ISSN 0103-846X
Rev ista Brasileira de Parasitologia Veterinária, v. 20, n. 1, jan.-mar. 2011
ISSN 1984-2961
(Impresso)
(Eletrônico)
Spores of Myxobolus sp.
Brazilian Journal of Veterinary Parasitology
Oocyst of Isospora cagasebi
Revista Brasileira de Parasitologia Veterinária V. 20, N. 1, Janeiro/ Março 2011
Colégio Brasileiro de Parasitologia Veterinária
ISSN 0103-846X
Rev ista Brasileira de Parasitologia Veterinária, v. 20, n. 1, jan.-mar. 2011
ISSN 1984-2961
(Impresso)
(Eletrônico)
Spores of Myxobolus sp.
Brazilian Journal of Veterinary Parasitology
Oocyst of Isospora cagasebi
Revista Brasileira de Parasitologia Veterinária V. 20, N. 1, Janeiro/ Março 2011
Colégio Brasileiro de Parasitologia Veterinária
Brazilian Journal of Veterinary Parasitology
Revista Brasileira de Parasitologia Veterinรกria V. 20, N. 1, Janeiro/Marรงo 2011
Copyright© 1981 Colégio Brasileiro de Parasitologia Veterinária Os trabalhos publicados na Revista Brasileira de Parasitologia Veterinária são de inteira responsabilidade dos autores, permitida a reprodução desde que citada a fonte. Papers published in this Journal are from the complete responsability of the authors. Reproduction is permited since that cited the reference.
Revista Brasileira de Parasitologia Veterinária = Brazilian Journal of eterinarian P V arasitology., v.1, n.0, 1991. São Carlos: Cubo Multimídia Ltda., 2011 Trimestral / Quarterly Português e Inglês / Portuguese and English Rev. Bras. Parasitol. Vet., v.20, n.1, jan./mar. 2011 ISSN 0103-846X (Impresso / In Print) ISSN 1984-2961 (Eletrônico / Electronic) 1. Parasitologia Veterinária. 2. Veterinária. 3. Periódicos - Brasil. 1. Vet. Parasitology. 2. Veterinary. 3. Journals - Brazil. CDD 636.089 CDU 576.89:619
Circulação: 31 de março de 2011 / Circulation: March 31, 2011
A publicação está indexada no AGRÍCOLA, BIOSIS, CAB-International, Index Medicus (Pub Med), ISI/Thomson – Current Contents/Agriculture e SciELO Brasil. This publication is indexed in AGRICOLA, BIOSIS, CAB-International, Index Medicus (Pub Med), ISI / Thomson – Current Contents / Agriculture and SciELO Brazil.
Produção Editorial
Web Site e Versão On Line
Revista Brasileira de Parasitologia Veterinária Brazilian Journal of Veterinary Parasitology Editora-chefe / Chief Editor Rosangela Zacarias Machado
Editores Científicos Assistentes / Assistant Scientific Editors Andréa Caetano da Silva (UFG – GO, Brasil) Carlos Termignoni (UFRS – RS, Brasil) Carlos Wilson Gomes Lopes (UFRRJ – RJ, Brasil) Cláudia Maria Leal Bevilaqua (UECE – CE, Brasil)
Claúdio Lisias Mafra de Siqueira (UFV – MG, Brasil) Fernando Paiva (UFMS – MS, Brasil) João Luís Garcia (UEL – PR, Brasil) John Furlong (CNPGL/EMBRAPA – MG, Brasil)
Leucio Camara Alves (UFRPE – PE, Brasil) Renato Andreotti e Silva (CNPQC/EMBRAPA – MS, Brasil) Romário Cerqueira Leite (UFMG – MG, Brasil) Solange Maria Gennari (USP – SP, Brasil)
Corpo Editorial / Editorial Advisory Board Adivaldo Henrique da Fonseca (UFRRJ – RJ, Brasil) Adjair Antonio do Nascimento (UNESP – SP, Brasil) Agustín Estrada Penã (Universidad de Zaragoza, Espanha) Alberto A. Guglielmone (INTA, Argentina) Alessandro F. Talamini Amarante (UNESP – SP, Brasil) Ana Carolina de Sousa Chagas (Embrapa Pecuária Sudeste – SP, Brasil) Ana Clara Gomes dos Santos (UEMA – MA, Brasil) Ana Lúcia Abreu Silva (UEMA – MA, Brasil) Anabella Gaspar (University of Pretoria, África do Sul) Anderson Barbosa de Moura (UDESC – SC, Brasil) Andrea Cristina Higa Nakaghi (FCAVJ/UNESP – SP, Brasil) Antônio Pereira de Souza (UDESC – SC, Brasil) Antônio Thadeu Medeiros de Barros (EMBRAPA/CPAP – MS, Brasil) Beatriz Rossetti Ferreira (USP – SP, Brasil) Carlos E. Suarez (ARS-USDA – Pullman, WA) Carlos José Einicker Lamas (USP – SP, Brasil) Cristiane Divan Baldani (UFRRJ – RJ, Brasil) Daniel de Barros Macieira (UFF – RJ, Brasil) Daniel Moura de Aguiar (UFMT – MT, Brasil)
Daniela Miyasaka Silveira Cassol (Ouro Fino Saúde Animal Ltda – SP, Brasil) Darci Moraes Barros-Battesti (Instituto Butantan – SP, Brasil) Diana Scorpio (The Johns Hopkins University School of Medicine, Baltimore, USA) Edvaldo Lopes de Almeida (UFRPE – PE, Brasil) Elisabeth A. Innes (Moredun Research Institute – Scotland) Eloy Guillermo Castellón Bermúdez (INPA – AM, Brasil) Flávio Augusto Menezes Echevarria (CPPSul /EMBRAPA – RS, Brasil) Guido Fountgalland Coelho Linhares (UFGO – GO, Brasil) Hervé Hoste (INRA – Toulouse, França) Isabel Kinney Ferreira de Miranda Santos (USP – SP, Brasil) Italmar Teodorico Navarro (UEL – PR, Brasil) James M. Trout (USDA – USA) Joanne B. Messick (Purdue University School of Veterinary Medicine – West Lafayette) João Batista Catto (CNPGC/EMBRAPA – MS, Brasil) Jorge da Costa Eiras (Universidade do Porto, Portugal) José Eugênio Guimarães (UFBA – BA, Brasil) José Luis Fernando Luque Alejos (UFRRJ – RJ, Brasil)
Karen Regina Lemos (UNICENTRO – PR, Brasil) Kátia Denise Saraiva Bresciani (UNESP – SP, Brasil) Laura Fielden (Ph.D – Truman State University, USA) Lígia Miranda Ferreira Borges (UFG – GO, Brasil) Lúcia Padilha Cury Thomaz de Aquino (UNIFIAN – SP, Brasil) Lygia Maria Friche Passos (UFMG – MG, Brasil) Marcelo Bahia Labruna (USP – SP, Brasil) Marcelo Beltrão Molento (UFPR – PR, Brasil) Marcos Pezzi Guimarães (UFMG – MG, Brasil) Maria Inez Santos Silva (UEMA – MA, Brasil) Marta Maria Geraldes Teixeira (USP – SP, Brasil) Matias Pablo Juan Szabó (UFU – MG, Brasil) Múcio Flávio Barbosa Ribeiro (UFMG – MG, Brasil) Nicolau Maués Serra-Freire (Instituto Oswaldo Cruz – RJ, Brasil) Pedro Paulo Vissotto de Paiva Diniz (North Carolina State University, USA) Raimundo Wilson de Carvalho (Fundação Oswaldo Cruz – RJ, Brasil) Rita de Cássia A. Alcântara de Menezes (UFRRJ – RJ, Brasil) Rita de Maria N. de Candanedo Guerra (UEMA – MA, Brasil)
Rodrigo Martins Soares (USP – SP, Brasil) Rosangela Locatelli Dittrich (UFPR – PR, Brasil) Sérgio de Albuquerque (USP – SP, Brasil)
Solange Maria Gennari (USP – SP, Brasil) Teresa Cristina Bergamo do Bomfim (UFRRJ – RJ, Brasil) Tiago Wilson Patriarca Mineo (UFU – MG, Brasil)
Revisores de Métodos Estatísticos Reviewers of Statistical Methods Antônio Sérgio Ferraudo (FCAVJ/UNESP – SP, Brasil) Danísio Prado Murani (FCAVJ/UNESP – SP, Brasil) Euclides Braga Malheiros (FCAVJ/UNESP – SP, Brasil) Gener Tadeu Pereira (FCAVJ/UNESP – SP, Brasil)
Urara Kawazoe (UNICAMP – SP, Brasil) Valdomiro Bellato (UDESC – SC, Brasil) Wilma Aparecida Starke Buzetti (UNESP – SP, Brasil)
Revisores de Trabalhos em Português Portuguese Reviewers of Manuscripts Lygia Aparecida Guerreiro Nascimbem
Revisores de Trabalhos em Inglês English Reviewers of Manuscripts Marcia Triunfol David George Elliff Carla Finger
Informações Gerais A Revista Brasileira de Parasitologia Veterinária – Brazilian Journal of Veterinary Parasitology (ISSN impresso – 0103-846X; ISSN eletrônico 1984-2961) é o órgão oficial de divulgação do Colégio Brasileiro de Parasitologia Veterinária. Um volume anual é publicado, com quatro números, nos meses de Março, Junho, Setembro e Dezembro. A Revista publica artigos originais de pesquisas básica ou aplicada em Helmintologia, Protozoologia e Entomologia relacionadas à saúde animal. Artigos de pesquisa com delineamento experimental ou clínico sobre morfologia, taxonomia, ultraestrutura, cultura in vitro, biologia, imunologia, bioquímica, biologia molecular, diagnóstico, mecanismo de ação de drogas, patologia, epidemiologia e controle de parasitas de animais domésticos, de laboratório e silvestres, estão dentro do perfil da Revista. Correspondências, assinaturas, envio de artigos devem ser encaminhados para o Editor-chefe. O preço da assinatura anual ou por volume é de 35 dólares americanos mais 5 dólares americanos para cobrir despesas de postagem, num total de 40 dólares americanos.
General Information The Revista Brasileira de Parasitologia Veterinária – Brazilian Journal of Veterinary Parasitology (ISSN printed – 0103-846X; ISSN electronic 1984-2961) is the oficial organ of the Brazilian College of Veterinary Parasitology. One volume is published each year, with numbers in March, June, September and December. The Journal publishes original papers on basic or applied research in Helminthology, Protozoology and Entomology as related to animal health. Papers dealing with experimental or clinical research on morphology, taxonomy, ultrastructure, in vitro culture, biology, immunology, biochemistry, molecular biology, diagnosis, pathology, epidemiology and parasite control in domestic, laboratory or wild animal, are within the scope of the Journal. Correspondence on subscriptions, submission of papers of the other topics should be sent to the Chief Editor. The price per volume and of annual subscription is US$ 35.00 plus US$ 5.00 to cover surface mail postage, total of US$ 40.00.
Endereço Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista – UNESP Via de acesso Prof. Paulo Donato Castellane s/n, Zona Rural, CEP 14884-900 Jaboticabal – SP, Brasil Fone: (16) 3209-2662 – Ramal 216; Fax: (19) 4062-9501 e-mail: rbpv-secretaria@rbpv.org.br; web site: www.cbpv.com.br/rbpv
Editorial Since the beginnings of the Brazilian Journal of Veterinary Parasitology (Revista Brasileira de Parasitologia Veterinรกria), it has focused on publishing the results from research on parasite control, with emphasis on chemotherapy for and the epidemiology of many parasitic diseases, directed towards implementation of strategic control programs. An analysis, albeit superficial, has shown that over the last few years, the RBPV has continued with its traditional approach towards prevention and control of parasitic diseases. On the other hand, the availability of new tools for veterinary parasitologists, particularly within the fields of molecular biology, genetics, biochemistry and statistics has led to publication of scientific studies that are more directed towards direct and indirect diagnosis of parasites. Veterinarians are increasingly involved in conservation programs and include wild animals in studies on biodiversity and ecosystems. Emerging parasitic diseases require knowledge of protozoans, helminths or arthropods (this last group transmits many diseases), in order to make sensitive and specific diagnoses. The taxonomy of parasites in Veterinary Medicine is of great importance in research and in undergraduate courses and postgraduate programs, since with the use of molecular tools, the level of interspecies variability in different groups of parasites can be known. With regard to development of antiparasitic vaccines, little has been achieved, given that the evasion mechanisms of each parasite and the parasite-host relationships and their effect mechanisms need to be understood. Much is required regarding knowledge of immune responses, particularly in relation to effector cells and the action of cell mediators, both in natural infections and in vaccinated individuals. The future of chemotherapy and the phenomenon of nematode parasite resistance to the two major antinematode drug groups (benzimidazoles and macrolytic lactones) are of concern to us. It should be borne in mind that no development of new drugs is expected in the near future, given that the investment required would be very high and little research has been done along these lines. Thus, Veterinary Parasitology increasingly needs renovation of brains and young researchers, teachers and students, for new research projects to be drawn up: particularly those that seek to impede the action of factors that disseminate zoonoses and to develop vaccines and chemotherapy and phytotherapy products for eliminating and/or controlling parasites.
Rosangela Zacarias Machado
Editorial A Revista Brasileira de Parasitologia Veterinária (Brazilian Journal of Veterinary Parasitology) desde o seu início teve como foco a publicação de resultados de pesquisas sobre o controle de parasitas, com ênfase a quimioterapia e epidemiologia de muitas doenças parasíticas, objetivando a implementação de programas de controle estratégicos. Uma análise, ainda que superficial, vem demonstrar que nos últimos anos a RBPV, continua tradicionalmente abordando a prevenção e controle das doenças parasitárias, mas a disponibilidade de novas ferramentas aos parasitologistas veterinários, particularmente, nas áreas de biologia molecular, genética, bioquímica e estatística tem propiciado a publicação de trabalhos científicos mais dirigidos ao diagnóstico direto e indireto dos parasitas. Médicos Veterinários estão cada vez mais envolvidos com programas de conservação e incluem animais silvestres nos estudos de biodiversidade e ecossistemas. As doenças parasitárias emergentes requerem conhecimento para o diagnóstico sensível e específico, seja entre os protozoários, helmintos e artrópodes, estes últimos transmissores de muitas doenças. A taxonomia de parasitas em Medicina Veterinária tem grande importância na pesquisa e nos cursos de graduação e pós-graduação, pois com a utilização de ferramentas moleculares, o nível de variabilidade interespecífica em diferentes grupos de parasitas pode ser conhecido. No desenvolvimento de vacinas antiparasitárias, pouco tem sido alcançado, pois é necessário entender os mecanismos de evasão de cada parasita e as relações parasito-hospedeiro com os seus mecanismos efetores. Muito é exigido do conhecimento da resposta imune, particularmente sobre as células efetoras e ação dos mediadores celulares, seja na infecção natural ou em indivíduos vacinados. Preocupa-nos sobre o futuro dos quimioterápicos e os fenômenos de resistência dos parasitas nematóides, aos dois maiores grupos de drogas, os benzimidazois e lactonas macrolíticas, lembrando que o desenvolvimento de novas drogas em um futuro próximo não deve ocorrer, pois o investimento é muito alto e poucas pesquisas nesta linha tem sido realizadas. Desta forma, a Parasitologia Veterinária necessita cada vez mais de renovação de cérebros e jovens pesquisadores, docentes e estudantes para a elaboração de novos projetos de pesquisa, principalmente aqueles que busquem impedir a ação de fatores disseminadores de zoonoses, de desenvolvimento de vacinas e produtos quimioterápicos e fitoterápicos na eliminação e/ou controle dos parasitas.
Rosangela Zacarias Machado
Review Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 1-12, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Ehrlichiosis in Brazil Erliquiose no Brasil Rafael Felipe da Costa Vieira1; Alexander Welker Biondo2,3; Ana Marcia Sá Guimarães4; Andrea Pires dos Santos4; Rodrigo Pires dos Santos5; Leonardo Hermes Dutra1; Pedro Paulo Vissotto de Paiva Diniz6; Helio Autran de Morais7; Joanne Belle Messick4; Marcelo Bahia Labruna8; Odilon Vidotto1* Departamento de Medicina Veterinária Preventiva, Universidade Estadual de Londrina – UEL
1
Departamento de Medicina Veterinária, Universidade Federal do Paraná – UFPR
2
Department of Veterinary Pathobiology, University of Illinois
3
Department of Veterinary Comparative Pathobiology, Purdue University, Lafayette
4
Seção de Doenças Infecciosas, Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul – UFRGS
5
College of Veterinary Medicine, Western University of Health Sciences
6
Department of Clinical Sciences, Oregon State University
7
Departamento de Medicina Veterinária Preventiva e Saúde Animal, Universidade de São Paulo – USP
8
Received June 21, 2010 Accepted November 3, 2010
Abstract Ehrlichiosis is a disease caused by rickettsial organisms belonging to the genus Ehrlichia. In Brazil, molecular and serological studies have evaluated the occurrence of Ehrlichia species in dogs, cats, wild animals and humans. Ehrlichia canis is the main species found in dogs in Brazil, although E. ewingii infection has been recently suspected in five dogs. Ehrlichia chaffeensis DNA has been detected and characterized in mash deer, whereas E. muris and E. ruminantium have not yet been identified in Brazil. Canine monocytic ehrlichiosis caused by E. canis appears to be highly endemic in several regions of Brazil, however prevalence data are not available for several regions. Ehrlichia canis DNA also has been detected and molecularly characterized in three domestic cats, and antibodies against E. canis were detected in free-ranging Neotropical felids. There is serological evidence suggesting the occurrence of human ehrlichiosis in Brazil but its etiologic agent has not yet been established. Improved molecular diagnostic resources for laboratory testing will allow better identification and characterization of ehrlichial organisms associated with human ehrlichiosis in Brazil. Keywords: Ehrlichia sp., domestic animals, wild animals, humans.
Resumo Erliquiose é uma doença causada por rickettsias pertencentes ao gênero Ehrlichia. No Brasil, estudos sorológicos e moleculares têm avaliado a ocorrência de espécies de Ehrlichia em cães, gatos, animais selvagens e seres humanos. Ehrlichia canis é a principal espécie em cães no Brasil, embora a infecção por E. ewingii tenha, recentemente, despertado suspeita em cinco cães. O DNA de E. chaffeensis foi detectado e caracterizado em cervo-do-pantanal, enquanto que E. muris e E. ruminantium ainda não foram identificadas no Brasil. A erliquiose monocítica canina causada pela E. canis parece ser altamente endêmica em muitas regiões do Brasil, embora dados de prevalência não estejam disponíveis em muitas delas. O DNA de E. canis também foi detectado e caracterizado em três gatos domésticos, enquanto anticorpos contra E. canis foram detectados em felídeos neotropicais de vida livre. Evidências sorológicas sugerem a ocorrência de erliquiose humana no Brasil, entretanto, o agente etiológico ainda não foi identificado. A melhoria do diagnóstico molecular promoverá a identificação e caracterização de espécies associadas à erliquiose humana no Brasil. Palavras-chave: Ehrlichia sp., animais domésticos, animais silvestres, humanos.
*Corresponding author: Odilon Vidotto Departamento de Medicina Veterinária Preventiva, Universidade Estadual de Londrina – UEL, Pr 445, Km 380, CEP 86051-990, Londrina - PR, Brazil; e-mail: vidotto@uel.br
www.cbpv.com.br/rbpv
2
Vieira, R.F.C. et al.
Introduction Ehrlichia are Gram-negative, pleomorphic, obligate intracellular bacteria that infect a wide range of mammals. The genus initially included 10 species classified based on the host cell infected: monocytes (E. canis, E. risticii, E. sennetsu), granulocytes (E. ewingii, E. equi, E. phagocytophila, human granulocytic ehrlichiosis [HGE] agent), and thrombocytes (E. platys). Based on sequences of 16S ribosomal RNA (rRNA) and other genes (e.g., groESL operon and surface protein genes), the genus Ehrlichia was rearranged and currently consists of five species: E. canis, E. chaffeensis, E. ewingii, E. muris and E. ruminantium (formerly Cowdria ruminantium). The Ehrlichia genus belongs to the family Anaplasmataceae of the order Rickettsiales (DUMLER et al., 2001). The remaining organisms were reclassified into the Anaplasma genus: A. platys (formerly E. platys) and A. phagocytophilum (a combination of organisms previously known as E. equi, E. phagocytophila and HGE agent), and into the Neorickettsia genus: N. helminthoeca, N. risticii (formerly E. risticii) and N. sennetsu (formerly E. sennetsu). The organisms not currently belonging to the genus Ehrlichia will not be further discussed in this review. The organism was first described in dogs by Donatien and Letosquard (1935) in Algeria. After a major epizootic during the Vietnam War ehrlichiosis was characterized as a dog disease due to the infection and death of many military working German Shepherd dogs (HUXSOLL et al., 1970). In Brazil, E. canis was first reported in dogs from the city of Belo Horizonte, State of Minas Gerais, Southeastern Brazil (COSTA et al., 1973). Ehrlichia organisms are mainly transmitted through the bite of an infected tick. This explains the higher prevalence of ehrlichiosis in tropical and subtropical regions due to the geographical distribution of vectors (ANDEREG; PASSOS, 1999). Thus, the presence of known competent tick vectors as well as reservoir hosts largely determine where ehrlichiosis is found. For instance, E. canis infecting dogs is mainly transmitted by Rhipicephalus sanguineus (DANTAS-TORRES, 2008), E. ruminantium (cattle) by ticks of genus Amblyomma, E. chaffeensis (deer) and E. ewingii (human and dogs) by A. americanum and Dermacentor variabilis (DUMLER et al, 2001; YABSLEY, 2010), and E. muris (rodents) by Haemaphysalis flava and Ixodes persulcatus (INOKUMA et al., 2007). Other tick species, such as A. cajennense, have been suspected to act as vectors of E. canis in rural areas (COSTA JR et al., 2007). Several methods with varying degrees of sensitivity and specificity can be used to detect Ehrlichia organisms. In the past, Ehrlichia species were identified using light microscopy by finding elementary bodies, initial bodies or morulae in the host cell cytoplasm of Romanowsky-stained blood smears (Figure 1) (HILDEBRANDT et al., 1973). Unfortunately, this technique lacks sensitivity and specificity. Indirect immunofluorescence assay (IFA) was the traditional test to diagnose human and canine monocytic ehrlichiosis (Figure 2) (RISTIC et al., 1972; WANER et al., 2001; AGUIAR et al., 2007a; DUMLER et al., 2007; SAITO et al., 2008). Although this technique is still widely used, a significant number of false positives may occur due to cross-reactivity with other organisms from the genera Ehrlichia, Anaplasma and Neorickettsia (RISTIC et al., 1981; HARRUS et al.,
Rev. Bras. Parasitol. Vet.
2002; OLANO; WALKER, 2002; PADDOCK; CHILDS, 2003). Several other serological tests are now commercially available to diagnose ehrlichiosis (e.g., Enzyme Linked Immunosorbent Assay (ELISA), immunoblot, competitive Enzyme Linked Immunosorbent Assay (cELISA)) (OHASHI et al., 1998; WANER et al., 2000; ALLEMAN et al., 2001; LÓPEZ et al., 2007; ZHANG et al., 2008). Diagnostic accuracy has been greatly enhanced by the introduction of culture and molecular techniques. In Brazil, E. canis was first cultivated in 2002 using DH82 cells (TORRES et al., 2002) and a Brazilian strain was molecularly characterized in 2008 using dsb, 16S rRNA and p28 genes (AGUIAR et al., 2008). These organisms can all be grown in cell culture with exception of E. ewingii. However, this is a time-consuming technique not available in many laboratories. Cultures also require specialized laboratory facilities and highly trained personnel. Molecular detection of the Ehrlichia genus by polymerase chain reaction (PCR), nested-PCR and real-time PCR has been used to identify individuals infected either experimentally or naturally in both acute and chronic phase (MACIEIRA et al., 2005; DINIZ et al., 2007; LABRUNA et al., 2007; DAGNONE et al., 2009; FARIA et al., 2010; NAKAGHI et al., 2010). PCR is a more sensitive and specific test compared to other methods (IQBAL et al., 1994; PEIXOTO et al., 2005; LABRUNA et al., 2007), although falsepositive results can still occur (APFALTER et al., 2005). The geographic distribution of some Ehrlichia species has not yet been fully established, although E. canis and E. chaffeensis have been described in most regions of the world (INOKUMA et al., 1999; COCCO et al., 2003; FABURAY et al., 2005; MASTRANDREA et al., 2006; PEREZ et al., 2006; TAMAMOTO et al., 2007; MORO et al., 2009, NDIP et al., 2009). Ehrlichiosis is widely detected across Brazil (Figure 3). Three species have been described to date in Brazil: E. canis (AGUIAR et al., 2007a; LABRUNA et al., 2007; UENO et al., 2009; DINIZ et al., 2007; OLIVEIRA et al., 2009a), E. ewingii (OLIVEIRA et al., 2009c) and E. chaffeensis (MACHADO et al., 2006). This is a review of recent studies on the occurrence of Ehrlichia species in domestic and wild animals, ticks and humans in Brazil.
Companion Animals 1. Clinical findings of Ehrlichia canis infection in dogs Canine monocytic ehrlichiosis (CME) is a disease caused by E. canis and classically consists of three stages: acute, subclinical and chronic (NEER, 1998). The acute stage lasts two to four weeks and has non-specific clinical signs that may include apathy, anorexia, vomiting, fever, ocular and nasal discharge, weight loss, ocular lesions, lymphadenopathy, hepatosplenomegaly, and dyspnea (MOREIRA et al., 2003, 2005; CASTRO et al., 2004; AGUIAR et al., 2007b; ORIÁ et al., 2008; BORIN et al., 2009). Hematological findings in this phase may include normocytic normochromic anemia (MOREIRA et al., 2003, 2005; CASTRO et al., 2004; BORIN et al., 2009), leukopenia with a shift to the left (MOREIRA et al., 2003; BORIN et al., 2009) and thrombocytopenia (MOREIRA et al., 2003, 2005;
v. 20, n. 1, jan.-mar. 2011
Ehrlichiosis in Brazil
3
Figure 1. Light micrograph of Ehrlichia canis, Jaboticabal strain, inside a macrophage from an experimentally infected dog. Wright’s-Giemsa (100×). Photograph kindly provided by Profa. Dra. Machado, R. Z.
Figure 2. Indirect immunofluorescence assay (IFA) of Ehrlichia canis in serum from an infected dog (400×). Photograph kindly provided by Prof. Dr. Labruna, M. B.
CASTRO et al., 2004; BORIN et al., 2009; XAVIER et al., 2009). Cardiomyocyte injury has been identified in Brazilian dogs naturally infected with E. canis. In this population, dogs with acute ehrlichiosis were at a higher risk of developing myocardial cell injury than other sick dogs (DINIZ et al., 2008). The subclinical phase usually starts 6 to 9 weeks post-infection. Laboratory findings during the subclinical stage include nonregenerative anemia (MOREIRA et al., 2003, 2005; ORIÁ et al., 2008; BORIN et al., 2009), leukopenia and thrombocytopenia (DAGNONE et al., 2003; BULLA et al., 2004; MOREIRA et al., 2005; ORIÁ et al., 2008; SANTOS et al., 2009; XAVIER et al., 2009). Altered platelet function is likely since dogs may present superficial bleeding such as epistaxis and petechia, even when platelet counts and coagulation profiles are within reference ranges (FRANK; BREITSCHWERDT, 1999; MOREIRA et al., 2005). In chronic cases, infected dogs fail to mount an effective immune response. Bone marrow involvement leads to pancytopenia (WALKER et al., 1970; MOREIRA et al., 2005) and death may occur due to hemorrhage secondary to thrombocytopathy (DAGNONE et al., 2001) or infections in neutropenic patients (HUXSOLL et al., 1970). It appears that CME occurs at any time throughout the year in many parts of Brazil. Tropical weather favors the proliferation of its main biological vector R. sanguineus (DANTAS-TORRES, 2008).
epidemiological data among studies is difficult or not feasible. IFA and other serological methods may yield false-positive results because these techniques do not differentiate between infection and previous exposure to the organism, whereas false-negatives by PCR in peripheral blood also may occur in subclinically or chronically infected dogs. In the chronic phase, the pathological agent is present inside macrophages in the spleen (HARRUS et al., 1998) and not in peripheral blood (HARRUS et al., 2004), explaining the negative PCR results. The detection range by PCR varies among laboratories (MAANEN et al., 2004). In Jaboticabal city, São Paulo State, Southeastern Brazil, 30 dogs with clinical signs suggestive of ehrlichiosis were tested by different diagnostic methods; 53% were positive by nestedPCR from the 16S rRNA gene and 73% by serology (63% by IFA and 70% by dot-ELISA). In this study, only 27% of the dogs were tested positive by all three methods (NAKAGHI et al., 2008). The prevalence of E. canis infection in dogs from different areas and from selected hospital populations from Southeastern Brazil ranged from 15% (MACIEIRA et al., 2005) to 44.7% (COSTA JR et al., 2007). Table 1 summarizes the occurrence of E. canis in dogs from different geographic locations according to the type of population studied, total number of dogs evaluated in each study, and method of diagnosis. When dogs suspected to be infected based on suggestive clinical signs, such as pale mucous membranes, inappetence, apathy, vomiting, fever, lymphadenopathy, splenomegaly, epistaxis and others or laboratory data (anemia, thrombocytopenia) were tested, the prevalence increased from 40% (UENO et al., 2009) to 92.3% (OLIVEIRA et al., 2000). The prevalence of E. canis infection in dogs from rural and urban areas of the State of Rio Grande do Sul without abnormal clinical or laboratory findings was 4.8% (SAITO et al., 2008). Using dot-ELISA an E. canis prevalence of 36% was found in a hospital population in the Ilhéus-Itabuna microregion, Bahia State,
2. Prevalence of Ehrlichia canis infection in dogs Ehrlichia canis was first reported in Brazil in 1973 (COSTA et al., 1973). Although the disease is currently described nationwide, prevalence data is only available for some regions (Table 1). The studies differ with respect to population, geographic area, presence of vector, and diagnostic test used. Therefore, comparison of
4
Vieira, R.F.C. et al.
Rev. Bras. Parasitol. Vet.
Figure 3. Geographical illustration of serologic and molecular occurrence of Ehrlichia spp. infections in dogs from Brazil based on data from Table 1. Geographic Information System, ARCGIS 9, Version 9.2, ERSI.
Northeastern Brazil (CARLOS et al., 2007). Using nested-PCR, only 7.8% of dogs from a hospital population had E. canis DNA in their blood in this same microregion (CARVALHO et al., 2008). It is important to notice that since these studies were conducted in a hospital population, prevalence data may not reflect the actual situation of canine ehrlichiosis in that region. A national seroprevalence of E. canis and other agents was performed in 2,553 dogs presented to 138 veterinary practices in 12 Brazilian States using dot-ELISA as the diagnostic method. Dogs were presented to the clinic for routine vaccinations, examinations, or other procedures (LABARTHE et al., 2003). The geographical distribution of Ehrlichia spp. infections in dogs from Brazil by serologic and molecular methods is illustrated in Figure 1. In a survey of dogs from rural and urban areas by IFA, the prevalence found in Mato Grosso State (42.5%), Central-West Brazil (SILVA et al., 2010), was higher than in Rond么nia State (36%), Northern Brazil (AGUIAR et al., 2007b), Bahia State (35.6%),
Northeastern Brazil (SOUZA et al., 2010), and Rio Grande do Sul State (4.8%), Southern Brazil (SAITO et al., 2008). The reasons for different prevalences in Southern, Central-West and NorthernNortheastern Brazil are unknown, since R. sanguineus is abundant throughout these urban and rural areas of Brazil (LABRUNA; PEREIRA, 2001; DANTAS-TORRES et al., 2006). However, R. sanguineus ticks can adopt different strategies to seek their hosts and these strategies may vary widely from region to region (DANTAS-TORRES, 2008). As previously described, climatic (KEEFE et al., 1982), or habitat conditions where the animals live (SAINZ et al., 1996) may account for the differences found.
3. Risk factors of Ehrlichia canis infection in dogs In a study at the Veterinary Teaching Hospital (VTH), Universidade Estadual de Londrina, Paran谩 State, Southern Brazil, a random representative sample of the canine population at that
v. 20, n. 1, jan.-mar. 2011
Ehrlichiosis in Brazil
5
Table 1. Occurrence of ehrlichial infection in dogs from Brazil. Geographical area Southeastern Brazil Jaboticabal, SP
N. dogs
Diagnostic method
Jaboticabal, SP
Suspect Positive by dot-ELISA Suspect
52 48 51
Jaboticabal, SP
Suspect
25
Jaboticabal, SP
Suspect
30
Jaboticabal, SP
Suspect
40
Botucatu, SP
Suspect
35 35 198
Botucatu, SP
Suspect
70
Botucatu, SP
Hospital
217
dot-ELISA1 Blood smear examination IFA dot-ELISA1 Nested PCR for 16S rRNA gene IFA dot-ELISA1 Nested PCR for 16S rRNA gene Nested PCR for 16S rRNA gene Spleen aspiration Blood smear examination PCR for 16S rRNA gene IFA PCR for dsb gene Blood smear examination Nested PCR for 16S rRNA gene
non-thrombocytopenic thrombocytopenic Random Random Random Random non-thrombocytopenic thrombocytopenic Hospital
71 146 671 422 446 226 114 112 221
non-thrombocytopenic thrombocytopenic Rural area Urban area Hospital
114 107 226 101 4407
Random Random Random Random Anemic and/or thrombocytopenic Random
São Paulo State Rio de Janeiro State Minas Gerais State Rio de Janeiro, RJ
Ribeirão Preto, SP
Minas Gerais State Minas Gerais State Minas Gerais State Southern Brazil Rio Grande do Sul State Rio Grande do Sul State Paraná State Londrina, PR Londrina, PR Santa Catarina State Northern Brazil Montenegro, RO
Northeastern Brazil Salvador, BA Ilhéus-Itabuna, BA Ilhéus-Itabuna, BA Bahia State 1
Population
dot-ELISA2 dot-ELISA2 dot-ELISA2 PCR for 16S rRNA gene
Nested PCR for 16S rRNA gene
Occurrence 48/52 (92.3%) 1/48 (2%) 34/51 (66.6%) 44/51 (86.2%) 22/25 (88%)
Reference Oliveira et al. (2000) Oriá et al. (2008) Dagnone et al. (2009)
19/30 (63.3%) 21/30 (70%) 16/30 (53.3%)
Nakaghi et al. (2008)
29/40 (72.5%)
Faria et al. (2010)
17/35 (48.6%) 2/35 (5.7%) 154/198 (77.7%) 145/198(73.2%) 28/70 (40%) 10/70 (7%) 67/217 (30.9%)
Diniz et al. (2007) Diniz et al. (2007) Ueno et al. (2009)
1/71 (1.4%) 66/146 (45%) 104/671 (15.5%) 125/422 (29.6%) 93/446 (20.9%) 34/226 (15%) 4/114 (2.6%) 30/112 (26.8%) 86/221 (38.9%)
Bulla et al. (2004)
Labarthe et al. (2003) Labarthe et al. (2003) Labarthe et al. (2003) Macieira et al. (2005)
Santos et al. (2009)
29/114 (25%) 57/107 (53%) IFA 101/226 (44.7%) Blood smear examination 16/101 (16%) Blood smear examination 251/4407 (5.7%)
Costa Jr et al. (2007) Soares et al. (2006) Borin et al. (2009)
389 356 43 381 129
IFA dot-ELISA2 dot-ELISA2 dot-ELISA2 PCR for 16S rRNA gene
19/389 (4.8%) 6/356 (1.7%) 2/43 (4.7%) 87/381 (22.8%) 28/129 (22%)
Saito et al. (2008) Labarthe et al. (2003) Labarthe et al. (2003) Trapp et al. (2006) Dagnone et al. (2003)
142
dot-ELISA2
1/142 (0.7%)
Labarthe et al. (2003)
Random Urban area Rural area
314 153 161
IFA
Random Hospital Hospital
472 200 153
Random
117
IFA dot-ELISA Nested PCR for 16S rRNA gene dot-ELISA2
Immunocomb, Biogal; 2SNAP® 3DX, Idexx.
97/314 (31%) 58/153 (38%) 40/161 (25%)
Aguiar et al. (2007b)
168/472 (35.6%) 72/200 (36%) 12/153 (7.8%)
Souza et al. (2010) Carlos et al. (2007) Carvalho et al. (2008)
42/117 (35.9%)
Labarthe et al. (2003)
6
Vieira, R.F.C. et al.
Rev. Bras. Parasitol. Vet.
