Skip to main content

Leuisiana State University Thesis by Felix Francis

Page 1

COMPARATIVE GENOMICS, TRANSCRIPTOME ANALYSIS AND CHARACTERIZATION OF SELECTED REGULATORY GENES OF BURKHOLDERIA GLUMAE

A Thesis

Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College In partial fulfillment of the Requirements for the degree of Master of Science in The Department of Plant Pathology & Crop Physiology

By Felix Francis B. S., Kerala Agricultural University, 2009 August 2012


DEDICATION

Dedicated to my parents and teachers

ii


ACKNOWLEDGEMENTS

It is my pleasant privilege to place on record my deep sense of gratitude and indebtedness to the compassionate people around me who made this thesis possible, to only some of whom it is possible to give particular mention here. Above all, I would like to thank my parents for being a constant support and encouragement throughout my journey, for which my mere expression of thanks likewise does not suffice. I would like to express my deep and sincere gratitude to my supervisor, Dr. Jong Hyun Ham. It has been an honor to be his student. He taught me, both consciously and un-consciously, how good research is done. It was indeed a productive and stimulating experience. I am most grateful to my mentor, Dr. Joohyun Kim, Center for Computation & Technology, Louisiana State University, who helped me learn and build the foundation for some important computational techniques required for my projects. I would like to thank my committee members Dr. Christopher A Clark, Dr. William T. Doerrler and Dr. Rodrigo A. Valverde, for their time, interest, and helpful comments. I would like to thank Dr. Lawrence Datnoff, Dr. Marc A. Cohn, Dr. Donald Ferrin, Dr. Charles Overstreet, Dr. Jeffrey W. Hoy and other members of the Department of Plant Pathology and Crop Physiology for all the advice, assistance, and support that they have given me. I would like to acknowledge the financial, academic and technical support of Louisiana State University and the Louisiana State University Agricultural Center.

iii


I am indebted to my fellow graduate students for providing a stimulating and enjoyable environment to learn and grow. I am especially grateful to my lab members Ms. Inderjeet Kaur, Mr. Hari Karki, Ms. Rebecca Melanson, Mr. Bishnu Shrestha and Ms. Ruoxi Chen, for their encouragement, guidance and support.

iv


TABLE OF CONTENTS

DEDICATION: ...............................................................................................................................ii

ACKNOWLEDGEMENTS: .........................................................................................................iii

ABSTRACT: .................................................................................................................................vi

CHAPTER 1: Introduction..............................................................................................................1

CHAPTER 2: Genome sequencing and comparative genomics of Burkholderia glumae, strain 336gr-1.............................................................................................................................................6

CHAPTER 3: Characterization of ECF sigma 70 gene and sigma 54 dependent response regulator gene (tepr) in Burkholderia glumae, strain 336gr-1. .....................................................50

CHAPTER 4: RNA-seq based transcriptome analysis to study the gene expression of Burkholderia glumae, strain 336gr-1.............................................................................................64

CHAPTER 5: Conclusions............................................................................................................79

REFERENCES: ............................................................................................................................82

APPENDIX: ..................................................................................................................................88

VITA: ……....................................................................................................................................95

v


ABSTRACT Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice, which is becoming a major threat to global rice production. The genome of a highly virulent B. glumae strain, 336gr-1 that was isolated from rice in Louisiana, was sequenced to better understand the genome-scale characteristics, particularly that of its pathogenicity. Comparative genomic analyses with another strain, BGR1 that was isolated from Korea, revealed several unique regions present in the genomes of these two geographically separated phytopathogenic bacteria. Genome plasticity, primarily caused by a horizontal gene transfer, was observed in these closely related strains of Burkholderia that are capable of infecting the same host plant. The highly conserved nature of chromosome 2, along with the presence of important virulence determinant gene coding regions in it, such as those involved in type III secretion and toxoflavin production, indicates its importance in pathogenesis. The presence of multiple genomic islands, detectable pseudo genes, insertions, deletions, and paralogous genes indicates recent adaptation to diverse ecological niches and reduced selection pressures in specific regions of the B. glumae genome. These findings would help explain the genotype and host range diversity of B. glumae and augment characterization of its ecology and pathogenesis. Characterization of ECF Ďƒ70 gene and Ďƒ54 dependent response regulator gene in B. glumae has revealed that they are not directly involved in pathogenicity in this phytopathogenic bacterium. Global transcriptome analysis of B. glumae strain 336gr-1 has revealed that the expression of 87 genes is influenced by the quorum sensing genes tofI/tofR and their intergenic region, orf1. Especially, the genes for the type II secretion system and diguanylatecyclase activity, which play important roles in the pathogenesis of B. glumae, were found to be regulated by quorum sensing mechanism.

vi


CHAPTER 1: INTRODUCTION

1


1.1.0

INTRODUCTION:

1.1.1. Bacterial panicle blight and the pathogen Bacterial panicle blight (BPB) of rice is becoming widespread in many ricegrowing countries, including the United States, China, Japan, Korea, Vietnam, Philippines and India (Ham et al., 2011). This disease, primarily caused by B. glumae, is among the three most limiting rice diseases in Louisiana and the Southern United States (Nandakumar et al., 2009). B. glumae is a Gram-negative, non-fluorescent, rod-shaped bacterium, with a polar flagellar tuft (Cho et al., 2007). The optimum temperature for growth is around 30째C, but it can grow even at 41째C (Saddler, 1994). Based on the 16S rRNA sequences, DNA-DNA homology values, cellular lipid and fatty acid composition, and phenotypic characteristics, the genus Burkholderia was proposed for the RNA homology group II of genus Pseudomonas in 1992 (Yabuuchi et al., 1992). The genus initially included seven different species such as Burkholderia cepacia, B. mallei, B. pseudomallei, B. caryophylli, B. gladioli, B. pickettii and B. solanacearum(Yabuuchi et al., 1992). Some of the related Burkholderia species are major opportunistic human pathogens for patients with cystic fibrosis, chronic granulomatous disease etc. Genus Burkholderia currently consists of more than 40 identified species, with a great ecological diversity (Coenye & Vandamme, 2007). Its habitat ranges from free living forms in soil and water, in plants as endophytes or pathogens, in animals as endosymbionts or pathogens, to those living within specific fungal mycelia (Coenye & Vandamme, 2003). The phytopathogenic species of Burkholderia cause diseases for a variety of plants, and induce symptoms such as wilt, rot, blight, or canker (Coenye & Vandamme,

2


2007). Several species of Burkholderia can induce plant diseases. B. glumae is known to cause seedling and grain rot in rice and also wilting symptoms in tomato, sesame, perilla, eggplant and hot pepper (Jeong et al., 2003). Bacterial panicle blight is a frequent problem in several rice-producing areas in the United States, Japan, and Korea. The incidence of this disease has also been increasing in recent years. The disease which results in sterility of the spikelets and discoloration of the emerging grains, appears to be a significant issue, specially under conditions of warm nights and high humidity (Tsushima, 1996). The bacterial panicle blight disease in rice can lead to a yield reduction of up to 75% in severely infested fields. This occurs as an outcome of a decrease in grain weight, sterility of florets, inhibition of seed germination and reduction of stands (Ham et al., 2011). In spite of the economic significance of this pathogen, molecular biological and genetic studies of B. glumae are still in their early stages. Very little is known about the virulence mechanisms and associated regulatory systems.

1.1.2. Virulence factors of Burkholderia glumae The pathogenesis of B. glumae is a complex process that encompasses multiple virulence factors. Toxins (toxoflavin and fervenulin) and lipase are the only known major virulence factors of B. glumae (Ham et al., 2011). Their production is dependent on a quorum-sensing mechanism, which is mediated by acyl homoserine lactone (AHL) – type diffusible signaling molecules (Kim et al., 2004). Toxoflavin (a broad-host range phytotoxin) and fervenulin are bright yellow pigments produced by B. glumae, and constitute the major pathogenicity factors for causing rice seedling rot and grain rot (Kim et al., 2004). Toxoflavin results in reduced growth of leaves and roots of rice seedlings

3


and also leads to chlorotic symptoms on rice panicles (Iiyama et al., 1994). Besides this, toxoflavin is also known to show antibacterial and antifungal activities and is toxic to mice, leading to haematuria, diarrhea and lachrymation (Nagamatsu, 2002). Toxoflavin, an active electron carrier between NADH and oxygen, produces hydrogen peroxide, and may bypass the cytochrome system (Latuasan & Berends, 1961). toxABCDE operon (involved in biosynthesis of toxoflavin) and toxFGHIoperon (involved in transport of toxoflavin), is regulated by the LysR family regulator ToxR, for which toxoflavin is a coinducer (Kim et al., 2009). The other set of four genes (toxF, toxG, toxH and toxI) are responsible for the transport of toxoflavin (Kim et al., 2004). Toxoflavin biosynthesis and its transport in B. glumae is quorum sensing dependent (Kim et al., 2004), and the production is maximum at 37째C and no significant amount is produced at 25-28 째C .Very little is known about how B. glumae cells transport toxoflavin or protect themselves against this toxin. Lipase has also been reported to be involved in the pathogenicity of B. glumae. A derivative of a highly virulent strain that was made defective in lipA, which encodes the LipA lipase, was found to be much less virulent on rice than the parental strain. Flagellamediated motility (swimming and swarming) plays a crucial part in the pathogenesis by B. glumae. Mutants of B. glumae that were defective in flagellar biogenesis genes (thus non-motile), were non-virulent on rice plants (Kim et al., 2007). Type III Secretion Systems (T3SSs) are essential components of several Gramnegative bacteria, that are responsible for inducing pathogenicity on susceptible host plants and for the induction of hypersensitive responses on the leaves of non-host or resistant host plants (Alfano & Collmer, 2004). Recently, the gene cluster encoding the

4


T3SS of B. glumae was characterized along with the identification of 34 extracellular proteins. These proteins were accumulated in a HrpB-dependent manner; and among the 34 genes that were identified, twenty-one genes had putative HrpB-binding sequences in their upstream regulatory regions (Kang et al., 2008). These 34 extracellular proteins were secreted independent of the Hrp T3SS, but 16 of them were secreted through a type II protein secretion system (T2SS). However, because the T3SS-deficient mutant showed lesser virulence on rice panicles, it can be inferred that even though type III effectors secreted by the T3SS have not yet been reported in B. glumae, most of these type III effectors are required for full virulence (Kang et al., 2008). Based on their function in closely related phytopathogenic bacteria, endopolygalacturonase and exopolysaccharides are also good candidates that could have potential roles in B. glumae pathogenesis (Gonzalez et al., 1997, Jeong et al., 2003).

5


CHAPTER 2: GENOME SEQUENCING AND COMPARATIVE GENOMICS OF BURKHOLDERIA GLUMAE, STRAIN 336GR-1.

6


2.1.0. LITERATURE REVIEW : 2.1.1. Burkholderia genome and comparative genomics: The basis of the remarkable diversity in the habitats of different Burkholderia members lie within their large genomes (averaging between 7 – 8 Mb sizes) (Lessie et al., 1996). The multireplicon nature, genome plasticity and potential for intragenomic rearrangement between the chromosomal replicons play a significant role in creating this diversity within and between species of Burkholderia (Lessie et al., 1996). In spite of their implication in human health and environment, only few selected Burkholderia species have been intensively studied. Currently, the genomes of fifteen species of Burkholderia have been fully sequenced and annotated and more than 98 different strains have been either fully or partially sequenced (Winsor et al., 2008). However, very little information along these lines is known about the majority of plant pathogenic Burkholderia species. Comparative genomics is an effective way for understanding the genetic features that have been acquired, modified, or lost, and helped bacteria to evolve and adapt to specific environmental niches (Lu et al., 2008). Genomic exploration of the phytopathogenic Burkholderia can provide insights about the mechanisms that are responsible for their adaptations and pathogenesis. Recent advances in high-throughput DNA sequencing technologies, including Solexa (Illumina Inc., San Diego, CA, USA) and 454 (454 Life Sciences, Branford, CT, USA) systems, and associated bioinformatics techniques, have made genomic studies more feasible and affordable. Further reduction of cost and improvement in base-calling accuracy will uncover the genetic architecture of

7


complex diseases and make the use of genome sequencing a routine practice for life sciences researchers (Xiong et al., 2010). B. glumae - rice interaction will be a good model pathosystem to understand how plant-pathogenic bacteria infect rice panicles and flowers. Because of the broad ecological niches and great genetic diversity among the Burkholderia species, it will be truly valuable to augment the genome information about this genus. The complete genome of a strain of B. glumae (BGR1) from East Asia was previously sequenced in 2009, using a traditional whole-genome shotgun sequencing technique (Lim et al., 2009). The genome of this strain (BGRI) consists of two chromosomes (chromosome 1 of 3,906,529 bp, 68.11% G+C content, 3,290 predicted coding sequences (CDS), 144 pseudo genes, three rRNA operons, and 56 tRNAs; chromosome 2 of 2,827,355 bp, 68.76% G+C content, 2,079 CDS, 192 pseudo genes, two rRNA operons, and eight tRNAs) and four plasmids(Plasmid bglu_1p of 133,591 bp, 60.59% G+C content, 102 CDS, and 42 pseudo genes; plasmid bglu_2p of 141,792 bp, 63.21% G+C content, 97 CDS, and 24 pseudo genes; plasmid bglu_3p of 141,067 bp, 62.68% G+C content, 106 CDS, 36 pseudo genes, and one tRNA; and plasmid bglu_4p of 134,349 bp, 62.71% G+C content, 102 CDS, 12 pseudo genes, and one tRNA) (Lim et al., 2009). Analysis of the BGR1 genome revealed that many of the important pathogenicity-related genes are found in chromosome 2. They include the genes for a hypersensitive response and pathogenicity (Hrp) type III protein secretion system and toxoflavin biosynthesis and transport genes (Lim et al., 2009). Previous molecular genetic studies conducted on the B. glumae strain 336gr-1 from the U.S. indicated probable difference in the virulence mechanisms between the

8


local strains and that from Eastern Asia (strain BGR1) (unpublished). Comparative genomics may now provide an opportunity for insight into these differences and better understanding of the genetics of the pathogen and its virulence mechanisms. On completion, this would also be the first genome sequence information reported about a B. glumae strain from the U.S. Comparative genomic analyses of these pathogenic strains will give an insight into how they adapted to different ecological niches and host plants, particularly the rice varieties. Such findings will help us to explain the diversity of B. glumae genotypes and host ranges, and enhance elaborate characterization of its ecology and pathogenesis.

