
ssRNA
~5.6kb
?
Berkeley bee picorna-like virus
BBPV
icosahedral
30nm
37-?-35-32kDa
ssRNA
~9kb
?
Varroa destructor Macula-like virus
VdMLV
icosahedral
30nm
24kDa*
ssRNA
~7kb
Tymoviridae
Apis mellifera filamentous virus
AmFV
rod
150x450nm
12x(13~70kDa)
dsDNA
?
Baculoviridae
AIV
polyhedral
150nm
dsDNA
?
Iridoviridae
Apis iridescent virus
* (genome predicted)
? SDS-PAGE
(order in polyprotein)
Fig. 1. Diagram describing the different possible transmission routes for honey bee viruses. Adapted from de Miranda et al. (2011).
The COLOSS BEEBOOK: virus methods
7
Table 2. Summary of the current state of knowledge concerning biological properties of honey bee viruses, such as transmission routes, associations with other parasites/pathogens, principal life stages affected and seasonal incidences. Adapted from de Miranda et al. (2011). TRANSMISSION HORIZONTAL
LIFE STAGE
ASSOCIATION
VERTICAL
SEASON
INFECT/SYMPTOMS
ORAL-FECAL
CONTACT
AIR
VARROA
OVARIES
SEMEN
SPERM
VARROA
ACARAPIS
NOSEMA
MALPIGHAMOEBA
EGGS
LARVAE
PUPAE
ADULTS
SPRING
SUMMER
AUTUMN
Acute bee paralysis virus
ABPV
+
-
?
+
+
+
?
+
?
?
?
+/-
+/-
+/~
+/+
+
+++
++
Kashmir bee virus
KBV
+
-
?
+
+
~
?
+
?
?
?
+/-
+/-
+/+
+/+
+
++
+++
Israeli acute paralysis virus
IAPV
+
-
?
+
+
~
?
+
?
?
?
+/-
+/-
+/~
+/+
+
++
++
Black queen cell virus
BQCV
+
-
?
~
+
?
?
+
?
+
?
+/-
+/-
+/+
+/-
+
+++
+
Aphid lethal paralysis virus
ALPV
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
-/-
+/?
-
+++
-
Big Sioux River virus
BSRV
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
-/-
+/?
-
+++
++
Deformed wing virus
DWV
+
-
?
+
+
+
?
+
?
?
?
+/-
+/-
+/+
+/+
+
++
+++
+
-
?
+
+
+
?
+
?
?
?
+/-
+/-
+/+
+/+
+
++
+++
VIRUS
Varroa VDV-1 destructor virus-1 Egypt bee virus
EBV
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
+/?
+/~
?
?
?
Sacbrood virus
SBV
+
-
?
-
?
?
?
~
?
?
?
?/?
+/+
+/-
+/~
+++
++
+
Thai/Chinese sacbrood virus
TSBV
+
?
?
?
?
?
?
?
?
?
?
?/?
+/+
+/-
+/~
?
?
?
Slow bee paralysis virus
SBPV
+
-
?
+
?
?
?
+
?
?
?
?/?
+/-
+/-
+/+
+
+
+
Chronic bee paralysis virus
CBPV
+
+
?
-
?
?
?
~
~
?
?
~/-
+/-
+/-
+/+
++
++
+
Chronic bee paralysis satellite virus
CBPSV
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
?/?
+/?
+
+
+
Cloudy wing virus
CWV
?
~
~
-
?
?
?
~
?
?
?
-/-
~/-
~/-
+/+
+
+
+
Bee virus-X
BVX
+
?
?
?
?
?
?
?
?
-
+
-/-
-/-
-/-
+/+
+++
+
+
Bee virus-Y
BVY
+
?
?
?
?
?
?
?
?
+
-
-/-
-/-
-/-
+/+
+
+++
+
Lake Sinai Virus-1
LSV-1
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
+/?
+/?
++
+++
++
Lake Sinai Virus-2
LSV-2
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
~/?
+/?
+++
+
+
Arkansas bee virus
ABV
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
~/?
+/?
?
?
?
Berkeley bee picorna-like virus
BBPV
?
?
?
?
?
?
?
?
?
?
?
?/?
?/?
?/?
+/?
?
?
?
Varroa destructor Macula-like VdMLV virus
?
?
?
+
?
?
?
+
?
?
?
?/?
?/?
+/?
+/?
+
++
+++
Apis mellifera filamentous virus
AmFV
+
?
?
?
?
?
?
?
?
+
?
-/-
-/-
-/-
+/+
+++
+
+
Apis iridescent virus
AIV
?
?
~
?
?
?
?
?
?
?
?
-/-
-/-
-/-
+/+
+
++
+
+
(present)
~
(uncertain)
?
(unknown)
de Miranda et al.
8
Varroa destructor virus-1 (VDV-1) is genetically closely related to DWV symptoms consists of hairless, greasy black bees caused by nibbling but is reported to be more specific to Varroa destructor than to bees
attacks from healthy bees in the colony. They soon also become
(Ongus, 2006). However, both viruses replicate in varroa mites as well flightless, tremble and die (Bailey, 1965; Bailey and Ball, 1991; Ribière as in honey bees (Ongus et al., 2004; Yue and Genersch, 2005; Zioni
et al., 2010). The virus also infects the larval and pupal stages, can be
et al., 2011); both have been detected at high titres in different honey detected in faecal material and is efficiently transmitted through bee tissues (Zioni et al., 2011; Gauthier et al., 2011); both have been
contact and feeding (Bailey et al., 1983b; Ribière et al., 2010). CBPV
found in regions where V. destructor is absent (Martin et al., 2012)
is sometimes associated with a small “satellite” virus; chronic paralysis
and natural recombinants between them have been found (Moore et
satellite virus (CBPSV; originally called chronic bee paralysis virus
al., 2011). VDV-1 and DWV therefore appear to co-exist in bees and
associate CBPVA), which has a unique genome and capsid protein to
mites as part of the same species-complex (de Miranda and Genersch, CBPV (Ribière et al., 2010) and is of unknown significance to 2010; Moore et al., 2011; Gauthier et al., 2011; Martin et al., 2012).
symptomatology (Bailey et al., 1980; Ball et al., 1985).
Egypt bee virus (EBV) is serologically related to DWV, but has no known symptoms in adults, pupae or larvae (Bailey et al., 1979).
1.1.8. Cloudy wing virus The symptoms for cloudy wing virus (CWV) consist of opaque wings
1.1.5. Sacbrood virus /Thai sacbrood virus
of severely infected adult bees, with lower titres resulting in asymptomatic
The clearest symptoms of sacbrood virus (SBV) appear a few days
infected bees (Bailey et al., 1980; Bailey and Ball, 1991; Carreck et al.,
after capping, and consist of non-pupated pale yellow larvae,
2010). It cannot be propagated in larvae or pupae. It has an unpredictable
stretched on their backs with heads lifted up towards the cell opening, incidence, no regular associations with other pathogens or pests. Like trapped in the unshed, saclike larval skin containing a clear, yellow-
chronic bee paralysis satellite virus it has a small particle and very
brown liquid. The virus is also present in adult bees, but without
small genome, but they are serologically unrelated and their single
symptoms (Lee and Furgula, 1967; Bailey, 1968). Diseased larvae are
capsid proteins are of different size (Table 1; Bailey et al., 1980).
most commonly seen in spring, but the disease normally clears quickly with rapid expansion. However, the Asian honey bee, Apis cerana,
1.1.9. Bee virus X /Bee virus Y
frequently suffers from lethal sacbrood epidemics caused by a closely
Bee virus X (BVX) is largely symptomless in adult bees and does not
related strain of SBV, variously called Thai sacbrood virus (TSBV),
multiply in larvae or pupae (Bailey and Ball, 1991). It is associated
Chinese sacbrood virus (CSBV) or Korean sacbrood. The genetic
with the protozoan Malpighamoeba mellificae that causes dysentery in
differences of these strains with the SBV infecting A. mellifera are
winter bees (Bailey et al., 1983a). Bee virus Y (BVY) is serologically
minimal. SBV-infected adults cease to attend brood or eat pollen, start related to BVX and is similarly symptomless in adult bees, larvae or foraging much sooner than normal, and only forage nectar, rarely
pupae. It is associated in adult bees with the dysentery inducing
pollen (Bailey and Fernando, 1972). These may be behavioural
microsporidium Nosema apis (Bailey et al., 1983a). Both viruses are
adaptations by A. mellifera to prevent sacbrood epidemics, since SBV
common, BVY more so than BVX, with strong peaks in late winter for
is shed in the hypopharyngeal secretions fed to larvae and combined
BVX and early summer for BVY (Table 2; Bailey and Ball, 1991).
with pollen to make bee-bread (Bailey and Ball, 1991). 1.1.10. Lake Sinai virus-1 /Lake Sinai virus-2 1.1.6. Slow bee paralysis virus
Lake Sinai virus-1 (LSV-1) and Lake Sinai virus-2 (LSV-2) are two
Slow bee paralysis virus (SBPV) is characterised by the paralysis of the closely related viruses that were identified in through a mass front two pairs of legs of adult bees, a few days before dying, after
metagenomic sequencing survey of honey bee colonies in the USA
inoculation by injection (Bailey and Woods, 1974). The virus is associated (Runckel et al., 2011). Their genome organization and sequences with, and transmitted by, V. destructor (Bailey and Ball, 1991; Denholm, place them together with CBPV, in a unique family somewhere 1999). Despite this association, SBPV is rarely detected in bee colonies between the Nodaviridae and Tombusviridae. Both viruses are common (Bailey and Ball, 1991; de Miranda et al., 2010b). SBPV can also be
and very abundant at peak incidence. LSV-1 is more common than
detected in larvae and pupae, but produces no symptoms in these.
LSV-2, present throughout the year with a peak in early summer. LSV2 has a very sharp incidence and abundance peak in late winter with
1.1.7. Chronic bee paralysis virus /satellite virus
low incidence and abundance the rest of the year. These viruses have
Chronic bee paralysis virus (CBPV) manifests itself in adult bees
also been detected, with similar incidences and titres, in historical
through two distinct set of symptoms. One set consists of trembling of European honey bee samples. LSV-1 and LSV-2 have strong similarities the wings and bodies and a failure to fly, causing them to crawl in
in capsid and genome size, seasonal incidence, predominantly adult-
front of the hive in large masses. They often have partly spread,
based infection and absence of overt symptoms with Bee virus Y and
dislocated wings and bloated bodies as well. The other set of
Bee virus X respectively (Table 1 and 2), and may therefore be related.
The COLOSS BEEBOOK: virus methods
9
1.1.11. Arkansas bee virus & Berkeley bee virus
Virulence is usually correlated to the pathogen’s capacity to
Arkansas bee virus (ABV) and Berkeley bee picorna-like virus (BBPV)
multiply in the host (Casadevall and Pirofski, 2001)
are two viruses first identified in the USA (Bailey and Woods, 1974;
represented, for example, by the virion titre when symptoms
Lommel et al., 1985; Bailey and Ball, 1991) of which very little is
appear (Figure 2) or the rate of multiplication. It can also be
known other than that they often occur together. They have no
affected by host and environmental factors, such as the
known symptoms in adult bees or brood. BBPV has typical capsid and
transmission route or type of tissue/life-stage infected. For
genome size characteristics of the Dicistro- and Iflaviruses.
example, a pathogen may be virulent when infecting one type of tissue and non-virulent when infecting a different tissue
1.1.12. Apis mellifera filamentous virus
(Casadevall and Pirofski, 1999). Virulence is therefore
Apis mellifera filamentous virus (AmFV) is a baculovirus-like DNA virus
dependent on the nature of the infection.
that has no physical symptoms. It renders the haemolymph of adult
Virulence is also a relative trait, referring to the differences in
bees milky white with rod-shaped viral particles, when examined by
the degree of pathology caused by strains of the same
electron microscopy (Clark, 1978; Bailey and Ball, 1991).
pathogen, or differences in the efficiency with which different strains can cause symptoms (Pirofski and Casadevall, 2012).
1.1.13. Apis iridescent virus
For example, a pathogen strain that requires few particles to
The symptoms for Apis iridescent virus (AIV) are similar to the adult
produce disease symptoms (strain-A in Figure 2) would be
flightless clustering symptoms of CBPV (Bailey et al., 1976; Bailey and
more virulent than a strain that requires many particles to
Ball, 1978). It is only known to occur in adult bees. A partial sequence
produce the same symptoms (strain-B in Figure 2).
of AIV has been published (Webby and Kalmakoff, 1999).
Since virulence is a quantitative measure, methods have been developed to quantify the relative contributions of different
1.2. Definitions: pathogenicity vs virulence; incidence vs prevalence The terms ‘Infectivity’, ‘Pathogenicity’, ‘Virulence’ and ‘Transmissibility’ are often used interchangeably, which has led to efforts to tighten and standardize their definition and adapt them to our improved understanding of host-pathogen interactions (Casadevall and Pirofski, 1999; 2001). The same is true for the terms ‘Incidence’ and ‘Prevalence’ in surveys and epidemiology. Here are their definitions:
Prevalence: The proportion of a population that is infected, or diseased, at any one time.
virulence factors to a phenotype (McClelland et al., 2006).
Transmissibility: This refers to the efficiency with which a pathogen is transmitted to naïve hosts. There are valid arguments that at epidemiological level, transmissibility could be considered a component of virulence (Figure 2). The relationship between transmission and virulence is a major topic in pathogen-host evolutionary theory (e.g. Ebert and Bull, 2003) and has been discussed within the context of honey bee colony structure (Fries and Camazine, 2001) and honey bee virus transmission (de Miranda and Genersch, 2010).
Incidence: This is the risk of new infection during a specified time. It is globally related to prevalence as a function of time:
prevalence = incidence x time
Infectivity: This refers to the ability of a microorganism to invade and replicate in a host tissue, whether the microbe is pathogenic or not.
Pathogenicity: This is a qualitative trait, referring to the inherent, genetic capacity of a microorganism to cause disease, mediated by specific virulence factors. Whether or not it does so, is the result of the specific host-pathogen interactions.
Virulence: This is a quantitative trait, representing the extent of the pathology caused by a microorganism. Virulence is therefore a trait expressing the interaction between a pathogen and its host. Its definition has been re-assessed
Fig. 2. Diagram describing the Log-linear relationship between virus
recently (Casadevall and Pirofski, 1999; 2001), in view of the
concentration (X-axis) and virulence (Y-axis), represented by the
significant influence of the host’s immunological condition on
degree/probability of Pathology (PPathology) or the efficiency/probability
the extent of the damage (i.e. virulence) caused by a
of Transmission (PTransmission). Other variables can also be plotted on
pathogen.
the Y-axis.
Image © J R de Miranda.
de Miranda et al.
10
1.3. Virus replication and variation
individuals as a unit. There are two forces that shape the genetic
Viruses have two main characteristics that are fundamental to the
identity of such a ‘mutant swarm’ (or ‘quasi-species’ as it is officially
design, analysis and interpretation of virological experiments, surveys
known)
and assays. These are:
The potential for rapid, exponential growth
The potential for rapid evolution and high levels of molecular variability
Fierce competition between molecular variants for supremacy in a particular cell, host etc.
Functional co-operation between variants, where a temporarily disfavoured variant can remain within the quasi-
Below we briefly discuss these two features and their impact on
species by ‘borrowing’ essential functions such as replication
experimentation and data management.
and packaging from the locally dominant variant. The functional co-operation is an adaptive super-feature of viruses,
1.3.1. The mathematics of virus replication and transmission
since it allows a wide range of genetic diversity to persist within a
Viruses are obligatory cell parasites and as such are capable of rapid,
quasi-species across time, hosts and environments. The true adaptive
exponential growth. This is particularly the case for viral replication
strength of a virus lies therefore more in the diversity within the
within individual organisms. This means that the virus replication
swarm than in the evolutionary abilities of any one strain.
dynamics can range from linear (when the virus persists as a covert
The importance of this variability for experimentation is in the
infection, with minimal replication) all the way to fully logarithmic
design of diagnostic assays for virus detection. Serological assays,
(when the virus is growing exponentially) and back to linear again
such as ELISA, are generally not affected by this variability which is
when the maximum virus load within diseased or dying organisms is
mainly expressed at the nucleic acid level. However, nucleic acid
reached, due to exhaustion of the resources for replication (Fig. 2).
assays, especially those based on the Polymerase Chain Reaction
The epidemiological spread between organisms is influenced by
(PCR), are often very sensitive to microvariation at the nucleotide
the transmission medium (air, water, vector), whose rules of
level, where even a single base-pair difference can be exploited for
dispersion are often not fully exponential. This also applies to other
specific diagnosis. It is here therefore that supreme care must be
barriers to virus proliferation, such as tissue-specificity, interference,
taken to ensure that the assays developed for detecting viruses, or
auto-interference, RNA silencing, and immune reactions which all can
virus strains, are designed accurately and conservatively, to avoid non
influence virus multiplication, shedding and dispersal. These
-detection due to assay inadequacy (see also section 12; “Quality Control”).
restrictions can temper the logarithmic character of the quantitative virus data distribution, at the individual bee, colony or regional level. What this means is that, from the design of experiments through to the analysis of the data, allowance has to be made for non-linear distributions of the data, ranging from fully logarithmic (pathogenic
2. Virus surveys 2.1. Introduction
replication) through semi-exponential (epidemic proliferation) to near- Bee diseases caused by viruses are significant threats to apiculture. linear (covert replication, dispersal). This can be addressed through
Pathogen surveillance is an essential component of a structured
transformations, thresholds or non-linear models, but it MUST be
(inter)national management strategy to contain or prevent epidemics
dealt with appropriately. Guidelines for this can be found in detail in
of viral diseases in honey bee populations. Such surveillance is done
the BEEBOOK paper on statistical methods (Pirk et al., 2013), with
both through questionnaires of beekeepers (see the BEEBOOK paper
aspects specific to virus research also covered in section 3; “Statistical on surveys; van der Zee et al., 2013) and through monitoring bee Aspects” of this chapter.
colonies for pathogen prevalence and amount.
1.3.2. Virus variability and evolution
virus (CBPV), deformed wing virus (DWV), black queen cell virus
The second major characteristic of viruses, particularly important
(BQCV), sacbrood bee virus (SBV) and cloudy wing virus (CWV), are
when designing molecular assays, is the ease and speed with which
capable of causing diseases with recognizable symptoms, most honey
they can generate and maintain large amounts of molecular
bee viruses usually persist and spread between colonies as covert
variability. The virus encoded RNA dependant RNA polymerase
infections without apparent symptoms in bees. Many other bee
(RdRp), which facilitates genome replication, lacks proofreading and
viruses such as bee virus X and bee virus Y (BVX; BVY) or filamentous
repair mechanisms causing a high mutation rate in RNA viruses.
virus (AmFV), either do not cause outward symptoms at all, or others,
Therefore a virus is not so much an individual entity with a fixed
such as slow bee paralysis virus (SBPV) and acute bee paralysis virus
genome, but rather a large ‘swarm’ of closely related variants,
(ABPV) only do so under laboratory conditions or produce vague, non-
Although some honey bee viruses, such as chronic bee paralysis
recombinants and other genetic oddities that are transmitted between descript symptoms, such as ‘early death’ by Kashmir bee virus (KBV)
The COLOSS BEEBOOK: virus methods
and Israeli acute paralysis virus (IAPV) or ‘clustering’ associated with Apis iridescent virus (AIV). Many bee virus infections cannot therefore be identified through field observations, because the symptoms are
11
3. Statistical aspects 3.1. Introduction
non-existent, inconsistent or absent due to low titres. Until field-ready Whether experimenting or conducting surveys, data will be generated pathogen ID-kits become available, pathological analysis requires the
that will need to be analysed, and this requires the use of statistics.
transport of samples to a laboratory for analysis.
Fortunately, there are excellent statistical tools available right now for helping design experiments, determining the sample size needed to
2.2. Types of survey
be able to make certain conclusions, for analysing the data and for
In epidemiology, there are two broad types of pathogen surveillance
modelling and prediction. It is highly recommended to include an
systems. Although they are often treated together in summaries and
expert statistician in the project right from the beginning, at the
reviews, they are in fact radically different in purpose, strategy,
design stage. It will mean that the experiment is set up correctly, that
methods and implications. Here we discuss these briefly as they apply
sampling is as efficient as possible and that the data are analysed
to honey bee virus surveillance. For more detail information on how to correctly. The most important statistical concepts and practices manage these different approaches, see the BEEBOOK papers on
relevant to honey bee research and surveying are covered in the
epidemiology (vanEngelsdorp et al., 2013) and surveys (van der Zee
BEEBOOK paper on statistical methods (Pirk et al., 2013), to which
et al., 2013).
the reader is referred to for guidance.
2.2.1. Passive surveillance
3.2. Statistical distribution of virus data
This is the type of survey where beekeepers voluntarily send in
The major additional point specifically relevant to honey bee virus
suspect bee samples to a diagnostic laboratory for analysis. Most
research (and probably other pathogens) is that virus titres follow an
countries operate such a service and often the samples are of colonies Exponential (~Logarithmic) distribution, rather than a Normal that died suddenly, usually after winter. The survey is ‘passive’ since it distribution (Fig. 2; Gauthier et al., 2007; Brunetto et al., 2009; Yañez only analyses material received from the public. It is analogous in
et al., 2012; Locke et al., 2012). Also, the prevalence of very rare
human epidemiology to the entry reports of health care facilities for
viruses (pathogens, parasites) may follow a Poisson distribution rather
active disease cases. There is no statistically designed sampling
than a Binomial distribution. These differences in how the primary
strategy, samples will be biased by beekeeper interest, experience
virus data is statistically distributed affects the design of an
and knowledge and proximity to the diagnostic facilities. Samples will
experiment, the determination of sample sizes (Wolfe and Carlin,
arrive in various states of decomposition making definitive diagnosis
1999), surveying strategy, the analysis of pooled samples and the
problematic (see section 4; ‘Virus Sample Management’), the data will
management of the data produced. This subject is treated in more
be heavily biased towards diseased colonies with high pathogen
detail in the BEEBOOK paper on statistical methods (Pirk et al., 2013).
prevalence/titre and the results will be more relevant to the management of epidemics rather than to their prevention.
3.2.1. Log-transformation Exponentially distributed data (i.e. quantitative virus titre data) must
2.2.2. Active surveillance
be treated with a power transformation (Box and Cox, 1964; Bickle
Active surveillance schemes fill many of the gaps of passive
and Doksum, 1981), usually a log-transformation, before they can be
surveillance. These are usually statistically designed sampling
used to estimate descriptive statistics (means, medians, variances
schemes to determine pathogen prevalence within the general bee
etc.) or be used in parametric statistical analyses (ANOVAs,
population, irrespective of symptoms. The bee samples are alive when correlations, GLMs etc.). This can be done prior to statistical analysis, collected, making molecular detection uniform and reliable, and the
or can be incorporated as part of the statistical analysis.
data are an accurate representation of the complete pathogen presence within a region. Often samples are taken repeatedly from
3.2.2. Zero values
the same colonies throughout a season, which has to be taken into
Since it is not possible to log-transform zero values, instances of non-
account during data analysis. A sub-category of active surveillance
detection (i.e. a ‘zero’ value) should be replaced by a non-zero
systems is ‘sentinel’ surveillance, i.e. a series of designated
constant value appropriate to the variable in question (Cox et al.,
‘monitoring’ colonies placed to catch certain pathogens before they
2000). A logical constant value to use for replacing zero-values in
reach a particular region.
quantitative virus data sets is one that is set just below the detection threshold for the virus in question (Yañez et al., 2012; Locke et al., 2012). This approach treats zero values as “below detection threshold” rather than as “absence of virus”, which is usually also a
de Miranda et al.
12
more accurate description of the virus status of a sample, especially if
4.2.2. Where to sample?
the virus is known to be present within the wider bee population.
The difficulty with adult bees is that the virus titre can be influenced by the age and the tasks of the bee. It is therefore advisable to sample as much as possible the same age/task group throughout the
4. Virus sample management
experiment, in order to minimize the influence of such effects on the
4.1. Introduction
either sampling from the brood chamber (mostly young nurse bees),
The aim of a survey or experiment is that the final data should as
the honey supers (medium-age bees) or at the entrance (older
closely as possible represent the (virus) status of the bee or colony
foraging bees). The choice of age-class for sampling is less important
when the sample was taken, since ultimately the data interpretation,
than consistently sampling the same age-class. See also the BEEBOOK
conclusions and recommendations will again refer to live bees.
paper on statistical methods (Pirk et al., 2013).
data (Van der Steen et al., 2012). In practical terms, this means
Sample management (from collection and field preservation, to transportation, short- and long-term storage, processing and finally
4.2.3. When to sample?
analysis) is therefore crucial to the accurate interpretation of survey
There are two considerations here. The first is the best time of day to
and experimental data. Honey bee sample management is covered in
collect a sample and the second how often to sample. The best time
detail in the BEEBOOK paper on molecular methods (Evans et al.,
to sample is either on sunny days, during the afternoon, when bees
2013) with a reduced version given below. Most viruses have an RNA
are actively foraging and the adult population is most clearly
genome and much of the host’s molecular response to virus infection
subdivided according to tasks/age, or at the other extreme during
is also at the RNA level. However, RNA is highly sensitive to
cold rainy days, when there is no substructuring of the population and
degradation by nucleases and a major criterion for bee sample
all bees are sampled randomly, irrespective of age class. This choice
management is therefore to minimize this degradation (Chen et al.,
depends on the design and purpose of the sampling scheme.
2007; Dainat et al., 2011). The primary concern is not so much the virus particle (which is usually relatively robust), but rather the viral replicative RNA intermediates and host mRNAs.
The frequency of sampling depends on the type survey/ experiment conducted:
For single virus geographic prevalence surveys, the best time of year for sample collection would be during the seasonal
4.2. What, where and when to sample Different viruses have different infection patterns, life-stage/tissue
peak for the virus in question (Table 2).
For multivirus-pathogen geographic prevalence surveys, and if
preferences and seasonal prevalences (Table 2), and so the decision
only a single sample is collected, the best time would be
as to what bee stages to sample, when/how often to sample and
autumn, when most viruses have a seasonal peak.
where to sample depends to a large degree on the objective of the
For multivirus-pathogen surveys it is advisable to sample at
experiment/survey and on the virus studied. When the experiments/
least three times per season; in early spring when the colony
surveys are detailed and specific, the sampling regimen should be
is expanding, during peak productivity in summer and during
designed to suit those specific aims. However, often the same
late autumn when the colony is contracting, in order to catch
samples will be analysed for multiple viruses, or the experiments/
the different pathogens at their peaks, observe seasonal
surveys are more global in character, requiring a more consensual
variations in prevalence and identify possible associations
approach to sampling. Here are some considerations for making
between different pathogens-parasites.
sampling decisions in these situations. See also the BEEBOOK paper
For colony-level experiments with repetitive sampling, it may
on statistical methods (Pirk et al., 2013) for decisions on how to
be useful to take into account the natural turnover of the
determine the optimal sample size and pooled samples.
adult population when considering sampling frequency. During summer, both the brood stage and the adult stage last about
4.2.1. What to sample?
three weeks. Sampling every three weeks therefore means
All viruses described to date can be detected in adult bees (Table 2).
that a completely new generation of adult bees is sampled
This is logical, since adult bees are central to most of the virus
each time, corresponding to the brood generation of the
transmission pathways (Fig. 1), due to their high mobility, contact
previous sampling point.
rate and diverse contact network. This makes adult bees the most suitable single bee stage for detecting all viruses. Within adult bees,
4.3. Sample collection
the gut is a major site of accumulation for most viruses (and many
Methods for collecting different sample types (adults vs brood; whole
other pathogens), and is thus the most suitable single tissue type for
bees vs extracted tissues), for sample preservation (chemical and/or
sampling.
temperature) and for transportation (hours vs days) are described in
The COLOSS BEEBOOK: virus methods
13
detail in the BEEBOOK paper on molecular methods (Evans et al.,
4.3.8. Dead colonies
2013). Faeces may be a useful sample type for the non-destructive or
Many virus experiments involve bee death as a parameter. Dead bee
repetitive sampling of the individual bees, such as queens (Hung,
samples from such experiments should be treated like freshly killed
2000). The general rules for sample collection are to get the samples
material and frozen as soon as possible to minimize the effects of
to a freezer as quick as possible, and to keep dead, preserved or
decay on RNA integrity.
processed bee samples as cold as possible during transport.
Passive surveys also involve dead bee samples, in this case those sent in by beekeepers for post-mortem analysis of the cause of colony
4.3.1. Adult bees
death. The RNA from such bees will most likely be degraded, which
Adult bees are usually collected from brood frames (young bees);
will affect the reliability of the data, especially of negative results
honey frames (older bees); at the hive entrance (foragers) or in dead- (virus absence). How to manage such samples and data is covered in bee traps (dead bees). Around 200 bees (about 20g, or a cup-full) are detail in the BEEBOOK paper on molecular methods (Evans et al., shaken or brushed into either a cage or ventilated box with food (live
2013). Collect the more desiccated dead bees and transport in a
transport) or in a 1l plastic bag (cold transport). This is enough for
ventilated cardboard box at ambient temperature.
both mite and virus analyses.
4.4. Sample transport 4.3.2. Pupae
The integrity of samples can stabilized during transport by:
Pupae are usually collected as a 10cm x 10cm section of sealed brood, placed in a suitably sized ventilated box (live transport) or in a
4.4.1. Freezing
plastic bag (cold transport). Individual pupae can be collected in
Freezing on-site is the gold standard for sample transport, but usually
microcentrifuge tubes or on collection cards (see section 4.4.5.).
too expensive for mass surveys. There are several alternatives for different purposes and samples sizes (see the BEEBOOK paper on
4.3.3. Larvae
molecular techniques; Evans et al., 2013), including the ‘dry shipper’
Larvae are usually collected in tubes or on collection cards and
which can hold up to 1300 2-ml cryo-tubes below freezing for up to 3
transported on ice, since they tend to crawl out of comb sections
weeks and is approved for international air-shipment.
during live transport. 4.4.2. Ice 4.3.4. Eggs
Transport on ice is a cheap and practical substitute for freezing, if the
Eggs can be collected as cut comb section, transported in a non-
samples can be (re)-frozen within 48 hours.
ventilated container to prevent dehydration, or individually in tubes or on collection cards.