Table 1. Continued... Geographical area Ceará State Pernambuco State Alagoas State Central-West Brazil Cuiabá, MT Campo Grande, MS
1
Population Random Random Random
N. dogs Diagnostic method 11 dot-ELISA2 105 dot-ELISA2 11 dot-ELISA2
Random Suspect
254 26
Mato Grosso do Sul State Random Federal District Random
126 101
IFA Nested PCR for 16S rRNA gene dot-ELISA2 dot-ELISA2
Occurrence 5/11 (45.5%) 52/105 (49.5%) 6/11 (54.5%)
Reference Labarthe et al. (2003) Labarthe et al. (2003) Labarthe et al. (2003)
108/254 (42.5%) 10/26 (38.4%)
Silva et al. (2010) Dagnone et al. (2009)
45/126 (35.7%) 24/101 (23.8%)
Labarthe et al. (2003) Labarthe et al. (2003)
Immunocomb, Biogal; 2SNAP® 3DX, Idexx.
institution was tested. Eighty-seven out of 381 (22.8%) dogs were seropositive for ehrlichiosis using a commercially available immunoenzymatic dot-ELISA (SNAP® 3DX, IDEXX Laboratories Inc., Portland, ME, USA) assay. The groups at higher risk of being seropositive to ehrlichiosis than the general population included: dogs older than 1 year, previously exposed to ticks and presence of neurological signs. Dogs seropositive for B. vogeli were more likely to be seropositive to E. canis and 54/381 (14.2%) of these dogs had antibodies against both agents (TRAPP et al., 2006). In another study using thrombocytopenia and anemia as screeners for E. canis infection, 22% of 129 dogs tested positive for E. canis DNA by PCR at the same VTH (DAGNONE et al., 2003). Most veterinary clinicians in Brazil use the presence of clinical and/or laboratorial findings to make a presumptive diagnosis of E. canis infection in dogs. At the Botucatu VTH, Southeastern Brazil, 217 canine blood samples randomly obtained from routine tests made at the Clinical Pathology Laboratory were divided into two groups based on platelet count: 71 nonthrombocytopenic and 146 thrombocytopenic. This population has an unexpectedly high prevalence of thrombocytopenia but unfortunately the randomization method was not described in the study. Thrombocytopenic dogs were divided into those with mild thrombocytopenia (62/146 dogs, platelets count between 100,000‑200,000/µL) and severe thrombocytopenia (84/146 dogs, less than 100,000/µL). Sixty-seven (31%) of all dog blood samples in the study were positive using a nested-PCR protocol, whereas 45% of thrombocytopenic dogs were positive. Twentyone percent of the dogs with mild and 63% of dogs with severe thrombocytopenia had ehrlichial DNA amplified by nested-PCR from the 16S rRNA gene. In this study the authors suggested that in endemic areas dogs with severe thrombocytopenia are more likely to be infected by E. canis infection (BULLA et al., 2004). In Rio de Janeiro, Southeastern Brazil, 226 dogs presented at private clinics were sampled and divided into thrombocytopenic (112/226) and non-thrombocytopenic (114/226). Ehrlichia canis infection was documented in 30 (27%) dogs with thrombocytopenia, but only in 4 (3%) non-thrombocytopenic animals using a PCR assay specific for the 16S rRNA gene. Anemia was found in 60% of thrombocytopenic dogs that were PCR-positive (MACIEIRA et al., 2005). In Ribeirão Preto, Southeastern Brazil, 86/221 dogs (39%) from private veterinary university hospitals were positive for E. canis by nested-PCR for the 16S rRNA gene, 57/107 (53%) were thrombocytopenic and 29/114 (25%) were non-thrombocytopenic (SANTOS et al., 2009).
In the city of Jaboticabal, Southeastern Brazil, 51 dogs with uveitis tested positive to E. canis infection by IFA (66.6%) and dot-ELISA (86.2%). Anemia and thrombocytopenia were the most common hematological abnormalities found. A high association between clinical uveitis and positive serology for E. canis was demonstrated in this study (ORIÁ et al., 2008). In another study in the city of Jaboticabal, 52 dogs suspected of naturally acquired ehrlichiosis were selected at the VTH and tested by a commercial ELISA. A high prevalence of seropositive dogs (92.3%) was found. The most common clinical and laboratorial findings were inappetence, apathy, anemia and thrombocytopenia (OLIVEIRA et al., 2000). Seroprevalence by IFA was determined in three rural areas of Minas Gerais State, Southeastern Brazil using 226 dogs living in these areas. Ehrlichia canis prevalence in this study ranged from 24.7-65.6% (COSTA JR et al., 2007). In this study, male dogs >2 years of age and those infested by ticks were at high risk of being seropositive to E. canis (COSTA JR et al., 2007). In a survey conducted in urban areas of Minas Gerais State, blood samples were collected from 51 dogs that were restricted to house backyards and 50 dogs that lived in apartments. E. canis was found by blood smear examination in 16% of dogs from houses with grassy yards, but in none of the dogs restricted to apartments. R. sanguineus was the only tick found in this study (SOARES et al., 2006). Differences on E. canis prevalence between these two studies may be due to different detection methods. Rhipicephalus sanguineus can also transmit other hemoparasites (DANTAS-TORRES, 2008) and since it is widespread in Brazil (LABRUNA; PEREIRA, 2001), it is relatively common to find E. canis-infected dogs co-infected with Anaplasma sp. (MOREIRA et al., 2003; DAGNONE et al., 2003, 2009), Babesia sp. (MOREIRA et al., 2003; SOARES et al., 2006; TRAPP et al., 2006; BORIN et al., 2009), Bartonella sp. (DINIZ et al., 2007), Hepatozoon sp. (O’DWYER et al., 2006; MUNDIM et al., 2008), Leishmania sp. (DINIZ et al., 2007) and Mycoplasma sp. (MOREIRA et al., 2003, 2005). Blood smear examination is not an effective diagnostic method as morulae are visualized only during the acute phase and the percentage of infected cells is usually less than 1% (CADMAN et al., 1994). Diagnostic sensitivity between cytological methods was assessed in 50 dogs naturally infected by E. canis. During the acute phase of the disease, the highest sensitivities were found in buffy coats (66%) and lymph nodes (60.4%) compared to peripheral
v. 20, n. 1, jan.-mar. 2011
Ehrlichiosis in Brazil
blood (8%) examinations (MYLONAKIS et al., 2003). Using 35 samples collected from dogs suspected of being infected with E. canis, based on clinical signs and presence of thrombocytopenia, 17 dogs (48.6%) showed intracytoplasmatic morulae in spleen aspiration and only two (5.7%) showed in buffy coat, however E. canis DNA was isolated in 29/40 (72.5%) spleen samples and 30/40 (75%) whole blood samples (FARIA et al., 2010). Moreover, 51 blood samples from dogs with both clinical signs consistent with ehrlichiosis and the presence of intracytoplasmatic inclusion bodies or morulae-like forms in white blood cells were submitted to molecular analysis. Thirty-two (64%) dog samples were positive for E. canis by nested-PCR for the 16S rRNA gene (DAGNONE et al., 2009). Thus, an absence of parasites in blood smears does not rule out the possibility of infection (HOSKINS, 1991).
4. Ehrlichia ewingii infection in dogs In Minas Gerais State, Southeastern Brazil, 5/100 (5%) dogs tested positive by nested-PCR for the 16S rRNA gene of E. ewingii. These same dogs were also positive by a second PCR assay targeting a fragment of the ehrlichial dsb gene. Four animals had anemia and one of them also had thrombocytopenia. This was the first study to provide evidence of canine infection caused by E. ewingii in Brazil (OLIVEIRA et al., 2009c), however species confirmation by DNA sequencing was not reported. Given that a previous study documented false-positive amplifications, especially when targeting the 16S rRNA by PCR (SUKSAWAT et al., 2001), other genes should be analyzed to confirm E. ewingii infection and thus the initial results from Oliveira et al. (2009c) remain to be confirmed.
5. Ehrlichiosis in Cats Antibodies against E. canis antigens have been described in domestic cats in a few countries (MATTHEWMAN et al., 1996; PEAVY et al., 1997; ORTUÑO et al., 2005; SOLANOGALLEGO et al., 2006) and documented clinical cases of ehrlichiosis in these animals are rare (BREITSCHWERDT et al., 2002). Ehrlichia organisms have not been cultured from feline samples; evidence of infection came exclusively from serological and molecular studies (BREITSCHWERDT et al., 2002; OLIVEIRA et al., 2009b). Nevertheless, Ehrlichia canis-like organisms were detected by PCR and DNA sequencing in cats from Brazil and North America (BREITSCHWERDT et al., 2002; OLIVEIRA et al., 2009b). The first molecular detection of E. canis in Brazilian cats was reported in a study at a VTH of Minas Gerais State, Southeastern Brazil, in which blood samples from 3/15 cats tested positive by nested-PCR for the 16S rRNA gene. The E. canis sequence, a fragment of the 16S rRNA gene, showed 100% identity with the E. canis sequence obtained from dogs from the same study area (OLIVEIRA et al., 2009a, 2009b). Further studies are needed to better characterize the Ehrlichia spp. involving other genes, transmission, pathogenesis and clinical presentation in cats.
7
Wildlife Animals Cervid species may be infected with Ehrlichia organisms (YABSLEY et al., 2002; MACHADO et al., 2006; KAWAHARA et al., 2009; LEE et al., 2009). In the United States, white-tailed deer (Odocoileus virginianus) is considered the main reservoir of E. chaffensis and possibly of E. ewingii (YABSLEY et al., 2002; KAWAHARA et al., 2009). The first molecular detection of E. chaffeensis in Brazil was reported on the border of São Paulo and Mato Grosso do Sul States, between Southeastern and Central-Western regions of Brazil. In this study, 3/7 captured marsh deers (Blastocerus dichotomus) tested positive by nested-PCR for E. chaffeensis infection (MACHADO et al., 2006). Sequence analysis from positive samples showed 97% identity with sequences deposited in GenBank. Two out of three positive E. chaffeensis-positive marsh deer samples were also positive for Anaplasma marginale by nested-PCR. Ehrlichia ruminantium infection in ruminants has been reported only in Africa and Caribbean region. Some non-African cervids are also known to be susceptible to this agent, including the whitetailed deer, the Timor deer (Cervus timorensis) and chital (Axis axis) (PETER et al., 2002). Recently, an Ehrlichia sp. closely related to E. ruminatium was detected in white-tailed deer from the United States, suggesting that the range of Ehrlichia species infecting these animals is broader than first thought (YABSLEY et al., 2008). To date, there are no reports of other Ehrlichia species rather than E. chaffeensis in wild ruminants from Brazil; monitoring of these animals is highly desired. An E. canis serological survey by IFA of 20 free-ranging felids (18 pumas [Puma concolor], one ocelot [Leopardus pardalis] and two spotted cats [Leopardus tigrinus]) from different parts of Brazil was conducted and antibodies against E. canis were detected only in one puma (FILONI et al., 2006). Since IFA has high cross-reactivity with members of Anaplasmataceae family, definitive diagnosis of E. canis infection cannot be ensured. In another study, 72 blood samples from wild captive felids (9 pumas [P. concolor], 29 oncelots [L. pardalis], 6 jaguarondis [P. yagouaroundi], 2 margays [L. wiedii], 14 little spotted cats [L. tigrinus], 3 pampas cats [L. pajeros] and 9 jaguars [Panthera onca]) were tested for Ehrlichia spp. infection. Using IFA 5/72 (7%) animals tested positive for E. canis antibodies and 11/72 (15.3%) animals were positive for E. canis by nested‑PCR based on 16S rRNA gene. Nested-PCR positive samples were submitted to another omp-1 gene based nested‑PCR and only four samples tested positive. Sequencing of the 16S rRNA gene obtained showed 97% identity to E. canis strain Jaboticabal. However, based on omp-1 sequences, Ehrlichia sp. detected from Brazilian felids may be a novel Ehrlichia species. It was the first study of molecular detection of Ehrlichia sp. in Brazilian wild felids (ANDRÉ et al., 2010).
Public Health There are to date two recognized diseases caused by Ehrlichia species: human monocytic ehrlichiosis (HME) caused by E. chaffeensis; and human granulocytic ehrlichiosis (HGE) due to E. ewingii (OLANO; WALKER, 2002). Other rickettsial agents, A. phagocytophilum and N. sennetsu also cause disease in humans.
8
Vieira, R.F.C. et al.
HME and HGE have been described worldwide (OTEO et al., 2000; GUILLAUME et al., 2002; GARDNER et al., 2003; RUSCIO; CINCO, 2003; MASTRANDREA et al., 2006). Three human ehrlichiosis cases have been serologically identified as HME in Brazil since 1980 (CALIC et al., 2004; COSTA et al., 2005, 2006) but molecular confirmation has not been performed. The disease in humans has been suggested serologically in other South American countries including Argentina (RIPOLL et al., 1999), Chile (LÓPEZ et al., 2003) and Peru (MORO et al., 2009). The lack of molecular characterization of the organism precludes any conclusion regarding the pathogenic agent in these cases. An E. canis isolate has been successfully obtained in cell culture from blood of an asymptomatic person in Venezuela (PEREZ et al., 1996). The genetic sequence from this isolate was identical to E. canis isolates infecting dogs and R. sanguineus ticks in the same area of Venezuela, suggesting that human infection may be transmitted by R. sanguineus ticks (UNVER et al., 2001). Ehrlichia canis DNA was also amplified from blood of six human patients with clinical signs of HME in Venezuela, suggesting that E. canis can be associated with clinical manifestation in humans (PEREZ et al., 2006). In addition, the genetic characterization of the entire 16S rRNA gene of two strains of E. canis in Botucatu region, São Paulo State, Brazil, showed that one strain naturallyinfecting dogs was identical to the Venezuelan strain infecting humans (DINIZ et al. 2007). Thus, E. canis strains from Brazil may be capable of infecting humans. Infestations by the brown dog tick, R. sanguineus, in humans have been reported worldwide (MANFREDI et al., 1999; GUGLIELMONE et al., 1991; FELZ et al., 1996; VENZAL et al., 2003; DEMMA et al., 2005). They were observed twice in Brazil, in the city of Goiania, Goiás State, Central-Western region where larvae, nymph and adult stages of R. sanguineus were found (LOULY et al. 2006), and in the city of Recife, Pernambuco State, Northeastern region, where only adult ticks were found parasitizing humans (DANTAS-TORRES et al., 2006). In the city of Londrina, Paraná State, Southern Brazil, owners of dogs with ticks were more likely to have been exposed to ticks themselves. Only 10% of the owners who occasionally interacted with their dogs while more than 25% of the owners who frequently or very frequently interacted reported past tick infestations (TRAPP et al., 2006). Thus, interaction between human beings and R. sanguineus is likely to be more common than is usually recognized (DANTAS‑TORRES, 2008). Ehrlichia ewingii, an agent known to cause granulocytic ehrlichiosis in dogs, was recognized in 1998 to cause infections in humans (BULLER et al., 1999), but it has not been identified as an infecting agent of humans in Brazil. A single case of ehrlichiosis caused by an Ehrlichia ruminantium–like bacterium, called the Panola Mountain Ehrlichia, has been identified in a 31-year-old man from Georgia, United States (REEVES et al., 2008). Human exposure to tick vectors is seasonal and occurs predominantly in rural and suburban areas involving recreational, peridomestic, occupational, and military activities (DEMMA et al., 2005). Both forms of human ehrlichiosis (monocytic and granulocytic) have common clinical and laboratory manifestations that include fever, headache, myalgia and malaise, thrombocytopenia, leukopenia, and elevated liver enzymes (OLANO et al., 2003;
Rev. Bras. Parasitol. Vet.
STONE et al., 2004). Infection by E. chaffeensis can cause a severe form of HME that can be life-threatening in HIV-infected patients (PADDOCK et al., 2001). Central nervous system infection is found rarely in HGE, whereas rashes are common in HME cases. The key for HME or HGE diagnosis is the identification of fever and thrombocytopenia, leukopenia, and elevated serum alanine-amino transferase in a patient exposed to ticks in endemic areas during times of tick activity (STONE et al., 2004; OLANO et al., 2003). The first case of HME diagnosed in the United States was in a 51-year-old man who became ill in April 1986, 12 to 14 days after bitten by ticks in rural Arkansas (MAEDA et al., 1987). The disease was first thought to be caused by the canine pathogen E. canis. However, E. chaffeensis was shown to be the main causative agent of HME in the US in the 1990’s (BAKKEN et al., 1994). The first study using IFA was carried out in 1998 for E. chaffeensis infection in Minas Gerais State, Southeastern Brazil, in which no reactivity was found in 473 students from four schools (GALVÃO et al., 2002). The two first suspected cases of human ehrlichiosis in Brazil occurred in 2001, in Minas Gerais State, Southeastern Brazil (CALIC et al., 2004). The first patient was a 39-year-old man suspected of harboring the Brazilian Spotted Fever (BSF) agent. He had fever, headache, nausea, vomiting, myalgia, conjunctivitis, respiratory and renal failure. IFA testing for BSF and murine typhus, microagglutination testing for leptospirosis, and ELISA testing for yellow fever and dengue were performed and they were all negative. However, IFA detected antibodies against E. chaffeensis. Antibodies against A. phagocytophilum were not present. The second patient was a 20-year-old man presenting similar clinical signs. Antibodies were detected against E. chaffeensis, but not against A. phagocytophilum. Based on clinical and serologic results a suggestive diagnosis of HME was established. Nine of 771 (1.2%) febrile patients had antibodies against E. chaffeensis by IFA in a study conducted in Minas Gerais, Southeastern Brazil, from 2001 to 2005. This case series resulted from a specific protocol to search for rickettsial agents as a cause of fever (COSTA et al., 2006). In the study, all patients reported tick bite prior to the disease. Based on the accepted criteria for diagnosis (WALKER, 2000), all cases had epidemiological and serologic findings consistent with HME (COSTA et al., 2006). In 2001, another IFA serosurvey for rickettsial agents conducted in healthy individuals from a rural community in Minas Gerais State showed that 46/437 (10.5%) had antibodies against E. chaffeensis (COSTA et al., 2005). The infection rate was higher among people living in farms when compared to those living in the village. History of tick exposure was widespread affecting roughly 100% of this population. IFA is considered the gold standard for clinical diagnosis of HME. However, it is important to note the cross-reactivity between E. canis and E. chaffeensis. There is only one description of E. chaffeensis (from a deer) confirmed by sequencing in Brazil, however E. canis in dogs is common and widespread. The authors’ hypothesis is that some, if not all, human cases attributed to E. chaffeensis in Brazil are actually caused by E. canis (DINIZ et al., 2007). The first molecular surveillance for tick-borne diseases on humans was recently conducted in rural areas of Rondônia and São Paulo States, Northern and Southeastern Brazil, respectively
v. 20, n. 1, jan.-mar. 2011
Ehrlichiosis in Brazil
(LABRUNA et al., 2007). No Ehrlichia DNA was detected by real-time PCR in 75 blood samples from febrile patients with history of tick exposure. In summary, suspected human ehrlichiosis has been serologically suggested in Brazil since 2001. The surveillance studies are limited and restricted to only a few geographic areas. Comprehensive epidemiological studies using both serological and molecular methods are needed to fully establish the extent and importance of human ehrlichiosis in Brazil.
Conclusion In conclusion, two Ehrlichia species, E. canis and E. chaffeensis, have been confirmed to occur in Brazil to date. Only E. canis has been successfully isolated in cell cultures from clinical samples of dogs. The disease caused by E. canis is considered endemic in dogs from several regions of Brazil, whereas the infection by E. chafeensis has been found in a wild reservoir. Although human ehrlichiosis has been serologically suggested in Brazil, the extent of the disease and its causative agent remain unknown.
Acknowledgements We thank Profa. Dra. Rosangela Zacarias Machado (Faculdade de Ciências Agrárias e Veterinárias – UNESP, Jaboticabal, São Paulo) for her corrections and suggestions made to the manuscript.
References AGUIAR, D. M. et al. Diagnóstico sorológico de erliquiose canina com antígeno brasileiro de Ehrlichia canis. Ciência Rural, v. 37, n. 3, p. 796-802, 2007a. AGUIAR, D. M. et al. Prevalence of Ehrlichia canis (Rickettsiales: Anaplasmataceae) in dogs and Rhipicephalus sanguineus (Acari: Ixodidae) ticks from Brazil. Journal of Medical Entomology, v. 44, n. 1, p. 126‑132, 2007b. AGUIAR, D. M.; HAGIWARA, M. K.; LABRUNA, M. B. In vitro isolation and molecular characterization of an Ehrlichia canis strain from São Paulo, Brazil. Brazilian Journal of Microbiology, v. 39, n. 3, p. 489-493, 2008. ALLEMAN, A. R. et al. Recombinant major antigenic protein 2 of Ehrlichia canis: a potential diagnostic tool. Journal of Clinical Microbiology, v. 39, n. 7, p. 2494-2499, 2001. ANDEREG, P. I.; PASSOS, L. M. F. Erliquiose canina – Revisão. Clinica Veterinária, v. 4, n. 19, p. 31-38, 1999. ANDRÉ, M. R. et al. Molecular and serologic detection of Ehrlichia spp. in endangered Brazilian wild captive felids. Journal of Wildlife Diseases, v. 46, n. 3, p. 1017-1023, 2010. APFALTER, P.; REISCHL, U.; HAMMERSCHLAG, M. R. In-house nucleic acid amplification assays in research: how much quality control is needed before one can rely upon the results? Journal of Clinical Microbiology, v. 43, n. 12, p. 5835-5841, 2005.
9
BAKKEN, J. S. et al. Human granulocytic ehrlichiosis in the upper Midwest United States. A new species emerging? Journal of the American Medical Association, v. 272, n. 3, p. 212-218, 1994. BORIN, S.; CRIVELENTI, L. Z.; FERREIRA, F. A. Aspectos epidemiológicos, clínicos e hematológicos de 251 cães portadores de mórula de Ehrlichia spp. naturalmente infectados. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 61, n. 3, p. 566-571, 2009. BREITSCHWERDT, E. B et al. Molecular evidence supporting Ehrlichia canis–like infection in Cats. Journal of Veterinary Internal Medicine, v. 16, n. 6, p. 642-649, 2002. BULLA, C. et al. The relationship between the degree of thrombocytopenia and infection with Ehrlichia canis in an endemic area. Veterinary Research, v. 35, n. 1, p. 141-146, 2004. BULLER, R. S. et al. Ehrlichia ewingii, a newly recognized agent of human ehrlichiosis. New England Journal of Medicine, v. 341, n. 3, p. 148-155, 1999. CADMAN, H. F.; KELLY, P. J.; MATTHEWMAN, L. A. Comparison of the dot-blot enzyme linked immunoassay with immunofluorescence for detecting antibodies to Ehrlichia canis. Veterinary Record, v. 135, n. 15, p. 362, 1994. CALIC, S. B. et al. Human ehrlichioses in Brazil: First suspect cases. The Brazilian Journal of Infectious Diseases, v. 8, n. 3, p. 259-262, 2004. CARLOS, R. S. A. et al. Frequencia de Anticorpos anti- Erhlichia canis, Borrelia burgdorferi e Antígenos de Dirofilaria immitis em cães na microregião Ilhéus – Itabuna, Bahia, Brazil. Revista Brasileira de Parasitologia Veterinária, v. 16, n. 3, p. 117-120, 2007. CARVALHO, F. S. et al. Epidemiological and molecular study of Ehrlichia canis in dogs in Bahia, Brazil. Genetic and Molecular Research, v. 7, n. 3, p. 657-662, 2008. CASTRO, M. B. et al. Experimental acute canine monocytic ehrlichiosis: clinicopathological and immunopathological findings. Veterinary Parasitology, v. 119, n. 1, p. 73-86, 2004. COCCO, R. et al. Ehrlichiosis and rickettsiosis in a canine population of Northern Sardinia. Annals of the New York Academy of Sciences, v. 990, p. 126-130, 2003. COSTA Jr, L. M. C. et al. Sero-prevalence and risk indicators for canine ehrlichiosis in three rural areas of Brazil. The Veterinary Journal, v. 174, n. 3, p. 673-676, 2007. COSTA, J. O. et al. Ehrlichia canis infection in a dog in Belo HorizonteBrazil. Arquivos Escola Veterinária UFMG, v. 25, p. 199-200, 1973. COSTA, P. S. G. et al. More about human monocytotropic ehrlichiosis in Brazil: serological evidence of nine new cases. The Brazilian Journal of Infectious Diseases, v. 10, n. 1, p. 7-10, 2006. COSTA, P. S. G.; BRIGATTE, M. E.; GRECO, D. B. Antibodies to Rickettsia rickettsii, Rickettsia typhi, Coxiella burnetii, Bartonella henselae, Bartonella quintana, and Ehrlichia chaffeensis among healthy population in Minas Gerais, Brazil. Memórias do Instituto Oswaldo Cruz, v. 100, n. 8, p. 853-859, 2005. DAGNONE, A. S. et al. Molecular diagnosis of Anaplasmataceae organisms in dogs with clinical and microscopical signs of ehrlichiosis. Revista Brasileira de Parasitologia Veterinária, v. 18, n. 4, p. 20-25, 2009. DAGNONE, A. S. et al. Ehrlichiosis in anemic, thrombocytopenic, or tick-infested dogs from a hospital population in South Brazil. Veterinary Parasitology, v. 117, n. 4, p. 285-290, 2003.
10
Vieira, R.F.C. et al.
DAGNONE, A. S.; MORAIS, H. S. A.; VIDOTTO, O. Erliquiose nos animais e no homem. Semina Agrárias, v. 22, n. 2, p. 191-201, 2001. DANTAS-TORRES, F. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): From taxonomy to control. Veterinary Parasitology, v. 152, n. 3-4, p. 173-185, 2008. DANTAS-TORRES, F.; FIGUEIREDO, L. A.; BRANDÃO-FILHO, S. P. Rhipicephalus sanguineus (Acari: Ixodidae), the brown dog tick, parasitizing humans in Brazil. Revista da Sociedade Brasileira de Medicina Tropical, v. 39, n. 1, p. 64-67, 2006. DEMMA, L. J. et al. Epidemiology of human ehrlichiosis and anaplasmosis in the United States, 2001-2002. American Journal of Tropical Medicine and Hygiene, v. 73, n. 2, p. 400-409, 2005. DINIZ, P. P. V. P. et al. Serum cardiac troponin I concentration in dogs with ehrlichiosis. Journal of Veterinary Internal Medicine, v. 22, n. 5, p. 1136-1143, 2008. DINIZ, P. P. V. P. et al. Surveillance for zoonotic vector-borne infections using sick dogs from Southeastern Brazil. Vector-Borne and Zoonotic Diseases, v. 7, n. 4, p. 689-697, 2007. DUMLER, J. S. et al. Ehrlichioses in humans: epidemiology, clinical presentation, diagnosis, and treatment. Clinical Infectious Diseases, v. 45, Supl. 1, p. 45-51, 2007. DUMLER, J. S. et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Internation Journal of Systematic and Evolutionary Microbiology, v. 51, n. 6, p. 2145-2165, 2001. FABURAY, B. et al. Point seroprevalence survey of Ehrlichia ruminantium infection in small ruminants in The Gambia. Clinical and Diagnostic Laboratory Immunology, v. 12, n. 4, p. 508-512, 2005. FARIA, J. L. M. et al. Ehrlichia canis morulae and DNA detection in whole blood and spleen aspiration samples. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 2, p. 98-102, 2010. FELZ, M. W.; DURDEN, L. A.; OLIVER Jr, J. H. Ticks parasitizing humans in Georgia and South Carolina. Journal of Parasitology, v. 82, n. 3, p. 505-508, 1996.
Rev. Bras. Parasitol. Vet.
GUILLAUME, B. et al. Seroprevalence of human granulocytic ehrlichiosis infection in Belgium. European Journal of Clinical Microbiology & Infectious Diseases, v. 21, n. 5, p. 397-400, 2002. HARRUS, S. et al. Amplification of ehrlichial DNA from dogs 34 months after infection with Ehrlichia canis. Journal of Clinical Microbiology, v. 36, n. 1, p. 73-76, 1998. HARRUS, S. et al. Comparison of simultaneous splenic sample PCR with blood sample PCR for diagnosis and treatment of experimental Ehrlichia canis infection. Antimicrobial Agents and Chemotherapy, v. 48, n. 11, p. 4488-4490, 2004. HARRUS, S. et al. Comparison of three enzyme-linked immunosorbant assays with the indirect immunofluorescent antibody test for the diagnosis of canine infection with Ehrlichia canis. Veterinary Microbiology, v. 86, n. 4, p. 361-368, 2002. HILDEBRANDT, P. K. et al. Ultrastructure of Ehrlichia canis. Infection and Immunity, v. 7, n. 2, p. 265-271, 1973. HOSKINS, J. D. Ehrlichial diseases of dogs: diagnosis and treatment. Canine Practice, v. 16, n. 3, p. 13-21, 1991. HUXSOLL, D. L. et al. Tropical canine pancytopenia. Journal of American Veterinary Medicine Association, v. 157, n. 11, p. 1627‑1632, 1970. INOKUMA, H. et al. Prevalence of tick-borne Rickettsia and Ehrlichia in Ixodes persulcatus and Ixodes ovatus in Tokachi district, Eastern Hokkaido, Japan. Journal of Veterinary Medical Science, v. 69, n. 6, p. 661-664, 2007. INOKUMA, H.; OHNO, K.; YAMAMOTO, S. Serosurvey of Ehrlichia canis and Hepatozoon canis infection in dogs in Yamaguchi Prefecture, Japan. Journal of Veterinary Medical Science, v. 61, n. 10, p. 1153‑1155, 1999. IQBAL, Z.; CHAICHANASIRIWITHAYA, W.; RIKIHISA, Y. Comparison of PCR with other tests for early diagnosis of canine ehrlichiosis. Journal of Clinical Microbiology, v. 32, n. 7, p. 1658‑1662, 1994. KAWAHARA, M. et al. Ehrlichia chaffeensis in Sick Deer, Nara Park, Japan. Emerging Infectious Diseases, v. 15, n. 12, p. 1991-1993, 2009.
FILONI, C. et al. First evidence of Feline Herpesvirus, Calicivirus, Parvovirus, and Ehrlichia Exposure in Brazilian Free-ranging Felids. Journal of Wildlife Diseases, v. 42, n. 2, p. 470-477, 2006.
KEEFE, T. J.; SALYER, P. E.; RISTIE, M. Distribution of Ehrlichia canis among military working dogs in the world and selected civilian dogs United States. Journal of American Veterinary Association, v. 181, n. 3, p. 236-238, 1982.
FRANK, J. R.; BREITSCHWERDT, E. B. A retrospective study of ehrlichiosis in 62 dogs from North Carolina and Virginia. Journal of Veterinary Internal Medicine, v. 13, n. 3, p. 194-201, 1999.
LABARTHE, N. et al. Serologic prevalence of Dirofilaria immitis, Ehrlichia canis, and Borrelia burgdorferi infections in Brazil. Veterinary Therapeutics, v. 4, n. 1, p. 67-75, 2003.
GALVÃO, M. A. M. et al. Rickettsioses emergentes e reemergentes numa região endêmica do estado de Minas Gerais, Brasil. Cadernos de Saúde Pública, v. 18, n. 6, p. 1593-1597, 2002.
LABRUNA, M. B. et al. A preliminary investigation of Ehrlichia species in ticks, humans, dogs, and capybaras from Brazil. Veterinary Parasitology, v. 143, n. 2, p. 189-195, 2007.
GARDNER, S. L. et al. National surveillance for the human ehrlichioses in the United States, 1997-2001, and proposed methods for evaluation of data quality. Annals of the New York Academy of Sciences, v. 990, p. 80-89, 2003.
LABRUNA, M. B.; PEREIRA, M. C. Carrapato em cães no Brasil. Clínica Veterinária, v. 6, n. 30, p. 24-32, 2001.
GUGLIELMONE, A. A.; MANGOLD, A. J.; VIÑABAL, A. E. Ticks (Ixodidae) parasitizing humans in four provinces of north-western Argentina. Annals of Tropical Medicine and Parasitology, v. 85, n. 5, p. 539-542, 1991.
LEE, M. et al. Natural co-infection of Ehrlichia chaffeensis and Anaplasma bovis in a deer in South Korea. The Journal of Veterinary Medical Science, v. 71, n. 1, p. 101-103, 2009. LÓPEZ, J. et al. Ehrlichiosis humana en Chile, evidencia serológica. Revista Médica de Chile, v. 131, n. 1, p. 67-70, 2003.
v. 20, n. 1, jan.-mar. 2011
Ehrlichiosis in Brazil
11
LÓPEZ, L. et al. Development of a sensitive and specific indirect enzymelinked immunosorbent assay based on a baculovirus recombinant antigen for detection of specific antibodies against Ehrlichia canis. Journal of Veterinary Diagnostic Investigation, v. 19, n. 6, p. 635-642, 2007.
NDIP, L. M. et al. Molecular and clinical evidence of Ehrlichia chaffeensis infection in Cameroonian patients with undifferentiated febrile illness. Annals of Tropical Medicine and Parasitology, v. 103, n. 8, p. 719‑725, 2009.
LOULY, C. C. B. et al. Ocorrência de Rhipicephalus sanguineus em trabalhadores de clínicas veterinárias e canis, no Município de Goiânia, GO. Ciência Animal Brasileira, v. 7, n. 1, p. 103-106, 2006.
NEER, T. M. Canine monocytic granulocytic ehrlichiosis. In: GREENE, C. E. (Ed). Infectious Disease of the Dog and Cat. 2nd ed. Philadelphia: W. B. Saunders, 1998. p. 139-147.
MAANEN, C. et al. An interlaborator y comparison of immunohistochemistry and PCR methods for detection of Neospora caninum in bovine foetal tissues. Veterinary Parasitology, v. 126, n. 4, p. 351-364, 2004.
O’DWYER, L. H. et al. Prevalence, hematology and serum biochemistry in stray dogs naturally infected by Hepatozoon canis in São Paulo. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 58, n. 4, p. 688-690, 2006.
MACHADO, R. Z. et al. Detection of Ehrlichia chaffeensis in Brazilian marsh deer (Blastocerus dichotomus). Veterinary Parasitology, v. 139, n. 1-3, p. 262-266, 2006.
OHASHI, N. et al. Cloning and characterization of multigenes encoding the immunodominant 30-kilodalton major outer membrane proteins of Ehrlichia canis and application of the recombinant protein for serodiagnosis. Journal of Clinical Microbiology, v. 36, n. 9, p. 26712680, 1998.
MACIEIRA, D. B. et al. Prevalence of Ehrlichia canis infection in thrombocytopenic dogs from Rio de Janeiro, Brazil. Veterinary Clinical Pathology, v. 34, n. 1, p. 44-48, 2005. MAEDA, K. et al. Human infection with Ehrlichia canis, a leukocytic rickettsia. New England Journal of Medicine. v. 316, n. 14, p. 853‑856, 1987.
OLANO, J. P. et al. Human monocytotropic ehrlichiosis, Missouri. Emerging Infectious Diseases, v. 9, n. 12, p. 1579-1586, 2003. OLANO, J. P.; WALKER, D. H. Human ehrlichioses. The Medical Clinics of North America, v. 86, n. 2, p. 375-392, 2002.
MANFREDI, M. T. et al. Tick species parasitizing people in an area endemic for tick-borne diseases in north-western Italy. Parassitologia, v. 41, n. 4, p. 555-560, 1999.
OLIVEIRA, D. et al. Anti- Ehrlichia canis antibodies detection by “DotELISA” in naturally infected dogs. Revista Brasileira de Parasitologia Veterinária, v. 9, n. 1, p. 1-5, 2000.
MASTRANDREA, S. et al. Two cases of human granulocytic ehrlichiosis in Sardinia, Italy confirmed by PCR. Annals of the New York Academy of Sciences, v. 1078, p. 548-551, 2006.
OLIVEIRA, L. P. et al. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil. Brazilian Journal of Microbiology, v. 40, n. 2, p. 238-240, 2009a.
MATTHEWMAN, L.; KELLY, P. J.; WRAY, K. Antibodies in cat sera from southern Africa react with antigens of Ehrlichia canis. Veterinary Record, v. 138, n. 15, p. 364-365, 1996. MOREIRA, S. M. et al. Retrospective study (1998-2001) on canine ehrlichiosis in Belo Horizonte, MG, Brazil. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 55, n. 2, p. 141-147, 2003. MOREIRA, S. M.; MACHADO, R. Z.; PASSOS, L. F. Detection of Ehrlichia canis in bone marrow aspirates of experimentally infected dogs. Ciência Rural, v. 35, n. 4, p. 958-960, 2005. MORO, P. L. et al. Short Report: Serologic evidence of human ehrlichiosis in Peru. The American Journal of Tropical Medicine and Hygiene, v. 80, n. 2, p. 242-244, 2009. MUNDIM, A. V. et al. Clinical and hematological signs associated with dogs naturally infected by Hepatozoon sp. and with other hematozoa: A retrospective study in Uberlândia, Minas Gerais, Brazil. Veterinary Parasitology, v. 153, n. 1-2, p. 3-8, 2008. MYLONAKIS, M. E. et al. Evaluation of cytology in the diagnosis of acute canine monocytic ehrlichiosis (Ehrlichia canis): a comparison between five methods. Veterinary Microbiology, v. 91, n. 2-3, p. 197‑204, 2003. NAKAGHI, A. C. H. et al. Sensitivity evaluation of a single-step PCR assay using Ehrlichia canis p28 gene as a target and its application in diagnosis of canine ehrlichiosis. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 2, p. 75-79, 2010. NAKAGHI, A. C. H. et al. Canine ehrlichiosis: clinical, hematological, serological and molecular aspects. Ciência Rural, v. 38, n. 3, p. 766‑770, 2008.