2.2.0. MATERIALS AND METHODS : 2.2.1. Genome sequencing The whole genome of the B. glumae strain 336gr-1, a highly virulent strain isolated from a Louisiana Rice field, was sequenced using a high-throughput DNA sequencing platform, Illumina GAIIx (Illumina, CA) in collaboration with the National Center for Genome Resources (NCGR: Santa Fe, New Mexico). Approximately 1 Gbp of total DNA sequence data were obtained from six lanes of 36-cycle single end read sequencing, which yielded more than 29 million short reads (36 bases / read). This read length is approximately 140 times the size of the B. glumae BGR1 genome (~ 7.3 Mb), which was previously sequenced and annotated (Lim et al., 2009).These sequence data were submitted to NCBI’s Sequence Read Archive (SRA) (Sequence ID #: SRX016441).

9


2.2.2. de novo assembly and mapping Abyss (Birol et al., 2009)was used to perform de novo assembly of the sequence data. Nearly 7000 contigs, with an average size of 6.8 MB, and with a contig N50 of around 5Kbp were generated. Along with this, two other programs, EDENAand NGC, were used to conduct de novo assembly of the sequence data and the results from these three programs were compared. 2.2.3. Alignment and comparison with the reference genome Since a reference genome sequence assembly based on shotgun Sanger sequencing was previously published (Lim et al., 2009) to GenBank, the emphasis of our investigation was to align and analyze Solexa reads against this reference genome. The previously published sequence of B. glumae BGR1 (Lim et al., 2009) (NCBI Reference Sequences: NC_012724.1, NC_012721.1, NC_012723.1, NC_012718.1, NC_012720.1 and NC_012725.1) were obtained from the NCBI FTP site. 2.2.4. Comparative genomics analysis CGView (Stothard & Wishart, 2005), a comparative genomics tool was used to visualize the sequence feature information, in the context of comparative sequence analysis.

CGView Server was employed to conduct a BLAST (Altschul et al.,

1990)comparison of the Solexa reads of B. glumae (strain 336gr-1) with the reference genome, B. glumae strain BGR1. The B. glumae strain BGR1 genomic information (Lim et al., 2009) in GenBank (Benson et al., 2008)format was used to create the two outer rings (forward and reverse strands) that depict the protein coding sequences.

The

GenBank files for each of the two chromosomes and four plasmids of strain BGR1 were 10


used to create separate circular maps. For each of these maps, a BLAST comparison was done using the sequences of both the B. glumae strains, BGR1 and 336gr-1. From the sequence comparison results, closer maps of the regions that had gaps were generated. Gaps represent the unique regions in BGR1 strain. The magnification was based on the length of the gaps. A greater magnification was employed for smaller gaps and vice versa. From these closer views of the gaps, the accession numbers of all the coding sequences were found out and their respective coding proteins were identified from NCBI database. The unique contigs of 336gr-1 assembled data (not matching with that of BGR1) were identified and their respective GC content, GC profile, matching organisms from the NCBI database and the major genes in those contigs were identified. These unique regions of both the genomes and the respective genes present in those regions were examined to study the differences between the two genomes. 2.2.5. PCR validation for the unique regions PCR validation was performed to further prove that the unique contigs of 336gr-1 identified by sequence comparisons are actually not present in BGR1 genome. Ten pairs (forward and reverse) of primers (Table 1.) were designed for the ten largest unique contigs of 336gr-1. Another set of eleven pairs of primers (Table 2) for the unique regions of BGR1 were used to validate them.

11


Table1. Ten pairs of primers used for validation of unique regions of 336gr-1. Number

Product

Primer sequence

Size

1

2

3

4

5

6

7

891

904

897

880

853

888

890

Forward primer

GTCGACGAATCGCTGATGAT

Reverse primer

GACGGTCTGGTACTGCTGGT

Forward primer

AGAACCTGAGCGAGGAAGTG

Reverse primer

ATTGCTTGGCTCCTTCAGTG

Forward primer

AACGTGATCCGCGACTAAAG

Reverse primer

ATTCAGGATCGGGGTATCGT

Forward primer

GCGAGATACATGCAGAGCAC

Reverse primer

TCCTTCAAAGAGCGCTTACC

Forward primer

GAGGGGCACGTAGATGTTGT

Reverse primer

GGACCGGTCGTCGAGTATC

Forward primer

GAGCTATCACGGCAACCTGT

Reverse primer

GCGTGATCGTTTTCTTGAT

Forward primer

ATGCTGGCCAAATTCAGTCT

Reverse primer

GTCTACTGGGTCTGCGAAGC

12


(Table 1. continued) 8

9

10

900

899

885

Forward primer

GGTGGTGATCGCAGTATTCC

Reverse primer

CGGGCTTTATGCACCTATTT

Forward primer

ATCAAAACGAAACCGCAAG

Reverse primer

AACTACCGCTCGAATCATGG

Forward primer

AGCTCGGCAACCATCTGTT

Reverse primer

CACCATGTCGCTGTCGTATT

Table 2. Eleven pairs of primers and the positive control primers used for validation of unique regions of BGR1. Number

1

2

3

Primer sequence

Forward primer

CCATCGCTTCTTCTTTCGTC

Reverse primer

GGCCAGGAAATCAAGGTGT

Forward primer

ATAGTGAGCGCCTCGAATGT

Reverse primer

AAAAGACCCCCAAAAACTGG

Forward primer

GGCGACAAGATCATCGAAAT

Reverse primer

AACGAAACGCTGATGGAAAG

13


(Table 2. continued) 4

5

6

7

8

9

10

Forward primer

CTGCAAGTCTGCGATGATGT

Reverse primer

GAACCCCGACAAAGATTTCA

Forward primer

TCACGATCGATGAATTCGAG

Reverse primer

ATATTGAACGTCGCCTGTCC

Forward primer

CAGATCCCGGCTTTAATCAG

Reverse primer

AAGAATCTCCAGACCGAGCA

Forward primer

CGTGTGCTTCTTCTGGTTCA

Reverse primer

AAGCTCCCACTGGATAGCAA

Forward primer

CGGTACCTCGGTGGACTTC

Reverse primer

GCTGGTCGGTGTAGGTCTTC

Forward primer

CGCATCTTCGCTTGGTAGTC

Reverse primer

GACGATCGCGGCTAACTATC

Forward primer

CTCTTCATCCGGCACGTAGT

Reverse primer

AAGGATACGTACGCCGTCAT

14


(Table 2. continued) 11

Forward primer

CCGACTGAGCGATTTAAAGG

Reverse primer

TCAACCGGATTCAGGAAAAG

Positive

Forward primer

ACACGGAACACCTGGGTA

control**

Reverse primer

TCGCTCTCCCGAAGAGAT

**Takeuchi, T., Sawada, H., Suzuki, F. and Matsuda, I. 1997. Specific detection of Burkholderia plantarii and B. glumae by PCR using primers selected from the 16S-23S rDNA spacer regions. Annals of the Phytopathological Society of Japan 63: 455-462. The following PCR program was employed for amplification of the target sequences from both the genomes respectively:

1.

Initialization step:

95°C for 2 minutes

2.

Denaturation step:

94°C for 30 seconds

3.

Annealing step:

55°C for 30 seconds

4.

Extension/elongation step:

72 °C for 1 minute

5.

Go to step 2:

for 29 times.

6.

Final elongation:

72°C for 7 minutes

7.

Final hold:

4°C

The amplified PCR products were loaded on 1% Agarose gel and electrophoresis was carried out at 120V.

15


2.2.6. Pairwise sequence comparison Exonerate (Slater & Birney, 2005), a generic tool for pairwise sequence comparison was used to individually check the presence of genes (in the strain 336gr-1) that were already known/ thought to be involved in virulence (Table 3) in B. glumae BGR1 and other phytopathogenic bacteria. Their gene locus tags and corresponding sequences were obtained from NCBI database. For each of these 84 coding sequences, gapped alignment against a database (B. glumae, strain 336gr-1 contigs) was performed.

Table 3. List of genes and their gene locus tags that were used for gapped alignment using Exonerate.

Function of Gene

Gene Name

Quorum-sensing

tofI

Gene code /locus_tag for BGR1

bglu_2g14490

bglu_2g14470

tofR Toxoflavin

bglu_2g06400

toxA

synthesis and transport bglu_2g06410

toxB

bglu_2g06420

toxC

bglu_2g06430

toxD

bglu_2g06440

toxE

16


(Table 3. continued) bglu_2g06380

toxF

bglu_2g06370

toxG

bglu_2g06360

toxH

bglu_2g06350

toxI

bglu_2g06330

toxJ

bglu_2g06390

toxR Lipase synthesis

bglu_2g07730

lipA

bglu_2g18930

Polygalacturonase pehA

bglu_2g07060 (chr 2)

pehB

bglu_1g15100 (chr 1) Type II protein

D ( outer membrane

secretion system

secretin)

bglu_1g00380

(Core components) bglu_1g00370

E ( cytoplasmic ATPase )

bglu_1g00360

F ( inner membrane protein) G ( major pseudopilin)

H ( minor pseudopilin)

17

bglu_1g00340

bglu_1g00330


(Table 3. continued) I (minor pseudopilin ) J (minor pseudopilin )

bglu_1g00320 bglu_1g00310

K (minor pseudopilin )

bglu_1g00300

L (inner membrane

bglu_1g00290

protein) bglu_1g00280

M (inner membrane protein)

bglu_1g00350

C ( substrate recognition/secretin interaction ) Type II protein

N (related to C)

bglu_1g00270

hrcC

bglu_2g02480 (chr2)

secretion system (variable components) Type III protein secretion system bglu_2g02460

hrcT

bglu_2g02440 (chr2)

hrcN

bglu_1g03700 (chr1) bglu_2g02410

hrcJ

bglu_2g02380

hrcU

18


(Table 3. continued) bglu_2g02370 (55% coverage)

hrcV

bglu_2g02350 (product="Type III

hrcQ

secretion system apparatus protein YscQ/HrcQ") bglu_2g02340 ("part of a set of proteins

hrcR

involved in the infection of eukaryotic cells; in plant pathogens involved in the hypersensitivity response") bglu_1g00190 ("FliP, with proteins FliQ and FliR, forms the core of the central channel in the flagella export apparatus") bglu_2g02330

hrcS

hrpK

bglu_2g02530

hrpF

bglu_2g02520

hrpG

bglu_2g02500 bglu_2g02470

hrpB hrpL

bglu_2g02430

hrpB4

bglu_2g02420 bglu_2g02400

hrpB2

bglu_2g02390

hrpB1

bglu_2g02360

hpaP

19


(Table 3. continued) bglu_2g02300

hrpD

bglu_2g02290

hpaB

bglu_2g02580

orf1

bglu_2g06340 orf2 bglu_2g02570 bglu_2g02560

orf3

bglu_2g02550

orf4

bglu_1g03420 bglu_2g02540

orf5

bglu_1g00150 (chr 1)

bglu_2g16140 (chr 2) note="nonfunctional due to frameshift" orf6

bglu_2g02510

orf7

bglu_2g02490

orf8

bglu_2g02450

orf9

bglu_2g02320

orf10

bglu_2g02310 bglu_2g02280

orf11

20


(Table 3. continued) Flagellar

bglu_1g01980

fliA

biogenesis bglu_1g01970

flhG

bglu_1g01960

flhF

bglu_1g01950

flhA

bglu_1g01940

flhB

bglu_1g01900

cheZ

bglu_1g01890

cheY

bglu_1g14830 (product="Response regulator receiver domain protein(CheY)" bglu_1g01880

cheB

bglu_1g11760 product="CheBmethylesterase" (CHR1)

bglu_2g19930 product="Two component CheBmethylesterase" (chr2) bglu_1g01870 (product="chemoreceptor

cheD

glutamine deamidaseCheD")

21


(Table 3. continued) bglu_1g01860 (chr1)

cheR

bglu_2g19910 (product "Chemotaxis protein methyltransferaseCheR") (chr2)

bglu_2g16970 product="MCP methyltransferase, CheRtype" (chr2)

bglu_1g11770 product="MCP methyltransferase, CheR-type" (chr 1)

bglu_1g01850

tsr

bglu_1g01840 (product="CheW")

cheW

bglu_1g22490 (product="Chemotaxis protein CheW")

bglu_2g16960 bglu_2g16980 (product="CheW domain protein")

bglu_2g19940 (product="CheW")

bglu_2g20910 (product="Chemotaxis protein CheW")

22


(Table 3. continued) bglu_1g01830 (product="CheA")

cheA

bglu_1g28890 (product="Putative CheA signal transduction histidine kinase�)

bglu_2g19890 (product="CheA Signal Transduction Histidine Kinases (STHK) bglu_1g01820

cheY1

bglu_1g01810 (gene="motB")

motB

bglu_1g01800

bglu_1g03970 (product="OmpA/MotB")

bglu_1g08710 (product="OmpA/MotB domain protein")

bglu_1g13420 (product="OmpA/MotB") bglu_1g01790 (product="transcriptional

flhC

bglu_1g01780 (with FlhC is involved in the activation of class 2 flagellar genes and is involved in the regulation of a number of other genetic systems) bglu_1g01780 (product="transcriptional

flhD

activator FlhD")

23


(Table 3. continued) bglu_1g01710

fliC

bglu_1g01700 (product="FliD")

fliD

bglu_2g21370

katG

Catalase

(product="Catalase/peroxidase HPI")

2.3.0. RESULTS :

2.3.1. de novo assembly, mapping, alignment and comparison with the reference genome The Solexa data was aligned to the reference BGR1 genome using GSNAP and 23.9 million reads were matched (Table 4). From this data, SNP and small indels were called using the Alpheus pipeline.

Table 4. Summary of de novo assembly and mapping of the 336gr-1 sequence data. BGR1 de

336gr-1

novo Total: 7,284,683 bpa

Assembly

Total: 6,780,547 bp

Chr. 1: 3,906,529 bp

Assemble stat. (w/ NGS Cell v2.1.0)

Chr. 2: 2,827,355 bp

# of total short reads: ~ 24.6 million

Plasmid 1: 133,591 bp

# of contigs: 1292

Plasmid 2: 141,792 bp

Min. length: 200 bp

Plasmid 3: 141,067 bp

Max. length: 54,445 bp

Plasmid 4: 134,349 bp

Mean size: 5,248 bp N50: 11,450 bp

24


(Table 4. continued) Mapping

Mapping stat. (w/ GSNAP)b

to Reference sequence

the reference Covered region by 336gr-1 seq:

# of matched reads: ~ 23.9 million

sequence

~ 6.5 Mb

(uniquely matched: ~ 22.7 million)

Uncovered region: ~ 0.8 Mb

SNP and small indels calledc:

(Max. gap size: ~ 144 Kb)

2,000 SNPs, 10 small inserts, & 69 small deletions

# of genesd

6,462

6,546

: From NCBI database. b: Allowing 2 mismatches. c: With the Alpheus pipeline (Miller et al., 2008). d : With the GeneMark.hmm-P web tool. a

2.3.2. Comparative genomics analysis Circular alignment maps of 336gr-1 (Figures 1, 2, and 3) with respect to each of the two chromosomes and the four plasmids of the reference genome BGR1 were obtained using the CGView (Stothard & Wishart, 2005) application. The third inner ring depicting the self-comparison highlights the enriched sequences and reveals those sequences that were removed by the low-complexity sequence filter. The gaps in the BLAST comparison results using the Solexa reads of B. glumae (strain 336gr-1) presumably indicate the unique regions in the reference genome,B. glumae (strain BGR1).For both the BLAST results rings, the overlapping hits appear as darker regions. The innermost two rings show GC content and GC skew respectively, which are plotted as a deviation from the average of the entire sequence.

