Skip to main content

Dietary vitamin c affects growth, antioxidant status and serum immune parameter of juvenile hybrid g

Page 1


DietaryvitaminCaffectsgrowth,antioxidant statusandserumimmuneparameterofjuvenile hybridgrouper(Epinephelusfuscoguttatus♀× Epinepheluslanceolatus♂)fedlowfishmealdiets

QinxiaoCai

https://ebookmass.com/product/dietary-vitamin-c-affectsgrowth-antioxidant-status-and-serum-immune-parameter-ofjuvenile-hybrid-grouper-epinephelusfuscoguttatus-%e2%99%80-x-epinepheluslanceolatus-%e2%99%82-fed-low-fish/

Instant digital products (PDF, ePub, MOBI) ready for you

Download now and discover formats that fit your needs...

Dietary methionine hydroxy analogue supplementation benefits on growth, intestinal antioxidant status and microbiota in juvenile largemouth bass Micropterus salmoides Ye Zhao

https://ebookmass.com/product/dietary-methionine-hydroxy-analoguesupplementation-benefits-on-growth-intestinal-antioxidant-status-andmicrobiota-in-juvenile-largemouth-bass-micropterus-salmoides-ye-zhao/ ebookmass.com

Woman 99 Greer Macallister

https://ebookmass.com/product/woman-99-greer-macallister/

ebookmass.com

Effects of dietary different canthaxanthin levels on growth performance, antioxidant capacity, biochemical and immune-physiological parameters of white shrimp ( Litopenaeus Vannamei ) Samia Fawzy

https://ebookmass.com/product/effects-of-dietary-differentcanthaxanthin-levels-on-growth-performance-antioxidant-capacitybiochemical-and-immune-physiological-parameters-of-white-shrimplitopenaeus-vannamei-samia-fawzy/ ebookmass.com

Ngh■ Giàu Và Làm Giàu Napoleon Hill

https://ebookmass.com/product/nghi-giau-va-lam-giau-napoleon-hill/

ebookmass.com

Stationen: Ein Kursbuch fu■r die Mittelstufe 4th Edition Prisca Augustyn

https://ebookmass.com/product/stationen-ein-kursbuch-fur-diemittelstufe-4th-edition-prisca-augustyn/

ebookmass.com

Brocklehurst’s Textbook of Geriatric Medicine and Gerontology 8th Edition Howard M. Fillit

https://ebookmass.com/product/brocklehursts-textbook-of-geriatricmedicine-and-gerontology-8th-edition-howard-m-fillit/

ebookmass.com

The ARRL Ham Radio License Manual

https://ebookmass.com/product/the-arrl-ham-radio-license-manual/

ebookmass.com

SEAL Wolf Surrender Terry Spear

https://ebookmass.com/product/seal-wolf-surrender-terry-spear-3/

ebookmass.com

Health Technology: Sourcebook 3rd Edition Health Reference

https://ebookmass.com/product/health-technology-sourcebook-3rdedition-health-reference/

ebookmass.com

Good Stocks Cheap Value Investing with Confidence for a Lifetime of Stock Market Outperformance Marshall

https://ebookmass.com/product/good-stocks-cheap-value-investing-withconfidence-for-a-lifetime-of-stock-market-outperformance-marshall/

ebookmass.com

Contents lists available at ScienceDirect

Aquaculture

journal homepage: www.elsevier.com/locate/aquaculture

Dietary vitamin C affects growth, antioxidant status and serum immune parameter of juvenile hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) fed low fishmeal diets

Qinxiao Cai a, b , Xiaoyi Wu a, b, * , Delbert M. Gatlin III c , Lu Zhang a, b , Haoyun Zhai a, b , Zhiyu Zhou a, b , Haoran Yin a, b , Lina Geng a, b , Misbah Irm a, b

a State Key Laboratory of Marine Resource Utilization in South China Sea, Haikou 570228, China

b Hainan Provincial Key Laboratory for Tropical Hydrobiology and Biotechnology, Department of Aquaculture, Hainan University, Haikou, Hainan 570228, China

c Department of Wildlife and Fisheries Sciences, Texas A & M University, College Station, TX 77843-2258, USA

ARTICLE INFO

Keywords:

Hybrid grouper

Vitamin C

Weight gain percentage

Immunoglobulin M

Antioxidant status

ABSTRACT

Ascorbic acid (Vitamin C - VC) is one of the essential micronutrients required for normal growth and physiology of fish. In this research, the optimum dietary VC requirement of juvenile hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) was evaluated in a comparative feeding trial and subsequent oxidative stress test. Six isoenergetic (340 kcal/kg), isoproteic (49%) and isolipidic (7%) experimental diets were supplemented with graded amounts of L-ascorbyl-2-polyphosphate (analyzed VC concentrations of 76, 86, 104, 126, 137 and 152 mg/kg dry matter) and hand-fed to fish (initial weight of 15 ± 0.1 g/fish (means ± S.D.)) in three replicate cages twice a day (08:00 h and 16:30 h) to apparent satiation for 7 weeks. Percent weight gain (WG%), together with the VC concentrations in liver and head kidney, were elevated with increasing dietary VC contents, reaching a plateau in the VC137 treatment. The optimal dietary VC requirement of hybrid grouper was estimated to be 148 mg/kg dry matter based on broken-line regression analysis of WG%. Serum immunoglobulin M (IgM) concentrations and the relative mRNA expression of hepatic insulin-like growth factor-1 (IGF-1) displayed a similar variation tendency as WG%. At the transcriptional level, the activity of Nrf2-Keap1 pathway was upregulated by VC supplementations, with the VC104 treatment showing the highest value. In summary, the optimal dietary VC requirement for the highest value of WG% of juvenile hybrid grouper was 148 mg/kg dry matter, and appropriate dietary VC supplementation improved oxidation resistance and serum IgM concentrations of the fish.

1. Introduction

Ascorbic acid (Vitamin C - VC), a water-soluble micronutrient, has been demonstrated to participate in many physiological functions in fish (Darias et al., 2011; NRC, 2011). In particular, adequate dietary VC is needed to support normal fish growth (Lin and Shiau, 2005; Zhou et al., 2012), and this may be through regulating IGF-1 expression and the utilization of several amino acids or collagen synthesis (Gerald and McClung, 2016; Dawood and Koshio, 2016; Cheng et al., 2017). Secondly, VC plays an important role in immunity as it can stimulate neutrophils to exert actions such as chemotaxis, phagocytosis and antimicrobial activity (Lin and Shiau, 2005; Johnny et al., 2007), as well as differentiate and proliferate the T-cells and B-cells (Carr and Maggini,

2017). IgM is secreted by B cells, and it is the first antibody to appear in the immune response (Alberts et al., 2002). Some previous studies have reported that proper VC supplementation to diets could affect IgM concentrations in serum of juvenile silver sillago (Sillago sihama) and the gill of grass carp (Ctenopharyngodon idella) (Huang et al., 2019; Xu et al., 2016a).

In addition, VC is also a potent antioxidant, and has been shown to elevate the activities of various antioxidases in fish including glutathione-transferase (GST), superoxide dismutase (SOD), glutathione reductase (GR), catalase (CAT) and glutathione peroxidase (GPx) in fish which has been attributed to the Nrf2 signaling pathway (Xing et al., 2012; Xu et al., 2016b).

Fish must obtain VC from the diet because they lack l-gulonolactone

* Corresponding author at: State Key Laboratory of Marine Resource Utilization in South China Sea, Haikou 570228, China. E-mail address: wjurk@163.com (X. Wu).

https://doi.org/10.1016/j.aquaculture.2022.738285

Received 30 January 2022; Received in revised form 19 April 2022; Accepted 20 April 2022

Availableonline25April2022 0044-8486/©2022ElsevierB.V.Allrightsreserved.

oxidase which is important for VC biosynthesis in other vertebrates (Ai et al., 2006). A dietary deficiency of VC can cause severe detrimental effects, such as poor growth, high mortality, depressed immunity, spinal deformation, caudal fin erosion and anorexia (Huang et al., 2019; Zhou et al., 2012; Ai et al., 2004).

The appropriate supplemented levels (mg/kg, dry matter) of VC in aquatic feeds varied remarkably among different marine fish species such as 23.8 for large yellow croaker Pseudosciaena crocea (Ai et al., 2006), 103 for Korean rockfish Sebastes schlegeli (Lee et al., 1998), 102.6–147.8 for largemouth bass Micropterus salmoides (Chen et al., 2015). Grouper is one of the important marine fish species cultured in Southeast Asia. Previous researches indicated that even in the grouper family, different grouper species have different VC requirements such as 30 for greasy grouper Epinephelus tauvina (Boonyaratpalin et al., 1993), 45.3 for malabar grouper Epinephelus malabaricus (Lin and Shiau, 2005), 70 for humpback grouper Cromileptes altivelis (Cui et al., 2013) Ebi et al. (2018) reported that when hybrid grouper was fed high fishmeal (70.8%) diets, 95 mg/kg or 156 mg/kg dietary VC was needed for fish normal skeletal development or optimal growth.