OLIVEIRA, L. S. et al. Molecular detection of Ehrlichia canis in cats in Brazil. Clinical Microbiology and Infection, v. 15, Supl. 2, p. 53-54, 2009b. OLIVEIRA, L. S. et al. First report of Ehrlichia ewingii detected by molecular investigation in dogs from Brazil. Clinical Microbiology and Infection, v. 15, Supl. 2, p. 55-56, 2009c. ORIÁ, A. P. et al. Ophthalmic, hematologic and serologic findings in dogs with suspected Ehrlichia canis infections. Revista Brasileira de Ciência Veterinaria, v. 15, n. 2, p. 94-97, 2008. ORTUÑO, A. et al. Serological evidence of Ehrlichia spp. exposure in cats from Northeastern Spain. Journal of Veterinary Medicine B. Infectious Diseases and Public Health, v. 52, n. 5, p. 246-248, 2005. OTEO, J. A. et al. First report of human granulocytic ehrlichiosis from southern Europe (Spain). Emerging Infectious Diseases, v. 6, n. 4, p. 430-432, 2000. PADDOCK, C. D. et al. Infections with Ehrlichia chaffeensis and Ehrlichia ewingii in persons coinfected with human immunodeficiency virus. Clinical Infectious Diseases. v. 33, n. 9, p. 1586-1594, 2001. PADDOCK, C. D.; CHILDS, J. E. Ehrlichia chaffeensis: a prototypical emerging pathogen. Clinical Microbiology Reviews, v. 16, n. 1, p. 37‑64, 2003. PEAVY, G. M.; HOLLAND, C. J.; DUTTA, S. K. Suspected ehrlichial infection in five cats from a household. Journal of the American Veterinary Medical Association, v. 210, n. 2, p. 231-234, 1997. PEIXOTO, C. C. et al. Quantification of Ehrlichia ruminantium by real time PCR. Veterinary Microbiology, v. 107, n. 3-4, p. 273-278, 2005.
12
Vieira, R.F.C. et al.
Rev. Bras. Parasitol. Vet.
PEREZ, M. et al. Human Infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Annals of the New York Academy of Sciences, v. 1078, p. 110-117, 2006.
TAMAMOTO, C. et al. Detection of Ehrlichia muris DNA from sika deer (Cervus nippon yesoensis) in Hokkaido, Japan. Veterinary Parasitology, v. 150, n. 4, p. 370-373, 2007.
PEREZ, M.; RIKIHISA, Y.; WEN, B. Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. Journal of Clinical Microbiology, v. 34, n. 9, p. 2133-2139, 1996.
TORRES, H. M. et al. Isolamento e propagação da Ehrlichia canis em células DH82 e obtenção de antígeno para reação de imunofluorescência indireta. Revista Brasileira de Ciência Veterinária, v. 9, n. 2, p. 77-82, 2002.
PETER, T. F.; BURRIDGE, M. J.; MAHAN, S. M. Ehrlichia ruminantium infection (heartwater) in wild animals. Trends in Parasitology, v. 18, n. 5, p. 214-218, 2002. REEVES, W. K. et al. The first report of human illness associated with the Panola Mountain Ehrlichia species: A case report. Journal of Medical Case Reports, v. 2, p. 139, 2008. RIPOLL, C. M. et al. Evidence of rickettsial spotted fever and ehrlichial infections in a subtropical territory of Jujuy, Argentina. The American Journal of Tropical Medicine and Hygiene, v. 61, n. 2, p. 350-354, 1999.
TRAPP, S. M. et al. Seroepidemiology of canine babesiosis and ehrlichiosis in a hospital population. Veterinary Parasitology, v. 140, n. 3-4, p. 223-230, 2006. UENO, T. E. H. et al. Ehrlichia canis em cães atendidos em hospital veterinário de Botucatu, Estado de São Paulo, Brasil. Revista Brasileira de Parasitologia Veterinária, v. 18, n. 3, p. 57-61, 2009. UNVER, A. et al. Molecular and antigenic comparison of Ehrlichia canis isolates from dogs, ticks, and a human in Venezuela. Journal of Clinical Microbiology, v. 39, n. 8, p. 2788-2793, 2001.
RISTIC, M. et al. Evidence of a serologic relationship between Ehrlichia canis and Rickettsia sennetsu. The American Journal of Tropical Medicine and Hygiene, v. 30, n. 6, p. 1324-1328, 1981.
VENZAL, J. M. et al. Ticks (Ixodida: Ixodidae) parasitising humans in Uruguay. Annals of Tropical Medicine and Parasitology, v. 97, n. 7, p. 769-772, 2003.
RISTIC, M. et al. Serological diagnosis of tropical canine pancytopenia by indirect immunofluorescence. Infection and Immunity, v. 6, n. 3, p. 226-231, 1972.
WALKER, D. H.; THE TASK FORCE ON CONSENSUS APPROACH FOR EHRLICHIOSIS. Diagnosing human ehrlichioses: current status and recommendations. American Society for Microbiology News, v. 66, n. 5, p. 287-290, 2000.
RUSCIO, M.; CINCO, M. Human granulocytic ehrlichiosis in Italy: first report on two confirmed cases. Annals of the New York Academy of Sciences, v. 990, p. 350-352, 2003. SAINZ, A. et al. Seroprevalence of canine Ehrlichiosis in Castilla-León (North West Spain). Preventive Veterinary Medicine, v. 29, n. 1, p. 1-7, 1996. SAITO, T. B. et al. Canine Infection by Rickettsiae and Ehrlichiae in Southern Brazil. American Journal of Tropical Medicine and Hygiene, v. 70, n. 1, p. 102-108, 2008. SANTOS, F. et al. Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs from Ribeirão Preto, Brazil. The Veterinary Journal, v. 179, n. 1, p. 145-148, 2009. SILVA, J. N. et al. Soroprevalência de anticorpos anti-Ehrlichia canis em cães de Cuiabá, Mato Grosso. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 2, p. 108-111, 2010. SOARES, A. O. et al. Avaliação ectoparasitológica e hemoparasitológica em cães criados em apartamentos e casas com quintal na cidade de Juiz de Fora, MG. Revista Brasileira de Parasitologia Veterinária, v. 15, n. 1, p. 13-16, 2006. SOLANO-GALLEGO, L. et al. Serological and molecular evidence of exposure to arthropod-borne organisms in cats from northeastern Spain. Veterinary Microbiology, v. 118, n. 3-4, p. 274-277, 2006. SOUZA, B. M. P. S. et al. Prevalence of ehrlichial infection among dogs and ticks in Northeastern Brazil. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 2, p. 89-93, 2010.
WALKER, J. S. et al. Clinical and Clinicopathologic findings in tropical canine pancytopenia. Journal of American Veterinary Medicine Association, v. 157, n. 1, p. 43-55, 1970. WANER, T. et al. Significance of serological testing for ehrlichial diseases in dogs with special emphasis on the diagnosis of canine monocytic ehrlichiosis caused by Ehrlichia canis. Veterinary Parasitology, v. 95, n. 1, p. 1-15, 2001. WANER, T.; STRENGER, C.; KESARY, A. Comparison of a clinicbased ELISA test kit with the immunofluorescence test for the assay of Ehrlichia canis antibodies in dogs. Journal of Veterinary Diagnostic Investigation, v. 12, n. 3, p. 240-244, 2000. XAVIER, M. S. et al. Avaliação da coagulação plasmática e plaquetometria em cães não infectados e infectados experimentalmente com Ehrlichia spp. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 61, n. 5, p. 1049-1053, 2009. YABSLEY, M. J. Natural history of Ehrlichia chaffeensis: vertebrate hosts and tick vectors from the United States and evidence for endemic transmission in other countries, Veterinary Parasitology, v. 167, n. 2-4, p. 136-148, 2010. YABSLEY, M. J. et al. Ehrlichia ewingii infection in white-tailed deer (Odocoileus virginianus). Emerging Infectious Diseases, v. 8, n. 7, p. 668-671, 2002.
STONE, J. H. et al. Human monocytic ehrlichiosis. Journal of the American Medical Association, v. 292, n. 18, p. 2263-2270, 2004.
YABSLEY, M. J.; LOFTIS, A. D.; LITTLE, S. E. Natural and experimental infection of white-tailed deer (Odocoileus virginianus) from the United States with an Ehrlichia sp. closely related to Ehrlichia ruminantium. Journal of Wildlife Diseases, v. 44, n. 2, p. 381-387, 2008.
SUKSAWAT, J. et al. Coinfection with three Ehrlichia species in dogs from Thailand and Venezuela with emphasis on consideration of 16S ribosomal DNA secondary structure. Journal of Clinical Microbiology, v. 39, n. 1, p. 90-93, 2001.
ZHANG, X et al. Identification of 19 polymorphic major outer membrane protein genes and their immunogenic peptides in Ehrlichia ewingii for use in a serodiagnostic assay. Clinical and Vaccine Immunology, v. 15, n. 3, p. 402-411, 2008.
Full Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 13-16, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Selective control of Rhipicephalus (Boophilus) microplus in fipronil-treated cattle raised on natural pastures in Lages, State of Santa Catarina, Brazil Controle seletivo do Rhipicephalus (Boophilus) microplus em bovinos criados em campo nativo, no município de Lages, Santa Catarina, Brasil Fernanda Paim1*; Antonio Pereira de Souza1; Valdomiro Bellato1; Amélia Aparecida Sartor1 Centro de Ciências Agroveterinárias – CAV, Universidade do Estado de Santa Catarina – UDESC
1
Received June 14, 2010 Accepted October 8, 2010
Abstract An examination of a selective control of Rhipicephalus (Boophilus) microplus and consequent cost reduction was carried out in two areas of native pasture in the municipality of Lages, State of Santa Catarina, Southern Brazil, from May 2007 to April 2009. Forty cattle were divided into two groups of 20 animals each (conventional and selective control groups). At 14-day intervals female ticks larger than 4.5 mm found on the right flank of cattle bodies were counted, and these results multiplied by two. Fipronil 1 mg.kg–1 pour on was then administered for tick control. In the conventional group all the cattle were treated when tick count averaged more than 40 female ticks per animal while in the selective group only animals parasitized by more than 40 ticks were treated with acaricide. Every 28 days the cattle’s weight was checked for cost-effective analysis. The conventional group required an additional 20 doses of fipronil compared with the selective one. There was no statistically significant differences regarding weight gain in both groups. Keywords: Rhipicephalus (Boophilus) microplus, cattle, fipronil, selective control, conventional control.
Resumo Com o objetivo de avaliar o método de controle seletivo do Rhipicephalus (Boophilus) microplus e reduzir os custos para o controle, de maio de 2007 a abril de 2009, em duas invernadas de campo nativo no município de Lages, SC, utilizaram-se 40 bovinos que foram divididos em dois grupos (convencional e seletivo), de 20 animais cada. A cada 14 dias foi realizada a contagem das fêmeas maiores ou igual a 4,5 mm, no lado direito do corpo dos animais, e o valor obtido, multiplicado por dois. Foi utilizado fipronil 1 mg.kg–1 pour on para o controle de carrapatos. No grupo convencional, foram tratados todos os bovinos quando a média do grupo foi igual ou superior a 40 fêmeas e no grupo seletivo, foram tratados apenas os animais que apresentaram uma infestação igual ou superior a 40. A cada 28 dias foi realizada a pesagem dos animais para análise da relação custo/benefício. Foram realizadas 20 aplicações a mais do carrapaticida no grupo convencional em relação ao seletivo. Não houve diferença estatística entre o ganho de peso do grupo convencional em relação ao grupo seletivo. Palavras-chave: Rhipicephalus (Boophilus) microplus, bovino, fipronil, controle seletivo, controle convencional.
Introduction The State of Santa Catarina is located in Southern Brazil between the parallels 25° and 29° South, an area where it is found a major ectoparasite of cattle, Rhipicephalus (Boophilus) microplus. The cattle herd in Santa Catarina consists of over 3.8 million animals (IBGE, 2008) and is characterized by small properties with an average population around 23 head per property (MENDES, 2006). *Corresponding author: Fernanda Paim Mestrado em Ciência Animal, Centro de Ciências Agroveterinárias – CAV, Universidade do Estado de Santa Catarina – UDESC, Rua Senador Salgado Filho, 282, CEP 88523-150, Coral, Lages - SC, Brazil; e-mail: fernandapaim@yahoo.com.br; Bolsista CAPES/2009
The favorability index for the development of R. (B.) microplus in the city of Lages (28) where the experiment was conducted is one of the lowest in the state (HONER et al., 1993), but livestock in the region is affected by tick damage. Economic losses result from the transmission of babesiosis and anaplasmosis pathogens to cattle causing decrease in weight gain, reduced milk production, low quality of leather, potential loss due to mortality, as well as increased costs of treatment and workmanship. Grisi et al. (2002) estimated that losses caused by Boophilus microplus in Brazil considering both direct and indirect damage may exceed two billion dollars per year. www.cbpv.com.br/rbpv
14
Paim, F. et al.
Cattle raisers seeking to increase productivity have implemented technologies of pasture cultivation and/or improvement of native pasture, enhancing cattle production and increasing the number of heads, which have contributed to greater infestations. There is an intensification of the system used, especially increased use of chemicals for parasite control in cattle herds with increasing selection pressure, which may result in the emergence of parasites resistant to the chemicals used. According to Martins (2006), despite selection of more resistant breeds of cattle, rotational grazing management systems and immunization of cattle against ticks, the use of chemical acaricides is still necessary as it remains the most effective method for tick control. Any control method including chemicals is likely to be used excessively and may increase the risk of environment contamination and emergence of resistant strains (SANTOS JÚNIOR; FURLONG; DAEMON, 2000). According to Vieira et al. (2003), the use of strategic control can lead to a sharp fall in the population of R. (B.) microplus, causing enzootic instability for bovine babesiosis. In order to reduce factors contributing to the occurrence of parasites resistant to antiparasitic drugs, and to minimize treatment costs, partial control of the flock, also known as selective control, has been investigated since that, in a parasite population, only few animals have high concentrations of parasites (MADALENA et al. 1985). And these animals are the target of selective control.
Rev. Bras. Parasitol. Vet.
Souza et al. (2005) reported the efficacy of selective treatment in reducing the number of Haematobia irritans (89.35%). It also possibly offers the advantage of delaying the development of resistance due to the presence of a refugee population that is crossed with the population exposed to the chemicals applied. Martins et al. (2002), in an experiment with European cattle in Rio Grande do Sul, examined a form of partial treatment. Half of the flock received strategic treatment and the other did not receive any acaricide. The strategically treated group was found to have, at certain times, large amounts of R. (B.) microplus and the group who did not receive any treatment showed very high levels of infestation, resulting in an abundant source of larvae on pasture, re-infesting both groups. The objective of the present study was to examine the selective control method of R. (B.) microplus and consequent cost reduction.
Material and Methods The experiment was conducted from May 2007 to April 2009 in a farm located 25 km from Lages, Southern Brazil (27° 49’ 611’’ S and 50° 32’ 303’’ W and altitude of 927 m). A total of 40 Charolais cross cattle aged around one year at the start of the experiment were divided into two groups of
Table 1. Average infestation rate, number of cattle infested with more than 40 females of Rhipicephalus (Boophilus) microplus larger than 4.5 mm and number of treatments applied from May 2007 to April 2008, Lages, Southern Brazil. Month/ year
Count/ month
May/07
1st 2nd 1st 1st 2nd 1st 1st 2nd 3rd 1st 2nd 1st 2nd 1st 2nd 1st 2nd 1st 2nd 3rd 1st 2nd 1st 2nd
June/07 July/07 August/07 September/07
October/07 November/07 December/07 January/08 February/08
March/08 April/08 Total
Conventional control group Avg. N. females N. of animals N. of treatments 20.9 3 0 5.3 1 0 2.8 1 0 20.8 3 0 25.3 4 0 0.6 0 0 0.0 0 0 0.4 0 0 2.5 0 0 0.9 0 0 13.5 3 0 16.4 3 0 9.4 0 0 52.4 11 20 0.5 0 0 1.4 0 0 65.9 11 20 0.8 0 0 0.3 0 0 10.8 1 0 121.3 17 20 2.3 0 0 0.4 0 0 37.5 6 0 64 60
Selective control group Avg. N. females N. of animals N. of treatments 18.2 3 3 3.4 0 0 3.1 0 0 4.8 1 1 0.1 0 0 1.2 0 0 0.3 0 0 4.8 0 0 2.0 0 0 1.2 0 0 12.2 0 0 17.2 0 0 16.9 0 0 62.0 15 15 2.3 0 0 6.3 1 1 58.6 14 14 0.8 0 0 2.8 1 1 20.4 0 0 24.7 5 5 1.2 0 0 28.0 3 3 174.9 16 16 59 59
v. 20, n. 1, jan.-mar. 2011
Selective control of Rhipicephalus (Boophilus) microplus in fipronil-treated cattle raised on natural pastures in Lages
20 animals. They were randomized according to their degree of R. (B.) microplus infestation and housed in two paddocks of pasture naturally infested by R. (B.) microplus, while respecting the capacity of 0.4 cattle.ha–1. In April 2007, after the animals were grouped and before the beginning of the experiment, all animals with parasitic infection by helminths of the order Strongylida greater than 250 eggs per gram (EPG) were treated with anthelmintic albendazole sulphoxide at a dose of 5 mg.kg–1 subcutaneously. Every 28 days the animals were weighed for cost-effective analysis. At 14-day intervals female ticks larger than 4.5 mm found on the right flank of cattle bodies were counted in both groups. The number of ticks counted was multiplied by two to obtain an estimated total number of ticks per animal. In group 1, the conventional control group, all animals were treated when their average infestation was equal to or greater than 40 females. In group 2, the selective control group, only animals with infestation lower than 40 females were treated. The insecticide used was 1% fipronil at a dose of 1 mg.kg–1, applied to the back (pour on) of the animals. This acaricide was assessed in the field, property, at baseline, the percentage reduction in the number of ticks of 100%.
15
Statistical analyses were conducted using data from all animals treated according to the experimental design. A linear model analysis of variance with measures repeated in time was performed. All analyses were conducted using SAS® (SAS, 2003) MIXED procedure (LITTEL et al., 2006). The level of significance was 5% for all analyses.
Results and Discussion During the experimental period, 200 doses of fipronil were applied in the selective control group while 220 were applied in the conventional control group (Tables 1 and 2). Two animals were excluded from the selective group during the experiment, one in January 2008 and another one in February 2009 due to health conditions that required their withdrawal from the study. A higher number of treatments was administered to the conventional group due to high parasite load seen in some animals. The average infestation was high, which resulted in the treatment of all animals, even of those who did not necessarily require insecticide application due to low infestation on a count day. For example, during the third count of January 2009 (Table 2),
Table 2. Average infestation rate, number of cattle infested with more than 40 females of Rhipicephalus (Boophilus) microplus larger than 4.5 mm and number of treatments applied from May 2008 to April 2009, Lages, Southern Brazil. Month/year
May/08 June/08 July/08 August/08 September/08 October/08
November/08 December/08 January/09
February/09 March/09 April/09 Total
Count/ month 1st 2nd 1st 2nd 1st 2nd 1st 2nd 3rd 1st 2nd 1st 2nd 1st 2nd 1st 2nd 1st 2nd 3rd 1st 2nd 1st 2nd 1st 2nd
Conventional control group Avg. N. females N. of animals Avg. N. females 100.7 15 20 8.5 1 0 3.0 0 0 17.2 2 0 60.9 7 20 12.8 2 0 5.0 0 0 1.6 0 0 50.7 11 20 4.4 0 0 2.7 0 0 5.7 0 0 23.8 5 0 100.0 13 20 9.6 1 0 8.4 1 0 131.5 19 20 5.4 0 0 102.9 11 20 40.3 5 20 7.9 0 0 14.1 3 0 104.4 12 20 9.9 1 0 2.9 1 0 35.7 5 0 115 160
Selective control group N. of animals Avg. N. females N. of animals 24.0 2 2 5.8 0 0 28.2 4 4 89.7 15 15 14.3 1 1 7.7 0 0 15.8 2 2 2.5 0 0 40.3 11 11 7.0 0 0 15.0 3 3 34.2 6 6 30.8 3 3 44.2 12 12 19.4 4 4 15.5 3 3 92.6 12 12 32.1 8 8 44.4 10 10 62.8 9 9 37.3 7 7 42.1 6 6 47.0 8 8 69.3 7 7 38.8 7 7 15.8 1 1 141 141
16
Paim, F. et al.
four animals showed a parasite load greater than 100 ticks, one of them greater than 230. Fifteen cattle had parasite loads below 40 ticks, five of them under six ticks. In the first year of the experiment, from May to September, the selective control group had an average number of females smaller than the conventional group and a lower number of insecticide doses (four) were applied in the selective group. There was no significant selection pressure during this phase of the experiment. The average number of females in both groups was similar over time with an increase in the number of doses used in both groups during the second year of the experiment. There was a 10% difference in the number of doses used by the end of the experimental period in both groups of animals, suggesting that selective control has a slight advantage in controlling the population of ticks compared to the conventional control method. This fact is probably due to a residual power of fipronil which reduces the remaining population of parasites. It was found that 88.07% of the animals in the selective group were treated over a 24 month period. As for the period of greatest infestation of R. (B.) microplus it was observed that during the summer months the parasite load was higher with an increase in tick populations starting from the month of November in both groups. The lowest infestations were seen during the period of lower temperatures (Table 1), which corroborates the finding of a study by Souza et al. (1988a) on the seasonal variation of R. (B.) microplus conducted in southern Brazil. The lowest tick infestations in cattle occurred from August to November due to non-occurrence of eggs, and the largest infestations were recorded from January to April due to the occurrence of high hatching of larvae during January and February (SOUZA et al., 1988b). The average weight of both groups at the beginning of the experiment was very similar, 174.55 and 174.15 kg in the selective and conventional control groups, respectively. After 24 months, their average weight was 336.94 and 323.15 kg respectively, with a higher average weight gain of 13.39 kg in the animals in the selective group, however, this difference was not statistically significant. In spite of the environmental importance due to lower use of fipronil and thereby lower costs, the small reduction in the number of doses used was not sufficient to compensate the farmers’ costs with manpower for animal handling.
Conclusion Selective control method with the use of fipronil 1 mg.kg for two years, despite a 10% reduction in insecticide applications, proved to be less cost-effective and did not show any relevant advantages compared to the conventional method for the control of Rhipicephalus (Boophilus) microplus in cattle raised on natural pastures in Lages, Southern Brazil. –1
Rev. Bras. Parasitol. Vet.
References GRISI, L. et al. Impacto econômico das principais ectoparasitoses em bovinos no Brasil. A Hora Veterinária, v. 21, n. 125, p. 8-10, 2002. HONER, M. R. et al. Epidemiologia e Controle do Carrapato dos Bovinos Boophilus microplus no Estado de SC. Florianópolis: Epagri, 1993. 26 p. (Boletim técnico, 62). INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA IBGE. Santa Catarina – Pecuária. 2008. Disponível em: <http://www. ibge.gov.br/estadosat/temas.php?sigla=sc&tema=pecuaria2009>. Acesso em: 21 jan. 2010. LITTEL, R. C. et al. SAS® for Mixed Models. 2nd ed. Cary, NC, USA: SAS Institute Inc., 2006. 834 p. MADALENA, F. E. et al. Causes of variation of field burdens of cattle ticks (B. microplus). Revista Brasileira de Genética, v. 8, n. 2, p. 361‑375, 1985. MARTINS, J. R. et al. Partial strategic tick control within a herd of European breed cattle in the state of Rio Grande do Sul, southern Brazil. Experimental and Applied Acarology, v. 27, n. 3, p. 241-251, 2002. MARTINS, J. R. S. Carrapato Boophilus microplus (Can. 1887) (Acari: Ixodidae) resistente a ivermectina, moxidectina e doramectina. 2006. 74 f. Tese (Doutorado em Ciência Animal)–Escola de Veterinária, Universidade Federal de Minas Gerais Belo Horizonte, 2006. MENDES, R. E. O impacto financeiro da rastreabilidade em sistemas de produção de bovinos no Estado de Santa Catarina, Brasil. Ciência Rural, v. 36, n. 5, p. 1524-1528, 2006. SANTOS JÚNIOR, J. C. B.; FURLONG, J.; DAEMON, E. Controle do carrapato Boophilus microplus (Acari: Ixodidae) em sistemas de produção de leite da microrregião fisiográfica fluminense do Grande Rio - Rio de Janeiro. Ciência Rural, v. 30, n. 2, p. 305-311, 2000. SAS INSTITUTE INC. SAS Ver. 9.1.3. Cary, NC, USA: SAS Institute Inc., 2003 SOUZA, A. P. et al. Variação Sazonal de Boophilus microplus no Planalto Catarinense. Pesquisa Agropecuária Brasileira, v. 23, n. 6, p. 627-630, 1988a. SOUZA, A. P. et al. Fase de Vida livre do Boophilus microplus no Planalto Catarinense. Pesquisa Agropecuária Brasileira, v. 23, n. 4, p. 427-434, 1988b. SOUZA, A. P. et al. Variação Sazonal de Haematobia irritans no Planalto Catarinense e eficiência do “Controle Dirigido”. Revista Brasileira de Parasitologia Veterinária, v. 14, n. 1, p. 11-15, 2005. VIEIRA, M. I. B et al. Estratégias de controle do carrapato Boophilus microplus (Canestrini, 1887) e influência na estabilidade enzoótica da babesiose bovina. Revista Brasileira de Parasitologia Veterinária, v. 12, n. 4, p. 139-144, 2003.
Full Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 17-21, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Phthiraptera (Arthropoda, Insecta) in Gallus gallus from isolated and mixed backyard rearing systems Phthiraptera (Arthropoda, Insecta) em Gallus gallus de criações de fundo de quintal isoladas e mistas Ana Clara Gomes dos Santos1*; Albério Lopes Rodrigues3; Sandra Batista dos Santos2; Roberto César Araújo Lima3; Rita de Maria Seabra Nogueira de Candanedo Guerra1 Laboratório de Parasitologia, Universidade Estadual do Maranhão – UEMA
1
Centro Universitário de Desenvolvimento do Centro-Oeste – UNIDESC
2
Departamento de Agropecuária, Centro de Formação de Tecnólogos, Universidade Federal da Paraíba – UFPB
3
Received June 24, 2010 Accepted October 8, 2010
Abstract The objectives were to identify the species of chewing lice (Mallophaga) at different body sites in chickens (Gallus gallus), in isolated and mixed rearing systems, and to determine the dynamics and structure of the louse populations collected. The prevalences were 100 and 35% for chickens in the isolated and mixed systems, respectively. The species recorded were: Menopon gallinae, Menacanthus stramineus, Goniodes gigas, Goniocotes gallinae and Lipeurus caponis. The chickens in the isolated system presented more lice than did the ones in the mixed system. The most prevalent species were M. gallinae (30.58 and 62.31%) and L. caponis (29.12 and 14.49%), in the isolated and mixed systems, respectively. The preferential sites of parasitism were the dorsum, venter and wings among the chickens in the isolated system, while among the ones in the mixed system, the preferential sites were the dorsum and venter. The mean intensity of infestation in the isolated system was 111.4 for males and 19.1 for females, while in the mixed system it was 80 for males and 6.75 for females. The amplitudes of the infestation were 1-226 for males and 1-22 for females in the isolated system, while in the mixed system, the amplitudes were 1-111 and 1-8, respectively. It can be concluded that chickens reared in the isolated system harbor a greater number of lice than do chickens in the mixed system. However, the kind of rearing system does not prevent louse infestations. Keywords: Gallus gallus, Phthiraptera.
Resumo Objetivou-se identificar as espécies de malófagos em diferentes regiões do corpo de Gallus gallus, sob os sistemas de criação isolado e misto e determinar a dinâmica e estrutura da população. A prevalência de parasitismo foi de 100 e 35% para as aves no sistema de criação isolado e misto, respectivamente. As espécies identificadas foram: Menopon gallinae, Menacanthus stramineus, Goniodes gigas, Goniocotes gallinae e Lipeurus caponis. As aves mantidas isoladas apresentaram maior parasitismo do que aquelas sob o sistema misto de criação. As espécies mais prevalentes foram M. gallinae (30,58 e 62,31%) e L. caponis (29,12 e 14,49%), nos sistemas isolado e misto, respectivamente. As regiões do corpo preferenciais dos malófagos foram dorso, ventre e asa para as aves do sistema isolado; e o dorso e ventre para as do sistema misto. Para as aves do sistema isolado, a intensidade média de infestação para os machos foi de 111,4 e para as fêmeas foi de 19,1. E, para o sistema misto foi de 80 e 6,75 para machos e fêmeas, respectivamente. A amplitude de infestação variou de 1-226 e 1-22 para machos e fêmeas, respectivamente (sistema isolado); enquanto para o sistema misto foi de 1-111 e 1-8, para machos e fêmeas, respectivamente. Conclui-se que as aves de fundo de quintal, criadas sob o sistema isolado de criação, apresentam maior infestação por malófagos do que aquelas criadas com outras espécies de aves, embora o sistema de criação não isente as aves do parasitismo. Palavras-chave: Gallus gallus, Phthiraptera.
*Corresponding author: Ana Clara Gomes dos Santos Laboratório de Parasitologia, Universidade Estadual do Maranhão – UEMA Cidade Universitária Paulo VI, Tirirical, CP 09, CEP 65055-970, São Luis - MA, Brazil; e-mail: santos.clara@ig.com.br
www.cbpv.com.br/rbpv
18
Santos, A.C.G. et al.
Introduction Poultry rearing is a profitable activity that provides an excellent protein source for consumers. Today, it is seen that there is a consumer market for products with better health attributes, and backyard chicken rearing forms part of this scenario. However, even though chickens are easy to manage, they are not free from infections and/or parasitic infestations. Among the ectoparasites that can infest poultry, biting/chewing lice (Phthiraptera; Mallophaga) stand out, especially because of their diversity and high capacity for infesting their hosts. Chewing lice that infest poultry feed on sloughed tissue from the skin and feathers, and on sebaceous secretions (FIGUEIREDO et al., 1993). Infestations give rise to restlessness, self-mutilation together with feather loss, thermal imbalance and sleeplessness among poultry. Furthermore, they affect feeding, which gives rise to weight loss and decreased egg production (PANDA; AHLUWALIA, 1983; GLESS; RAUN, 1959; OLIVEIRA et al., 1999; PINTO et al., 2001). According to Emerson (1956), domestic hens (Gallus gallus) are parasitized by a greater variety of louse species than any other bird species. From the literature, the following species are known to parasitize domestic hens: Menopon gallinae L., Menacanthus pallidulus Neumann, Menacanthus cornutus Schommer, Menacanthus stramineus Nitzsch, Goniocotes gallinae De Geer, Goniodes dissimilis Denny, Goniodes gigas Taschenberg, Lipeurus caponis L. and Cuclotogaster heterographus Nitzsch (EMERSON, 1956). Regarding the site of parasitism, Ash (1960) stated that each louse species is located in a well-defined body zone or niche in its host. Knowledge of louse species and their locations in their hosts’ bodies is of fundamental importance for indicating preventive and therapeutic measures to maintain the health and productivity of the breeding stock. The present study had the aims of identifying louse species; determining the preferential regions for parasitism on the bodies of backyard chickens, according to the rearing system used (isolated or mixed); and investigating the structure and dynamics of the population collected.
Material and Methods The material was collected from backyard chicken rearing systems on the periphery of the city of Patos, State of Paraíba, which is located at the coordinates 7° 01’ 37.78” S and 37° 16’ 39.40” W, in the mesoregion of the backlands of Paraíba. This region is characterized by a semi-arid climate and scrub vegetation, with a mean annual temperature of 37.9 °C (maximum) and 24.6 °C (minimum) and mean rainfall of 364.33 mm, occurring as rare and irregular showers (IBGE, 2002). Forty hens were examined: 20 that were kept in a system of isolated rearing (i.e. just one poultry species present) and 20 that were kept in a mixed system (i.e. more than one poultry species cohabiting in the same space). The samples were collected from two properties: one with isolated rearing, consisting solely of backyard chickens; and the other with rearing not only of backyard
Rev. Bras. Parasitol. Vet.
chickens but also of farmyard ducks, garganey ducks, turkeys and guineafowl. In both systems, the management was the same: during the day, the hens were let loose and at night they were gathered into a hencoop constructed of sticks. The hens were inspected visually and were selected randomly, independent of their physical appearance and without considering their breed (if any). In this study, the following regions of the body were taken into consideration: head, neck, dorsum, venter, cloaca and wings. The samples were collected manually, by removing tufts from feathers in each region. These were then packed in glass vials containing 70% alcohol; identified according to the region of the body, sex and rearing system; and sent to the Veterinary Parasitology Laboratory, Centro de Saúde e Tecnologia Rural (CSTR), Universidade Federal de Campina Grande (UFCG), Patos Campus, Paraíba, for louse identification. The louse specimens were screened according to sex and biological development stage (egg, nymph or adult), with the aid of entomological probes and a stereomicroscope, and were mounted on slides with coverslips in accordance with the technique described by Pinto (1938). The identification key produced by Tuff (1977) was used. The data were assessed using analysis of variance (ANOVA), followed by Tukey’s test at probability levels of 5 and 1%, with comparisons of the means between the louse species found in each rearing system, with the aid of the Instat v. 2.05a computer software (1990-1994). To study the population structure after species identification, the lice were quantified according to development stages (eggs, nymphs, male adults and female adults). These data were analyzed in accordance with Silveira Neto et al. (1976).
Results and Discussion The species identified in the different regions of the hosts’ bodies in the two rearing systems were: Menopon gallinae, Menacanthus stramineus, Goniodes gigas, Goniocotes gallinae and Lipeurus caponis. Species of the suborder Ischnocera predominated in relation to the suborder Amblycera, thus differing from the observations of Ferrero et al. (2004) and agreeing with Figueiredo et al. (1993) and Silva (2002). The prevalence of infestation observed was 100% among the hens reared in the isolated system and 35% in the mixed system. The mean levels of parasitism among the hens reared in the isolated system are shown in Table 1. The species M. gallinae differed significantly from M. stramineus, and the latter differed from L. caponis (P < 0.05). However, in the mixed rearing system, only M. gallinae presented a significant difference, compared with the other species (P < 0.01). The hens that were samples presented simultaneous parasitism by more than one louse species. This has already been described in the literature (EMERSON, 1956; UGOCHUKWU; OMIJE, 1986; FIGUEIREDO et al., 1993; PINTO et al., 2001; FERRERO et al., 2004; GUERRA et al., 2008). According to Figueiredo et al. (1993), a variety of louse species infest domestic poultry. They highlighted M. gallinae, M. stramineus, G. gigas, G. gallinae and L. caponis, which were
v. 20, n. 1, jan.-mar. 2011
Phthiraptera (Arthropoda, Insecta) in Gallus gallus from isolated and mixed backyard rearing systems
all found in the present study. On the other hand, despite observations of parasitism due to M. contortus in farmyard hens in the state of Rio Grande do Sul (Oliveira and Ribeiro, 1990) and G. dissimilis in backyard hens in the states of São Paulo and Rio de Janeiro (PINTO et al., 2001) and on the island of São Luis, State of Maranhão (GUERRA et al., 2008), these species were not identified in the present study. Although the louse fauna is known, there are differences in the species that affect poultry in different geographic areas. Climatic conditions may influence species adaptation. Guerra et al. (2008) observed statistical differences in some louse species in poultry on the island of São Luis, between the dry and wet seasons. According to Emerson (1956) and Emerson (1962), the species M. stramineus is typical of turkeys (Meleagris gallopavo),
Table 1. Numbers of specimens, prevalence, mean and standard deviation among louse species collected from (Gallus gallus), in an isolated rearing system (n = 20) and a mixed rearing system (n = 20), in the city of Patos, Paraíba. Isolated rearing system Louse species Number Mean Menopon gallinae 63 3.15ab Menacanthus stramineus 7 0.35bb Goniodes gigas 47 2.35ab Goniocotes gallinae 29 1.45ab Lipeurus caponis 60 3.0ac Mixed rearing system Menopon gallinae 43 2.15a Menacanthus stramineus 3 0.15b Goniodes gigas 4 0.2b Goniocotes gallinae 9 0.45b Lipeurus caponis 10 0.5b
± SD 5.94 0.67 1.38 0.82 2.33
P (%) 30.58 3.39 22.81 14.07 29.12
3.28 0.36 4.86 6.23 6.12
62.31 4.34 5.79 13.04 14.49
Mean values followed by different letters in the column differed according to Tukey’s test, at the probability level of 5% (P < 0.05) (isolated rearing) and 1% (P < 0.01) (mixed rearing).