25


Figure 1. Circular alignment map for chromosome 1. The outermost two rings show features extracted from the chromosome 1 of B. glumae strain BGR1 genome (GenBank file). The next two light red rings show positions of BLAST hits detected by BLASTn searches against BGR1 and 336gr-1 genomes. The next two rings show GC content and GC skew. Each is plotted as the deviation from the average for the entire sequence.

26


Figure 2. Circular alignment map for chromosome 2. The outermost two rings show features extracted from the chromosome 2 of B. glumae strain BGR1 genome (GenBank file). The next two light red rings show positions of BLAST hits detected by BLASTn searches against BGR1 and 336gr-1 genomes. The next two rings show GC content and GC skew. Each is plotted as the deviation from the average for the entire sequence.

27


Plasmid 1 (133,591 bp)

Plasmid 2 (141,792 bp)

Plasmid 3 (141,067 bp)

Plasmid 4 (134,349 bp)

Figure 3. Circular alignment maps for plasmids 1, 2, 3 and 4.

28


Closer maps of the regions that had gaps, were generated and are depicted in the Figures 4-14. These gaps highlight the unique regions in BGR1 strain. The magnification was based on the length of the gaps. A greater magnification was employed for smaller gaps and vice versa. Individual coding sequences and tRNA’s that were present in these specific regions could be identified from these closer view of the maps. The gene locus tags for the genes present in each gap and their respective functional or encoded proteins were identified from the NCBI database (Table 5).

Figure 4. Gap1

Figure 5. Gap2.1, 2.2

29


Figure 6. Gap 3.1, 3.2

Figure 7. Gap 4

Figure 8. Gap 5.1, 5.2, 5.3

Figure 9. Gap 6

30


Figure 10. Gap 7

Figure 11. Gap 8

Figure 12. Gap 9

Figure 13. Gap 10

31


Figure 14. Gap 11. The outermost two rings depicting the forward and reverse strands show features extracted from BGR1. The blue arrows represent the coding sequences, whereas, the tRNA’s are depicted by red arrows. Each of the coding sequence is labeled by their corresponding locus tags. The next two light red rings depicting BLASTn 1 AND BLASTn 2 results, show positions of BLAST hits detected by BLASTn searches against BGR1 and 336gr-1 genomes respectively. Gaps in the inner light red ring (BLASTn 2) corresponds to the regions of BGR1 genome, that are absent in 336gr-1 genome. The next two rings show GC content and GC skew.

32


Table 5. Locus tags of the genes present in each gap and their respective encoded proteins.

Gap id

Locus Tag

Average GC %

Function/encoded protein

bglu_1g34270 1.

Hypothetical protein 70.2

bglu_1g34290

Hypothetical protein

bglu_1g01090 2.1.

2.2.

68.44 bglu_1g01100 bglu_1g01130 bglu_1g01140 bglu_1g01150 bglu_1g01160 bglu_1g01170 bglu_1g01180 bglu_1g01190 bglu_1g01200 bglu_1g01210 bglu_1g01220 bglu_1g01230 bglu_1g01240 bglu_1g01250 bglu_1g01260 bglu_1g01270 bglu_1g01280 bglu_1g01290 bglu_1g01300 bglu_1g01310 bglu_1g01320 bglu_1g01330 bglu_1g01340 bglu_1g01350 bglu_1g01360 bglu_1g01370 bglu_1g01380 bglu_1g01390 bglu_1g01400 bglu_1g01410 bglu_1g01420 bglu_1g01430 bglu_1g01440

63.34

Site-specific recombinase, phage integrase family protein Hypothetical protein Hypothetical protein Hypothetical protein Putative phage-encoded membrane protein Hypothetical protein Hypothetical protein Putative phage transcriptional activator Ogr/Delta Hypothetical protein Hypothetical protein Transcriptional regulator, XRE family protein Fels-2 prophage protein Hypothetical protein Hypothetical protein Hypothetical protein Gp28, phage tail protein E Phage major tail tube protein Hypothetical protein Bacteriophage-acquired protein Phage-related tail fiber protein Hypothetical protein Bacteriophage baseplate assembly protein J Phage baseplate assembly protein Hypothetical protein Hypothetical protein Hypothetical protein Bacteriophage tail completion protein R Gp41, LysC Putative phage-encoded lipoprotein Gp43, bacteriophage-acquired protein Putative phage-encoded membrane protein Putative phage-encoded membrane protein Phage tail protein Fels-2 prophage protein 33


3.1

3.2

4

bglu_1g01450 bglu_1g01460 bglu_1g01470 bglu_1g01480 bglu_1g01490 bglu_1g01500 bglu_1g01510 bglu_1g01520 bglu_1g01530 bglu_1g01540

Hypothetical protein Gp2, phage major capsid protein, P2 family protein Phage capsid scaffolding protein (GPO) Phage terminase, ATPase subunit Gp5, phage portal protein, pbsx family protein Hypothetical protein DNA cytosine methyltransferase M.NgoMIII XorII very-short-patch-repair endonuclease Deoxyguanosinetriphosphate triphosphohydrolase PAAR repeat-containing protein

bglu_1g03530 bglu_1g03540 bglu_1g03550 bglu_1g03560 bglu_1g03570 bglu_1g03580 bglu_1g03590 bglu_1g03600 bglu_1g03610 bglu_1g03620 bglu_1g03630 bglu_1g03640 bglu_1g03650 bglu_1g03660 bglu_1g03810 bglu_1g03820 bglu_1g03830

hypothetical protein hypothetical protein phage-related integrase hypothetical protein hypothetical protein type II secretory pathway, component PulD putative phage-related membrane protein putative phage-related membrane protein hypothetical protein putative phage-related membrane protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein

bglu_1g11940 bglu_1g11950 bglu_1g11960 bglu_1g11980 bglu_1g11990 bglu_1g12000 bglu_1g12030 bglu_1g12040 bglu_1g12050 bglu_1g12060 bglu_1g12070

56.5

56.1

62.76

Prophage integrase phage integrase family protein hypothetical protein hypothetical protein putative helix-turn-helix transcriptional regulator hypothetical protein permeases of the major facilitator superfamily protein hypothetical protein hypothetical protein hypothetical protein D12 class N6 adenine-specific DNA methyltransferase

bglu_1g15150 bglu_1g15160

gp52 hypothetical protein 34


bglu_1g15170 bglu_1g15180 bglu_1g15190 bglu_1g15220 bglu_1g15230 bglu_1g15240 bglu_1g15250 bglu_1g15260 bglu_1g15270 bglu_1g15280 bglu_1g15290 bglu_1g15300

5.1

bglu_1g15310 bglu_1g15320 bglu_1g15330 bglu_1g15340 bglu_1g15350 bglu_1g15360 bglu_1g15370 bglu_1g15380 bglu_1g15390 bglu_1g15400 bglu_1g15410 bglu_1g15420 bglu_1g15430 bglu_1g15440 bglu_1g15450 bglu_1g15460 bglu_1g15470 bglu_1g15480 bglu_1g15490 bglu_1g15500 bglu_1g15510 bglu_1g15520 bglu_1g15530 bglu_1g15540 bglu_1g15550 bglu_1g15560 bglu_1g15570 bglu_1g15580 bglu_1g15590 bglu_1g15600 bglu_1g15610 bglu_1g15620

65.5

hypothetical protein note="nonfunctional due to frameshift" /pseudo hypothetical protein gp38 note="disrupted gene"/pseudo hypothetical protein Retron-type reverse transcriptase hypothetical protein hypothetical protein Delta 1-pyrroline-5-carboxylate dehydrogenase DNA repair ATPase putative DNA segregation ATPase FtsK/SpoIIIElike proteins hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein gp32 disrupted gene note="disrupted gene"/pseudo hypothetical protein hypothetical protein hypothetical protein hypothetical protein DNA modification methylase hypothetical protein hypothetical protein hypothetical protein endodeoxyribonuclease RusA hypothetical protein gp22 hypothetical protein HNH endonuclease family protein hypothetical protein hypothetical protein hypothetical protein phage Mu protein gp30-like protein hypothetical protein putative bacteriophage protein putative bacteriophage protein hypothetical protein hypothetical protein 35


5.2

6

bglu_1g15630 bglu_1g15710 bglu_1g15720 bglu_1g15730 bglu_1g15740 bglu_1g15750 bglu_1g15760 bglu_1g15770 bglu_1g15780 bglu_1g15790 bglu_1g15800 bglu_1g15810 bglu_1g15820 bglu_1g15830 bglu_1g15840 bglu_1g15850 bglu_1g15860 bglu_1g15870 bglu_1g15880 bglu_1g15890 bglu_1g17060 bglu_1g17070 bglu_1g17080 bglu_1g17090 bglu_1g17100 bglu_1g17110 bglu_1g17120 bglu_1g17130 bglu_1g17140 bglu_1g17150 bglu_1g17160 bglu_1g17170 bglu_1g17180 bglu_1g17190 bglu_1g17200 bglu_1g17210 bglu_1g17220 bglu_1g17230 bglu_1g17240 bglu_1g17250 bglu_1g17260 bglu_1g17270 bglu_1g17280 bglu_1g17290

62.6

61.5

putative bacteriophage protein hypothetical protein phage-related tail protein hypothetical protein hypothetical protein putative bacteriophage protein hypothetical protein putative bacteriophage protein hypothetical protein putative bacteriophage protein hypothetical protein hypothetical protein gp51 hypothetical protein hypothetical protein ATP-binding region, ATPase-like protein hypothetical protein hypothetical protein Lipase, class 3 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein D12 class N6 adenine-specific DNA hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein ParA protein hypothetical protein HicA protein hypothetical protein putative transcriptional regulator putative portal protein phage terminase ATPase subunit phage capsid scaffolding protein P2 family phage major capsid protein Gp1, phage terminase, endonuclease subunit phage head completion phage tail protein 36


bglu_1g17300 bglu_1g17310 bglu_1g17320 bglu_1g17330 bglu_1g17340 bglu_1g17350 bglu_1g17360 bglu_1g17370 bglu_1g17380 bglu_1g17390 bglu_1g17400 bglu_1g17410 bglu_1g17420 bglu_1g17430 bglu_1g17440 bglu_1g17450 bglu_1g17460 bglu_1g17470 bglu_1g17480 bglu_1g17490 bglu_1g17500 bglu_1g17510 bglu_1g17520 bglu_1g17530

hypothetical protein hypothetical protein hypothetical protein protein lysB hypothetical protein hypothetical protein phage baseplate assembly protein V phage baseplate assembly protein Baseplate J-like protein hypothetical protein bacteriophage protein hypothetical protein hypothetical protein hypothetical protein phage major tail tube protein Gp28, phage tail protein E Gp29, bacteriophage membrane protein phage protein U phage protein D hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein

bglu_1g20220 bglu_1g20230 bglu_1g20240

hypothetical protein Gp272 putative exported phospholipase, patatin-like protein hypothetical protein Mannosyl-glycoprotein endo-beta-Nacetylglucosamidase hypothetical protein gp51 gp52 hypothetical protein hypothetical protein putative phage tail protein phage baseplate assembly protein V hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein

bglu_1g20250 bglu_1g20260 bglu_1g20270 bglu_1g20280 bglu_1g20290 bglu_1g20300 bglu_1g20310 bglu_1g20320 bglu_1g20330 bglu_1g20340 bglu_1g20350 bglu_1g20360 bglu_1g20370 bglu_1g20380 bglu_1g20390

37


7

bglu_1g20400 bglu_1g20410 bglu_1g20420 bglu_1g20430 bglu_1g20440 bglu_1g20450 bglu_1g20460 bglu_1g20470 bglu_1g20480 bglu_1g20490 bglu_1g20500 bglu_1g20510 bglu_1g20520 bglu_1g20530 bglu_1g20540 bglu_1g20550 bglu_1g20560 bglu_1g20570 bglu_1g20580 bglu_1g20590 bglu_1g20600 bglu_1g20610 bglu_1g20620 bglu_1g20630 bglu_1g20640 bglu_1g20650 bglu_1g20660 bglu_1g20670 bglu_1g20680 bglu_1g20690 bglu_1g20700 bglu_1g20710 bglu_1g20720 bglu_1g20730 bglu_1g20740 bglu_1g20750 bglu_1g20760 bglu_1g20770 bglu_1g20780 bglu_1g20790 bglu_1g20800 bglu_1g20810 bglu_1g20820 bglu_1g20830 bglu_1g20840

64.5

hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Bbp25 putative bacteriophage protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Replicative DNA helicase hypothetical protein gp51 hypothetical protein hypothetical protein hypothetical protein XRE family transcriptional regulator transcriptional regulator, Cro/CI family protein gp21 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Delta 1-pyrroline-5-carboxylate dehydrogenase hypothetical protein hypothetical protein C-5 cytosine-specific DNA methylase hypothetical protein gp43 hypothetical protein hypothetical protein hypothetical protein hypothetical protein gp33 phage integrase family protein hypothetical protein 38


bglu_1g20850 bglu_1g20860 bglu_1g20870 bglu_1g20880 bglu_1g20890 bglu_1g20900 bglu_1g20910 bglu_1g20920 bglu_1g20930 bglu_1g20940 bglu_1g20950 bglu_1g20960 bglu_1g20970 bglu_1g20980 bglu_1g20990 bglu_1g21000 bglu_1g21010 bglu_1g21020 bglu_1g21030 bglu_1g21040 bglu_1g21050 bglu_1g21060 bglu_1g21070 bglu_1g21080 bglu_1g21090 bglu_1g21100 bglu_1g21120 bglu_1g21130 bglu_1g21140 bglu_1g21150 bglu_1g21160 bglu_1g21170 bglu_1g21180 bglu_1g21190 bglu_1g21200 bglu_1g21210 bglu_1g21220 bglu_1g21230 bglu_1g21240 bglu_1g21250 bglu_1g21260 bglu_1g21270

hypothetical protein hypothetical protein gp38 methyltransferase DNA methylase N-4/N-6 domain-containing protein hypothetical protein hypothetical protein exonuclease VIII, 5' - 3' specific dsDNA exonuclease hypothetical protein putative phage repressor hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein gp2 hypothetical protein phage Mu protein gp30-like protein hypothetical protein hypothetical protein hypothetical protein gp09 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Mannosyl-glycoprotein endo-beta-Nacetylglucosamidase hypothetical protein hypothetical protein hypothetical protein hypothetical protein phage P2 baseplate assembly protein gpV P42.1 hypothetical protein phage Mu protein gp47-like protein hypothetical protein 39