Up to date, information concerning the roles of VC in antioxidant status and serum immune parameter of hybrid grouper is limited. Furthermore, our recent studies have demonstrated that the fishmeal inclusion levels in diets of hybrid grouper can be reduced to about 20% by the use of alterative protein sources (Zhou et al., 2020; Ye et al., 2021), without negative effects on fish growth. Therefore, the main objective of this research was to evaluate the effects of different VC levels on growth, antioxidant status and serum immune parameter of this fish species which were fed low fishmeal diets.

2. Materials and methods

2.1. Ethical approval

The undertaking of this feeding trial complied with both Hainan University Application for Animal Welfare and Ethical Review (HNUAUCC-2022-00066) and “3R” (Replacement, Reduction, Refinement) rules from Hainan University Institutional Animal Use and Care Committee (Hainan University Office, Publication No. 2, revised 2020). All experimental fish were well fed, and prior to sampling, they were euthanized with MS-222 (0.1 g/L) to avoid possible pain.

2.2. Experimental design and diets

Six isoenergetic (340 kcal/kg), isoproteic (49%) and isolipidic (7%) experimental diets (expressed on a dry-matter basis) were formulated and manufactured with different levels of VC (Table 1). The form of VC was L-ascorbyl-2-polyphosphate (Guangzhou Chengyi Aquaculture Company, 35% ascorbic acid equivalent, C2PP). Dietary VC levels of this research were selected based on the studies on grouper’s VC nutrition (Lin and Shiau, 2005; Cui et al., 2013; Ebi et al., 2018).

All ingredients were accurately weighed. Vitamin mixtures and mineral mixtures were prepared one day in advance. Fishmeal, soybean protein isolate, poultry by-product meal, corn starch and cellulose were first mixed for 10 min in a Hobart mixer (A-200 T Mixer Bench Model unit; Resell Food Equipment Ltd), and then the remaining dry ingredients were added and continued to be mixed for 30 min. Finally, fish oil and water (40%) were added in order. Then the moistened mixture was squeezed into noodle-like shapes through a 3-mm die attached to a twin-screw meat grinder (Institute of Chemical Engineering, South China University of Technology, Guangzhou, China) and then broken into pellets. Diets were air-dried (16 ◦ C, 24 h), sieved, and then stored ( 20 ◦ C). The analyzed VC concentrations in these experimental diets were 76, 86, 104, 126, 137 and 152 mg/kg dry matter, and experimental treatments were abbreviated as VC76, VC86, VC104, VC126, VC137 and VC152.

Table 1

Formulation (dry matter basis, %) and analyzed compositions of the experimental diets.

Analyzed VC levels (mg/kg)

Analyzed compositions

C (mg/kg, dry matter)

1 Vitamin and mineral mixture see Lin and Shiau (2003)

2.3. Experimental procedures

Experimental fish were purchased from a commercial hatchery (Lingao, Hainan, China), and were acclimated to the culture system during a 2-week feeding period in which they were fed a commercial diet. The fish averaged 15 ± 0.1 g/fish (mean ± S.D.) were randomly distributed into floating cages (L 1.2 m × W 0.7 m × H 0.5 m) at a density of 12 fish per cage. Eighteen cages were randomly placed in 6 ponds, and each pond had three cages which were assigned to different dietary treatment. All ponds form a water-following system. Each diet was fed to experimental fish in three replicate cages to apparent satiation twice daily (08:00 h and 16:30 h), and feed intake was monitored every day. The feeding trial lasted for 7 weeks. Total ammonia and dissolved oxygen concentrations, as well as water temperature were monitored daily and ranged from 0 to 0.20 mg/L, 5.9–6.3 mg/L and 28–30 ◦ C respectively. Fish were exposed to a 12 h: 12 h light: dark cycle, and each week, they were gently moved out to be bulk weighed so that the growth performance could be known, and at this time, cages and ponds were brushed and rinsed with a high-pressure water gun.

2.4. Sampling

An initial sample of 10 fish was taken for the analysis of whole-body proximate composition prior to the feeding trial. At the termination, all fish were counted and weighed, and all diets were weighed and analyzed compositions to determine WG, feed efficiency (FE), protein efficiency ratio (PER), protein productive value (PPV) and survival rate. All fish were starved for 12 h, and then five fish were randomly selected from each cage and euthanized with MS-222 (0.1 g/L). Two fish were used for whole-body composition analysis, and the other three fish were separately bled from the caudal vasculature using heparinized syringes and dissected to obtain white muscle, liver and head kidney. The serum was collected by centrifuging for 15 min at 1000 ×g at 4 ◦ C. Samples of serum, head kidney and liver were stored at 80 ◦ C.

Percent weight gain (WG%) = 100 × weight gain (g)/initial average body weight (g)

Feed conversion ratio (FE) = total body weight of fish (g)/total dry matter intake (g)

Protein efficiency ratio (PER) = 100 × weight gain (g)/protein intake (g)

parker bottle. The HPLC (Waters 2690 System, German) conditions were as follows: chromatographic column: ZORBAX SB-C18 analytical column; mobile phase: methanol-ion pair reagent buffer (15:85, v/v); de-

Protein productive value (PPV) = 100 × body protein weight gain (g)/protein intake (g)

tector: DAD detector with detection wavelength of 254 nm; column temperature: 30 ◦ C; flow rate: 1.0 mL/min; injection volume: 10 μl.

Survival% = 100 × (final number of fish)/(initial number of fish)

2.5. The Cu challenge test

After the growth trial, the remaining fish were fed for a week more, and meanwhile, a preliminary experiment was carried out to determine the lethal concentration 50% of Cu (II). All remaining fish were finally challenged with 3 mg Cu (II) ⋅ L 1 for 65 h by adding CuSO4 to sea water. The Cu dose used in this study was close to those (4.0–4.5 mg ⋅ L 1) used in previous studies (Wu et al., 2018; Zhou et al., 2020). During the Cu challenge, fish were fasted, and the water flow was stopped, and the cumulative mortality of each cage was recorded. At the end of the Cu challenge, all remaining fish were euthanized with MS-222 and sampled to obtain serum, head kidney and liver for the analysis of antioxidative or immune parameters. All samples were stored at 80 ◦ C.

2.6. Compositional analysis and the determination of serum IgM concentrations

Crude protein (N × 6.25) and crude lipid were determined by the Dumas combustion method (the rapid MAX N exceed system, Elementar, Germany) and Soxhlet extraction method (the automated process of fat extraction ANKOMXT15 Extraction System, America), respectively. Dry matter was determined by putting about 3.5 g of sample in the oven (105 ◦ C) for 3–4 h. Enzyme-Linked ImmunoSorbent Assay (ELISA) commercial kits were used to determine VC concentrations in tissues (Kit no.:AE92364Fi, AMEKO, Lianshuo Biotechnology Company, Shanghai, China) and serum IgM concentrations (Kit no.: C0197170176. Cusabio Biotechnology Company, Hubei, China).

Dietary VC concentrations were determined by the HPLC method of Zhang and Zhou (2010) Briefly, the diets were ground (5 g) and extracted with KH2PO4 buffer solution (0.1 mol/L) in an ultrasonic bath at 45 ◦ C for 15 min, and then were filtered by syringe filter (0.45 μm). The ion pair reagent buffer was prepared by diluting 17 mL tetrabutyl ammonium hydrogen sulfate (0.33 mol/L) to 1000 mL with KH2PO4 buffer solution (0.1 mol/L), and then mixed well. The pH of the KH2PO4 buffer solution (0.1 mol/L) and ion pair reagent buffer were adjusted to 6 using NaOH solution (3 mol/L). Standard solutions of 2-Phospho-Lascorbic acid trisodium salt (Sigma-Aldrich) were prepared in KH2PO4 buffer solution (0.1 mol/L) and stored at 4 ◦ C in brown wide mouth

2.7. The quantitative real-time PCR (RT-qPCR) analysis of IGF-1, Nrf2 and Keap1

Total RNA from liver and head kidney were extracted with trizol (Ambion, Life Technologies, USA), chloroform, isopropanol, and ethanol (Silong Scientific Company, China), and then converted to cDNA by reverse transcription. The yield and purity of RNA were determined by NanoDrop®ND-1000 (Nanodrop, USA). The criterion of pure RNA was that the ratio of optical density between 260 nm and 280 nm should be in the range of 1.8–2.0. Finally, the integrity of total RNA was estimated by the brightness of 28S and 18S rRNA bands on a 1.0% denaturing agarose gel (Biofroxx, German), the intensity of the 28S rRNA band should be roughly twice that of the 18S rRNA band. RNA was reverse transcribed to cDNA by a kit (Takara, Japan). The SYBR® Green qPCR assay was selected in this kit.