19
and its proliferation is due to the fact that simultaneous rearing of turkeys and hens has been established in the United States. This has also become established in Brazil. It was observed that this louse species was present in both rearing systems, which suggests that it has become adapted to G. gallus. The findings of M. stramineus are noteworthy because Tridevi, Saxena and Rawat (1991) reported that parasitism by this louse species causes great irritation in the cloaca region. It was observed in the present study that, as well as from the cloaca, specimens were also collected from the ventral region. Among the body regions sampled (head, neck, dorsum, venter, cloaca and wings), 206 lice were collected from the chickens reared in the isolated system and 69 from the chicken in the mixed system. In both rearing systems, the regions with greatest infestation were the venter and dorsum, while the regions with least parasitism were the head and cloaca. According to data in the literature, the head is one of the regions least likely to be affected by parasitism due to lice (GABAJ et al., 1993; SANTOS-PREZOTO et al., 2003; GUERRA et al., 2008). The distribution of the species identified according to host body region, in both rearing systems, are detailed in Table 2. The species L. caponis seemed to be the one that was best adapted to parasitism in different regions of the body. It was found in all the regions samples in chickens in the isolated rearing system, but the chickens in the mixed system did not present this species in the head and dorsum regions. Guerra et al. (2008) also observed that the species L. caponis was collected from all regions of the body, including the head. The other regions presented parasitism by more than one louse species, independent of the rearing system. All of the louse species identified in this study, in both rearing systems, were found in the venter region. M. gallinae was the most prevalent species in this region. These data are in agreement with the observations of Ash (1960), with regard to the affirmation that the lice presented defined niches in their hosts. In relation to the biological development stages of the lice, 1099 eggs, 153 nymphs and 53 adults were obtained in the
Table 2. Prevalence of lice collected from Gallus gallus, in an isolated system (n = 20) and a mixed system (n = 20), according to regions of the body, in the city of Patos, Paraíba. Louse species
M. gallinae M. stramineus G. gigas G. gallinae L. caponis Total
Head N. (%) 0 (0) 0 (0) 0 (0) 0 (0) 1 (100) 1
Neck N. (%) 6 (25) 0 (0) 7 (29.16) 4 (16.66) 7 (29.16) 24
M. gallinae M. stramineus G. gigas G. gallinae L. caponis Total
0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0
6 (66.66) 0 (0) 0 (0) 0 (0) 3 (9.0) 9
Isolated rearing system Regions of the body Dorsum Venter N. (%) N. (%) 23 (33.82) 27 (39.70) 0 (0) 2 (2.94) 18 (26.47) 19 (27.94) 10 (14.70) 15 (22.05) 17 (25.0) 5 (7.35) 68 68 Mixed rearing system 17 (77.27) 19 (55.88) 0 (0) 3 (8.82) 2 (9.09) 2 (5.88) 3 (13.63) 6 (17.64) 0 (0) 4 (11.76) 22 34
Cloaca N. (%) 7 (38.88) 5 (27.77) 3 (16.66) 0 (0) 3 (16.66) 18
Wing N. (%) 0 (0) 0 (0) 0 (0) 0 (0) 27 (100) 27
1 (50.0) 0 (0) 0 (0) 0 (0) 1 (50.0) 2
0 (0) 0 (0) 0 (0) 0 (0) 2 (100) 2
20
Santos, A.C.G. et al.
Rev. Bras. Parasitol. Vet.
Table 3. Structure of the louse population collected from Gallus gallus, in an isolated rearing system (n = 20) and a mixed rearing system (n = 20), in the city of Patos, Paraíba. Louse species Females M. gallinae M. stramineus G. gigas G. gallinae L. caponis Total
N. 25 2 3 2 16 48
(%) (39.68) (28.57) (6.38) (6.89) (26.66) (23.30)
M. gallinae M. stramineus G. gigas G. gallinae L. caponis Total
16 2 4 3 8 33
(37.20) (66.66) (100) (33) (80) (47.82)
Isolated rearing system Biological development stages Males Nymphs N. (%) N. (%) 2 (3.17) 36 (57.14) 0 (0) 5 (71.42) 1 (2.12) 43 (91.48) 0 (0) 27 (93.10) 2 (3.33) 42 (70) 5 (2.42) 153 (74.27) Mixed rearing system 0 (0) 27 (62.79) 0 (0) 1 (33.33) 0 (0) 0 (0) 0 (0) 6 (66.66) 0 (0) 2 (20) 0 (0) 36 (52.17)
Table 4. Mean intensity and amplitude of infestation with lice collected from Gallus gallus, in an isolated rearing system (n = 20) and a mixed system (n = 20), in the city of Patos, Paraíba. Lice
Isolated MII M. gallinae 3.15 ± 5.94a M. stramineus 0.35 ± 0.67a G. gigas 2.35 ± 1.38a G. gallinae 1.45 ± 0.82a L. caponis 3.0 ± 2.33a
AI 1-28 0-2 1-5 1-4 1-9
Mixed MII 10.75 ± 13.20b 0.75 ± 1.03a 1.0 ± 1.30a 2.25 ± 2.76b 3.07 ± 3.07a
AI 3-9 0-1 0-1 1-2 1-2
MII = mean intensity of infestation; AI = amplitude of infestation. Mean values followed by different letters in the same line differed according to Tukey’s test, at the probability level of 1% (P < 0.01).
isolated rearing system. In the mixed system, there were 198 eggs, 36 nymphs and 33 adults. Thus the numbers of eggs and nymphs were larger than the numbers of adults, in both systems. It was observed that the eggs continued to adhere to the plumage of the hens until the nymphs emerged (embryogenesis period), while the nymphs and adults migrated to seek out their preferred habitats (external or internal dewlap; barbules, barbs and radial/filamentous tufts of feathers; lungs; and/or body skin). The structure of the louse population in the isolated system is summarized in Table 3. It was found that in the isolated system, the prevalence of nymphs was 74.27%, and the prevalence of males was 2.42%. The same distribution was found in the mixed system, i.e. nymphs were seen in greater numbers than other stages. The data relating to the mean intensity of parasitic infestation (number of lice/number of positive chickens) and the amplitude of infestation are reported in Table 4. The species M. gallinae presented 3.15 ± 5.94, with an amplitude from 1 to 28, in the chickens in the isolated rearing system, while mean intensity in the mixed system was 10.75 ± 13.20, with an amplitude from 3 to 9. This species presented higher values than did the others. There was a statistically significant difference (P < 0.01) in infestation
Total N. 63 7 47 29 60 206
(%) (100) (100) (100) (100) (100) (100)
43 3 4 9 10 69
(100) (100) (100) (100) (100) (100)
by M. gallinae and G. gallinae between the chickens kept in the isolated system and those kept in the mixed system, thus showing an association between louse species. It can be concluded that backyard hens that do not have any sanitary management are predisposed to infestations with lice, and that choosing between an isolated and a mixed rearing system does not provide exemption from parasitism.
References ASH, J. S. A study of the Mallophaga of birds with particular reference to their ecology. Ibis, v. 102, n. 1, p. 93-110, 1960. EMERSON, K. C. Mallophaga (Chewing Lice) occurring of the domestic chicken. Journal of the Kansas Entomological Society, v. 29, n. 2, p. 63-79, 1956. EMERSON, K. C. Mallophaga (Chewing Lice) occurring on the turkey. Journal of the Kansas Entomological Society, v. 35, n. 1, p. 196-201, 1962. FERRERO, A. A. et al. Phthiraptera (Arthropoda, Insecta) en Gallus gallus (Galliformes, Phasianidae) en criaderos de áreas urbanas y suburbanas de la ciudad de Bahía Blanca, provincia de Buenos Aires, Argentina. Entomologia y Vectores, v. 11, n. 2, p. 297-303, 2004. FIGUEIREDO, S. M. et al. Biologia e ecologia de malófagos (Insecta, Phthiraptera) em aves de postura de granjas industriais. Revista Brasileira de Parasitologia Veterinária, v. 2, n. 1, p. 45-51, 1993. GABAJ, M. M.; BEESLEY, W. N.; AWAN, M. A. Lice of farm animals in Libya. Medical and Veterinary Entomology, v. 7, n. 2, p. 138-140, 1993. GLESS, E. E.; RAUN, E. S. Effects of chicken body louse infestation on egg production. Journal of Economic Entomology, v. 52, n. 2, p. 358-359, 1959. GUERRA, R. M. S. N. C. et al. Espécies, Sítios de Localização, Dinâmica e Estrutura de Populações de malófagos em galinhas caipiras (Gallus gallus L.) criadas na ilha de São Luis, MA. Neotropical Entomology, v. 37, n. 3, p. 259-264, 2008.
v. 20, n. 1, jan.-mar. 2011
Phthiraptera (Arthropoda, Insecta) in Gallus gallus from isolated and mixed backyard rearing systems
INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA IBGE. Anuário Estatístico. 2002. OLIVEIRA, C. M. B.; RIBEIRO, V. L. S. Ocorrência de Menachantus cornutus (Mallophaga: Menoponidae) em galinhas do Rio Grande do Sul. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 42, n. 2, p. 121-126, 1990. OLIVEIRA, H. H.; FERREIRA, I.; SERRA-FREIRE, N. M. Fauna de Mallophaga (Insecta: Aptera) de ectoparasitos em Gallus gallus L. e Columbia livia L. amostrados no Rio de Janeiro. Brasil. Entomologia y Vectores, v. 6, n. 5, p. 509-515, 1999.
21
SANTOS-PREZOTO, H. H. et al. Sítios de localização de ectoparasitos em Gallus gallus Linnaeus, 1758. Revista Brasileira de Zoociências, v. 5, n. 1, p. 129-135, 2003. SILVA, S. B. Dinâmica da fauna ectoparasitária (Ischnocera, Amblycera e Acari) em galinhas domésticas (Gallus gallus) de criações rústicas no município de Patos, Paraíba, Estudo preliminares. 2002. 68 f. Dissertação (Mestrado)–Universidade Federal Rural do Rio de Janeiro, Rio de Janeiro. SILVEIRA NETO, S. S. Manual de ecologia dos insetos. São Paulo: Agronomia Ceres, 1976. 419 p.
PANDA, D. N.; AHLUWALIA, S. S. Affect on the Menacanthus stramineus tropicalis infestation on weight gains in broiler birds. Indian Veterinary Journal, v. 60, n. 2, p. 85-87, 1983.
TRIDEVI, M. C.; SAXENA, A. K.; RAWAT, B. S. Incidence of Mallophaga on poultry in Dehradun (India). Angewandte Parasitologie, v. 33, n. 2, p. 69-78, 1991.
PINTO, C. et al. Ocorrência de Malófagos em galinhas caipiras e sua relação com o padrão de coloração da plumagem. Entomologia y Vectores, v. 8, n. 3, p. 295-301, 2001.
TUFF, D. W. A key to the lice of man and domestic animals. Texas Journal Science, v. 28, n. 1-4, p. 145-158, 1977.
PINTO, C. Zooparasitos de interesse médico e veterinário. Pimenta de Mello Cia, 1938. 369 p.
UGOCHUKWU, E. I.; OMIJE, J. S. Ectoparasitic fauna of poultry in Nsukka, Nigéria. International Journal of Zoonoses, v. 13, n. 2, p. 93-97, 1986.
Review Full Article Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 22-26, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Isospora coerebae n. sp. (Apicomplexa: Eimeriidae) from the bananaquit Coereba flaveola (Passeriformes: Coerebidae) in South America Isospora coerebae n. sp. do caga-sebo Coereba flaveola (Passeriformes: Coerebidae) na América do Sul Bruno Pereira Berto1; Walter Flausino1; Hermes Ribeiro Luz2; Ildemar Ferreira2; Carlos Wilson Gomes Lopes1* Departamento de Parasitologia Animal, Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro – UFRRJ
1
Departamento de Biologia Animal, Instituto de Biologia, Universidade Federal Rural do Rio de Janeiro – UFRRJ
2
Received June 29, 2010 Accepted December 9, 2010
Abstract The present study describes a new isosporoid coccidian parasite from the bananaquit Coereba flaveola, in Brazil. This new species is similar to I. cagasebi, but it can be distinguished by the size and shape of Stieda and susbstieda bodies. Isospora coerebae n. sp. oocysts are spheroidal to sub-spheroidal, 24.8 × 23.3 µm, with a smooth and bi-layered wall, ~1.2 µm. Micropyle, oocyst residuum and polar granule are absent. Sporocysts are elongate ovoidal, 17.9 × 10.9 µm. Stieda and substieda bodies are present. Sporocyst residuum is present and sporozoites have a posterior refractile body. Keywords: Passeriformes, Coerebidae, oocysts, Marambaia Island, Brazil.
Resumo Um novo parasito coccídio isosporóide do caga-sebo Coereba flaveola, do Brasil, é relatado no estudo atual. Essa nova espécie é semelhante à Isospora cagasebi, no entanto, pode ser distinguida pelos tamanho e forma dos corpos de Stieda e substieda. Os oocistos de I. coerebae n. sp. são esféricos a subesféricos, 24,8 × 23,3 μm, com parede dupla e lisa, ~ 1,2 μm. A micrópila, resíduo e grânulo polar do oocisto estão ausentes. Os esporocistos são ovóides alongados, 17,9 × 10,9 μm. Os corpos de Stieda e substieda estão presentes. O resíduo do esporocisto está presente e os esporozoítos possuem um corpo refrátil posterior. Palavras-chave: Passeriformes, Coerebidae, oocistos, Ilha da Marambaia, Brasil.
Introduction
Material and Methods
The bananaquit Coereba flaveola Linnaeus, 1758 is a small honeycreeper in the family Coerebidae. It is common in and around gardens where flowers are abundant. It adapts well to human activity, and lives in borders of open country, plantations, towns and forests (SICK, 1997; RAFFAELE et al., 1998). Coccidiosis in this host family is rare with only a single species, Isospora cagasebi Berto, Flausino, Luz, Ferreira, Lopes, 2008, described by Berto et al. (2008) infecting a bananaquit of Brazil. It is here described a new Isospora species named Isospora coerebae and also I. cagasebi infecting the bananaquit C. flaveola from Marambaia Island, Rio de Janeiro State, Brazil and the characteristics of Stieda and substieda bodies that differentiate these two coccidia.
Eight bananaquits were captured using nets on Marambaia Island (23° 04’ S and 43° 53’ W). They were kept in individual cages, and feces were collected immediately after defecation. After identification the birds were released, and fecal samples were placed into plastic vials containing 2.5% (w/v) solution of K2Cr2O7 in 1:6 (v/v). Samples were sent for analysis at the Coccidia and Coccidiosis Laboratory at Universidade Federal Rural do Rio de Janeiro (UFRRJ). They were placed in a thin layer (~5 mm) of K2Cr2O7 2.5% solution in Petri plates, and incubated at 23-28 °C for 10 days or until 70% of oocysts were sporulated. Oocysts were recovered by flotation in Sheather’s sugar solution (S.G. 1.20) and microscopically examined using the technique described by Duszynski and Wilber (1997). Morphological observations (micropyle [M], oocyst residuum [OR], polar granule [PG], Stieda body [SB], substieda body [SSB], parastieda body [PSB], sporocyst residuum [SR], sporozoite [SZ], refractile body [SRB], nucleus [N]) and measurements, in µm, were performed using a binocular microscope Carl Zeiss with apochromatic oil immersion objective lens and ocular micrometer (K-15X PZO, Poland). Line
*Corresponding author: Carlos Wilson Gomes Lopes Departamento de Parasitologia Animal, Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro – UFRRJ, BR-465, Km 7, CEP 23890-000, Seropédica - RJ, Brazil; e-mail: lopescwg@ufrrj.br
www.cbpv.com.br/rbpv
v. 20, n. 1, jan.-mar. 2011
Isospora coerebae n. sp. (Apicomplexa: Eimeriidae) from the bananaquit Coereba flaveola (Passeriformes: Coerebidae)
drawings were prepared using a binocular microscope Wild M-20 with drawing tube. Pictures were taken using a digital camera (Model CD Mavica MVC-CD250 Sony®). Size ranges are shown in parenthesis followed by average and shape index (L/W ratio). Means comparisons of Stieda and substieda bodies by Student’s t-test were performed using Excel XP (Microsoft Co., Redmond, WA, USA), as proposed by Sampaio (2002).
Results Three of eight C. flaveola examined shed oocysts in their feces. All oocysts were typical for the genus Isospora. Two types of oocysts were recorded, each type was detected in two birds, and the third bird presented a mixed infection. The first type of oocysts was identified as Isospora cagasebi. The second type of oocysts could be well recognized from I. cagasebi and seemed to represent an unknown species, the description of which follows. Isospora cagasebi Berto, Flausino, Luz, Ferreira, Lopes, 2008 (Figures 1a-d, 3a-c) Description of a sporulated oocyst: Oocyst shape (N = 11): spheroidal to sub-spheroidal; number of walls: 2; wall thickness: 1.3 (1.1–1.3); smooth outer wall about 2/3 of total thickness; L × W: 25.2 × 24.5 (23-27 × 23-25), with L/W ratio: 1.0 (1.0-1.1); M, OR, PG: all absent.
23
Description of a sporocyst and sporozoites: Sporocyst shape (N = 11): elongate ovoidal or ellipsoidal; L × W: 18.7 × 11.4 (17-20 × 10-12); L/W ratio: 1.6 (1.5-1.7); SB: present and knob-like; SSB: present and prominent (Table 1); PSB: absent; SR: present; SR characteristics: composed of many scattered granules of different sizes; SZ: vermiform with SRB and N. Host: Coereba flaveola Linnaeus, 1758 (Passeriformes: Coerebidae), captured on January 13, 2009. Materials: Oocysts stored in 10% aqueous buffered formalin (v/v), and deposited in the Parasitology Collection at the Department of Animal Parasitology at UFRRJ, Seropédica, Rio de Janeiro, Brazil. Phototypes and line drawings are deposited at the same location. The repository number is 07/2009. Locality: Marambaia Island (23° 04’ S and 43° 53’ W), Rio de Janeiro, Brazil. Sporulation time: Four days. Site of infection: Not investigated. Prevalence: 25% (two of eight birds examined). Isospora coerebae n. sp. (Figures 2a-d, 3d-f ) Description of a sporulated oocyst: Oocyst shape (N = 14): spheroidal to sub-spheroidal; number of walls: 2; wall thickness: 1.2 (1.1–1.3); smooth outer wall about 2/3 of total thickness; L × W: 24.7 × 23.3 (23-27 × 21-26), with L/W ratio: 1.1 (1.0-1.1); M, OR, PG: all absent. a
b
c
d
Figure 1. Line drawings of Isospora cagasebi, a coccidium species recovered from the bananaquit Coereba flaveola. (a) Sporulated oocyst with its respective variations of (b, c, d) detached Stieda and substieda bodies. Scale bar: 10 µm for oocysts; and 5 µm for Stieda and substieda bodies.
24
Berto, B.P. et al.
Rev. Bras. Parasitol. Vet.
Table 1. Means comparisons of Stieda and substieda bodies of Isospora cagasebi and I. coerebae n. sp. recovered from bananaquit Coereba flaveola. Means Oocyst
Sporocyst
Shape Length Width Shape index Wall Polar granule Shape Length Width Shape index Stieda body
Substieda body
Residuum
Shape High Wide Shape High Wide
Oocyst samples (µm) I. coerebae (n = 11) I. cagasebi (n = 11) spheroidal to sub-spheroidal spheroidal to sub-spheroidal 25.2 (23-27)a 24.7 (23-27)a 23.3 (21-26)a 24.5 (23-25)a 1.1 (1.0-1.1)a 1.0 (1.0-1.1)b bi-layered, ~1.2 bi-layered, ~1.3 absent absent elongate ovoidal elongate ovoidal or ellipsoidal 18.7 (17-20)b 17.7 (16-19)a a 10.9 (10-12) 11.4 (10-12)a a 1.6 (1.5-1.8) 1.6 (1.5-1.7)a prominent and rounded knob-like 0.9 (0.7-1.2)b 1.2 (0.9-1.4)a 1.9 (1.7-2.1)a 2.0 (1.9-2.1)b short and widely prominent 2.3 (2.0-2.6)b 1.2 (0.9-1.3)a 4.0 (3.6-4.5)a 2.9 (2.6-3.3)b diffuse diffuse
Different letters in each line denote statistically significant differences (p < 0.01) by the Student’s t-test.
a
a
b
c
d
Figure 2. Line drawings of Isospora coerebae, a new coccidium species recovered from the bananaquit Coereba flaveola. (a) Sporulated oocyst with its respective variations of (b, c, d) detached Stieda and substieda bodies. Scale bar: 10 µm for oocysts; and 5 µm for Stieda and substieda bodies.
v. 20, n. 1, jan.-mar. 2011
Isospora coerebae n. sp. (Apicomplexa: Eimeriidae) from the bananaquit Coereba flaveola (Passeriformes: Coerebidae)
25
a
b
c
d
e
f
Figure 3. Photographs of sporulated oocysts of coccidia species recovered from the bananaquit Coereba flaveola. (a, b, c) Isospora cagasebi and (d, e, f ) I. coerebae. Scale bar: 10 µm.
Description of a sporocyst and sporozoites: Sporocyst shape (N = 14): elongate ovoidal; L × W: 17.7 × 10.9 (16-19 × 10-12); L/W ratio: 1.6 (1.5-1.8); SB: present, prominent and rounded; SSB: present, short, however widely (Table 1); PSB: absent; SR: present; SR characteristics: composed of many scattered granules of different sizes; SZ: vermiform with a posterior SRB. Type host: Coereba flaveola Linnaeus, 1758 (Passeriformes: Coerebidae), captured on January 13, 2009. Type material: Oocysts stored in 10% aqueous buffered formalin (v/v), and deposited in the Parasitology Collection at the Department of Animal Parasitology at UFRRJ, Seropédica, Rio de Janeiro, Brazil. Phototypes and line drawings are deposited at the same location. The repository number is P-32/2009. Type locality: Marambaia Island (23° 04’ S and 43° 53’ W), Rio de Janeiro, Brazil. Sporulation time: Four days. Site of infection: Not investigated. Prevalence: 25% (two of eight birds examined). Etymology: The specific epithet is derived from the generic name of the host type.
Comments: The I. coerebae oocysts can be basically distinguished by the shape of SB and SSB. Isospora cagasebi oocysts present knob-like SB and prominent SSB, while I. coerebae has rounded, short and widely SB and SSB.
Discussion The new species described in this present study is close to I. cagasebi. At 400x magnification it is not possible to distinguish oocysts of the two species, however, at 1000× magnification two distinct types of SB and SSB are visualized. Thus, the I. cagasebi oocyst was redrawn, with details of SB and SSB, for comparison with the new species I. coerebae. Means comparisons of Stieda and substieda bodies between these species confirmed that each species can be distinguished morphologically and morphometrically, as significant differences among all analyzed parameters were found (Table 1). These results are similar to those reported by Grulet, Landau and Baccam (1982), where 12 species of Isospora were described from the domestic sparrow Passer domesticus Linnaeus, 1758. These authors identified these species mainly by the Stieda
26
Berto, B.P. et al.
Rev. Bras. Parasitol. Vet.
and substieda complex. According to Duszynski and Wilber (1997), new coccidian species should be compared in detail with coccidian species that are feature-similar and belong to the same host family. Due to the lack of descriptions of coccidia in Coerebidae family, I. coerebae was only compared with I. cagasebi. The Coerebidae family is grouped into a single species, C. flaveola; however it can be approached to the Thraupidae and Emberezidae families (BURNS; HACKETT; KLEIN, 2003; CBRO, 2009). Thus, Berto et al. (2008) compared I. cagasebi with coccidian species parasites of these two families. These comparisons are equally valid to I. coerebae. Up to date the coccidia support the classification of C. flaveola in an exclusive family since coccidia of coerebids have not yet been reported in thraupids and emberezids.
References
Acknowledgements
RAFFAELE, H. et al. A Guide to the Birds of the West Indies. Princeton: Princeton University Press, 1998. 500 p.
We thank the Brazilian Navy, especially CADIM (Centro de Adestramento da Ilha da Marambaia) commander who authorized our access to Marambaia Island and the use of some CADIM facilities during the fieldwork.
SAMPAIO, I. B. M. Estatística aplicada à experimentação animal. 2. ed. Belo Horizonte: FEPMVZ, 2002. 265 p.
BERTO, B. P. et al. Isospora cagasebi sp. nov. (Apicomplexa, Eimeriidae) from the bananaquit, Coereba flaveola of Brazil. Acta Parasitologica, v. 53, n. 2, p. 117-119, 2008. BURNS, K. J.; HACKETT, S. J.; KLEIN, N. K. Phylogenetic relationships of Neotropical honeycreepers and the evolution of feeding morphology. Journal of Avian Biology, v. 34, n. 4, p. 360-370, 2003. COMITÊ BRASILEIRO DE REGISTROS ORNITOLÓGICOS CBRO. Lista das Aves do Brasil. Rio de Janeiro: CBRO, 2009. 38 p. DUSZYNSKI, D. W.; WILBER, P. G. A guideline for the preparation of species descriptions in the Eimeridae. Journal of Parasitology, v. 83, n. 2, p. 333-336, 1997. GRULET, O.; LANDAU, I.; BACCAM, D. Les Isospora du Moineau domestique; multiplicite des especes. Annales de Parasitologie humaine et Compareè, v. 57, n. 3, p. 209-233, 1982.
SICK, H. Ornitologia Brasileira. Nova Fronteira: Rio de Janeiro, 1997. 862 p.
Full Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 27-30, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae) in Southern Pantanal, Brazil Sazonalidade de Cochliomyia macellaria (Diptera: Calliphoridae) no Pantanal Sul-mato-grossense, Brasil Wilson Werner Koller1*; Antonio Thadeu Medeiros de Barros2; Elaine Cristina Corrêa3 Embrapa Gado de Corte, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA
1
Embrapa Pantanal, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA
2
Embrapa Pantanal, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA, Bolsista ATP-A
3
Received July 12, 2010 Accepted November 24, 2010
Abstract Cochliomyia macellaria (Diptera: Calliphoridae), known as the secondary screwworm, occurs in the Americas and has medical-veterinary and forensic importance. This study aimed to describe the seasonal fluctuation of this species in the Pantanal region, Central-Western Brazil. From December 2004 to November 2007 fly catches using four windoriented traps baited with decaying bovine liver were carried out at the Nhumirim ranch, Nhecolândia subregion, Southern Pantanal. Traps remained active throughout the study period and collections were carried out on a weekly basis. A total of 159,397 Calliphoridae were caught and C. macellaria (57.33%) was the most abundant species. C. macellaria occurred all over the year showing a bimodal behavior with peaks in May-July (late autumn/early winter) and October-December (spring). Keywords: Secondary screwworm, population dynamics, secondary myiasis.
Resumo Cochliomyia macellaria (Diptera: Calliphoridae), conhecida como mosca-varejeira, ocorre no continente americano e apresenta importância médico-veterinária e forense. O presente estudo teve como objetivo conhecer a flutuação sazonal dessa espécie na região do Pantanal. De dezembro/2004 a novembro/2007 foram realizadas coletas de dípteros na fazenda Nhumirim, sub-região da Nhecolândia, Pantanal sul-mato-grossense. Foram utilizadas quatro armadilhas orientadas pelo vento, iscadas com fígado bovino deteriorado. As armadilhas permaneceram ativas durante todo o período de estudo, e coletas foram realizadas semanalmente. Foram capturados 159.397 califorídeos, sendo C. macellaria (57,33%) a espécie mais abundante. C. macellaria foi observada em todos os meses do ano, apresentando comportamento bimodal com picos populacionais em maio/julho (final de outono/início de inverno) e outubro/dezembro (primavera). Palavras-chave: Mosca-varejeira, dinâmica populacional, miíase secundária.
Introduction Cochliomyia macellaria (Fabricius, 1775), known as the secondary screwworm, is widely distributed in the Americas, occurring in tropical and subtropical Western Hemisphere from Southern Canada to Patagonia, including the Galapagos Islands and West Indies (FERREIRA, 1983; GUIMARÃES; PAPAVERO, 1999). This fly has a significant medical and veterinary importance causing secondary cutaneous myiasis and vectoring eggs of Dermatobia hominis (human bot fly), which causes significant economic losses to livestock in Brazil (GRISI et al., 2002). *Corresponding author: Wilson Werner Koller Embrapa Gado de Corte, BR 262, Km 4, CP 154, CEP 79002-970, Campo Grande - MS, Brazil; e-mail: koller@cnpgc.embrapa.br; Supported by: Fundect e Embrapa
Due to the scavenger habits of its larvae, C. macellaria has considerable ecological importance in the removal of carcasses and organic wastes in nature. It is also useful in forensic entomology in criminal investigation, providing pre- and post-mortem information (CATTS; GOFF, 1992). After the introduction of Chrysomya flies in Brazil in 1970 and its gradual dispersion nationwide, C. macellaria began to compete with exotic species for similar ecological niches (FURLANETTO et al., 1984) in the States of São Paulo (LINHARES, 1981) and Goiás (FERREIRA, 1983). There are relatively few studies on C. macellaria abundance and population dynamics in Brazil and information about its ecology in different biomes is scarce. This study described population fluctuation of C. macellaria in Southern Pantanal region, Central‑Western Brazil. www.cbpv.com.br/rbpv
28
Koller, W.W.; Barros, A.T.M.; Corrêa, E.C.
Material and Methods A 3-year survey was conducted from December 2004 to November 2007 at Nhumirim cattle farm (18° 59’ S and 56° 39’ W, 98 m a.s.l.), an experimental station of the Brazilian Agricultural Research Corporation (Embrapa) Pantanal located in the subregion of Nhecolândia, Corumbá county, State of Mato Grosso do Sul, Central-Western Brazil. It is a tropical region characterized by seasonal flooding, with a well defined rainfall season from November to March, accounting for 72% of the total annual rainfall of about 1,200 mm, and a dry season from April to October. Average annual temperature is 25.5 °C and relative humidity is about 82% (SORIANO et al., 1997). Fly catches were carried out with four-wind oriented traps, as described by Broce, Goodenough and Coppedge (1977) and modified by Oliveira, Moya-Borja and Mello (1982). The traps were suspended approximately 1.2 m above the ground and placed more than 1,200 m apart in four sites: Site 1 – trap placed about 50 m from corral in a pasture area with sparse trees; Site 2 – trap placed in an open area with native grasses about 30 m from a forested savanna edge; Site 3 – trap placed 15 m inside an area of forested savanna; and Site 4 – trap placed in an area of transition between an open area and forested savanna edge. About 500 g of bovine liver placed in a plastic container protected by nylon net were used as bait inside each trap. Liver was previously left at room temperature for 24 hours before use and half of the rotting liver bait was replaced on a weekly basis. The traps were kept active throughout the study period and were weekly replaced for collection of captured specimens and routine maintenance. Flies were removed from traps after killed with insecticide (pyrethroid) spray. The insects collected were placed into labeled plastic ziplock bags and brought to the Embrapa Pantanal Entomology Laboratory for sorting, counting and preliminary identification (MELLO, 2003). The samples were subsequently sent to the Embrapa Beef Cattle Entomology Laboratory for confirmation of species. The entomological material was deposited in both Embrapa Pantanal and Embrapa Beef Cattle reference collections. Daily records of temperature, relative humidity, and rainfall were obtained from a weather station at the study site. Monthly average temperatures and relative humidity, as well as total monthly rainfall, were usaed in the analysis. A descriptive statistical analysis was performed using data from monthly fly catches. The influence of climatic parameters on population dynamics was assessed by correlation analysis.
Results and Discussion A total of 677,313 dipterans were caught during the study period. Calliphorids totalized 159,397 specimens from the following species: Cochliomyia macellaria (Fabricius, 1775), Cochliomyia hominivorax (Coquerel, 1858); Chloroprocta idioidea Robineau – Desvoidy, 1830; Chrysomya albiceps (Wiedemann, 1819); Chrysomya megacephala (Fabricius, 1794); Chrysomya putoria (Wiedmann, 1830), Lucilia cuprina (Wiedmann, 1830) and Lucilia eximia (Wiedmann, 1819). Specimens from other
Rev. Bras. Parasitol. Vet.
families were also sampled and included Fanniidae, Muscidae, Sarcophagidae, Syrphidae, and Ropalomeridae. Cochliomyia macellaria (n = 91,386) was the most abundant species, accounting for 13.49% of all dipteran catches and 57.33% of the Calliphoridae. Yearly relative abundances of C. macellaria compared to other calliphorids were always above 50% (64.03, 50.46, and 52.25%, respectively for the three years of study). A high abundance of C. macellaria (76.09%) among Calliphoridae was also described by Ferreira (1983) in a rural area of Goiânia. However, much lower relative abundances have been found in most studies conducted in different regions (OLIVEIRA; MOYA-BORJA; MELLO, 1982; MADEIRA; DIAS; MASCARENHAS, 1982; D’ALMEIDA; LOPES, 1983; WIEGAND et al., 1991). Several factors such as trap sites and bait attractiveness may influence the frequency of C. macellaria in catches (FERREIRA, 1983). However, competition with Chrysomya species has been considered a major factor for reduced abundance of C. macellaria (GUIMARÃES; PRADO; BURALLI, 1979; D’ALMEIDA; LOPES, 1983). This interespecific competition with Chrysomya species did not seem to play a major role in this study since relative abundance of C. macellaria was consistently high during the three years studied, although its population peaks coincided with those found in Chrysomya species (CORRÊA; KOLLER; BARROS, 2010). Furthermore, no negative correlation was found between abundance of C. macellaria and Chrysomya flies, as it would be expected in the event of major competition, but rather a low positive correlation (r ≤ 0.18) was found between C. macellaria and the three species of Chrysomya (C. albiceps, C. megacephala, and C. putoria). C. macellaria was caught in all sites but its abundance markedly varied among them. The highest number of individuals was caught in the open area (35.57%) whereas the lowest abundance was seen in the forested savanna (8.07%). The denser vegetation of the forested site may have reduced dispersion of the bait odor, thus reducing catches in that environment. Remarkable differences have been described regarding abundance of C. macellaria in rural and urban areas. In this study, which was carried out in a rural area about 150 km away from the city of Corumbá, this species accounted for 57.33% of all calliphorids while a much lower abundance (7.26%) was reported in an urban area of Corumbá (CAMPOS; BARROS, 1995). D’Almeida and Lopes (1983) studied preference of C. macellaria for ecological environments in Rio de Janeiro and reported that this species was practically restricted to rural areas (97.96%) when compared to urban (1.37%) and forested (0.69%) areas. C. macellaria females (76.07%) were more frequently seen than males in the traps, which can be explained by the attractiveness of decaying liver as a potential substrate for oviposition. Similar results were reported by Oliveira, Moya-Borja and Mello (1982) and Gomes, Koller and Barros (2000) using liver baits. In general, the weather was typical for the study region. Moderate temperatures occurred from May to August and the highest temperatures were recorded from October to March. The rainy season began in September-October and the heaviest rainfall period was December-February. The average relative humidity was lower in August-September during the dry season (Figure 1).
v. 20, n. 1, jan.-mar. 2011
Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae) in Southern Pantanal, Brazil
C. macellaria was caught throughout the year in Pantanal. Similar results were reported by Gomes, Koller and Barros (2000) from ecological studies carried out in the same state in a highland region about 400 km apart. Two yearly population peaks of C. macellaria were recorded in Pantanal (Figure 2). The first peak occurred between May and
29
July (late autumn/early winter) coinciding with the beginning of the dry season in the region; the second peak occurred between October and December (spring), early rainy season. Oliveira, MoyaBorja and Mello (1982) also reported greater abundance of this species during the winter and spring in Rio de Janeiro. However, Wiegand et al. (1991) and Ribeiro et al. (1993) described a single population growth in early summer in studies in Rio Grande do Sul. Variations in the seasonality of C. macellaria result from climatic conditions found in different Brazilian regions – the central-western ans southern are quite different regions. Low correlation (r < 0.19) between population data and climatic records (temperature, relative humidity, and rainfall) indicated that seasonality of C. macellaria was not determined by a single climatic parameter but probably by an association of abiotic variables. In conclusion, C. macellaria is the most abundant Calliphoridae in Southern Pantanal (subregion of Nhecolândia); it occurs throughout the year and shows a bimodal behavior with population peaks in late autumn/early winter and spring.
Acknowledgements We thank Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso do Sul (FUNDECT) and the Brazilian Agricultural Research Corporation (Embrapa) for financial support. We also thank Luciana A. de Oliveira, Ernande Ravaglia, Marcos José M. Alves, Waldno da Silva Aquino, Sidney José Benício, and Wibert Avellar for their help with field and laboratory activities.
References BROCE, A. B.; GOODENOUGH, J. L.; COPPEDGE J. R. A wind oriented trap for screwworm flies. Journal of Economic Entomology, v. 70, n. 4, p. 413-416, 1977.
Figure 1. Climatic data at the Nhumirim cattle farm, Nhecolândia subregion, Pantanal, State of Mato Grosso do Sul, Brazil, December 2004 to November 2007.
CAMPOS, F. M.; BARROS, A. T. M. Dípteros muscóides da área urbana de Corumbá, Mato Grosso do Sul, Brasil. Revista Brasileira de Biologia, v. 55, n. 3, p. 351-354, 1995. CATTS, E. P.; GOFF, M. L. Forensic entomology in criminal investigations. Annual Review of Entomology, v. 37, p. 253-272, 1992. CORRÊA, E. C.; KOLLER, W. W.; BARROS, A. T. M. Abundância relativa e sazonalidade de espécies de Chrysomya (Diptera: Calliphoridae) no Pantanal sul-mato-grossense, Brasil. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 2, p. 85-88, 2010. D’ALMEIDA, J. M.; LOPES, H. S. Sinantropia de dípteros caliptratos (Calliphoridae) no estado do Rio de Janeiro. Arquivo Universidade Federal Rural do Rio de Janeiro, v. 6, n. 1, p. 39-48, 1983. FERREIRA, M. J. M. Sinantropia de Calliphoridae (Diptera) em Goiânia, Goiás. Revista Brasileira de Biologia, v. 43, n. 2, p. 199-210, 1983.