4.4.3. Live transport Live transport is very practical and cheap, especially if the samples are
4.3.5. Extracted guts
sent by post. Obviously there is no RNA degradation due to bee
Adult bee guts can be collected by carefully pulling out the stinger
death, but live transport may affect the expression of host genes, and
plus last integument, and slowly drawing out the hind and midgut.
possibly virus replication, which should be taken into account when
Extracted guts can be transported in tubes or on collection cards, on ice. planning experiments. 4.3.6. Drone endophallus and semen
4.4.4. Chemical stabilizers
Drone endophali and/or semen can be collected by squeezing out the
There are a number of chemicals that help prevent RNA degradation.
endophallus as described in the BEEBOOK article on artificial
For these to work, they have to penetrate the bee exoskeleton and
insemination (Cobey et al., 2013). The endophallus or semen can be
get into the tissues. They are therefore more useful for extracted
transported in tubes or on collection cards, on ice.
tissues, eggs and larvae and less useful for adult bees. There are two types of chemical preservation: salts (in solution or impregnated on
4.3.7. Faeces
collection cards) and organic solvents (usually alcohol). Solvents
Faeces can be collected destructively by removing the bee gut (see
penetrate the exoskeleton better than salt solutions and are more
section 4.3.5.) and expelling the faeces, or non-destructively by
suitable for adult bees. A large excess (>5-fold by weight) should be
placing the bee in a petri dish and waiting for defecation.
used to make sure the chemical’s concentration in the tissues is high enough to inhibit the nucleases. Various solutions and how to use them are described in the BEEBOOK paper on molecular methods (Evans et al., 2013).
de Miranda et al.
14
4.4.5. Sample collection cards
reliable methods for determining the infectivity of a preparation.
FTA™ collection cards (Whatman) preserve tissues both by
Furthermore, such well-characterized and precious reference material
desiccation and chemical (salt) preservatives embedded in the filter
is often in limited supply and highly valuable as a historical
paper (Becker et al., 2004; Rensen et al., 2005). They are ideal for
“reference” isolate for future experiments. Such reference material
soft tissues and for remote collecting situations where sample weight
can be stored long-term either as freeze-dried bees/pupae/larvae, or
and ambient storage are important factors. They are very reliable, but as a (semi)purified virus solution in an appropriate virus purification pricey, only suitable for small sample sizes and processing can be messy. buffer (Table 4) and stabilized by 50% glycerol. It is therefore See the BEEBOOK paper on molecular methods (Evans et al., 2013).
advisable, particularly for infectivity tests but also for propagation, to first prepare a “working” inoculum, by injecting or feeding a small
4.5. Long-term sample storage
number of bees (larvae, pupae or adults; around 5-10 individuals)
The factors important for long-term storage and preservation are the
with a small amount of the pure reference material. This also serves
same ones highlighted for sample transport, which are (in order of
as an infectivity test for the viability of the stored reference material.
effectiveness): temperature, desiccation (lyophilisation) and chemical
After incubating for the appropriate time, a crude extract should be
preservatives. See the BEEBOOK paper on molecular methods (Evans
prepared from the bees, the purity and virus concentration of this
et al., 2013) for details.
extract determined, and then this working extract should be used for large-scale propagation or infectivity tests within the next few of weeks.
5. Virus propagation
5.3. Oral propagation
5.1. Introduction
Oral propagation is relatively inefficient for most viruses, requiring
The methods for propagating and purifying honey bee viruses in bees
high titre inoculums (106-1011 particles, depending on the virus; Table
have not changed much from those described by Bailey and Ball
3) to establish an infection (Bailey and Gibbs, 1964; Bailey and Ball,
(1991). Many viruses, including all of the important ‘picorna-like’
1991).
viruses, can be propagated by injection in either pupae or adult bees. Pupal injections are easier to manage than injection into adult bees, from pretty much every aspect: injection, incubation, homogenization
5.3.1. Larvae 1. Mix purified virus of the appropriate minimum concentration
and purification. Some viruses can only be infected orally and/or are
(Table 3) with medium for in-vitro larval rearing and allocate
only infectious in adult bees. The propagation criteria for each virus
this to the wells of a 48-well tissue culture plate (see the
are listed in Table 3. Infectivity tests are essentially more precise versions
BEEBOOK paper on in-vitro larval rearing (Crailsheim et al.,
of the propagation protocols. Another way to propagate and purify honey bee viruses is through tissue culture. This removes the potential
2013). 2. Transfer two-day old larvae to the wells, making sure there is
for contamination and the dependence on the bee season that comes
enough virus so that each larva gets the minimum infectious
with propagating in bees, and allows for large volume propagation. It
dose.
also is a highly effective tool for detailed laboratory experimentation
3. Follow the procedures for in-vitro larval rearing (see the
at cellular level, without the influence of bee and hive effects. Attempts
BEEBOOK paper on in-vitro larval rearing (Crailsheim et al.,
at virus propagation in bee tissue culture have so far met with limited
2013), transferring the larvae periodically to fresh food, either
success. However, significant progress has recently been made with
including or excluding further virus extract.
Nosema cultivation in commercial (Lepidopteran) insect cell lines (see the BEEBOOK paper on cell culture (Genersch et al., 2013).
5.2. Starting material Often the starting material for propagation is a previous virus preparation that has been checked for the absence of contaminating viruses and retained as a pure isolate. Virus preparations can,
4. Include a series of control inoculations, using larval food medium without virus. 5.3.2. Adults 1. Mix purified virus with 60% sucrose to the desired concentration for infecting bees individually or in bulk. 2. Feed the virus-sucrose solution individually to newly emerged
however, lose infectivity during prolonged storage. For example
adult bees in 5-10 µl volumes, using a Pasteur or micro-
deformed wing virus (DWV) and its relatives kakugo virus (KV) and
pipette.
Varroa destructor virus-1 (VDV-1), are particularly sensitive to decay
3. Immobilize the bees by either holding their wings or in a
during storage. Since neither serological nor molecular assays can
suitable restrainer, such as head-first in a 1.5 ml
distinguish between degraded or intact virus particles, they are not
microcentrifuge tube with the bottom cut off (see the section
The COLOSS BEEBOOK: virus methods
15
'standard methods for immobilising, terminating, and storing
The Hamilton Company produces both dispenser units and 10~50 µl
adult Apis mellifera' in the BEEBOOK paper on miscellaneous
syringes with Luer locks that fit disposable needles. The pupae can be
methods; Human et al., 2013).
injected by hand, which is faster (but less precise) than doing so
4. Bulk-feeding of the virus-sucrose solution to adult bees is
under microscope, with moveable trays.
done either in hoarding cages, using disposable 15 ml plastic
7. Attach the syringe and control unit horizontally to a stand.
feeding tubes (see the BEEBOOK paper on maintaining adult
8. Close the four fingers of your hand and carefully lay a white-
Apis mellifera workers in cages; Williams et al., 2013) or in
eye pupa on its back in the groove between index and middle
whole colonies using internal or top feeders. In both cases it
finger.
is important to calculate the amount of purified virus needed
The abdomen of the pupa points towards the tip of the fingers and
to ensure that each bee gets the minimum infectious dose
the head is supported by the tip of the thumb.
(Table 3).
9. Move the pupa towards the needle, inserting the needle at the
5. Include a series of control inoculations, using sucrose solution
narrowest angle possible under the skin of the pupa, on the lateral side, between the 2nd and 3rd integuments of the
without virus.
abdomen.
5.4. Injection propagation
10. Inject 1~5 µl of virus suspension using the control unit.
Propagation by injection into pupae or adults is generally very
11. Move the pupa backwards off the needle.
efficient, requiring very low virus doses and concentrations to
12. Move the pupa carefully from the hand to a plastic, disposable
2
4
establish an infection (10 -10 particles, depending on the virus). However, this high efficiency also makes propagation by injection
tissue culture plate, using forceps to support the pupa underneath.
susceptible to the amplification of any contaminating viruses, either
Use plates with matching lids, both to prevent cross-contamination
those present in the injected inoculum or those present naturally
between wells and to control the humidity.
within the bees. Extra care has to be taken therefore to confirm the purity of the propagation, after purification.
13. Incubate the plate at 30°C in a humidity-controlled incubator. If this is not available, place the plates in a closed plastic box containing moistened paper towels.
5.4.1. Pupae 1. Lay the frame horizontally at a slight angle, bottom-to-top, under good light. 2. Using needle-forceps, remove the wax capping from 10-50 cells containing white-eyed pupae, by cutting along the inside of the cell. It is easiest to work from the bottom of the frame upwards, clearing
14. Check the progress of the infection by monitoring the change in eye colour of the pupae. Those pupae injected with virus that remain alive will change eye colour, but more slowly than those pupae injected with only buffer. 15. Include a control series with buffer-only inoculations, and a control series without inoculation, just incubation of the pupae.
room underneath for opening up the cells higher up the frame and picking up the pupae from behind. 3. With blunt, curved forceps remove the top part of each cell, exposing the head of the pupa. 4. Place the curved forceps underneath the head of the pupa, from the back, and carefully lift the pupa out of its cell.
The best propagations are with those inoculum concentrations that keep the pupae alive for as long as possible, generating the highest propagation concentrations. Sometimes parts of the body become necrotic, either only the abdomen or only the thorax/head. This can happen when the virus concentration of the inoculum is too
It is critical to remove the white-eye pupae very carefully from the
high, killing the tissue too quickly for efficient propagation. Too low a
comb, to avoid damage.
virus inoculums concentration will, however, increase the risk of
5. Collect the pupae in a plastic Petri dish containing a circular filter paper dampened with sterile water. 6. For the purpose of propagation, you need:
amplifying unrelated covert infections already present in the pupa. It is therefore advisable to first propagate a range of log-scale dilutions (1/10, 1/100, 1/1000 etc.) of the virus inoculum. Then for
a 10~50 µl syringe,
large-scale propagation, choose the highest inoculum concentration
a thin needle (around 28G~30G)
that does not necrotize the pupae before the 4th day of incubation.
a semi-automatic volume dispenser control unit that can dispense 1~5 µl volumes.
de Miranda et al.
16
Table 3. Summary of the protocols and conditions for the oral and injection propagation of the different honey bee viruses in larvae, pupae and adult bees. Non-viable propagation routes are marked with an ‘x’. Absence of reliable information is marked with ‘?’. Adapted from Bailey and Ball (1991). PROPAGATION VIRUS
Acute bee (ABPV)
Kashmir bee virus (KBV)
Israeli acute (IAPV)
Black queen cell virus (BQCV)
METHOD
ORAL
INJECTION ORAL INJECTION
ORAL
INJECTION
ORAL
INJECTION
Deformed wing Varroa destructor virus-1 (DWV & VDV-1)
Egypt bee virus (EBV)
Sacbrood virus (SBV) Thai/Chinese Sacbrood virus (TSBV)
Slow bee paralysis virus (SBPV)
AGE
larvae
48 hour
adult pupae adult
< 24 hour white eye any
INJECTION ORAL INJECTION ORAL INJECTION ORAL INJECTION
ORAL
INJECTION
CONTACT
(CBPV) INJECTION
DOSE (2ng ≈ 107 particles) ? > 10
10
particles/bee
INCUBATION*
?
2
5 days
2
5 days
> 10 particles/bee > 10 particles/bee
48 hour
?
?
adult
< 24 hour
> 107 particles/bee
5 days
pupae
white eye
> 102 particles/bee
3 days
2
adult
any
> 10 particles/bee
3 days
larvae
48 hour
?
?
adult
< 24 hour
> 4ng pure virus/bee
6 days
pupae
white eye
> 102 particles/bee
3 days
2
adult
any
> 10 particles/bee
4 days
larvae
48 hour
?
?
adult
< 24 hour
> 4mg crude extract/bee
40 days
pupae
white eye
> 103 particles/bee
5 days
adult
any
larvae
48 hour
> 109 genomes/bee
5 days
adult
< 24 hour
> 108 genomes/bee
?
pupae
white eye
> 102 genomes/bee
14 days
7
adult
any
> 10 genomes/bee
3 days
larvae
48 hour
?
?
adult
< 24 hour
?
?
2
pupae
white eye
> 10 particles/bee
8 days
adult
any
?
?
larvae
48 hour
adult
< 24 hour
pupae
white eye
adult
any
larvae
48 hour
adult
< 24 hour
pupae
white eye
adult
any
larvae
48 hour
adult
< 24 hour
pupae adult larvae
white eye any 48 hour
7 days > 103 particles/bee
> 103 particles/bee
5 days
?
?
?
?
3
> 10 particles/bee
5 days
3
12 days
> 10
10
particles/bee
5 days
> 10
10
particles/bee
? days
adult
< 24 hour
larvae
x
x
adult
< 48 hour
> 107 genomes/bee
pupae
white eye
> 102 particles/bee
adult
any
5 days 7 days
> 10 particles/bee
2
> 10 particles/bee
NOTES
?
larvae
ORAL
ORAL Chronic bee paralysis virus
STAGE
x
5 days 7 days
requires N. apis co-infection
The COLOSS BEEBOOK: virus methods
17
Table 3. continued VIRUS
Cloudy wing virus (CWV)
Bee virus X (BVX)
Bee virus Y (BVY)
Arkansas bee virus (ABV)
Filamentous virus (AmFV)
Apis iridescent virus (AIV)
METHOD CONTACT INJECTION ORAL
INJECTION ORAL INJECTION ORAL INJECTION
ORAL INJECTION ORAL INJECTION
STAGE
AGE
larvae
?
DOSE (2ng ≈ 107 particles) ?
INCUBATION* ?
adult
?
?
?
pupae
x
x
x
adult
x
x
x
larvae
x
x
x
adult
< 24 hour
> 4mg crude extract/bee
30 days
pupae
x
x
x
adult
x
x
x
larvae
x
x
x
adult
< 24 hour
> 4mg crude extract/bee
30 days
pupae
x
x
x
adult
x
x
x
larvae
48 hour
?
?
adult
< 24 hour
?
?
> 10 particles/bee
5 days
pupae
3
white eye
3
NOTES
enhanced by M. mellificae co-infection
requires N. apis co-infection
adult
any
> 10 particles/bee
21 days
larvae
?
?
?
enhanced by
adult
< 24 hour
> 4mg crude extract/bee
30 days
N. apis
pupae
x
x
x
adult
x
x
x
larvae
48 hour
?
?
adult
< 24 hour
?
?
> 10 particles/bee
5 days
pupae
white eye
adult
any
3
* based on minimum
5.4.2. Adults Propagation in adult bees is best done with newly emerged bees,
Bees sometimes die from excess anaesthesia. This is
whose exoskeleton is still soft, making it easier for controlled
especially important for infectivity tests, where the death of a
injection. Using young bees also avoids any age-related variability in propagation and unintentional propagation of adult-acquired viruses. 1. Collect the bees in lots of 10-20 in queen cages, or similar containers. 2. Anaesthetize the bees for 1 minute with CO2 from a pressurized cylinder. 3. Make sure to bubble the CO2 gas through water to melt any CO2 micro-particles, which can be very injurious to bees. See the section 'Standard methods for immobilising, terminating, and storing adult Apis mellifera' in the BEEBOOK paper on miscellaneous methods (Human et al., 2013). 4. Proceed quickly to avoid excess anaesthesia for the bees and do not anaesthetize the bees more than once a day.
bee is often a recorded experimental variable. 5. Inject 1~5 µl of virus suspension between the 2nd and 3rd integuments of the bee using a similar controlled-volume syringe set-up as for pupal propagation (see section 5.4.1.). 6. Incubate the inoculated bees in a hoarding cage at 30°C in 60 -70% relative humidity with sufficient sterilized food and water (see the BEEBOOK paper on maintaining adult
Apis mellifera workers in cages (Williams et al., 2013) for the appropriate amount of time for each virus (Table 3). 7. Include a control series with buffer-only inoculations, and a control series without inoculation, just incubation of the adult bees.
de Miranda et al.
18
Table 4. Summary of the protocols for the purification of the different honey bee viruses. Adapted from Bailey and Ball (1991). PURIFICATION VIRUS
Acute bee paralysis virus (ABPV)
Kashmir bee virus (KBV & IAPV)
Israeli acute paralysis virus (IAPV)
Black queen cell virus (BQCV)
Deformed wing virus & Varroa destructor virus-1 (DWV & VDV-1)
Egypt bee virus (EBV)
Sacbrood virus (SBV)
Thai/Chinese Sacbrood virus (TSBV)
Slow bee paralysis virus (SBPV)
Chronic bee paralysis virus (CBPV)
EXTRACTION BUFFER (2 ml/g tissue)
LOW-SPEED HIGH-SPEED CENTRIFUGE CENTRIFUGE
RESUSPENSION BUFFER (0.1 ml/g tissue)
SUCROSE GRADIENTS
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.01M potassium phosphate (7.0)
45 000 g
0.02% diethyldithiocarbamate
10 minutes
3 hours
incubate 12-36 hours; 5°C
3 hours
low-speed centrifugation; 5°C
0.1 volume ether
15°C
15°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
4°C
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.02% diethyldithiocarbamate
10 minutes
0.1 volume ether
15°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
0.01M potassium phosphate (7.6)
10 000 g
100 000 g
0.01M potassium phosphate (7.6)
100 000 g*
0.2% Na-deoxycholate
20 minutes
3 hours
0.6 g/ml CsCl
24 hours*
2% BRIJ-58
15°C
15°C
* CsCl gradient centrifugation
20°C
collect band 0.01M potassium phosphate (7.0)
45 000 g
3 hours
incubate 12-36 hours; 5°C
3 hours
15°C
low-speed centrifugation; 5°C
4°C collect band
supernatant
retain pellet
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.01M potassium phosphate (7.0)
collect band 45 000 g
0.02% diethyldithiocarbamate
10 minutes
3 hours
incubate 12-36 hours; 5°C
3 hours
low-speed centrifugation; 5°C
0.1 volume ether
15°C
15°C
0.1 volume CCl4
supernatant
retain pellet
4°C
0.5M potassium phosphate (8.0)
8000 g
75 000 g
0.5M potassium phosphate (8.0)
45 000 g
0.2% diethyldithiocarbamate
10 minutes
3 hours
immediately to sucrose gradients
3 hours
0.1 volume ether
15°C
15°C
collect band
4°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
0.5M potassium phosphate (8.0)
8000 g
75 000 g
0.5M potassium phosphate (8.0)
collect band 45 000 g
2% ethylene diamine tetra acetic acid
10 minutes
3 hours
immediately to sucrose gradients
3 hours
1% ascorbic acid; 0.1 volume ether
15°C
15°C
4°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
collect band
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.01M potassium phosphate (7.0)
45 000 g
0.02% diethyldithiocarbamate
10 minutes
3 hours
incubate 12-36 hours; 5°C
3 hours
low-speed centrifugation; 5°C
0.1 volume ether
15°C
15°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
4°C
0.5M potassium phosphate (8.0)
8000 g
75 000 g
0.5M potassium phosphate (8.0)
45 000 g
0.2% diethyldithiocarbamate
10 minutes
3 hours
0.02M ethylene diamine tetra acetic acid
3 hours
0.02M ethylene diamine tetra acetic acid
15°C
15°C
0.1 volumes ether; carbon tetrachloride
supernatant
retain pellet
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.02% diethyldithiocarbamate
10 minutes
0.1 volume ether
15°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
0.2M potassium phosphate (7.5)
3000 g
100 000 g
0.2M potassium phosphate (7.5)
45 000 g
0.02% diethyldithiocarbamate
30 minutes
2 hours
15°C
4.5 hours
collect band
4°C collect band 0.01M potassium phosphate (7.0)
45 000 g
3 hours
incubate 12-36 hours; 5°C
3 hours
15°C
low-speed centrifugation; 5°C
4°C collect band
0.1 volume ether
15°C
15°C
15°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
collect band
The COLOSS BEEBOOK: virus methods
19
Table 4. Cont’d. PURIFICATION EXTRACTION BUFFER (2 ml/g tissue)
VIRUS
Cloudy wing virus (CWV)
LOW-SPEED HIGH-SPEED CENTRIFUGE CENTRIFUGE
RESUSPENSION BUFFER (0.1 ml/g tissue)
SUCROSE GRADIENTS
0.5M potassium phosphate (8.0)
8000 g
75 000 g
0.5M potassium phosphate (8.0)
45 000 g
0.2% diethyldithiocarbamate
10 minutes
3.5 hours
immediately to sucrose gradients
4.5 hours
0.1 volume ether
15°C
15°C
4°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.01M potassium phosphate (7.0)
45 000 g
0.02% diethyldithiocarbamate
10 minutes
3 hours
equal volume 0.2M ammonium acetate (5.0)
3 hours
0.1 volume ether
15°C
15°C
low-speed & high-speed centrifugation
4°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
resuspend 0.1M ammonium acetate (7.0)
collect band
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.01M potassium phosphate (7.0)
45 000 g
0.02% diethyldithiocarbamate
10 minutes
3 hours
equal volume 0.2M ammonium acetate (5.0)
3 hours
Bee virus X (BVX)
Bee virus Y (BVY)
collect band
0.1 volume ether
15°C
15°C
low-speed & high-speed centrifugation
4°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
resuspend 0.1M ammonium acetate (7.0)
collect band
0.01M potassium phosphate (7.0)
8000 g
75 000 g
0.01M potassium phosphate (7.0)
45 000 g
0.02% diethyldithiocarbamate
10 minutes
3 hours
incubate 12-36 hours; 5°C
3 hours
0.1 volume ether
15°C
15°C
low-speed centrifugation; 5°C
4°C
0.1 volume carbon tetrachloride
supernatant
retain pellet
0.01M ammonium acetate (7.0)
150 g
30 000 g
0.02% diethyldithiocarbamate
10 minutes 15°C
Arkansas bee virus (ArkBV)
Filamentous virus (AmFV)
collect band 0.1M ammonium acetate (7.0)
10 000 g
30 minutes
layer on 50% w/v sucrose
30 minutes
15°C
centrifuge 75 000g, 3 hours, 15°C
5°C
supernatant
retain pellet
resuspend 0.1M ammonium acetate (7.0)
collect band
0.01M potassium phosphate (7.0)
150 g
30 000 g
0.01M potassium phosphate (7.0)
10 000 g
0.02% diethyldithiocarbamate
10 minutes
30 minutes
incubate 12-36 hours; 5°C
30 minutes
0.1 volume carbon tetrachloride
15°C
15°C
low-speed centrifugation; 5°C
5°C
supernatant
retain pellet
Apis iridescent virus (AIV)
collect band
5.5. Tissue culture The importance of a viable tissue-culture system for the purification
cell lines (Ongus et al., 2006). Protocols for the establishment and
and propagation of honey bee viruses has long been acknowledged.
maintenance of honey bee and commercial insect cell lines can be
There are two possible approaches to such a system. One is to
found in the BEEBOOK article on cell cultures (Genersch et al., 2013).
develop a reliable, immortal honey bee cell line for infection. Only recently has there been any significant progress towards this goal
5.5.1. Virus infection
(Bergem et al., 2006; Hunter, 2010; Kitagishi et al., 2011; Gisder et al., The most common method of infecting tissue culture cells is through 2012). The other approach is to propagate honey bee viruses in
passive co-incubation of purified virus particles with the cells, allowing
existing commercial, heterologous insect cell lines. Many of the honey
the natural processes of virus entry to establish an infection (Minor,
bee viruses naturally infect other insect hosts, such as other Apis spp., 1985; Gantzer et al., 1998; Rhodes et al., 2011; Amdiouni et al., varroa and tropilaelaps parasitic mites, bumble bees, wasps, ants and
2012). However, the virus particles (or the naked viral RNA genome)
a range of solitary pollinators (Bailey and Gibbs, 1964; de Miranda
can also be forced into the cells using electroporation, which involves
et al., 2010a; de Miranda and Genersch, 2010; Ribière et al., 2010;
a short high-voltage pulse of electricity to temporarily open up the cell
Dainat et al., 2009; Singh et al., 2010; Peng et al., 2011; Li et al.,
membrane to allow foreign elements to enter the cell, or chemical-
2011; DiPrisco et al., 2011; Zhang et al., 2012; Evison et al., 2012)
mediated transfection, where a combination of membrane-active ions
and the replication-translation control regions of honey bee virus
and concentrating agents interact to encourage the uptake of the
genomes are active in several commercial Lepidopteran and Dipteran
virus or nucleic acid into the cell (e.g. Boyer and Haenni, 1994;
de Miranda et al.
20
Benjeddou et al., 2002; Ongus et al., 2006; Yunus et al., 2010).
Another strategy, used for viruses that prove impossible to clone full-
Whichever virus transfection protocol is chosen, it is essential that the length, is to clone the genome in two halves, which are maintained virus preparation is free of bacteria or fungi to prevent contamination
independently and then recombined in vitro prior to RNA transcription
of the tissue culture (Minor, 1985; Gantzer et al., 1998). Bacteria,
using a suitably engineered restriction site (Jakab et al., 1997). This
fungi and their spores can be effectively removed from a virus
improves the stability of the clones, the engineered restriction site can
preparation using microfilters with appropriate pore size, depending
be used for recombining different virus strains for gene function
on the size of the virus (Gantzer et al., 1998; Rhodes et al., 2011;
analysis and also serves as a useful marker for tracing the virus
Amdiouni et al., 2012), with 0.2 µm suitable for purifying most small,
through experiments.
enteric picorna-like viruses of around 30-60nm (Rhodes et al., 2011;
A third alternative is to dispense with cloning altogether and
Amdiouni et al., 2012), which includes most of the honey bee RNA
generate infectious RNA transcripts directly off full-length PCR
viruses (Table 2).
products that have a suitable recognition site for the T3, T7 or SP6 RNA polymerase incorporated into the full-length amplification
5.6. Full-length infectious virus clones
primers, for transcript synthesis. This avoids the instability problems
A supremely powerful tool in RNA virus research is cloning full-length
of cloned full-length clones but limits the extent to which the genomes
genomic sequences of the virus into bacterial vectors. The naked RNA can be manipulated genetically. This approach was successful for transcribed from such clones is usually infectious when introduced into synthesizing full-length, infectious transcripts of BQCV after it proved a suitable host (Yunus et al., 2010), especially for positive-stranded RNA impossible to successfully clone full-length BQCV (Benjeddou et al., 2002). viruses (i.e. the majority of known bee viruses). Such clones can be manipulated by site-directed mutagenesis and recombination for
5.6.2. Protocol
functional analysis of different open reading frames or control regions. Here we describe a method for: Reporter genes such as green fluorescent protein can be inserted to
Producing full-length PCR products of positive-stranded,
make fusion proteins with viral genes or to study promoter function in
ssRNA honey bee viruses, with a T7 RNA polymerase
real-time (Ongus et al., 2006) and of course they can function as a
promoter site incorporated into the forward primer sequence (sections 5.6.2.1. – 5.6.2.2.)
genetically pure source of infectious virus, rather than having to rely on biological propagation with the associated dangers of contamination
5.6.2.3.)
with other viruses and the changing genetic constitution of the virus, through evolution.
identify complete sequences of individual viruses within the population,
Confirming the integrity and character of the full-length clones (section 5.6.2.4.)
Full-length viral cDNAs are also an important tool in studying the genetic complexity of virus populations, since they make it possible to
Cloning this product into a stable plasmid vector (section
Synthesizing full-length infectious RNA transcripts of the virus (sections 5.6.2.5. – 5.6.2.6.)
including natural recombinants between major variants (Palacios et al., 2007; Moore et al., 2011).
5.6.2.1. Full-length reverse transcription Genomic RNA of most honey bee ssRNA viruses is approximately 10 kb
5.6.1. Full-length viral RNA synthesis strategies
long and contains highly structured 5’-terminal un-translated region
Full-length cloning of viral genomes has been a common tool in virology
with extended hairpin structures. Therefore, the first strand cDNA
since the 1980’s (Taniguchi et al., 1978; Lowry et al., 1980; Racaniello synthesis should be performed using a reverse transcriptase with a and Baltimore, 1981), but it is often a long and tedious process, mostly high optimum temperature (e.g. InVitrogen’s Superscript III), so that due to the frequent instability of the full-length clones in bacteria (Boyer and Haenni, 1994). It is thought that cryptic bacterial promoters and secondary structures within the viral sequences encourage the bacteria to excise problematic viral regions from the plasmid clone. Full-length clones therefore have to be monitored constantly for possible deletions and re-arrangements as part of their maintenance.
RNA secondary structures are also transcribed. 1. Prepare purified virus particles using gradient centrifugation (see section 7; “Virus purification") 2. Extract viral RNA from the purified virus particles (see section 8.3.; “Nucleic acid extraction”) 3. Combine in a single 200 µl thin wall tube:
The process has been made easier by improvements in cloning
3.1. 1 µg virus RNA,
techniques and the stability of the cloning vectors with respect to
3.2. 1 µl 2 µM “Reverse Primer” 5’-CGGTGTTTAAAC(T)27(X)32-
accepting and maintaining long (~10kb) inserts. There are several
3’, where (X)32 is a sequence complementary to the final 32
alternatives to cloning full-length genomes. Sometimes it is easier to
nucleotides at the 3’ end of the virus genome to be cloned,
clone the genome in several partial clones first, and then recombine
3.3. 1 µl 10 mM dNTPs,
these afterwards into a single full-length clone (Rodriguez et al., 2006).