The nucleotide sequences of IGF-1 (F: TATTTCAGTAAACCAACAGGCTATG; R: TGAATGACTATGTCCAGGTAAAGG), NF-E2-related factor 2 (Nrf2) (F: TATGGAGATGGGTCCTTTGGTG; R: GCTTCTTTTC CTGCGTCTGTTG) and Kelch-like ECH-associated protein 1 (Keap1) (F: TCCACAAACCCACCAAAGTAA; R: TCCACCAACAGCGTAGAAAAG) followed that of Zhou et al. (2020) A quantitative thermal cycler (LightCycler 480II, Roche) was used for the RT-qPCR reaction mix of 10 μL

Table 2

Growth performance and feed utilization of hybrid grouper juveniles fed different dietary VC levels for 7 weeks.

Regression (N 3) SBL

Note: PSE, pooled standard error of treatment means (n = 3); SBL, straight broken-line trend; Adj. R2, adjusted R square.

SBL

ParametersL=361.4

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

final volume. The 10 μl reaction volume contain 0.2 μl of each forward and reverse primer (10 μmol/L), 5 μl TB Green™ Premix Ex Taq™ II (Takara), 0.5 μl of cDNA, 4.1 μl of nuclease-free water. The RT-qPCR program was as follows: First, 95 ◦ C for 30 s. Second, forty cycles of 95 ◦ C, 5 s, 56 ◦ C, 30s and 72 ◦ C, 30s for quantification analysis mode. Third, 95 ◦ C, 5 s, 65 ◦ C, 60s, and 97 ◦ C, continuous acquisition mode for melting curves. Finally, 50 ◦ C for 30s. Standard curves were created by plotting the input amount of a plasmid DNA as standard template against threshold cycle numbers, and E = 10( 1/slope) – 1 was used to the calculation of amplification efficiency. The 2 ΔΔCT method (Livak and Schmittgen, 2001) was used for the calculation of the expression levels of IGF-1, Nrf2 and Keap1.

2.8. Statistical analysis

Normality and homoscedasticity assumptions were confirmed prior to any statistical analysis. All the parameters were analyzed by the broken-line regression model of the SAS® software package (SAS Institute Inc., Cary, NC USA), and the significance level was set at 0.05.

3. Results

3.1. Growth performance, feed utilization and expression of hepatic IGF-1

The results of growth performance are summarized in Table 2 and Fig. 1 All responses were significantly influenced by the different dietary VC treatments. WG% of fish was increased as dietary VC levels increased, with the plateau occurring at VC137. Values of FE, PER and PPV obtained in the VC137 and VC152 treatments were higher than those obtained in other treatments. Based on the broken-line regression analysis of WG% against dietary VC levels, the optimal dietary VC requirement was estimated to be 148 mg/kg dry matter (Fig. 1). There were no significant differences in survival rate among all experiment treatments during the growth trial. The relative mRNA levels of IGF-1 in liver were up-regulated by VC supplementations, with the VC137 treatment having the highest value (Fig. 3).

3.2. Whole-body, white muscle compositions as well as VC concentrations in liver, head kidney tissues

Proximate compositions of whole body and white muscle including crude protein, crude lipid and moisture contents were not significantly influenced by different dietary VC levels (Table 3). However, VC concentrations in liver and head kidney were remarkably influenced by different VC treatments (Fig. 2).

3.3. Immune and antioxidant indices before/after the challenge

There were no significant differences in survival among fish in all the dietary treatments during the Cu challenge. The VC104, VC126, VC137 and VC150 treatments showed higher IgM concentrations in serum before/after the challenge than the VC76 and VC86 treatments (Fig. 4), although this parameter was generally elevated with the Cu challenge. The Nrf2-Keap1 pathway in head kidney tissue was also significantly affected by different dietary VC concentrations. The VC126, VC137 and VC137 treatments displayed higher expression of Nrf2 but lower expression of Keap1 than other dietary treatments before the challenge. After the challenge, expression of Nrf2 and Keap1 showed similar tendencies as those observed before the challenge.

SBL

ParametersL=57.07 U= -0.0234 R=146.7

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

SBL

Fig. 2. The VC concentrations in liver and head kidney of hybrid grouper juveniles
Fig. 1. Relationship of WG (%) of hybrid grouper juveniles with dietary VC levels.

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

Fig. 3. Relative expression of IGF-1 in liver of hybrid grouper juveniles fed different dietary VC levels for 7 weeks (n = 9).

Table 3

The moisture, crude protein, crude lipid contents (%, fresh weight basis) in whole body and white muscle of experimental fish.

Analyzed

4. Discussion

4.1. Comparison of VC requirements between hybrid grouper and other fish species

It has been well recognized that vitamin C can regulate growth, reproduction, response to stressors, wound healing, and various immune responses of fish (NRC, 2011), so an adequate dietary level of VC is of considerable importance. In this study, for optimal weight gain, the minimum dietary VC requirement of hybrid grouper was determined to be 148 mg/kg of dry matter which is similar to reported requirement values for shrimp (Penaeus vannamei), largemouth bass and yellow drum (Nibea albiflora) (150 mg/kg, 148 mg/kg, 142 mg/kg) (Zhou et al., 2004; Chen et al., 2015; Wang et al., 2017). However, there were lower values reported for red drum (Sciaenops ocellatus) and Heterobranchus longifilis fingerlings (15 mg/kg, 82.2 mg/kg) (Aguirre and Gatlin, 1999; Ibiyo et al., 2007) or higher values reported for giant catfish (Pangasianodon gigas) and Wuchang bream (Megalobrama amblycephala Yih) (250 mg/kg, 700 mg/kg) (Pimpimol et al., 2012; Ming et al., 2012). Reasons for the widely varying requirement values may be due to metabolic differences in the various species and the size at which they were evaluated, the availability of the various VC forms and VC storage in tissues at initiation of the trials as well as duration of the trials (Chen et al., 2015). Ebi et al. (2018) reported that the dietary VC requirement of hybrid grouper which were fed high dietary fishmeal level (70.8%), but in the present

study, the fishmeal of diets was relatively low (19%), so, the VC requirement obtained here could make the VC nutrition of this species more comprehensive.

4.2. Responses of WG%, FE, PER, PPV and IGF-1 expression to dietary VC treatments

In this study, there was a positive relationship between feed utilization (FE, PER and PPV) and growth (WG%), with VC137 and VC152 having comparatively high values. These results indicated that proper dietary VC supplementations could promote feed and protein utilization of hybrid grouper, thereby improving their growth, which is in line with the findings obtained with largemouth bass (Yusuf et al., 2021) and ricefield eel (Monopterus albus) (Hu et al., 2020). It also has been reported that VC can significantly enhance amino acyl transferase enzyme activity, amino acid profile in muscle as well as intestinal digestive enzyme activity (Yusuf et al., 2021), which may explain the positive responses of FE, PER, PPV to dietary VC treatments.

The IGF-I/PI3K/AKT/mTOR signaling pathway is of great significance for regulating protein synthesis, proliferation, cell growth and differentiation (Chen et al., 2014). IGF-1 can initiate intracellular signal transduction by specifically binding to the IGF-1 receptor (IGF-1R) (Hakuno and Takahashi, 2018), and then triggers the downstream cascade of molecules including mammalian target of rapamycin (mTOR), phosphatidylinositol-3-kinase (PI3K) and protein kinase B (AKT) (Chen et al., 2014). It was shown that IGF-1 can promote growth of almost every cell because IGF-1R is present on the surface of many cell types, especially cartilage, bone and skeletal muscle (Chen et al., 2014). In several of our previous studies, IGF-1 has been demonstrated to be strongly responsible for the growth of hybrid grouper (Wu et al., 2018; Zhou et al., 2019; Li et al., 2019; Li et al., 2020; Zhou et al., 2021). The relative mRNA level of hepatic IGF-1 was up-regulated by suitable dietary VC supplementations in this study, demonstrating that VC may improve the growth of hybrid grouper through elevating the transcription level of hepatic IGF-1. Some other studies on pufferfish (Takifugu obscurus) and largemouth bass (Cheng et al., 2017; Yusuf et al., 2021) also reported similar observations.