8

bglu_1g21280 bglu_1g21290 bglu_1g21300 bglu_1g21310 trnP3 bglu_1g21320

Tail fiber protein gp51 phage-related lysozyme gp26 tRNA-Pro3 anticodon GGG, product="tRNA-Pro" hypothetical protein

bglu_1g23280 bglu_1g23290 bglu_1g23300 bglu_1g23310 bglu_1g23320 bglu_1g23330 bglu_1g23340 bglu_1g23350 bglu_1g23360 bglu_1g23370 bglu_1g23380

integrase, catalytic region hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Rhs element Vgr protein hypothetical protein hypothetical protein hypothetical protein transposase IS3/IS911

60.8

bglu_1g23800 bglu_1g23810 bglu_1g23820 bglu_1g23830 bglu_1g23840 bglu_1g23850 bglu_1g23860 bglu_1g23870 bglu_1g23880 bglu_1g23890 bglu_1g23900 bglu_1g23910 bglu_1g23920 bglu_1g23930

9

bglu_1g23940 bglu_1g23950 bglu_1g23960 66.0 bglu_1g23970 bglu_1g23980 bglu_1g23990 bglu_1g24000 bglu_1g24010 bglu_1g24020 bglu_1g24030

hypothetical protein hypothetical protein hypothetical protein hypothetical protein gp29 hypothetical protein gp30 putative transposase Csp231I DNA methyltransferase hypothetical protein hypothetical protein ParA putative ATP-dependent exoDNAse (exonuclease V) subunit alpha type IV secretory pathway VirD4 components-like protein disrupted gene hypothetical protein hypothetical protein Ankyrin hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein 40


bglu_1g24040 bglu_1g24050 bglu_1g24060 bglu_1g24070 bglu_1g24080 bglu_1g24090 bglu_1g24100 bglu_1g24110 bglu_1g24120 bglu_1g24130

Nuclease of the RecB family-like protein hypothetical protein hypothetical protein DNA-binding protein hypothetical protein UvrD/REP helicase adenine specific DNA methyltransferase hypothetical protein hypothetical protein putative transcriptional regulator, XRE family protein hypothetical protein hypothetical protein DNA topoisomerase III TrfA family protein hypothetical protein YeeP disrupted gene hypothetical protein phage/plasmid primase P4, C-terminal hypothetical protein hypothetical protein disrupted gene hypothetical protein disrupted gene hypothetical protein hypothetical protein Surface-exposed protein hypothetical protein putative integrase

bglu_1g24140 bglu_1g24150 bglu_1g24160 bglu_1g24170 bglu_1g24180 bglu_1g24190 bglu_1g24200 bglu_1g24210 bglu_1g24220 bglu_1g24230 bglu_1g24240 bglu_1g24250 bglu_1g24260 bglu_1g24270 bglu_1g24280 bglu_1g24290 bglu_1g24300 bglu_1g24310 bglu_1g24320

10

bglu_1g26960 bglu_1g26990 bglu_1g27000 bglu_1g27010 bglu_1g27020 bglu_1g27030 bglu_1g27040 bglu_1g27050 bglu_1g27060 bglu_1g27070 bglu_1g27080 bglu_1g27090 bglu_1g27100 bglu_1g27110

hypothetical protein PAAR repeat-containing protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein gp54 gp27 hypothetical protein hypothetical protein phage late control D family protein phage tail X family protein phage P2 GpU family protein hypothetical protein

62.6

41


bglu_1g27120 bglu_1g27130 bglu_1g27140 bglu_1g27150 bglu_1g27160 bglu_1g27170 bglu_1g27180 bglu_1g27190 bglu_1g27200 bglu_1g27210 bglu_1g27220 bglu_1g27230 bglu_1g27240 bglu_1g27250 bglu_1g27260 bglu_1g27280 bglu_1g27300 bglu_1g27310 bglu_1g27320 bglu_1g27330 bglu_1g27340 bglu_1g27350 bglu_1g27360 bglu_1g27370 bglu_1g27380 bglu_1g27390 bglu_1g27400 bglu_1g27410 bglu_1g27420 bglu_1g27430 bglu_1g27440 bglu_1g27450 bglu_1g27460 bglu_1gt51 11

bglu_1g28490 57.8 bglu_1g28500

Pyocin R2_PP, tail length determination protein hypothetical protein phage major tail tube protein phage tail sheath protein hypothetical protein hypothetical protein phage tail protein I Baseplate J family protein GPW/gp25 family protein hypothetical protein hypothetical protein phage baseplate assembly protein V hypothetical protein hypothetical protein hypothetical protein internal stop codon would be translated as tryptophan due to suppressor functions hypothetical protein hypothetical protein hypothetical protein hypothetical protein phage terminase large subunit (GpA) hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein metal-dependent hydrolases of the beta-lactamase super hypothetical protein hypothetical protein hypothetical protein hypothetical protein protein TraN phage integrase tRNA-Arg4 anticodon CCT, Cove score 72.32 ATP-dependent endonuclease of the OLD familylike protein hypothetical protein

42


2.3.3. PCR validation for the unique regions of B. glumae 336gr-1 The bands (PCR amplification products) were formed only for the samples that had 336gr-1 genomic DNA, indicating that the primers could amplify only specific regions of the 336gr-1 genomic DNA (Figure 15) and not those samples that had BGR1 genomic DNA. This confirms that the unique regions of 336gr-1 genome were absent in BGR1 genome. Another set of eleven pairs of primers for the unique regions of BGR1 were used to validate these regions (Figure 16).

Figure 15. Bands indicating the amplified targeted regions for the samples containing 336gr-1 genomic DNA. L = Ladder; A3 – J3 = Samples with 336gr-1 genomic DNA; A1 – J1 = Samples with BGR1 genomic DNA.

43


Figure 16. Bands indicating the amplified targeted regions for the samples containing BGR1 genomic DNA. L = Ladder; A3 –K3 = Samples with 336gr-1 genomic DNA; A1 – K1 = Samples with BGR1 genomic DNA; L1 –L3 = Negative controls (without any added DNA template); M1, M3 (Positive controls): Samples with 336gr-1 (M1) and BGR1 (M3) genomic DNA, amplified with known primers for ITS region

44


2.3.4. Pairwise sequence comparison: Pairwise sequence comparison was performed using Exonerate (Slater & Birney, 2005) to check the presence of genes already known or thought to be involved in virulence (Table 3) in B. glumae strain BGR1 and other phytopathogenic bacteria and was revealed that 84 genes listed were present in the genome of B. glumae 336gr-1.

2.3.5. Genomic Island predictions The genomic islands of the two chromosomes predicted using the SIGI-HMM were incorporated into the CGView maps and were depicted in Figures 17 and 18 respectively. Most of the unique loci for BGR1 and 336gr-1 are associated with atypical GC content and the presence of genes characteristic of mobile genetic elements, which corresponded to the putative genomic islands. Significant amount of plasticity in the genomes, contributed mainly by horizontal gene transfer and dynamic rearrangements within portions of the genomes, has been observed in these closely related strains of B. glumae, that infect the same host plant, rice, but in different geographical settings. Majority of the genomic islands and the other unique regions showed variation in GC content compared to rest of the genome, indicating that those regions could have been acquired over different time scales.

45


Figure 17. Chromosome 1 map incorporated with the predicted genomic islands data. The genomic islands identified by either or both of the two methods (SIGI-HMM (SIGI and IslandPath-DIMOB) DIMOB) are represented on chromosomes 1 by the outer red bands. The outermost two rings show features extracted from the B. glumae strain BGR1 genome (GenBank file). The next two light red rings show positions of BLAST hits detected by BLASTn searches against BGR1 and 336gr 336gr-1 1 genomes. The next innermost two rings show GC content and GC skew. Each is plotted as the deviation from the average for the entire sequence.

46


Figure 18. Chromosome 2 map incorporated with the predicted genomic islands data. The genomic islands identified by either or both of the two methods (SIGI-HMM (SIGI and IslandPath-DIMOB) DIMOB) are represented on chromosomes 2 by the outer red bands. The outermost two rings show features extracted from the B. glumae strain BGR1 genome (GenBank file). ). The next two light red rings show positions of BLAST hits detected by BLASTn searches against BGR1 and 336gr 336gr-1 1 genomes. The next innermost two rings show GC content and GC skew. Each is plotted as the deviation from the average for the entire sequence.

47


2.3.6. DISCUSSION : Many Burkholderia species genomes show inherently rapid evolution by acquisition of foreign DNA. It has been recorded that up to 10% of the genomes in many species are comprised of genomic islands (Coenye & Vandamme, 2007). Studies have revealed that the transfer of genomic islands is strongly influenced by the host background (Juhas et al., 2009). Genomic islands have been shown to be the key ingredient for the genome plasticity, especially in chromosome 1 of these highly virulent B. glumae strains (BGR1 and 336gr-1), isolated from rice fields of Louisiana in the US and South Korea. At the same time, some of the genomic islands, particularly those in chromosome 2, were conserved in both strains. The alignment of chromosome 2 of B. glumae strains BGR1 and 336gr-1 has shown excellent correspondence between them. The highly conserved nature of chromosome 2, along with the presence of important virulence determinant gene coding regions in it, such as those involved in type III secretion and toxoflavin production, indicates its importance in pathogenesis. The individual genes present in the identified genomic islands have phage related genes, which strongly indicates that they could have been acquired from other genomes by bacteriophage mediated transfer. The presence of multiple genomic islands, detectable pseudogenes, insertions, deletions and paralogous genes, indicates recent adaptation to diverse ecological niches and a reduced selection pressure in those specific regions of the B. glumae genome. Besides the core gene pool, the bacterial genome contains a variety of dispensable parts, which might facilitate their adaptation to diverse ecological conditions (Dobrindt & Hacker, 2001). The large size of the B. glumae genome (around 7.3 MB) allows the bacterial genome to encode a vast array of functions that support their survival 48


under diverse host and environmental conditions. These observations are consistent with that of other bacteria that shows great versatility in their host ranges or habitats (Juhas et al., 2009). The presence of a substantial amount of plasticity in the genome of B. glumae strains would have great significance in the study of pathogenesis of this important phytopathogenic bacteria and ultimately in the development of control measures or resistant host varieties.

49


CHAPTER 3: CHARACTERIZATION OF ECF SIGMA 70 GENE AND SIGMA 54 DEPENDENT RESPONSE REGULATOR GENE (TEPR) IN BURKHOLDERIA GLUMAE, STRAIN 336GR-1.

50


3.1.0. LITERATURE REVIEW : 3.1.1. Sigma factors Transcription initiation in many bacteria requires specific proteins, known as σ factors that bind reversibly to the catalytically active core RNA polymerase and play an important role in the specificity of transcription initiation (Helmann & Chamberlin, 1988). By exploiting these potential control points for gene expression regulation, bacteria have developed refined regulatory mechanisms that permit the cell to adapt to changing growth regimens (Buck et al., 2000). The functions of a few of these σ factors that have been determined, appear to be involved in regulation of bacterial interactions with their immediate environment, stress adaptation, and in certain cases, bacterial virulence (Missiakas & Raina, 1998). The σ factors identified in bacteria can be categorized into two major classes based on their structure and function (Buck et al., 2000). Common cellular transcription requires the predominant, or primary σ factor (Vismara et al., 1990). The primary σ factor in E. coli is referred to as σ70, which is involved in the expression of several vital genes during the exponential growth phase. It has been revealed from bacterial genome projects that the genes which code for σ factors belonging to the ECF (extracytoplasmic function) family, are widespread in numerous bacterial species (Manganelli et al., 2001). Generally, the sigmas belong to a single family of proteins, which are structurally and functionally related to the σ70 of Escherichia coli. Another major group of sigma factor σ54 (σN), encoded by rpoN, is commonly seen in prokaryotes (Merrick, 1993). In spite of the lack of any significant similarity in their sequences, both the categories of σ factors bind to the same core RNA polymerase, but they produce holoenzymes with dissimilar properties (Buck et al., 2000).

51


The members of σ70 family can broadly be divided into four main groups on the basis of gene structure and function. The largest of them is group four, with highly diverged extracytoplasmic function (ECF) subfamily (Paget & Helmann, 2003). Group 1 σ70 factors directs general transcription, whereas the other accessory σ factors (groups 24) typically function in turning on specific gene sets as a response to a suitable signal. The group four members respond to signals from the extracytoplasmic environment, such as the presence of misfolded proteins in the periplasmic space (Paget & Helmann, 2003). Extracytoplasmic function sigma factors influence a variety of functions that include, plant pathogenicity in Pseudomonas syringae, synthesis of outer membrane proteins in Photobacterium sp. strain SS9, expression of heat-shock genes in E. coli, biosynthesis of alginates

and

carotenoids

in Pseudomonas

aeruginosa and Myxococcusxanthus,

respectively, iron uptake in E. coli and Pseudomonas sp., nickel and cobalt efflux in Alcaligenes europhus (Missiakas & Raina, 1998). σ54, encoded by rpoN is a widely distributed sigma factor that is known to be involved in the regulation of nitrogen metabolism, as seen in E. coli(Wolfe et al., 2004). σ54 factor was initially demarcated based on the genetic investigation of nitrogen regulation. In other organisms, σ54 additionally regulates diverse functions such as biogenesis of the polar flagella (swimming) and the lateral flagella (swarming) in Vibrio parahaemolyticus (Stewart & McCarter, 2003); motility and bioluminescence in Vibrio harveyi(Lilley & Bassler, 2000);activation of transcription of both the flagellin and pilin genes, negatively affecting quorum-sensing genes and promoting virulence in Pseudomonas aeruginosa (Ishimoto & Lory, 1989, Totten et al., 1990); regulation of flagellin gene transcription in Vibrio cholera (Wolfe et al., 2004) etc. It has been shown

52


that the σ54 factor functions as a σ factor in vitro. This protein shows little sequence similarity with other known σ factors (Hunt & Magasanik, 1985). σ54-dependent transcription activation is highly regulated by environmental signals by regulatory modules in the enhancer-binding proteins (EBPs) and also sometimes by other regulatory protein interactions (Studholme & Dixon, 2003). σ54dependent transcription activation uses ATP hydrolysis for isomerizing the initial transcriptionally inactive Eσ54 promoter DNA complex (closed complex), to a transcriptionally capable open complex (Joly et al., 2007). PAS domains, PRD modules, V4R domains, GAF domains, and CheY-like response regulator domains etc. may form the sensory modules in EBPs, and they are generally represented by an N-terminal region (Studholme & Dixon, 2003). AAA+ proteins constitute a family of chaperone-like ATPases which function as molecular machines responsible for the formation and remodeling of protein and protein-nucleic acid complexes (Neuwald et al., 1999). σ

54

-

dependent EBPs are actually AAA+ proteins (Studholme & Dixon, 2003). Many EBPs include only the σ54 interaction module along with a DNA-binding domain. PspF, the phage shock protein, is a well-characterized one among these. pspABCDE operon encodes several proteins that might help the cell to adapt to changes in membrane integrity (Elderkin et al., 2002). This is brought about by filamentous phage infection and the presence of secretin proteins, which assists in the export of large protein complexes from the cell, which includes virulence factors and type II and type III secretion systems. PspA seem to assist E. coli in coping with insertions of secretins in the membrane, in addition to its function as a regulator of PspF. In Yersinia enterocolitica, pspC gene is important for normal growth (Darwin & Miller, 2001).According to

53


phylogenetic analysis, PspF is found to belong to a clade of response regulator EBPs. In Pseudomonas syringae, HrpR/HrpS regulators of plant pathogenicity genes are EBPs that lack regulatory input domains. (Studholme & Dixon, 2003). There is also a group of well-studied class of EBPs that contain the two-component response regulator receiver CheY-like domain at their N termini. This forms a part of the system by which bacteria can sense and respond to a variety of stresses and environmental cues (Hoch, 2000).