3.4. Make the total volume 13 µl with RNase-free water.
The COLOSS BEEBOOK: virus methods
21
4. Mix well by pipetting on ice.
5.6.2.3. Cloning full-length viral RNAs
5. Incubate at 65°C for 3 minutes in PCR heating block.
Cloning of long (~10 kbp) PCR products into plasmid vectors may be
6. Transfer to ice and cool down for 1 minute.
not very efficient. We recommend to using pCR-XL-TOPO cloning,
7. Add the following:
which is vector specifically designed for cloning of large products. This
7.1. 4 μl 10x First Strand Buffer (supplied with Superscript III), vector requires 3’ terminal A overhangs in the PCR products, therefore 7.2. 1 μl 0.1M DTT,
the first stage is the addition of 3’ overhangs to the Phusion-
7.3. 1 μl RNase OUT recombinant RNAse inhibitor (Invitrogen). generated blunt ends. 8. Mix well and incubate at 52°C for 2 minutes in heating block. 9. Add 2 µl Superscript III reverse transcriptase (Invitrogen) and mix well.
1. Mix the following: 1.1. 50 μl purified PCR fragments, 1.2. 6 μl 10x Taq polymerase buffer,
10. Incubate at 52°C for 10 min.
1.3. 3 μl 10mM dNTPs,
11. Incubate at 55°C for 60 min.
1.4. 1 μl Taq polymerase.
12. Incubate at 70°C for 15 min.
2. Incubate at 72°C for 10 min.
13. Store in freezer as a template for full length cDNA amplification.
3. Separate the fragments by electrophoresis in 0.8% agarose gel in TAE buffer.
5.6.2.2. Amplifying full-length viral RNAs One critical factor in the successful amplification of viable, full-length
4. Stain the gel with crystal violet (see InVitrogen TOPO XL PCR cloning kit).
cDNAs is the use of a thermostable DNA polymerase with proof-
5. Excise the 10 kb full-length cDNA fragments.
reading capacity. One such high-fidelity, high processivity DNA
6. Extract DNA using the Gel Purification reagents included in the
polymerase is Phusion DNA polymerase (New England Biolabs). If the fragment is to be cloned into a plasmid vector lacking a T7 or T3 RNA
TOPO XL PCR Cloning kit (Invitrogen). 7. Ligate fragments into the pCR XL TOPO vector by mixing:
polymerase promoter site (required for the synthesis of full-length
7.1. 4 μl of the purified product (approximately 10 to 50 ng)
infectious RNA copies), then such a site should be incorporated into the
7.2. 1 μl of pCR XL TOPO vector.
5’ amplification primer (e.g. Benjedou et al., 2002; Ongus et al., 2006).
8. Incubate reaction for 5 min at 25°C.
1. Combine following in the 200 μl thin wall PCR tube placed on ice: 1.1. 2 μl of the first strand cDNA reaction, 1.2. 35 μl sterile nuclease free water, 1.3. 10 μl of 5x HF Phusion amplification buffer,
9. Stop reaction by addition of 6x TOPO cloning Stop Solution. 10. Mix for a few seconds at room temperature and place the reaction to ice. 11. Proceed immediately to transformation of the OneShot
1.4. 1 μl 10mM dNTP mixture,
competent E. coli cells (Invitrogen), following the
1.5. 0.5 μl 2 μM “Reverse primer” (section 5.6.2.1.; step 3.2.)
manufacturer’s instructions.
1.6. 0.5 μl 2 μM T7 RNA polymerase promoter-tagged “Forward primer” 5’-GCTATAATACGACTCACTATAGG(X)20-3’ 5.6.2.4. Confirmation of full-length clones where (X)20 are the first 20 nucleotides at the 5’ end of
1. Select the white colonies and transfer to a fresh plate.
the virus genome
2. Amplify insert DNA from all colonies using the PCR primers
2. Mix well by pipetting on ice.
and protocols from Section 9.3.3.; “RT-(q)PCR – Protocols”.
3. Add 2 μl (5U) Phusion DNA polymerase.
3. Separate PCR products on gel electrophoresis.
4. Mix by pipetting.
4. Isolate clones with inserts > 10kb.
5. Place the tube in the thermocycler when the block is 90°C
5. Prepare plasmid DNA from full-length clones using a Qiagen
(Hot-start PCR). 6. Amplify with the following cycling programme:
plasmid purification kit and corresponding instructions. 6. Sequence the inserts in selected plasmids using a series of
6.1. 98°C:1 min,
oligonucleotide primers that are conserved between all known
6.2. 5x [98°C:15 sec – 52°C:60 sec – 72°C:7 min],
variants of the virus.
6.3. 25x [98°C:15 sec – 55°C:60 sec – 72°C:7 min], 6.4. 72°C: 7 min. 7. Purify the reaction products with PCR purification kit (Qiagen), eluting into 50 μl of water.
7. Confirm identity of clones through comparing the cloned sequences with the published consensus virus sequences.
de Miranda et al.
22
5.6.2.5. Synthesizing full-length viral RNA
damage and vitality. In both cases it is advisable to incubate them for
The plasmid can be used as a template for in vitro transcription using
12-24 hours prior to conducting the assay, and remove larvae or
T7 RNA polymerase.
pupae that show signs of necrosis or low vitality. The infectivity
1. Linearize plasmid downstream of the 3’ poly-A sequence with
PmeI restriction endonuclease. 2. Purify the linearized templates with a Qiagen plasmid
assays should also include a number of additional methodological controls (effects of transfer, incubation, manipulation, feeding etc.), to facilitate the interpretation of the data.
purification kit. 3. Synthesize capped in vitro RNA transcripts using “mMESSAGEmMAchine” T7 kit (Ambion).
7. Virus purification
5.6.2.6. Confirmation of Full-length Viral RNA
7.1. Introduction
The full-length nature and activity of the transcripts is confirmed by
The method given below for purifying honey bee viruses is simple but
in vitro translation experiments (Green and Sambrook, 2012), and
only suitable for non-enveloped viruses, which fortunately covers the
ultimately by infection of pupae through injection with the synthesized vast majority of RNA viruses. However, this method is unsuitable for RNA transcripts (see section 5.4). The infectivity of such transcripts is
viruses containing membranes, such as Apis mellifera filamentous
confirmed by comparing virus titres between transcript-inoculated
virus. There are a number of enveloped virus families that have insect
pupae with control-inoculated pupae, and by sequencing the new
-infecting members and there may be more enveloped honey bee
virus infection (Benjedou et al., 2002).
viruses to be discovered. The various buffers, solvents and centrifugation conditions for purifying individual viruses are given in Table 4. Most of the buffers shown are the phosphate buffers developed by Bailey and
6. Virus infectivity assays
Ball (1991), between 0.01 and 0.5M and of neutral pH (between 7.0
Infectivity assays were used before sensitive molecular techniques
will perform equally well. Similarly, chloroform can be substituted for
were developed to detect low levels of virus in surveys (Bailey, 1976;
the more toxic ether/carbon tetrachloride combination for extract
Bailey et al., 1981; 1983b). These assays take advantage of the fact
clarification. Nonionic detergents such as Triton X100 (0.05%), BRIJ-
that most bee viruses when injected into adult bees or pupae multiply
58 (2%) and/or sodium deoxycholate (0.2%) are also common agents
rapidly to high titres that can subsequently be detected by serology
for lipid solubilisation and extract clarification during virus purification.
(Dall, 1987). Dilution series of the extracts provide a measure of
0.1 M ascorbic acid is a common alternative to DIECA as antioxidant.
quantitation. Different viruses develop titre and kill pupae at different
Conduct as much of the purification as possible at 4°C (on ice). With
rates, which can be detected by the ‘breaking’ of the eye-colour
each purification step, there is a considerable loss of yield, particularly
development in white-eyed pupae (Anderson and Gibbs, 1988; 1989).
during the high-speed and gradient centrifugation steps. As much as
This can provide an early indication of which virus is being multiplied.
80% of the primary extract can be lost during purification. It is
Although labour intensive, infectivity assays can rival the most
therefore important to consider how pure the virus preparation needs
sensitive molecular tests available (Denholm, 1999). One serious
to be for your experiments. For infection experiments, purity may be
drawback of honey bee infectivity assays is that often unapparent
less important while for developing a specific antiserum, high purity is
viruses present at very low levels in the assay pupae can also be
essential. The high-speed and gradient centrifugation steps are
amplified, sometimes by the mere injection of buffer (Bailey, 1967;
excellent for separating the virus from other cellular contents and
Anderson and Gibbs 1988; 1989). Several important bee viruses
particles, but are not suitable for separating different virus species:
(ABPV, KBV and SBPV) were discovered this way, as a by-product of
they all have very similar densities.
and 8.0). In most cases, TRIS.Cl buffers of similar molarity and pH
the propagation of CBPV, AIV and BVX respectively (Bailey et al., 1963; Bailey and Milne, 1969; Bailey and Woods, 1974; 1977; Bailey
7.2. Protocols
and Ball, 1991), and the technique may yet prove useful for the
7.2.1. Primary extract
discovery of other symptomless bee viruses. In general terms, the procedures for virus infection infectivity assays are the same as for virus propagation. It is especially important is that the larvae and pupae are transferred to the incubation plate as carefully as possible, and that they are checked for vitality and survival before being used for infection experiments. Larvae and pupae should be checked under a stereo microscope for
1. Mix 2 ml of extraction buffer (Table 4) per 1 g of bee tissue. 2. Prepare a primary virus extract by either: Grinding the bee tissues in liquid nitrogen in a mortar-andpestle. Liquidizing in an automatic blender. Using a large-volume bead mill. (see also section 8.2.; “Sample Homogenisation”)
The COLOSS BEEBOOK: virus methods
23
3. Transfer to a solvent-resistant container.
usually have 6 buckets, which should all be used during each
4. Add 0.5 ml of chloroform or carbon tetra-chloride per 1 g of
centrifugation run, since the rotor is only fully balanced when each
bee tissue. 5. Shake vigorously by hand.
bucket is present in its correct position. This means that for each run, six centrifugation tubes should be prepared and balanced.
6. Centrifuge at 8,000 g and 4°C for 15 minutes. 7. Carefully collect the supernatant. 8. Discard the organic phase. 9. Remove 10 µl for virus analysis by RT-qPCR or ELISA (see section 9.3. and the BEEBOOK article on molecular methods (Evans et al., 2013) to determine the viral purity of the extract. 10. The crude extract at this stage is appropriate for long-term
7.2.3.1. Sucrose gradients 1. Prepare four solutions, containing the appropriate virus extraction buffer (Table 4) and either 10%, 20%, 30% or 40% sucrose. This is best done by mixing the appropriate amounts of 10x buffer, 60% sucrose solution and water.
storage. Add glycerol to a final concentration of 50%, aliquot
2. Divide the total volume of a centrifuge tube by 5.
and store at -80°C.
3. Add 1/5th volume of the 10% sucrose-buffer solution to every centrifugation tube.
7.2.2. High speed centrifugation 1. Centrifuge the supernatant at 75,000 g and 4°C for 3 hours. 2. Discard the supernatant. 3. Re-suspend the pellet 5 ml extraction buffer. This is best achieved by storing the pellet with buffer overnight at 4°C, to loosen the pellet.
Be accurate with the volumes, to avoid problems with balancing the tubes later-on. 4. Using a syringe with a long needle, layer 1/5th volume of the 20% sucrose-buffer solution underneath the 10% solution. 5. Repeat with 1/5th volumes of the 30% and 40% sucrosebuffer solutions.
4. Next day vortex the pellet lightly.
6. Place the tubes in a freezer with minimum disturbance,.
5. Centrifuge at 8,000 g and 4°C for 15 minutes.
7. Once completely frozen, take the tubes out and thaw
6. Retain the supernatant for gradient centrifugation.
completely. The higher concentration solution will thaw earlier than the lower
7.2.3. Gradient Centrifugation
density solutions, causing the boundaries between the concentration
The purpose of gradient centrifugation is to concentrate the virus
layers to blur.
particles according to their specific density and thereby separate them from other cellular material with different density. For high purity
8. Repeat the freeze-thaw process twice more to extend this process, generating a continuous density gradient.
requirements, where the virus needs to be separated from other
Do not freeze-thaw too often, or you will end up with a single-density
particles with similar density (e.g. ribosomes), ‘continuous’ gradients
solution.
are used. These have a gradual transition from high to low density so
9. For discontinuous gradients, layer 1/5th volume of the 40%
that each particle-type can band at its own specific density. For lower
sucrose-buffer solution underneath 3/5th volume of the 10%
purity requirements ‘discontinuous’ gradients can be used. These have
sucrose-buffer solution.
low density solution layered on top of high density solution, with a sharp interface between them where all material with a specific density between the high and low solutions concentrates. Discontinuous gradients are slightly easier to prepare and to fractionate, but continuous gradients are cleaner and more secure if the specific density of a virus is not known. Many different substances can be used for creating the density differential (sugars, salts, polyethylene glycol, synthetic polymers), each with their (dis)
10. Layer 1/5th volume of virus extract carefully on top of the gradient. 11. Balance the tubes by weight to within 1 mg, using buffer solution. 12. Insert tubes carefully in the buckets and hang the buckets in the correct orientation in their appropriate place on the rotor. 13. Centrifuge in a swing-out rotor at the appropriate speed, time and temperature for the virus in question (see Table 4).
advantages, but for most virus purification purposes sucrose gradients are adequate. The most common alternative is CsCl (caesium
7.2.3.2. Caesium chloride gradients
chloride) gradients. These are easier to prepare and generally leave
CsCl gradients can be used either instead of sucrose gradients, or as
cleaner virus preparations, but require longer centrifugation. CsCl is
an additional purification step after sucrose gradients. CsCl gradients
also chaotropic, stripping virus particles from other cellular
are formed automatically during centrifugation, from a single-density
constituents, and is therefore not suitable for purifying enveloped
solution (isopycnic, or self-forming, gradients). This is a property of
viruses. For these, sucrose gradients should be used. Gradient
the heavy salt.
centrifugation is best done in a high-speed, swing-out rotor. These
1. Resuspend the virus in its buffer (Table 4).
de Miranda et al.
24
2. Make the solution 1.37 g/ml CsCl; final concentration. This is the density where most picorna-like viruses will band. 3. Centrifuge 28,000 rpm for 16-24 hours at 15°C-20°C. Higher centrifugation speeds will create steeper gradients.
8. Virus sample processing 8.1 Introduction The primary processing of a sample is crucial for the uniformity of a diagnostic method and should be optimized for high yield and low
7.2.3.3. Fractionation
variability (Bustin, 2000). There are two main stages: sample
1. After centrifugation, carefully remove the centrifuge tubes
homogenization and nucleic acid extraction. This section is covered in detail in the BEEBOOK article on molecular methods (Evans et al.,
from each bucket. If there is a lot of virus then the virus particles can be seen as an
2013), with a reduced version given below.
iridescent band underneath a top-light (Figure 3). Often two bands can be seen; a lighter band higher in the gradient
8.2. Sample homogenisation
and a more intense band lower in the gradient. These correspond to
The most variable step in sample processing is sample
‘empty’ and ‘filled’ (with RNA) particles respectively.
homogenization. Different sample types require different
2. Remove the band(s) with a disposable syringe and needle.
homogenization methods (see below), but all should be optimized
This is best done using a needle with a ‘flat’ end, rather than the
experimentally to ensure minimal variability between replicate
‘angled’ end. Slide the needle along the centrifuge wall to just below
samples.
the band and draw up the band slowly into the syringe. 3. If no bands can be seen, either because of low virus amounts or because the centrifuge tube is opaque, then the gradient
8.2.1. Bead-mill homogenizers These are mechanical shakers that homogenize samples with glass,
needs to be fractionated by removing 0.5 ml volumes at a time. ceramic or steel beads and give excellent and highly uniform The best way is to use an automated fractionator, which removes the
homogenization of small samples (1-10 bees).
fractions from the bottom of the gradient. The manual alternative is to remove 0.5 ml fractions from the top of the gradient. 4. Analyse 10 µl of each fraction for the presence of virus, using
8.2.2. Blender Similar homogenization uniformity to the beadmills, but for large
either ELISA (see section 9.2.) or RT-(q)PCR (see section 9.3.
samples (50-1000 bees). There is a risk of cross-contamination
and the BEEBOOK article on molecular methods; Evans et al.,
between samples, through re-use of the blender, which should be
2013).
assessed.
Since there will be some virus contaminating every fraction, qualitative RT-PCR will not be able to distinguish very well between
8.2.3. Mortar and pestle
high and low virus fractions.
This method is suitable for medium-size samples (10-50 bees) but is
5. Pool the 3-4 fractions containing the highest virus concentrations, giving a final volume of approximately 2 ml.
much less uniform than beadmills or blenders, and also has a crosscontamination risk due to re-use of the equipment.
6. If necessary, the virus can be concentrated further by another high-speed centrifugation (Table 4), although this will reduce
8.2.4. Mesh bags
the yield.
Mesh bags are a disposable alternative to mortars, also for mediumsize samples (10-50 bees). Homogenization uniformity is also moderate, but without the cross-contamination risk. 8.2.5. Micropestle These are disposable pestles for manually grinding individual bee samples in microcentrifuge tubes. They are much inferior to beadmills in terms of homogenization uniformity, for the same samples size. At best they should only be used for soft (brood) stages. 8.2.6. Robotic extraction Robotic extraction stations are very reliable and consistent, but generally only suitable for small sample sizes and soft tissues. They
Fig. 3. White translucent band containing DWV particles after CsCl density gradient centrifugation.
are best used after bead-mill homogenization, as part of a semi-
Image © E Ryabov. automated homogenization-extraction chain.
The COLOSS BEEBOOK: virus methods
25
8.3. Nucleic acid extraction
8.3.2. Protocol 2 – TRIzol extraction and isopropanol
A denaturing buffer should be used during homogenization to protect
precipitation
the nucleic acids from degradation. The most common denaturants
This protocol uses TRIzol®; a proprietary mixture of phenol and high
used are: high concentrations of chaotropic (guanidine) salts, strong
concentration salt solution (InVitrogen). The RNA is recovered
antioxidants (β-mercaptoethanol), detergents and/or organic solvents. through isopropanol precipitation. The nucleic acid is purified from the buffer using either cheap,
1. Homogenize bees directly at 4°C in TRIzol® reagent in a glass
disposable affinity purification columns or even cheaper precipitation
-walled blender or mortar and pestle. Use 1 ml reagent per
with ethanol, isopropanol or lithium chloride (RNA only). Both
bee (~120 mg tissue).
methods are reliable, though not particularly uniform (Tentcheva et
2. Add 0.5 ml chloroform per bee.
al., 2006). Affinity columns generally produce cleaner nucleic acid
3. Shake hard for 1 minute.
samples, due to the column washing steps. Precipitation can produce
4. Centrifuge 8,000 g; 15 minutes; 4°C.
higher yields, since columns have a limited binding capacity, or
5. Recover the upper (aqueous) layer containing the nucleic
extract volume, equivalent to ~¼ bee.
acids, discarding the lower red (organic) phase and the semisolid, white interphase (containing proteins and lipids).
8.3.1. Protocol 1 – affinity column purification
6. Add an equal volume of iso-propanol, mix and precipitate at
The processing consists of making a primary homogenate from 1-30
-20°C for at least 15 minutes.
bees and purifying RNA from 100 μl aliquots of the homogenate
7. Centrifuge 8,000 g; 15 minutes; 4°C.
(equivalent to 20 mg bee tissue: the maximum loading capacity of
8. Remove iso-propanol supernatant.
one affinity column). The protocol is based on the Qiagen RNA
9. Resuspend nucleic acid pellets in 100 µl RNase-free water.
purification columns. β-mercaptoethanol is toxic.
10. Determine nucleic acid concentration and purity (see section
1. Prepare fresh GITC buffer:
8.4.; “Nucleic acid quality assessment”).
1.1. 5.25 M guanidinium thiocyanate (guanidine isothiocyanate),
11. Store as two separate 50 μl aliquots at -80°C, one for working
1.2. 50 mM TRIS.Cl (pH 6.4),
with and one for storage.
1.3. 20 mM EDTA, 1.4. 1.3% Triton X-100,
8.4. Nucleic acid quality assessment
1.5. 1% β-mercaptoethanol.
A number of sophisticated methods are available to determine the
2. Place frozen bees in the homogenizer of choice.
quantity, quality and integrity of an RNA sample, as described in the
3. Per bee add the following amount of GITC buffer:
BEEBOOK paper on molecular methods (Evans et al., 2013). The minimum requirements are to determine the yield of the RNA, and its
Bee
Weight
Buffer
Total volume
Worker bee
120 mg
500 μl
600 μl
Drone
180 mg
700 μl
900 μl
Worker pupa
160 mg
650 μl
800 μl
Drone pupa
240 mg
1000 μl
1200 μl
purity with respect to protein and phenolic metabolite contaminants. This can be determined by UV spectrophotometry (Green and Sambrook, 2012), through comparing peak absorbance at 260 nm (nucleic acids), 280 nm (proteins) and 230 nm (phenolic metabolites):
A260 of 1.0
= 40 ng/μl ssRNA = 37 ng/μl ssDNA = 50 ng/μl dsDNA
4. Proceed according to the Qiagen Plant RNA extraction protocol using 100 μl extract as sample. The Qia-shredder option
260
280
A
A260/A230 < 2.0 indicates contamination with phenolics.
/A
< 2.0 indicates contamination with proteins.
significantly increases yield and purity of nucleic acid (see Qiagen instructions booklet). 5. Elute in 100 μl nuclease-free water. 6. Determine nucleic acid concentration and purity (see section 8.4.; “Nucleic acid quality assessment”).
9. Virus detection 9.1. Introduction
7. Store as two separate 50 μl aliquots at -80°C, one for working There are numerous techniques available for detecting and with and one for storage. 8. Include a ‘blank’ extraction (i.e. an extraction of purified
quantifying viruses (de Miranda, 2008; see also the BEEBOOK paper on molecular methods (Evans et al., 2013). Most of these detect only
water) after every 24 bee samples, to make sure none of the
a small portion of the viral genome or the capsid proteins, and almost
extraction reagents have become contaminated.
all require some sort of amplification, either of the target (most of the
de Miranda et al.
26
nucleic acid-based detection technologies) or the detection signal
9.2.2. Sandwich ELISA
(most of the protein-based detection technologies). Both are
In “sandwich” ELISA, a modified version of the primary antibody is
important considerations to bear in mind when interpreting virus
adsorbed to the well first, in order to ‘capture’ the virus particles after
diagnostic data. Here we will only cover the most commonly used
the sample is added. The captured virus particles are then detected as
methods.
before, either with the reporting enzyme directly conjugated to the
Secondly, despite the popular classification of molecular assays as detecting antibody (Fig. 4C) or with an extra incubation using an either ‘qualitative’ (presence/absence) or ‘quantitative’ (concentration),
antibody-detecting protein conjugated to the reporter enzyme (Fig. 4D).
ultimately all assays are quantitative: qualitative assays are simply
The sandwich ELISA is cleaner and much more sensitive than conventional
quantitative assays with a detection threshold (a visible colour; a band ELISA, but has a less predictable relationship between virus concentration on a gel; a fluorescence level; a Cq value; a statistical index). This is an important consideration, since there are many factors besides the
and signal (depending on which component in the assay is limiting). The most common reporter enzyme systems are horseradish
initial virus amount that can influence whether or not an assay
peroxidase (HRP) and alkaline phosphatase (AP). Both are relatively
reaches a detection threshold, such as degradation of the sample,
robust enzymes that can be conjugated to the primary or secondary
changes to storage-extraction procedures, assay deterioration etc..
antibody. They convert a colourless substrate into a coloured reaction
Furthermore, the molecular and mathematical rules underpinning any
product, such that the absorbance at a wavelength appropriate for the
assay are the same whether this assay is ‘qualitative’ or ‘quantitative’.
specific colour produced is proportional to the amount of enzyme
The only difference is that in ‘quantitative’ assays these rules are
activity present in the sample, which in turn is proportional to the
specifically acknowledged and accounted for, whereas in ‘qualitative’
amount of antibody captured by the sample, and thus also the
assays they are often ignored. It is therefore advisable to approach
amount of virus in the sample. The protocols below are generic ones
any experiment or assay from a quantitative perspective first, and
for conventional ELISA and sandwich ELISA, based on the methods of
include the appropriate controls for threshold-conversion to
Allen et al. (1986), using horseradish peroxidase as the reporter
‘qualitative’ data, if this is desired.
enzyme. See also Harlow and Lane (1988) for alternatives and more extensive laboratory protocols involving antibodies.
9.2. Enzyme-Linked ImmunoSorbent Assay (ELISA) There are many versions of the ELISA, using different blocking
9.2.3. Protocols
agents, primary/secondary antibodies, reporter enzymes and their
9.2.3.1. Sample preparation
specific colorimetric substrate solutions for detection and
1. Mix phosphate-buffered saline (PBS):
quantification (Harlow and Lane, 1988). They generally fall into one of
1.1. 0.8% NaCl,
two major categories:
1.2. 0.14% Na2HPO4.2H2O, 1.3. 0.02% KH2PO4,
9.2.1. Normal ELISA In conventional ELISA, the sample is adsorbed directly into the wells,
1.4. 0.02% KCl, 1.5. Adjust to pH 7.4.
to be detected by the specific antibody. This antibody is either
2. Grind each bee in 1 ml PBS.
conjugated directly to an enzyme (Fig. 4A), usually either horse radish
3. Add 300 µl chloroform.
peroxidase or alkaline phosphatase, or more commonly is detected in
4. Mix on a vortex.
a subsequent incubation by a commercial enzyme-conjugated protein
5. Centrifuge for 3 minutes to clarify.
that recognizes antibodies in general (Fig. 4B).
Fig. 4. Different types of ELISA, depending on whether the antigen1 is adsorbed directly onto the assay well (A & B) or is captured by the Fab fragment of a specific antibody4 or the full antibody5 (sandwich ELISA; C & D) and whether the detection system involves an enzyme reporter conjugated directly to the detecting antibody6 (A & C) or a reporter conjugated to a generic antibody-recognizing protein3 recognizing the detecting antibody2 (B & D). Adapted from de Miranda (2008).
The COLOSS BEEBOOK: virus methods
9.2.3.2. ELISA 1. Mix coating buffer (CB):
27
9.2.3.4. Development The development of the enzymatic reaction is the same for
1.1. 0.159% Na2CO3,
conventional and sandwich ELISA. This method is appropriate for
1.2. 0.293% NaHCO3,
horseradish peroxidase as a reporter enzyme. A different substrate is
1.3. Adjust to pH 9.6.
required if alkaline phosphatase is used as the reporter enzyme
2. Seed each well with 180 µl of CB.
(Harlow and Lane, 1988), together with a different wavelength for
3. Add 5-20 µl sample.
determining the absorbance, but the overall procedure is the same.
4. Incubate 3 hrs at ambient temperature, or overnight at 4°C.
1. Prepare TMB substrate solution:
5. Tip out and wash the wells 3X with PBS-T (= PBS containing
1.1. 100 ml water,
0.05% Tween20 detergent), shaking the ELISA plate dry each
1.2. 1 ml 10 mg/ml TMB (33’55’TetraMethylBenzidine) in
time.
DMSO (DiMethylSulfOxide),
6. Prepare a 1/2,000 - 1/5,000 dilution of the primary antibody
1.3. 10 ml 1M Na Acetate (pH 5.8 with 1.0M citric acid),
in PBS-TPO:
1.4. 20 µl 30% H2O2.
6.1. 2% Polyvynylpyrrolidone (PVP) mw 440000,
2. Add 200 µl substrate solution to each well.
6.2. 0.2% Bovine serum albumin (BSA),
3. Let colour develop for 10-15 minutes .
6.3. in PBS-T (fresh daily).
4. Add 50 µl 3M H2SO4 to terminate the reaction.
7. Add 200 µl of antibody/PBS-TPO to each well.
5. Immediately read the absorbance at 450 nm (the
8. Incubate 3 hrs at ambient temperature, or overnight at 4°C.
termination reaction will continue to develop colour).
9. Tip out fluid and wash the wells 3X with PBS-T, shaking the ELISA plate dry each time. 10. Prepare a ProteinA-HorseRadishPeroxidase (PrA-HRP) conjugate stock solution at 100 µg/ml.
9.2.3.5. Controls ELISA is a complex, multistep assay involving sensitive enzymatic reporters, which means that there are many opportunities for assay
11. Make a 1/2,000 – 1/5,000 dilution of PrA-HRP stock solution in failure, either through false-positive or false-negative results. PBS-TPO.
Enzymatic reporter systems, such as used by ELISA, are sensitive to
12. Add 200 µl to each well.
any native enzymatic activity present in the sample (peroxidases,
13. Incubate 3hrs at ambient temperature, or overnight at 4°C.
phosphatases). The initial coating step in a highly alkaline buffer
14. Tip out fluid and wash the wells 3X with PBS-T, shaking the
abolishes most of such background activity, as does the specific
ELISA plate dry each time.
capture of virus particles in sandwich ELISA and the washes with PBS. However, the user should be aware of the possibility of residual
9.2.3.3. Sandwich ELISA 1. Seed each well with 200 µl of a 1/2,000-1/5,000 dilution of
enzymatic activity in the samples, particularly if the substrate incubation step is extended to allow more colour to develop (for
the Fab fragment (Harlow and Lane, 1988) of the primary
instance, when trying to detect very low amounts of virus). Secondly,
antibody in coating buffer (CB, see section 9.2.3.2.).
either the enzyme or the substrate may be faulty, preventing colour
2. Incubate 3hrs at ambient temperature, or overnight at 4°C.
development even though there has been antibody recognition of the
3. Tip out and wash the wells 3X with PBS-T, shaking the ELISA
sample. Alternatively, the primary or secondary antibody may fail, for
plate dry each time.
a number of reasons. All ELISA assays should therefore have a
4. Add 180 µl PBS-TPO to each well.
number of controls to establish the correct functioning of the assay
5. Add 20 µl sample to each well.
itself, thus validating the results from the samples.
6. Incubate 3hrs at ambient temperature, or overnight at 4°C. 7. Tip out fluid and wash the wells 3X with PBS-T, shaking the
ELISA plate dry each time. 8. Add 200 µl 1/2,000 – 1/5,000 dilution of PrA-HRP stock
substrate absorbance).
solution in PBS-TPO to each well.