4.3. VC concentrations in liver and head kidney tissues

In the present study, the VC concentrations in head kidney and liver tissues increased with dietary VC concentrations until leveling off at VC137 and VC126, respectively. The saturation of VC in head kidney and liver tissues of hybrid grouper agreed with the results of other studies (Xiao et al., 2010; Zehra and Khan, 2012; Zhou et al., 2012). Liver is an important organ in catabolism and storage of VC, and head kidney is a major immune organ (Xiao et al., 2010). Liver and kidney VC concentrations of less than 20 μg/g has been suggested as an indicator of VC deficiency in fish (NRC, 2011), and some previous studies reported that fish fed diets deficient in VC often exhibited signs of VC deficiency, such as high mortality, spinal deformation, caudal fin erosion and dark skin coloration (Ai et al., 2004; Zhou et al., 2012; Huang et al., 2019).

In this study, the lowest VC concentrations of liver (50.9 μg/g) and head kidney (55.1 μg/g) observed in VC76 group were above 20 μg/g, indicating no severe VC deficiency signs were manifested. Similar results were reported in ricefield eel and large yellow croaker (Ai et al., 2006; Hu et al., 2020). Several factors may induce the inconsistent results reported above for various studies. One of the most probable reasons for such differences is the size of experimental fish. Larger fish may require a longer time to deplete tissue stores of VC when they fed a VC-deficient diet (Ai et al., 2006). The average initial body weight in this study (15 g) was larger than those (2.33 g, 5.5 g, 6.26 g) in other studies (Ai et al., 2004; Zhou et al., 2012; Huang et al., 2019). Secondly, the relatively high VC concentration of the basal diet used in the present study may meet the minimum needs of healthy growing fish. The VC level of the basal diet (76 mg/kg) was much higher than values in basal diets (0 mg/

After challenge

SBL P = 0.047 R2 = 0.225

Parameters L=97.777 U= -2.2 R=84.88

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

Dietary VC levels (mg / kg)

Before challenge

SBL P < 0.001 R2 = 0.728

ParametersL=131.4 U= -0.394 R=136.7

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

After challenge

Serum IgM concentration (ng / ml)

Dietary VC levels (mg / kg)

Before challenge

SBL P <0.001 R2 = 0.678

Parameters L=2.05 U= -0.0787 R=89.1

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

7090110130150

Dietary VC levels (mg / kg)

Before challenge

Relative expression of Nrf2 in head kidney

SBL P =0.003 R2 = 0.550

Parameters L=152.7 U= -0.3755 R=140.6

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

7090110130150

Dietary VC levels (mg / kg)

After challenge

SBL P =0.006 R2 = 0.499

Parameters L=1.91 U= -0.0154 R=125.8

Z1=(x<R)*(R-x) Model y=L+U*(Z1)

7090110130150

Dietary VC levels (mg / kg)

After challenge

Fig. 4. Survival, serum IgM concentration and relative expression of Nrf2 and Keap1 in head kidney and of experimental fish before/after exposure to 3 mg Cu (II)⋅ L 1 for 65 h (n = 9).

SBL P <0.001 R2 = 0.615

Parameters L=0.518 U=0.0264 R=94

Z1=(x<R)*(R-x)

Model y=L+U*(Z1)

Relative expression

Relative expression of Keap in head kidney

Dietary VC levels (mg / kg)

kg, 17.5 mg/kg) of other studies (Aguirre and Gatlin, 1999; Wang et al., 2003; Chen et al., 2015). Thirdly, different VC sources have been shown to have different potency. Cross-comparison of the biopotencies of Lascorbyl-2-sulfare (C2S), C2PP, L-ascorbyl-2-monophosphate-Mg (C2MP-Mg) and VC was reported for grouper to be C2PP > C2MP-Mg > C2S (NRC, 2011). The VC sources used in this study were mainly from the basal diet and C2PP.

4.4. Responses of serum IgM concentrations to dietary VC treatments

Immunoglobulins (Ig) can mediate humoral adaptive immunity in fish (Mashoof and Criscitiello, 2016). IgM is one of the most important Ig in teleost humoral adaptive immunity (Bag et al., 2009), and it first appears in response to initial exposure to an antigen, and then recognizes and targets pathogens including foreign bacteria and viruses for targeted removal (Alberts et al., 2002). Xu et al. (2016a) and Huang et al. (2019) reported that dietary VC can positively influence IgM concentrations in liver and gill tissues of fish. In this research, IgM concentrations in serum were elevated by dietary VC supplementations before/after the Cu challenge, thus displaying enhancement in immune response and resistance to environmental stress. Some previous studies have shown that VC could differentiate and proliferate the T-cells and Bcells (Carr and Maggini, 2017), thereby enhancing IgM and IgG generation (Tanaka et al., 1994).

4.5. Responses of the Nrf2-Keap1 pathway to dietary VC treatments

Fish health also is intimately linked with oxidation resistance. The Nrf2-Keap1 pathway is the principal protective response to oxidative stress (Baird and Yamamoto, 2020). Sequestered by cytoplasmic Keap1 under normal physiological conditions, Nrf2 detaches from Keap1 and combines with an antioxidant responsive element to activate relative antioxidant genes transcription in response to oxidative stress (Bellezza et al., 2018; Huang et al., 2019), such as GPx, SOD and CAT (CarmonaAparicio et al., 2015). VC is a potent antioxidant and can scavenge free radicals and harmful oxygen derivatives (Carmona-Aparicio et al., 2015). Xu et al. (2016b) reported that VC could activate the expression of Nrf2 and enhance activities of SOD, CAT, GPx, GST and GR to remove reactive oxygen species in grass carp. In present study, the mRNA expression level of head-kidney Nrf2 was up-regulated with increasing dietary VC supplementation, reaching a plateau in fish fed VC104 before the challenge and those fed VC126 group after the challenge, respectively. This response was similar to the studies in grass carp and juvenile silver sillago (Xu et al., 2016b; Huang et al., 2019).

SBL P = 0.002 R2 = 0.566

Parameters L=0.482 U= -0.0152 R=109.2

Z1=(x<R)*(R-x)

Model y=L+U*(Z1)

7090110130150

Dietary VC levels (mg / kg)

5. Conclusions

Findings of this study demonstrated the optimal dietary VC requirement for normal WG% of hybrid grouper fed low fishmeal diets was 148 mg/kg of dry matter, and suitable dietary VC supplementation improved antioxidant status and serum IgM concentrations of this fish species.

Author contribution

This study was designed by Xiaoyi Wu. The feeding trial was conducted by Qinxiao Cai. Sampling by Lu Zhang, Haoyun Zhai, Zhiyu Zhou, Haoran Yin and Lina Geng. Data collection was conducted by Qinxiao Cai. The manuscript was written by Qinxiao Cai and amended by Xiaoyi Wu, Delbert M. Gatlin III and Misbah Irm.

Declaration of Competing Interest

Authors hereby declare no conflict of interest.

Acknowledgement

This study was supported by National Natural Science Foundation of China (No. 31760760). The authors would like to thank the experimental platform provided by laboratory and appreciate the editor and participant reviewers for their valuable suggestions on our manuscript.

References

Aguirre, P., Gatlin, D.M., 1999. Dietary vitamin C requirement of red drum Sciaenops ocellatus Aquac. Nutr. 5, 247–250. https://doi.org/10.1046/j.13652095.1999.00114.x

Ai, Q.H., Mai, K.S., Zhang, C.X., Xu, W., Duan, Q.Y., Tan, B.P., Liufu, Z.G., 2004. Effects of dietary vitamin C on growth and immune response of Japanese seabass, Lateolabrax japonicus Aquaculture 242, 489–500. https://doi.org/10.1016/j. aquaculture.2004.08.016

Ai, Q., Mai, K., Tan, B., Xu, W., Zhang, W., Ma, H., Liufu, Z., 2006. Effects of dietary vitamin C on survival, growth, and immunity of large yellow croaker, Pseudosciaena crocea Aquaculture 261, 327–336. https://doi.org/10.1016/j. aquaculture.2006.07.027

Alberts, B., Johnson, A., Lewis, J., Walter, P., Raff, M., Roberts, K., 2002. Molecular Biology of the Cell, Forth ed. Routledge, New York

Bag, M.R., Makesh, M., Rajendran, K.V., Mukherjee, S.C., 2009. Characterization of IgM of Indian major carps and their cross-reactivity with anti-fish IgM antibodies. Fish Shellfish Immunol. 26 (2), 275–278. https://doi.org/10.1016/j.fsi.2008.11.009

Baird, L., Yamamoto, M., 2020. The molecular mechanisms regulating the KEAP1-NRF2 pathway. Mol. Cell. Biol. 40, 13. https://doi.org/10.1128/MCB.00099-20

Bellezza, I., Giambanco, I., Minelli, A., Donato, R., 2018. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta, Mol. Cell Res. 1865 (5), 721–733. https://doi.org/10.1016/j.bbamcr.2018.02.010

Fig. 4. (continued).