3.2.0. MATERIALS AND METHODS : 3.2.1. Disruptive mutation of the ECF σ70 gene and σ54 dependent response regulator gene. The primer pair ECFTB fp (forward primer) ACGATCTGGTCCAGGCCTCG and ECFTB rp (reverse primer) GATCGGCACCTCGAGCAGTT was used to amplify the internal fragment of the ECF σ70 gene (locus_tag="bglu_1g00130"). The amplified region of interest was cloned using StrataClone PCR Cloning Kit (Stratagene, La Jolla, CA, USA). Restriction digestion was carried out on the PCR clone as well as the vector (pKNOCK Gm conjugative suicide vector). The insert and the vector were then ligated. The original primer pair ECFTB (fp) and ECFTB (rp) was used to confirm the resultant constructs. The constructs obtained were electroporated into E. coli S17-1λpir competent cells. Triparental mating was then done to create disruptive mutation of the ECF σ70 gene in B. glumae strain 336gr-1. The recipient (B. glumae, 336gr-1), the donor (pKNOCK derivative) and the helper strains (E.colipRK2013::Tn7) were grown overnight. 500 µl donor, 500 µl recipient and 500 µl helper strain were then mixed together. The mixture obtained was centrifuged at 13, 2000 rpm for one min and the supernatant was discarded. The remaining pellet was re-suspended in 50 µl Luria Bertani (LB) broth. This was 54


inoculated as a spot culture on LB plate and incubated at 300C for 12 h. The culture grown was suspended in 1ml LB broth and then plated (using 100 µl of the suspension) onto LB nitrofurantoin (100 µg/ml) / gentamicin plates (20 µg/ml). The parental B. glumae 336gr-1 strain has natural resistance to nitrofurantoin. These plates were incubated at 300C for two days. The following PCR program and primers were used to amplify the internal homologous fragment in the middle of the ECF σ70 Gene.

1. Initialization step:

95°C for 2 minutes

2. Denaturation step:

94°C for 1 minutes

3. Annealing step:

55°C for 30 seconds

4. Extension/elongation step:

72 °C for 1 minute

5. Go to step 2:

for 29 times.

Final elongation:

70°C for 7 minutes

A similar approach was used by Ms. Inderjit Kaur Barphagha in our lab to generate disruptive mutants of the σ54 dependent response regulator gene (tepR) (locus_tag="bglu_1g09700"). This gene was of interest because, random mutagenesis using miniTn5gus transposon (a mini-Tn5 derivative containing a promoter less gus reporter gene encoding β-glucuronidase) was conducted on B. glumae, strain 336gr-1, in our lab, to study the regulatory genes that control the expression of virulence factors. Nearly 50 interesting mutants that showed altered phenotypes for toxoflavin, lipase or exopolysaccharide production, out of more than 20,000 mutants screened. They were identified by sequencing the mutated genes. One of the mutant (that had miniTn5gus 55


insertion site in the middle of the coding region of tepR), showed increased toxoflavin production. Whereas, three other mutants (EM4, EM7 and EM11) that had transposon insertion upstream of tepR, showed reduced toxoflavin and EPS production symptoms.

3.2.2. Onion virulence test of the mutants

To test the virulence of the mutants generated with respect to the wild type virulent 336gr-1 strain, a modified onion virulence test (Jacobs et al., 2008) was conducted. The outer scales of brown skinned onion were removed using a sterile knife and the fleshy scales were cut into small squares of nearly 3-4 cm sides. The bacterial cultures that were to be tested were grown on LB agar for 48 h and were adjusted to 108 cfu/ml using 10 mM MgCl2. The inner region of the onion scales were inoculated with 2 Âľl of this suspension, by making a small wound with the micropipette tip. The inoculated onion sections were incubated in a moist chamber at 300C for about 72 h. The maceration area produced on the inoculated area indicated the virulence level of the inoculum.

3.2.3. Test for production of toxoflavin on King’s B agar media

Toxoflavin (yellow colored toxin) production was observed by the intensity and spread of the yellow color on LB and KB agar plates with the respective bacterial culture. The inoculated media plates were incubated at 300C for 48 h. The intensity of the color and its spread was observed at an interval of 24 h.

3.2.4. Hypersensitive reaction of tobacco leaves against the mutants Bacterial cells were dissolved in 10 mM MgSO4 to make the suspension to an OD600 value of 0.5. This suspension was infiltrated in tobacco leaves (of three month old 56


tobacco plants) with the help of a syringe. Hypersensitive response was observed after 18 h of infiltration. 3.2.5. Swimming and swarming assay on SWA and SWI agars. Since the disruptive mutants generated for σ54 dependent response regulator gene showed variation in growth pattern from its wild type strain 336gr-1, swimming and swarming assays (Kim et al., 2007) were conducted on SWI (semi solid 0.7% LB agar medium) and SWA agars (semi solid 0.3% LB agar medium) respectively to test the role of the gene in motility of the bacteria under different growth conditions.

3.3.0 RESULTS: 3.3.1. The ECF σ70 disruptive mutants showed similar phenotypes as its wild type strain. ECF σ70 disruptive mutants showed almost the same amount of toxoflavin production as wild type 336gr-1, when grown on LB and KB agar media plates (Figure 1a). Similar results were observed when they were grown on LB broth (Figure 19 b). Onion virulence assay revealed that the ECF σ70 disruptive mutants were not avirulent. They showed comparable maceration area as the wild type 336gr-1 (Figure 20). The mean of the relative maceration area caused by the mutant was plotted along with similar quantification of the wild type (Figure 21). This was computed using the ௔

௕

formula: A= ߨ ቀଶ + ଶቁ2; where a and b are the long and short diameters respectively, of the maceration region.

57


Figure19. (a) Toxoflavin production of ECF σ70 disruptive mutant* and wild type 336gr-1 on KB media. (b) Toxoflavin production of ECF σ70 disruptive mutant* and wild type 336gr-1 in LB broth. * ∆ here indicates disruptive mutation

Figure 20. Maceration on Onion scales produced by inoculation of ECF σ70 mutant and wild type 336gr-1. 58


Figure 21. Relative virulence (maceration area in cm2) on onion, by ECF σ70mutant as compared to wild type 336gr--1.

Similar elicitation of HR on tobacco (F (Figure 22) leaves was observed when they were separately inoculated with a suspension of ECF σ70 disruptive mutant and wild type B. glumae strain 336gr-1.

Figure 22.. HR testing on tobacco leaves by (a) wild type 336gr 336gr-1 1 (b) ECF σ70 disruptive mutant (c) Negative control (buffer)

59


3.3.2. The Ďƒ54 dependent response regulator gene (tepR) disruptive mutants showed similar virulence associated phenotypes as its wild type strain. tepR disruptive mutants showed almost the same amount of toxoflavin production as wild type 336gr-1, when grown on LB and KB agar media plates (Figure 23a). The same results were observed when they were grown on LB broth (Figure 23b).

Figure 23. (a) Toxoflavin production by tepR disruptive mutants and wild type 336gr-1, when grown on KB media. (b) Toxoflavin production by tepR disruptive mutants and wild type 336gr-1, when grown in LB broth.

Onion virulence assay revealed that most of the inoculums with tepR disruptive mutants did not show any increase in virulence as it was expected. Most of them produced comparable maceration area as the wild type 336gr-1 (Figure 24). The mean of the relative maceration area caused by the mutant was plotted along with similar quantification of the wild type (Figure 25).

60


Figure 24. Maceration on Onion scales by tepR disruptive mutants and wild type 336gr-1. 336gr

Figure 25. Relative virulence (maceration area in cm2) on onion, by tepR mutant and the wild type. Even though most of the virulence associated phenotypes were similar to that of the wild type B. glumae strain 336gr 336gr-1, 1, it was interesting to observe that the tepR mutant consistently showed slower growth on LB and KB solid media. To study whether this was because the motility of the bacteria was affected, swimming and swarming assays (Kim et al., 2007) were conducted on SWA and SWI agars to test the role of the gene in 61


motility of the bacteria under different growth conditions. Swimming and swarming assays also showed comparable able results as the wild type (F (Figure 26, Figure27).

Figure 26. Swimming assays in semi semi-solid 0.7% LB agar medium, to compare the swimming motility of wild type 336gr-1 and tepR mutant.

Figure 27. Swarming assays in semi semi-solid 0.3% LB agar medium, to compare the swarming motility of wild type 336gr 336gr-1 and tepR mutant.

62


3.4.0. DISCUSSION: Unlike what was hypothesized based on the function of ECF σ70 gene and σ54 dependent response regulator gene (tepR) in closely related bacterial species, the results indicate that they do not have any direct role in the virulence of B. glumae strain 336gr-1. At the same time, it was interesting to note a consistent slower growth pattern for tepR mutant. Swimming and swarming motility assays showed that this was not because of any reduced motility, unlike what has been observed with Vibrio parahaemolyticus (Stewart & McCarter, 2003) and Vibrio harveyi(Lilley & Bassler, 2000), where σ54 is known to influence their motility. σ54, encoded by rpoN is known to be involved in the regulation of nitrogen metabolism in E. coli(Wolfe et al., 2004). σ54 factor was initially demarcated based on the genetic investigation of nitrogen regulation. This study also indicates that tepR might be involved in nutrient regulation in B. glumae, which could be the reason for slower growth and multiplication of the bacteria.

63


CHAPTER 4: RNA-SEQ BASED TRANSCRIPTOME ANALYSIS TO STUDY THE GENE EXPRESSION OF BURKHOLDERIA GLUMAE, STRAIN 336GR-1.

64


4.1.0. LITERATURE REVIEW : 4.1.1. Quorum sensing mechanism in B. glumae Quorum sensing (QS) is a mechanism of bacterial cell-to-cell communication, which relies upon the interaction of a small diffusible signal molecule with a sensor or transcriptional activator to link gene expression with cell population density (Withers et al., 2001). QS -dependent regulation is involved in various cellular processes that include production

of

extracellular

polysaccharides,

degradative

enzymes,

antibiotics,

siderophores, and pigments, as well as Hrp protein secretion, Ti plasmid transfer, motility, biofilm formation, and epiphytic fitness. Because of the significance of QS regulatory systems in pathogenesis, interference with QS signaling may provide a mechanism for controlling bacterial diseases of plants (von Bodman et al., 2003). Bacterial components for QS have very often been important targets for designing new antibacterial drugs (Khmel & Metlitskaya, 2006). N-acyl homoserine lactones (AHLs) are common QS signaling molecules in Gram-negative bacteria. These AHL-type molecules are also vital for B. glumae in QSdependent production of its known virulence factors (toxoflavin and lipase) (Devescovi et al., 2007). B. glumae produces two types of AHL molecules [N-hexanoyl homoserine lactone (C6-HSL) and N-octanoyl homoserine lactone (C8-HSL)] in similar amounts (Kim et al., 2004). Yet, only C8-HSL is essential for the expression of the known virulence genes. The genes tofI and tofR are responsible for the C8-HSL synthesis. tofI encodes a 22.4 kDa protein homologous to members of the LuxI family and tofR encode a 26.6 kDa protein homologous to members of the LuxR family (Kim et al., 2007). The biological function of C6-HSL is still unknown in B. glumae. The regulatory complex 65


that involves multiple QS signal molecules has not been studied very well in spite of the significance of this genus in human and plant health.

4.1.2. RNA-Seq based transcriptome analysis The transcriptome is the total set of transcripts, for a definite stage of development or functional form. Understanding the transcriptome provides an insight for interpreting the functional elements of the genome and understand various developmental and disease mechanisms (Wang, et al. 2009). Research in the field of transcriptome analysis has evolved from using Northern blotting for candidate gene-based detection of RNAs to high-throughput expression profiling (Morozova et al., 2009). Massively parallel cDNA sequencing, popularly called as RNA-seq in little time since its initial application, has resulted in several advances in characterization and quantification of transcriptomes (Ozsolak & Milos, 2011). DNA sequencing approaches has the advantage of directly determining the identity and the abundance of a transcript. Resequencing applications using next-generation sequencers are currently becoming popular, especially with the completion of reference genomes of several organisms (Morozova et al., 2009). For many eukaryotes, their transcriptomes have been reported by direct highthroughput Illumina sequencing of cDNAs (Illumina RNA-seq). But to date, very little work has been done on bacterial transcriptomes, likely because of the absence of mRNA polyA tails in bacteria, that impedes exact targeting of the mRNA from the considerably larger rRNA pool (Yoder-Himes et al., 2009). Also, the possibility of their degradation by exonucleases is greater in case of bacterial RNA because of poly adenylation (Skvortsov & Azhikina, 2010). The half-life of bacterial RNA is comparatively short,

66


which averages to seven minutes; and that specifically for their mRNAs is even less than two minutes (Hambraeus et al., 2003, Selinger et al., 2003). Because of these reasons, isolating high quality bacterial RNA suitable for further analysis is contingent on how fast the method used for RNA isolation permits inactivation of ribonucleases and stabilization of RNA. Recent progress in high-throughput DNA sequencing methods, particularly RNAseq, has enabled novel techniques for mapping and quantifying transcriptomes, and has strong advantages over other prevailing methods. It has significantly reduced the cost of sequencing and experimental intricacy, along with improved transcript coverage, thus rendering sequencing-based transcriptome analysis more accessible and beneficial to individual laboratories (Morozova et al., 2009). This technique is particularly well suited for de novo detection of splice junctions and facilitates genome-wide qualitative expression profiling (Ĺ abaj et al., 2011). Because many transcription factors are biologically active at low-copy numbers, this tool is very well suited for studies of gene regulation (Griffith et al., 2010). An emerging approach is to align reads to the reference genome; and based on this information, the transcripts can be assembled de novo and their abundance calculated (Trapnell et al., 2010). Transcriptomics gives novel biological insight, which helps us better understand gene structure, their splicing patterns and other post-transcriptional modifications, to detect rare and novel transcripts, and quantify the changing expression levels of each transcript during development and under different conditions. RNA-seq is emerging as a new and powerful method for transcriptome analysis. Unlike the classical 'single gene' approach, where biological phenomena are understood using a small set of model genes,

67


transcriptome research permits a bird's-eye view of a particular phenomenon in all genes concurrently (Sorek & Cossart, 2010).