Sample-free negative control (Absence of non-specific binding of antibodies/reporters to wells; test of blocking and washing
9. Incubate 3hrs at ambient temperature, or overnight at 4°C. 10. Tip out fluid and wash the wells 3X with PBS-T, shaking the
Reporter-free negative control (quantification of background
efficacy).
ELISA plate dry each time.
Primary antibody-free negative control (Absence of nonspecific binding of secondary antibody and/or reporters).
Secondary antibody/reporter-free negative control (quantification of background enzymatic activity in samples).
de Miranda et al.
28
Substrate-free negative control (quantification of background
by far the most variable nucleotides in any virus genome
absorbance in the system).
(Grabensteiner et al., 2001; Bakonyi et al., 2002b; de Miranda
Primary antibody positive control (direct adsorption of
et al., 2004; Lanzi et al., 2006; Olivier et al., 2008; de
antibody in CB: test for recognition of antibody by secondary
Miranda et al., 2010b).
antibody-reporter).
Use deoxyinosine as the 3’ nucleotide, which can pair with all
Secondary antibody positive control (direct adsorption of
nucleotides (Benjeddou et al., 2001; Topley et al., 2005), thus
secondary antibody-reporter in CB: test for functioning
avoiding the 3’ mismatch problem altogether.
reporter enzyme).
Purified virus positive control (correct recognition of virus by
9.3.1.2. Where in the genome?
primary antibody; calibration standards).
The genome of positive-strand RNA viruses is usually compact and efficiently coded, and there is normally no duplication of sequences
9.3. RT-(q)PCR
within the genome. This facilitates the assay design enormously, since
The most common current methods for honey bee virus detection are
one can choose between many alternative assays on virological and
based on Reverse Transcription Polymerase Chain reaction (RT-PCR),
assay performance-quantitation criteria, no matter where in the
essentially the PCR amplification of cDNA. A detailed coverage of the
genome they are located, since they should all only amplify a single
principles and practices of PCR is found in Yuryev (2007) and the
region of the genome.
BEEBOOK paper on molecular methods (Evans et al., 2013). A reduced version, including those elements specifically relevant to virus detection, 9.3.1.3. Primer annealing temperature, length and
composition
is presented here.
Both amplification primers should have similar melting temperature 9.3.1. Primer design
(Tm), length and composition. It is useful to design all assays and primers
Designing RT-(q)PCR assays for detecting (honey bee) RNA viruses
around the same annealing temperature, so that a single cycling
poses some unique challenges. The most critical components of a PCR program can be used for all assays, and that different assays can be assay are the two amplification primers. RNA viruses are genetically
run concurrently with the same program, on the same plate. 56°C is a
highly variable while PCR is very sensitive to nucleotide mismatches
good, standard, robust target for the in silico estimated Tm for primers.
between primer and target, particularly at the 3’ primer termini where extension occurs (Onodera, 2007). A mismatch at the 3’ terminus of
9.3.1.4. Primer-dimer and other PCR artefacts
just one of the primers will result in non-amplification. Mismatches
PCR is susceptible to qualitative and quantitative errors caused by the
further away from the 3’ terminus have increasingly less influence on
accidental, and highly efficient, amplification of short non-target PCR
the success of amplification and generally only the last two 3’
templates formed by fleeting complementarity of the primers with non
nucleotides are critical for amplification specificity. The 3’ mismatch
-target templates, or among the primers themselves (SantaLucia,
issue is therefore crucial to the specificity, accuracy, reliability and
2007; see the BEEBOOK paper on molecular methods; Evans et al.,
sensitivity of a PCR-based virus assay. Here we outline how to use
2013). Such artefacts can be identified by gel electrophoresis during
this to our benefit, and how to avoid it when needed.
assay optimization. The easiest solution to persistent PCR artefacts is to design new primers and test these experimentally (SantaLucia, 2007).
9.3.1.1. What do we want to detect? The first decision is to establish precisely what the assay should
9.3.1.5. Fragment length
detect and what it should not detect:
PCR assay design software packages usually design very short
For distinguishing closely related strains, locate the 3’
amplicons (< 100 nucleotides), with high amplification efficiency and
terminus of one primer at a position where the strains differ
short cycling times. However, amplicons up to 300 nucleotides amplify
consistently. The other primer can be common for all strains
equally efficiently but are easier to separate from PCR artefacts,
(de Miranda et al., 2010b).
provide more room for designing probes and can be used to
For detecting all potential variants within a virus species or
characterize new variants, through sequence analyses.
complex, the primer sequences should be conserved between
all known variants, so as to be able to detect both known and
9.3.2. Detection and analysis of PCR products
as-yet-unknown variants in the complex. Locate the primers
9.3.2.1. “End-point” vs “real-time” detection
at least 200 nucleotides apart, so that new variants can be
The PCR products can be detected after the PCR is completed, usually
identified by sequence analyses of the intervening region.
for “qualitative” analysis (presence/absence of product), either by
rd
Avoid locating the 3’ terminus of a primer on the 3 base of a
(gel) electrophoresis or Melting Curve analysis. Detection can also be
codon in the coding region of a virus genome, since these are
done after each cycle, as PCR proceeds, using laser optics (i.e. in ‘real
The COLOSS BEEBOOK: virus methods
29
-time’). The amount of initial target cDNA in a reaction can then be
9.3.3.2. One-Step/Two-Step RT-PCR
very accurately related to how many amplification cycles are required
Reverse transcription and PCR can be conducted in a single buffer, PCR
for a product to appear. This is the basis for “quantitative” PCR
following reverse transcription (One-Step RT-PCR) or in two separate
(qPCR), which is extremely accurate over a wide range of target
reactions (Two-Step RT-PCR). The advantages of One-Step RT-PCR
concentrations (see the BEEBOOK paper on molecular methods;
are speed and reduced contamination risk; the disadvantages are waste-
Evans et al., 2013).
ful use of precious RNA and inability to control for differences in cDNA synthesis efficiency between reactions (Bustin, 2000; Bustin et al., 2009).
9.3.2.2. Cycles and thresholds
These (dis)advantages are reversed for Two-Step RT-PCR, with the
Continuous real-time detection also allows multiple detection
additional advantage that the cDNA produced can be used for many other
thresholds (i.e. the cycle at which product appears) to be set for the
purposes as well. Two-Step RT-PCR also tends to be considerably more
same reaction, which can be related to different levels of risk for
sensitive and more prone to artefacts, unless steps are taken to avoid
disease. For most practical (or even experimental) purposes, 35 cycles this (see the BEEBOOK paper on molecular methods; Evans et al., 2013). of amplification is sufficient. Beyond 35 cycles, the rapidly increasing risk of both false-positive and false-negative detection errors
9.3.4. Protocols
outweighs the marginal gains in sensitivity (see the BEEBOOK paper
Numerous qualitative and quantitative RT-(q)PCR protocols have been
on molecular methods; Evans et al., 2013).
published for honey bee viruses (Annex 1: http://www.ibra.org.uk/ downloads/20130805/download), although few have been optimized
9.3.2.3. Detection chemistry
experimentally. The European Reference Laboratory for bee diseases
There are many different detection chemistries available for following
at ANSES (France) is in the process of designing fully optimized,
qPCR in real-time (de Miranda, 2008). The two most common are
validated RT-qPCR protocols for all bee viruses (see Blanchard et al.,
SYBR-green and similar DNA-binding dyes, and fluorophore-labelled
2012) for routine, standardised diagnostic use by accredited
™
hydrolysis (TaqMan ) probes. The merits of both systems are
laboratories. For experimental purposes, existing published protocols
discussed in the BEEBOOK paper on molecular methods (Evans et al.,
can be used and optimized, many of which can be easily adapted to
™
2013). TaqMan assays are best suited for well-optimized, stable
qPCR using SYBR-green dye detection. Alternatively, new protocols
assays for widespread, routine diagnosis. SYBR-green assays are
can be designed based on the following practical, robust protocols for
better suited for discovery, characterization of new strains and
Reverse Transcription, One-Step RT-qPCR and Two-Step RT-qPCR,
analysis of strain mixtures (Papin et al., 2004). They are also much
suitable for either quantitative or qualitative analyses. These provide a
cheaper to design, adapt and optimize (Bustin and Nolan, 2004).
useful basis for individual adaptation and optimization, using the guidelines given above and in the BEEBOOK paper on molecular
9.3.3. Assay optimization
techniques (Evans et al., 2013).
Once a PCR assay has been designed, it should be optimized experimentally for annealing temperature (using annealing
9.3.4.1. Reverse transcription
temperature gradients), primer concentration and cycling times (see
The following is a robust, standard reverse transcription protocol for
the BEEBOOK paper on molecular techniques; Evans et al., 2013).
generating cDNA that is fully representative of the original RNA
Optimization usually identifies the highest annealing temperature, the
population:
lowest primer concentrations and the shortest incubation time that consistently generates the right product, without artefacts, at a consistent amplification cycle (see section 12: “Quality control”).
1. Mix: 1.1. 0.5 μg sample RNA template, 1.2. 1 ng exogenous reference RNA (e.g. Ambion RNA250),
9.3.3.1. Reverse transcription
1.3. 1 µl 50 ng/μl random hexamers,
Reverse transcription is the most variable step in RT-PCR, whose
1.4. 1 µl 10mM dNTP,
efficiency is easily affected by inhibitors, reaction conditions (including
1.5. up to 12 µl RNAse free water.
primers) and even nucleic acid concentration (Ståhlberg et al., 2004a;
2. Heat the mixture to 65°C for 5 min and chill quickly on ice.
2004b). To minimize this variability, the nucleic acid should be
3. Add:
optimally prepared and a constant amount used in every reaction.
3.1. 4 μl 5X First-Strand Buffer,
Since PCR does not require large amounts of initial target, the RNA
3.2. 2 μl 0.1 M DTT,
can be diluted to minimise the effects of any inhibitors. cDNA is best
3.3. 1 μl (200 units) of M-MLV RT.
prepared with random hexamer primers that generate a bias-free
4. Mix by pipetting gently up and down.
cDNA copy of the entire RNA population, suitable for a multitude of
5. Centrifuge briefly to collect the contents at the bottom of the
analyses.
tube.
de Miranda et al.
30
6. Incubate 10 min at 25°C.
1.5. x µl *OneStep Buffer* + dNTP(0.2 mM final dNTP),
7. Incubate 50 min at 37°C.
1.6. y µl nuclease-free water,
8. Inactivate the reaction by heating 15 min at 70°C.
1.7. z µl Reverse Transcriptase/Thermostable DNA polymerase
9. Dilute the cDNA solution tenfold with nuclease-free water
mix,
before using in PCR assays, to reduce the risk of PCR
1.8. 20 µl total volume.
artefacts. * Use appropriate buffer for either SYBR-green or TaqMan™ probe
9.3.4.2. Two-Step RT-qPCR
assays. dNTP is usually included in pre-optimized buffers. If not, add
The following is a robust, standard qPCR protocol for amplifying and
separately to 0.2 mM final concentration.
quantifying cDNA templates < 300bp in length. The protocol is based
2. Incubate in real-time thermocycler:
on SYBR-green detection chemistry, with modifications for probe-
2.1. 15 min:50°C,
based detection and qualitative PCR indicated:
2.2. 5 min:95°C, 2.3. 35 cycles [10 sec:95°C - 30 sec:58°C - read].
1. Mix:
3. For SYBR-green assays, follow with Melting Curve analysis:
1.1. 3 μl cDNA (pre-diluted 1/10, in nuclease-free water),
3.1. 1 min:95°C,
1.2. 0.6 µl 10 μM Forward primer (0.3 μM final concentration),
3.2. 1 min:55°C,
1.3. 0.6 µl 10 μM Reverse primer (0.3 μM final concentration),
3.3. 5 sec:0.5°C:read from 55°C to 95°C.
[1.4. 0.4 µl*10 μM TaqMan™ probe* (0.2 μM final
4. For qualitative PCR, a conventional thermocycler can be used
concentration*)],
and the products can be analysed by gel, capillary or
1.5. x µl *TwoStep Buffer* + dNTP(0.2 mM final dNTP),
chip-based electrophoresis.
1.6. y µl nuclease-free water, 1.7. z µl Thermostable DNA polymerase mix,
9.3.5. Quantitation controls
1.8. 20 µl total volume.
A number of controls are required for quantifying the amount of virus in a sample. These can be broadly divided into “external reference
* Use appropriate buffer for either SYBR-green or TaqMan™ probe
standards”, which are used to quantify the absolute amount of target
assays. dNTP is usually included in pre-optimized buffers. If not, add
in each reaction, and “internal reference standards”, which are used
separately to 0.2 mM final concentration.
to correct the quantitative data for unique differences between
2. Incubate in real-time thermocycler:
individual samples. The BEEBOOK paper on molecular methods (Evans
2.1. 5 min:95°C,
et al., 2013) describes in detail the function, preparation and
2.2. 35 cycles [10 sec:95°C - 30 sec:58°C - read].
application of these standards.
3. For SYBR-green assays, follow with Melting Curve analysis: 3.1. 1 min:95°C,
9.3.5.1. External reference standards
3.2. 1 min:55°C,
These consist of dilution series of known concentrations of (cloned)
3.3. 5 sec:0.5°C:read from 55°C to 95°C.
target DNA or RNA, which is used to establish a calibration curve for
4. For qualitative PCR, a conventional thermocycler can be used
converting RT-qPCR data to absolute amounts of target (genome
and the products can be analysed by gel, capillary or chip-
copies) in a reaction (Pfaffl and Hageleit, 2001; Bustin et al., 2009).
based electrophoresis.
External reference standards should be prepared for every target assayed, including all internal reference standards.
9.3.4.3. One-Step RT-qPCR The following is a robust, standard One-Step RT-qPCR protocol for
9.3.5.2. Internal reference standards
amplifying and quantifying targets < 300bp in length, using SYBR-
Unfortunately, external standards cannot correct for factors unique to
green detection chemistry, and starting with an RNA template:
each sample that affect the RT and/or PCR reactions, such as RNA quality and quantity, enzyme inhibitors, sample degradation, internal
1. Mix: 1.1. 3 μl 5 ng/ μl RNA, 1.2. 0.6 µl 10 μM Forward primer (0.3 μM final concentration),
fluorescence etc. To correct for these factors, internal reference standards are used. These come in two forms: “Exogenous internal reference standard”, which is a pure,
1.3. 0.6 µl 10 μM Reverse primer (0.3 μM final concentration), unrelated RNA of known concentration that is added to the RT
[1.4. 0.4 µl*10 μM TaqMan™ probe* (0.2 μM final
mastermix prior to RT-qPCR (Tentcheva et al., 2006). The amount
concentration*)],
used should be < 1% of the amount sample RNA, so as not to affect
The COLOSS BEEBOOK: virus methods
the RT-qPCR reaction efficiencies. These are used to calculate cDNA
31
identified by size, through (gel) electrophoresis. Several such
reaction efficiencies of individual samples (correcting for RT inhibitors). qualitative multiplex protocols have been designed for honey bee
“Endogenous internal reference standards” (commonly called
viruses (Chen et al., 2004b; Topley et al., 2005; Grabensteiner et al.,
‘housekeeping genes’), are relatively invariant host mRNAs present in
2007; Weinstein-Texiera et al., 2008; Meeus et al., 2010). Real-time
every sample. These can be used to normalize quantitative data for
qPCR can also be multiplexed, usually for the simultaneous
differences between samples in RNA degradation or the presence of
amplification of a target and internal reference standards, by using
inhibitors (Bustin et al., 2009; Radonić et al., 2004) and to guard
TaqMan™ probes with different fluorophores.
against ‘false-negative’ data (due to RNA degradation). There are a couple of practical difficulties with endogenous
The main reason for multiplexing is to save cost and time. However, multiplex PCR is less sensitive than uniplex PCR, more
internal reference standards. First, one can never be certain that they
complex to optimize, more prone to artefacts and requires post-PCR
are truly invariant (Radonić et al., 2004). The current
fragment analysis, nullifying any gains in time and cost. Most
recommendations are therefore to use an index of 3 or 4 endogenous
importantly, the late amplification of low-abundance targets is
reference standards for data correction (Bustin, 2000). Second,
strongly affected by the prior amplification of high-abundance targets,
contaminating genomic DNA in an RNA sample can interfere with
through the auto-inhibition of the PCR by the DNA it produces
accurate quantification of the endogenous gene mRNA. This can be
(SantaLucia, 2007). For these reasons, it is often more effective to
avoided by digesting the RNA sample with DNAse prior to RT-PCR, or
use uniplex RT-PCR, even for large projects.
more elegantly by designing intron-spanning primers for the endogenous reference gene (Bustin, 2000; Yañez et al., 2012; Locke et al., 2012),
9.4. Microarrays
such that only cDNA to the mRNA can be amplified.
Multiplexing is far more effective through a microarray, which is an
Internal reference standards are costly, since they are run for all
ordered array of hundreds of molecular probes specific for different
samples. Their inclusion should therefore be evaluated in relation to
target RNAs bound to a solid support, usually a slide. Most microarray
their importance to the project. There are probably more relevant for
technology has been developed for nucleic acid probes, although
fully-quantitative experiments and less for semi-quantitative surveys.
protein-based arrays are also being developed (Sage, 2004). The hybridization of RNA target sequences to these probes to these
9.3.6. Multiple assays
probes can be detected by a variety of methods (de Miranda, 2008),
With careful primer design (see section 9.3.1.) it should be possible to including PCR and sequencing. Numerous honey bee microarrays have approach 100% correct detection (no false positive or false negative
been designed, including honey bee immune gene-pathogen arrays
results) for most viruses with a single primer pair. This is, however,
(Evans, 2006; Runckel et al., 2011) and a honey bee virus array
very much conditional on the natural variation and variability (i.e. the
(Glover et al., 2011). Microarrays are being superseded for research
capacity to generate new variants) for each virus. There are valid
purposes by high-throughput sequencing technologies, but retain a
arguments that PCR is perhaps too specific for the reliable detection
future in routine screening applications, due to their adaptability and
of highly variable entities such as RNA viruses, even when employing
high multiplexing capacity (Glover et al., 2011). See also the
several different primer sets (Gardner et al., 2003). When the
microarray section in the BEEBOOK paper on molecular methods
reliability of a primer set with respect to virus variability is in doubt,
(Evans et al., 2013).
the best resolution is to employ several primer sets in parallel so that the failure of one set does not necessarily result in misdiagnosis. Multiple primer sets also allows one to estimate the rate of misdiagnosis by different primer sets due to virus variability (Chui et
10. Virus replication
al., 2005). Within the honey bee viruses, multiple primer sets may be
10.1. Introduction
needed for reliable diagnosis within the highly variable ABPV complex
The detection of viral replication is crucial for differentiating between
(de Miranda et al., 2010a) and the slightly less variable DWV-VDV-1
an active infection and just the presence of virus particles in a host, or
complex (de Miranda and Genersch, 2010). Multiple assays are
between a mechanical (virus non-replicating) and a biological (virus
available for most honey bee viruses, and comparisons of multiple
replicating) vector of a virus. Evidence that a virus is actively infecting
assays have been made for SBV (Grabensteiner et al., 2001), ABPV
a host includes the presence of viral particles and structures within
(Bakonyi et al., 2002a; 2002b) and DWV (Genersch, 2005).
host cells, revealed by electron microscopy, preferably including a specific nucleic acid or serological probe to positively identify the
9.3.7. Multiplex RT-(q)PCR
virus. Another approach is to detect the non-structural proteins
Multiplex RT-PCR refers to the simultaneous amplification of several
involved in virus replication, which for most positive-stranded RNA
targets in the same reaction. The different end-products are usually
viruses are only produced after invasion and mark the start of a
de Miranda et al.
32
replication cycle. Negative-stranded RNA viruses often carry their
10.2.1. Thermostable reverse transcriptases
replicative proteins within the particle. A related philosophy, which is
Thermostable reverse transcriptases, operating at temperatures up to
more sensitive and accessible, is to specifically detect the replicative
50-70°C, avoid much non-specific priming of the RNA through
strand RNA of a virus. Most of the described bee viruses are single-
elevated reaction temperatures (Lanford et al., 1995; Laskus et al.,
and plus-strand RNA viruses which replicate through a negative-
1998; Craggs et al., 2001; Horsington and Zhang, 2007; Carrière
strand RNA intermediate serving as template for the generation of
et al., 2007; Celle et al., 2008). Thermostable reverse transcriptases
new viral plus-strand RNA genomes. The specific detection of viral
need to be inactivated thoroughly prior to the PCR step, otherwise the
negative strand RNAs can therefore serve as a marker of active
reverse transcriptase has access to primers for both strands (thus
replication of these RNA viruses in a certain host, tissue or cell type.
nullifying the strand-specificity). Another strategy is to inactivate the
Below are outlined two methods for strand-specific detection of RNA
(viral) RNA by alkaline treatment or digestion with RNase H
virus sequences.
(McGuiness et al., 1994), thereby removing any target for reverse transcription during PCR.
10.2. Strand-specific RT-qPCR
When using thermostable reverse transcriptase, make sure that
One of the most popular methods in bee virology for detecting virus
the virus-specific portion of the tagged cDNA primer has a theoretical
replication is the specific detection of negative strand viral RNA, using
Tm ~60°C, to ensure adequate priming at elevated temperatures.
strand-specific Reverse Transcriptase-PCR (Peng et al., 2012; DiPrisco
et al., 2011; Boncristiani et al., 2009; Dainat et al., 2009; Eyer et al.,
10.2.2. Chemical blocking of RNA 3’ ends
2009; Gisder et al., 2009; Celle et al., 2008), following its first
The free 3’ ends of the RNA can be blocked with borohydride, so that
application in bee virology by Yue and Genersch (2005). The
the RNA cannot serve as a primer for cDNA synthesis by self-priming
procedure is illustrated in Fig. 5, including the most common cause of
or random priming with small cellular RNAs. This means that only RNA
false-positive results (non-specific cDNA synthesis) and how best to
primed with the strand-specific cDNA primers can be elongated by the
avoid this (tagged-cDNA primer followed by tag-specific PCR).
reverse transcriptase (Gunji et al., 1994). The protocol involves
Theoretically, strand-specificity can be achieved by performing the
oxidation of the RNA free ends with sodium periodate (NaIO4)
reverse transcription reaction in the presence of only one primer
followed by reduction with sodium tetrahydroborate (NaBH4).
specifically annealing with a unique region of the viral negative strand before amplifying the obtained cDNA by adding the second primer or
10.2.3. Tagged cDNA primers
a specific primer pair for PCR amplification. Unfortunately, strand-
To further improve strand-specific detection of viral RNA, tagged RT-
specific RT-PCR is highly susceptible to false positive results (Gunji
PCR can be used (Craggs et al., 2001). This method relies on a primer
et al., 1994; Lanford et al., 1995; Lanford et al., 1994; McGuiness et al., for cDNA synthesis which contains a tag sequence at the 5’-end that 1994; Craggs et al., 2001; Peyrefitte et al., 2003; Boncristiani et al.,
is unrelated to either virus or host. PCR amplification is then carried
2009) due to:
out with a primer consisting of only the tag sequence, together with a
False-priming of the incorrect strand by the cDNA primer.
virus-specific upstream primer. This ensures that only cDNA’s derived
Self-priming of positive-strand RNA in areas of complex
from the tagged cDNA primer are amplified, and not cDNAs from
secondary structures.
false-, self- or mis-priming events. It is therefore important to ensure
Random priming by contaminating cellular nucleic acids.
that the chosen tag sequence does not show any homology with a
Incomplete inactivation of the reverse transcriptase, leaving
known bee pathogen or invertebrate sequence, by checking the tag
residual activity during PCR amplification (which contains both sequences against the nucleotide sequence databases available on the negative and positive strand primers). To overcome these drawbacks and improve the specificity of the
NCBI website, using BLAST (Altschul et al., 1990). Tag sequences screened for use with honey bee viruses are shown in Table 5.
assays, certain effective techniques have been developed that enhance strand-specificity. These include:
10.2.4. Removal of tagged-cDNA primers from the cDNA
Thermostable reverse transcriptases.
reaction
Tagged-cDNA primers.
Since the purpose of using tagged-cDNA primers is to amplify only
Inactivation/removal of residual tagged-cDNA primers prior to
with the tag sequence, it is important to either remove or inactivate
PCR.
the original tagged-cDNA primers after the cDNA reaction, and prior
Chemical blocking of free 3’ ends before or after reverse
to PCR. If not, then these tagged-cDNA primers (which contain virus-
transcription.
specific sequences) can participate in the PCR reaction, just like a
The COLOSS BEEBOOK: virus methods
33
Fig. 5. Outline of the procedure for strand-specific RT-PCR amplification of negative-strand viral RNA, using tagged-cDNA primers to avoid amplification of non-target cDNAs. Only cDNA produced with tagged-cDNA primers, and amplified with the tag and a virus-specific primer will be amplified. RdRp refers to the viral RNA-dependent RNA polymerase.
Image © JR de Miranda.
non-tagged virus-specific cDNA primer would. The presence of tagged 10.2.5. Inactivating tagged-cDNA primers in the cDNA -cDNA primers in the PCR reaction therefore permits the amplification
reaction
of false-, self- or misprimed cDNAs of the ‘wrong’ strand, leading to
It is also possible to inactivate the tagged-cDNA primer in the cDNA
an incorrect conclusion of strand-specificity (Craggs et al., 2001;
reaction, and so prevent it from participating in the PCR reaction. This
Peyrefitte et al., 2003; Plaskon et al., 2009; Boncristiani et al., 2009).
can be done using exonuclease-I, which specifically digests only
Tagged-cDNA primers can be most easily removed from the cDNA single-stranded DNA, i.e. the tagged-cDNA primer (Craggs et al., 2001; reaction using commercial PCR/cDNA purification columns (Peyrefitte
Purcell et al., 2006; Plaskon et al., 2009; Lin et al., 2009) or by
et al., 2003). An alternative is to use biotinylated tagged-cDNA primers phosphorylating the 3’ end of the tagged-cDNA primer (making it and then capture the tagged cDNA with Streptavidin-conjugated
impossible for the polymerases in PCR to synthesize DNA from this
magnetic beads (Boncristiani et al., 2009). Although highly effective at primer). These enzymatic reactions can be done right after the cDNA removing primers, the disadvantage of cDNA purification is that its
reaction, in the same reaction tube, after which the enzymes can be
DNA recovery efficiency of individual columns can be highly variable
heat-inactivated prior to the PCR reaction. The exonuclease-I
(Tentcheva et al., 2006), leading to different types of error in
digestion has become the method of choice for quantitative strand-
(quantitative) detection and interpretation. This can be managed by
specific RT-qPCR (e.g. Purcell et al., 2006; Plaskon et al., 2009;
adding a passive ‘reference’ DNA prior to cDNA purification (similar in
Lin et al., 2009; Runckel et al., 2011). The main advantages of
concept to the “exogenous internal reference standards” used in RT-
enzymatic inactivation of the tagged-cDNA primers, compared to the
qPCR quantification, discussed in the BEEBOOK paper on molecular
primer removal methods (see section 10.2.4.), is that enzymatic
techniques; Evans et al., 2013), which can be used to normalize the
inactivation is much faster and cheaper, with fewer handling and
data again afterwards.
contamination errors (no tube changes), and that it avoids the possible quantitation errors of the primer removal methods.
de Miranda et al.
34
Table 5. Primers and tags used for detection of positive and negative strand honey bee virus RNAs by strand-specific RT-PCR. TAG
VIRUS
STRAND
PRIMER
+ (pos)
tag-B23 F15
agcctgcgcaccgtggCCACCCAAATGCTAACTCTAAGCG TCCATCAGGTTCTCCAATAACGGA
tagged-cDNA virus-sense
tag-F15
agcctgcgcaccgtggTCCATCAGGTTCTCCAATAACGGA
tagged-cDNA
DWV - (neg)
B23
virus-antisense
+ (pos)
agcctgcgcaccgtggTCGACAATTTTCGGACATCA ATCAGCGCTTAGTGGAGGAA
tagged-cDNA virus-sense
- (neg)
tag-DWVs DWV-as
agcctgcgcaccgtggATCAGCGCTTAGTGGAGGAA TCGACAATTTTCGGACATCA
tagged-cDNA virus-antisense
tag-IAPVas
agcctgcgcaccgtggCTTGCAAGATAAGAAAGGGGG
agcctgcgcaccgtgg + (pos)
IAPV-s
IAPV
GCGGAGAATATAAGGCTCAG
virus-sense
- (neg) + (pos)
tag-BQCVas BQCV-s
agcctgcgcaccgtggGCAACAAGAAGAAACGTAAACCAC TCAGGTCGGAATAATCTCGA
- (neg)
tag-BQCVs BQCV-as
agcctgcgcaccgtggTCAGGTCGGAATAATCTCGA GCAACAAGAAGAAACGTAAACCAC
tagged-cDNA virus-antisense
tag-R23
atcggaatcgcctagcttCCCAATGTCCAAGATGGAGT
tagged-cDNA
+ (pos)
R20
CBPV
tag-R20 R23
- (neg) + (pos) LSV-1 - (neg) + (pos) LSV-2 - (neg)
agcctgcgcaccgtggGCGGAGAATATAAGGCTCAG CTTGCAAGATAAGAAAGGGGG
GCTTGATCTCCTCCTGCTTG
Yue and Genersch, 2005 Gisder et al., 2009 Dainat et al., 2009
Boncristiani et al., 2009
tagged-cDNA virus-antisense
DiPrisco et al., 2011
tagged-cDNA virus-sense
Peng et al., 2011
virus-sense
atcggaatcgcctagcttGCTTGATCTCCTCCTGCTTG CCCAATGTCCAAGATGGAGT
tag-LSVU-R1717 ggccgtcatggtggcgaataaCCATATCATAAGTTGGCAAGTG LSV1-F1434 CAGGTGCAGAGCAATTGGATTCA tag-LSV1-F1434 ggccgtcatggtggcgaataaCAGGTGCAGAGCAATTGGATTCA LSVU-R1717 CCATATCATAAGTTGGCAAGTG tag-LSVU-R1717 ggccgtcatggtggcgaataaCCATATCATAAGTTGGCAAGTG LSV2-F1434 TAGGTGTCGGGCCATAGGGTTTG tag-LSV2-F1434 ggccgtcatggtggcgaataaTAGGTGTCGGGCCATAGGGTTTG LSVU-R1717
REFERENCES
tagged-cDNA
tag-IAPVs IAPV-as
BQCV
ggccgtcatggtggcgaataa (Plaskon et al., 2009)
CCACCCAAATGCTAACTCTAAGCG
FUNCTION
tag-DWVas DWV-s
DWV
atcggaatcgcctagctt
SEQUENCE
CCATATCATAAGTTGGCAAGTG
Celle et al., 2008
tagged-cDNA virus-antisense tagged-cDNA virus-sense tagged-cDNA virus-antisense tagged-cDNA virus-sense
Runckel et al., 2011
tagged-cDNA virus-antisense
10.2.6. Dilution
10.2.8.1. High temperature reverse transcription
Another strategy to minimize the chance of illegitimate amplification
Using an elevated temperature for the cDNA reaction significantly
of non-strand-specific cDNA molecules through the involvement of
reduces mis-priming events, and thus the risk of falsely detecting the
residual tagged-cDNA primer, is to dilute the cDNA reaction mixture
incorrect strand. Common alternatives are: SuperScript-III (50°C:
10-fold prior to PCR (Craggs et al., 2001).