Boonyaratpalin, M., Wannagowat, J., Borisut, C., 1993. L-ascorbyl 1-2 phosphate-Mg as a dietary vitamin C source for grouper. In: Presented at the Seminar on Fisheries, Department of Fisheries, pp. 16–17

Carmona-Aparicio, L., Perez-Cruz, C., Zavala-Tecuapetla, C., Granados-Rojas, L., RiveraEspinosa, L., Montesinos-Correa, H., Cardenas-Rodríguez, N., 2015. Overview of Nrf2 as therapeutic target in epilepsy. Int. J. Mol. Sci. 16 (8), 18348–18367. https:// doi.org/10.3390/ijms160818348

Carr, A., Maggini, S., 2017. Vitamin C and immune function. Nutrients 9 (11), 1211. https://doi.org/10.3390/nu9111211

Chen, J., Alberts, I., Li, X., 2014. Dysregulation of the IGF-I/PI3K/AKT/mTOR signaling pathway in autism spectrum disorders. Int. J. Dev. Neurosci. 35, 35–41. https://doi. org/10.1016/j.ijdevneu.2014.03.006

Chen, Y., Yuan, R., Liu, Y., Yang, H., Liang, G., Tian, L., 2015. Dietary vitamin C requirement and its effects on tissue antioxidant capacity of juvenile largemouth bass, Micropterus salmoides. Aquaculture 435, 431–436. https://doi.org/10.1016/j. aquaculture.2014.10.013

Cheng, C., Liang, H., Guo, Z., Wang, A., Ye, C., 2017. Effect of dietary vitamin C on growth performance, antioxidant status and innate immunity of juvenile Pufferfish (Takifugu obscurus). Israel J. Aquacult. - Bamidgeh 13. https://doi.org/10.46989/ 001c.20848

Cui, J., Luo, J., Yan, F., Chen, G., 2013. Studies on the requirements of cromileptes altivelis for the optimum level of vitamin C and D3. J. Anhui Agricult. Sci. Chinese 41 (18). https://doi.org/10.13989/j.cnki.0517-6611.2013.18.128, 7843-7845,7848.

Darias, M.J., Mazurais, D., Koumoundouros, G., Cahu, C.L., Zambonino-Infante, J.L., 2011. Overview of vitamin D and C requirements in fish and their influence on the skeletal system. Aquaculture 315, 49–60. https://doi.org/10.1016/j. aquaculture.2010.12.030

Dawood, M.A.O., Koshio, S., 2016. Vitamin C supplementation to optimize growth, health and stress resistance in aquatic animals. Rev. Aquac. 10, 334–350. https:// doi.org/10.1111/raq.12163

Ebi, I., Yong, A.S., Lim, L., Shapawi, R., 2018. Dietary ascorbic acid requirement for the optimum growth performances and normal skeletal development in juvenile hybrid grouper, Epinephelus fuscoguttatus × Epinephelus lanceolatus J. King Saud Univ. Sci. 30, 493–499. https://doi.org/10.1016/j.jksus.2018.04.024

Gerald, F.C.J., McClung, J.P., 2016. The Vitamins: Fundamental Aspects in Nutrition and Health, Fifth ed. American Academic Press, The United States

Hakuno, F., Takahashi, S.I., 2018. 40 YEARS OF IGF1: IGF1 receptor signaling pathways. J. Mol. Endocrinol. 61 (1), T69–T86. https://doi.org/10.1530/JME-17-0311.

Hu, Y., Zhang, J., He, L., Hu, Y., Zhong, L., Dai, Z., Zhou, D., 2020. Effects of dietary vitamin C on growth, antioxidant activity, and immunity in ricefield eel (Monopterus albus). J. World Aquacult. Soc. 51, 159–170. https://doi.org/10.1111/jwas.12636

Huang, Q., Zhang, S., Du, T., Yang, Q., Chi, S., Liu, H., Tan, B., 2019. Modulation of growth, immunity and antioxidant-related gene expressions in the liver and intestine of juvenile Sillago sihama by dietary vitamin C. Aquac. Nutr. 26, 338–350. https:// doi.org/10.1111/anu.12996

Ibiyo, L., Atteh, J.O., Omotosho, J.S., Madu, C.T., 2007. Vitamin C (ascorbic acid) requirements of Heterobranchus longifilis fingerlings. Afr. J. Biotechnol. 6 (13) https://doi.org/10.5897/AJB2007.000-2225

Johnny, F., Mahardika, K., Giri, I.N.A., Roza, D., 2007. Addition of vitamin C on diet to improve immunity on Tiger grouper, Epinephelus fuscoguttatus to infection viral nervous necrosis. Jurnal Akuakultur Indonesia 6 (1), 42–53. https://doi.org/ 10.19027/jai.6.43-53

Lee, K.J., Kim, K.W., Bai, S.C., 1998. Effects of different dietary levels of L-ascorbic acid on growth and tissue vitamin C concentration in juvenile Korean rockfish, sebastes schlegeli (Hilgendorf). Aquac. Res. 29, 237–244. https://doi.org/10.1111/ are.1998.29.4.237

Li, X., Wu, X., Dong, Y., Gao, Y., Yao, W., Zhou, Z., 2019. Effects of dietary lysine levels on growth, feed utilization and related gene expression of juvenile hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Aquaculture 502, 153–161. https://doi.org/10.1016/j.aquaculture.2018.12.035

Li, X., Mu, W., Wu, X., Dong, Y., Zhou, Z., Wang, X., Geng, L., 2020. The optimum methionine requirement in diets of juvenile hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂): effects on survival, growth performance, gut micromorphology and immunity. Aquaculture 520. https://doi.org/10.1016/j. aquaculture.2020.735014

Lin, X.Y., Shiau, S.Y., 2003. Dietary lipid requirement of grouper, Epinephelus malabaricus, and effects on immune responses. Aquaculture 225, 243–250. https:// doi.org/10.1016/S0044-8486(03)00293-X

Lin, M., Shiau, S., 2005. Dietary l-ascorbic acid affects growth, nonspecific immune responses and disease resistance in juvenile grouper, Epinephelus malabaricus Aquaculture 244 (2005), 215–221. https://doi.org/10.1016/j. aquaculture.2004.10.026

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. https://doi. org/10.1006/meth.2001.1262

Mashoof, S., Criscitiello, M., 2016. Fish immunoglobulins. Biology 5 (4), 45. https://doi. org/10.3390/biology5040045, 2016.

Ming, J.H., Xie, J., Xu, P., Ge, X.P., Liu, W.B., Ye, J.Y., 2012. Effects of emodin and vitamin C on growth performance, biochemical parameters and two HSP70s mRNA

expression of Wuchang bream (Megalobrama amblycephala Yih) under high temperature stress. Fish Shellfish Immunol. 32, 651–661. https://doi.org/10.1016/j. fsi.2012.01.008

NRC (National Research Council), 2011. Nutrient Requirements of Fish and Shrimp. National Academy Press, Washington, DC

Pimpimol, T., Phoonsamran, K., Chitmanat, C., 2012. Effect of dietary vitamin C supplementation on the blood parameters of Mekong giant catfish (Pangasianodon gigas). Int. J. Agric. Biol. 14 (2), 256–260

Tanaka, M., Muto, N., Gohda, E., Yamamoto, I., 1994. Enhancement by ascorbic acid 2glucoside or repeated additions of ascorbate of mitogen-induced IgM and IgG productions by human peripheral blood lymphocytes. Japanese J. Pharmacol. 66 (4), 451. https://doi.org/10.1254/jjp.66.451

Wang, X.J., Kim, K.W., Bai, S.C., Huh, M.D., Cho, B.Y., 2003. Effects of the different levels of dietary vitamin C on growth and tissue ascorbic acid changes in parrot fish (Oplegnathus fasciatus). Aquaculture 215, 21–36. https://doi.org/10.1016/S00448486(02)00042-X

Wang, L.G., Chen, D.X., Lou, B., Zhan, W., Chen, R.Y., Liu, F., Mao, G.M., 2017. The effects of dietary vitamin C on growth performance, serum enzymes activities and resistance to Vibrio alginolyticus challenge of yellow drum Nibea albiflora Aquac. Res. 48, 4684–4695. https://doi.org/10.1111/are.13290