4.2.0. MATERIALS AND METHODS: 4.2.1. Bacteria and culture conditions B. glumae, strain 336gr-1 and its mutant ∆tofI/tofR/orf1 (LSUPB139) provided by Ms. InderjitKaur and Ms. Ruoxi Chen , Dept. Plant Pathology & Crop Physiology, LSU AgCenter, were grown for a period of 48h on LB agar plates at 300C. They were then inoculated in LB broth and incubated at 370C for 12 h. One milliliter of this culture was purified twice, by centrifugation and re-suspension of the pallet in LB broth. This purified culture (15µl) was re-inoculated in 15ml LB broth and incubated at 370C. Bacterial cultures were collected at late exponential phase, when OD600 value was 1.0. 4.2.2. Isolation and enrichment of RNA Bacterial pellets made from cultures at their late exponential phase (OD600 = 1.0) were put through a freeze thaw cycle using liquid Nitrogen. Trizol (Invitrogen, Carlsbad, CA) was used to extract RNA following the manufacturer’s instructions. Ambion® DNase was used to remove any residual DNA from the isolated RNA samples. Elimination of DNA was verified by PCR amplification using primers for the ITS region of

B.

glumae.

Primer

pair

for

the

ITS

region**

forward

primer

(ACACGGAACACCTGGGTA) and reverse primer (TCGCTCTCCCGAAGAGAT) was used for verification of the removal of DNA.

68


The concentration (ng/µl) and purity (260/280 value) of RNA was checked using a NanoDrop 1000 Spectrophotometer. Bioanalyzer (LSU Biological sciences, common facility) was used to check the integrity of RNA. The RNA samples were then separated from any unincorporated NTPs, enzymes, and buffer components by using a MEGAclear™ Kit. Ambion®MicrobExpress kit was used to enrich bacterial mRNA from purified total RNA by removing the 16S and 23S ribosomal RNAs (rRNA). 4.2.3. RNA processing 500ng of ribosomal depleted RNA was fragmented by the addition of fragmentation buffer (10X RNase III buffer + RNase III, Ambion) and heating at 37°C for 10 minutes. Immediately after the incubation, nuclease free water was added and the samples were placed on ice. RiboMinus™ Concentration Module (Invitrogen) was then used to further clean up the RNA. The concentration and purity of RNA samples thus obtained were checked using a NanoDrop 1000 Spectrophotometer. 4.2.4. Constructing amplified whole transcriptome library and sequencing The fragmented and cleaned RNA samples were treated with Ambion adaptor mix in the presence of hybridization solution so that the adaptors were ligated to the ends of the RNA fragments. Reverse transcription was performed using components of the Ambion® RNA-Seq library construction kit. The cDNA thus produced was purified using a MinElute® PCR purification kit (Qiagen). This purified cDNA was amplified using Ambion® RNA-Seq library construction kit. The following PCR program was employed for the amplification.

69


1.

Initialization step:

95°C for 5 minutes

2.

Denaturation step:

95°C for 30 seconds

3.

Annealing step:

62°C for 30 seconds

4.

Extension/elongation step:

72 °C for 30 seconds

5.

Final elongation:

72°C for 30 seconds

6.

Go to step 2:

for 14 times.

Final hold:

72°C for 7 minutes

The amplified PCR products were loaded on to 1% agarose gel and electrophoresis was carried out at 120V. The stained gel was illuminated and the region containing 200-250 bp cDNA was excised. GenElute™ Gel Extraction Kit (SigmaAldrich) was used to purify this extracted cDNA and the samples (eluted into 20µl elution buffer) were sequenced using Illumina GAIIx (Single-end sequencing at 50cycles). 4.2.4. Sequence analysis Quality control was performed on the Illumina GAIIx sequence reads for the two samples (wild type 336gr-1 and LSUPB139) using the Galaxy platform. This was done to get rid of any reads that contained N’s and those that were too short. A summary statistics file and a box plot of quality scores was prepared to check the quality of the data. TopHat(Langmead et al., 2009), a fast splice junction mapper was used to map the reads to the reference genome (B. glumae strain BGR1). The TopHat output files were transferred to Cufflinks (Roberts et al., 2011), to assemble transcripts and estimate their abundance and expression. The transcript sequences from the two samples were extracted 70


using the original reference sequence and the co-ordinates of the assembled transcripts dataset. Cuffdiff program that is included in the Cufflinks (Roberts et al., 2011) package was used to find significant changes in transcript expression. CummeRbund, an R package, was then used to create a SQLite database of the results. It was also used to plot and visualize the results that were stored in this database. 4.3.0. RESULTS: High quality RNA (260/280 value greater than 2.0), with no DNA contamination was extracted from the two samples. The replicates for each of the samples were combined to minimize any experimental bias. Using the AmbionŽMicrobExpress kit, bacterial mRNA was enriched by removing 95% of the ribosomal RNAs. Bioanalyser results before mRNA enrichment (Figure 28. a, b, c) and after the preparation of amplified whole transcriptome library (Figure 29. a, b, c) ensured that the integrity of the RNA samples were good at each stages. 1.6 Gb of sequence reads for wild type 336gr-1 sample and 953.9 Mb of sequence reads for LSUPB139 sample were obtained from the Illumina GAIIx. A summary statistics file and a box plot of quality scores were obtained, after quality control was performed to remove any reads that contain N’s and those that are too short. The gene expression, transcript expression and assembled transcript datasets were obtained by running the Cufflinks program. Estimated gene-level expression values were obtained from the gene expression dataset; and the estimated isoform-level expression values were given in the transcript expression dataset. Both these datasets were in FPKM tracking format.

71


Figure 28. (a) Gel image from bioanalyser, before before mRNA enrichment. (b) Bioanalyser integrity curves (electropherogram) for the two samples of LSUPB139 (c) Bioanalyser integrity curves (electropherogram) for the two samples of wild type 336gr-1.

72


Figure 29. (a) Gel image and electropherogram for wild type 336gr-1 sample after mRNA enrichment and preparation of amplified whole transcriptome library.

Figure 29. (b) Gel image and electropherogram for LSUPB139 sample after mRNA enrichment and preparation of amplified whole transcriptome library.

73


Figure 30. csDensity plot showing the distributions of FPKM scores across samples. (q1 = wild type 336gr-1; 1; q2 = LSUPB139)

From the SQLite database of the results created using the CummeRbund package, csDensity plot was created to assess the distributions of FPKM scores across samples (Figure 30). Pairwise comparison between the two samples w were ere made by using csScatter (Figure 31a) Using the CummeRbund R package, a gene set that contains only genes g that had significant difference in their expression, was created. 87 such genes with significant expression difference under the two sample conditions (wild type 336gr-1 336gr and LSUPB139) were identified. A pairwise comparison (Figure 31 b) using csScatter and a

74


heatmaps (Figure 32)) for genesets between the two samples mples within this specific geneset gene were obtained

Figure 31 Pairwise comparison between the two samples (q1 = wild type 336gr-1; 336gr q2 = LSUPB139) using csScatter (a) global level (b) comparison for the gene set that shows significant expression difference. 75


Figure 32. Heatmap showing the difference in gene expression between the two samples (q1 = wild type 336gr-1; q2 = LSUPB139) for the given gene set (corresponding gene names are given in the appendix). Darker regions indicate lower levels of gene expression (log10 FPKM value).

4.4.0. DISCUSSION: Quorum sensing, the ability of intercellular communication and the resultant collective behavior as a group brings forth obvious advantages to the bacteria that demonstrate this phenomenon. Those advantages include the capability to migrate to better nutrient supply or hosts, employ new modes of growth, like sporulation or biofilm formation, that may facilitate defense against harmful environments,

76

production of


toxins etc. (de Kievit & Iglewski, 2000). Previous studies in our lab showed that LSUPB139 (∆tofI/tofR/orf1) did not produce any toxoflavin, one of the major virulence factor of B.

glumae. This indicated the role of the quorum sensing system in the

production of this phytotoxin. Global transcriptome analysis of a highly virulent B. glumae strain 336gr-1 (wild type) and its comparison with its mutant that was deficient for genes involved in quorum sensing has shown that the expression of 87 genes are influenced by the quorum sensing genes tofI/tofRand their intergenic region, orf1. Of the 87 genes that showed significant difference in their expression levels under the two conditions studied, 16 genes (including the 3 deleted genes) showed no expression under the ∆tofI/tofR/orf1 condition. At the same time, 4 genes (that codes for: ABC amino acid transporter, periplasmic ligand binding protein, predicted phosphatases and Cold shock-like protein CspD, respectively) were over expressed under the ∆tofI/tofR/orf1 condition. Rest of the 67 genes showed reduced levels of expression than in the wild type condition. It was interesting to note the reduced expression of a translation initiation inhibitor and eight transcriptional regulators under the ∆tofI/tofR/orf1 condition. Further specific experimental study in this regard will unravel the mechanisms that are affected by each of them. This study also gives an indication that the diguanylatecyclase pathway, that plays an important role in the virulence of B. glumae, is quorum sensing dependent. A gene that codes for the Type II secretion system protein E was found to be significantly under-expressed in the quorum sensing deficient mutant. It has been reported that, when their genes are overexpressed, the components of the type II secretion apparatus can form a pilus-like structure. This structure may act as a piston, and by its extension and

77


retraction action, pushes the secreted proteins through the gated pore (Sandkvist, 2001). This study indicates that this mechanism could be involved in the transport of the phytotoxins in B. glumae and also about the possibility that it could be regulated by the quorum sensing mechanism.

78


CHAPTER 5: CONCLUSIONS

79


Bacterial Panicle Blight (BPB) caused by B. glumae is an emerging threat to rice production in several rice producing areas of the world. There is a lack of any significant control measures for this disease, mainly because of limited research in this area. Most of the important virulence mechanisms, epidemiology and host resistance mechanisms are not well understood. Comparative genomic and genome wide expression studies will augment the information on B. glumae genome, its virulence factors and regulatory mechanisms, and also contribute to the information available for other animal and plant pathogenic Burkholderia species. The whole genome sequencing of B. glumae strain 336gr-1 that was isolated from Louisiana, and its comparative genomics study with the B. glumae strain BGR1 from South Korea has revealed significant amounts of plasticity in the genomes of these phytopathogenic bacteria. The presence of mobile genetic elements, many of which corresponded to genomic islands, indicate that this plasticity is brought about mainly by horizontal gene transfer mechanism and dynamic rearrangements within portions of their genomes. The highly conserved nature of chromosome 2 in both strains and the presence of major virulence associated genes in this chromosome revealed its importance in pathogenicity. The remaining part of the genomes of these two rice pathogenic B. glumae strains that infect the same host plant, but in different geographic locations, shows significant variation. These regions might be dispensable for survival or pathogenesis but help the bacteria adapt to diverse ecological niches. ECF Ďƒ70 and Ďƒ54 -dependent response regulator genes are known to have important roles in the pathogenicity of bacteria that are closely related to B. glumae. Characterization of these genes in a highly virulent strain of B. glumae, 336gr-1, has

80


revealed that they are not directly responsible for the virulence of B. glumae. But it was interesting to note a slower growth pattern of the bacterial culture that had the gene for the Ďƒ54 -dependent response regulator mutated. Because the motility remained the same, this phenotypic characteristic could be because the nutrient regulation was affected. Global transcriptome analysis of B. glumae strain 336gr-1 has shown that the expressions of 87 genes were influenced by the quorum sensing genes tofI/tofRand their intergenic region, orf1. Type II secretion system protein E encoding gene was found to be significantly under-expressed in the quorum sensing deficient mutant. This reflects the role of the quorum sensing mechanism in regulating the formation of pilus-like structure that is responsible for the export of bacterial toxins. The role of quorum sensing in regulating the diguanylatecyclase pathway, that plays an important role in the virulence of B. glumae, was also confirmed by this study. Better understanding of B. glumae with regard to its virulence and regulatory mechanisms underlying bacterial pathogenesis will help develop better and effective disease control strategies. The use of the knowledge we gain about plant-pathogen interactions can be used to engineer plants for increased resistance to diseases and thereby lessen the need for synthetic chemical inputs.

81


REFERENCES Alfano, J. R. & A. Collmer, (2004) Type III secretion system effector proteins: Double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol.42: 385414. Altschul, S. F., W. Gish, W. Miller, E. W. Myers & D. J. Lipman, (1990) Basic local alignment search tool. Journal of Molecular Biology215: 403-410. Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J. Ostell & D. L. Wheeler, (2008) GenBank. Nucleic Acids Research36: D25-D30. Birol, I., S. D. Jackman, C. B. Nielsen, J. Q. Qian, R. Varhol, G. Stazyk, R. D. Morin, Y. Zhao, M. Hirst, J. E. Schein, D. E. Horsman, J. M. Connors, R. D. Gascoyne, M. A. Marra & S. J. M. Jones, (2009) De novo transcriptome assembly with ABySS. Bioinformatics25: 2872-2877. Buck, M., M. T. Gallegos, D. J. Studholme, Y. Guo & J. D. Gralla, (2000) The bacterial enhancer-dependent sigma(54) (sigma(N)) transcription factor. Journal of Bacteriology182: 4129-4136. Cho, H. S., S. Y. Park, C. M. Ryu, J. F. Kim, J. G. Kim & S. H. Park, (2007) Interference of quorum sensing and virulence of the rice pathogen Burkholderia glumae by an engineered endophytic bacterium. FEMS Microbiology Ecology60: 14-23. Coenye, T. & P. Vandamme, (2003) Diversity and significance of Burkholderia species occupying diverse ecological niches. Environmental Microbiology5: 719-729. Coenye, T. & P. Vandamme, (2007) Burkholderia : molecular microbiology and genomics.Horizon Bioscience, Wymondham. Darwin, A. J. & V. L. Miller, (2001) The psp locus of Yersinia enterocolitica is required for virulence and for growth in vitro when the Ysc type III secretion system is produced. Molecular Microbiology39: 429-445. de Kievit, T. R. & B. H. Iglewski, (2000) Bacterial Quorum Sensing in Pathogenic Relationships. Infect. Immun.68: 4839-4849. Devescovi, G., J. Bigirimana, G. Degrassi, L. Cabrio, J. J. LiPuma, J. Kim, I. Hwang & V. Venturi, (2007) Involvement of a Quorum-Sensing-Regulated Lipase Secreted by a Clinical Isolate of Burkholderia glumae in Severe Disease Symptoms in Rice. Appl. Environ. Microbiol.73: 4950-4958. Dobrindt, U. & J. Hacker, (2001) Whole genome plasticity in pathogenic bacteria. Curr. Opin. Microbiol.4: 550-557.