Peyrefitte et al., 2003; Purcell et al., 2006; Plaskon et al., 2009; Lin et al., 2009; Runckel et al., 2011), OmniScript/SensiScript (55°C: Yue and
10.2.7. Strand-specific real-time RT-qPCR
Genersch, 2005; Gisder et al., 2009), Thermoscript (60°C: Carrière et al.,
Finally, a very effective way to manage the consequences of
2006; Horsington and Zhang, 2007) and rTth reverse transcriptase
illegitimate priming events during cDNA synthesis is to use real-time
(70°C: Lanford et al., 1995; Laskus et al., 1998; Craggs et al., 2001;
qPCR for strand-specific detection (Purcell et al., 2006; Gisder et al.,
Celle et al., 2009). The method below is a generic one, with individual
2009; Boncristiani et al., 2009; Plaskon et al., 2009; Lin et al., 2009;
adaptations for the different reverse transcription options:
Zioni et al., 2011). This allows all the PCR products arising from rare cDNAs generated by false-, self- or mis-priming events to be excluded from the data on quantitative grounds.
1. Mix: 1.1. 5 µl 50 ng/µl RNA, 1.2. 1 µl 10 µM tagged-cDNA primer (0.5 µM final
10.2.8. Protocols
concentration),
All these conditions can easily be incorporated into a one-tube
1.3. 2 µl nuclease-free water.
protocol combining the benefits of an RT-reaction at higher
2. Heat 70°C for 5 min. Cool on ice for 2 min .
temperature, tagged primers, exonuclease-I digestion of the tag-cDNA
3.a. For SuperScript-III reactions, add:
primer and dilution of the cDNA, prior to real-time qPCR with a primer
3.a.1. 10 µl 2x SuperScript-III buffer (containing 1 mM dNTP),
complementary to the tag and a virus-specific forward primer.
3.a.2. 2 µl SuperScript-III/RNAseOUT mixture, 3.a.3. Incubate 30 min at 50oC,
The COLOSS BEEBOOK: virus methods
35
3.a.4. Inactivate 15 min at 95°C,
(Boncristiani et al., 2009; DiPrisco et al., 2011; Peng et al., 2012).
3.a.5. Cool reaction to room temperature, store on ice.
1. Follow Qiagen DNA affinity column purification protocol.
3.b. For OmniScript/SensiScript reactions, add:
2. Elute the purified cDNA in 100 µl nuclease-free water.
3.b.1. 4 µl 5x Qiagen OneStep RT-PCR buffer, 3.b.2. 0.8 µl 10 mM dNTP (400 µM final concentration),
10.2.8.4. OneStep PCR
3.b.3. 0.8 µl Qiagen OneStep enzyme mix,
Yue and Genersch (2005) developed a modified OneStep protocol for
3.b.4. 5.4 µl nuclease-free water,
strand-specific RT-PCR that does not include specific steps to remove
3.b.5. Incubate 30 min at 50°C. Go to section 10.2.8.4.
the tagged cDNA primer prior to PCR. Occasionally, weak bands are
3.c. For ThermoScript reactions, add: 3.c.1. 4 µl 5x ThermoScript buffer, 3.c.2. 2 µl 10 mM dNTP (1 mM final concentration),
produced derived from non-strand-specific cDNA priming events (Gisder et al., 2009). 1. For the OmniScript/SensiScript OneStep RT-PCR reactions,
3.c.3. 1 µl 0.1 M DTT (5 mM final concentration),
add:
3.c.4. 1 µl 40 u/µl RNAseOut,
1.1. 0.5 µl 10 µM tag primer (0.25 µM final concentration),
3.c.5. 1 µl 15 u/µl ThermoScript,
1.2. 0.5 µl 10 µM virus-specific primer (0.25 µM final
3.c.6. 4 µl nuclease-free water,
concentration).
3.c.7. Incubate 30 min at 60°C,
2. Incubate
3.c.8. Inactivate 15 min at 95°C,
2.1. 15 min at 95°C,
3.c.9. Cool reaction to room temperature, store on ice.
2.2. 35 cycles of [94°C:30 sec – 54.5°C:60 sec – 72°C:30 sec],
3.d. For rTth reactions, add:
2.3. 72°C:10 min.
3.d.1. 2 µl 10x rTth buffer, 3.d.2. 0.4 µl 10 mM dNTP (200 µM final concentration),
10.2.8.5. Real-time qPCR
3.d.3. 1 µl 10 mM MnCl2 (1 mM final concentration),
The SuperScript-III, Thermoscript and rTth cDNA reactions all enter a
3.d.4. 2 µl 2.5 u/µl rTth reverse transcriptase,
separate (TwoStep) PCR protocol, which can be conveniently adapted
3.d.5. 6.6 µl nuclease-free water,
to real-time qPCR, using a real-time qPCR kit containing SYBR-green:
3.d.6. Incubate 30 min at 70°C, 3.d.7. Add 2 µl 10x chelating buffer (to chelate the Mn+2),
1. Mix:
3.d.8. Inactivate 15 min at 98°C,
1.1. 3 μl cDNA (column purified, or diluted 1/10),
3.d.9. Cool reaction to room temperature, store on ice.
1.2. 0.4 µl 10 μM tag primer (0.2 μM final concentration), 1.3. 0.4 µl 10 μM virus-specific primer (0.2 μM final
10.2.8.2. Exonuclease-I digestion of tagged primer
concentration),
Exonuclease-I specifically digests only single-stranded DNA, in a 3’-5’
1.4. 0.4 µl* 10 mM dNTP* (0.2 mM final concentration*),
direction, and thus inactivates unincorporated tagged-cDNA primer
1.5. x µl Buffer + SYBR-green (as per manufacturer),
prior to PCR. This reduces ten-fold the chance of falsely detecting the
1.6. y µl nuclease-free water,
incorrect strand (Craggs et al., 2001) and is a common step in strand-
1.7. z µl Taq polymerase (as per manufacturer),
specific RT-PCR (Purcell et al., 2006; Lin et al., 2009; Plaskon et al., 2009; Runckel et al., 2011). 1. Add to the cDNA reaction: 10 u Exonuclease-I. 2. Incubate 30 min at 37°C; inactivate 15 min at 70°C. 3. Dilute cDNA reaction ten-fold, to 200 µl.
1.8. 20 µl total volume. (* dNTPs are often included in the optimized buffer) 2. Incubate in real-time thermocycler: 2.1. 5 min:95°C, 2.2. 35 cycles [10 sec:95°C - 30 sec:58°C - read]. 3. For Melting Curve analysis of the products, incubate: 3.1. 1 min:95°C,
10.2.8.3. Column purification of cDNA
3.2. 1 min:55°C,
The cDNA can also be purified to remove unincorporated tagged-
3.3. 5 sec:0.5°C:read from 55°C to 95°C.
cDNA primer, using Qiagen affinity purification columns, and thus significantly reduce the chance of falsely detecting the incorrect
10.2.9. Controls
strand through participation of residual tagged-cDNA primer in the
By now it should be evident that strand-specific RT-PCR should
early PCR reactions. This procedure is a common alternative to
include a large number of controls, to account for the many ways by
Exonuclease-I digestion (Peyrefitte et al., 2003; Carrière et al., 2007)
which an incorrect result can be generated. Most of these involve the
and used in strand-specific detection of several honey bee viruses
reverse transcription reaction, since this is where most of the errors
de Miranda et al.
36
come from. The one essential control that should be run for every
bee viruses including CBPV, DWV (KV & VDV-1), ABPV (IAPV & KBV),
individual sample is:
BQCV, SBPV, SBV (De Smet et al., 2012). Because these are all RNA
A primer-free cDNA reaction (proof that self-primed cDNA is
viruses, the MLPA is preceded by a reverse transcription of RNA into
not amplified).
cDNA. Since the probes are strand-specific, this technique is highly
Other controls that should be included at least once for the
suitable for the selective detection of either the positive-strand
experiment are:
genomic viral RNA or the negative-strand virus replicative
A template-free cDNA reaction (absence of contamination of reagents/pipettes with target DNA).
intermediate RNA, which is a marker for virus replication. Since several targets are amplified at the same time, there will be
A reverse-transcriptase-free cDNA reaction (absence of
competition between different targets for the amplification resources
reverse-transcriptase activity during PCR).
(primers, nucleotides, enzyme). This ‘competitive’ PCR allows for a
An exonuclease-I-free cDNA reaction (disappearance of signal
measure of relative quantification between the targets, in the sense
from mis-primed cDNA reactions).
that the relative proportion of the targets after amplification should, if all targets amplify equally efficiently, reflect their initial proportions in
The PCR step for all these controls should also include tagged-cDNA
the sample. By including one or more internal reference genes or
primer, equivalent to the estimated carry-over from the cDNA
exogenously added absolute quantification standards among the
reaction, in addition to the regular concentrations of tag primer and
targets, the procedure can be made (semi-) quantitative.
virus-specific primer necessary for the PCR. Through this, the controls will contain the complete primer composition of the experimental
10.3.2. Protocol
reactions, which (as explained above) is an essential condition for
The reactions are performed in a thermocycler with heated lid (105°C)
excluding possible false positives.
in 0.2 ml thin-walled PCR tubes. The specific MLPA reagents can be
Whether or not false-positive results during strand-specific RT-
obtained from MRC-Holland. The various probes and oligonucleotides
PCR presents a major problem also depends on the question to be
used in the honey bee virus MLPA are given in Table 6. It is
answered. If the virus replication in a certain host, tissue or cell type
recommended to use the wildtype MuMLV Reverse Transcriptase from
is expected, then false-positive results are not a major factor. In
Promega (M1701). The right probe oligos (RPO) are phosphorylated
contrast, if the absolute presence or absence of replication needs to
and should be synthesized as ‘ultramer’ grade.
be proven, then extreme care must be taken when conducting and interpreting the experiments.
10.3.2.1. Primer and probe mixtures 1. Prepare RT-primer mix:
10.3. Multiplex Ligation-dependent Probe Amplification (MLPA) 10.3.1. Introduction
1.1. 5 mM each dNTP, 1.2. 5 µM each RT primer (Table 6). 2. Prepare probe mix: 1.33 nM of each half-probe (Table 6) in TE(8.0) buffer.
Multiplex Ligation-dependent Probe Amplification (MLPA) technology is an amplification technique that allows simultaneous detection of up to 10.3.2.2. Reverse transcription 40 targets with the use of a single PCR primer pair. The procedure
1. Mix on ice:
uses a series of paired oligonucleotides (half-probes), each pair
1.1. 10~500 ng RNA,
specific for one target. The two half-probes; the Left Probe Oligo
1.2. 1 µl SALSA RT buffer,
(LPO) and the Right Probe Oligo (RPO) lie adjacent to each other on
1.3. 0.5 µl RT-primer mix,
the target genome so that they can be joined together by a ligation
1.4. Sterile water to 4.5 µl total volume.
reaction, to produce an amplification probe (Fig. 6). In addition to a
2. Incubate 1 min at 80°C.
target-specific sequence, each of the half-probes contains one of two
3. Incubate 5 min at 45°C.
sequences recognized by a universal PCR primer, for probe
4. Add 1.5 µl 20 u/µL MuMLV Reverse Transcriptase.
amplification. Since these PCR primer sequences are common to all
If necessary, dilute in 1:1 water: SALSA enzyme dilution buffer.
half-probe pairs, a single pair of PCR primers can amplify all target
5. Mix.
probes in a multiplex reaction. The half-probe pairs also contain a
6. Incubate:
‘stuffer’ fragment of variable length, allowing each amplified probe to
6.1. 15 min at 37°C,
be identified by its size, using (capillary) electrophoresis (Fig. 6). This
6.2. 98°C for 2 min (reverse transcriptase inactivation),
technique was recently adopted to detect the most common honey
6.3. Cool to 25°C.
The COLOSS BEEBOOK: virus methods
37
Fig. 6. Outline of the MLPA procedure for amplifying strand-specific ligated probes. LPO and RPO refer to the Left Probe Oligo and Right Probe Oligo respectively. RdRp refers to the viral RNA-dependent RNA polymerase.
Image © L De Smet.
Table 6. Primers and probes used for detection of positive and negative strand honey bee virus RNAs by MLPA. Adapted from De Smet et al. (2012). VIRUS
CBPV
DWV/KV VDV-1
ABPV KBV IAPV
BQCV
SBPV
SBV
β-Actin
STRAND PRIMER FUNCTION LDS22 (-)cDNA + (pos) LDS23 (+)MLPA-LPO LDS24 (+)MLPA-RPO LDS59 (+)cDNA LDS60 (-)MLPA-LPO - (neg) LDS61 (-)MLPA-RPO LDS8 (-)cDNA LDS9 (+)MLPA-LPO + (pos) LDS10 (+)MLPA-RPO LDS31 (+)cDNA LDS32 (-)MLPA-LPO - (neg) LDS33 (-)MLPA-RPO LDS1 (-)cDNA (ABPV) LDS2 (-)cDNA (KBV&IAPV) + (pos) LDS19 (+)MLPA-LPO LDS4 (+)MLPA-RPO LDS62 (+)cDNA LDS63 (-)MLPA-LPO - (neg) LDS64 (-)MLPA-RPO LDS16 (-)cDNA LDS21 (+)MLPA-LPO + (pos) LDS18 (+)MLPA-RPO LDS65 (+)cDNA - (neg) LDS66 (-)MLPA-LPO LDS67 (-)MLPA-RPO LDS25 (-)cDNA + (pos) LDS26 (+)MLPA-LPO LDS27 (+)MLPA-RPO LDS68 (+)cDNA - (neg) LDS69 (-)MLPA-LPO LDS70 (-)MLPA-RPO LDS28 (-)cDNA + (pos) LDS29 (+)MLPA-LPO LDS30 (+)MLPA-RPO LDS71 (+)cDNA - (neg) LDS72 (-)MLPA-LPO LDS73 (-)MLPA-RPO LDS58 (-)cDNA + (pos)
PCR
LDS56
(+)MLPA-LPO
LDS57 LDS11 LDS12
(+)MLPA-RPO PCR-Forward PCR-Reverse
SEQUENCE (5'-3') GCCCCGATCATATAAGCAAA gggttccctaagggttggaCCGTAGCTGTTTCTGCTGCGGT PACTCAGCTCAGCTCGACGCTCAGAtctagattggatcttgctggcac GAACATCCGGAACAGACGAT gggttccctaagggttggaTCTGAGCGTCGAGCTGAGCTGAGT PACCGCAGCAGAAACAGCTACGGtctagattggatcttgctggcac TCACATTGATCCCAATAATCAGA gggttccctaagggttggaTGACCGATTCTTTATGCAGCGAGCTCT PTACGTGCGAGTCGTACTCCTGTGACAtctagattggatcttgctggcac GTGTGGTGCATCTGGAATTG gggttccctaagggttggaGTTGTCACAGGAGTACGACTCGCA PCGTAAGAGCTCGCTGCATAAAGAATCGGTtctagattggatcttgctggcac CAATGTGGTCAATGAGTACGG TCAATGTTGTCAATGAGAACGG gggttccctaagggttggaCTCACTTCATCGGCTCGGAGCATGGATGAT PACGCACAGTATTATTCAGTTTTTACAACGCCCtctagattggatcttgctggcac TGAAACGGAACAAATCACCA gggttccctaagggttggaCGAGCCGATGAAGTGTCTTGAGCCATGG PGGGTATTGATCCTATTTGGAGTTTCCACATCATGtctagattggatcttgctggcac CGGGCCTCGGATAATTAGA gggttccctaagggttggaCTTCATGTTGGAGACCAGGTTTGTTTGCCGACTTACGGAA PTGTCGTTAAACTCTAGGCTTTCCGGATGGCTTCTTCATGGtctagattggatcttgctggcac TTAAAAGCCCCGTATGCTTG gggttccctaagggttggaTCAGCGCAACAGAAGCCATCCGGAAAGCCTAGAGTTTAACG PACATTCCGTAAGTCGGCAAACAAACCTGCCTTATCTGGTtctagattggatcttgctggcac CGCAAACACGACGAATTTTA gggttccctaagggttggaCGTTCAATGGTCGAGATAGAAGCCACAGTAGAAGTATTACGCGCT PTCTTGTGTTTTGGCTTATGGGCGTGGGCCTGATCTTCATTCAGCtctagattggatcttgctggcac GGTGTCATAAACAGAATGACGAG gggttccctaagggttggaTCAGCGCAACACTCAGGCCCACGCCCATAAGCCAAAACACAAGAA PGCGCGTAATACTTCTACTGTGGCTTCTATCTCGCCTTATCTGGTtctagattggatcttgctggcac TGGACATTTCGGTGTAGTGG gggttccctaagggttggaCGTTGATCCAATGGTCAGTGGACTCTTATACCGATTTGTTTAATGGTTGG PGTTTCTGGTATGTTTGTTGACAAGAACGTCCACCTTCAGCCATTCAGCtctagattggatcttgctggcac CCTTACCTCTAGTAAGAAGACATTTGA gggttccctaagggttggaTAAAAAACTACCGTGTAGTGGACGTTCTTGTCAACAAACATACCAGAAA PCCCAACCATTAAACAAATCGGTATAAGAGTCCACTGAAAAGTCGGTGGAtctagattggatcttgctggcac TTTCATGGTGGATGGTGCTA gggttccctaagggttggaGCAGGAAGTCGTTACCACCTGGCCCACGGAGCCAATTTCTCATGCTTGCCAACACTGTCCTTTCTGGAGGT PACCACCATGTATCCTGGAATCGCGAAAACGTGGTGTACCGGCTGTCTGGTATGTATGAGTTTGTGGTGAtctagattggatcttgctggcac gggttccctaagggttgga gtgccagcaagatccaatctaga
SIZE (bp) 88
88
95
95
104
104
122
122
131
131
140
140
182
n.a.
de Miranda et al.
38
10.3.2.3. Hybridisation of MLPA half-probes 1. Add to the reverse transcription reaction and mix with care:
Agarose gel electrophoresis: 1. Prepare a 4% high resolution agarose gel in 1x TRIS-Borate-
1.1. 1.5 µl Probe-mix, 1.2. 1.5 µl MLPA buffer.
EDTA buffer (Green and Sambrook, 2012). 2. Mix:
2. Incubate:
2.1. 10 µl aliquot of the MLPA reaction,
2.1. 1 min at 95°C, 2.2. 16 h at 60°C in a PCR ThermoCycler.
2.2. 5 µl 4x Sample Buffer. 3. Load gel. 4. Run for 45-60 minutes at 75-90 volts.
10.3.2.4. Ligation of MLPA half-probes 1. Reduce the temperature of the thermal cycler to 54°C. 2. While at 54°C, add to each sample: 2.1. 3 µl Ligase-65 buffer A,
Semi-automatic high-resolution gel electrophoresis: 1. Use gel system appropriate for 25-500 bp DNA fragments. 2. Follow manufacturers’ instructions for sample preparation,
2.2. 3 µl Ligase-65 buffer B,
loading, running and data analysis.
2.3. 25 µl sterile water, 2.4. 1 µl Ligase-65.
10.3.4. Controls
3. Mix well.
As for strand-specific RT-PCR, MLPA requires a large number of
4. Incubate:
controls to rule out the possibility of artefactual results due to the
4.1. 10-15 min at 54°C,
methods used.
4.2. 5 min at 98°C (inactivation of Ligase-65). 5. Cool on ice.
A nucleic acid-free control (the two half-probes should not be able to ligate without a template).
10.3.2.5. PCR amplification of MLPA probes
should not be able to ligate on an RNA template).
1. Mix in new tubes: 1.1. 10 µl MLPA ligation reaction,
A ligase-free control (the two half-probes should not be able to ligate without ligase0.
2.1. 2 µl SALSA PCR primers, 2.2. 2 µl SALSA enzyme dilution buffer,
A half-probes-free control (only the two half-probes should generate an amplifiable template for PCR).
2. While the tubes are in the thermal cycler at 60°C, add to each tube:
A cDNA primer-free control (identifies possible self-priming of RNA for cDNA synthesis).
1.2. 4 µl SALSA PCR buffer, 1.3. 26 µl sterile water.
A reverse transcriptase-free control (the two half-probes
A PCR primer-free control (the two half-probes should not be
2.3. 5.5 µl sterile water,
able to function as PCR primers either with each other or with
2.4. 0.5 µl SALSA polymerase.
the cDNA primer).
3. Incubate: 3.1. 35 cycles [30 sec:95°C - 30 sec:60°C - 60 sec:72°C], 3.2. 20 min:72°C.
11. Virus variation
10.3.3. Fragment analysis
11.1. Introduction
The MLPA reaction products can be analysed on conventional slab
Due to the importance of genetic variability to virus virulence and
electrophoresis, using a 4% agarose-TBE gel (De Smet et al., 2012;
evolution, the detection and quantification of virus genetic variability
Green and Sambrook, 2012), or using a high-resolution, semi-
as a trait in itself has been an interest throughout the history of virus
automatic electrophoresis system such as the BioAnalyzer (Aligent),
research. Throughout the history of molecular diagnostics, new
Experion (Biorad), Qiaxcel (Qiagen) or MultiNA (Shimadzu), which are
technologies have been adapted for the detection and quantification
designed for separating short fragments. In all cases, interpretation of of polymorphisms or genetic variation, reviewed by Ahmadian and the results is simplified by loading a specific MLPA ladder, generated amplifying each of the MLPA targets individually from cloned controls and pooling these into a single ladder.
Lundeberg (2002). Below are a few of the more current methods.
The COLOSS BEEBOOK: virus methods
39
11.2. Protocols
nucleic acids underpins all nucleic acid technologies. The principal
11.2.1. Nuclease protection assays (RPAs and SNPAs)
parameters governing disassociation/hybridization are the length and
Nuclease protection assays are an efficient way to analyse the genetic composition of the DNA, the temperature and the salt concentration complexities of natural populations of organisms (Kurath et al., 1993;
of the solution. Work in the 1950s demonstrated that the G-C pairing,
Arens, 1999; Wang and Chao, 2005). A labelled probe is hybridised to with three hydrogen bonds, gave higher thermal stability than the A-T the nucleic acid sample of a population of organisms (usually viruses
pairing, which has only two such bonds (Marmur and Doty, 1959).
or other pathogens, sometimes related mRNA species) and then
This made it possible to predict the temperature at which a DNA
digested with RNAse (RNA probe) or S1-nuclease (DNA probe) which
molecule would melt (Tm) from its length and base pair composition
will cut the probe wherever there is a mismatch between probe and
(Marmur and Doty, 1962). The discovery of DNA binding dyes such as
target. The resulting pattern of digested probe fragments, revealed by SYBR-green, that fluoresce only when intercalated with double gel electrophoresis, is qualitatively and quantitatively indicative of the
stranded but not single stranded molecules, provided a practical
mismatch polymorphisms present in the nucleic sample. These
method to quantify the melting process based on a reduction in
procedures are called RNAse Protection Assay (RPA) and S1-Nuclease
fluorescence during gradual heating, as the two DNA strands
Protection Assay (SNPA).
separated. This fluorescence-based detection was integrated with real -time PCR thermocyclers that can very precisely control the
Pros: Entire populations can be screened for genetic complexity
temperature of a DNA sample and collect fluorescence data between
within the target sequence in a single reaction. The polymorphic
10 and 200 times per °C, providing high-resolution melting curves
sites can be mapped on the genome, through the sizes of the
that can distinguish single base pair differences between two PCR
fragments produced.
products (Wittwer et al., 2003). This makes it possible to use High
Cons: Assay is limited to about 300 bases, requiring many assays
Resolution Melting (HRM) analysis to analyse the composition of
to cover a genome. Protocols are complex and subject to errors.
mixed samples, i.e. samples containing two or more genetic variants
The nature of the polymorphs requires further analysis.
of the same region, by comparing the melting curve of the mixed sample with those of the individual variants.
11.2.2. Gel retardation assays (SSCP and DGGE)
HRM analysis is a versatile method that can be applied to any
Single Strand Conformation Polymorphism (SSCP) and Denaturing
sample that contains double stranded DNA, including cDNA or PCR
Gradient Gel Electrophoresis (DGGE) are two techniques that use
products. The flexibility of HRM analysis has led to a diverse array of
electrophoresis to differentiate directly between variants in a
applications including pre-sequence screening, Single Nucleotide
population of sequences (Hauser et al., 2000; Stach et al., 2001). In
Polymorphism (SNP) typing, methylation analysis, microsatelite or
SSCP the nucleic acids are made single-stranded, to fold into a
Simple Sequence Repeat (SSR) marker screening (Arthofer et al., 2011)
preferred secondary structure. In DGGE, the nucleic acids are
and copy number quantification. Several of these techniques are
separated in an electrophoretic gel containing a salt gradient that will
covered in the BEEBOOK paper on molecular techniques (Evans et al.,
progressively denature the nucleic acids. In both methods, minor
2013). Such applications of HRM are also relevant to virology, and the
nucleotide differences between polymorphs in the population affect
first record of a virological use of HRM analysis was to strain type
the migration of the DNA. Another technique with a similar philosophy West Nile virus (Papin et al., 2004). Recently, HRM analysis has been is the heteroduplex mobility shift assay, where single nucleotide
used to monitor the relationship between varroa infestation and virus
mismatches between a probe and target affect the mobility of the
diversity (Martin et al., 2012).
hybridised complex during electrophoresis, (Arens, 1999).
Many standard real-time PCR machines can be used for HRM analyses. Often an upgrade of the software package and the running
Pros: Entire populations can be screened for genetic complexity
of a calibration plate is all that is required to enable a real-time PCR
within the target sequence in a single reaction.
machine to run HRM analyses. Since HRM is a highly technical and
Cons: Assay is limited to about 300 bases, requiring many assays
sensitive procedure that integrates reaction biochemistry with
to cover a genome. Protocols are complex, sensitive to procedural machinery and analysis software, the best advice is to follow the accuracy and subject to errors. The nature of the polymorphs
protocol, reagents and incubation profile recommended by
requires further analysis.
manufacturer. The basic procedure is as follows:
11.2.3. High Resolution Melting (HRM) analysis
1. Amplification: Amplify your chosen fragment from your
Double stranded DNA can disassociate (or melt) into two single
experimental samples and cloned controls, using specific HRM
strands upon heating, and can re-associate (or hybridize) upon
reagents containing a saturating DNA DNA intercalating dye
cooling, in a highly predictable fashion. This fundamental property of
and the recommended incubation profile.
de Miranda et al.
40
2. Replicates: Use a minimum of three technical replicates for
Pros: Comprehensive; fast; flexible; accurate; sensitive; specific;
each sample. The replicate melting profiles will be averaged
low contamination risk; approximate quantification (NSG).
and used to assess whether the sample is distinct from other
Cons: Expensive - precise - limited quantification (Sanger
samples/controls.
sequencing); Very expensive - approximate quantification (NGS).
3. HRM: Immediately after amplification the PCR products are subjected to a high-resolution melting step, within the same tube, during which the decrease in fluorescence due to the transition of the DNA from double- to single-stranded shape is monitored. 4. Analysis: The melting curve of the experimental sample,
12. Quality control 12.1 Introduction Standardization of the diagnostic methods for detecting and
containing a mixture of different variants, is compared to the
quantifying bee viruses and of the interpretation of the results is the
melting curves of pure, cloned versions of each of the
first requirement for improved harmonization of the data collected by
individual variants.
different laboratories. The protocols and assays for different animal diseases registered with the World Organization for Animal Health
Pros: Simple; fast; flexible; cheap; sensitive; specific; low
(OIE; previously the Office International des Epizooties) ensure the
contamination risk.
global harmonization and standardization of detection methodologies.
Cons: Requires individual melting curves of (cloned) variants.