Wu, M., Wu, X., Lu, S., Gao, Y., Yao, W., Li, X., Jin, Z., 2018. Dietary arginine affects growth, gut morphology, oxidation resistance and immunity of hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) juveniles. Br. J. Nutr. 120, 269–282. https://doi.org/10.1017/S0007114518001022

Xiao, L., Mai, K., Ai, Q., Xu, W., Wang, X., Zhang, W., Liufu, Z., 2010. Dietary ascorbic acid requirement of cobia, Rachycentron canadum Linneaus Aquac. Nutr. 16, 582–589

Xing, K., Guo, Y., Chen, C., Bai, D., Xu, D., 2012. Effects of dietary vitamin C levels on growth and tissue antioxidant function in juvenile grouper, Epinephelus malabaricus Fish Sci. Chinese 31 (11), 635–639. https://doi.org/10.16378/j.cnki.10031111.2012.11.002

Xu, H., Jiang, W., Feng, L., Liu, Y., Wu, P., Jiang, J., Zhou, X., 2016a. Dietary vitamin C deficiency depresses the growth, head kidney and spleen immunity and structural integrity by regulating NF-κB, TOR, Nrf2, apoptosis and MLCK signaling in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 52, 111–138. https:// doi.org/10.1016/j.fsi.2016.02.033

Xu, H., Jiang, W., Feng, L., Liu, Y., Wu, P., Jiang, J., Zhou, X., 2016b. Dietary vitamin C deficiency depressed the gill physical barriers and immune barriers referring to Nrf2, apoptosis, MLCK, NF-κB and TOR signaling in grass carp (Ctenopharyngodon idella) under infection of Flavobacterium columnare. Fish Shellfish Immunol. 58, 177–192. https://doi.org/10.1016/j.fsi.2016.09.029

Ye, B., Xue, M., Wu, X.F., Wu, X.Y., Wang, X., Ma, L., Mu, W., Geng, L.N., Cai, Q.X., Zhang, L., Zhai, H.Y., Misbah, I., 2021. Replacing poultry by-product meal protein with soybean protein isolate in low fishmeal diets for juvenile hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Aquaculture Nutrition 00, 0–11. https://doi.org/10.1111/anu.13372

Yusuf, A., Huang, X., Chen, N., Li, S., Apraku, A., Wang, W., David, M.A., 2021. Growth and metabolic responses of juvenile largemouth bass (Micropterus salmoides) to dietary vitamin c supplementation levels. Aquaculture 534, 736243. https://doi.org/ 10.1016/j.aquaculture.2020.736243

Zehra, S., Khan, M.A., 2012. Dietary vitamin C requirement of fingerling, Cirrhinus mrigala (Hamilton), based on growth, feed conversion, protein retention, hematological indices, and liver vitamin C concentration. J. World Aquacult. Soc. 43, 648–658. https://doi.org/10.1111/j.1749-7345.2012.00597.x

Zhang, C., Zhou, X., 2010. Study on simultaneous determination of vitamin C and vitamin C phosphate in premix feed by high performance liquid chromatograghy meothod. China Feed Chinese 10, 40–42. https://doi.org/10.15906/j.cnki.cn112975/s.2010.10.009

Zhou, Q.C., Ding, Y., Zheng, S.X., Su, S.F., Zhang, L., 2004. The effect of dietary vitamin C supplementation on growth and anti-disease ability of shrimp, Penaeus vannamei Acta Hydrobiol. Sin. Chinese 28 (6). https://doi.org/10.3321/j.issn:10003207.2004.06.003.

Zhou, Q., Wang, L., Wang, H., Xie, F., Wang, T., 2012. Effect of dietary vitamin C on the growth performance and innate immunity of juvenile cobia (Rachycentron canadum). Fish Shellfish Immunol. 32, 969–975. https://doi.org/10.1016/j.fsi.2012.01.024

Zhou, Z., Wang, X., Wu, X., Gao, Y., Li, X., Dong, Y., Yao, W., 2019. Effects of dietary leucine levels on growth, feed utilization, neuro-endocrine growth axis and TOR related signaling genes expression of juvenile hybrid grouper (Epinephelus fusco guttatus♀× Epinephelus lanceolatus♂). Aquaculture 504, 172–181. https://doi.org/ 10.1016/j.aquaculture.2019.02.005

Zhou, Z., Wu, X., Li, X., Dong, Y., Zhang, Y., 2020. The optimum dietary isoleucine requirement of juvenile hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Aquac. Nutr. 26 (4), 1295–1310. https://doi.org/10.1111/anu.13085

Zhou, Z., Wu, X., Gatlin, D.M., Wang, X., Mu, W., Ye, B., Ma, L., 2021. Dietary valine levels affect growth, protein utilisation, immunity and antioxidant status in juvenile hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Br. J. Nutr. 125, 408–419. https://doi.org/10.1017/S0007114520002858

Other documents randomly have different content

The last words he was heard to speak, was to a near relation. “My dear, don’t vex yourself for me; for I shall be in heaven in two or three minutes.” Prayers being ended, he committed his spirit into the hands of God, with a chearful countenance, being in the 20th year of his age.

His body was taken care of by his friends, and on the Sunday following, was decently interred in Tindall’s burial ground.—Mr. H. and another friend, performed the last office of prayer and praise over his grave, before a great concourse of people; where we must leave him to rest till the morning of the resurrection, when his body, sown in dishonour, shall be raised in glory.

An E X T R A C T

Of the L I F E and D E A T H of

Mr. J O H N J A N E W A Y.

C H A P T E R I.

An account of him from his childhood, to the seventeenth year of his age.

MR. John Janeway was born in the year ♦1633, October 27, in Tylly, in the county of Hertford. He soon gave his parents the hope of much comfort, and the symptoms of something more than ordinary appeared in him. For pregnancy of wit, solidity of judgment, and the greatness of his memory, he had no superiors, and few equals, considering his age and education.

♦ “63” replaced with “1633” per Errata

He was initiated in the Latin tongue by his father; afterwards he was brought up at St. Paul’s school in London, where he made a considerable proficiency in Latin and Greek. When he was about eleven years old he took a great fancy to the Hebrew tongue.

About this time his parents removing into a little village called Aspoden, had the opportunity of having their son instructed by a learned neighbour, who was pleased to count it diversion to read mathematics to him, being then about twelve years old; and he made such progress that he read Oughtred with understanding before he was thirteen. A person of quality, hearing of the admirable proficiency of this boy, sent for him up to London, and kept him with him for sometime to read mathematics to him.

In the year 1646, he was chosen by the provost of Eaton college, one of the foundation of that school: where he gave no unsuitable returns to the high expectations that were conceived of him.

After a little continuance at Eaton, he obtained leave of his master to go to Oxford, to perfect himself in mathematics, being with Dr Ward, one of the professors, he attained to a strange exactness in that study, the doctor looked upon him as one of the wonders of his age; loved him dearly, and could not for some time after his death mention his name without tears. When he had spent about a quarter of a year with Dr. Ward, he was commanded to return to Eaton, where he soon gave proof of the improvement of his time while he was absent, by calculating the eclipses for many years before hand; so that by this time he had many eyes upon him as the glory of the school. Yet he did not discover the least self-conceit; every one took more notice of his parts than himself.

At about seventeen years old he was chose to King’s-college in Cambridge. He was chosen first, and an elder brother of his the sixth; but he was very willing to change places with his elder brother, letting him have the first, and thankfully accepting of the sixth place.

Besides his great learning, his deportment was so sweet and lovely, his demeanor so courteous and obliging, that many of them who had little kindness for religion could not but speak well of him. His great wisdom did even command respect: he had an excellent power over his passions, and was free from vices which usually attend such an age and place.

But all this while he understood little of Christ, or his own soul. He studied the heavens and the motion of the sun, moon, and stars, but thought little of God, who made them; the creature had not led him to the Creator; but God, when he was about eighteen years old shone in upon his soul with power; and convinced him what a poor thing it was to know so much of the heavens and never come there. He now thought Mr. Bolton had reason to say, Give me the most magnificent glorious worldling, that ever trod upon earthly mould, richly crowned with all the ornaments and excellencies of nature, art, policy, preferment, or what heart can wish besides; yet without the life of grace, to animate and ennoble them, he were to the eye of heavenly wisdom, but as a rotten carcase, stuck over with flowers, magnified dung, guilded rotteness, golden damnation.

C H A P T E R II.

Of his conversion and carriage when fellow of ♦the college.