Figure 2. Seasonal fluctuation of Cochliomyia macellaria in the subregion of Nhecolândia, Pantanal, State of Mato Grosso do Sul, Brazil, December 2004 to November 2007.
FURLANETTO, S. M. P. et al. Microrganismos enteropatogênicos em moscas africanas pertencentes ao gênero Chrysomya (Diptera, Calliphoridae) no Brasil. Revista de Microbiologia, v. 15, n. 3, p. 170-174, 1984.
30
Koller, W.W.; Barros, A.T.M.; Corrêa, E.C.
GOMES, A.; KOLLER, W. W.; BARROS, A. T. M. Sazonalidade da mosca-varejeira, Cochliomyia macellaria (Diptera: Calliphoridae), na região dos Cerrados, Campo Grande, MS. Revista Brasileira de Parasitologia Veterinária, v. 9, n. 2, p. 125-128, 2000. GRISI, L. et al. Impacto econômico das principais ectoparasitoses em bovinos no Brasil. A Hora Veterinária, v. 21, n. 125, p. 8-10, 2002. GUIMARÃES, J. H.; PAPAVERO, N. Myiasis in man and animals in the Neotropical region; bibliographic database. São Paulo: Plêiade/ FAPESP, 1999. 308 p. GUIMARÃES, J. H.; PRADO, A. P.; BURALLI, G. M. Dispersal and distribution of three newly introduced species of Chrysomya RobineauDesvoid in Brazil (Diptera, Calliphoridae). Revista Brasileira de Entomologia, v. 23, n. 4, p. 245-255, 1979. LINHARES, A. X. Synanthropy of Calliphoridae and Sarcophagidae (Diptera) in the city of Campinas, São Paulo, Brazil. Revista Brasileira de Entomologia, v. 25, n. 3, p. 189-215, 1981. MADEIRA, N. G.; DIAS, E. S.; MASCARENHAS, C. S. Contribuição ao conhecimento da fauna de Calliphoridae (Diptera) sinantrópicos da Pampulha - Belo Horizonte, Minas Gerais. Revista Brasileira de Entomologia, v. 26, n. 2, p. 137-140, 1982.
Rev. Bras. Parasitol. Vet.
MELLO, R. P. Chave de identificação das formas adultas das espécies da família Calliphoridae (Diptera, Brachycera, Cyclorrapha) encontradas no Brasil. Entomologia Veterinária, v. 10, n. 2, p. 255-268, 2003. OLIVEIRA, C. M. B.; MOYA-BORJA, G. E.; MELLO, R. P. Flutuação populacional de Cochliomyia hominivorax no município de Itaguaí, Rio de Janeiro. Pesquisa Agropecuária Brasileira, v. 2, n. 4, p. 139-142, 1982. RIBEIRO, P. B. et al. Influência da temperatura na captura de califorídeos em armadilhas W. O. T. Cochliomyia hominivorax e C. macellaria. (Diptera - Calliphoridae). Revista Brasileira de Parasitologia Veterinária, v. 2, n. 1, p. 53-54, 1993. SORIANO, B. M. A. et al. Plano de utilização da fazenda Nhumirim. Corumbá: EMBRAPA – CPAP, 1997. 72 p. (Documentos, 21). Disponível em: <http://www.cpap.embrapa.br/publicacoes/online/ DOC21.pdf>. Acesso em: 26 jul. 2010. WIEGAND, M. M. et al. Flutuação populacional de Cochliomyia hominivorax e C. macellaria (Diptera: Calliphoridae) no Município do Capão do Leão, Rio Grande do Sul. Arquivo Brasileiro Medicina Veterinária e Zootecnia, n. 42, p. 155-162, 1991.
Full Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 31-35, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
In vitro activity of Artemisia annua L (Asteraceae) extracts against Rhipicephalus (Boophilus) microplus Atividade in vitro de extratos de Artemisia annua L (Asteraceae) sobre Rhipicephalus (Boophilus) microplus Ana Carolina de Souza Chagas1*; Cynthia Sanches Georgetti2; Camila Olivo de Carvalho3; Márcia Cristina de Sena Oliveira1; Rodney Alexandre Rodrigues4; Mary Ann Foglio4; Pedro Melillo de Magalhães4 Laboratório de Sanidade Animal, Embrapa Pecuária Sudeste, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA
1
Centro Universitário Central Paulista – UNICEP
2
Universidade Estadual Paulista – UNESP
3
Centro Pluri-disciplinar de Pesquisas Químicas, Biológicas e Agrícolas, Universidade Estadual de Campinas – UNICAMP
4
Received August 24, 2010 Accepted November 29, 2010
Abstract The activity of plant extracts on parasites may indicate groups of substances that are potentially useful for controlling Rhipicephalus (Boophilus) microplus. The aim of the present study was to investigate the in vitro action of Artemisia annua extracts on this tick. The concentrations of the sesquiterpene lactones artemisinin and deoxyartemisinin present in plant extracts were quantified via high-performance liquid chromatography. Four extracts produced from the concentrated crude extract (CCE) were evaluated on larvae using the impregnated paper method, with readings after 24 hours of incubation. The engorged females were immersed in the CCE and in its four derived extracts for five minutes, with incubation for subsequent analysis of biological parameters. The extracts were not effective on the larvae at the concentrations tested (3.1 to 50 mg.mL–1). The CCE showed greater efficacy on engorged females (EC50 of 130.6 mg.mL–1 and EC90 of 302.9 mg.mL–1) than did the derived extracts. These results tend to confirm that the action of artemisinin on engorged females of R. (B.) microplus is conditional to their blood intake. In this case, in vitro methods would be inadequate for effective evaluation of the action of A. annua on R. (B.) microplus. Keywords: Phytotherapy, artemisinin, tick, control, R. (B.) microplus, Artemisia annua.
Resumo A atividade de extratos vegetais sobre parasitas pode indicar grupos de substâncias de uso potencial no controle de Rhipicephalus (Boophilus) microplus. O objetivo do presente estudo foi investigar a ação in vitro de extratos de Artemisia annua sobre esta espécie. A concentração das lactonas sesquiterpênicas artemisinina e deoxiartemisinina presentes nos extratos vegetais, foi quantificada via cromatografia líquida de alta eficiência. Quatro extratos produzidos a partir do extrato bruto concentrado (EBC) foram avaliados sobre larvas pela metodologia do papel impregnado, com leitura após 24 horas de incubação. As fêmeas ingurgitadas foram imersas por cinco minutos no EBC e nos seus quatro extratos derivados, e incubadas para posterior análise dos parâmetros biológicos. Os extratos não tiveram eficácia sobre as larvas nas concentrações avaliadas (de 3,1 a 50 mg.mL–1). O EBC apresentou melhor eficácia sobre as fêmeas ingurgitadas (CE50 de 130,6 mg.mL–1 e CE90 de 302,9 mg.mL–1) que os extratos derivados. Esses resultados tendem a confirmar que a ação da artemisinina sobre as fêmeas ingurgitadas de R. (B.) microplus estaria condicionada à sua ingestão através do sangue. Nesse caso, os métodos in vitro seriam inadequados para a efetiva avaliação da ação de A. annua sobre R. (B.) microplus. Palavras-chave: Fitoterapia, artemisinina, carrapato, controle, R. (B.) microplus, Artemisia annua.
*Corresponding author: Ana Carolina de Souza Chagas Laboratório de Sanidade Animal, Embrapa Pecuária Sudeste Rod. Washington Luiz, Km 234, CP 339, CEP 13560-970, São Carlos - SP, Brasil; e-mail: carolina@cppse.embrapa.br
www.cbpv.com.br/rbpv
32
Chagas, A.C.S. et al.
Introduction
Material and Methods
Good results from cattle rearing depend on nutritional, reproductive and health management, among other factors. In health management, parasite control is a major challenge, since rearing implies inevitable parasitic infestation. Brazil has one of the largest cattle herds in the world, estimated at 173.2 million head (ANUALPEC, 2009). Rhipicephalus (Boophilus) microplus tick (Canestrini, 1887) is considered largely responsible for economic losses in cattle production. Research has shown that Brazil spends about 800 million dollars a year on acaricides to combat this parasite (FURLONG et al., 2007). However, control using chemicals has become increasingly less tenable for a number of reasons, such as high cost, short time of effectiveness, rapid development of resistance, inadequate management and disregard of the lack of time and possibility of pesticide waste in the environment and products of animal origin (GRISI et al., 2002). For this reason, searching for new alternatives to conventional acaricides for parasite control has become inevitable. Several specific investigations have been conducted on R. (B.) microplus, in which the antiparasitic potential and bioactivity of plant extracts have been evaluated. The essential oil of Eucalyptus staigeriana (Myrtaceae) has been tested on larvae and engorged females and was found to cause mortality ranging from 12.5 to 100%. When the oil was turned into an emulsifiable concentrate, efficiency of 100% was obtained at a concentration of 3.9% (CHAGAS et al., 2002). In vivo tests have shown that the 0.25% hexane extract of Melia azedarach (Meliaceae) reduced the infestation of R. (B.) microplus by around 24% (BORGES et al., 2005). The essential oil of Cymbopogon winterianus (Poaceae) at 7% concentration inhibited 100% of egg hatchability in treated engorged females, although the compound isolated were not so effective (MARTINS, 2006). The 2.7% alcoholic extract of Cymbopogon citratus caused mortality of 43% in the field (HEIMERDINGER et al., 2006). The oil of Copaifera reticulata (Caesalpiniaceae) presented an EC99 of 3.5 ppm for larvae (FERNANDES; FREITAS, 2007). The hexane extract of Hypericum polyanthemum (Guttiferaceae) killed 100% of the larvae at 6.25 mg.mL–1 (RIBEIRO et al., 2007). Artemisia annua L (Asteraceae) (the target of the present study) and other species of this genus contain a sesquiterpene lactone called artemisinin, which has already been proven to have antimalarial activity. The mechanisms of action, clinical characteristics and toxicity of artemisinin have been studied extensively. Agrotechnological, pharmacological and chemical studies have also been conducted on other sesquiterpene compounds present in this plant (RODRIGUES et al., 2006). In addition to the rapid action of artemisinin at nanomolar concentrations for controlling Plasmodium spp. (CREEK et al., 2005; FERREIRA et al., 2006), the genus Artemisia also has an effect on gastrointestinal nematodes, thereby decreasing the number of eggs per gram of feces (EPG) in small ruminants (IDRIS et al., 1982; IQBAL et al., 2004; TARIQ et al., 2009). There have not been any specific studies in the literature examining the action of A. annua on the tick R. (B.) microplus. Hence, the present study aimed to evaluate the effect of extracts of A. annua on R. (B.) microplus, and to identify and quantify its constituents, thus providing future possibilities for preparing safe, standardized and commercially available formulations for farmers.
1. Production of A. annua extracts
Rev. Bras. Parasitol. Vet.
A. annua leaves and twigs genotype Ch × Viet55, which was selected for late flowering and was cultivated in the Multidisciplinary Centre for Chemical, Biological and Agricultural Research (CPQBA) at UNICAMP, was used throughout the present study. To extract the active ingredients, the traditional method was used on a weight of 1 kg of dried and ground plant material. In this process, the plant was subjected to extraction using ethanol (96° GL) as the extractor liquid at room temperature, with the aid of mechanical agitation for 4½ hours (3 × 1½ hours). The extracts were filtered, pooled and concentrated to ⅓ of the total volume, thus providing the so-called concentrated crude extract (CCE), which was subjected to evaporation. From this extract, another four extracts were produced under cold conditions in accordance with Simões et al. (2004), using different solvents for non-sequential extraction in: A) water followed by lyophilization; B) water basified with NaHCO3 (sodium bicarbonate) at 0.1%; C) ethanol (96° GL), followed by concentration in a rotary evaporator; and D) dichloromethane, followed by concentration in a rotary evaporator.
2. Quantification of artemisinin and deoxyartemisinin in the A. annua extracts The extracts were suspended in 5.0 mL volumetric flasks with chromatographic-grade methanol, filtered through 0.45 µm Millipore and analyzed by means of refractive index highperformance liquid chromatography (RI-HPLC). To prepare the mobile phase, 60:40 solvents of H2O to MeOH were used, with filtration on 0.45 µm Millipore and sonication under vacuum. To prepare the calibration curve, 65 mg of the extracts was weighed, and this was diluted in 25 mL of HPLC-grade methanol, thereby resulting in a concentration of 2,444 µg.mL–1, of analytical standard with 94% purity. Injections in triplicate were made at seven points on the analytical curve, at concentrations from 50 to 1,250 µg.mL–1, and the curve was obtained through the Empower software. The chromatograph was used equipped with an ionization detector and a Phenomenex Luna CN 100A° capillary column (250 mm × 4.6 mm × 5 µm), and with volume injection of 20 µL and flow rate of 1 mL/min. This procedure had a sensitivity of 32 °C and internal temperature of 35 °C. The quantification of artemisinin (retention time of 7 minutes) and deoxyartemisinin (6.5 minutes) content in the extracts was done using the methodology validated by Celeghini et al. (2009), from the external standard method.
3. Sensitivity of larvae in the impregnated paper test Engorged females from the colony of R. (B.) microplus that is maintained by Embrapa Pecuária Sudeste (CPPSE) were placed in an incubator (± 27 °C and RH > 80%) for larvae production, for use 14 to 21 days after hatching. The extracts were tested at five concentrations: aqueous (A) and sodium bicarbonate (B) extracts
v. 20, n. 1, jan.-mar. 2011
In vitro activity of Artemisia annua L (Asteraceae) extracts against Rhipicephalus (Boophilus) microplus
were used at concentrations ranging from 12.5 to 50 mg.mL–1; and ethanol (C) and dichloromethane extracts (D) between 3.1 and 12.5 mg.mL–1. These concentrations were defined according to the available quantity of each of the extracts and from in vitro results with eggs and larvae of gastrointestinal nematodes (CALA, 2010). The ethanol extracts were dissolved in 0.33% Tween 80 and 10% ethanol, with one control consisting of distilled water and another of distilled water, and the other solvents at the same concentrations. All tests were conducted with three replications. Approximately 100 larvae were placed between 2 × 2 cm filter papers that had newly been impregnated with the extracts, thereby forming a sandwich. This was placed inside a filter paper envelope and sealed. This approach is recommended by the World Food and Agriculture Organization (CHAGAS et al., 2003). The envelopes were kept in an incubator (±27 °C and RH > 80%) and counting of live and dead larvae was performed after 24 hours. To calculate the percentage mortality, the following formulas were used:
(1)
4. Sensitivity of engorged females in the immersion test Engorged females collected from cattle at CPPSE were weighed in order to form homogeneous groups of 10 females, which were immersed for 5 minutes in the plant extracts tested (DRUMMOND et al., 1973). After this period, the females were removed from the solution, dried on paper towels and placed in properly identified Petri dishes bearing double-sided tape. The groups were placed in the incubator (27 °C and RH > 80%) for 18 days and, after the spawning period, the eggs were weighed and transferred to properly labeled syringes, sealed and placed in the incubator. The hatchability was verified visually by comparing the number of remaining eggs with the shells (AMARAL, 1993). Because the expected effectiveness was not obtained in the larva test, the immersion test on engorged females was set at higher concentrations, but again respecting the availability of each extract. Five concentrations were evaluated: aqueous extracts (A) from 40 to 280 mg.mL–1; sodium bicarbonate extracts (B) and dichloromethane extracts (D) from 20 to 220 mg.mL–1; and ethanol extracts (C) and CCE extracts from 10 to 140 mg.mL–1. Three replicates were performed for each concentration and the solvents 0.33% Tween 80 and 10% ethanol were used for the ethanol extracts. Control groups were prepared with solvents as mentioned above. Toxicity limits had been determined previously (CHAGAS et al., 2003). The percentage efficiency was calculated in accordance with Drummond et al. (1973): (2) *Constant that indicates the number of eggs present in 1 g.
(3)
33
The results were analyzed using the Probit procedure (from SAS) to determine the EC50 and EC99. The data on the five concentrations were compared within each extract using the Tukey test.
Results The chemical analyses on the four plant extracts enabled quantification of artemisinin (to which antiparasitic action has been attributed) and deoxyartemisinin, another sesquiterpene lactone that is present in extracts from this species (Table 1). Taking the values found, it was observed that the dichloromethane extract (D) had the highest amounts of artemisinin and deoxyartemisinin, followed by the ethanol extract (C). All the larvae remained alive after exposure to the extracts at all the concentrations tested. In the immersion test, no significant action was seen at any concentration for the four extracts derived. It was only possible to calculate the EC50 and EC90 for the CCE extract (p ≥ 0.05): 130.6 mg.mL–1 (115.9 to 152.7) and 302.9 mg.mL–1 (238.6 to 436.0), respectively. The results regarding reproductive efficiency and the effectiveness of the CCE and its four derivative extracts can be seen in Table 2.
Discussion From assessment of the records of A. annua activity on a variety of parasites, it was decided to evaluate its potential for controlling the tick R. (B.) microplus. It was observed in the larva test that the four extracts of A. annua had no effectiveness at the concentrations evaluated. There was an expectation of better results with dichloromethane, which contained a large amount of artemisinin (1343.9 g.mL–1) because of its high affinity for the solvent, which could explain its more significant biological activity. One factor that may have affected the results was the cracking condition of the CCE; other substances that might have been acting synergistically within the antiparasitic effect were diluted in the subsequent four extracts, thereby resulting in lower effectiveness for the dichloromethane extract than for the CCE. Doses of Artemisia herba-alba from 2 to 30 g were administrated orally to goats that had been artificially infected with the gastrointestinal nematode H. contortus. There was a reduction in EPG in the abomasum of adults, as well as reductions in histological damage or blood disorders (IDRIS et al., 1982). In sheep that received the crude ethanol and methanol extracts of Artemisia brevifolia for 14 days, at doses of 3.0 g.kg–1 body weight (bw), EPG reductions of 67.2 and 62.1% were detected (IQBAL et al., 2004). Aqueous and ethanol crude extracts of Artemisia absinthium were also administered orally to infected sheep, and there was a reduction in EPG: in the aqueous extract, 80.49% was obtained at a dose of 2 g.kg–1 bw and in the ethanol extract, 90.46% at a dose of 2 g.kg–1 bw and 82.85% at a dose of 1 g.kg–1 bw (TARIQ et al., 2009). Although artemisinin-derived drugs have shown effects on a variety of parasites such as Fasciola hepatica and gastrointestinal nematodes in small ruminants. Plasmodium spp., Coccidia spp., Babesia spp., Leishmania spp., Neospora caninum and Schistosoma spp., and have been successfully tested as cancer
34
Chagas, A.C.S. et al.
Table 1. Quantification of the sesquiterpene lactones artemisinin and deoxyartemisinin (µg.mL–1) in aqueous, sodium bicarbonate, ethanol and dichloromethane extracts of Artemisia annua, via highperformance liquid chromatography. Code A B C D
Extract Aqueous Sodium bicarbonate Ethanol Dichloromethane
Artemisinin 108.627 93.476 989.985 1,343.929
Deoxyartemisinin 38.068 37.532 289.054 316.838
Table 2. Reproductive efficiency index (REI) and extract effectiveness (EE) in engorged females of Rhipicephalus (Boophilus) microplus, tested by means of immersion in different concentrations (mg.mL–1) of Artemisia annua extracts: concentrated crude extract (CCE), aqueous, sodium bicarbonate, ethanol and dichloromethane. Extract CCE
Aqueous
Sodium bicarbonate
Ethanol
Dichloromethane
Concentration 10 20 40 80 140 40 80 160 220 280 20 40 80 160 220 40 80 160 220 280 20 40 80 160 220
REI 95 95 91 68 45 94 92 86 88 83 85 78 80 84 75 81 65 92 78 76 88 86 75 82 91
EE 0.0 0.0 4.2 28.4 52.6 0.7 2.7 9.2 6.8 12.5 10.7 17.3 15.7 11.7 21.0 14.1 31.0 2.8 17.5 19.4 6.8 9.0 18.0 13.1 3.5
* a a a b c a a a a a a a a a a a a a a a a a a a a
*Different letters in the same column represent a difference. (p ≥ 0.5) within the same extract.
treatments (FERREIRA, 2007), they were not shown to be effective on R. (B.) microplus in the present study. Derivatives devoid of the peroxide bond, such as deoxyartemisinin, are considered completely inactive on parasites. Thus, the fundamental group that confers activity to artemisinin, and even to synthetic substances, is lead peroxide (KLAYMAN, 1985; MESHNICK et al., 1996). Endoperoxides are classified as blood schizonticidal agents in the case of Plasmodium spp. control in malaria (TARANTO et al, 2006). The mode of action of artemisinin in gastrointestinal nematodes, trematodes and monogeneans has been extensively investigated (KEISER et al., 2006, 2008; EKANEM; BRISIBE, 2010). Such
Rev. Bras. Parasitol. Vet.
studies may explain how artemisinin can be applied to control other parasites of veterinary importance, such as R. (B.) microplus. Artemisinin is thought to exert its effect by reacting with the heme groups of the hemoglobin molecules digested by parasites, altering the cell structure and its functions through the free radicals derived from artemisinin, and thus affect the growth and reproduction of parasites (WRIGHT; WARHURST, 2002 apud FERREIRA; GONZALEZ, 2008). In this manner, it can be claimed that the action of artemisinin occurs in two steps: first, there is the generation of free radical; and then, alkylation of specific proteins that are essential for parasite survival (SILVA, 2006). Indeed, such generation of free radicals depends on iron ions present in the heme group, and this is the major step of the mechanism of action, since the formation of a complex between the heme group and artemisinin causes disruption of the endoperoxide bridge by means of catalytic reduction (LA-SCALEA et al., 2007). However, in addition to the feeding mechanism, which enables breakage of the peroxide bridge, other mechanisms may also be involved, since artemisinin has been shown to have action against the nonhematophagous parasite Echinostoma caproni in mice (KEISER; UTZINGER, 2007). Thus, if the mode of action of artemisinin on the parasite is indirect, i.e. impairing its reproduction, for example, its efficacy on engorged R. (B.) microplus would be conditional on its intake through the blood. The same has been said for gastrointestinal nematodes in small ruminants (FERREIRA et al., 2006). If ingestion is the process that activates the main mechanism of action of artemisinin in R. (B.) microplus, in vitro methods would be inadequate for effective evaluation of A. annua in this parasite. Thus, we now intend to conduct in vivo tests at CPPSE, in which cattle may receive A. annua in food, in order to elucidate this hypothesis.
References AMARAL, N. K. Guidelines for the evaluation of ixodicides against the cattle tick Boophilus microplus (Canestrini, 1887) (Acari: Ixodidae). Revista Brasileira de Parasitologia Veterinária, v. 2, n. 2, p. 144-151, 1993. ANUALPEC. Anuário da pecuária brasileira. São Paulo: Angra FNP Pesquisas. 2009, 360 p. BORGES, L. M. F. et al. Ação do extrato hexânico de frutos maduros de Melia azedarach (Meliaceae) sobre Boophilus microplus (Acari: Ixodidae) em bezerros infestados artificialmente. Revista de Patologia Tropical, v. 34, n. 1, p. 53-59, 2005. CALA, A. C. Avaliação da atividade de Artemisia annua L., Melia azedarach L. e Trichilia claussenii C. sobre nematódeos gastrintestinais de ovinos. 2010. 64 f. Dissertação (Mestrado)Universidade Estadual Paulista, Faculdade de Ciências Agrárias e Veterinárias, Jaboticabal. CELEGHINI, R. M. S. et al. Desenvolvimento e validação de metodologia analítica por CLAE-IR para determinação de artemisinina em Artemisia annua L. Química Nova, v. 32, n. 4, p. 875-878, 2009. CHAGAS, A. C. S. et al. Efeito acaricida de óleos essenciais e concentrados emulsionáveis de Eucalyptus em Boophilus microplus. Brazilian Journal of Veterinary Research and Animal Science, v. 39, n. 5, p. 247-253, 2002.
v. 20, n. 1, jan.-mar. 2011
In vitro activity of Artemisia annua L (Asteraceae) extracts against Rhipicephalus (Boophilus) microplus 35
CHAGAS, A. C. S. et al. Sensibilidade do carrapato Boophilus microplus a solventes. Ciência Rural, v. 33, n. 1, p. 109-114, 2003.
IQBAL, Z. et al. Anthelmintic activity of Artemisia brevifolia in sheep. Journal of Ethnopharmacology, v. 93, n. 2, p. 265-268, 2004.
CREEK, D. J. et al. Kinetics of ironmediated artemisinin degradation: effect of solvent composition and iron salt. Journal of Pharmaceutical Sciences, v. 94, n. 8, p. 1820-1829, 2005.
KEISER, J. et al. Artesunate and artemether are effective fasciolicides in the rat model and in vitro. Journal of Antimicrobial Chemotherapy, v. 57, n. 6, p. 1139-1145, 2006.
DRUMMOND, R. O. et al. Boophilus annulatus and B. microplus: laboratory tests of insecticides. Journal of Economic Entomology, v. 66, n. 1, p. 130-133, 1973.
KEISER, J. et al. Efficacy and safety of artemether against a natural Fasciola hepatica infection in sheep. Parasitology Research, v. 103, n. 3, p. 517-522, 2008.
EKANEM, A. P.; BRISIBE, E. A. Effects of ethanol extract of Artemisia annua L. against monogenean parasites of Heterobranchus longifilis. Parasitology Research, v. 106, n. 5, p. 1135-1139, 2010.
KEISER, J.; UTZINGER, J. Food-borne trematodiasis: current chemotherapy and advances with artemisinins and synthetic trioxolanes. Trends in Parasitology, v. 23, n. 11, p. 555-562, 2007.
FERNANDES, F. F.; FREITAS, E. P. S. Acaricidal activity of an oleoresinous extract from Copaifera reticulata (Leguminosae: Caesalpinioideae against larvae of the southern cattle tick, Riphicephalus (Boophilus) microplus (Acari:Ixodidae). Veterinary Parasitology, v. 147, n. 1-2, p. 150-154, 2007.
KLAYMAN, D. L. Qinghaosu (Artemisinin): na antimalarial drug from China. Science, v. 228, n. 4703, p. 1049-1055, 1985.
FERREIRA, J. F. S. et al. Agrotechnological aspects of the anti-malarial plant Artemisia annua and its potential use in animal health in Appalachia. In: Revue de Régions Arides - Numéro special - Actes du séminaire international les Plants à Parfum, Aromatiques et Medicinales (English version: International Center for Agricultural Research in Dry Areas, International Symposium on Perfume, Aromatic and Medicinal Plants, n. 2-4, p. 797-804, 2006. FERREIRA, J. F. S. Nutrient Deficiency in the Production of Artemisinin, Dihydroartemisinic Acid, and Artemisinic Acid in Artemisia annua L. Journal of Agricultural and Food Chemistry, v. 55, n. 5, p. 1686-1694, 2007. FERREIRA, J. F. S.; GONZALEZ, J. M. Chemical and biological stability of artemisinin in bovine rumen fluid and its kinetics in goats (Capra hircus). Revista Brasileira de Parasitologia Veterinária, v. 17, Supl. 1, p. 103-109, 2008. FURLONG, J. et al. O carrapato dos bovinos e a resistência: temos o que comemorar? A Hora Veterinária, v. 159, p. 26-32, 2007. GRISI, L. et al. Impacto econômico das principais ectoparasitoses em bovinos no Brasil. A Hora Veterinária, v. 21, n. 125, p. 8-10, 2002. HEIMERDINGER, A. et al. Extrato alcoólico de Capim-cidreira (Cymbopogon citratus) no controle do Boophilus microplus em bovinos. Revista Brasileira de Parasitologia Veterinária, v. 15, n. 1, p. 37-39, 2006. IDRIS, U. A.; ADAM, S. E.; TARTOUR, G. The anthelmintic efficacy of Artemisia herba-alba against Haemonchus contortus infection in goats. Animal Health Quarterly, v. 22, n. 3, p. 138-143, 1982.
LA-SCALEA, M. A.; SILVA, H. S. R. C.; FERREIRA, E. I. Redução voltamétrica de artemisinina e sua interação com grupo heme (hemina). Brazilian Journal of Pharmaceutical Sciences, v. 43, n. 3, p. 371-383, 2007. MARTINS, R. M. Estudio in vitro de la acción acaricida del aceite esencial de la gramínea Citronela de Java (Cymbopogon winterianus Jowitt) en la garrapata Boophilus microplus. Revista Brasileira de Plantas Medicinais de Botucatu, v. 8, n. 2, p. 71-78, 2006. MESHNICK, S. R. et al. Second-generation antimamalarial endoperoxides. Parasitology Today, v. 12, n. 2, p. 79-82, 1996. RIBEIRO, V. L. S. et al. Acaricidal properties of extracts from the aerial parts of Hypericum polyanthemum on the cattle tick Boophilus microplus. Veterinary Parasitology, v. 147, n. 1-2, p. 199-203, 2007. RODRIGUES, R. A. F. et al. Otimização do processo de extração e isolamento do antimalárico artemisinina a partir de Artemisia annua L. Química Nova, v. 29, n. 2, p. 368-372, 2006. SILVA, H. S. R. C. Antimaláricos potenciais: pró-fármacos poliméricos e formas de liberação controlada de artemisinina. 2006. 209 f. Tese (Doutorado)-Universidade de São Paulo, São Paulo. SIMÕES, C. M. et al. Farmacognosia: da planta ao medicamento. 5. ed. Porto Alegre: Editora da UFRGS; Florianópolis: Editora da UFSC, 2004. 1102 p. TARANTO, A. G. et al. Estudo sobre o mecanismo de ação da artemisinina e dos endoperóxidos, a mais nova classe de agentes antimaláricos. Sitientibus, v. 34, p. 47-58, 2006. TARIQ, K. A. et al. Anthelmintic activity of extracts of Artemisia absinthium against ovine nematodes. Veterinary Parasitology, v. 160, n. 1-2, p. 83-88, 2009.
Review Full Article Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 36-41, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
The use of conjunctival swab samples for PCR screening for visceral leishmaniasis in vaccinated dogs O uso de amostras de swab conjuntival para triagem por PCR da leishmaniose visceral em cães vacinados Rodrigo Souza Leite1*; Virginia Carregal Mendes1; Aline Leandra Carvalho Ferreira1; Antero Silva Riberiro de Andrade1 Laboratório de Radiobiologia, Centro de Desenvolvimento da Tecnologia Nuclear – CDTN
1
Received September 13, 2010 Accepted November 29, 2010
Abstract The polymerase chain reaction (PCR) has been shown to provide a rapid and sensitive technique for Leishmania detection. The aim of this study was to evaluate the technique of noninvasive conjunctival swabs (CS) as a sampling method for molecular screening for visceral leishmaniasis (VL) in a group of 42 police dogs, all of them vaccinated against VL, and to compare the results with those obtained by serological tests. The serological assays were performed independently by three laboratories. Laboratories 1 and 2 were private laboratories and laboratory 3 was the National Reference Laboratory. The first serological screening performed by laboratory 1 showed 15 reactive dogs and 4 indeterminate. Laboratory 2 confirmed only 3 reactive dogs and 2 indeterminate. Laboratory 3 confirmed 7 reactive dogs and 3 indeterminate. The PCR diagnosis using the CS procedure was performed on all 42 animals and was able to detect Leishmania DNA in 17 dogs. The PCR assay confirmed all the cases that were simultaneously reactive in the serological tests by two laboratories. The results showed that the CS technique was a sensitive and practical method for sample collection, thus allowing reliable diagnostic tests through PCR. Keywords: Visceral leishmaniasis, dog, diagnosis, PCR, conjunctival swab.
Resumo A PCR (do inglês Polymerase Chain Reaction) tem demonstrado ser uma técnica rápida e sensível para detecção de Leishmania. O objetivo deste estudo foi avaliar a técnica não invasiva do swab conjuntival na identificação por PCR de animais infectados em um grupo de 42 cães policiais, todos vacinados contra a Leishmaniose Visceral (VL), e comparar os resultados com aqueles obtidos pelos testes sorológicos. Os ensaios sorológicos foram realizados independentemente por três laboratórios. Os laboratórios 1 e 2 eram privados. O laboratório 3 era o Laboratório de Referência Nacional. A primeira triagem sorológica realizada pelo laboratório 1 apresentou 15 cães reativos e 4 indeterminados. O laboratório 2 confirmou apenas 3 cães reativos e 2 animais indeterminados. O laboratório 3 confirmou 7 cães reativos e 3 cães foram classificados como indeterminados. O diagnóstico pela PCR, utilizando o procedimento do swab conjuntival, foi realizado em todos os 42 animais e foi capaz de detectar DNA de Leishmania em 17 cães. A PCR confirmou todos os casos simultaneamente reativos nos testes sorológicos de dois laboratórios. Os resultados demonstraram que o swab conjuntival é um método sensível e prático para coleta de amostra, permitindo um diagnóstico consistente através da PCR. Palavras-chave: Leishmaniose visceral, cão, diagnóstico, PCR, swab conjuntival.
Introduction Visceral leishmaniasis (VL) is an infectious disease caused in Brazil by the protozoan Leishmania (Leishmania) infantum (syn. Leishmania (Leishmania) chagasi) (DANTAS-TORRES, 2009). Dogs are the major domestic reservoirs of L. infantum, and constitute part of the epidemiological cycle of human transmission (LAISON; SHAW, 1987). Epidemiological control for VL in *Corresponding author: Rodrigo Souza Leite Laboratório de Radiobiologia, Centro de Desenvolvimento da Tecnologia Nuclear – CDTN, Av. Antônio Carlos, 6627, Campus da UFMG, CEP 31270-901, Belo Horizonte - MG, Brazil; e-mail: rleite2005@gmail.com
Brazil involves elimination of infected dogs (TESH, 1995) in an attempt to reduce human disease. Therefore, reliable diagnostic tests are essential to avoid disease transmission or unnecessary culling of dogs. Dog removal is based on seropositivity, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT). However, these techniques present limitations (SILVA et al., 2006), since the sensitivity of antibody detection is generally lower in early or asymptomatic canine infections (LEONTIDES et al., 2002). In addition, the serological tests can present false positive results in www.cbpv.com.br/rbpv
v. 20, n. 1, jan.-mar. 2011
The use of conjunctival swab samples for PCR screening for visceral leishmaniasis in vaccinated dogs
dogs due to cross-reactions with other diseases like trypanosomiasis (BARBOSA DE DEUS et al., 2002). The polymerase chain reaction (PCR) has been shown to provide a rapid, specific and sensitive technique for Leishmania detection (MAIA; CAMPINO, 2008; ASSIS et al., 2010; QUEIROZ et al., 2010). A broad range of clinical specimens (including blood, skin biopsies, lymph node, bone marrow and spleen) have been used for PCR detection of the parasite (SOLANO-GALLEGO et al., 2009). However, noninvasive samples are very desirable since they could be obtained outside of veterinary centers and could be applied to massive screenings of dogs. One useful method for sample collection is the conjunctival swab (CS) technique, which consists of using a sterile swab to sample the dogs’ conjunctivas. This method has been shown to be highly sensitive for VL diagnosis using PCR, both among symptomatic dogs (STRAUSS-AYALI et al., 2004; FERREIRA et al., 2008; PILATTI et al., 2009) and among asymptomatic dogs (LEITE et al., 2010). The aim of this study was to evaluate noninvasive CS for molecular screening of a group of police dogs (which were all vaccinated against VL), including seronegative and seropositive animals, and to compare the results with those obtained from serological tests. A group of vaccinated dogs was chosen in view of the potential use of CS as a confirmatory diagnosis for these animals, in which vaccination could render some dogs positive in the serological tests. Moreover, this group of dogs was continuously monitored and subjected to regular serological screenings.
Material and Methods 1. Dogs Forty-two dogs belonging to the Military Police of the state of Minas Gerais (PMMG) were included in this study. The dogs were working and living in the area of the Fourth Company of Military Police/Command of Specialized Police, which is located in the city of Belo Horizonte, Minas Gerais, Brazil. All the dogs had been vaccinated against VL using the Leishmune® vaccine (Fort Dodge, Brazil), in accordance with the manufacturer’s protocol. The animals were subjected to clinical examination and classified as symptomatic (presenting at least one symptom of VL) or asymptomatic (not presenting any clinical signs). The clinical signs evaluated were: alopecia, weight loss, onychogryphosis, skin lesions, lymphadenopathy and splenomegaly. The samples were collected between August and September 2009.
2. Samples Exfoliative epithelial cells were collected from the right and left conjunctiva of each animal using sterile cotton swabs that had been manufactured for bacteriological isolation. The cotton tips were broken off and only the cotton parts were transferred to sterile tubes and stored at –20 °C until use. Peripheral blood (B) was collected from each dog (2.7 mL) in tubes containing EDTA and stored at –20 °C.