Moreover, the OIE provides criteria for the technical requirements and
Cannot identify nature of novel variants. Limited quantification of
quality management in veterinary testing laboratories, in the form of a
variants. Limited capacity to resolve complex mixture. Limited to
series of standards and recommendations that each laboratory should
very short genome fragments.
address in the design and maintenance of its quality management program. Valid laboratory results are essential for diagnosis, obtained
11.2.4. Sequencing
by the use of good management practices, validated protocols and
The most powerful means for detecting variation is sequencing, since
calibration methods as described in the ISO/IEC 17025 International
every possible variant is identified and precisely mapped on the
Standard. By following these standards, a laboratory is able to obtain
genome. There are several approaches that can be used. The purest
accreditation, linked to the international certification standard ISO
and most expensive approach is to clone PCR products of the target(s) 9001. OIE guidelines provide an interpretation of the ISO/IEC 17025 and sequence batches of individual clones. This also allows the
guidelines in the context of veterinary laboratories working with
relative frequencies of individual variants to be determined, even
infectious diseases, including the validation of diagnostic assays, the
those variants occurring at very low frequencies. A second and
production of international reference standards and laboratory
cheaper approach is to sequence the PCR products directly and
competence testing. The European reference laboratory for honey bee
identify the polymorphisms at sites of ambiguity in the sequence
diseases at ANSES in France is developing a set of standard diagnostic
(Forsgren et al., 2009; Fig. 7). Since such double peaks can also be
procedures for honey bee viruses, following these procedures and
the result of sequencing artefacts, each polymorphic site has to be
criteria.
confirmed by a matching pattern when sequencing the complementary strand. Only major polymorphisms can be identified and quantitation is moderate, similar to HRM. The new, high volume automated sequencing methods (Next Generation Sequencing, or NGS) have the capacity to directly analyse complex DNA and RNA mixtures through sequencing followed by automated similarity searches. These methods are rapidly becoming cheaper and more accurate, mostly through massive multiplexing of reactions and samples. They are increasingly being used as a one-step diagnostic method capturing millions of different targets, thus benefiting also from economy of scale in the data generated. They have recently also been used in honey bee pathology studies (Cox-Foster et al., 2007; Runckel et al., 2011) and are covered in detail in the BEEBOOK paper on molecular techniques
Fig. 7. Mixed virus sequences as revealed in sequence electropherogram.
(Evans et al., 2013).
The mixed sequence can be resolved into component sequences using specifically designed software. Adapted from Forsgren et al., 2009.
The COLOSS BEEBOOK: virus methods
12.2. Assay selection and validation
41
A series of possible diagnostic assays are designed using bioinformatics
Full validation of molecular techniques, as per guidelines issued by the tools, based on the particular diagnostic requirements for the method. World Organization for Animal Health (OIE) is a relatively new concept in the field of honey bee virus diagnosis. In general terms, a
12.2.1.2. Experimental specificity
diagnostic protocol is designed in response to a particular diagnostic
The specificity of the PCR assay is then tested experimentally, using
need and this is then developed into an optimized, documented and
inclusivity and exclusivity tests.
fixed procedure, using a series of intra-laboratory validation steps that
Inclusivity tests
demonstrate the reliability of results and the performance of the
Inclusivity tests assess the robustness of an assay, i.e. its
method. Recently, a new standard (XP U47-600) was developed by
ability to detect genetically diverse isolates. The PCR assay is
the French Standards Institute (AFNOR) concerning the minimum
evaluated against a panel of samples representing the full
requirements for the development, validation and implementation of
range of genetic diversity of the virus in question. This
veterinary PCR-based diagnostic methods in animal health, based on
diversity is determined beforehand through phylogenetic
the recommendations by the OIE and following the ISO/IEC 17025
analysis of bio-geographic isolates (see section 12.2.1.1.).
criteria (NF, 2005; OIE, 2010). The validation procedure establishes
Exclusivity tests
the performance characteristics for each test method, such as
Exclusivity tests assess the specificity of an assay, i.e. its
sensitivity, specificity, detection and/or quantification limits.
ability to detect only the virus in question, and not any other
The initial validation of a RT-qPCR assay involves two steps. The first concerns the validation of the qPCR assay itself, in terms of:
viruses. The PCR assay is evaluated against a panel of viruses unrelated to the virus being tested, but which are found in the same environment or ecological area as the virus being tested.
1. Analytical specificity. 2. The PCR detection limit (DLPCR).
12.2.2. PCR detection limit
3. The PCR quantification limit (QLPCR).
The detection limit of a qPCR assay is the lowest number of nucleic
4. The linearity and efficiency of the qPCR assay.
acid targets in a given template volume that can be detected in at least 95% of replicate assays. The detection limit is established by
The second step concerns the evaluation of the entire diagnostic
performing at least three independent trials, each with trial consisting
protocol in terms of:
of three independent two-fold serial dilutions of a template of known concentration. At each dilution level in each serial dilution series, eight
1. The method’s detection limit (DLmethod).
replicate qPCR assays are run, i.e. a total of 24 replicate assays at
2. The diagnostic specificity and sensitivity on samples of known
each dilution level. The detection limit is the highest dilution level
status. 3. The method’s quantitation limit (QLmethod) based on a
(i.e. lowest amount of target nucleic acid template) giving at least 23 positive results from the 24 assays (95% of the replicates).
validation range and accuracy profile. 12.2.3. qPCR dynamic range and quantitation limit In each of the two steps, various performance parameters are
PCR is an exponential (i.e. logarithmic) amplification process that is
calculated, including measurement uncertainty (MU), deviations of
extremely consistent (i.e. predictable) over the entire reaction (35~40
repeatability and intermediate reliability.
cycles) and over a large range of initial target concentrations (at least
The following is a step-by-step outline of how to develop an
106-fold). This dynamic range and the quantitation limits of qPCR are
accredited RT-qPCR assay for the detection and quantitation of honey
determined using a 10-fold serial dilution series of known
bee viruses, based on the successful development of such an assay
concentrations of (cloned) target DNA. A standard calibration curve is
for CBPV (Blanchard et al., 2012).
generated by linear regression of the quantification cycle (Cq) at which the PCR product is detected vs. the log10[target copy number]. The
12.2.1. Analytical specificity
12.2.1.1. Analysis in silico Multiple nucleic acid sequences of the virus, obtained from public sequence databases and from a diverse range of biological and geographic
resulting algebraic equation: Cq = a * log10[target] + b (where ‘a’ is the slope and ‘b’ the intercept)
sources, are compared in silico with each other and unrelated viruses
is then used to estimate the amount of target in a sample, given the
using BLAST (Basic Local Alignment Search Tool; Altschul et al.,
Cq value (Bustin et al., 2009). For accurate calibration of the curve
1990), to identify regions of variability and conservation. See also the
and determining the error associated with data conversion, at least
BEEBOOK paper on molecular techniques (Evans et al., 2013).
three independent trials of three independent 10-fold serial dilutions
de Miranda et al.
42
should be run. For each series and trial, the known amounts of target
and compared to the acceptability limits defined by the laboratory,
in each dilution are compared to the theoretical amounts estimated
e.g. +/- 0.5 log10 (Blanchard et al., 2012). The tolerance interval
from the calibration curve, to obtain the individual bias, which is the
limits of the accuracy profile have to be within the acceptability limits,
averaged for all series and trials to obtain the mean bias (mb) at each validating the method for the thus defined calibration range. The dilution (an example is shown in Table 7). These values are then used quantitation limit of the method is then determined by the first level to calculate the standard deviation of the obtained values (SD), and
load of the validated calibration range. An example of the confidence
the uncertainty of the linearity is obtained by the formula ULINi = 2[√
and acceptability limits of an RT-qPCR calibration curve is given Fig. 8,
SD² + mb²]. The combined linearity uncertainly is defined for the
where the evaluated method is validated for a calibration range
2
entire calibration range by the formula ULIN = │√ ΣULINi / k│ where k
between 103 and 106 copies, with a quantitation limit of 103 copies.
is the number of dilution levels. The quantitation limit of the assay is then set at the target concentration of the calibration range.
12.4. Laboratory Validation The final validation of a diagnostic method is through inter-laboratory
12.3. Method validation
proficiency tests, to evaluate the reproducibility and the overall uncertainty
12.3.1. Method detection limit
of the method, and to assess performance of other laboratories to
The method detection limit (DLmethod) is the lowest amount of
conduct specifically this method (Birch et al., 2004; Valentine-Thon
biological target in a sample that can be detected by the entire
et al., 2001; Verkooyen et al., 2003). To achieve this, candidate
method (from processing through RT-qPCR). The DLmethod is evaluated laboratories must submit to a training and accreditation programme. with biological reference samples obtained by spiking virus-free bee homogenates with known amounts of purified virus. At least two
12.4.1. Training and accreditation
independent trials must be performed on two independent two-fold
The International Laboratory Accreditation Cooperation (ILAC) is an
serial dilutions, with four replicate RNA extractions at each dilution
international cooperation of laboratory and inspection accreditation
level. The DLmethod is the last dilution at which viral RNA can be
bodies created more than 30 years ago. It has published specific
detected in all replicates (100% frequency).
requirements and guides for laboratories and accreditation bodies. Under the ILAC system, ISO/IEC 17025 is to be used for accreditation.
12.3.2. Method diagnostic sensitivity and diagnostic
This procedure attests for the laboratory’s technical competence and
specificity
the reliability of its results. In each country, a sole national
The diagnostic specificity and sensitivity is assessed on complete
accreditation body is designated, as the French Accreditation
method analysis (processing through assay) of biological samples of
Committee (COFRAC) in France, the Deutsche Akkreditierungsstelle
known virus status (positive or negative). Diagnostic sensitivity is
GmbH (DAssK) in Germany or the Swedish Board for Accreditation
determined by the percentage of positive results among the known
and Conformity Assessment (SWEDAC) in Sweden. Performance of
positive samples. Diagnostic specificity is determined by the
the method must thus be validated according to the OIE or AFNOR
percentage of negative results among the known negative samples.
standards and approved by the national accreditation committee of each country. Furthermore, inter-laboratory proficiency tests should
12.3.3. Method quantitation limit and accuracy profile
be carried out to evaluate the reproducibility of the method.
The assessment of a method’s quantitation limit is based on the construction and interpretation of an accuracy profile to estimate the
12.4.2. Inter-laboratory proficiency testing
precision and reliability of the values. Three independent trials must
The basic purpose of proficiency testing is to assess performance of
be performed on three independent 10-fold serial dilutions, including
laboratories in conducting specific method. Proficiency testing provides
two replicate RNA extractions for each level of dilution. For each
an opportunity to have an independent assessment of each laboratory’s
dilution series and each target amount, various parameters are
data compared to reference values or to the performance of other
determined from estimated target amounts, such as the inter-series
laboratories (e.g. Apfalter et al., 2002). The participation of the
variance and the repeatability variance, the sum of both giving the
laboratory to proficiency testing programs assesses if the laboratory’s
reliability variance. The standard deviation of the reliability (SDrl) is
performances is satisfactory. In case of any potential problems within
then obtained by the square root of the reliability variance. The mean
the laboratory, investigations to detect the difficulties are required. In
bias is determined (difference between the theoretical value and the
order to successfully run proficiency test programs, the production and
mean of the observed values). To construct the accuracy profile, the
the distribution of reference materials (positive control, extraction
lower and upper tolerance interval limits of the quantitation method
control) are key points, as well as technical trainings of laboratories if
are determined using the following formula:
necessary. In this framework, data harmonization could contribute to
mean bias +/- 2 × SDrl
a better understanding of honey bee diseases and to a better diagnosis of pathological issues.
The COLOSS BEEBOOK: virus methods
43
Table 7. Worked example of the estimation of primary and secondary pathogen detection that made more insightful research into disease statistics relating to the accuracy and confidence limits of a qPCR
and epidemiology possible. The most pioneering honey bee virology
calibration curve. After Blanchard et al., (2012).
revelations were made during this time, in particular the discovery
Target amount (copies/reaction)
and serological characterisation of most of the honey bee viruses that 30
300
3000
30000
Theoretical value Log10 (Tv)
1.477
2.477
3.477
4.477
nucleic acid level. The development of cheap, high throughput mass
Measured value Log10 (Mv)
1.426
2.524
3.539
4.420
sequencing of genomes and transcriptomes has overtaken these
1.490
2.443
3.507
4.469
efforts somewhat, leading to the identification of novel viral nucleic
1.462
2.475
3.528
4.444
acid sequences in bee and mite samples that may very well represent
1.492
2.439
3.509
4.468
1.494
2.435
3.511
4.468
-0.052
0.046
0.062
-0.057
0.013
-0.034
0.030
-0.009
-0.016
-0.002
0.051
-0.033
0.014
-0.038
0.032
-0.009
0.017
-0.043
0.034
-0.009
Sum of Mv
7.363
12.316
17.594
22.270
Mean Mv
1.473
2.463
3.519
4.454
Mean bias
-0.005
-0.014
0.042
-0.023
Standard deviation of Mv
0.029
0.037
0.014
0.022
ULINi
0.060
0.080
0.088
0.063
quantitative disease management style. Accuracy of detection at the
ULINi²
0.004
0.006
0.008
0.004
molecular level (and virus detection is largely molecular) depends
Bias (Mv - Tv)
ULIN
0.074
we know today. Several of these remain to be characterised at the
the genomes of viruses that had already been discovered previously. Matching these historical virus discoveries and their serological data to these nucleic acid genomes is therefore an important and urgent task, to avoid confusion in bee virus classification and to make sure that the historical literature on these viruses remains relevant in the current molecular age. The principal criteria for an ideal diagnostic system are sensitivity, accuracy, reliability, universality, simplicity, speed and cost. Most modern detection technologies are now sensitive enough to detect down to a single target molecule. This means that any future development will increasingly focus on quantitative detection (depending on the diagnostic requirements), with a concomitant change to a more integrated,
essentially on the nature of the primary molecular recognition event,
i.e. the interaction between target and probe. In this regard, nucleic acid-based detection has a considerable advantage over serological detection, since the kinetics of nucleic acid hybridisation is much more predictable and reliable than that of protein interactions. This also makes nucleic acid-based detection much more adaptable to changing requirements due to the discovery or emergence of new virus variants. The principal area of concern for molecular virus detection is reliability, i.e. avoiding misdiagnosis due to false-positive or falsenegative results. The nucleic acid genomes of viruses are naturally highly variable and can evolve very quickly, while current molecular diagnostic methods are highly sensitive to minor variations in the
Fig. 8. Example of the mean bias, confidence interval, acceptability
nucleic acid target, making it prone to possible false-negative errors.
limits and quantitation limit for a RT-qPCR calibration curve.
This sensitivity is largely linked to the enzymes used for molecular
After Blanchard et al., 2012.
detection and future developments in molecular virus diagnostics may therefore increasingly feature enzyme-free technologies (Liepold
13. Future perspectives
et al., 2005). The variability of virus genomes is an important component of a
The future is bright for disease diagnosis and pathogen detection. The virus’ adaptive response. It is in many ways a defining and unique molecular biology revolution of the past quarter century has matured
characteristic for individual viruses. Other areas of virology now
through the experimental, labour driven phase to high volume
distinguish which viral forms offer increased pathogenicity, or which
automated systems delivering reliable, high quality information. The
spread more easily. New methods that can directly describe and
revolution is likely to continue, with new methods being developed
quantify this variability, such as HRMC, may become increasingly
annually, increasing the options available to the diagnostic virologist.
important in honey bee virology to clarify how the interactions
In the 1960’s, 70’s and 80’s the development of semi-automated,
between host factors, individual variants, combinations of variants or
sensitive serological assays precipitated a similar revolution in
the variability as a whole, can induce a diseased state.
de Miranda et al.
44
Disease is the result of a breakdown in a host’s normal physiological state due to the presence or proliferation of a pathogenic agent. The simpler component of this interaction is the pathogen, and its detection. Future developments however, will increasingly focus on
ALLEN, M F; BALL, B V; WHITE, R; ANTONIW, J F (1986) The detection of acute paralysis virus in Varroa jacobsoni by the use of a simple indirect ELISA. Journal of Apicultural Research 25(2): 100-105. ALTSCHUL, S F; GISH, W; MILLER, W; MEYERS, E W; LIPMAN, D J
the host component of disease and the interplay between pathogen
(1990) Basic local alignment search tool. Journal of Molecular
and host. This means that future technological direction in disease
Biology 215(3): 403-410.
diagnosis will emphasise multiplexing, miniaturisation (Fiorini and
http://dx.doi.org/10.1016/S0022-2836(05)80360-2
Chui, 2005) and automation (Service, 2006; Belák et al., 2009), to
AMDIOUNI, H; MAUNULA, L; HAJJAMI, K; FAOUZI, A; SOUKRI, A;
provide epigenetic data to better understand how the breakdown in
NOURLIL, J (2012) Recovery comparison of two virus
the homeostasis between host and pathogen results in disease. Such
concentration methods from wastewater using cell culture and
information is important, since it can inform disease prevention,
real-time PCR. Current Microbiology 65(4): 432-437.
treatment and potential cures.
http://dx.doi.org/10.1007/s00284-012-0174-8
Finally, automation and increased demand for simpler, faster and
ANDERSON, D L; GIBBS, A J (1988) Inapparent virus infections and
cheaper technologies for routine diagnosis with wide applicability in
their interactions in pupae of the honey bee (Apis mellifera L.) in
low-tech settings (Higgins et al., 2003; Schaad et al., 2003) will
Australia. Journal of General Virology 69: 1617-1625.
ultimately drive the costs down to where disease surveillance and routine monitoring becomes cost-effective (Service, 2006), even in low priority areas like honey bee pathology.
http://dx.doi.org/10.1099/0022-1317-69-7-1617 ANDERSON, D L; GIBBS, A J (1989) Transpupal transmission of Kashmir bee virus and sacbrood virus in the honey bee (Apis
mellifera). Annals of Applied Biology 114(1): 1-7. http://dx.doi.org/10.1111/j.1744-7348.1989.tb06781.x
14. Acknowledgements
ANTÚNEZ, K; D’ALESSANDRO, B; CORBELLA, E; RAMALLO, G; ZUNINO, P (2006) Honey bee viruses in Uruguay. Journal of
The COLOSS (Prevention of honey bee COlony LOSSes) network aims
Invertebrate Pathology 91(1): 67-70.
to explain and prevent massive honey bee colony losses. It was
http://dx.doi.org/10.1016/j.jip.2006.05.009
funded through the COST Action FA0803. COST (European Cooperation ANTÚNEZ, K; D’ALESSANDRO, B; CORBELLA, E; ZUNINO, P (2005) in Science and Technology) is a unique means for European researchers
Detection of chronic bee paralysis virus and acute bee paralysis
to jointly develop their own ideas and new initiatives across all
virus in Uruguayan honey bees. Journal of Invertebrate Pathology
scientific disciplines through trans-European networking of nationally
90(1): 69-72.
funded research activities. Based on a pan-European intergovernmental
http://dx.doi.org/10.1016/j.jip.2005.07.001
framework for cooperation in science and technology, COST has
APFALTER, P; ASSADIAN, O; BLASI, F; BOMAN, J; GAYDOS, C A;
contributed since its creation more than 40 years ago to closing the
KUNDI, M; MAKRISTATHIS, A; NEHR, M; ROTTER, M L;
gap between science, policy makers and society throughout Europe
HIRSCHL, A M (2002) Reliability of nested PCR for detection of
and beyond. COST is supported by the EU Seventh Framework
Chlamydia pneumoniae DNA in atheromas: results from a
Programme for research, technological development and demonstration
multicenter study applying standardized protocols. Journal of
activities (Official Journal L 412, 30 December 2006). The European
Clinical Microbiology 40(12): 4428-4434.
Science Foundation as implementing agent of COST provides the
http://dx.doi.org/10.1128/JCM.40.12.4428-4434.2002
COST Office through an EC Grant Agreement. The Council of the European Union provides the COST Secretariat. The COLOSS network is now supported by the Ricola Foundation - Nature & Culture.
ARENS, M (1999) Methods for subtyping and molecular comparison of human viral genomes. Clinical Microbioly Reviews 12(4): 612–626. ARTHOFER, W; STEINER, F M; SCHLICK-STEINER, B C (2011) Rapid and cost-effective screening of newly identified microsatellite loci by high-resolution melting analysis. Molecular Genetics and
15. References AHMADIAN, A; LUNDEBERG, J (2002) A brief history of genetic variation analysis. BioTechniques 32: 1122-1124; 1126; 1128 passim. ALLEN, M F; BALL, B V (1995) Characterisation and serological relationships of strains of Kashmir bee virus. Annals of Applied
Genomics 286(3-4): 225-235. http://dx.doi.org/10.1007/s00438-011-0641-0 BAILEY, L (1965) Paralysis of the honey bee, Apis mellifera Linnaeus.
Journal of Invertebrate Pathology 7(2): 132-140. http://dx.doi.org/10.1016/0022-2011(65)90024-8 BAILEY, L (1967) Acute bee-paralysis virus in adult honey bees
Biology 126(3): 471-484.
injected with sacbrood virus. Virology 33(2): 368.
http://dx.doi.org/10.1111/j.1744-7348.1995.tb05382.x
http://dx.doi.org/10.1016/0042-6822(67)90161-4
The COLOSS BEEBOOK: virus methods
BAILEY, L (1968) The multiplication of sacbrood virus in the adult
45
BAKONYI, T; FARKAS, R; SZENDROI, A; DOBOS-KOVACS, M; RUSVAI, M
honey bee. Virology 36(2): 312-313.
(2002a) Detection of acute bee paralysis virus by RT-PCR in
http://dx.doi.org/10.1016/0042-6822(68)90151-7
honey bee and Varroa destructor field samples: rapid screening of
BAILEY, L (1976) Viruses attacking the honey bee. Advances in Virus
Research 20: 271-304. http://dx.doi.org/10.1016/S0065-3527 BAILEY, L; BALL, B V (1978) Apis iridescent virus and "Clustering
representative Hungarian apiaries. Apidologie 33(1): 63-74. http://dx.doi.org/10.1051/apido:2001004 BAKONYI, T; GRABENSTEINER, E; KOLODZIEJEK, J; RUSVAI, M; TOPOLSKA, G; RITTER, W; NOWOTNY, N (2002b) Phylogenetic
disease" of Apis cerana. Journal of Invertebrate Pathology 31(3):
analysis of acute bee paralysis virus strains. Applied and
368-371. http://dx.doi.org/10.1016/0022-2011(78)90231-8
Environmental Microbiology 68(12): 6446-6450.
BAILEY, L; BALL, B V (1991) Honey bee pathology (2nd Ed.). Academic Press; London, UK. 193 pp. BAILEY, L; BALL, B V; CARPENTER, J M (1980) Small virus like particles in honey bees associated with chronic paralysis virus and
http://dx.doi.org/10.1128/AEM.68.12.6446-6450.2002 BALL, B V (1985) Acute paralysis virus isolates from honey bee colonies infested with Varroa jacobsoni. Journal of Apicultural
Research 24(2): 115-119.
with a previously undescribed disease. Journal of General Virology BALL, B V (1989) Varroa jacobsoni as a virus vector. In Cavalloro, R 46: 149-155. http://dx.doi.org/10.1099/0022-1317-46-1-149 BAILEY, L; BALL, B V; PERRY, J N (1981) The prevalence of viruses of honey bees in Britain. Annals of Applied Biology 97: 109-118. http://dx.doi.org/10.1111/j.1744-7348.1981.tb02999.x BAILEY, L; BALL, B V; PERRY, J N (1983a) Association of viruses with two protozoal pathogens of the honey bee. Annals of Applied
Biology 103: 13-20. http://dx.doi.org/10.1111/j.1744-7348.1983.tb02735.x BAILEY, L; BALL, B V; PERRY, J N (1983b) Honey bee paralysis: Its natural spread and its diminished incidence in England and Wales.
Journal of Apicultural Research 22(3): 191-195. BAILEY, L; BALL, B V; WOODS, R D (1976) An iridovirus from bees.
(Ed.). Present status of varroatosis in Europe and progress in the Varroa mite control. EEC; Luxemburg. pp. 241-244. BALL, B V; ALLEN, M F (1988) The prevalence of pathogens in honey bee colonies infested with the parasitic mite Varroa jacobsoni.
Annals of Applied Biology 113: 237-244. http://dx.doi.org/10.1111/j.1744-7348.1988.tb03300.x BALL, B V; OVERTON, H A; BUCK, K W (1985) Relationship between the multiplication of chronic bee paralysis virus and its associate particle. Journal of General Virology 66(7): 1423-1429. http://dx.doi.org/10.1099/0022-1317-66-7-1423 BECKER, S; FRANCO, J R; SIMARRO, P P; STICH, A; ABEL, P M; STEVERDING, D (2004) Real-time PCR for detection of
Journal of General Virology 31(3): 459-461.
Trypanosoma brucei in human blood samples. Diagnostic
http://dx.doi.org/10.1099/0022-1317-31-3-459
Microbiology and Infectious Disease 50(3): 193-199.
BAILEY, L; CARPENTER, J M; WOODS, R D (1979) Egypt bee virus and Australian isolates of Kashmir bee virus. Journal of General Virology 43(3): 641-647. http://dx.doi.org/10.1099/0022-1317-43-3-641 BAILEY, L; FERNANDO, E F W (1972) Effects of sacbrood virus on adult honey bees. Annals of Applied Biology 72: 27-35. http://dx.doi.org/10.1111/j.1744-7348.1972.tb01268.x BAILEY, L; GIBBS, A J (1964) Acute infection of bees with paralysis virus. Journal of Insect Pathology 6(4): 395–407. BAILEY, L; GIBBS, A J; WOODS, R D (1963) Two viruses from adult honey bees (Apis mellifera Linnaeus). Virology 21: 390-395. http://dx.doi.org/10.1016/0042-6822(63)90200-9 BAILEY, L; MILNE, R G (1969) The multiplication regions and
http://dx.doi.org/10.1016/j.diagmicrobio.2004.07.001 BELÁK, S; THORÉN, P; LEBLANC, N; VILJOEN, G (2009) Advances in viral disease diagnostic and molecular epidemiological technologies. Expert Reviews in Molecular Diagnostics 9(4): 367381. http://dx.doi.org/10.1586/ERM.09.19 BENJEDDOU, M; LEAT, N; ALLSOPP, M; DAVISON, S (2001) Detection of acute bee paralysis virus and black queen cell virus from honey bees by reverse transcriptase PCR. Applied and Environmental
Microbiology 67(5): 2384-2387. http://dx.doi.org/10.1128/AEM.67.5.2384-2387.2001 BENJEDDOU, M; LEAT, N; ALLSOPP, M; DAVISON, S (2002) Development of infectious transcripts and genome manipulation of
interaction of acute and chronic bee-paralysis viruses in adult
Black queen-cell virus of honey bees. Journal of General Virology
honey bees. Journal of General Virology 4(1): 9-14.
83(12): 3139-3146.
http://dx.doi.org/10.1099/0022-1317-4-1-9 BAILEY, L; WOODS, R D (1974) Three previously undescribed viruses
BERENYI, O; BAKONYI, T; DERAKHSHIFAR, I; KOGLBERGER, H; NOWOTNY, N (2006) Occurrence of six honey bee viruses in
from the honey bee. Journal of General Virology 25: 175-186.
diseased Austrian apiaries. Applied and Environmental
http://dx.doi.org/10.1099/0022-1317-25-2-175
Microbiology 72: 2414-2420.
BAILEY, L; WOODS, R D (1977) Two more small RNA viruses from honey bees and further observations on sacbrood and acute bee-
http://dx.doi.org/10.1128/AEM.72.4.2414-2420.2006 BERGEM, M; NORBERG, K; AAMODT, R M (2006) Long-term
paralysis viruses. Journal of General Virology 37: 175-182.
maintenance of in vitro cultured honey bee (Apis mellifera)
http://dx.doi.org/10.1099/0022-1317-37-1-175
embryonic cells. BMC Developmental Biology 6(17). http://dx.doi.org/10.1186/1471-213X-6-17
de Miranda et al.
46
BICKLE, P J; DOKSUM, K A (1981) An analysis of transformations
BRUNETTO, M R; COLOMBATTO, P; BONINO, F (2009) Bio-
revisited. Journal of the American Statistical Association 76(374):
mathematical models ofviral dynamics to tailor antiviral therapy in
296-311. http://dx.doi.org/10.1080/01621459.1981.10477649
chronic viral hepatitis. World Journal of Gastroenterology 15(5):
BIRCH, L; ENGLISH, C A; BURNS, M; KEER, J T (2004) Generic scheme for independent performance assessment in the
531-537. http://dx.doi.org/10.3748/wjg.15.531 BUSTIN, S A (2000) Absolute quantification of mRNA using real-time
molecular biology laboratory. Clinical Chemistry 50(9): 1553-1559.
reverse transcription polymerase chain reaction assays. Journal of
http://dx.doi.org/10.1373/clinchem.2003.029454
Molecular Endocrinology 25(2): 169-193.
BLANCHARD, P; SCHURR, F; OLIVIER, V; CELLE, O; ANTÚNEZ, K; BAKONYI, T; BERTHOUD, H; HAUBRUGE, E; HIGES, M;
http://dx.doi.org/10.1677/jme.0.0250169 BUSTIN, S A; BEAULIEU, J F; HUGGETT, J; JAGGI, J; KIBENGE, R;
KASPRZAK, S; KOEGLBERGER, H; KRYGER, P; THIÉRY, R;
FSBOLSVIK, P A; PENNING, L C; TOEGEL, S (2010) MIQE précis:
RIBIÈRE, M (2009) Phylogenetic analysis of the RNA-dependent
Practical implementation of minimum standard guidelines for
RNA polymerase (RdRp) and a predicted structural protein (pSP)
fluorescence-based quantitative real-time PCR experiments. BMC
of the Chronic bee paralysis virus (CBPV) isolated from various
Molecular Biology 11:e74.
geographic regions. Virus Research 144(2): 334-338. http://dx.doi.org/10.1016/j.virusres.2009.04.025 BLANCHARD, P; OLIVIER, V; ISCACHE, A L; CELLE O; SCHURR, F;
http://dx.doi.org/10.1186/1471-2199-11-74 BUSTIN, S A; BENES, V; GARSON, J A; HELLEMANS, J; HUGGETT, J; KUBISTA, M; MUELLER, R; NOLAN, T; PFAFFL, M W; SHIPLEY, G
LALLEMAND, P; RIBIÈRE, M (2008) Improvement of RT-PCR
L; VANDESOMPELE, J; WITTWER, C T (2009) The MIQE
detection of chronic bee paralysis virus (CBPV) required by the
Guidelines: Minimum information for publication of quantitative
description of genomic variability in French CBPV isolates. Journal
Real-Time PCR experiments. Clinical Chemistry 55(4): 611-622.
of Invertebrate Pathology 97(2): 182-185.
http://dx.doi.org/10.1373/clinchem.2008.112797
http://dx.doi.org/10.1016/j.jip.2007.07.003 BLANCHARD, P; REGNAULT, J; SCHURR, F; DUBOIS, E; RIBIÈRE, M (2012) Intra-laboratory validation of chronic bee paralysis virus
BUSTIN, S A; NOLAN, T (2004) Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. Journal of
Bimolecular Techniques 15(3): 155- 166.
quantitation using an accredited standardised real-time quantitative CARRECK, N L; BALL, B V; MARTIN, S J (2010) The epidemiology of RT-PCR method. Journal of Virological Methods 180(1-2): 26-31.
cloudy wing virus infections in honey bee colonies in the UK.
http://dx.doi.org/10.1016/j.jviromet.2011.12.005
Journal of Apicultural Research 49(1): 66-71.