♦ duplicate word “the” removed

THE great work of conversion, was not ♦carried on upon his soul, in that dreadful manner that it is upon some, but the Lord was pleased, sweetly, to unlock his heart, by the exemplary life, and heavenly discourse of a young man in the college whose heart God had inflamed with love to his soul. He quickly made an attempt upon this young man, and the Spirit of God set home his councils with such power, that they proved effectual for his awakening; being accompanied with the preaching of Dr. Hill, and Dr. Arrowsmith, together with the reading of Mr. Baxter’s Saints Everlasting Rest.

♦ “carcarried” replaced with “carried”

Now a mighty alteration might be discerned in him. He did not taste so much sweetness in those kind of studies, which he so greedily employed himself in as formerly. He began to pity them who ♦were curious in their enquiries after every thing, but that which is most needful, Christ, and themselves; and that which sometimes was his gain he now counted loss for Christ. Not that he looked upon human learning as useless; but when not improved for Christ? He looked upon wisdom as folly, and learning as madness, and that which would make one more like the devil.

♦ “where” replaced with “were”

Mr Janeway now considered how he might best improve what he did know, and turn all his studies into the right channel: grace did not take him off from, but made him more diligent and spiritual in his study. And now Christ was at the end of every thing: how did he contrive how he might most express his love and thankfulness to him who had brought him out of darkness into his marvellous light! To this end he sent up and down packets of letters, in which, he discoursed so substantially of the great things of God, that it would not at all have unbecome some grey head to have owned what he wrote.

He was not a little like Elihu, in whose words he used to excuse his freedom with persons of years. He said, days should speak, and multitude of years should teach wisdom; but there is a spirit in a man, and the inspiration of the Almighty giveth them understanding; I am full of matter, the spirit within me constraineth me: behold my belly is as wine which hath no vent, it is ready to burst like new bottles, I will speak that I may be refreshed. He could not but speak the things which he had seen and heard, and invite all the world, to taste and see how good the Lord is.

He began first with his relations, begging them to think of their immortal souls, and to lay in speedy provisions for eternity. And what pathetic expressions did he use, what vehement expostulations?

Read what his language was (when he was between eighteen and nineteen years old) in a letter to a friend that had the care of many children.

SIR,

YOUR charge is great upon a temporal account, but greater upon a spiritual. Out of an earnest desire of the good of souls and your own joy and peace, I importunately request that you should have a great care of your children, and be often dropping in some wholesome admonitions; and this I humbly, with submission to your judgment in it, commend to you: not to admonish them always together, but likewise privately one by one. Wherein you may please to press upon ♦ them natural corruption, the necessity of regeneration, the excellency of Christ, and how unspeakably lovely it is to see young ones setting out for heaven. This way I think may do most good, having had experience of it myself in some small measure; God grant that all may work for the edifying of those who are committed to you. I leave you under the protection of him that hath loved us, and given himself for us.

♦ “their” replaced with “them” per Errata

When he was about twenty years old, he was made fellow of the college, which did not a little advance those noble projects which he had for the interest of the Lord Christ. Then how sweetly would he insinuate into the young ones desiring to carry as many of them as possible with him to heaven. Many attempts he made upon some of the same house, that he might season them with grace, and animate those who were looking towards heaven. And as for his own relations, never was there a more compassionate and tenderhearted brother. How many pathetical letters did he send to them! And how did he follow them with prayers and tears

Read what his heart was, in the following lines.

“Distance of place cannot at all lessen that natural bond, whereby we are conjoined in blood, neither ought to lessen that of love. Nay, where true love is, it cannot; for love towards you I can only say this, that I feel it better than I can express it: but love felt and not expressed is little worth. I therefore desire to make my love manifest in the best way I can. Let us look upon one another not as brethren only, but as members of the same body whereof Christ is the head. Let us therefore hunger after him, so that our close knot may meet in Christ: if we are in Christ, and Christ in us, then we shall be one with each other You cannot complain for want of instruction, God hath not been to us a dry wilderness; you have had line upon line, and precept upon precept: he hath planted you by the rivers of water. It is the Lord indeed who maketh fruitful, but yet we are not to stand and do nothing. There is a crown worth looking for; seek therefore, and that earnestly. Oh! seek by continual prayer, keep your soul in a praying frame, this is a great and necessary duty: nay, a high and precious privilege. If thou canst say nothing, come and lay thyself in an humble manner before the Lord. You may believe me, for I have experienced what I say. There is more sweetness in one glimpse of God’s love, than in all that the world can afford. Oh! do but try; taste and see how good the Lord is. Get into a corner and throw yourself down before the Lord, and beg of God to make you sensible of your lost state by nature, and of the excellency and necessity of Christ. Say, Lord give me a broken heart, soften and melt me. Any thing in the world, so I may be enabled to value Christ, and to accept of him, as he is tendered in the gospel. O that I may be delivered from the wrath to come! Oh! a blessing for me, even for me! And resolve not to be content till the Lord have in some measure answered you. My bowels yearn towards you. Oh! that you did but know with what affection I write now, and what prayers and tears are mingled with these lines! The Lord set these things home, and give you an heart to apply them! Give me leave to deal plainly, for I love your soul so well, that I cannot bear the thoughts of the loss of it. Know this, that except a man be born again, he cannot enter into the kingdom of heaven; God’s favour is not to be recovered without it. This new birth hath its foundation laid in a sense of sin, a godly sorrow for it, and a heart set against it; without this there can be no salvation. Look well

about you, and see into yourself, and thou wilt see that thou art at hell’s mouth without this first step, and nothing but free-grace and pure mercy is between you and the state of the devils. The Lord deliver us from a secure careless heart! Here you see a natural man’s condition. How darest thou then lie down in security. Oh! look about for your soul’s sake. Repentance itself may lose its labour, if it be not in the right manner. Tears and groans, and prayers will not do without Christ. Most, when they are convinced of sin, and are under fears of hell, reform something, and thus the wound is healed, and by this thousands fall short of heaven. For if we be not brought off from ourselves, and our righteousness as well as our sins, we are never like to be saved. We must see an absolute need of Christ, and give ourselves up to him, and count all but dung and dross in comparison of Christ’s righteousness. Look therefore for mercy only in Christ, for his sake rely upon God’s mercy. The terms of the gospel are, repent and believe; gracious terms! Mercy for fetching, nay, mercy for desiring, nay, for nothing but receiving. Dost thou desire mercy and grace? I know thou dost. Even this is the gift of God to desire, hunger after Christ; let desires put you upon endeavour, the work itself is sweet: yea, repentance and mourning itself hath more sweetness in it, than all the world’s comforts. Upon repentance and believing comes justification, after this sanctification, by the spirit dwelling in us. By this we come to be the children of God, to be made partakers of the divine nature, to have a suitableness to God.”

C H A P T E R III.

His great love to prayer.

HE was mighty in prayer, and his spirit was oftentimes so transported in it that he forgot the weakness of his own body. Indeed the acquaintance he had with God was so sweet, and his converse with him so frequent, that when he was engaged in duty, he scarce knew how to leave off. His constant course for some years was this. He prayed at least three times a day in secret, sometimes seven times, twice a day in the family or college. And he found the sweetness of it beyond imagination and enjoyed wonderful communion with God. He could say by experience, that the ways of wisdom were ways of pleasantness, and all her paths peace. He knew what it was to wrestle with God, and he could scarce come off his knees, without his blessing. He was used to converse with God, with a holy familiarity as a friend, and would upon all occasions run to him for advice, and had many strange and immediate answers of prayer. One of which I think it not impertinent to give an account of.

His father Mr. William Janeway, minister of Kelshall in Hertfordshire, being sick, and under dark apprehensions as to the state of his soul, he would often say to his son John: “Oh! Son! This passing into eternity is a great thing, this dying is a solemn business, and enough to make one’s heart ake, that hath not his evidences for heaven clear. And truly, son, I am under no small fears, as to my own estate for another world. Oh! That God would clear his love! Oh! that I could say chearfully, I can upon good grounds be able to look death in the face, and venture upon eternity with well grounded peace and comfort.”