82


Elderkin, S., S. Jones, J. Schumacher, D. Studholme & M. Buck, (2002) Mechanism of Action of the Escherichia coli Phage Shock Protein PspA in Repression of the AAA Family Transcription Factor PspF. Journal of Molecular Biology320: 23-37. Gonzalez, C. F., E. A. Pettit, V. A. Valadez & E. M. Provin, (1997) Mobilization, Cloning, and Sequence Determination of a Plasmid-Encoded Polygalacturonase from a Phytopathogenic Burkholderia (Pseudomonas) cepacia. Mol. PlantMicrobe Interact.10: 840-851. Griffith, M., O. L. Griffith, J. Mwenifumbo, R. Goya, A. S. Morrissy, R. D. Morin, R. Corbett, M. J. Tang, Y. C. Hou, T. J. Pugh, G. Robertson, S. Chittaranjan, A. Ally, J. K. Asano, S. Y. Chan, H. Y. I. Li, H. McDonald, K. Teague, Y. J. Zhao, T. Zeng, A. Delaney, M. Hirst, G. B. Morin, S. J. M. Jones, I. T. Tai & M. A. Marra, (2010) Alternative expression analysis by RNA sequencing. Nat. Methods7: 843-U108. Ham, J. H., R. A. Melanson & M. C. Rush, (2011) Burkholderia glumae: next major pathogen of rice? Mol. Plant Pathol.12: 329-339. Hambraeus, G., C. von Wachenfeldt & L. Hederstedt, (2003) Genome-wide survey of mRNA half-lives in Bacillus subtilis identifies extremely stable mRNAs. Molecular Genetics and Genomics269: 706-714. Helmann, J. D. & M. J. Chamberlin, (1988) Structure and Function of Bacterial Sigma Factors. Annual Review of Biochemistry57: 839-872. Hoch, J. A., (2000) Two-component and phosphorelay signal transduction. Curr. Opin. Microbiol.3: 165-170. Hunt, T. P. & B. Magasanik, (1985) Transcription of Glna by purified Escherichia-coli components - core Rna-polymerase and the products of Glnf, Glng, and Glnl. Proc. Natl. Acad. Sci. U. S. A.82: 8453-8457. Iiyama, K., N. Furuya, K. Hara, N. Nakashima, Y. Takanami & N. Matsuyama, (1994) Phytotoxin produced by Pseudomonas-glumae kurita-et-tabei, a causal bacterium of the grain and seedling rot of rice. Journal of the Faculty of Agriculture Kyushu University38: 175-181. Ishimoto, K. S. & S. Lory, (1989) Formation of pilin in Pseudomonas aeruginosa requires the alternative sigma factor (RpoN) of RNA polymerase. Proceedings of the National Academy of Sciences86: 1954-1957. Jacobs, J. L., A. C. Fasi, A. Ramette, J. J. Smith, R. Hammerschmidt & G. W. Sundin, (2008) Identification and Onion Pathogenicity of Burkholderia cepacia Complex Isolates from the Onion Rhizosphere and Onion Field Soil. Applied and Environmental Microbiology74: 3121-3129. 83


Jeong, Y., J. Kim, S. Kim, Y. Kang, T. Nagamatsu & I. Hwang, (2003) Toxoflavin Produced by Burkholderia glumae Causing Rice Grain Rot Is Responsible for Inducing Bacterial Wilt in Many Field Crops. Plant Disease87: 890-895. Joly, N., M. Rappas, S. R. Wigneshweraraj, X. Zhang & M. Buck, (2007) Coupling nucleotide hydrolysis to transcription activation performance in a bacterial enhancer binding protein. Molecular Microbiology66: 583-595. Juhas, M., J. R. Van Der Meer, M. Gaillard, R. M. Harding, D. W. Hood & D. W. Crook, (2009) Genomic islands: tools of bacterial horizontal gene transfer and evolution. FEMS Microbiology Reviews33: 376-393. Kang, Y., J. Kim, S. Kim, H. Kim, J. Y. Lim, M. Kim, J. Kwak, J. S. Moon & I. Hwang, (2008) Proteomic analysis of the proteins regulated by HrpB from the plant pathogenic bacterium Burkholderia glumae. Proteomics 8: 106-121. Khmel, I. & A. Metlitskaya, (2006) Quorum sensing regulation of gene expression: A promising target for drugs against bacterial pathogenicity. Molecular Biology40: 169-182. Kim, J., Y. Kang, O. Choi, Y. Jeong, J.-E. Jeong, J. Y. Lim, M. Kim, J. S. Moon, H. Suga & I. Hwang, (2007) Regulation of polar flagellum genes is mediated by quorum sensing and FlhDC in Burkholderia glumae. Molecular Microbiology64: 165-179. Kim, J., J.-G. Kim, Y. Kang, J. Y. Jang, G. J. Jog, J. Y. Lim, S. Kim, H. Suga, T. Nagamatsu & I. Hwang, (2004) Quorum sensing and the LysR-type transcriptional activator ToxR regulate toxoflavin biosynthesis and transport in Burkholderia glumae. Molecular Microbiology54: 921-934. Kim, J., J. Oh, O. Choi, Y. Kang, H. Kim, E. Goo, J. Ma, T. Nagamatsu, J. S. Moon & I. Hwang, (2009) Biochemical Evidence for ToxR and ToxJ Binding to the tox Operons of Burkholderia glumae and Mutational Analysis of ToxR. J. Bacteriol.191: 4870-4878. Ĺ abaj, P. P., G. G. Leparc, B. E. Linggi, L. M. Markillie, H. S. Wiley & D. P. Kreil, (2011) Characterization and improvement of RNA-Seq precision in quantitative transcript expression profiling. Bioinformatics27: i383-i391. Langmead, B., C. Trapnell, M. Pop & S. Salzberg, (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology10: R25. Latuasan, H. E. & W. Berends, (1961) On origin of toxicity of toxoflavin. Biochimica Et Biophysica Acta52: 502-&.

84


Lessie, T. G., W. Hendrickson, B. D. Manning & R. Devereux, (1996) Genomic complexity and plasticity of Burkholderia cepacia. Fems Microbiology Letters144: 117-128. Lilley, B. N. & B. L. Bassler, (2000) Regulation of quorum sensing in Vibrio harveyi by LuxO and Sigma-54. Molecular Microbiology36: 940-954. Lim, J., T. H. Lee, B. H. Nahm, Y. Do Choi, M. Kim & I. Hwang, (2009) Complete Genome Sequence of Burkholderia glumae BGR1. Journal of Bacteriology191: 3758-3759. Manganelli, R., M. I. Voskuil, G. K. Schoolnik & I. Smith, (2001) The Mycobacterium tuberculosis ECF sigma factor σE: role in global gene expression and survival in macrophages†. Molecular Microbiology41: 423-437. Merrick, M. J., (1993) In a class of its own — the RNA polymerase sigma factor σ;54 (σN). Molecular Microbiology10: 903-909. Miller, N. A., S. F. Kingsmore, A. Farmer, R. J. Langley, J. Mudge, J. A. Crow, A. J. Gonzalez, F. D. Schilkey, R. J. Kim, J. van Velkinburgh, G. D. May, C. F. Black, M. K. Myers, J. P. Utsey, N. S. Frost, D. J. Sugarbaker, R. Bueno, S. R. Gullans, S. M. Baxter, S. W. Day & E. F. Retzel, (2008) Management of high-throughput DNA sequencing projects: Alpheus. J Comp Sci Sys Biol1: 132-148. Missiakas, D. & S. Raina, (1998) The extracytoplasmic function sigma factors: role and regulation. Molecular Microbiology28: 1059-1066. Morozova, O., M. Hirst & M. A. Marra, (2009) Applications of New Sequencing Technologies for Transcriptome Analysis. Annual Review of Genomics and Human Genetics10: 135-151. Nagamatsu, T., (2002) Syntheses, Transformation, and Biological Activities of 7Azapteridine Antibiotics: Toxoflavin, Fervenulin, Reumycin and Their Analogues. ChemInform33: 261-261. Nandakumar, R., A. K. M. Shahjahan, X. L. Yuan, E. R. Dickstein, D. E. Groth, C. A. Clark, R. D. Cartwright & M. C. Rush, (2009) Burkholderia glumae and B. gladioli Cause Bacterial Panicle Blight in Rice in the Southern United States. Plant Disease93: 896-905. Neuwald, A. F., L. Aravind, J. L. Spouge & E. V. Koonin, (1999) AAA+: A Class of Chaperone-Like ATPases Associated with the Assembly, Operation, and Disassembly of Protein Complexes. Genome Research9: 27-43. Ozsolak, F. & P. M. Milos, (2011) RNA sequencing: advances, challenges and opportunities. Nat Rev Genet12: 87-98. 85


Paget, M. S. B. & J. D. Helmann, (2003) Protein family review - The sigma(70) family of sigma factors. Genome Biology4. Roberts, A., H. Pimentel, C. Trapnell & L. Pachter, (2011) Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics. Saddler, G. S., (1994) IMI descriptions of fungi and bacteria no. 1219. Burkholderia glumae. Mycopathologia128: 59-60. Sandkvist, M., (2001) Biology of type II secretion. Molecular Microbiology40: 271-283. Selinger, D. W., R. M. Saxena, K. J. Cheung, G. M. Church & C. Rosenow, (2003) Global RNA half-life analysis in Escherichia coli reveals positional patterns of transcript degradation. Genome Research13: 216-223. Skvortsov, T. A. & T. L. Azhikina, (2010) A review of the transcriptome analysis of bacterial pathogens in vivo: Problems and solutions. Russian Journal of Bioorganic Chemistry36: 550-559. Slater, G. & E. Birney, (2005) Automated generation of heuristics for biological sequence comparison. BMC Bioinformatics6: 31. Sorek, R. & P. Cossart, (2010) Prokaryotic transcriptomics: a new view on regulation, physiology and pathogenicity. Nat Rev Genet11: 9-16. Stewart, B. J. & L. L. McCarter, (2003) Lateral Flagellar Gene System of Vibrio parahaemolyticus. J. Bacteriol.185: 4508-4518. Stothard, P. & D. S. Wishart, (2005) Circular genome visualization and exploration using CGView. Bioinformatics21: 537-539. Studholme, D. J. & R. Dixon, (2003) Domain Architectures of {sigma}54-Dependent Transcriptional Activators. J. Bacteriol.185: 1757-1767. Totten, P. A., J. C. Lara & S. Lory, (1990) The rpoN gene product of Pseudomonas aeruginosa is required for expression of diverse genes, including the flagellin gene. J. Bacteriol.172: 389-396. Trapnell, C., B. A. Williams, G. Pertea, A. Mortazavi, G. Kwan, M. J. van Baren, S. L. Salzberg, B. J. Wold & L. Pachter, (2010) Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol.28: 511-U174. Tsushima, S., H. Naito, and M. Koitabashi., (1996) Population dynamics of Pseudomonas glumae, the causal agent of bacterial grain rot of rice, on leaf sheaths of rice 86


plants in relation to disease development in the field. Ann. Phytopathol. Soc. Jpn62: 108-113. Vismara, D., M. F. Mezzopreti, M. S. Gilardini, P. Delporto, G. Lombardi, E. Piccolella, G. Damiani, R. Rappuoli & V. Colizzi, (1990) Identification of a 35-kilodalton Mycobacterium-tuberculosis protein containing b-cell and t-cell epitopes. Infect. Immun.58: 245-251. von Bodman, S. B., W. D. Bauer & D. L. Coplin, (2003) Quorum sensing in plantpathogenic bacteria. Annu. Rev. Phytopathol.41: 455-482. Winsor, G. L., B. Khaira, T. Van Rossum, R. Lo, M. D. Whiteside & F. S. L. Brinkman, (2008) The Burkholderia Genome Database: facilitating flexible queries and comparative analyses. Bioinformatics24: 2803-2804. Withers, H., S. Swift & P. Williams, (2001) Quorum sensing as an integral component of gene regulatory networks in Gram-negative bacteria. Curr. Opin. Microbiol.4: 186-193. Wolfe, A. J., D. S. Millikan, J. M. Campbell & K. L. Visick, (2004) Vibrio fischeri {sigma}54 Controls Motility, Biofilm Formation, Luminescence, and Colonization. Appl. Environ. Microbiol.70: 2520-2524. Xiong, M., Z. Zhao, J. Arnold & F. Yu, (2010) Next-Generation Sequencing. Journal of Biomedicine and Biotechnology2010. Yabuuchi, E., Y. Kosako, H. Oyaizu, I. Yano, H. Hotta, Y. Hashimoto, T. Ezaki & M. Arakawa, (1992) Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov, p. 12511275. Yoder-Himes, D. R., P. S. G. Chain, Y. Zhu, O. Wurtzel, E. M. Rubin, J. M. Tiedje & R. Sorek, (2009) Mapping the Burkholderia cenocepacia niche response via highthroughput sequencing. Proceedings of the National Academy of Sciences106: 3976-3981.