37
3. DNA extraction DNA purification from CS was carried out as described by Strauss-Ayali et al. (2004), with minor modifications. Each cotton tip received 300 µL of lysis buffer (50 mMol.L–1 of Tris, 50 mMol.L–1 of NaCL and 10 mMol/l of EDTA; at pH 8.0) containing proteinase K (250 µg.mL–1) and Triton X‑100 (1%). After the incubation (2 hours at 56 °C) the solution was eluted from the cotton, transferred into phase-lock gel tubes (PLG-H; Eppendorf, Hamburg, Germany) and was mixed with 500 µL of 75% Tris-saturated phenol (Sigma-Aldrich, St. Louis, USA), 25% chloroform-isoamyl alcohol. The organic phase was separated from the aqueous phase by centrifugation at 12,000 g for 5 minutes, and the organic material was transferred to a new phase-lock gel tube. The extraction was repeated with 500 µL of 50% phenol, 50% chloroform-isoamyl alcohol and once with 100% chloroformisoamyl alcohol. DNA precipitation was performed using a single volume of isopropanol-sodium acetate, followed by washing with 75% ethanol. The DNA pellet was suspended in 30 µL of Tris-EDTA buffer (10 mMol.L–1 of Tris and 1 mMol/l of EDTA; at pH 8.0). After extraction, DNA preparations from the right and left conjunctivas of the same animal were mixed and kept at –20 °C until needed.
4. PCR The samples were analyzed by means of internal transcribed spacer-1 nested PCR (ITS-1 nPCR). A positive control consisting of genomic DNA from L. (L.) infantum (strain MHOM/1973/ BH46) was used at 1.0 ng.µL–1. A negative control without DNA was included in all tests. This PCR protocol was adapted from Schönian et al. (2003). Primers targeting internal transcribed spacer-1 (ITS‑1) between the genes coding for SSU rRNA and 5.8S rRNA were used. For the first amplification, 10.0 µL of DNA solution was added to 40.0 µL of PCR mix containing 15 pmol of the primers 5´- CTGGATCATTTTCCGATG-3´ and 5´‑ TGATACCACTTATCGCACTT-3´ and 0.2 mM of deoxynucleoside triphosphate, 2 mM of MgCl2, 5 mM of KCl, 75 mM of Tris-HCl (pH 9.0), 2.0 mM of (NH4)SO4, and 1.4 U of Taq DNA polymerase (Ludwig Biotec, Porto Alegre, Brazil). The cycling conditions were 94 °C for 5 minutes followed by 30 cycles of 94 °C for 30 seconds, 53 °C for 30 seconds and extension at 72 °C for 30 seconds, followed by a final extension at 72 °C for 5 minutes. The amplification products were viewed on 2% agarose gel stained with ethidium bromide. The PCR product size was between 300 and 350 bp. For the second amplification, 10.0 µL of a 1:40 dilution of the first PCR product was added to 15 µL of PCR mix under the same conditions as the first amplification but with the following primers (15 pmol each): 5´‑CATTTTCCGATGATTACACC-3´ and 5´-CGTTCTTCAACGAAATAGG-3´. Positive samples yielded a PCR product of between 280 and 330 bp.
5. Serological tests The tests were performed one year after vaccination, independently by three different laboratories. Laboratories 1 and 2
38
Leite, R.S. et al.
Rev. Bras. Parasitol. Vet.
Results
(Lab 1 and Lab 2) were private laboratories. Laboratory 3 (Lab 3) was the National Reference Laboratory for Human and Canine Visceral Leishmaniasis Diagnosis of the Ezequiel Dias Foundation (Funed). The three laboratories used the same diagnostic kits, produced by the Oswaldo Cruz Foundation (Fiocruz) and validated by Funed. Two serological tests were used: enzymelinked immunosorbent assay (ELISA – EIE - Canine Visceral Leishmaniasis produced by Bio-manguinhos/Fiocruz, Brazil) and the immunofluorescence antibody test (IFAT – IFI – Canine Visceral Leishmaniasis produced by Bio-manguinhos/Fiocruz, Brazil). In cases of divergence between the two techniques, the IFAT was considered to be confirmatory. For ELISA, samples that showed optical density greater than or equal to the cutoff were considered to be reactive. Nonreactive samples presented optical density lower than the cut-off. Indeterminate samples had optical density between the cutoff and the cutoff value multiplied by 1.2. In the IFAT test, samples that showed fluorescence at serum dilution of 1:40 were considered reactive. Non-reactive samples did not present fluorescence. Indeterminate samples presented little fluorescence in the first dilution (1:40), but it was not possible to affirm that the reading was not reactive. The consolidated serologic result was considered positive when ELISA and IFAT were simultaneously reagents or ELISA was non reagent and IFAT showed fluorescence at sera dilution of 1:80. The results were considered indeterminate when ELISA was non reagent and IFAT showed fluorescence at sera dilution of 1:40 or ELISA was reagent and IFAT was non reagent.
The serological screening performed by Lab 1 showed 15 reactive dogs, and 4 dogs were classified as indeterminate. Only three reactive dogs (1, 3 and 4) and one indeterminate dog (8) were symptomatic (Tables 1 and 2). Because of the high positivity found in this assay, reactive and indeterminate animals diagnosed by Lab 1 were subjected to a new serological test by Lab 2. Lab 2 found only three reactive dogs, and two animals were indeterminate. Because of the low agreement between the results from Lab 1 and Lab 2, all the reactive and indeterminate animals as determined according to Lab 1 were again reanalyzed by Lab 3 (the National Reference Laboratory). Lab 3 confirmed that there were 7 reactive dogs, and 3 dogs were classified as indeterminate. The dogs that were confirmed as reactive in the serological diagnosis from Lab 3 were put down. The autopsies on the animals that were put down showed morphological changes relating to visceral leishmaniasis, in organs and tissues, except for dog 5 (Table 1). Molecular diagnosis by means of PCR using the CS procedure was performed on all 42 animals and was able to detect Leishmania DNA in 17 dogs (Tables 1 and 2). Comparing the PCR results with those obtained from serological assays by Lab 1, PCR was positive for 10 reactive and one indeterminate case, but was negative for 5 reactive and 3 indeterminate cases. In addition, PCR was positive for 5 non-reactive cases (dogs 17, 18, 21, 24 and 26). The reactive cases according to Lab 1 that were PCR-negative (dogs 13,14,15,25 and 29)
Table 1. Comparison of serological and molecular tests on dogs that were put down. Diagnosis Dog Sex Breed
Serological Lab 2 ELISA IFAT C
Autopsy report
Clinical
Clinical signals
R
R
R
NR
NR
NR
R
R
R
+
R
R
R
I
NR
NR
R
R
R
+
R
R
R
R
R
R
R
R
R
+
Enlarged spleen, interstitial nephritis
R
R
R
NR
NR
NR
R
R
R
+
Enlarged spleen, interstitial nephritis
1
M
GS
S
Recurrent dermatitis; Wound characteristics of vasculitis in syrup.
2
M
LA
A
-
3
F
MB
S
4
F
MB
S
Changes (bilateral) lymph nodes of the thoracic lymphatic chain; Presence of a hemorrhagic lymph node. Bilateral eye discharge; irritation lip; bald patches around the lips; dermatitis sacral.
Lab 1 ELISA IFAT
C
Lab 3 ELISA IFAT
PCR C
Enlarged spleen, interstitial nephritis Enlarged spleen, interstitial nephritis
No change in the target organs (liver, spleen, kidney) Enlarged spleen, 6 M MB A R R R NR NR NR I R R + interstitial nephritis Enlarged spleen, 7 M MB A R R R R R R R R R + interstitial nephritis M = Male, F = Female, S = Symptomatic, A = Asymptomatic, R = reactive, I = Indeterminate, NR = Non-reactive, C = consolidated result, + = Positive, - = Negative. To IFAT test, value > 1/40 was reactive. For breed: GS = German Shepherd; LA = Labrador; MB = Mallinois Belgian Shepherd. 5
F
GS
A
-
R
R
R
NR
NR
NR
R
R
R
+
v. 20, n. 1, jan.-mar. 2011
The use of conjunctival swab samples for PCR screening for visceral leishmaniasis in vaccinated dogs
39
Table 2. Comparison of serological and molecular tests on dogs that were not put down. Dog 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42
Sex M F M M M M F F M F F F M M M M M F F M M F F M M M M M M M M F M M M
Breed GS GS GS GS MB GS GS GS GS MB GS GS GS LB GS GS GS MB GS GS GS GS MB GS LB GS GS GS SP LB MB LB GS GS MO
Clinical S* A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A
ELISA I R R NR NR R R NR NR NR NR NR NR NR R I NR R NR NR I R I NR NR NR NR NR NR NR NR NR NR NR NR
Lab 1 IFAT I R R NP NP R R NP NP NP NP NP NP NP R I NP R NP NP I R I NP NP NP NP NP NP NP NP NP NP NP NP
C I R R NR NR R R NR NR NR NR NR NR NR R I NR R NR NR I R I NR NR NR NR NR NR NR NR NR NR NR NR
Diagnosis Serological Lab 2 ELISA IFAT NR NP R R NR NP NP NP NP NP NR NP NR NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NR NP NR NP NP NP NR NP NP NP NP NP NR NP NR NP NR NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP NP
C NR R NR NP NP NR NR NP NP NP NP NP NP NP NR NR NP NR NP NP NR NR NR NR NP NP NP NP NP NP NP NP NP NP NP
ELISA NR R R NP NP NR NR NP NP NP NP NP NP NP NR NR NP I NP NP NR NR NR NP NP NP NP NP NP NP NP NP NP NP NP
Lab 3 IFAT I NR NR NP NP NR NR NP NP NP NP NP NP NP NR NR NP NR NP NP NR NR NR NP NP NP NP NP NP NP NP NP NP NP NP
PCR C I I I NP NP NR NR NP NP NP NP NP NP NP NR NR NP NR NP NP NR NR NR NP NP NP NP NP NP NP NP NP NP NP NP
+ + + + + + + + + + -
M = Male, F = Female, S = Symptomatic, A = Asymptomatic, R = reactive, NR = Non-reactive, I = Indeterminate, C = consolidated result, + = Positive, - = Negative, NP = Not performed, * = clinical signs: skin lesions, ear infections, alopecia on the chin and eschar sciatic. To IFAT test, value > 1/40 was reactive. For breed: GS = German Shepherd; LA = Labrador; MB = Mallinois Belgian Shepherd, SP = Springer, MO = Mongrel.
tested negative in the serological assays by Lab 2 and Lab 3, and may have been false positive cases. The same occurred with the three indeterminate cases from Lab 1 that were PCR-negative (dogs 23, 28 and 30). According to Lab 2, PCR confirmed all 3 reactive cases (dogs 3, 7 and 9) and was positive for the two indeterminate cases (dogs 2 and 4). In relation to the results obtained by Lab 3, PCR confirmed all the reactive cases (dogs 1, 2, 3, 4, 5, 6 and 7) and tested positive for the three indeterminate cases (dogs 8, 9 and 10). The PCR assay confirmed all the cases that were simultaneously reactive in the serological tests by two laboratories (dogs 1, 2, 3, 4, 5, 6, 7 and 9).
Discussion PCR assays have greatly improved the sensitivity and the specificity of diagnosing Leishmania infection in dogs. However, to make this technique achievable, the sampling methods need to be noninvasive, easy and painless. CS presented all these characteristics, together with high sensitivity. Using CS to diagnose symptomatic dogs through PCR, Strauss-Ayali et al. (2004) observed sensitivity of 92%; Ferreira et al. (2008) found 91.7% and Pilatti et al. (2009) obtained between 73.9 and 95.6%, depending on the PCR method used. Using asymptomatic infected animals, Leite et al.
40
Leite, R.S. et al.
(2010) obtained sensitivity of between 83.3 and 90% using CS, according to the PCR protocol used. In the present study, the CS sampling method was used to screen a group of police dogs that include seronegative and seropositive animals. The PCR diagnosis using CS samples was positive for 17 dogs, and the positivity rate was higher than that of the serological test performed by Lab 1, which detected 15 reactive animals. PCR was positive for 5 seronegative dogs, which were all asymptomatic, thus demonstrating the higher sensitivity of this technique and its potential for identifying seronegative asymptomatic infected animals. Asymptomatic animals may account for a high percentage (up to 85%) of infected dogs in areas of endemicity (DANTAS-TORRES et al., 2006), and they serve as reservoirs for vector transmission (MICHALSKY et al., 2007). In this study, asymptomatic animals represented 70.6% (12/17 dogs) of the positive PCR dogs. The 5 reactive and the 3 indeterminate cases obtained by Lab 1 that were PCR-negative were not confirmed by the serological tests of Lab 2 and Lab 3. In addition, all the reactive and indeterminate cases obtained by Lab 3 (the National Reference Laboratory) tested positive in the PCR diagnosis, thus indicating the high specificity of the PCR assay. According to some studies, Leishmune® vaccinated dogs might test positive in conventional serological assays (SILVA et al., 2001; BORJA-CABRERA et al., 2002; OLIVEIRA MENDES et al., 2003), thus rendering these tests useless for surveillance or control programs involving vaccinated animals. The antigen in the ELISA assay that these studies used was the fucose-mannose ligand (FML) antigen, i.e. the same antigen as used in the Leishmune® vaccine formulation. However, a recent study demonstrated that by using the total promastigote lysate of L. major and L. braziliensis, which are the antigens of the official ELISA test recommended by the Brazilian Ministry of Health, only 1.3% of vaccinated dogs tested positive (PALATNIK-DE-SOUSA et al., 2009). Our results are in agreement with this study, since 15 of the 42 vaccinated animals tested positive in the assay performed by Lab 1 and 10 of them had the Leishmania infection confirmed by PCR. Five dogs could still be classified as false positive but, even so, they were not reactive in the serological assays performed by Lab 2 and Lab 3. Although the three laboratories used the same official diagnostic kits to perform the serological assays, significant differences in the results were seen among them. For this reason, it was decided that only the cases confirmed by Lab 3 (the National Reference Laboratory) should be put down. These results highlight the need of molecular methods as complementary tools for accurately diagnosing canine visceral leishmaniasis, especially in Brazil, where infected dogs are put down. Another unexpected result was the high occurrence of serologically and molecularly positive animals, among which some were symptomatic, in this group of vaccinated dogs. Restriction fragment length polymorphism (RFLP) performed on the ITS-1 nPCR products showed that all 17 PCR-positive dogs were infected with L. (L.) infantum (data not shown). This result disregards a case of L. (Viannia) braziliensis infection (in dog 5), in which no morphological changes relating to VL were seen in the autopsy. This animal was probably infected but
Rev. Bras. Parasitol. Vet.
completely asymptomatic, since it was PCR-positive and reactive in the serological tests by laboratories 1 and 3. This was the first report on the use of CS for screening for VL by means of PCR in a group of vaccinated dogs. As a whole, our results showed that CS is a sensitive and practical method for sample collection, thus allowing reliable diagnostic tests using PCR. The CS procedure could be especially useful as a confirmatory diagnostic method for asymptomatic vaccinated dogs that test positive in serological assays.
Acknowledgements This investigation was supported by Fundação de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG) (CBBAPQ-00399-08), Pan-American Health Organization (PAHO) (SGP0911) and Centro de Desenvolvimento da Tecnologia Nuclear/ Comissão Nacional de Energia Nuclear (CDTN/CNEN). We gratefully thank the Fourth Company of Military Police/Command of Specialized Police of Belo Horizonte, State of Minas Gerais.
References ASSIS, J. et al. Estudo comparativo dos métodos diagnósticos para Leishmaniose Visceral em cães oriundos de Ilha Solteira, SP. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 1, p. 17-25, 2010. BARBOSA DE DEUS, R. et al. Leishmania major-like antigen for specific and sensitive serodiagnosis of human and canine visceral leishmaniasis. Clinical and Diagnostic Laboratory Immunology, v. 9, n. 6, p. 1361‑1366, 2002. BORJA-CABRERA, G. P. et al. Long lasting protection against canine Kala-azar using the FML-QuilA saponin vaccine in an endemic area of Brazil (São Gonçalo do Amaranto, RN). Vaccine, v. 20, n. 27-28, p. 3277-3284, 2002. DANTAS-TORRES, F. Canine leishmaniosis in South America. Parasites and Vectors, v. 2, Supl. 1, p. 1-8, 2009. DANTAS-TORRES, F. et al. Seroepidemiological survey on canine leishmaniasis among dogs from an urban area of Brazil. Veterinary Parasitology, v. 140, n. 1-2, p. 54-60, 2006. FERREIRA, S. A. et al. Evaluation of the conjunctival swab for canine visceral leishmaniasis diagnosis by PCR-hybridization in Minas Gerais State, Brazil. Veterinary Parasitology, v. 152, n. 3-4, p. 257-263, 2008. LAISON, R.; SHAW, J. J. Ecology and epidemiology: New World. In: PETERS, W.; KILLICK-KENDRICK, R. (Ed.). The leishmaniasis in biology and medicine. vol 1. Biology and Epidemiology. London: Academic Press Inc., 1987. p. 291-363. LEITE, R. S. et al. PCR diagnosis of visceral leishmaniasis in asymptomatic dogs using conjunctival swab sample. Veterinary Parasitology, v. 170, n. 3-4, p. 201-206, 2010. LEONTIDES, L. S. et al. A cross-sectional study of Leishmania spp. Infection in clinically healthy dogs with polymerase chain reaction and serology in Greece. Veterinary Parasitology, v. 109, n. 1-2, p. 19-27, 2002. MAIA, C.; CAMPINO, L. Methods for diagnosis of canine leishmaniasis and immune response to infection. Veterinary Parasitology, v. 158, n. 4, p. 274-287, 2008.
v. 20, n. 1, jan.-mar. 2011
The use of conjunctival swab samples for PCR screening for visceral leishmaniasis in vaccinated dogs
MICHALSKY, E. M. et al. Infectivity of seropositive dogs, showing different clinical forms of leishmaniasis, to Lutzomyia longipalpis phlebotomine sand flies. Veterinary Parasitology, v. 147, n. 1-2, p. 67-76, 2007. OLIVEIRA MENDES, C. et al. IgG1/IgG2 antibody dichotomy in sera of vaccinated or naturally infected dogs with visceral leishmaniosis. Vaccine, v. 21, n. 19-20, p. 2589-2597, 2003. PALATNIK-DE-SOUZA, C. B. et al. Decrease of the incidence of human and canine visceral leishmaniasis after dog vaccination with Leishmune® in Brazil endemic areas. Vaccine, v. 27, n. 27, p. 3505‑3512, 2009. PILATTI, M. M. et al. Comparison of PCR methods for diagnosis of canine visceral leishmaniasis in conjunctival swab samples. Research in Veterinary Science, v. 87, n. 2, p. 255-257, 2009. QUEIROZ, N. M. G. P. et al. Diagnóstico da Leishmaniose Visceral Canina pelas técnicas de imunoistoquímica e PCR em tecidos cutâneos em associação com a RIFI e ELISA-teste. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 1, p. 34-40, 2010.
41
SCHÖNIAN, G. et al. PCR diagnosis and characterization of Leishmania in local and imported clinical samples. Diagnostic Microbiology and Infectious Disease, v. 47, n. 1, p. 349-358, 2003. SILVA, E. S. et al. Diagnosis of canine leishmaniasis in the endemic area of Belo Horizonte, Minas Gerais, Brazil by parasite, antibody and DNA detection assays. Veterinary Research Communications, v. 30, n. 6, p. 637-643, 2006. SILVA, V. O. et al. A phase III trial of efficacy of the FML-vaccine against canine kala-azar in an endemic area of Brazil (São Gonçalo do Amaranto, RN). Vaccine v. 19, n. 9-10, p. 1082-1092, 2001. SOLANO-GALLEGO, L. et al. Directions for the diagnosis, clinical staging, treatment and prevention of canine leishmaniosis. Veterinary Parasitology, v. 165, n. 1-2, p. 1-18, 2009. STRAUSS-AYALI, D. et al. Polymerase chain reaction using noninvasively obtained samples, for the detection of Leishmania infantum DNA in dogs. The Journal of Infectious Diseases, v. 189, n. 9, p. 1729-1733, 2004. TESH, R. B. Control of zoonotic visceral leishmaniasis: is it time to change strategies? American Journal of Tropical Medicine and Hygiene, v. 52, n. 3, p. 287-292, 1995.
Review Full Article Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 42-48, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
A novel A2 allele found in Leishmania (Leishmania) infantum chagasi Novo alelo do gene A2 descrito em Leishmania (Leishmania) infantum chagasi Trícia Maria Ferreira de Sousa Oliveira1; Elton José Rosas de Vasconcelos2; Andréa Cristina Higa Nakaghi3; Tânia Paula Aquino Defina2; Márcia Mariza Gomes Jusi3; Cristiane Divan Baldani4; Ângela Kaysel Cruz2; Rosangela Zacarias Machado3* Departamento de Zootecnia, Faculdade de Zootecnia e Engenharia de Alimentos, Universidade de São Paulo – USP
1
Laboratório de Parasitologia Molecular, Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo – USP
2
Laboratório de Imunoparasitologia, Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinária, Universidade Estadual Paulista – UNESP
3
Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro – UFRRJ
4
Received September 24, 2010 Accepted November 5, 2010
Abstract Visceral leishmaniasis (VL) is a widely spread zoonotic disease. In Brazil the disease is caused by Leishmania (Leishmania) infantum chagasi. Peridomestic sandflies acquire the etiological agent by feeding on blood of infected reservoir animals, such as dogs or wildlife. The disease is endemic in Brazil and epidemic foci have been reported in densely populated cities all over the country. Many clinical features of Leishmania infection are related to the host-parasite relationship, and many candidate virulence factors in parasites that cause VL have been studied such as A2 genes. The A2 gene was first isolated in 1994 and then in 2005 three new alleles were described in Leishmania (Leishmania) infantum. In the present study we amplified by polymerase chain reaction (PCR) and sequenced the A2 gene from the genome of a clonal population of L. (L.) infantum chagasi VL parasites. The L. (L.) infantum chagasi A2 gene was amplified, cloned, and sequenced in. The amplified fragment showed approximately 90% similarity with another A2 allele amplified in Leishmania (Leishmania) donovani and in L. (L.) infantum described in literature. However, nucleotide translation shows differences in protein amino acid sequence, which may be essential to determine the variability of A2 genes in the species of the L. (L.) donovani complex and represents an additional tool to help understanding the role this gene family may have in establishing virulence and immunity in visceral leishmaniasis. This knowledge is important for the development of more accurate diagnostic tests and effective tools for disease control.
Keywords: Leishmania (Leishmania) infantum chagasi, A2 gene, allele, sequencing.
Resumo A leishmaniose visceral (LV) é uma zoonose amplamente disseminada, causada no Brasil pela Leishmania (Leishmania) infantum chagasi. Flebotomíneos vetores adquirem o agente etiológico, alimentando-se do sangue de animais contaminados, como cachorros ou animais selvagens. A doença é endêmica no Brasil, e focos de epidemia são relatados em cidades densamente povoadas por todo o país. Muitas manifestações clínicas relacionadas à infecção por Leishmania estão ligadas à relação parasitohospedeiro, e vários possíveis fatores de virulência dos parasitas, que causam a LV, são alvos de estudo, tais como os genes A2. O gene A2 foi isolado pela primeira vez em 1994 e, em seguida, em 2005, três novos alelos foram descritos em Leishmania (Leishmania) infantum. No presente estudo, um fragmento do gene A2 de uma população clonal de L. (L.) infantum chagasi foi amplificado por PCR e sua sequência de nucleotídeos determinada. O fragmento mostrou 90% de similaridade com alelos do gene A2 de Leishmania (Leishmania) donovani e de L. (L.) infantum, descritos na literatura. Entretanto, a tradução da sequência de nucleotídeos mostra diferenças na sequência de aminoácidos da proteína, que podem ser essenciais em determinar a variabilidade do gene A2 em espécies do complexo L. (L.) donovani e representa uma ferramenta adicional na compreenssão do papel dessa família de genes na virulência e imunidade da leishmaniose visceral. O conhecimento dessa variação é importante para o desenvolvimento de testes diagnósticos mais precisos e ferramentas mais eficazes no controle da doença.
Palavras-chave: Leishmania (Leishmania) infantum chagasi, gene A2, alelo, sequenciamento. *Corresponding author: Rosangela Zacarias Machado Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista – UNESP, Via de Acesso Prof. Dr. Paulo Donato Castellane, s/n, CEP 14884-900, Jaboticabal - SP, Brazil; e-mail: zacarias@fcav.unesp.br
www.cbpv.com.br/rbpv
v. 20, n. 1, jan.-mar. 2011
A novel A2 allele found in Leishmania (Leishmania) infantum chagasi 43
Introduction Visceral leishmaniasis (VL) is widespread in tropical and subtropical areas of Latin America, Europe, Africa and Asia. In the New World, the disease is caused by L. (L.) infantum chagasi being the sandfly Lutzomyia longipalpis its main vector (MELO et al., 2009). Peridomestic sandflies acquire the etiological agent L. (L.) infantum chagasi – which some authors consider to be the same species as L. (L.) infantum (MAURÍCIO et al., 1999) –, by feeding on blood of infected reservoir animals such as dogs or wildlife. Infected sandflies represent great danger to surrounding human populations because transmission to non-infected hosts can cause severe disease that may be fatal if not promptly treated (TESH, 1995). In Brazil, canine visceral leishmaniasis (CVL) has become a serious public health problem due to the growing number of urban cases and new foci (SILVA et al., 2001; GONTIJO; MELO, 2004; NASCIMENTO et al., 2008). From the epidemiological standing point, CVL is more important than human disease due to its higher prevalence and greater number of parasites in the skin, which can favors vector infection (TRAVI et al., 2001; VERÇOSA et al., 2008). Clinical signs in CVL depend on the immune response, which is directly associated to the host’s genetic factors. Humoral and cellular immune response are involved, and severity and clinical manifestations depends on a balance between these two systems, parasite tropism and virulence (CIARAMELLA et al., 1997; HONORE et al., 1998; GARIN et al., 2001). Among candidate virulence factors in parasites that cause VL are the A2 genes (ZHANG; MATLASHEWSKI, 1997, 2001). A2 genes consist of a family of genes that are abundantly transcribed and translated during the amastigote phase in leishmanias from the Donovani complex whereas their messenger RNA and protein are not present in the promastigote phase (CHAREST; MATLASHEWSKI, 1994; GHEDIN et al., 1997; ZHANG; MATLASHEWSKI, 2001; FARAHMAND et al., 2008). The A2 genes of L. (L.) donovani are composed predominantly of a sequence encoding 10 amino acids that may be repeated 40 to 90 times depending on each specific gene (CHAREST; MATLASHEWSKI, 1994; GHOSH; ZHANG; MATLASHEWSKI, 2001). A2 genes share similarities with the S antigen expressed by Plasmodium falciparum (CHAREST; MATLASHEWSKI, 1994), and a possible role for the structure/functionality of A2 genes in the cutaneous or visceral tropism of Leishmania parasites in L. major and L. (L.) infantum has been studied and suggested (GHEDIN et al., 1997; ZHANG et al., 2003; GARIN et al., 2005). Species that cause Old and New World VL, L. (L.) donovani, L. (L.) infantum, and L. (L.) infantum chagasi, and New World cutaneous leishmaniasis (CL), L. mexicana and L. amazonensis, have A2 genes in their chromosomes (GHEDIN et al., 1997). In L. major A2 is considered a pseudogene, and the introduction of L. (L.) donovani A2 gene in this species allowed its survival in visceral organs of mice (ZHANG et al., 2003). The gene was isolated and expressed for the first time in L. (L.) donovani (CHAREST; MATLASHEWSKI, 1994, ZHANG et al., 1996). In 2005, three new alleles were described in L. (L.) infantum (GARIN et al., 2005). There is evidence showing that A2 are stress response
proteins, important to L. (L.) donovani survival in visceral organs (McCALL; MATLASHEWSKI, 2010). Sera from humans and dogs naturally infected with L. (L.) infantum chagasi reacted in a serological assay using A2 recombinant proteins (GHEDIN et al., 1997; CARVALHO et al., 2002). The present study describes an A2 allele found in a L. (L.) infantum chagasi strain, isolated from a dog with VL treated in the Veterinary Hospital of Universidade Estadual Paulista in the city of Jaboticabal, São Paulo, Southeastern Brazil. We amplified, cloned, and sequenced a 743 bp fragment. The amplified fragment showed approximately 90% similarity with another A2 allele amplified in L. (L.) donovani (CHAREST; MATLASHEWSKI, 1994) and L. (L.) infantum (GARIN et al., 2005).
Material and Methods 1. L. (L.) infantum chagasi strain A strain of L. (L.) infantum chagasi was isolated from a dog’s bone marrow sample from the town of Olympia, São Paulo. The animal was examined at the Veterinary Hospital of FCAV-UNESP, Jaboticabal, São Paulo, with clinical symptoms of CVL and the strain obtained was used to isolate the A2 gene. The parasites were maintained in RPMI-1640 medium (Sigma-Aldrich, St. Louis, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco, Canyon City, USA) at 25 °C and strain characterization was made by polymerase chain reaction (PCR) and restriction fragment length polymorfism (PCR-RFLP) technique (CORTES et al., 2004; ANDRADE et al., 2006).
2. DNA extraction L. (L.) infantum chagasi genomic DNA extraction was adapted from a proteinase K extraction previously described (CLER et al., 2006). Briefly, promastigotes from axenic culture were harvested and then resuspended in 350 µL of TE buffer (Tris 10 mM; EDTA 1 mM, pH 8.0) and 20 µL of SDS 10%. Ten µL of proteinase K (10 µg.µL–1) were subsequently added, and microtubes were incubated for 36 hours at 37 °C. After incubation, DNA was extracted with a standard procedure (phenol/chloroform/isoamilic alcohol) (25:24:1) and DNA precipitation was done using NaCl/ ethanol procedure (SAMBROOK; FRITSCH; MANIATIS, 2001). The extracted DNA was dissolved in 20 µL of sterile water.
3. PCR Amplification of L. (L.) infantum chagasi DNA (50 ng) matrix was done using L2/R3 primers(5’T TG G C A ATG C G A G C G TC A C A G TC / 5 ’ CAACGCGTACGATAATGCCACA) that correspond to the 5’ end position 16301 and 16603 of the reverse complementary strand of the AC010851 sequence, respectively (GARIN et al., 2005). In addition to DNA, PCR was performed in a reaction mixture of 25 μL containing 2.5 μL PCR buffer 10× (200 mM
44
Oliveira, T.M.F.S. et al.
Tris-HCl, pH 8.4, 500 mM KCl), 3 mM MgCl2, 200 µM each dNTP (dTTP, dATP, dGTP, dCTP, Eppendorf ), 0.5 µM of each primer (Invitrogen, Carlsbad, USA) and 1 U recombinant Taq polymerase (Invitrogen, Carlsbad, USA). L2/R3-PCR conditions consisted of denaturation for 3 minutes at 94 °C, followed by 35 amplification cycles at 94 °C for 1 minute, 1 minute at 58 °C, 1 minute at 72 °C, then one cycle at 72 °C for 5 minutes. A total of 5 µL of PCR product was electrophoresed in 1% agarose gel in the presence of ethidium bromide, and visualized under UV light. A 100 bp ladder (Invitrogen, Carlsbad, USA) was used as MW marker.
4. DNA libraries and sequencing L2/R3-PCR products were purified with GeneClean II (QbioGene, 1001-400, Carlsbad, USA). The insertion of PCR products into pGEM-T Easy Vector Systems (Promega, Madison, USA), transformation of Escherichia coli DH10B competent cells, and cloning were performed using a PCR Cloning Kit (Promega, Madison, USA) as described by the manufacturer. One hundred and ninety-two clones were obtained and two A2-containing clones identified by sequencing. The plasmid DNA was extracted by alkaline lysis (SAMBROOK; FRITSCH; MANIATIS, 2001) and sequenced by the Sanger method with M13 forward and M13 reverse (Promega, Madison, USA) primers set using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied Biosystems, Courtaboeuf, France) on a ABI PRISM 3100 DNA Analyzer (Applied Biosystems, Courtaboeuf, France).
5. Sequence analysis Sequences obtained were then analyzed by Phred (EWING et al., 1998) and cross-match (www.phrap.org) algorithms to perform base calling and trimming (Q ≥ 20) and to mask cloning vector bases, respectively. After this filtering process the sequences were submitted to BlastN and BlastX (ALTSCHUL et al., 1990) analysis against non-redundant (nr) NCBI database and the L. (L.) infantum v3.0a database (ftp://ftp.sanger.ac.uk/pub4/ pathogens/L_infantum/ DATASETS/). The L. (L.) infantum chagasi A2 nucleotide sequence was translated by dna2pep algorithm (http://www.cbs.dtu.dk/services/VirtualRibosome/) and we took the same translation frame that was observed on BlastX best hits. Global multiple alignments for DNA and protein sequences of the identified L. (L.) infantum chagasi A2 gene, three A2 alleles from L. (L.) infantum (GARIN et al., 2005) and a L. (L.) donovani A2 gene (CHAREST; MATLASHEWSKI, 1994) were performed using ClustalW algorithm (THOMPSON; HIGGINS, 1994) and edited by BoxShade (http://www.ch.embnet.org/software/ BOX_form.html). The identity percentages among sequences on global multiple alignments were measured by the alistat algorithm included in the HMMER package (DURBIN et al., 1998).
6. GeneBank accession numbers The accession number for the A2 gene isolated in L. (L.) infantum chagasi described in this study is [GenBank:GQ290460]; the
Rev. Bras. Parasitol. Vet.
accession numbers for L.(L.)infantum A2 alleles II, III, and IV are [GenBank:AY255807, GenBank: AY255808, and GenBank: AY255809], respectively (GARIN et al., 2005), and the accession number for L. (L.) donovani is [GenBank:S69693] (CHAREST; MATLASHEWSKI, 1994).
Results and Discussion Direct sequencing and analyses of L2R3 PCR products from crude genomic DNA of L. (L.) infantum chagasi could not be performed. These PCR products resolved in a pattern of multiple bands (Figure 1), and thus A2 sequence was obtained from clone libraries as described in Methods. An identical A2-gene sequence of 743 nucleotides was isolated in two clones from the genomic library of L. (L.) infantum chagasi. BlastN analysis of this new sequence and other four different VL A2 alleles, against all annotated CDSs from L. (L.) infantum genome version 3.0a, showed gene LinJ22_V3.0670 as the best hit for all five query sequences. Our sequence showed 95% similarity with this gene; alleles isolated from L. (L.) infantum showed 97% (Type II), 91% (Type III), and 92% (Type IV) similarity; and L. (L.) donovani A2 allele showed 87% similarity (Table 1). However, considering only the coding region L. (L.) infantum chagasi has the same stop codon TAA present in L. (L.) infantum (Type II, III, and IV) (Figure 2), the sequence translated to an amino acid sequence has 342bp and is 98,9% identical to L. (L.) infantum (Type II) (Figure 3). Since the first description of A2 gene, the existence of at least five closely related genes (A2 series) has been investigated (CHAREST; MATLASHEWSKI, 1994; ZHANG; MATLASHEWSKI, 2001). Zhang et al. (1996) described A2 as a multigene family, which expresses different sizes of 10-amino acid repeats. Three different A2-gene alleles in a genetically pure parasite clonal lineage (L. infantum MHOM/FR/92/LEM 2385 clone-1) were subsequently isolated, providing additional evidence of the existence of multiple A2 genes (GARIN et al., 2005) and a different A2 sequence is here described in L. (L.) infantum chagasi. Allele types I, II, and III described in the pure clonal lineage
Figure 1. PCR electrophoresis patterns. Electrophoretic pattern of PCR products obtained from L. (L.) infantum chagasi genomic DNA. Each slot corresponds to a single sample amplified using the same PCR mix. The framed area corresponds to the expected sizes for the A2 gene.
v. 20, n. 1, jan.-mar. 2011
A novel A2 allele found in Leishmania (Leishmania) infantum chagasi
45
Figure 2. Multiple alignment of A2 nucleotide sequences from L. (L.) infantum (allele types II, III, and IV), L. (L.) donovani and L. (L.) infantum chagasi.
46
Oliveira, T.M.F.S. et al.
Rev. Bras. Parasitol. Vet.
Table 1. BlastN analysis of different A2 alleles. BlastN analysis of five different VL A2 alleles against all annotated CDSs in L. (L.) infantum genome version 3.0a. The LinJ22_V3.0670 gene was the best hit for all five query sequences. Queries Li_II, Li_III, and Li_IV are L. (L.) infantum A2 alleles described by Garin et al. (2005), and query L. donovani is the A2 gene from L. (L.) donovani described by Charest and Matlashewski (1994), and query L. chagasi is the V allele herein described. Query id Li_II Li_III Li_IV L_donovani L_chagasi
Subject id LinJ22_V3.0670 LinJ22_V3.0670 LinJ22_V3.0670 LinJ22_V3.0670 LinJ22_V3.0670
% identity 97 91 92 87 95
Alignment length 202 274 340 574 194
q. start
q. end
s. start
s. end
e-value
Bit
29 29 29 29 54
230 302 368 590 247
1 1 1 1 1
202 253 319 556 193
2,00E-97 1,00E-109 1,00E-141 1,00E-165 3,00E-85
353 392 500 579 313
(q.start: start of query sequence; q. end: end of query sequence; s. start: start of sequence; s.end: end of sequence).
Figure 3. Multiple alignments of A2 amino acid sequences (translated nucleotide sequences by dna2pep algorithm.) from L. (L.) infantum (allele types II, III, and IV), L. (L.) donovani and L. (L.) infantum chagasi.