BLANCHARD, P; RIBIÈRE, M; CELLE, O; LALLEMAND, P; SCHURR, F; OLIVIER, V; ISCACHE, A L; FAUCON, J P (2007) Evaluation of a
http://dx.doi.org/10.3896/IBRA.1.49.1.09 CARRIÈRE, M; PÈNE, V; BREIMAN, A; CONTI, F; CHOUZENOUX, S;
real-time two step RT-PCR assay for quantitation of Chronic bee
MEURS, E; ANDRIEU, M; JAFFRAY, P; GRIRA, L; SOUBRANE, O;
paralysis virus (CBPV) genome in experimentally-infected bee
SOGNI, P; CALMUS, Y; CHAUSSADE, S; ROSENBERG, A R;
tissues and in life stages of a symptomatic colony. Journal of
PODEVIN, P (2007) A novel, sensitive, and specific RT-PCR
Virological Methods 141: 7-13.
technique for quantitation of hepatitis C virus replication. Journal
http://dx.doi.org/10.1016/j.jviromet.2006.11.021
of Medical Virology 79:155–160. http://dx.doi.org/10.1002/jmv.20773
BONCRISTIANI, H F; DI PRISCO, G; PETTIS, J S; HAMILTON, M;
CASADEVALL, A; PIROFSKI, L-A (1999) Host-pathogen interactions:
CHEN, Y P (2009) Molecular approaches to the analysis of
Redefining the basic concepts of pathogenicity and virulence.
deformed wing virus replication and pathogenesis in the honey
Infection and Immunity 67(8): 3703-3713.
bee, Apis mellifera. Virology Journal 6: 1-9. http://dx.doi.org/10.1186/1743-422X-6-221 BOWEN-WALKER, P L; MARTIN, S J; GUNN, A (1999) The transmission of deformed wing virus between honey bees (Apis
CASADEVALL, A; PIROFSKI, L-A (2001) Host-pathogen interactions: Attributes of virulence. Journal of Infectious Diseases 184(3): 337 -344. http://dx.doi.org/10.1086/322044 CELLE, O; BLANCHARD, P; SCHURR, F; OLIVIER, V; COUGOULE, N;
mellifera L.) by the ectoparasitic mite Varroa jacobsoni Oud.
FAUCON, J P; RIBIÈRE, M (2008) Detection of chronic bee
Journal of Invertebrate Pathology 73: 101-106.
paralysis virus (CBPV) genome and RNA replication in various
http://dx.doi.org/10.1006/jipa.1998.4807
hosts: possible ways of spread. Virus Research 133: 280-284.
BOYER, J C; HAENNI, A L (1994) Infectious transcripts and cDNA clones of RNA viruses. Virology 198(2): 415-426. http://dx.doi.org/10.1006/viro.1994.1053 BOX, G E P; COX, D R (1964) An analysis of transformations. Journal
http://dx.doi.org/10.1016/j.virusres.2007.12.011 CHANTAWANNAKUL, P; WARD, L; BOONHAM, N; BROWN, M (2006) A scientific note on the detection of honey bee viruses using realtime PCR (TaqMan) in varroa mites collected from a Thai honey
of the Royal Statistical Society B 26(2): 211-252.
bee (Apis mellifera) apiary. Journal of Invertebrate Pathology 91
http://dx.doi.org/http://www.jstor.org/stable/2984418
(1): 69-73. http://dx.doi.org/10.1016/j.jip.2005.11.001
The COLOSS BEEBOOK: virus methods
CHEN, Y P; EVANS, J D; FELDLAUFER, M F (2006a) Horizontal and
47
COBEY, S W; TARPY, D R ; WOYKE, J (2013) Standard methods for
vertical transmission of viruses in the honey bee (Apis mellifera).
instrumental insemination of Apis mellifera queens. In V
Journal of Invertebrate Pathology 92: 152-159.
Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
CHEN, Y P; EVANS, J; HAMILTON, M; FELDLAUFER, M (2007) The influence of RNA integrity on the detection of honey bee viruses: molecular assessment of different sample storage methods.
Journal of Apicultural Research 46(2): 81-87. http://dx.doi.org/10.3896/IBRA.1.46.2.03 CHEN, Y P; HIGGINS, J A; FELDLAUFER, M F (2005a) Quantitative real
Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4. CORNMAN, S R; SCHATZ, M C; JOHNSTON, S J; CHEN, Y P; PETTIS, J; HUNT, G; BOURGEOIS, L; ELSIK, C; ANDERSON, D; GROZINGER, C M; EVANS, J D (2010) Genomic survey of the ectoparasitic mite
-time reverse transcription-PCR analysis of deformed wing virus
Varroa destructor, a major pest of the honey bee Apis mellifera.
infection in the honey bee (Apis mellifera L.). Applied and
BMC Genomics 11: 602.
Environmental Microbiology 71(1): 436-441.
http://dx.doi.org/10.1186/1471-2164-11-602
http://dx.doi.org/10.1128/AEM.71.1.436-441.2005 CHEN, Y P; PETTIS, J S; COLLINS, A; FELDLAUFER, M F (2006b) Prevalence and transmission of honey bee viruses. Applied and
Environmental Microbiology 72: 606-611. CHEN, Y P; PETTIS, J S; EVANS, J D; KRAMER, M; FELDLAUFER, M F (2004a) Transmission of Kashmir bee virus by the ectoparasitic mite, Varroa destructor. Apidologie 35: 441-448. http://dx.doi.org/10.1051/apido:2004031 CHEN, Y P; PETTIS, J S; FELDLAUFER, M F (2005b) Detection of
CORONA, M; HUGHES, K A; WEAVER, D B; ROBINSON, G E (2005) Gene expression patterns associated with queen honey bee longevity. Mechanisms of Ageing and Development 126(11): 1230 -1238. http://dx.doi.org/10.1016/j.mad.2005.07.004 COX, J L; HEYSE, J F; TUKEY, J W (2000) Efficacy estimates from parasite count data that include zero counts. Experimental
Parasitology 96: 1-8. http://dx.doi.org/10.1006/expr.2000.4550 COX-FOSTER, D L; CONLAN, S; HOLMES, E; PALACIOS, G; EVANS, J D; MORAN, N A; QUAN, P L; BRIESE, T; HORNIG, M; GEISER, D M;
multiple viruses in queens of the honey bee Apis mellifera L.
MARTINSON, V; VANENGELSDORP, D; KALKSTEIN, A L;
Journal of Invertebrate Pathology 90(2): 118-121.
DRYSDALE, A; HUI, J; SHAI, J; CUI, L; HUTCHISON, S K;
http://dx.doi.org/10.1016/j.jip.2005.08.005
SIMONS, J F; EGHOLM, M; PETTIS, J S; LIPKIN, W I (2007) A
CHEN, Y P; SMITH, I B; COLLINS, A M; PETTIS, J S; FELDLAUFER, M F (2004b) Detection of deformed wing virus infection in honey bees, Apis mellifera L., in the United States. American Bee Journal 144: 557-559. CHEN, Y P; ZHAO, Y; HAMMOND, J; HSU, H T; EVANS, J;
metagenomic survey of microbes in honey bee colony collapse disorder. Science 318: 283-287. http://dx.doi.org/10.1126/science.1146498 CRAGGS, J K; BALL, J K; THOMSON, B J; IRVING, W L; GRABOWSKA, A M (2001) Development of a strand-specific RT-PCR based assay
FELDLAUFER, M (2004c) Multiple virus infections in the honey bee
to detect the replicative form of hepatitis C virus RNA. Journal of
and genome divergence of honey bee viruses. Journal of
Virological Methods 94(1-2): 111-120.
Invertebrate Pathology 87(2-3): 84-93. http://dx.doi.org/10.1016/j.jip.2004.07.005 CHERNESKY, M; JANG, D; CHONG, S; SELLORS, J; MAHONY, J (2003)
http://dx.doi.org/10.1016/S0166-0934(01)00281-6 CRAILSHEIM, K; BRODSCHNEIDER, R; AUPINEL, P; BEHRENS, D; GENERSCH, E; VOLLMANN, J; RIESSBERGER-GALLÉ, U (2013)
Impact of urine collection order on the ability of assays to identify
Standard methods for artificial rearing of Apis mellifera larvae. In
Chlamydia trachomatis infections in men. Sexually Transmitted
V Dietemann; J D Ellis; P Neumann (Eds) The COLOSS BEEBOOK,
Diseases 30(4): 345-347.
Volume I: standard methods for Apis mellifera research. Journal
http://dx.doi.org/10.1097/00007435-200304000-00014
of Apicultural Research 52(1):
CHUI, L; DREBOT, M; ANDONOV, A; PETRICH, A; GLUSHEK, M; MAHONY, J (2005) Comparison of 9 different PCR primers for the
http://dx.doi.org/10.3896/IBRA.1.52.1.05 DAINAT, B; EVANS, J D; CHEN, Y P; NEUMANN, P (2011) Sampling
rapid detection of severe acute respiratory syndrome coronavirus
and RNA quality for diagnosis of honey bee viruses using
using 2 RNA extraction methods. Diagnostic Microbiology and
quantitative PCR. Journal of Virological Methods 174(1-2): 150-
Infectious Diseases 53(1): 47-55. http://dx.doi.org/10.1016/j.diagmicrobio.2005.03.007 CLARK, T B (1978) A filamentous virus of the honey bee. Journal of
152. http://dx.doi.org/10.1016/j.jviromet.2011.03.029 DAINAT, B; KEN, T; BERTHOUD, H; NEUMANN, P (2009) The ectoparasitic mite Tropilaelaps mercedesae (Acari, Laelapidae) as
Invertebrate Pathology 32: 332-340.
a vector of honey bee viruses. Insectes Sociaux. 56: 40-43.
http://dx.doi.org/10.1016/0022-2011(78)90197-0
http://dx.doi.org/10.1007/s00040-008-1030-5
de Miranda et al.
48
DALL, D J (1987) Multiplication of Kashmir bee virus in pupae of the
EVANS, J D (2004) Transcriptional immune responses by honey bee
honey bee, Apis mellifera. Journal of Invertebrate Pathology 49
larvae during invasion by the bacterial pathogen, Paenibacillus
(3): 279-290. http://dx.doi.org/10.1016/0022-2011(87)90060-7
larvae. Journal of Invertebrate Pathology 85(2): 105-111.
DE MIRANDA, J R (2008) Diagnostic techniques for virus detection in honey bees. In Aubert, M F A; Ball, B V; Fries, I; Moritz, R F A;
http://dx.doi.org/10.1016/j.jip.2004.02.004 EVANS, J D (2006) Beepath: An ordered quantitative-PCR array for
Milani, N; Bernardinelli, I (Eds). Virology and the honey bee. EEC
exploring honey bee immunity and disease. Journal of
Publications; Brussels, Belgium. pp. 121-232.
Invertebrate Pathology 93(2): 135-139.
DE MIRANDA, J R; CORDONI, G; BUDGE, G (2010a) The acute bee paralysis virus – Kashmir bee virus – Israeli acute paralysis virus
http://dx.doi.org/10.1016/j.jip.2006.04.004 EVANS, J D; SCHWARZ, R S; CHEN, Y P; BUDGE, G; CORNMAN, R S;
complex. Journal of Invertebrate Pathology 103: S30-S47.
DE LA RUA, P; DE MIRANDA, J R; FORET, S; FOSTER, L;
http://dx.doi.org/10.1016/j.jip.2009.06.014
GAUTHIER, L; GENERSCH, E; GISDER, S; JAROSCH, A;
DE MIRANDA, J R; CHEN, Y; RIBIÈRE, M; GAUTHIER, L (2011) Varroa
KUCHARSKI, R; LOPEZ, D; LUN, C M; MORITZ, R F A; MALESZKA, R;
and viruses. In Carreck, N L (Ed.). Varroa – still a problem in the
MUÑOZ, I; PINTO, M A (2013) Standard methodologies for
21st century. International Bee Research Association; Cardiff, UK.
molecular research in Apis mellifera. In V Dietemann; J D Ellis;
pp 11-31.
P Neumann (Eds) The COLOSS BEEBOOK, Volume I: standard
DE MIRANDA, J R; DAINAT, B; LOCKE, B; CORDONI, G; BERTHOUD, H;
methods for Apis mellifera research. Journal of Apicultural
GAUTHIER, L; NEUMANN, P; BUDGE, G E; BALL, B V; STOLTZ, D B
Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.11
(2010b) Genetic characterisation of slow paralysis virus of the
EVANS, J D; HUNG, A C F (2000) Molecular phylogenetics and
honey bee (Apis mellifera L.). Journal of General Virology 91:
classification of honey bee viruses. Archives of Virology 145(10):
2524-2530. http://dx.doi.org/10.1099/vir.0.022434-0
2015-2026. http://dx.doi.org/10.1007/s007050070037
DE MIRANDA, J R; DREBOT, M; TYLER, S; SHEN, M; CAMERON, C E;
EVISON, S E F; ROBERTS, K E; LAURENSON, L; PIETRAVALLE, S;
STOLTZ, D B; CAMAZINE, S M (2004) Complete nucleotide
HUI, J; BIESMEIJER, J C; SMITH, J E; BUDGE, G E; HUGHES, W O H
sequence of Kashmir bee virus and comparison with acute bee
(2012) Pervasiveness of parasites in pollinators. PLoS ONE 7(1):
paralysis virus. Journal of General Virology 85: 2263-2270. http://dx.doi.org/10.1099/vir.0.79990-0 DE MIRANDA, J R; FRIES, I (2008) Venereal and vertical transmission
e30641. http://dx.doi.org/10.1371/journal.pone.0030641 EYER, M; CHEN, Y P; SCHAFER, M O; PETTIS, J S; NEUMANN, P (2009) Honey bee sacbrood virus infects adult small hive beetles,
of deformed wing virus in honey bees (Apis mellifera L.). Journal
Aethina tumida (Coleoptera: Nitidulidae). Journal of Apicultural
of Invertebrate Pathology 98: 184-189.
Research 48(4): 296-297. http://dx.doi.org/10.3896/IBRA.1.48.4.11
http://dx.doi.org/10.1016/j.jip.2008.02.004 DE MIRANDA, J R; GENERSCH, E (2010) Deformed wing virus. Journal
FIEVET, J; TENTCHEVA, D; GAUTHIER, L; DE MIRANDA, J R; COUSSERANS, F; COLIN, M E; BERGOIN, M (2006) Localization of
of Invertebrate Pathology 103: S48-S61.
deformed wing virus infection in queen and drone Apis mellifera L.
http://dx.doi.org/10.1016/j.jip.2009.06.012
Virology Journal 3: e16.
DENHOLM, C H (1999) Inducible honey bee viruses associated with
Varroa jacobsoni. PhD thesis, Keele University; UK. 225 pp. DE SMET, L; RAVOET, J; DE MIRANDA J R; WENSELEERS, T; MORITZ R F A; DE GRAAF D C (2012) BeeDoctor, A versatile MLPA-based diagnostic tool for screening bee viruses. PLoS-ONE 7(10): e47953. http://dx.doi.org/10.1371/journal.pone.0047953 DIPRISCO, G; PENNACHCHIO, F; CAPRIO, E; BONCRISTIANI, H F;
http://dx.doi.org/10.1186/1743-422X-3-16 FIORINI, G S; CHIU, D T (2005) Disposable microfluidic devices: fabrication, function, and application. Biotechniques 38(3): 429446. http://dx.doi.org/10.2144/05383RV02 FORSGREN, E; DE MIRANDA, J R; ISAKSSON, M; WIE, S; FRIES, I (2009) Deformed wing virus associated with Tropilaelaps
mercedesae infesting European honey bees (Apis mellifera).
EVANS, J D; CHEN, Y P (2011) Varroa destructor is an effective
Experimental and Applied Acarology 47: 87-97.
vector of Israeli acute paralysis virus in the honey bee,
http://dx.doi.org/10.1007/s10493-008-9204-4
Apis mellifera. Journal of General Virology 92: 151-155. http://dx.doi.org/10.1099/vir.0.023853-0 EBERT, D; BULL, J J (2003) Challenging the trade-off model for the evolution of virulence: is virulence management feasible? Trends
in Microbiology 11: 15-20. http://dx.doi.org/10.1016/S0966-842X EVANS, J D (2001) Genetic evidence for co-infection of honey bees by
FRIES, I; CAMAZINE, S (2001) Implications of horizontal and vertical pathogen transmission for honey bee epidemiology. Apidologie 32 (3): 199–214. FUJIYUKI, T; MATSUZAKA, E; NAKAOKA, T; TAKEUCHI, H; WAKAMOTO, A; OHKA, S; SEKIMIZU, K; NOMOTO, A; KUBO, T (2009) Distribution of Kakugo virus and its effects on the gene
acute bee paralysis and Kashmir bee viruses. Journal of
expression profile in the brain of the worker honey bee
Invertebrate Pathology 78(4): 189-193.
Apis mellifera L. Journal of Virology 83: 11560-11568.
http://dx.doi.org/10.1006/jipa.2001.5066
http://dx.doi.org/10.1128/JVI.00519-09
The COLOSS BEEBOOK: virus methods
49
FUJIYUKI, T; OHKA, S; TAKEUCHI, H; ONO, M; NOMOTO, A; KUBO, T GISDER, S; MOCKEL, N; LINDE, A; GENERSCH, E (2011) A cell culture (2006) Prevalence and phylogeny of Kakugo virus, a novel insect
model for Nosema ceranae and Nosema apis allows new insights
picorna-like virus that infects the honey bee (Apis mellifera L.),
into the life cycle of these important honey bee-pathogenic
under various colony conditions. Journal of Virology 80: 11528-
microsporidia. Environmental Microbiology 13(2): 404-413.
11538. http://dx.doi.org/10.1128/JVI.00754-06
http://dx.doi.org/10.1111/j.1462-2920.2010.02346.x
FUJIYUKI, T; TAKEUCHI, H; ONO, M; OHKA, S; SASAKI, T; NOMOTO, A; GLOVER, R H; ADAMS, I P; BUDGE, G; WILKINS, S; BOONHAM, N KUBO T (2004) Novel insect picorna-like virus identified in the
(2011) Detection of honey bee (Apis mellifera) viruses with an
brains of aggressive worker honey bees. Journal of Virology 78:
oligonucleotide microarray. Journal of Invertebrate Pathology 107
1093-1100. http://dx.doi.org/10.1128/JVI.78.3.1093-1100.2004 GANTZER, C; MAUL, A; AUDIC, J M; SCHWARTZBROD, L (1998)
(3): 216-219. http://dx.doi.org/10.1016/j.jip.2011.03.004 GRABENSTEINER, E; BAKONYI, T; RITTER, W; PECHHACKER, H;
Detection of infectious enteroviruses, enterovirus genomes,
NOWOTNY, N (2007) Development of a multiplex RT-PCR for the
somatic coliphages, and Bacteroides fragilis phages in treated
simultaneous detection of three viruses of the honey bee (Apis
wastewater. Applied and Environmental Microbiology 64(11):
mellifera L.): acute bee paralysis virus, black queen cell virus and
4307-4312.
sacbrood virus. Journal of Invertebrate Pathology 94(3): 222-225.
GARDNER, S N; KUCZMARSKI, T A; VITALIS, E A; SLEZAK, T R (2003)
http://dx.doi.org/10.1016/j.jip.2006.11.006
Limitations of TaqMan PCR for detecting divergent viral pathogens GRABENSTEINER, E; RITTER, W; CARTER, M J; DAVISON, S; illustrated by hepatitis A, B, C and E viruses and human
PECHHACKER, H; KOLODZIEJEK, J; BOECKING, O;
immunodeficiency virus. Journal of Clinical Microbiology 41(6):
DERAKHSHIFAR, I; MOOSBECKHOFER, R; LICEK, E; NOWOTNY, N
2417-2427.
(2001) Sacbrood virus of the honey bee (Apis mellifera): rapid
http://dx.doi.org/10.1128/JCM.41.6.2417-2427.2003
identification and phylogenetic analysis using reverse transcription
GAUTHIER, L; RAVALLEC, M; TOURNAIRE, M; COUSSERANS, F; BERGOIN, M; DAINAT, B; DE MIRANDA, J R (2011) Viruses associated with ovarian degeneration in Apis mellifera L. queens.
-PCR. Clinical and Diagnostic Laboratory Immunology 8(1): 93104. http://dx.doi.org/10.1128/CDLI.8.1.93-104.2001 GREEN, M R; SAMBROOK, J (2012) Molecular cloning: a laboratory
PLoS Pathogens 6: e16217.
manual (4th Ed.). Cold Spring Harbor Laboratory Press; Cold
http://dx.doi.org/10.1371/journal.pone.0016217
Spring Harbor, USA. 2028 pp.
GAUTHIER, L; TENTCHEVA, D; TOURNAIRE, M; DAINAT, B;
GUNJI, T; KATO, N; HIJIKATA, M; HAYASHI, K; SAITOH, S;
COUSSERANS, F; COLIN, M E; BERGOIN, M (2007) Viral load
SHIMOTOHNO, K (1994) Specific detection of positive and
estimation in asymptomatic honey bee colonies using the
negative stranded hepatitis C viral RNA using chemical RNA
quantitative RT-PCR technique. Apidologie 38: 426-436.
modification. Archives of Virology 134(3-4): 293-302.
http://dx.doi.org/10.1051/apido:2007026 GENERSCH, E (2005) Development of a rapid and sensitive RT-PCR
http://dx.doi.org/10.1385/0-89603-521-2:465 HARLOW, E; LANE D (1988) Antibodies: A laboratory manual. Cold
method for the detection of deformed wing virus, a pathogen of
Spring Harbor Laboratory Press; Cold Spring Harbor, New York,
the honey bee (Apis mellifera). Veterinary Journal 169(1): 121-
USA. 726 pp.
123. http://dx.doi.org/10.1016/j.tvjl.2004.01.004 GENERSCH, E; GISDER, S; HEDTKE, K; HUNTER, W B; MÖCKEL, N;
HAUSER, S; WEBER, C; VETTER, G; STEVENS, M; BEUVE, M; LEMAIRE, O (2000) Improved detection and differentiation of
MÜLLER, U (2013) Standard methods for cell cultures in Apis
poleroviruses infecting beet or rape by multiplex RT-PCR. Journal
mellifera research. InV Dietemann; J D Ellis; P Neumann (Eds)
of Virological Methods 89(1-2): 11-21.
The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(1): http://dx.doi.org/10.3896/IBRA.1.52.1.02 GILDOW, F E; D’ARCY, C J (1990) Cytopathology and experimental
http://dx.doi.org/10.1016/S0166-0934(00)00203-2 HIGGINS, J A; NASARABADI, S; KARNS, J S; SHELTON, D R; COOPER, M; GBAKIMA, A; KOOPMAN, R P (2003) A handheld real time thermal cycler for bacterial pathogen detection. Biosensors and
host range of Rhopalosiphum padi virus, a small isometric RNA
Bioelectronics 18(9): 1115-1123. Erratum in: Biosensors and
virus infecting cereal grain aphids. Journal of Invertebrate
Bioelectronics 20, 663-664.
Pathology 55(2): 245-257.
http://dx.doi.org/10.1016/S0956-5663(02)00252-X
http://dx.doi.org/10.1016/0022-2011(90)90060-J GISDER, S; AUMEIER, P; GENERSCH, E (2009) Deformed wing virus
HIGHFIELD, A C; EL NAGAR, A; MACKINDER, L C M; NOËL, L M-L J; HALL, M J; MARTIN, S J; SCHROEDER, D C (2009) Deformed wing
(DWV): viral load and replication in mites (Varroa destructor).
virus implicated in overwintering honey bee colony losses. Applied
Journal of General Virology 90: 463-467.
and Environmental Microbiology 75(22): 7212-7220.
http://dx.doi.org/10.1099/vir.0.005579-0
http://dx.doi.org/10.1128/AEM.02227-09
de Miranda et al.
50
HORSINGTON, J; ZHANG, Z (2007) Analysis of foot-and-mouth
KURATH, G; HEICK, J A; DODDS, J A (1993) RNase protection analyses
disease virus replication using strand-specific quantitative RT-PCR.
show high genetic diversity among field isolates of satellite
Journal of Virological Methods 144(1-2): 149-155.
tobacco mosaic virus. Virology 194(1): 414-418.
http://dx.doi.org/10.1016/j.jviromet.2007.05.002
http://dx.doi.org/10.1006/viro.1993.1278
HUMAN, H; BRODSCHNEIDER, R; DIETEMANN, V; DIVELY, G; ELLIS, J; KUKIELKA, D; SÁNCHEZ-VIZCAÍNO, J M (2008) A sensitive one-step FORSGREN, E; FRIES, I; HATJINA, F; HU, F-L; JAFFÉ, R; KÖHLER, A;
real-time RT-PCR method for detection of deformed wing virus
PIRK, C W W; ROSE, R; STRAUSS, U; TANNER, G; TARPY, D R;
and black queen cell virus in honey bee Apis mellifera. Journal of
VAN DER STEEN, J J M; VEJSNÆS, F; WILLIAMS, G R; ZHENG, H-Q
Virological Methods 147: 275–281.
(2013) Miscellaneous standard methods for Apis mellifera research. In V Dietemann; J D Ellis; P Neumann (Eds) The
http://dx.doi.org/10.1016/j.jviromet.2007.09.008 KUKIELKA, D; SÁNCHEZ-VIZCAÍNO, J M (2009) One-step real-time
COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera
quantitative PCR assays for the detection and field study of
research. Journal of Apicultural Research 52(4):
sacbrood honey bee and acute bee paralysis viruses. Journal of
http://dx.doi.org/10.3896/IBRA.1.52.4.10
Virological Methods 161: 240–246.
HUNG, A C F (2000) PCR detection of Kashmir bee virus in honey bee excreta. Journal of Apicultural Research 39(3-4): 103-106. HUNG, A C F; SHIMANUKI, H (1999) A scientific note on the detection
http://dx.doi.org/10.1016/j.jviromet.2009.06.014 LANFORD, R E; CHAVEZ, D; CHISARI, F V; SUREAU, C (1995) Lack of detection of negative-strand hepatitis C virus RNA in peripheral
of Kashmir bee virus in individual honey bees and varroa mites.
blood mononuclear cells and other extrahepatic tissues by the
Apidologie 30(4): 353-354.
highly strand-specific rTth reverse transcriptase PCR. Journal of
http://dx.doi.org/10.1051/apido:19990414 HUNG, A C F; BALL, B V; ADAMS, J R; SHIMANUKI, H; KNOX, D A
Virology 69(12): 8079-8083. LANFORD, R E; SUREAU, C; JACOB, J R; WHITE, R; FUERST, T R
(1996a) A scientific note on the detection of American strains of
(1994) Demonstration of in vitro infection of chimpanzee
acute paralysis virus and Kashmir bee virus in dead bees in one
hepatocytes with hepatitis C virus using strand-specific RT/PCR.
US honey bee (Apis mellifera L.) colony. Apidologie 27: 55–56.
Virology 202(2): 606-614.
HUNG, A C F; SHIMANUKI, H; KNOX, D A (1996b) Inapparent infection of acute bee paralysis virus and Kashmir bee virus in US honey bees. American Bee Journal 136: 874–876.
http://dx.doi.org/10.1006/viro.1994.1381 LANZI, G; DE MIRANDA, J R; BONIOTTI, M B; CAMERON, CE; LAVAZZA, A; CAPUCCI, L; CAMAZINE, S M; ROSSI, C (2006)
HUNTER, W B (2010) Medium for development of bee cell cultures
Molecular and biological characterization of deformed wing virus
(Apis mellifera: Hymenoptera: Apidae). In Vitro Cellular &
of honey bees (Apis mellifera L.). Journal of Virology 80: 4998-
Developmental Biology-Animal 46(2): 83-86.
5009. http://dx.doi.org/10.1128/JVI.80.10.4998-5009.2006
http://dx.doi.org/10.1007/s11626-009-9246-x HUNTER, W; ELLIS, J; VANENGELSDORP, D; HAYES, J; WESTERVELT, D;
LASKUS, T; RADKOWSKI, M; WANG, L F; VARGAS, H; RAKELA, J (1998) Detection of hepatitis G virus replication sites by using
GLICK, E; WILLIAMS, M; SELA, I; MAORI, E; PETTIS, J;
highly strand-specific Tth-based reverse transcriptase PCR.
COX-FOSTER, D; PALDI, N (2010) Large-scale field application of
Journal of Virology 72(4): 3072-3075.
RNAi technology reducing Israeli acute paralysis virus disease in
LAUBSCHER, J M; VON WECHMAR, M B (1992) Influence of aphid
honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS
lethal paralysis virus and Rhopalosiphum padi virus on aphid
Pathogens 6: e1001160. http://dx.doi.org/10.1371journal.ppat.1001160
biology at different temperatures. Journal of Invertebrate
IQBAL, J; MÜLLER, U (2007) Virus infection causes specific learning deficits in honey bee foragers. Proceedings of the Royal Society
London B274: 1517-1521. http://dx.doi.org/10.1098/rspb.2007.0022 JAKAB, G; DROZ, E; BRIGNETI, G; BAULCOMBE, D; MALNOË, P (1997) Infectious in vivo and in vitro transcripts from a full-length cDNA clone of PVY-N605, a Swiss necrotic isolate of potato virus Y. Journal of General Virology 78(12): 3141-3145. KITAGISHI, Y; OKUMURA, N; YOSHIDA, H; NISHIMURA, Y; TAKAHASHI, J; MATSUDA, S (2011) Long-term cultivation of in
vitro Apis mellifera cells by gene transfer of human c-myc proto-
Pathology 60(2): 134-140. http://dx.doi.org/10.1016/0022-2011(92)90086-J LAUBSCHER, J M; VON WECHMAR, M B (1993) Assessment of aphid lethal paralysis virus as an apparent population growth-limiting factor in grain aphids in the presence of other natural enemies.