87


APPENDIX Table A1. 87 genes with significant expression difference under the two sample conditions (wild type 336gr-1 and LSUPB139)

Sl no

test_id

Gene and flanking regions

Chr omo som e

value_1

value_2

log2(fold _change )

test_ stat

p_ val ue

q_ val ue

1

CUFF.1036

Crystal protein ET79; Hypothetical protein; (front:nonfunctional due to frameshift back: Alanyl-tRNA synthetase)

1

111.017

10.6927

-3.37609

3.9584

7.5 5E05

0.0 024 723

2

CUFF.1059

Sodium:dicarboxylatesymporter

1

113.151

21.7407

-2.37977

3.9311 5

8.4 5E05

0.0 025 858

1

120.853

0

1.79769e+3 08

1.7976 9e+30 8

5.7 4E05

0.0 021 488

1

106.004

1.64432

-6.01049

5.7474 4

9.0 6E09

6.7 0E07

1

127.063

4.9068

-4.69462

7.8061

6.0 0E15

1.3 3E12

1

797.609

0

1.79769e+3 08

1.7976 9e+30 8

0.0 025 967

0.0 470 061

1

184.441

29.7046

-2.6344

3.0958 6

0.0 019 624

0.0 372 517

1

99.2259

7.46029

-3.73341

3.6146 6

0.0 003 007

0.0 076 218

2

100.614

16.9076

-2.57308

3.7368 5

0.0 001 863

0.0 048 801

3

CUFF.1079

4

CUFF.1086

5

CUFF.1090

6

CUFF.1093

7

CUFF.1279

8

CUFF.1593

9

CUFF.1738

(front:Transcriptional regulator, LuxR family back: GntR family transcriptional regulator) nonribosomal peptide synthase (front:Non-ribosomal peptide synthase back: Polyketide synthase) Beta-ketoacyl synthase (front:Polyketide synthase back:Long-chain-fatty-acid-CoA ligase) Translation initiation inhibitor (front:Di-haem cytochrome c peroxidase back: Hypothetical protein) Transcriptional regulator, LuxR family (back:disrupted gene) back: ) Hypothetical protein (front:ABC transporter-like protein back:Hypothetical protein) Diguanylatecyclase/phosphodie sterase (front:Sodium/bile acid symporter family protein back:Transcriptional regulator, LacI family) Taurine catabolism dioxygenaseTauD/TfdA (front:Transcriptional regulator, LysR family back: AMP-dependent synthetase and ligase)

88


10

CUFF.1 777

Demethylmenaquinonemethyltr ansferase (front:Non-ribosomal peptide synthesis thioesterase back:Branched-chain amino acid aminotransferase)

2

97.6486

4.08086

-4.58065

6.4872 4

8.7 4E11

9.6 9E09

11

CUFF.1778

Branched-chain amino acid aminotransferase (front:Demethylmenaquinonem ethyltransferase back:BarC)

2

182.775

0

1.79769e+3 08

1.7976 9e+30 8

0.0 008 126

0.0 180 189

12

CUFF.179

Cold shock-like protein CspD (front:Molecular chaperone-like protein back:Amino acid permeaseassociated region)

1

65.3867

253.484

1.95483

-3.604

0.0 003 134

0.0 077 206

13

CUFF.1813

IclR-family transcriptional regulator;Beta-ketoadipyl CoA thiolase (front:RNA polymerase, sigma24 subunit, ECF subfamily protein back:methylacceptingchemotaxis sensory transducer)

2

125.614

29.2456

-2.1027

3.8168 4

0.0 001 352

0.0 039 966

14

CUFF.1872

sarcosine oxidase subunit alpha (front:sarcosine oxidase subunit delta back:sarcosine oxidase subunit gamma)

2

140.278

0

1.79769e+3 08

1.7976 9e+30 8

0.0 019 739

0.0 372 517

15

CUFF.1905

Putative coenzyme PQQ synthesis protein c; Putative Branched-chain amino acid aminotransferase; LmbE family protein; Phenazine biosynthesis PhzC/PhzFprotein;ATPdependent carboxylate-amine ligase domain-containing protein ATP-grasp; (front:MhpE-like protein back:Putative MFS transporter)

2

95.2826

2.11781

-5.49157

6.3280 6

2.4 8E10

2.4 5E08

16

CUFF.1907

Hypothetical protein; Threonine dehydrogenase; TPR repeatcontaining protein (front:Putative MFS transporter back:Transcriptional regulator, AraC family)

2

102.159

4.74687

-4.42769

4.7255 4

2.3 0E06

0.0 001 197

89


17

CUFF.1938

LuxR family transcriptional regulator; Putative transposase; putative outer membrane protein OprM; putative RND efflux transporter; putative RND efflux membrane-fusion protein; Hypothetical protein; Hypothetical protein; LysR family transcriptional regulator (front:Hypothetical protein back: putative ubiquinone/menaquinone biosynthesis methyltransferase)

2

119.236

5.15463

-4.5318

7.6267 2

2.4 0E14

4.2 5E12

18

CUFF.1941

LysR family transcriptional regulator;putative ubiquinone/menaquinone biosynthesis methyltransferase; Putative GTP cyclohydrolase II; WDrepeat-containing protein; serine/threonine kinase; riboflavin biosynthesis protein RibD; Putative transposase; disrupted gene;

2

347.418

2.07197

-7.38953

9.6404 3

0

0

2

169.554

0

1.79769e+3 08

1.7976 9e+30 8

6.0 6E05

0.0 021 488

(front:Hypothetical protein back: LuxR family transcriptional regulator)

19

CUFF.2067

Linear gramicidin synthetase subunit D; Hypothetical protein; B (front:putative non-ribosomal peptide synthetase back: eta-hydroxylase, aspartyl/asparaginyl family)

20

CUFF.2072

Beta-lactamase (front:GNAT family acetyltransferase back: Thioesterreductase)

2

96.7319

0

1.79769e+3 08

1.7976 9e+30 8

5.4 5E05

0.0 021 488

21

CUFF.2076

Non-ribosomal peptide synthetase/polyketide synthase (front:Thioesterreductase back:Non-ribosomal peptide synthase)

2

100.336

0

1.79769e+3 08

1.7976 9e+30 8

6.0 0E05

0.0 021 488

90


22

CUFF.2085

Transcription factor jumonji; Metallo-beta-lactamase superfamily protein; MbtH-like protein; (front:Hypothetical protein back:nitrate/sulfonate/bicarbona te ABC transporter periplasmic protein)

2

128.859

2.84836

-5.49952

6.654

2.8 5E11

3.6 1E09

23

CUFF.2159

Carboxymuconolactone decarboxylase; disrupted gene (front:Major facilitator superfamily back:disrupted gene)

2

84989.4

15514.3

-2.45369

3.3542 2

0.0 007 959

0.0 180 189

24

CUFF.2346

ABC transporter permease/ATP-binding protein (front:OsmC family protein back:CAAX amino terminal protease family protein)

2

101.477

5.95992

-4.08972

5.4886 1

4.0 5E08

2.4 0E06

25

CUFF.2388

Phosphomethylpyrimidine kinase; Methyltransferase, UbiE/COQ5 family; Thymidylate synthase; putative nucleoside 2deoxyribosyltransferase; MutT/nudix family protein (front:putativethiaminase I back:Cyclopropane-fatty-acylphospholipid synthase)

2

136.315

4.04995

-5.0729

6.9653 5

3.2 8E12

4.8 4E10

26

CUFF.2431

malonate transporter subunit L; Major facilitator superfamily transporter; heat shock protein Hsp20; heat shock protein Hsp20; (front:Hypothetical protein back: Alpha,alpha-trehalosephosphate synthase)

2

129.846

22.8881

-2.50413

4.2898 2

1.7 9E05

0.0 008 812

27

CUFF.2440

Insertion element IS402; nonribosomal peptide synthase (front:Homogentisate 1,2dioxygenase back:Multi-sensor signal transduction histidine kinase)

2

193.059

13.238

-3.86628

6.2251 4

4.8 1E10

4.2 7E08

91


28

CUFF.2449

Transcriptional regulator, LysR family; transferasehexapeptide domain-containing protein; Hypothetical protein;

2

532.456

8.3927

-5.98738

9.3828 5

0

0

(front:Hypothetical protein back:NADHflavinoxidoreductase/NADH oxidase)

29

CUFF.2480

ChaperoninGroEL; Chaperonin Cpn10; (front:Hypothetical protein back:Aconitatehydratase)

2

95.1346

22.1972

-2.09959

3.7358 8

0.0 001 871

0.0 048 801

30

CUFF.2517

Rhs element Vgr protein (front:Hypothetical protein back: disrupted gene)

2

126.569

0

1.79769e+3 08

1.7976 9e+30 8

0.0 025 967

0.0 470 061

31

CUFF.2621

Peptidase C11 clostripain (front:Putative TIS1421transposase orfA protein back: Putative TIS1421transposase orfA protein)

1p

96.6617

0

1.79769e+3 08

1.7976 9e+30 8

7.8 0E05

0.0 024 723

32

CUFF.2623

Transcriptional Regulator, AraC family (front:pyridoxamine 5'phosphate oxidase family protein back:transposase)

1p

99.7215

0

1.79769e+3 08

1.7976 9e+30 8

0.0 008 126

0.0 180 189

33

CUFF.2664

Beta-ketoacyl synthase; Putative exported avidin family protein; Major facilitator superfamily protein (front:polyketide synthase back:MethylmalonylCoAepimerase)

2p

202.561

0

1.79769e+3 08

1.7976 9e+30 8

7.2 9E05

0.0 024 723

34

CUFF.331

Putative LysR-family transcriptional regulator (front:Cob(II)yrinic acid a,cdiamidereductase back:serine-pyruvate aminotransferase)

1

139.105

9.92338

-3.8092

5.5666 6

2.6 0E08

1.6 5E06

35

CUFF.35

Hypothetical protein (front:AMP-binding domain protein back:Prephenatedehydratase)

1

378.332

60.9787

-2.63327

4.2774 4

1.8 9E05

0.0 008 826

92


36

CUFF.407

Cold-shock DNA-binding domain-containing protein (front:Hypothetical protein back:Exonuclease, DNA polymerase III, epsilon subunit family/GIY-YIG catalytic domain-containing protein)

1

223.977

53.4331

-2.06755

3.7590 9

0.0 001 705

0.0 047 269

37

CUFF.412

aminopeptidase N (front:5methyltetrahydropteroyltrigluta mate-homocysteine Smethyltransferase back:Putative lipoprotein)

1

111.156

22.4771

-2.30605

4.1233 2

3.7 3E05

0.0 015 774

38

CUFF.433

Predicted phosphatases (front:Hypothetical protein back: 3-demethylubiquinone-9 3-methyltransferase)

1

605.985

26353.5

5.44257

8.7941 7

0

0

39

CUFF.756

Secreted protein (front:Hypothetical protein back: short-chain alcohol dehydrogenase-like protein)

1

411.559

0

1.79769e+3 08

1.7976 9e+30 8

0.0 010 329

0.0 213 058

40

CUFF.814

Serine metalloprotease (front:glycogen synthase ack: alpha/beta hydrolase fold protein)

1

121.384

5.5986

-4.43837

5.1464 8

2.6 5E07

1.4 7E05

41

CUFF.826

Major facilitator superfamily MFS_1 (front:4Fe-4S ferredoxin ironsulfur-binding domain-containing protein back:Beta-ketoacyl synthase)

1

150.601

0

1.79769e+3 08

1.7976 9e+30 8

0.0 001 455

0.0 041 636

42

CUFF.837

Transcriptional regulator, LysR family (front:Extracellular ligandbinding receptor back:Alpha/beta hydrolase fold)

1

143.672

0

1.79769e+3 08

1.7976 9e+30 8

0.0 008 126

0.0 180 189

43

CUFF.841

Putative siderophore nonribosomal peptide synthetase MbaF (front:Oligopeptidase A back:TubF protein)

1

95.386

6.97239

-3.77405

3.2016 6

0.0 013 664

0.0 269 333

44

CUFF.854

Thiotemplate mechanism natural product synthetase (front:Putative non-ribosomal peptide synthase/polyketide synthase back: metallo-beta-lactamase family protein)

1

108.429

0

1.79769e+3 08

1.7976 9e+30 8

0.0 009 633

0.0 208 402

93


45

CUFF.856

metallo-beta-lactamase family protein (front:Thiotemplate mechanism natural product synthetase back:thioesterase II)

1

190.421

0

1.79769e+3 08

1.7976 9e+30 8

0.0 010 329

0.0 213 058

46

CUFF.860

TauD/TfdA family dioxygenase; CmaBprotein;phosphopantethei ne-containing protein (front:putative transport/efflux protein back: Peptide synthetase)

1

105.497

10.3642

-3.34752

5.7705 9

7.9 0E09

6.3 7E07

47

CUFF.861

transporter, CPA2 family (front:Peptide synthetase back: alpha/beta hydrolase family protein)

1

108.324

10.3702

-3.38484

5.7102

1.1 3E08

7.7 0E07

48

CUFF.874

ABC amino acid transporter, periplasmic ligand binding protein (front:ABC amino acid transporter, inner membrane subunit back:Transcriptional regulator, LysR family)

1

21.4836

120.186

2.48396

4.2627

2.0 2E05

0.0 008 958

49

CUFF.967

Type II secretion system protein E (front:Flppilus assembly protein TadB<Type II secretion system protein<TPR-repeat pilus assembly protein TadD back: Response regulator receiver protein>Type II and III secretion system protein>Flppilus assembly CpaB)

1

103.947

33.2661

-1.64372

2.9920 7

0.0 027 709

0.0 491 564

50

CUFF.985

disrupted gene (front:Transposase IS3/IS911 back: Acyl carrier protein )

1

161.347

46.6724

-1.78953

3.2711 7

0.0 010 71

0.0 215 913

94


VITA Felix Francis was born in the state of Kerala, in India, where he attended primary and higher secondary school. In 2008, he completed his undergraduate education from the department of Agriculture, Kerala Agricultural University, in India, with a major in Forestry. During this period, he served two consecutive terms as the University Union Councilor of Kerala Agricultural University, during the academic years, 2005and 2006. After completing a 6 month practical field research training program in agriculture, he worked as a research assistant at the department of agriculture, Kerala Agricultural University, for a period of one year. He joined Louisiana State University’s Department of Plant Pathology and Crop Physiology as a graduate student under Dr. Jong Hyun Ham, to pursue a Master’s program in Plant Health, in August 2010. His Master’s research projects focused on comparative genomics, transcriptome analysis and characterization of two regulatory genes of Burkholderia glumae, the primary causal agent of bacterial panicle blight of Rice. During his graduate study at LSU, he served as the co-chair of the journal club and the secretary of the Department of Plant Pathology and Crop Physiology Graduate Student Association. He received travel awards from Virginia Bioinformatics Institute, National Institute for Mathematical and Biological Synthesis, LSU Graduate School, LSU Department of Plant Pathology and Crop Physiology Graduate Student Association, and the American Phytopathological Society - Southern Division, for attending scientific meetings and workshops. He was also awarded the 1st place in Graduate student presentation competition, during the 2012American Phytopathological Society SD meeting.

95


Turn static files into dynamic content formats.

Create a flipbook
Leuisiana State University Thesis by Felix Francis by Dr Francis Xavier - Issuu