L. (L.) infantum MHOM/FR/92/LEM 2385 clone-1 differ only in the number and arrangements of the repeated motifs at the 3’ end variable region of the gene (GARIN et al., 2005) and in all cases, only strains from the L. (L.) donovani complex causing VL in Old World were sequenced. In the present study, we used a clinical isolate of a L. (L.) infantum chagasi infected dog to identify and sequence an A2 gene copy, corroborating previous findings that the A2 family of VL species is a multiple gene family. The present study evidenced a divergent A2 gene in the L. (L.) infantum chagasi strain when compared to the L. (L.) infantum and L. (L.) donovani A2 alleles first identified. A comparative analysis
of the A2 gene isolated from L. (L.) donovani, three A2-gene alleles isolated from L. (L.) infantum (Type II, III, and IV), and the A2 gene isolated from L. (L.) infantum chagasi herein described showed that the 5’ ORF is highly preserved (Figure 2) in both nucleotide and amino acid sequences obtained by nucleotide sequence translated by dna2pep algorithm. At the protein level, the sequences aligned had an identity average of 93%, but this analysis showed few differences among the sequences that can cause great changes in protein function. Close to 170 and 200 positions of the alignment ruler (Figure 3) there is an alanine residue in L. (L.) infantum chagasi sequence instead of a serine residue present in the other A2 sequences analyzed.
v. 20, n. 1, jan.-mar. 2011
A novel A2 allele found in Leishmania (Leishmania) infantum chagasi 47
The L. (L.) donovani’s A2 protein shows immunogenicity. Significant protection against L. (L.) donovani and L. amazonensis infections associated with both humoral and cellular immune responses has been seen when using A2 as a recombinant protein or a DNA vaccine in BALB/c mice, and more recently in dogs (GHOSH; ZHANG; MATLASHEWSKI, 2001; COELHO et al., 2003; ZANIN et al., 2007; RESENDE et al., 2008; FERNANDES et al., 2008). A recombinant L. (L.) tarentolae expressing the L. (L.) donovani-specific A2 protein used as a live vaccine against L. (L.) infantum infection in BALB/c mice has provided evidence of favorable immune response and significant levels of protective immunity against L. (L.) infantum infections (MIZBANI et al., 2009). This study evidences that there are differences in nucleotide sequences, and possible in amino acid of A2 protein sequences, which can be essential to establish specific pathogenic pathways in Leishmania species. In two positions of the C-terminal region on the A2 protein multiple alignment, L. (L.) infantum chagasi has an alanine residue while the other A2 sequences have a serine residue. This change might cause changes in three-dimensional structure of the protein and consequently in its function. Phenotypic effects of the alteration are more drastic, according to the differences in the chemical nature of side chains of amino acid residues, the substitution of an amino acid hydrophilic by one amino acid with hydrophobic side chain of residue, as here described, can cause great changes in functional activity of the protein (NELSON; COX, 2006). Since multiple A2 sequences of varying lengths were observed in different VL isolates by our group and by others, our results may help to determine the variability of A2 genes in the species of the L. (L.) donovani complex and represents an additional tool to help us understand the role this family of genes may have in establishing virulence in visceral leishmaniasis. The exact function of A2 protein in Leishmania is still unknown (AZIZI et al., 2009). Gene silencing of A2 in L. (L.) donovani dramatically decreased its viability and pathogenicity in mammalian macrophages (ZHANG; MATLASHEWSKI, 1997). Overexpression of A2 in L. major resulted in visceralization of infection (ZHANG; MATLASHEWSKI, 1997; GARIN et al. 2005) and A2 gene was the only virulence factor that was not found in non-pathogenic parasites to human L.(L.) tarentolae (AZIZI et al., 2009), further supporting A2 gene importance in the pathogenesis of leishmaniasis. In Brazil, visceral leishmaniasis is caused by L. (L.) infantum chagasi, and the evidenced differences among A2 genes in species are important to elucidate the role of this gene in VL, which is essential for the development of more accurate diagnostic tests and effective tools for disease control. Studies with southern blotting and protein expression are being conducted with A2 gene isolated in L. (L.) infantum chagasi to confirm and better understand the changes found.
References ALTSCHUL, S. F. et al. Basic local alignment search tool. Journal of Molecular Biology, v. 215, n. 3, p. 403-410, 1990. ANDRADE, H. M. et al. Use of PCR-RFLP to identify Leishmania species in naturally infected dogs. Veterinary Parasitology, v. 140, n. 3-4, p. 231-238, 2006. AZIZI, H. et al. Searching for virulence factors in the non-pathogenic parasite to humans Leishmania tarentolae. Parasitology, v. 136, n. 7, p. 723-735, 2009. CARVALHO, F. A. et al. Diagnosis of American visceral leishmaniasis in humans and dogs using the recombinant Leishmania donovani A2 antigen. Diagnostic Microbiology and Infectious Disease, v. 43, n. 4, p. 289-295, 2002. CHAREST, H.; MATLASHEWSKI, G. Developmental gene expression in Leishmania donovani: differential cloning and analysis of an amastigotestage-specific gene. Molecular and Cellular Biology, v. 14, n. 5, p. 2975-2984, 1994. CIARAMELLA, P. et al. A retrospective clinical study of canine leishmaniasis in 150 dogs naturally infected by Leishmania infantum. Veterinary Record, v. 141, n. 21, p. 539-543, 1997. CLER, L. et al. A comparison of five methods for extracting DNA from paucicellular clinical samples. Molecular and Cellular Probes, v. 20, n. 3-4, p. 191-196, 2006. COELHO, E. A. F. et al. Immune Responses Induced by the Leishmania (Leishmania) donovani A2 Antigen, but Not by the LACK Antigen, Are Protective against Experimental Leishmania (Leishmania) amazonensis. Infection and Immunity, v. 71, n. 7, p. 3988-3994, 2003. CORTES, S. et al. PCR as a rapid and sensitive tool in the diagnosis of human and canine leishmaniasis using Leishmania donovani s.l. – specific kinetoplastid primers. Transactions of the Royal Society of Tropical Medicine and Hygiene, v. 98, n. 1, p. 12-17, 2004. DURBIN, R. et al. Biological sequence analysis: probabilistic models of proteins and nucleic acids. Cambridge University Press, 1998. EWING, B. et al. Base-calling of automated sequencer traces using phred.I. Accuracy assessment. Genome Research, v. 8, n. 3, p. 175‑185, 1998. FARAHMAND, M. et al. Expression of A2 proteins in amastigotes of Leishmania infantum produced from canine isolates collected in the district of Meshkinshahr, in north-western Iran. Annals of Tropical Medicine and Parasitology, v. 102, n. 1, p. 81-84, 2008. FERNANDES, A. P. et al. Protective immunity against challenge with Leishmania (Leishmania) chagasi in beagle dogs vaccinated with recombinant A2 protein. Vaccine, v. 26, n. 46, p. 5888-5895, 2008. GARIN, Y. J. et al. Virulence of Leishmania infantum is expressed as a clonal and dominant phenotype in experimental infections. Infection and Immunity, v. 69, n. 12, p. 7365-7373, 2001.
Acknowledgements
GARIN, Y. J. F. et al. A2 gene of Old World cutaneous Leishmania is a single highly conserved functional gene. BMC Infectious Diseases, v. 5, n. 18, p. 1-7, 2005.
We thank Dr. Vanete Thomaz Soccol, from Universidade Federal do Paraná, Curitiba, Brazil, for her help with the classification of L. (L.)infantum chagasi. This study was supported by FAPESP grant No. 2005/52678-4.
GHEDIN, E. et al. Antibody response against a Leishmania donovani amastigote-stage-specific protein in patients with visceral leishmaniasis. Clinical and Diagnostic Laboratory Immunology, v. 4, n. 5, p. 530‑535, 1997.
48
Oliveira, T.M.F.S. et al.
GHOSH, A.; ZHANG, W. W.; MATLASHEWSKI, G. Immunization with A2 protein results in a mixed Th1/Th2 and a humoral response which protects mice against Leishmania donovani infections. Vaccine, v. 20, n. 1-2, p. 59-66, 2001. GONTIJO, C. M. F.; MELO, M. N. Leishmaniose visceral no Brasil: quadro atual, desafios e perspectivas. Revista Brasileira de Epidemiologia, v. 7, n. 3, p. 338-349, 2004. HONORE, S. et al. Influence of the host and parasite strain in a mouse model of visceral Leishmania infantum infection. FEMS Immunology and Medical Microbiology, v. 21, n. 3, p. 231-239, 1998. MAURÍCIO, I. L. et al. Genomic diversity in the Leishmania complex. Parasitology, v. 119, n. 3, p. 237-246, 1999. McCALL, L. I.; MATLASHEWSKI, G. Localization and induction of the A2 virulence factor in Leishmania: evidence that A2 is a stress response protein. Molecular Microbiology, v. 77, n. 2, p. 518-530, 2010. MELO, F. A. et al. Hepatic extracellular matrix alterations in dogs naturally infected with Leishmania (Leishmania) chagasi. International Journal of Experimental Pathology, v. 90, n. 5, p. 538-548, 2009. MIZBANI, A. et al. Recombinant Leishmania tarentolae expressing the A2 virulence gene as a novel candidate vaccine against visceral leishmaniasis. Vaccine, v. 28, n. 1, p. 53-62, 2009. NASCIMENTO, E. L. T. et al. Forum: geographic spread and urbanization of visceral leishmaniasis in Brazil. Postscript: new challenges in the epidemiology of Leishmania chagasi infection. Cadernos de Saúde Pública, v. 24, n. 12, p. 2964-2967, 2008. NELSON, D. L.; COX, M. M. Lehninger-principles of biochemistry. 4th ed. Sarvier, 2006. 1202 p. RESENDE, D. M. et al. Epitope mapping and protective immunity elicited by adenovirus expressing the Leishmania amastigote specific A2 antigen: correlation with IFN-γ and cytolytic activity by CD8+ T cells. Vaccine, v. 26, n. 35, p. 4585-4593, 2008. SAMBROOK, J.; FRITSCH, E. F.; MANIATIS, T. Molecular cloning: a laboratory annual. 3rd ed. New York: Cold Spring Harbor Laboratory, Cold Spring Harbor, 2001.
Rev. Bras. Parasitol. Vet.
SILVA, E. S. et al. Visceral leishmaniasis in the metropolitan region of Belo Horizonte, state of Minas Gerais, Brazil. Memórias do Instituto Oswaldo Cruz, v. 96, n. 3, p. 285-291, 2001. TESH, R. B. Control of zoonotic visceral leishmaniasis. Is it time to change strategies? American Journal of Tropical Medicine and Hygiene, v. 52, n. 3, p. 287-292, 1995. THOMPSON, J. D.; HIGGINS, D. G. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research,v. 22, n. 22, p. 4673-4680, 1994. TRAVI, B. L. et al. Canine visceral leishmaniasis in Colombia: relationship between clinical and parasitologic status and infectivity for sand flies. American Journal of Tropical Medicine and Hygiene, v. 64, n. 3, p. 119-124, 2001. VERÇOSA, B. L. A. et al. Transmission potential, skin inflammatory response and parasitism of symptomatic and asymptomatic dogs with visceral leishmaniasis. BMC Veterinary Research, v. 4, n. 45, 2008. ZANIN, F. H. C. et al. Evaluation of immune responses and protection induced by A2 and nucleoside hydrolase (NH) DNA vaccines against Leishmania chagasi and Leishmania amazonensis experimental infections. Microbes and Infection, v. 9, n. 9, p. 1070-1077, 2007. ZHANG, W. W.; MATLASHEWSKI, G. Loss of virulence in Leishmania donovani deficient in an amastigote-specific protein, A2. Proceedings of the National Academy of Sciences of the United States of America, v. 94, n. 16, p. 8807-8811, 1997. ZHANG, W. W.; MATLASHEWSKI, G. Characterization of the A2-A2rel gene cluster in Leishmania donovani: involvement of A2 in visceralization during infection. Molecular Microbiology, v. 39, n. 4, p. 935-948, 2001. ZHANG, W. W. et al. Identification and overexpression of the A2 amastigote-specific protein in Leishmania donovani. Molecular and Biochemical Parasitology, v. 78, n. 1-2, p. 79-90, 1996. ZHANG, W. W. et al. Comparison of the A2 gene locus in Leishmania donovani and Leishmania major and its control over cutaneous infection. The Journal of Biological Chemistry, v. 278, n. 37, p. 35508-35515, 2003.
Full Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 49-53, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Prevalence of liver condemnation due to bovine fasciolosis in Southern Espírito Santo: temporal distribution and economic losses Prevalência de condenação de fígados bovinos por fasciolose no Sul do Espírito Santo: distribuição temporal e perdas econômicas Cíntia das Chagas Bernardo1; Milena Batista Carneiro1; Barbara Rauta de Avelar1; Dirlei Molinari Donatele2; Isabella Vilhena Freire Martins2*; Maria Julia Salim Pereira3 Laboratório de Parasitologia, Centro de Ciências Agrárias, Universidade Federal do Espírito Santo – UFES
1
Departamento de Medicina Veterinária, Centro de Ciências Agrárias, Universidade Federal do Espírito Santo – UFES
2
Departamento de Parasitologia Animal, Universidade Federal Rural do Rio de Janeiro – UFRRJ
3
Received October 14, 2010 Accepted February 1, 2011
Abstract The present study was conducted to evaluate the economic losses and temporal distribution of the prevalence of liver condemnation due to bovine fasciolosis. The abattoir in Atílio Vivácqua, in the South of the State of Espírito Santo, which is under state inspection by the veterinary service of the Livestock and Forest Protection Institute of Espírito Santo, was used as the data source. The prevalence of liver condemnation due to fasciolosis over the period 2006-2009 was calculated. The χ2 test, simple linear regression analysis and χ2 for trend were used, with a significance level of p ≤ 0.05. Over the period analyzed, 110,956 cattle were slaughtered and the prevalence of liver condemnation due to Fasciola hepatica was 15.24% in 2006, 23.93% in 2007, 28.57% in 2008 and 28.24% in 2009. The historical trend of liver condemnation is an increasing trend, thus indicating that this parasitism has become established in the herd as a problem in this region, with prevalence similar to that of traditionally endemic regions. Condemnations occurred throughout the year, with the highest prevalence in April and May and with significant differences between the dry and wet seasons. The economic losses from liver condemnation can be considered high. Keywords: Fasciola hepatica, abattoir, prevalence.
Resumo O presente trabalho foi realizado com o objetivo de avaliar as perdas econômicas e a distribuição temporal da prevalência de condenação de fígados bovinos devido a fasciolose. O matadouro frigorífico de Atílio Vivácqua, no sul do Estado do Espírito Santo, com inspeção estadual, realizada por médico veterinário vinculado ao Instituto de Defesa Agropecuária e Florestal do Espírito Santo, foi utilizado como fonte de dados. A prevalência de condenação de fígados por fasciolose no período de 2006-2009 foi calculada. O teste do χ2, a análise de regressão linear simples e o χ2 para tendência foram utilizados, considerando-se o nível de significância p ≤ 0,05. No período analisado foram abatidos 110.956 bovinos, observando-se prevalências de condenação de fígados por Fasciola hepatica, de 15,24% em 2006, 23,93% em 2007, 28,57% em 2008 e de 28,24% em 2009. A tendência histórica da condenação de fígados é crescente, indicando que este parasitismo estabeleceu-se no rebanho como um problema na região com prevalência similar a de regiões tradicionalmente endêmicas. As condenações ocorreram o ano todo com maior prevalência nos meses de abril e maio e com diferenças significativas entre os períodos seco e chuvoso. As perdas econômicas devido a condenação de fígados podem ser consideradas altas. Palavras-chave: Fasciola hepatica, matadouro frigorífico, prevalência.
*Corresponding author: Isabella Vilhena Freire Martins Departamento de Medicina Veterinária, Centro de Ciências Agrárias, Universidade Federal do Espírito Santo – UFES, Alto Universitário, CP 16, CEP 29500-000, Centro, Alegre - ES, Brazil; e-mail: ivfmartins@yahoo.com.br
www.cbpv.com.br/rbpv
50
Bernardo, C.C. et al.
Introduction Hepatic distomatosis or fasciolosis is a parasitic disease affecting herbivorous mammals and humans that is caused by the trematode Fasciola hepatica (BOWMAN, 2010). Currently, fasciolosis is recognized as an emerging zoonosis. The records of natural infection in humans are mostly correlated with regions that are endemic for animal fasciolosis, in rural communities in which humans share the water source with their animals, or areas in which raw vegetables cultivated in endemic regions are consumed (ROBINSON; DALTON, 2009). Fasciolosis causes serious losses to cattle and sheep rearing through reducing herd productivity in terms of inhibition of growth, smaller weight gains and diminished milk production. In addition, it leads of condemnation of the animals’ livers and increases the production costs because of the control measures required (OAKLEY et al., 1979; DAEMON; SERRA-FREIRE, 1992). The distribution of fasciolosis is linked to climatic factors, management of reservoir animals, topographic factors and presence in the environment of molluscs of the genus Lymnaea, which are needed for the parasite’s life cycle to be completed (MATTOS et al., 1997). In Brazil, parasitism due to F. hepatica was traditionally recorded in the Southern and Southeastern regions (RESENDE, 1979 apud AMATO et al., 1986). However, its occurrence differs from the coverage of endemic regions, which are extensive in states in the Southern region and present less extensive foci in states in the Southeastern and central-western regions (LIMA et al., 2009). According to Serra-Freire et al. (1995), the State of Espírito Santo was not known to be an endemic area for fasciolosis. However, according to reports from Fraga (2008), fasciolosis started to appear in the South of the State of Espírito Santo from 1995 onwards, in the Soturno area of the municipality of Cachoeiro de Itapemirim, in cattle slaughtered in the municipal abattoir, but without inspection. The first cases recorded by the Livestock and Forest Protection Institute of Espírito Santo only appeared in 2005. However, the temporal distribution of bovine fasciolosis is still unknown. Nor is there any estimate of the economic losses caused by liver condemnation in this region. Thus, knowledge of the temporal distribution of fasciolosis in the South of the State of Espírito Santo becomes important not only for better understanding of this disease but also for planning control actions, given that time series analysis on events within populations may generate information for indicating risks, monitoring their spread and preventing their occurrence, thereby providing clues towards explaining the causes and support for implementing preventive measures and assessing the impact of such interventions (MEDRONHO et al., 2002). Data from abattoirs have been used to study the prevalence of liver condemnation by some authors (FRAGA, 2008; BAPTISTA, 2008), but no time series analysis was conducted in any of these studies. Such analysis is used within epidemiology to detect the temporal trends of health events (THRUSFIELD, 2004). In addition, abattoirs have a sentinel role, and data thus generated may serve to enable herd tracking within the scope of disease control programs (BAPTISTA et al., 2004).
Rev. Bras. Parasitol. Vet.
The present study was carried out with the aim of assessing the economic losses and temporal distribution of the prevalence of condemnation of bovine livers due to fasciolosis in the South of the State of Espírito Santo, using an abattoir in that region as the data source.
Material and Methods The abattoir in the municipality of Atílio Vivácqua, which is located in the Southern region of Espírito Santo, was used as the source of data. This region is composed of 22 municipalities and has a high-altitude tropical climate, with large variations in altitude and relief consisting of plains and mountainous zones cut by numerous watercourses that rise in this region because of its high rainfall. Coffee cultivation and dairy farming are the predominant types of agricultural activity, and the cattle population has been estimated to be 452,807 animals, with milk productivity of 1037 liters/cow/year (IBGE, 2008). The figures for liver condemnation and cattle slaughtered at this abattoir over the period from January 2006 to December 2009 were analyzed. According to information contained in animal transit records, the animals slaughtered came from municipalities in the South of the State of Espírito Santo. The abattoir is under state inspection by the veterinary service of the Livestock and Forest Protection Institute of Espírito Santo and condemnation due to fasciolosis is implemented in accordance with article 148 of the state regulations for prior industrial and sanitary inspection and supervision for products of animal origin (IDAF, 2010). The χ2 test for trend was used to assess associations between prevalence and the study year, and simple linear regression was used to obtain the straight line for the prevalence trend. To calculate the prevalence, the number of livers condemned was divided by the total number of heads of cattle slaughtered, and the result was multiplied by 100. The months of the year were divided into two periods, i.e. the dry season (April to September) and the wet season (October to March), and the χ2 test was applied to investigate associations between prevalence and season. The monthly oscillation was analyzed graphically, as plots of the mean monthly prevalence over the periods evaluated. To estimate the economic losses, the weight of the liver was taken to be 4.7 kg and value per kilogram was taken to be R$ 5.00. To convert the price into dollars, the exchange rate was taken to be US$ 1.00 = R$ 1.70.
Results and Discussion Between 2006 and 2009, 110,956 heads of cattle were slaughtered at the abattoir in the municipality of Atílio Vivácqua, in the South of the State of Espírito Santo. Out of this total, 27,625 livers were condemned due to hepatic fasciolosis, thus representing prevalence of 24.89%. Similar results have been reported from the Southern region of Brazil, which has traditionally presented areas endemic for fasciolosis (DUTRA et al., 2010). In Table 1, it can be seen that the numbers of liver condemned were significantly different between the years. It needs to be emphasized that because all the animals came from the South of the State of
v. 20, n. 1, jan.-mar. 2011
Prevalence of liver condemnation due to bovine fasciolosis in Southern Espírito Santo
Espírito Santo, and because of the confirmed presence of Lymnaea columella (ALMEIDA, 2010) and infected animals, through feces examination at farms in several municipalities (ALVES, 2010), the disease has become established in this region. In Figure 1, it can be seen that the straight-line trend of liver condemnations due to fasciolosis is an increasing trend. In Rio Grande do Sul, where the problem is more long-standing, Marques and Scroferneker (2003) reported a small reduction in condemnations of bovine livers due to infection by F. hepatica. Moreover, in an analysis on data relating to slaughtering of sheep in abattoirs under supervision by the federal inspection service in Rio Grande do Sul, between 2000 and 2005, Cunha et al. (2007) observed that the percentage condemnation of livers decreased. Since fasciolosis in sheep is more serious than in cattle, and because Rio Grande do Sul has been known as an endemic area for a long time, it can be expected that producers’ knowledge about this parasitism will be greater. This would consequently lead to more effective control in this region, thus explaining the decrease in liver condemnation observed. Although studies on historical trends among health events are important for assessing the impact of control measures (MEDRONHO et al., 2002), there are no reports in the literature on this type of study for analyzing fasciolosis control. The results from the present study indicate that control measures in Espírito Santo either are not being implemented or are not being implemented efficiently. This situation may have arisen because livestock farmers may not have perceived the economic losses caused by fasciolosis, given that the payments that they receive are for the carcass weight (BAPTISTA, 2008), independent of organ condemnation. On the
51
other hand, subclinical infections may not have been noticed by livestock farmers, which may have led them not to consider that fasciolosis is a problem. According to Baptista (2008), in 2007, the prevalence of liver condemnation due to fasciolosis in 12 abattoirs under state inspection in Espírito Santo was 4.88%, out of a total of 134,356 animals slaughtered, with 80% of the condemnations occurring at the abattoir in Atílio Vivácqua. Thus, it was found that parasitism had become established in the herd as a problem in this region, with prevalence similar to that of endemic regions. In the present study, liver condemnations occurred throughout the year, but with highest prevalence in April and May, i.e. autumn in Brazil (Figure 2), and significantly greater prevalence during the dry season (April to September) than in the wet season (Table 2). During the dry season of the year, animals have access to vegetation in areas that were flooded during the wet season. Amato et al. (1986) reported that the population density of Lymnaea columella in the valley of the Paraíba river decreased from September to February and increased from March to September. They also observed that the greatest numbers of metacercariae occurred on pasture land between June and October and between March and April. In Itajubá, State of Minas Gerais, Coelho and Lima (2003) observed that the floods reduced the population of L. columella, since the intense water flow removed most of the molluscs from the area. Also in Itajubá, Faria et al.(2005) observed that elimination of F. hepatica eggs by cattle occurred throughout the year, but increased during the months of least precipitation (dry season), with a peak in September. They raised the hypothesis that the population of L. columella would increase during these months, thereby increasing the quantity of metacercariae ingested by the
Table 1. Prevalence of liver condemnation due to Fasciola hepatica in cattle slaughtered at the abattoir in the municipality of Atílio Vivácqua, Espírito Santo, between 2006 and 2009. Year
Total number of heads of cattle slaughtered
2006 2007 2008 2009
20425 26882 29779 33870
Prevalence of condemned livers N % 3114 15.24 6434 23.93 8509 28.57 9568 28.24
OR*
1.00 1.75 2.22 2.19
χ2 for trend = 1152.85; p ≤ 0.05; *Odds Ratio
Figure 2. Mean monthly prevalence of condemnation of cattle liver due to hepatic fasciolosis at the abattoir in the municipality of Atílio Vivácqua, Southern region of the State of Espírito Santo, between 2006 and 2009.
Table 2. Prevalence of condemnation of cattle liver due to hepatic fasciolosis at the abattoir in the municipality of Atílio Vivácqua, Southern region of the State of Espírito Santo, between 2006 and 2009. Season
Figure 1. Trend for condemnation of cattle liver due to hepatic fasciolosis at the abattoir in the municipality of Atílio Vivácqua, Southern region of the State of Espírito Santo, between 2006 and 2009.
Number of cattle Liver condemnation slaughtered N % Dry (April to September) 43920 15265 25.79 Wet (October to March) 39411 12360 23.87 2 χ = 108.01; p < 0.01
52
Bernardo, C.C. et al.
cattle. This may also have occurred in the region of the present study. Although no studies on the dynamics of fasciolosis or Lymnaea in Espírito Santo are yet available, the results from the present study are coherent with the biological cycle of the parasite, which has a prepatent period in cattle of 10 to 11 weeks. After definitively infecting the host, the immature forms reach the liver within six days and migrate to it over a six to seven-week period, attaining the adult stage after two months (FREITAS, 1977). Thus, two weeks after the time of infected was sufficient time for the animals to present lesions in the hepatic parenchyma, thus resulting in condemnation of this organ. Between 2006 and 2009, the economic loss caused by condemnation of livers parasitized with F. hepatica that were found at the abattoir in the municipality of Atílio Vivácqua was R$ 649,187.50, which corresponds to 381,875 US dollars. In the year 2009 alone, the losses were approximately 132,000 dollars, and this amount can be considered to be high, given that Echevarria (1995) found that the annual loss due to condemned livers in Rio Grande do Sul reached 140,000 dollars, in a state with a herd that is much larger than that of Espírito Santo. Thus, fasciolosis is currently a severe economic problem for producers in the Southern region of Espírito Santo and possibly for the whole territory of the state, given the possibility of dissemination to herds of cattle, sheep, goats and buffalos in many municipalities through transportation of parasitized animals and through the presence of intermediate hosts in different hydrographic basins in the region.
Conclusion The historical trend of liver condemnation due to fasciolosis found in slaughtered cattle at an abattoir in the South of the State of Espírito Santo was an increasing trend, with significant differences between the dry and wet seasons, thus indicating that this parasitism had become established in the herd as a problem in this region, with prevalence similar to that of traditionally endemic regions, and that the control measures were inefficient. The economic losses caused by liver condemnation could be considered to be high.
Acknowledgements To the veterinarians at IDAF and ABAV for supplying slaughter data and to Capes for financial assistance (Procad project no. 093/2007).
References ALMEIDA, B. R. Malacologia dos gêneros Lymnaea e Biomphalaria na mesorregião sul Espírito-Santense, e avaliação de extratos de Melia azedarach, Azadirachta indica e Cymbopogon winterianus como agentes moluscicidas. 2010. 171 f. Dissertação (Mestrado em Ciências Veterinárias) - Universidade Federal do Espírito Santo. Disponível em: <http://www.dominiopublico.gov.br/download/texto/cp144525.pdf>. Acesso em: 16 jan. 2011.
Rev. Bras. Parasitol. Vet.
ALVES, D. P. Distribuição e fatores associados à infecção por Fasciola hepatica em bovinos em municípios do Sul do Estado do Espírito Santo no período de 2008/2009. 2010. 76 f. Dissertação (Mestrado em Ciências Veterinárias) - Universidade Federal do Espírito Santo. Disponível em: <http://www.dominiopublico.gov.br/download/texto/ cp143849.pdf >. Acesso em: 16 jan. 2011. AMATO, S. B. et al. Epidemiology of Fasciola hepatica infection in the Paraíba river valley, São Paulo, Brasil. Veterinary Parasitology, v. 22, n. 3-4, p. 275-284, 1986. BAPTISTA, A. T. Quantificações das condenações em vísceras de bovinos em 2007 nos matadouros-frigoríficos do estado do Espírito Santo registrados no serviço de inspeção estadual. 2008. 14 f. Trabalho de conclusão de curso (Especialização em Higiene e Inspeção de Produtos de Origem Animal) - Universidade Castelo Branco. Disponível em: <http://www.qualittas.com.br/documentos/Quantificacoes%20das%20 Condenacoes%20-%20Anderson%20Teixeira%20Baptista.pdf> Acesso em: 13 ago. 2010. BAPTISTA, F. et al. Prevalência da tuberculose em bovinos abatidos em Minas Gerais. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 56, n. 5, p. 577-580, 2004. BOWMAN, D. D. Georgis – Parasitologia Veterinária. 9. ed. Rio de Janeiro: Elsevier, 2010. 432 p. COELHO, L. H. L.; LIMA, W. S. Population dynamics of Lymnaea columella and its natural infection by Fasciola hepatica in the State of Minas Gerais, Brazil. Journal of Helminthology, v. 77, n. 1, p. 7-10, 2003. CUNHA, F. O. V.; MARQUES, S. M. T.; MATTOS, T. M. J. Prevalence of slaughter and liver condemnation due to Fasciola hepatica among sheep in the state of Rio Grande do Sul, Brazil 2000 and 2005. Parasitologia Latinoamericana, v. 62, n. 3-4, p. 188-191, 2007. DAEMON, E.; SERRA-FREIRE, N. M. Estudos da relação custobenefício em parasitologia: uma proposta de análise. Parasitologia al Día, v. 16, p. 59-62, 1992. DUTRA, L. H. et al. Mapping risk of bovine fasciolosis in the south of Brazil using Geographic Information Systems. Veterinary Parasitology, v. 169, n. 1-2, p. 76–81, 2010. ECHEVARRIA, F. A. M. Mesa redonda sobre fasciolose bovina. Hora Veterinária, n. 1, p. 27-31, 1995. Ed. Extra. FARIA, R. N.; CURY, M. C.; LIMA, W. S. Prevalence and dynamics of natural infection with Fasciola hepatica (Linnaeus, 1758) in Brazilian cattles. Revue Médicine Véterinaire, v. 156, n. 2, p. 85-86, 2005. FRAGA, J. C. L. Incidência da Fasciolose Hepática Bovina no Sul do Espírito Santo. 2008. 29 f. Trabalho de conclusão de curso (Especialização) - Instituto Brasileiro de Pós-Graduação Qualittas, Universidade Castelo Branco, Rio de Janeiro. Disponível em: <http:// www.qualittas.com.br/documentos/Incidencia%20da%20Fasciolose%20 Hepatica%20Bovina%20no%20Sul%20-%20Jose%20Carlos%20 Landeiro%20Fraga.PDF>. Acesso em: 25 jul. 2010. FREITAS, M. G. Helmintologia veterinária. 3. ed. Belo Horizonte: Rabelo & Brasil, 1977. 396 p. INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA IBGE. Produção pecuária Municipal. 2008. Disponível em: <http:// www.ibge.gov.br/home/estatistica/economia/ppm/2008/defaulttabzip. shtm>. Acesso em: 02 fev. 2011.
v. 20, n. 1, jan.-mar. 2011
Prevalence of liver condemnation due to bovine fasciolosis in Southern Espírito Santo
INSTITUTO DE DEFESA AGROPECUÁRIA E FLORESTAL DO ESPÍRITO SANTO. Legislação Estadual nº 4.781, de 14 de junho de 1993: regula a obrigatoriedade da prévia inspeção e fiscalização dos produtos de origem animal no Estado do Espírito Santo. Diário Oficial do Estado, Espírito Santo, 21 jun. 1993. Disponível em: <www.idaf. es.gov.br>. Acesso em: 30 ago. 2010. LIMA, W. S. et al. Occurence of Fasciola hepatica (Linnaeus, 1758) infection in Brazilian cattle of Minas Gerais, Brazil. Revista Brasileira de Parasitologia Veterinária, v. 18, n. 2, p. 27-30, 2009. MARQUES, S. M. T.; SCROFERNEKER, M. L. Fasciola hepatica infection in cattle and buffaloes in the State of Rio Grande do Sul, Brazil. Parasitologia Latino americana, v. 58, n. 3-4, p. 169-172, 2003. MATTOS, M. J. et al. Ocorrência estacional de Lymnaea collumela Say, 1817 (Mollusca, Lymnaeidae) em habitat natural no Rio Grande do Sul. Revista Brasileira de Medicina Veterinária, v. 19, n. 6, p. 248‑250, 1997.
53
MEDRONHO, R. A. et al. Epidemiologia. São Paulo: Atheneu, 2002. 493 p. OAKLEY, G. A.; OWEN, B.; KNAPP, N. H. H. Production effects of subclinical liver fluke infection in growing dairy heifers. Veterinary Record, v. 104, n. 22, p. 503-507, 1979. ROBINSON, M. W.; DALTON, J. P. Zoonotic helminth infections with particular emphasis on fasciolosis and other trematodiases. Philosophical Transactions of the Royal Society B, v. 364, n. 1530, p. 2763-2776, 2009. SERRA-FREIRE, N. M. et al. Reinvestigação sobre a distribuição da Fasciola hepatica no Brasil. Hora Veterinária, v. 1, p. 19-21, 1995. THRUSFIELD, M. Epidemiologia veterinária. 2. ed. São Paulo: Roca, 2004. 556 p.
Review Full Article Article Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 54-60, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Production of recombinant EMA-1 protein and its application for the diagnosis of Theileria equi using an enzyme immunoassay in horses from São Paulo State, Brazil Produção da proteína recombinante EMA-1 e sua aplicação para o diagnóstico baseado no imunoensaio enzimático de Theileria equi em equinos do Estado de São Paulo, Brasil Cristiane Divan Baldani1; Eduardo Hilario2; Andréa Cristina Higa Nakaghi3; Maria Célia Bertolini4; Rosangela Zacarias Machado3* Departamento de Medicina e Cirurgia Veterinária, Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro – UFRRJ
1
Department of Biochemistry, University of California-Riverside, Riverside, California, USA
2
Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista – UNESP
3
Departamento de Bioquímica e Tecnologia Química, Universidade Estadual Paulista – UNESP
4
Receided November 26, 2010 Accepted January 18, 2011
Abstract The erythrocytic-stage surface protein, Equi Merozoite Antigen 1 (EMA-1), is a major candidate for the development of a diagnostic antigen for equine piroplasmosis. In order to establish an effective diagnostic method for practical use, the gene encoding the entire EMA-1 of Theileria equi Jaboticabal strain was cloned and expressed in Escherichia coli as a histidine-tagged protein (His6-EMA1). The expressed EMA-1 reacted with specific antibodies in Western blot and had an apparent molecular mass of 34 kDa which was largely consistent with its theoretical value. The nucleotide sequence of the EMA-1 gene of Jaboticabal strain was comparatively analyzed with other published sequences. The results indicated a high degree of homology with EMA-1 genes of all other strains isolated from various countries. The recombinant purified His6-EMA1 protein was tested in an enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies anti-T. equi in horses. The ELISA clearly differentiated T. equi-infected from Babesia caballi-infected horse sera or normal horse sera. Field serum samples collected from horses in the State of São Paulo, Southeastern Brazil, were examined for the diagnosis of T. equi infection by ELISA. Of 170 samples analyzed, 95.88% (163/170) were positive for T. equi infection. These results suggest that the His6-EMA1 protein expressed in E. coli could be a reliable immunodiagnostic antigen for ELISA test and that T. equi infection is a serious concern in the State of São Paulo, Brazil. Keywords: Theileria equi, diagnosis, EMA-1, ELISA.
Resumo A proteína de superfície eritrocitária, Antígeno 1 do Merozoíta de Theileria equi (EMA-1), é um potencial candidato para o desenvolvimento de antígenos de valor diagnóstico para a piroplasmose equina. Com o objetivo de estabelecer um método de diagnóstico efetivo e prático, o gene EMA-1 da amostra Jaboticabal - SP de T. equi foi clonado e expresso em Escherichia coli contendo uma cauda de poli-histidina (His6-EMA1). O EMA-1 expresso reagiu com anticorpos específicos no Western blot e apresentou peso molecular aparente de 34 kDa, sendo altamente consistente com seu valor teórico. A sequência nucleotídica do gene EMA-1 da amostra Jaboticabal foi analisado comparativamente com outras sequências públicas, e os resultados indicam elevado grau de homologia com amostras de diversos países. A proteína recombinante purificada His6-EMA1 foi testada no ensaio imunoenzimático (ELISA) para a detecção de anticorpos anti-T. equi em equinos. O teste de ELISA diferenciou-se claramente entre soros de equinos infectados por T. equi, soros de animais infectados por Babesia caballi e soro normal de equino. Amostras de soros coletadas de equinos
*Corresponding author: Rosangela Zacarias Machado Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista – UNESP, Via de Acesso Prof. Dr. Paulo Donato Castellane, s/n, CEP 14884-900, Jaboticabal - SP, Brazil; e-mail: zacarias@fcav.unesp.br
www.cbpv.com.br/rbpv
v. 20, n. 1, jan.-mar. 2011
Production of recombinant EMA-1 protein and its application for the diagnosis of Theileria equi 55
do Estado de São Paulo, sudeste do Brasil, foram examinadas para o diagnóstico da infecção por T. equi pelo ELISA. Das 170 amostras analisadas, 95,88% (163/170) foram positivas para T. equi. Os resultados sugerem que a proteína His6-EMA1 expressa em E. coli pode ser um antígeno confiável para diagnóstico imunológico pelo teste de ELISA, e que T. equi merece grande atenção no Estado de São Paulo. Palavras-chave: Theileria equi, diagnóstico, EMA-1, ELISA.