Biocontrol Science and Technology 3(4): 455-466. http://dx.doi.org/10.1080/09583159309355300 LEAT, N; BALL, B V; GOVAN, V; DAVISON, S (2000) Analysis of the complete genome sequence of black queen-cell virus, a picorna-like virus of honey bees. Journal of General Virology 81(8): 2111-2119. LEE, P E; FURGALA, B (1967) Viruslike particles in adult honey bees
oncogene. In Vitro Cellular and Developmental Biology-Animal 47
(Apis mellifera L.) following injection with sacbrood virus. Virology
(7): 451-453. http://dx.doi.org/10.1007/s11626-011-9431-6
32: 11-17. http://dx.doi.org/10.1016/0042-6822(67)90247-4
The COLOSS BEEBOOK: virus methods
51
LI, J L; PENG, W J; WU, J; STRANGE, J P; BONCRISTIANI, H F; CHEN, Y P McCLELLAND, E E; BERNHARDT, P; CASADEVALL, A (2006) Estimating (2011) Cross-species infection of deformed wing virus poses a
the relative contributions of virulence factors for pathogenic
new threat to pollinator conservation. Journal of Economic
microbes. Infection and Immunity 74(3): 1500-1504.
Entomology 104: 732–739. http://dx.doi.org/10.1603/EC10355
http://dx.doi.org/10.1128/IAI.74.3.1500–1504.2006
LIEPOLD, P; WIEDER, H; HILLEBRANDT, H; FRIEBEL, A; HARTWICH, G McGUINESS, P H; BISHOP, G A; MCCAUGHAN, G W; TROWBRIDGE, R; (2005) DNA-arrays with electrical detection: a label-free low cost
GOWANS, E J (1994) False detection of negative-strand hepatitis
technology for routine use in life sciences and diagnostics.
C virus RNA. Lancet 343: 551-552.
Bioelectrochemistry 67(2): 143-150.
http://dx.doi.org/10.1016/S0140-6736(94)91509-1
http://dx.doi.org/10.1016/j.bioelechem.2004.08.004 LIN, L; LIBBRECHT, L; VERBEECK, J; VERSLYPE, C; ROSKAMS, T;
MEEUS, I; SMAGGHE, G; SIEDE, R; JANS, K; DE GRAAF, D C (2010) Multiplex RT-PCR with broad-range primers and an exogenous
VAN PELT, J; VAN RANST, M; FEVERY, J (2009) Quantitation of
internal amplification control for the detection of honey bee
replication of the HCV genome in human livers with end-stage
viruses in bumble bees. Journal of Invertebrate Pathology 105:
cirrhosis by strand-specific real-time RT-PCR assays: methods and
200-2003. http://dx.doi.org/10.1016/j.jip.2010.06.012
clinical relevance. Journal of Medical Virology 81(9): 1569-1575. http://dx.doi.org/10.1002/jmv.21510 LOCKE, B; FORSGREN, E; FRIES, I; DE MIRANDA, J R (2012) Acaricide treatment affects viral dynamics in Varroa destructor-
MINOR, P D (1985) Growth, assay and purification of picornaviruses. In Mahy, B W (Ed.). Virology, a practical approach. IRL Press; Oxford, UK. pp. 25–41. MOON, J S; DOMIER, L L; MCCOPPIN, N K; D’ARCY, C J; JIN, H
infested honey bee colonies via both host physiology and mite
(1998) Nucleotide sequence analysis shows that Rhopalosiphum
control. Applied and Environmental Microbiology 78: 227-235.
padi virus is a member of a novel group of insect-infecting RNA
http://dx.doi.org/10.1128/AEM.06094-11
viruses. Virology 243(1): 54-65.
LOMMEL, S A; MORRIS, T J; PINNOCK, D E (1985) Characterization of
http://dx.doi.org/10.1006/viro.1998.9043
nucleic acids associated with Arkansas bee virus. Intervirology 23: MOORE, J; JIRONKIN, A; CHANDLER, D; BURROUGHS, N; EVANS, D J; 199-207. http://dx.doi.org/10.1159/000149606 MARMUR, J; DOTY, P (1959) Heterogeneity in deoxyribonucleic acids.
RYABOV, E V (2011) Recombinants between deformed wing virus and Varroa destructor virus-1 may prevail in Varroa destructor-
1. Dependence on composition of the configurational stability of
infested honey bee colonies. Journal of General Virology 92: 156-
deoxyribonucleic acids. Nature 183(4673): 1427-1429.
161 http://dx.doi.org/10.1099/vir.0.025965-0
http://dx.doi.org/10.1038/1831427a0 MARMUR, J; DOTY, P (1962) Determination of base composition of deoxyribonucleic acid from 1st thermal denaturation temperature.
NF EN ISO/IEC 17025 (2005) General requirements for the
competence of testing and calibration laboratories. 40 pp. OIE (2010) Manual of diagnostic tests and vaccines for terrestrial
Journal of Molecular Biology 5(1): 109-118.
animals In Chapter 1.1.1.4/ 5. Principles and methods of
http://dx.doi.org/10.1016/S0022-2836(62)80066-7
validation of diagnostic assay for infectious diseases. Adopted in
MAORI, E; LAVI, S; MOZES-KOCH, R; GANTMAN, Y; PERETZ, Y; EDELBAUM, O; TANNE, E; SELA, I (2007a) Isolation and
May 2009. OLIVIER, V; BLANCHARD, P; CHAOUCH, S; LALLEMAND, P; SCHURR, F;
characterization of Israeli acute paralysis virus, a dicistrovirus
CELLE, O; DUBOIS, E; TORDO, N; THIERY, R; HOULGATTE, R;
affecting honey bees in Israel: evidence for diversity due to intra-
RIBIÈRE, M (2008) Molecular characterization and phylogenetic
and inter-species recombination. Journal of General Virology 88:
analysis of chronic bee paralysis virus, a honey bee virus. Virus
3428-3438. http://dx.doi.org/10.1099/vir.0.83284-0
Research 132: 59–68.
MAORI, E; PALDI, N; SHAFIR, S; KALEV, H; TSUR, E; GLICK, E; SELA, I
http://dx.doi.org/10.1016/j.virusres.2007.10.014
(2009) IAPV, a bee-affecting virus associated with Colony Collapse ONGUS, J R (2006) Varroa destructor virus 1: A new picorna-like virus Disorder can be silenced by dsRNA ingestion. Insect Molecular
in varroa mites as well as honey bees. PhD thesis, Wageningen
Biology 18(1): 55-60.
University, Netherlands. 132 pp.
http://dx.doi.org/10.1111/j.1365-2583.2009.00847.x MAORI, E; TANNE, E; SELA, I (2007b) Reciprocal sequence exchange
ONGUS, J R; PEETERS, D; BONMATIN, J M; BENGSCH, E; VLAK, J M; VAN OERS, M M (2004) Complete sequence of a picorna-like virus
between non-retro viruses and hosts leading to the appearance of
of the genus Iflavirus replicating in the mite Varroa destructor.
new host phenotypes. Virology 362(2): 342-349.
Journal of General Virology 85: 3747-3755.
http://dx.doi.org/10.1016/j.virol.2006.11.038
http://dx.doi.org/10.1099/vir.0.80470-0
MARTIN, S J; HIGHFIELD, A C; BRETTELL, L; VILLALOBOS, E M;
ONGUS, J R; ROODE, E C; PLEIJ, C W A; VLAK, J M; VAN OERS, M M
BUDGE, G E; POWELL, M; NIKAIDO, S; SCHROEDER, D C (2012)
(2006) The 5 ' non-translated region of Varroa destructor virus 1
Global honey bee viral landscape altered by a parasitic mite.
(genus Iflavirus): structure prediction and RES activity in
Science 336: 1304-1306.
Lymantria dispar cells. Journal of General Virology 87: 3397-3407.
http://dx.doi.org/10.1126/science.1220941
http://dx.doi.org/10.1099/vir.0.82122-0
de Miranda et al.
52
ONODERA, K (2007) Selection for 3’-end triplets for polymerase chain reaction primers. In Yuryev, A (Ed.). PCR primer design. Methods
in Molecular Biology™ series #402. Humana Press; Totowa, New Jersey, USA. pp. 61-74. PALACIOS, G; HUI, J; QUAN, P L; KALKSTEIN, A; HONKAVUORI, K S;
RACANIELLO, V; BALTIMORE, D (1981) Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214 (4523): 916-919. http://dx.doi.org/10.1126/science.6272391 RADONIĆ, A; THULKE, S; MACKAY, I M; LANDT, O; SIEGERT, W; NITSCHE, A (2004) Guideline to reference gene selection for
BUSSETTI, A V; CONLAN, S; EVANS, J; CHEN, Y P;
quantitative real-time PCR. Biochemical and Biophysical Research
VAN ENGELSDORP, D; EFRAT, H; PETTIS, J; COX-FOSTER, D;
Communications 313(4): 856-862.
HOLMES, E C; BRIESE, T; LIPKIN, W I (2008) Genetic analysis of
http://dx.doi.org/10.1016/j.bbrc.2003.11.177
Israel acute paralysis virus: distinct clusters are circulating in the
RENSEN, G; SMITH, W; RUZANTE, J; SAWYER, M; OSBURN, B;
United States. Journal of Virology 82(13): 6209-6217.
CULLOR, J (2005) Development and evaluation of a real-time
http://dx.doi.org/10.1128/JVI.00251-08
fluorescent polymerase chain reaction assay for the detection of
PAPIN, J F; VAHRSON, W; DITTMER, D P (2004) SYBR green-based real-time quantitative PCR assay for detection of West Nile virus circumvents false-negative results due to strain variability. Journal
of Clinical Microbiology 42(4): 1511-1518. http://dx.doi.org/10.1128/JCM.42.4.1511-1518.2004 PENG, W J; LI, J L; BONCRISTIANI, H F; STRANGE, J P; HAMILTON, M; CHEN, Y P (2011) Host range expansion of honey bee black queen cell virus in the bumble bee, Bombus huntii. Apidologie 42: 650–658. http://dx.doi.org/10.1007/s13592-011-0061-5 PEYREFITTE, C N; PASTORINO, B; BESSAUD, M; TOLOU, H J;
bovine contaminates in cattle feed. Foodborne Pathogens and
Disease 2(2): 152-159. http://dx.doi.org/10.1089/fpd.2005.2.152 RHODES, E R; HAMILTON, D W; SEE, M J; WYMER, L (2011) Evaluation of hollow-fiber ultrafiltration primary concentration of pathogens and secondary concentration of viruses from water.
Journal of Virological Methods 176(1-2): 38-45. http://dx.doi.org/10.1016/j.jviromet.2011.05.031 RIBIÈRE, M; BALL, B V; AUBERT, M F A (2008) Natural history and geographic distribution of honey bee viruses. In Aubert, M F A;
COUISSINIER-PARIS, P (2003) Evidence for in vitro falsely-primed
Ball, B V; Fries, I; Morritz, R F A; Milani, N; Bernardinelli, I (Eds).
cDNAs that prevent specific detection of virus negative strand
Virology and the honey bee. EEC Publications; Brussels, Belgium.
RNAs in dengue-infected cells: improvement by tagged RT-PCR.
Journal of Virological Methods 113(1): 19-28. http://dx.doi.org/10.1016/S0166-0934(03)00218-0 PFAFFL, M W; HAGELEIT, M (2001) Validities of mRNA quantification using recombinant RNA and recombinant DNA external calibration curves in real-time RT-PCR. Biotechnology Letters 23(4): 275282. http://dx.doi.org/10.1023/A:1005658330108 PIRK, C W W; DE MIRANDA, J R; FRIES, I; KRAMER, M; PAXTON, R; MURRAY, T; NAZZI, F; SHUTLER, D; VAN DER STEEN, J J M;
pp. 15–84. RIBIÈRE, M; FAUCON, J P; PÉPIN, M (2000) Detection of chronic honey bee (Apis mellifera L.) paralysis virus infection: application to a field survey. Apidologie 31(5): 567-577. http://dx.doi.org/10.1051/apido:2000147 RIBIÈRE, M; OLIVIER, V; BLANCHARD, P (2010) Chronic bee paralysis virus. A disease and a virus like no other? Journal of Invertebrate
Pathology 103: S120-S131. http://dx.doi.org/10.1016/j.jip.2009.06.013 RIBIÈRE, M; TRIBOULOT, C; MATHIEU, L; AURIÈRES, C; FAUCON, J P;
VAN DOOREMALEN, C (2013) Statistical guidelines for Apis
PÉPIN, M (2002) Molecular diagnosis of chronic bee paralysis virus
mellifera research. In V Dietemann; J D Ellis; P Neumann (Eds)
infection. Apidologie 33(3): 339-351.
The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.13 PIROFSKI, L A; CASADEVALL, A (2012) Q & A: What is a pathogen? A question that begs the point. BMC Biology 10: e6. http://www.biomedcentral.com/1741-7007/10/6
http://dx.doi.org/10.1051/apido:2002020 RODRIGUEZ, M A; CHEN, Y; CRAIGO, J K; CHATTERJEE, R; RATNER, D; TATSUMI, M; ROY, P; NEOGI, D; GUPTA, P (2006) Construction and characterization of an infectious molecular clone of HIV-1 subtype A of Indian origin. Virology 345(2): 328-336. http://dx.doi.org/10.1016/j.virol.2005.09.053
PLASKON, N E; ADELMAN, Z N; MYLES, K M (2009) Accurate strand-
RORTAIS, A; TENTCHEVA, D; PAPACHRISTOFOROU, A; GAUTHIER, L;
specific quantification of viral RNA. PLoS ONE 4(10): e7468.
ARNOLD, G; COLIN, M E; BERGOIN, M (2006) Deformed wing
http://dx.doi.org/10.1371/journal.pone.0007468
virus is not related to honey bees' aggressiveness. Virology
PURCELL, M K; HART, S A; KURATH, G; WINTON, J R (2006) Strandspecific, real-time RT-PCR assays for quantification of genomic
Journal 3: e61. http://dx.doi.org/10.1186/1743-422X-3-61 RUNCKEL, C; FLENNIKEN, M L; ENGEL, J C; RUBY, J G; GANEM, D;
and positive-sense RNAs of the fish rhabdovirus, infectious
ANDINO, R; DERISI, J L (2011) Temporal analysis of the honey
hematopoietic necrosis virus. Journal of Virological
bee microbiome reveals four novel viruses and seasonal
Methods 132(1-2): 18-24.
prevalence of known viruses, nosema, and crithidia. PloS One 6
http://dx.doi.org/10.1016/j.jviromet.2005.08.017
(6): e20656. http://dx.doi.org/10.1371/journal.pone.0020656
The COLOSS BEEBOOK: virus methods
SAGE, L (2004) Protein biochips go high tech. Analytical Chemistry 76 (7): 137A-142A. http://dx.doi.org/10.1021/ac0415408 SANTALUCIA, J (2007) Physical principles and visual-OMP software for optimal PCR design. In Yuryev, A (Ed.). PCR primer design.
Methods in Molecular Biology™ series #402. Humana Press; Totowa, New Jersey, USA. pp. 3-33. SCHAAD, N W; FREDERICK, R D; SHAW, J; SCHNEIDER, W L; HICKSON, R; PETRILLO, M D; LUSTER, D G (2003) Advances in
53
STÅHLBERG, A; KUBISTA, M; PFAFFL, M (2004b) Comparison of reverse transcriptases in gene expression analysis. Clinical
Chemistry 50(9): 1678-1680. http://dx.doi.org/10.1373/clinchem.2004.035469 STOLTZ, D; SHEN, X R; BOGGIS, C; SISSON, G (1995) Molecular diagnosis of Kashmir bee virus infection. Journal of Apicultural
Research 34(3): 153-160. SUMPTER, D J T; MARTIN, S J (2004) The dynamics of virus
molecular-based diagnostics in meeting crop biosecurity and
epidemics in varroa-infested honey bee colonies. Journal of
phytosanitary issues. Annual Review of Phytopathology 41: 305-
Animal Ecology 73: 51-63.
324. http://dx.doi.org/10.1146/annurev.phyto.41.052002.095435 SHAH, K S; EVANS, E C; PIZZORNO, M C (2009) Localization of deformed wing virus (DWV) in the brains of the honey bee, Apis
mellifera Linnaeus. Virology Journal 6: e182. http://dx.doi.org/10.1.1186/1743-422X-6-182 SHEN, M Q; CUI, L W; OSTIGUY, N; COX-FOSTER, D (2005a) Intricate
http://dx.doi.org/10.1111/j.1365-2656.2004.00776.x TANIGUCHI, T; PALMIERI, M; WEISSMANN, C (1978) A Qbeta DNAcontaining hybrid plasmid giving rise to Qbeta phage formation in the bacterial host. Annales de Microbiologie 129B(4): 535-536. TENTCHEVA, D; GAUTHIER, L; BAGNY, L; FIEVET, J; DAINAT, B; COUSSERANS, F; COLIN, M E; BERGOIN, M (2006) Comparative
transmission routes and interactions between picorna-like viruses
analysis of deformed wing virus (DWV) RNA in Apis mellifera and
(Kashmir bee virus and sacbrood virus) with the honey bee host
Varroa destructor. Apidologie 37: 41-50.
and the parasitic varroa mite. Journal of General Virology 86(8): 2281-2289. http://dx.doi.org/10.1099/vir.0.80824-0 SHEN, M Q; YANG, X L; COX-FOSTER, D; CUI, L W (2005b) The role
http://dx.doi.org/10.1051/apido:2005057 TENTCHEVA, D; GAUTHIER, L; JOUVE, S; CANABADY-ROCHELLE, L; DAINAT, B; COUSSERANS, F; COLIN, M E; BALL, B V; BERGOIN, M
of varroa mites in infections of Kashmir bee virus (KBV) and
(2004a) Polymerase chain reaction detection of deformed wing
deformed wing virus (DWV) in honey bees. Virology 342:141-149.
virus (DWV) in Apis mellifera and Varroa destructor. Apidologie 35
http://dx.doi.org/10.1016/j.virol.2005.07.012
(4): 431-440.
SIEDE, R; BÜCHLER, R (2003) Symptomatische befall von drohnenbrut mit dem black queen cell virus auf hessischen
http://dx.doi.org/10.1051/apido:2004021 TENTCHEVA, D; GAUTHIER, L; ZAPPULLA, N; DAINAT, B;
bienenständen. Berliner und Münchener Tierärztliche
COUSSERANS, F; COLIN, M E; BERGOIN, M (2004b) Prevalence
Wochenschrift 116: 130-133.
and seasonal variations of six bee viruses in Apis mellifera L. and
SIEDE, R; BÜCHLER, R (2006) Spatial distribution patterns of acute
Varroa destructor mite populations in France. Applied and
bee paralysis virus, black queen cell virus and sacbrood virus in
Environmental Microbiology 70: 7185-7191.
Hesse, Germany. Wiener Tierärztliche Monatsschrift 93(4): 90-93.
http://dx.doi.org/10.1128/AEM.70.12.7185-7191.2004
SIEDE, R; DERAKHSHIFAR, I; OTTEN, C; BERÉNYI, O; BAKONYI, T;
TERIO, V; MARTELLA, V; CAMERO, M; DECARO, N; TESTINI, G;
KÖGLBERGER, H; BÜCHLER, R (2005) Prevalence of Kashmir bee
BONERBA, E; TANTILLO, G; BUONAVOGLIA, C (2008) Detection
virus in central Europe. Journal of Apicultural Research 44(3):
of a honey bee iflavirus with intermediate characteristics between
129. http://dx.doi.org/10.3896/IBRA.1.44.3.09 SINGH, R; LEVITT, A L; RAJOTTE, E G; HOLMES, E C; OSTIGUY, N;
kakugo virus and deformed wing virus. New Microbiologica 31: 439-444. TODD, J H; DE MIRANDA, J R; BALL, B V (2007) Incidence and
VANENGELSDORP, D; LIPKIN, W I; DEPAMPHILIS, C W; TOTH, A L;
molecular characterization of viruses found in dying New Zealand
COX-FOSTER, D L (2010) RNA viruses in hymenopteran
honey bee (Apis mellifera) colonies infested with Varroa
pollinators: evidence of inter-taxa virus transmission via pollen
destructor. Apidologie 38: 354-367.
and potential impact on non-Apis hymenopteran species. PLoS
ONE 5: e14357. http://dx.doi.org/10.1371/journal.pone.0014357 STACH, J E; BATHE, S; CLAPP, J P; BURNS, R G (2001) PCR-SSCP
http://dx.doi.org/10.1051/apido:2007021 TOPLEY, E; DAVISON, S; LEAT, N; BENJEDDOU, M (2005) Detection of three honey bee viruses simultaneously by a single Multiplex
comparison of 16S rDNA sequence diversity in soil DNA obtained
Reverse Transcriptase PCR. African Journal of Biotechnology 4(8):
using different isolation and purification methods. FEMS
763-767.
Microbiology Ecology 36(2-3): 139-151. http://dx.doi.org/10.1111/j.1574-6941.2001.tb00834.x STÅHLBERG, A; HÅKANSSON, J; XIAN, X; SEMB, H; KUBISTA, M
VALENTINE-THON, E; VAN LOON, A M; SCHIRM, J; REID, J; KLAPPER, P E; CLEATOR, G M (2001) European proficiency testing program for molecular detection and quantitation of hepatitis B
(2004a) Properties of the reverse transcription reaction in mRNA
virus DNA. Journal of Clinical Microbiology 39(12): 4407-4412.
quantification. Clinical Chemistry 50(3): 509-515.
http://dx.doi.org/10.1128/JCM.39.12.4407-4412.2001
http://dx.doi.org/10.1373/clinchem.2003.026161
de Miranda et al.
54
VAN DER STEEN, J J M; CORNELISSEN, B; DONDERS, J;
WHEELER, D E; BUCK, N; EVANS, J D (2006) Expression of insulin
BLACQUIÈRE, T; VAN DOOREMALEN, C (2012) How honey bees
pathway genes during the period of caste determination in the
of successive age classes are distributed over a one storey, ten
honey bee, Apis mellifera. Insect Molecular Biology 15(5): 597-
frames hive. Journal of Apicultural Research 51(2): 174-178.
602. http://dx.doi.org/10.1111/j.1365-2583.2006.00681.x
http://dx.doi.org/10.3896/IBRA.1.51.2.05 VAN DER ZEE, R; GRAY, A; HOLZMANN, C; PISA, L;
WILLIAMS, G R; ALAUX, C; COSTA, C; CSÁKI, T; DOUBLET, V; EISENHARDT, D; FRIES, I; KUHN, R; MCMAHON, D P;
BRODSCHNEIDER, R; CHLEBO, R; COFFEY, M F; KENCE, A;
MEDRZYCKI, P; MURRAY, T E; NATSOPOULOU, M E; NEUMANN, P;
KRISTIANSEN, P; MUTINELLI, F; NGUYEN, B K; ADJLANE, N;
OLIVER, R; PAXTON, R J; PERNAL, S F; SHUTLER, D; TANNER, G;
PETERSON, M; SOROKER, V; TOPOLSKA, G; VEJSNÆS, F;
VAN DER STEEN, J J M; BRODSCHNEIDER, R (2013) Standard
WILKINS, S (2012) Standard survey methods for estimating
methods for maintaining adult Apis mellifera in cages under in
estimating colony losses and explanatory risk factors in Apis
vitro laboratory conditions. In V Dietemann; J D Ellis; P Neumann
mellifera. In V Dietemann; J D Ellis; P Neumann (Eds) The
(Eds) The COLOSS BEEBOOK, Volume I: standard methods for
COLOSS BEEBOOK, Volume I: Standard methods for Apis mellifera
Apis mellifera research. Journal of Apicultural Research 52(1):
research. Journal of Apicultural Research 52(4): http://dx.doi.org/10.3896/IBRA.1.52.4.18 VAN MUNSTER, M; DULLEMANS, A M; VERBEEK, M;
http://dx.doi.org/10.3896/IBRA.1.52.1.04 WILLIAMS, G R; ROGERS, R E L; KALKSTEIN, A L; TAYLOR, B A; SHUTLER, D; OSTIGUY, N (2009) Deformed wing virus in western
VAN DEN HEUVEL, J F J M; CLÉRIVET, A; VAN DER WILK, F
honey bees (Apis mellifera) from Atlantic Canada and the first
(2002) Sequence analysis and genomic organization of aphid
description of an overtly-infected emerging queen. Journal of
lethal paralysis virus: a new member of the family Dicistroviridae.
Invertebrate Pathology 101: 77-79.
Journal of General Virology 83(12): 3131-3138.
http://dx.doi.org/10.1016/j.jip.2009.01.004
VANENGELSDORP, D; LENGERICH, E; SPLEEN, A; DAINAT, B;
WITTWER C T; REED, G H; GUNDRY, C N; VANDERSTEEN, J G;
CRESSWELL, J; BAYLISS, K, NGUYEN, K B; SOROKER; V;
PRYOR, R J (2003) High-resolution genotyping by amplicon
UNDERWOOD, R; HUMAN, H; LE CONTE, Y; SAEGERMAN, C
melting analysis using LCGreen. Clinical Chemistry 49(6): 853-
(2013) Standard epidemiological methods to understand and improve Apis mellifera health. In V Dietemann; J D Ellis, P
860. http://dx.doi.org/10.1373/49.6.853 WOLFE, R; CARLIN, J B (1999) Sample-size calculation for a
Neumann (Eds) The COLOSS BEEBOOK: Volume II: Standard
log-transformed outcome measure. Controlled Clinical
methods for Apis mellifera pest and pathogen research. Journal of
Trials 20: 547-554.
Apicultural Research 52(4):
http://dx.doi.org/10.1016/S0197-2456(99)00032-X
http://dx.doi.org/10.3896/IBRA.1.52.4.15 VERKOOYEN, R P; NOORDHOEK, G T; KLAPPER, P E; REID, J;
YAÑEZ, O; JAFFÉ, R; JAROSCH, A; FRIES, I; MORITZ, R F A; PAXTON, R J; DE MIRANDA J R (2012) Deformed wing virus and
SCHIRM, J; CLEATOR, G M; IEVEN, M; HODDEVIK, G (2003)
drone mating in the honey bee (Apis mellifera): implications for
Reliability of nucleic acid amplification methods for detection of
sexual transmission of a major honey bee virus. Apidologie 43: 17
Chlamydia trachomatis in urine: results of the first international
-30. http://dx.doi.org/10.1007/s13592-011-0088-7
collaborative quality control study among 96 laboratories. Journal
YANG, X; COX-FOSTER, D L (2005) Impact of an ectoparasite on the
of Clinical Microbiology 41(7): 3013-3016.
immunity and pathology of an invertebrate: Evidence for host
http://dx.doi.org/10.1128/JCM.41.7.3013-3016.2003
immunosuppression and viral amplification. Proceedings of the
WANG, T C; CHAO, M (2005) RNA recombination of hepatitis delta
National Academy of Science of the United States of America
virus in natural mixed-genotype infection and transfected cultured
102: 7470-7475.
cells. Journal of Virology 79(4): 2221-2229.
http://dx.doi.org/10.1073/pnas.0501860102
http://dx.doi.org/10.1128/JVI.79.4.221-2229.2005 WEBBY, R; KALMAKOFF, J (1998) Sequence comparison of the major capsid protein from 18 diverse iridoviruses. Archives of Virology 143: 1949-1966. http://dx.doi.org/10.1007/s007050050432 WEINSTEIN-TEXEIRA, E; CHEN, Y P; MESSAGE, D; PETTIS, J; EVANS,
YUE, C; GENERSCH, E (2005) RT-PCR analysis of deformed wing virus in honey bees (Apis mellifera) and mites (Varroa destructor).
Journal of General Virology 86: 3419-3424. http://dx.doi.org/10.1099/vir.0.81401-0 YUE, C; SCHRÖDER, M; BIENEFELD, K; GENERSCH, E (2006) Detection of viral sequences in semen of honey bees (Apis
J D (2008) Virus infections in Brazilian honey bees. Journal of
mellifera): evidence for vertical transmission of viruses through
Invertebrate Pathology 99(1): 117-119.
drones. Journal of Invertebrate Pathology 92: 105-108.
http://dx.doi.org/10.1016/j.jip.2008.03.014
http://dx.doi.org/10.1016/j.jip.2006.03.001
The COLOSS BEEBOOK: virus methods
YUNUS, M A; CHUNG, L M W; CHAUDHRY, Y; BAILEY, D;
55
ZHANG, X; HE, S Y; EVANS, J D; PETTIS, J S; YIN, G F; CHEN, Y P
GOODFELLOW, I (2010) Development of an optimized RNA-based
(2012) New evidence that deformed wing virus and black queen
murine norovirus reverse genetics system. Journal of Virological
cell virus are multi-host pathogens. Journal of Invertebrate
Methods 169(1): 112-118.
Pathology 109: 156-159. http://dx.doi.org/10.1016/j.jip.2011.09.010
http://dx.doi.org/10.1016/j.jviromet.2010.07.006 YURYEV, A (2007) PCR primer design. Methods in Molecular Biologyâ„¢
series #402. Humana Press; Totowa, New Jersey, USA. 431 pp.
ZIONI, N; SOROKER, V; CHEJANOVSKY, N (2011) Replication of Varroa destructor virus 1 (VDV-1) and a Varroa destructor virus 1deformed wing virus recombinant (VDV-1-DWV) in the head of the honey bee. Virology 417(1): 106-112. http://dx.doi.org/10.1016/j.virol.2011.05.009
Journal of Apicultural Research 52(4): (2013)
© IBRA 2013