Seeing his father continuing under despondings of spirit (though no Christians that knew him but had a high esteem of his uprightness) he got by himself and spent sometime in wrestling with God, earnestly begging that he would speedily give him some token for good, that he might joyfully and honourably leave this world. After he was risen from his knees, he came down to his father, and asked him, how he felt himself. His father made no answer for sometime, but wept exceedingly, (a passion he was not subject to) and continued for some considerable time weeping, so that he was not able to speak. But at last having recovered himself, he burst out: “O! Son! now it is come, it is come, it is come: I bless God I can die; the spirit of God hath witnessed with my spirit that I am his child. Now I can look up to God as my dear Father, and Christ as my redeemer; I can now say, this is my friend, and this is my beloved. My heart is full, it is brim full, I can hold no more. I know now what that sentence means, The peace of God which passeth understanding; I know now what that white stone is wherein a new name is written, which none know but them that have it, and that fit of weeping which you saw me in, was from overpowering love and joy, so great that I could not contain myself: neither can I express what glorious discoveries God hath made of himself to me. And had that joy been greater, I question whether it would not have separated soul and body. Bless the Lord O my soul, and all that is within me, bless his holy name, that hath pardoned all my sins, and sealed the pardon. He hath healed my wounds, and caused the bones which he had broken to rejoice. Oh! help me to bless the Lord, he hath put a new song into my mouth: now I can die! It is nothing, I bless God I can die. I desire to be dissolved and to be with Christ.” You may well think his son’s heart was not a little refreshed to meet the messenger that he had sent to heaven returned back so speedily.

After the death of his father, he did what he could to supply his absence, doing the part of a husband, son, and brother; so that he was no small comfort to his poor mother in her disconsolate state, and all the rest of his relations, that had any sense of God upon their spirits.

C H A P T E R IV.

His return to King’s-college after his father’s death and his temptations.

WHEN his father was dead he returned again to King’s-college, and was a member of a society, which began to contrive how they might best be serviceable to God and their generation. Their custom was frequently to meet together, to pray and to communicate studies and experiences. Some of this company grew cold, but others lived to let the world see, that what they did was from a vital principle: among whom, this young man was none of the least. One of their designs was to engage the Juniors, if possible, before they were ensnared by wicked company, when they came from school. After some time, most of his dear companions were transplanted either into gentlemen’s families or livings, and Mr. Janeway, being one of the youngest, was, for a while, left alone in the College. But wanting suitable society, he fixed so intensely upon his studies, that he soon gave an incurable wound to his constitution.

But he had his gloomy days, and his sweets were sometimes imbittered with dreadful and horrid temptations. The devil shot his poisonous arrows at him: yet through the captain of his salvation, he came off more than conqueror.

It would make a Christian’s heart even ake to hear what strange temptations he was exercised with. But he was well armed for such a conflict, having the shield of faith, whereby he quenched the fiery darts of that wicked one: yet, this fight cost him the sweating of his body for agonies of spirit; and tears and strong cries to heaven. As for himself, he was wont to take an arrow out of God’s quiver, and discharge it by faith and prayer, for the discomfiture of his violent enemy, who at last was fain to fly.

These conflicts with Satan, did not a little help ♦him dealing with them that are afflicted with the like temptations. I insert a letter of his to one in the like case.

♦ “in” replaced with “him” per Errata

Dear Friend,

‘You say that you are troubled with blasphemous thoughts: so then, though they are blasphemous, yet they are your trouble; and neither sent for, nor welcome. What then shall we think of them? If they were your own production, your heart would be delighted in its own issue, but it is nothing less. They are the injections of that wicked one, who is the accuser of the brethren, and the disturber of the peace of the people of God. But Satan uses only to employ those weapons against those he is in fear of losing? He is not wont to assault and fight against his friends in this manner. Those that he hath fast, he leads on as softly and quietly as he can; fearing lest they should awake, and see their danger: but those that have in some measure escaped his snares, he follows hard, with all the discouragements he can. These things are no other but a bitter relish of those things, which you know to be bitter after you have tasted how good the Lord is. What then shall I call these motions of your mind? They are the soul’s loathing the morsels which Satan would have it swallow: but you will say, if these horrible thoughts be not your sin, yet they are your misery. And you will ask, How shall I get free from them? First, See that you possess your soul in patience: know that God hath an over-ruling hand in all this: and wait upon him, for he can and will bring good out of all this evil. At present you see no light: yet, Trust in the Lord, and stay yourself upon your God. Can Christ forget the purchase of his own blood? Can a mother forget her sucking child? Yet, God cannot forget his. God hath gracious intents in all this, and his bowels yearn towards you. Yea, our Saviour suffers with us, through his ardent love by sympathy, as well as he hath suffered for us. And you know he hath all power in his hand. This power is made yours through the prayer of faith: but for your own work, do this.

‘First, Let not such thoughts have any time of abode in your mind, but turn them out with all the abhorrence you can: yet not with so much trouble and disturbance of mind as I believe you do. For by this the devil is pleased and makes you your own tormentor.

‘Secondly, Always divert your thoughts to some good thing, and let those very injections be the occasion of spiritual meditation. Think the quite contrary, or fall a praying with earnestness; and the devil will be weary if he finds his designs thus broken, and that those sparks of hell (which he struck into the soul to kindle corruption,) set faith and prayer a working.

‘Thirdly, Consider that this is no new thing; if any soul hath escaped out of darkness, if he will have heaven, he shall have it with as much trouble, as the devil can lay on; but, blessed be God, he cannot pluck us out of these almighty arms.’

His love to Christ and souls, made him very desirous to spend, and be spent in the work of the ministry. Accordingly he complied with the first clear call to preach the everlasting gospel. And though he was but two and twenty years old, yet he came to that work like one that understood what preaching was. He was a workman that needed not be ashamed, that was thoroughly furnished for every good word and work; one that hated sin with a perfect hatred, and loved holiness with all his soul; one that knew the terrors of the Lord, and how to beseech sinners in Christ’s stead to be reconciled unto God: one, in whom learning and holiness did as it were strive which could excel. He never preached publicly but twice; but he came to it, as if he had been used to it forty years; delivering the word of God with that power and majesty, with that tenderness and compassion, with that readiness and freedom, that it made his hearers amazed. He spoke nothing to others but what was the language of his heart, and the fruit of great experience, and which one might easily perceive had no small impression first upon his own spirit.

His first and last sermons were upon communion with God, out of Job xxii. 21. A subject that few Christians under heaven were better able to manage than himself: for he did for some time maintain such an intimate familiarity with God, that he seemed to converse with him as a friend with another This he began whilst he was here: but the perfecting his acquaintance with God, was a work for another world.

He kept an exact watch over his thoughts, words and actions, and made a review of all, at least once a day. He kept a diary, in which he set down every evening what the frame of his spirit had been all the day, especially in every duty. He took notice what profit he received; what returns from that far country; what answers of prayer, what deadness and flatness, and what observable providences. He set down the substance of what he had been doing: and any wanderings of thoughts, or passion. It cannot be conceived by them who do not practise this, to what a good account it turned. This made him retain a grateful remembrance of mercy, and live in a constant adoring of divine goodness; this brought him to a very intimate acquaintance with his own heart; kept his spirit low, and fitted him for free communications from God; this made him more lively and active; helped him to walk humbly with God; and made him speak more affectionately and experimentally to others of the things of God. In a word, this left a sweet calm upon his spirits, because he every night made even his accounts; and if his sheets should prove his winding-sheet, it had been all one; for his work was done; so that death could not surprize him.

C H A P T E R V.

An account of the latter part of his life.

FOR the latter part of his life, he lived like a man that was quite weary of the world, and that looked upon himself as a stranger here, and lived in the constant sight of a better. He plainly declared himself but a pilgrim that looked for a better country, a city that had foundations, whose builder and maker was God. His habit, his language, his deportment, all spoke him one of another world. His meditations were so intense, long, and frequent, that they ripened him apace for heaven. Few attain to such a holy contempt of the world, and to such a clear, joyful constant apprehension of the world that is to come.

He made it his whole business to grow into an humble familiarity with God, and to maintain it. And if by reason of company, or any necessary business, this was in any measure interrupted, he would complain like one out of his element, till his spirit was recovered into a delightful, unmixed, free intercourse with God. He was never so well satisfied, as when he was more immediately engaged in what brought him nearer to God; and by this he constantly enjoyed those comforts, which others rarely meet with. His graces and experiences toward his end grew to astonishment. He was oft brought into the banqueting-house, and there Christ’s banner over him was love. His eyes beheld the king in his beauty: he had frequent visions of glory, and lay in the bosom of his master. He was even sick of love, and could say to the world, O taste and see! And to Christians, Come and I will tell you what God hath done for my soul. O what do Christians mean that they do no more to get their senses spiritually exercised? Little do people think what they slight, when they are formal in secret duties, and when they neglect that great duty of meditation Did they but know the thousandth part of that sweetness that is in Christ, they could not choose but follow him hard; they would run and not be weary; and walk and not be faint.

Turn static files into dynamic content formats.

Create a flipbook
Dietary vitamin c affects growth, antioxidant status and serum immune parameter of juvenile hybrid g by Education Libraries - Issuu