Introduction Equine piroplasmosis, also known as biliary fever, is a tickborne protozoal disease caused by two intraerythrocytic parasites, Theileria equi and Babesia caballi. This illness affects members of Equidae family (horses, mules, donkeys and zebras) and may occur in an acute, subacute or chronic form. The disease is generally characterized by fever, anemia, icterus, hepatosplenomegaly, intravascular hemolysis and petechial hemorrhages of mucous surfaces, and hemoglobinuria (SCHEIN, 1988). This disease is widely distributed in tropical and subtropical areas worldwide where it causes significant economic loss to the horse industry (BRÜNING, 1996; DE WAAL, 1992; SCHEIN, 1988). International movement of horses into disease free-areas is allowed only if they have been tested negative for piroplasmosis through serological testing (UETI et al., 2005; BRÜNING, 1996; SCHEIN, 1988; TENTER; FRIEHOFF, 1986). In endemic countries, such as Brazil, the control of equine piroplasmosis is necessary to maintain the international market open to the horse industry. In Brazil, the seroprevalence of T. equi and B. caballi is particularly high and recent studies have shown that it ranges from 75 to 90% (HEIM et al., 2007; BALDANI et al., 2004; XUAN et al., 2001b). Despite the endemicity of equine babesiosis in the Western Hemisphere, the presence of tick vectors Rhipicephalus (Boophilus) microplus and Dermacentor nitens throughout the country points to the importance of equine piroplasmosis control and diagnosis in foreign animals (RIBEIRO et al., 1999; GUIMARÃES et al., 1998). Thus, with the V Military World Games in 2011 and the 2016 Olympic Games, both in the city of Rio de Janeiro, Southeastern Brazil, the number of imported horses from endemic areas will increase and therefore the detection of carrier status in these animals is necessary to prevent disease transmission. Indeed, equine piroplasmosis is the main difficulty for horse transportation to equestrian events or definitive exportation. Since 1969 the complement fixation test (CFT) has been used as the certified assay for the detection of horses infected with T. equi (FRERICHS et al., 1969). However, several limitations of CFT including low sensitivity have been described and a number of different diagnostic methods have been proposed to improve the rate of detection of carrier horses (BRÜNING, 1996; TENTER; FRIEDHOFF, 1986; McGUIRE et al., 1971). The indirect fluorescent antibody test (IFAT) is commonly used for the diagnosis of T. equi infection, but as CFT, is generally limited by the detection range of antibodies and cross-reactivity (BRÜNING, 1996; SCHEIN, 1988). Besides the CFT and IFAT, enzyme-linked immunosorbent assays (ELISA) with T. equi lysate antigen has been used for the detection of antibodies to T. equi (BALDANI et al., 2004; WEILAND et al., 1986). Although
good crude antigenic preparations from infected erythrocytes can be used in sensitive and specific ELISA, the test is hindered by a limited antigen supply (BALDANI et al., 2004). More recently, several ELISA tests have been developed with the use of recombinant antigens, demonstrating that it can be a useful test for the identification of chronically infected T. equi horses (JAFFER et al., 2010; SALIM et al., 2008; HUANG et al., 2003; CUNHA et al., 2002; HIRATA et al., 2002; XUAN et al., 2001a, b; TANAKA et al., 1999). The molecular search for T. equi diagnostic antigens has focused on the identification of immunodominant proteins that are recognized by sera from horses infected with geographically distinct isolates. Equi merozoite antigen 1 (EMA-1) is a major surface protein of T. equi (KAPPMEYER et al., 1993) and is considered an important target for the development of an effective diagnostic reagent (CUNHA et al., 2002; XUAN et al., 2001a; KNOWLES et al., 1992). In the present study, we developed an ELISA method using the recombinant histidine-tagged EMA-1 protein based on a Brazilian T. equi strain and investigated its potential use for the diagnosis of T. equi.
Material and Methods 1. Parasite The T. equi Jaboticabal strain (São Paulo State, Southeastern Brazil) was obtained in 1993 by Machado (BALDANI et al., 2004) from an 8-day-old foal and cryopreserved in liquid nitrogen as blood stability containing 10% dimethyl sulfoxide.
2. Cloning, expression and purification of recombinant EMA-1 antigen Erythrocytes infected by T. equi Jaboticabal strain were submitted to DNA extraction by a commercially available method (Puregene Kit, Gentra Systems Inc., USA). The full-length EMA-1 gene (819 pb) sequence was amplified by PCR from genomic DNA using the primers EMA-1F (5’-GGAATTCATGATTTCCAAATCCTTTG-3’) and EMA‑1R (5’-GGAATTCTTAGTAAAATAGAGTAGAG-3’), which were designed based on the polynucleotide sequence of the protein EMA-1 from T. equi strain Pelotas (GenBank accession number AF255730). The underlined sequences correspond to the EcoRI site. The entire Open Read Frame (ORF) was subcloned into the pMOSBlue vector (Amersham Pharmacia Biotech) and the whole sequence was confirmed by DNA sequencing. The insert was then transferred to the pET28a expression vector (Novagen) using the same restriction sites. The correct plasmid construction
56
Baldani, C.D. et al.
pET28a-EMA1 and the control plasmid pET28a were used to transform Escherichia coli strain BL21 (DE3) competent cells, respectively. The production of the recombinant histidine-tagged protein (His6-EMA1) was first evaluated in a small scale (50 mL) assay using 2YT medium containing 0.2% glucose and 30 μg.mL–1 kanamycin. The production of His6-EMA1 (34.2 kDa) was performed at 250 rev min–1 and both temperature of growth (25 to 37 °C) and concentration of inductor (0.1 to 0.4 mM IPTG) were assayed during induction. The production of the full-length His6-tagged polypeptide (58 amino acid residues, 6.3 kDa) was obtained at 250 rev min–1, 37 °C using 0.1 mM IPTG. Protein expression was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis 12% (SDS-PAGE) and confirmed by Western blot using polyclonal anti-EMA-1 equine antibodies. Large-scale cultures were grown in 5-liter flasks containing 1.0 L of medium using the high expresser His6-EMA1 and polyhistidine tagged cell clones. The cells were cultivated at 30 °C until OD600 = 0.6 and protein production was induced with 0.2 mM IPTG during 4 hours. Cells were harvested by centrifugation, resuspended in 0.1 L of lysis buffer containing 50 mM Tris-HCl, pH 9.0, 500 mM NaCl, 30 mM imidazol, 1 mM phenylmethylsulphonyl fluoride and 1 mM benzamidine and lysed by sonication. Cell debris and nucleic acids were separated by centrifugation at 30,000 × g for 30 minutes and the supernatant was applied in a nickel-affinity column in an Äkta Prime Purification System (Amersham Pharmacia Biotech, Uppsala, Sweden). Recombinant His6-EMA1 and His6tagged polypeptide were eluted in a linear elution gradient of 30-500 mM imidazol and their fractions were analyzed by SDSPAGE. Fractions containing the purified protein were pooled and dialyzed three times against 2 L of sodium bicarbonate-carbonated 0.05 M buffer (pH 9.6) at room temperature.
3. Sera Horse serum samples used for the evaluation of ELISA with His6-EMA1 were as follow: 15 negative sera obtained from foals before they suckled colostrums; 15 serum samples that tested positive for T. equi parasites in blood smears and by IFAT; 3 sera from horses experimentally infected with B. caballi; 170 sera from horses of the Northeast region of the State of São Paulo.
4. Immunization of mice with His6-EMA1 Immunization of mice was performed as previously described by Machado et al. (1993). Ten micrograms of the protein His6EMA1 in Freund’s complete adjuvant was intramuscularly injected into mice BALB/c. The same antigen in Freund’s incomplete adjuvant was injected into mice on day 14 and again on day 28. Sera from immunized mice were collected 10 days after the last immunization and evaluated by dot enzyme-linked immunosorbent assay (dot ELISA).
5. ELISA ELISA was essentially carried out according to the method as previously described (BALDANI et al., 2004). The recombinant antigen His6-EMA1 and negative controls such as His6-tagged
Rev. Bras. Parasitol. Vet.
polypeptide and crude extract from E. coli strain BL21 (DE3) were coated to 96-well microplates (Nunclon Surface; Nunc, Denmark). Protein concentration was adjusted to 5, 10, 20 and 40 µg.mL–1. Optimal dilutions of antigen and positive and negative sera were determined by checkerboard titrations. The immunological activity of each serum was calculated by determining the sample to positive serum ratio (S/P), considering positive and negative sera as reference, using the following equation: (1) S/P values were grouped into ELISA levels (EL), which ranged from 0 (lowest level) to 9 (highest level). The discriminated absorbance value (cut-off) was determined as being two and a half times the mean absorbance value of the negative group, where readings equal to or grater than the cut-off value were considered positive. All tests were performed in duplicates.
6. Western blot Sodium dodecyl sulfate polyacrylamide gel electrophoresis and Western blot analysis were performed as previously described (TOWBIN et al., 1979; LAEMMLI, 1970). Nitrocellulose membranes were assayed with positive T. equi and B. caballi control sera diluted at 1:100.
7. Dot ELISA Dot ELISA was performed as previously described (MONTENEGRO-JAMES et al., 1990). Nitrocellulose membranes (pore size 0.22 µm) were cut into 5.0 mm disks and handled with forceps. Antigen in 10 µL amounts (4 µg of protein) was dotted on the dull side of the disks. Antigen was fixed onto the disks by drying for 30 minutes at 37 °C. Immunized mouse serum samples were diluted at 1:100. The development of blue-purple dots on disks when compared to negative serum and conjugate controls was considered an evidence of positivity.
Results 1. Sequence analysis of EMA-1 gene from T. equi strain Jaboticabal The EMA-1 gene from T. equi strain Jaboticabal-SP was amplified by PCR and subcloned into pET28a expression vector. The full-length sequence was confirmed by DNA sequencing and the ORF encoded a protein of 272 residues of amino acids. Multiple sequence alignment was performed to evaluate the identity of EMA-1 from T. equi (GenBank accession no. DQ250541) with the same protein from different strains. There are more than 20 sequences of EMA-1 from different isolates deposited previously in the GenBank databank. All sequences are highly conserved, however the sequence of the protein EMA-1 from the
v. 20, n. 1, jan.-mar. 2011
Production of recombinant EMA-1 protein and its application for the diagnosis of Theileria equi
T. equi strain Jaboticabal is identical with other three polypeptide sequences previously deposited. Moreover, this protein shows high identity (99.3%) compared with the same protein from T. equi strain Pelotas (Figure 1), differing by two amino acids residues at positions 84 and 200.
2. Protein expression and purification Recombinant EMA-1 was expressed in soluble form (Figure 2) and the single-step purification by immobilized metal-affinity chromatography was sufficient to obtain high amounts of pure protein (15 mg.L–1). The relative molecular mass of the recombinant His6-EMA1 was 34 kDa by SDS-PAGE analysis, largely consistent with its theoretical value (KNOWLES et al., 1997). Western blot analysis shows that His6-EMA1 strongly reacted with sera from T. equi-infected horses but not with sera from uninfected horses (Figure 3). Additionally, no reaction was seen with crude extract from E. coli or the His6-tagged polypeptide. Some extra bands were detected by the horse serum in recombinant lysates and may represent alternative transcription or translation of EMA-1 proteins, aggregation of EMA-1 products or degradation of expressed proteins.
57
3. Immunogenicity of EMA-1 To determine the immunogenicity of the EMA-1 gene expressed in E. coli, BALB/c mice were immunized and the reactivity of the antiserum was analyzed by Dot ELISA. The results demonstrate that anti-T. equi antibody produced in mice strongly reacted with recombinant His6-EMA1.
4. Evaluation of ELISA with His6-EMA1 To evaluate whether the His6-EMA1 expressed in E. coli can be used as a suitable antigen for the diagnosis of T. equi infection, particularly in Brazil, the purified His6-EMA1 was tested in an ELISA using positive and negative reference serum, as well as sera from horses experimentally infected with B. caballi. Checkerboard titrations showed an antigen concentration of 5 μg.mL–1 in carbonate buffer, pH 9.6, as optimum. Serum samples were diluted at 1:100 and alkaline phosphatase conjugated anti-horse IgG (Sigma Chemical Co., USA) used at 1:30.000. The average absorbance of negative sera was 0.105 ± 0.013, resulting in a calculated cut-off value of 0.263 (EL 3 - Table 1). Absorbance values found with anti-B. caballi sera were lower (0.161 ± 0.017)
Figure 1. Multiple sequence alignment of amino acid sequences of EMA-1 proteins. The sequences correspond to the T. equi strain Jaboticabal, Pelotas, Brazil 2, USDA and Florida-JRA with GenBank accession nº. DQ250541, AF255730, AY058899, AB043618, AB015235, respectively. Except for the protein EMA-1 from strain Pelotas that exhibits two amino acid changes into the polypeptide sequence (Thr84Ala and Arg200Gly), the sequence of EMA-1 from strain Jaboticabal is identical to the other strains. This figure was generated using BoxShade 3.21 (http://www.ch.embnet.org/software/BOX_form.html). Regions of amino acid identity are shown in black; non-conservative substitutions are shown in white.
58
Baldani, C.D. et al.
Rev. Bras. Parasitol. Vet.
than the defined cutoff value. The mean absorbance value of the anti-T. equi serum group (1.130 ± 0.152) was approximately 10 times greater than that obtained with non-infected sera, clearly discriminating between mean absorbencies of positive and negative reference sera. Additionally, optical density (OD) readings of E. coli crude extract and His6-tagged polypeptide control wells were lower than the defined cut-off value. The EL was determined as shown in Table 1.
5. Diagnosis of T. equi infection in horses by ELISA with His6-EMA1
Figure 2. SDS-PAGE of protein samples from His6-EMA1 purification. (1), molecular weight markers (kDa) (Low Range, Bio-Rad); (2), crude extract; (3 and 4), supernatant and precipitate after centrifugation, respectively; (5), flow through and (6), His6-EMA1. The protein was fused to His6-tag at the N-terminus. The cells were lysed in 50 mM Tris-HCl, pH 9.0, containing 500 mM NaCl, 30 mM imidazol, 1 mM benzamidine and 1 mM PMSF. The protein was purified by affinity chromatography in 5 mL HiTrap Chelating in an Äkta Prime Purification System (Amersham Pharmacia Biotech). His6-EMA1 was eluted in a linear gradient using 30-500 mM imidazol. The protein was dialyzed against 10 mM Tris-HCl, pH 9.0, containing 10 mM NaCl. Twenty-five micrograms of proteins were loaded in each well and the gel was stained with Coomassie Blue R250. The arrow indicates the full-length fusion protein with 34.2 kDa, based on the theoretical molecular weight.
Figure 3. SDS-PAGE and Western immunoblotting of recombinant His6-EMA1. a) SDS-PAGE 12%. 1) molecular weight markers (kDa) (Bench Mark Ladder, Invitrogen); 2) crude extract from E. coli strain BL21 (DE3) carrying the plasmid pET-28a without EMA1 gene subcloned (control) (20 µg); 3) His6-tagged polypeptide tag (5 µg); and 4) recombinant His6-EMA1 protein (5 µg). b) Western immunoblotting. 5) crude extract of E. coli lysates; 6) His6-tagged polypeptide tag; and 7) His6-EMA1 were detected by the anti-EMA-1 polyclonal horse antibody. Arrows A and B indicates the full-length fusion protein and the polyhistidine tag, respectively.
Serum samples collected from 170 field horses in the Northeast region of the State of São Paulo were tested for detection of IgG antibodies to T. equi by ELISA. The number of sera distributed through EL is shown in Figure 4. The estimated ELISA values demonstrated that 95.88% (163/170) of the horses had EL 3-9, with only 4.12% (7/170) of the serum samples being negative for T. equi infection.
Discussion In the present study, we determined the nucleotide sequence of the EMA-1 gene from T. equi Jaboticabal-SP strain, Brazil and comparatively analyzed with other published sequences available in GenBank. The results indicate that even in strains already isolated in Brazil there are sequence differences that are reflected in the derived amino acid sequence. The analysis between T. equi Jaboticabal strain (GenBank accession no. DQ250541) and Pelotas isolate (GenBank accession no. AF255730) showed 99.3% of identity. Moreover, the analysis of EMA-1 sequences with other strains isolated from various countries reveals differences of as much as 10% (NICOLAIEWSKY et al., 2001). Previous studies have demonstrated antigenic differences between T. equi isolates from various regions (HEUCHERT et al., 1999). Kuttler et al. (1988) obtained higher titers in IFAT test using homologous antigens. Therefore, there is an increasing need to consider differences in parasite characteristics at the molecular level in order to develop more sensitive and specific diagnostic methods. However, Heim et al. (2007) did not find diversity among T. equi isolates obtained from endemic areas of Brazil. The recombinant antigen was expressed as a histidine-tagged protein in E. coli with 35 amino acid residues added at the N-terminus. We investigated the potential use of this protein in ELISA to diagnose T. equi in Brazilian horses. The ELISA proved to be highly specific and sensitive when an OD405 of 0.263 was used as the cutoff titer. The test clearly differentiated between T. equiinfected and B. caballi-infected horse sera and healthy horse sera. These results demonstrate that the recombinant EMA‑1 expressed in E. coli can be a useful diagnostic reagent for the detection of antibodies to T. equi, especially in Brazil, when the antigen is produced based on a Brazilian strain. EMA-1 has been proposed as a suitable subunit vaccine or diagnostic antigen for the detection of antibodies to T. equi in horses (KAPPMEYER et al., 1993; KNOWLES et al., 1991). Several ELISA tests for babesiosis using recombinant equi merozoite antigens 1 and 2 produced in E. coli or
v. 20, n. 1, jan.-mar. 2011
Production of recombinant EMA-1 protein and its application for the diagnosis of Theileria equi
Table 1. S/P values for EL 0-9. EL 0 1 2 3 4 5 6 7 8 9
S/P 0.000-0.131 0.132-0.177 0.178-0.239 0.240-0.323 0.324-0.436 0.437-0.589 0.590-0.795 0.796-1.073 1.074-1.449 ≥ 1.450
Figure 4. Number of sera from horses (n = 170) raised in the Northeast region of the State of São Paulo, Brazil, screened by ELISA using recombinant EMA-1 protein and plotted by ELISA level (EL): 0 (lowest level) to 9 (highest level).
baculovirus insect cell system have been developed (JAFFER et al., 2010; SALIM et al., 2008; HUANG et al., 2003; CUNHA et al., 2002; HIRATA et al., 2002; TANAKA et al., 1999; XUAN et al., 2001a, b). However, to our best knowledge this is the first report of the development of a recombinant EMA-1 expressed by the gene from T. equi Jaboticabal strain. Additionally, the production of EMA-1 in E. coli as in our study offers some advantages as the methodology is simple and addresses issues of antigen supply or contamination of red blood cell components in antigen preparations (MAHONEY; GOODGER, 1981). As known, protein production in E. coli is attractive because high amounts of recombinant protein can be obtained in few hours of induction. Moreover, other advantages include simple protein purification, higher protein yield, improved folding, low proteolysis, simple plasmid construction and economical culture medium. In this study the recombinant polyhistidine tagged antigen EMA-1 was expressed at high level in a soluble form. Single-step purification by affinity chromatography was sufficient to achieve high amounts of pure protein. However, some native E. coli proteins were copurified during chromatography but these proteins do not exhibit nonspecific reactivity with normal horse sera in ELISA.
59
Field serum samples collected from horses in the Northeast region of the State of São Paulo were evaluated for the diagnosis of T. equi infection by using ELISA. Of 170 horses tested, 96.5% were positive and they were all IFAT positive, considering titers equal to or above 1:80, as demonstrated in a previous study (BALDANI et al., 2010). Several studies have shown that the prevalence of equine piroplasmosis in Brazil is of serious concern. Heuchert et al. (1999) tested 752 serum samples from the State of São Paulo by IFAT and CFT and reported prevalence rates of 29.6% and 17.6%, respectively. Serum samples from horses in different regions of Brazil were tested by CTF and the results showed that the prevalence of T. equi infection was 42.48% (KERBER et al., 1999). Xuan et al. (2001b) examined serum samples from horses in the State of São Paulo and Mato Grosso do Sul, central-western Brazil, and found 81% of T. equi infection. Moreover, Baldani et al. (2004) demonstrated that 75% of the horses from São Paulo had antibodies anti-T. equi. More recently, Heim et al. (2007) tested horses from endemic areas in Brazil and reported a seroprevalence of 91% for T. equi. The prevalence of equine piroplasmosis reported here is relatively higher and may be due to differences in the serological tests used, horse breeding operations or intensity of tick infestation. His6-EMA1 strongly reacted with both anti-T. equi antibodies produced in mice and sera from T. equi-infected horses, as seen in Western blot and dot ELISA analysis, which indicated that the addition of 35 amino acid residues in the N-terminus of full-length EMA-1 did not affect the antigenicity of the protein. Moreover, as in ELISA, His6-EMA1 clearly differentiated T. equi-infected from B. caballi infected sera and normal sera. The results of the present study reinforce the fact that EMA-1 is a suitable candidate for the development of a reliable diagnostic test. ELISA with His6-EMA1 of T. equi expressed in E. coli showed a clear difference between negative and positive reference serum. The antigen did not show cross-reaction with B. caballi-infected horse sera and demonstrated to be immunogenic. Moreover, the results indicate that equine babesiosis is widespread and therefore is a serious concern in the State of São Paulo. Further studies should be carried out to investigate the occurrence of equine babesiosis and tick vectors of equine babesiosis in different regions of Brazil using ELISA with recombinant EMA-1 produced from Brazilian strains.
Acknowledgements This study was supported by grants from the Conselho Nacional de Pesquisa e Desenvolvimento (CNPq) and Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP, 03/12793-3 and 04/05223-9).
References BALDANI, C. D. et al. An enzyme-linked immunosorbent assay for the detection of IgG antibodies against Babesia equi in horses. Ciência Rural, v. 34, n. 5, p. 1525-1529, 2004. BALDANI, C. D.; NAKAGHI, A. C. H.; MACHADO, R. Z. Occurence of Theileria equi in horses raised in the Jaboticabal microregion, São Paulo State, Brazil. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 4, p. 228-232, 2010.
60
Baldani, C.D. et al.
BRÜNING, A. Equine piroplasmosis an update on diagnosis, treatment and prevention. British Veterinary Journal, v. 152, n. 2, p. 139-151, 1996. CUNHA, C. W. et al. Conformational dependence and conservation of an immunodominant epitope within the Babesia equi erythrocyte-stage surface protein equi merozoite antigen 1. Clinical and Diagnostic Laboratory Immunology, v. 9, n. 6, p. 1301-1306, 2002. DE WAAL, D. T. Equine piroplasmosis: a review. British Veterinary Journal, v. 148, n. 1, p. 6-14, 1992. FRERICHS, W. M.; HOLBROOK, A. A.; JOHNSON, A. J. Equine piroplasmosis complement fixation titers of horses infected with Babesia caballi. American Journal of Veterinary Research, v. 30, n. 5, p. 697‑702, 1969. GUIMARÃES, A. M.; LIMA, J. D.; RIBEIRO, M. F. B. Sporogony and experimental transmission of Babesia equi by Boophilus microplus. Parasitology Research, v. 84, n. 4, p. 323-327, 1998. HEIM, A. et al. Detection and molecular characterization of Babesia caballi and Theileria equi isolates from endemic areas of Brazil. Parasitology Research, v. 102, n. 1, p. 63-68, 2007. HEUCHERT, C. M. et al. Seroepidemiologic studies on Babesia equi and Babesia caballi infections in Brazil. Veterinary Parasitology, v. 85, n. 1, p. 1-11, 1999. HIRATA, H. et al. Cloning of a truncated Babesia equi gene encoding an 82-kilodalton protein and its potential use in an enzyme-linked immunosorbent assay. Journal of Clinical Microbiology, v. 40, n. 4, p. 1470-1474, 2002. HUANG, X. et al. High-level expression and purification of a truncated merozoite antigen-2 of Babesia equi in Escherichia coli and its potential for immunodiagnosis. Journal of Clinical Microbiology, v. 41, n. 3, p. 1147-1151, 2003. JAFFER, O. et al. A comparative study of serological tests and PCR for the diagnosis of equine piroplasmosis. Parasitology Research, v. 106, n. 3, p. 709-713, 2010. KAPPMEYER, L. S.; PERRYMAN, L. E.; KNOWLES, D. P. A Babesia equi gene encodes a surface protein with homology to Theileria species. Molecular and Biochemical Parasitology, v. 62, n. 1, p. 121-124, 1993. KERBER, C. E.; FERREIRA, F.; PEREIRA, M. C. Control of equine piroplasmosis in Brazil. Onderstepoort Journal of Veterinary Research, v. 66, n. 2, p. 123-127, 1999. KNOWLES, D. P. et al. Antibody to a recombinant merozoite protein epitope identifies horses infected with Babesia equi. Journal of Clinical Microbiology, v. 30, n. 12, p. 3122-3126, 1992. KNOWLES, D. P. et al. Detection of equine antibody to Babesia equi merozoite protein by a monoclonal antibody-based competitive inhibition enzyme-linked immunosorbent assay. Journal of Clinical Microbiology, v. 29, n. 9, p. 2056-2058, 1991. KNOWLES, D. P.; KAPPMEYER, L. S.; PERRYMAN, L. E. Genetic and biochemical analysis of erythrocyte-stage surface antigens belonging to a family of highly conserved proteins of Babesia equi and Theileria species. Molecular and Biochemical Parasitology, v. 90, n. 1, p. 69‑79, 1997. KUTTLER, K. L. et al. Serologic response of Babesia equi-infected horses as measured by complement-fixation and indirect fluorescent antibody tests. Veterinary Parasitology, v. 26, n. 3-4, p. 199-205, 1988.
Rev. Bras. Parasitol. Vet.
LAEMMLI, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, v. 227, p. 680-685, 1970. MACHADO, R. Z. et al. Babesia bigemina: isolation and characterization of merozoite rhoptries. Experimental Parasitology, v. 77, n. 3, p. 315‑325, 1993. MAHONEY, D. F.; GOODGER, B. V. The isolation of Babesia parasites and their products from the blood. In: RISTIC, M.; KREIR, J. P. (Ed.). Babesiosis. New York: Academic Press, 1981. p. 323-332. McGUIRE, T. C.; VAN HOOSIER, G. L.; HENSON, J. B. The complement-fixation reaction in equine infectious anemia: demonstration of inhibition by IgG (T). Journal of Immunology, v. 107, n. 6, p. 1738‑1744, 1971. MONTENEGRO-JAMES, S. et al. Use of the dot enzyme-linked immunosorbent assay with isolated Anaplasma marginale initial bodies for serodiagnosis in cattle. American Journal of Veterinary Research, v. 51, n. 10, p. 1518-1521, 1990. NICOLAIEWSKY, T. B. et al. Detection of Babesia equi (Laveran, 1901) by nested polymerase chain reaction. Veterinary Parasitology, v. 101, n. 1, p. 9-21, 2001. RIBEIRO, M. F. B.; COSTA, J. O.; GUIMARÃES, A. M. Epidemiological aspects of Babesia equi in horses in Minas Gerais, Brazil. Veterinary Research Communications, v. 23, n. 6, p. 385-390, 1999. SALIM, B. O. M. et al. Diagnosis of Babesia caballi and Theileria equi infections in horses in Sudan using ELISA and PCR. Parasitology Research, v. 103, n. 5, p. 1145-1150, 2008. SCHEIN, E. Equine babesiosis. In: RISTIC, M. (Ed.) Babesiosis of domestic animals and man. Florida: CRS Press, 1988. p. 197-208. TANAKA, T. et al. Expression of Babesia equi merozoite antigen-2 by recombinant baculovirus and its use in the ELISA. International Journal for Parasitology, v. 29, n. 11, p. 1803-1808, 1999. TENTER, A. M.; FRIEDHOFF, K. T. Serodiagnosis of experimental and natural Babesia equi and B. caballi infections. Veterinary Parasitology, v. 20, n. 1-3, p. 49-61, 1986. TOWBIN, H.; STAEHELIN, T.; GORDON, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences, v. 76, n. 9, p. 4350-4354, 1979. UETI, M. W. et al. Ability of the vector tick Boophilus microplus to acquire and transmit Babesia equi following feeding on chronically infected horses with low-level parasitemia. Journal of Clinical Microbiology, v. 43, n. 8, p. 3755-3759, 2005. WEILAND, G. Species-specific serodiagnosis of equine piroplasma infections by means of complement fixation test (CFT), immunofluorescence (IIF), and enzyme-linked immunosorbent assay (ELISA). Veterinary Parasitology, v. 20, n. 1-3, p. 43-48, 1986. XUAN, X. et al. Expression of Babesia equi merozoite antigen 1 in insect cells by recombinant baculovirus and evaluation of its diagnostic potential in an enzyme-linked immunosorbent assay. Journal of Clinical Microbiology, v. 39, n. 2, p. 705-709, 2001a. XUAN, X. et al. Diagnosis of equine piroplasmosis in Brazil by serodiagnostic methods with recombinant antigens. Journal of Veterinary Medical Science, v. 63, n. 10, p. 1159-1160, 2001b.
Research Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 61-63, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Metazoan endoparasites of Serrasalmus marginatus (Characiformes: Serrasalminae) in the Negro River, Pantanal, Brazil Metazoários endoparasitos de Serrasalmus marginatus (Characiformes: Serrasalminae) no Rio Negro, Pantanal, Brasil Wagner Vicentin1*; Kelly Regina Ibarrola Vieira1; Fábio Edir dos Santos Costa2; Ricardo Massato Takemoto3; Luiz Eduardo Roland Tavares4; Fernando Paiva4 Universidade Federal de Mato Grosso do Sul – UFMS
1
Laboratório de Ictiologia, Centro de Pesquisas em Biodiversidade, Universidade Estadual de Mato Grosso do Sul – UEMS
2
Laboratório de Ictioparasitologia, Núcleo de Pesquisas em Limnologia, Ictiologia e Aquicultura (Nupélia), Universidade Estadual de Maringá – UEM
3
Departamento de Parasitologia Veterinária, Universidade Federal de Mato Grosso do Sul – UFMS
4
Received March 15, 2010 Accepted April 19, 2010
Abstract In order to inventory the metazoan endoparasites of Serrasalmus marginatus, 91 specimens were examined. They were captured in the Negro River in Pantanal wetland, State of Mato Grosso do Sul, Central-Western Brazil, from October 2007 to August 2008. Parasites of six taxa were recovered: Procamallanus (Spirocamallanus) inopinatus, Contracaecum sp. (Nematoda), metacercarial type Diplostomulum (Digenea), Brevimulticaecum sp. (Nematoda) and Sebekia oxycephala, Subtriquetra sp. 1 and Subtriquetra sp. 2 (Pentastomida). The latter five species are reported for the first time in S. marginatus. Keywords: Parasites, prevalence, intensity of infection, freshwater fish, piranha.
Resumo Com o objetivo de inventariar os metazoários endoparasitos em Serrasalmus marginatus, no Rio Negro, Pantanal, Mato Grosso do Sul, Brasil, foram examinados 91 espécimes capturados no período de outubro de 2007 a agosto de 2008. Foram registrados seis táxons parasitos: Procamallanus (Spirocamallanus) inopinatus, Contracaecum sp. (Nematoda), metacercária do tipo Diplostomulum (Digenea); Brevimulticaecum sp. (Nematoda); e Sebekia oxycephala, Subtriquetra sp. 1 e Subtriquetra sp. 2 (Pentastomida). As últimas cinco espécies citadas são registradas pela primeira vez em S. marginatus. Palavras-chave: Parasitos, prevalência, intensidade de infecção, peixe de água doce, piranha.
Studies on the parasitofauna of piranha Serrasalmus marginatus (Valenciennes, 1837) are scarce and mostly have focused on the taxonomy of some groups. The most remarkable reports on endoparasites in S. marginatus include that of Tanaka (2000) who reported Procamallanus (Spirocamallanus) inopinatus, specimens of Capilariidae, Railliet, 1915, and Kritskyia sp. and that of Böeger et al. (2001) who described Kritskyia annakohnae in ureters and urinary bladder, both studies in the Paraná River basin. The *Corresponding author: Wagner Vicentin Programa de Pós-Graduação em Ecologia e Conservação, Universidade Federal de Mato Grosso do Sul – UFMS, CEP 79070-900, Campo Grande - MS, Brazil; e-mail: wagnervicentin.bio@gmail.com
hydrographic network of the Pantanal, with a variety of species of teleost fishes, has few records on parasite faunas, including piranha (S. marginatus) that is widely distributed in the Paraguay River basin. Thus, with the aim of registering species composition of metazoan endoparasites in S. marginatus, there were necropsied 91 specimens caught with hooks and cast nets from October 2007 to August 2008. Six collections were performed in the middle of the main channel of Negro River (19° 35’ 20.04” S and 56° 11’ 4.19” W), a tributary of Paraguay River, Pantanal, State of Mato Grosso do Sul, Central-Western Brazil. The procedures of necropsy, specimen collection, preparation and conservation of endoparasites were performed according to www.cbpv.com.br/rbpv
62
Vicentin, W. et al.
Eiras et al. (2006). The recovered parasites were compared with deposited specimens from the Helminthological Collection of Oswaldo Cruz Institute (CHIOC). Representative specimens of parasites were deposited in the Zoological Collection of Reference at Universidade Federal do Mato Grosso do Sul, such as the host (ZUFMS-PIS No. 3086). Parasitological descriptors were calculated according to Bush et al. (1997). We found six endoparasite species (Table 1). The metacercarial type Diplostomulum, comprising the genera Diplostomum Nordmann, 1832, Neodiplostomum Railliet, 1919 and Alaria Schrank, 1788 (NIEWIADOMSKA, 2002), was determined by morphology of the reserve bladder with three longitudinal canals (one median and two lateral with ramifications directed posteriorly) connected anteriorly, posterior to the pharynx, and posteriorly, anterior to the ventral sucker. The observed morphological characteristics in P. (S.) inopinatus are consistent with Moravec descriptions (MORAVEC et al., 1997), except for eight cephalic papillae arranged in two circles around the oral opening as the recovered specimens had only four cephalic papillae. Some individuals of P. (S.) inopinatus were compared with the voucher specimen CHIOC 31.324, host: Leporinus sp., Machado River, State of Rondônia, Brazil (GIESE et al., 2009). The specimen was visibly smaller, but with the same morphological structures of the one collected in the present study. This parasite is well documented in the literature and has been described in different fish species (PAVANELLI et al., 2004), including S. marginatus (TANAKA, 2000). The first report of Brevimulticaecum sp. was of adult specimens in freshwater stingrays Potamotrygon motoro (Müller & Henle, 1841) by Rego (1979) in the Salobra River, State of Mato Grosso do Sul, and later Sprent (1990) described this species and named it Brevimulticaecum regoi. With respect to teleost fishes, in the neotropical region, there are reports on parasitic larvae of the Brevimulticaecum in the following fishes: Gymnotus carapo Linnaeus, 1758 and Loricariichthys brunneus (Hancock, 1828) in Venezuela (MORAVEC et al., 1997) and Leporinus friderici (Bloch, 1794),
Rev. Bras. Parasitol. Vet.
L. lacustris Amaral Campos, 1945, L. obtusidens (Valenciennes, 1837) and L. elongatus Valenciennes, 1850, in Brazil (GUIDELLI, 2006). Some specimens were compared to voucher specimens CHIOC 36.977, host Potamotrygon falkneri Castex & Maciel, 1963, Paraná River, State of Paraná, Brazil (LACERDA, 2007). It was not possible to compare the ventriculus in the specimen because of overlapping body parts of the voucher specimen in permanent mounting. Some larvae of Contracaecum sp. were compared with voucher specimen CHIOC 35.521, host: Geophagus brasiliensis, Guandu River, State of Rio de Janeiro, Brazil (AZEVEDO et al., 2006). It was not found any morphological difference among them. Larvae of Contracaecum sp. have been reported in different fish species including S. marginatus (PAVANELLI et al., 2004). Larvae of Sebekia oxycephala were compared with voucher specimens CHIOC 32.445, host: Pygocentrus nattereri (Kner, 1958) and CHIOC 32.447, host: Pseudoplatystoma corruscans Spix & Agassiz, 1829, both in the Cuiabá River, State of Mato Grosso, Brazil (REGO; EIRAS, 1989). It was not found any morphological difference between voucher and collected specimens. Pentastomids of genus Subtriquetra were divided into two morphospecies due to differences in body size, mouth, hooks and spines that are larger in Subtriquetra sp. 2. It was not possible to identify the species due to missing larvae descriptions of these pentastomids. Some individuals of both morphospecies were compared with larvae of S. subtriquetra (Diesing, 1836) CHIOC 17.697, reported in Hoplias malabaricus (Bloch, 1794) in the Salobra River, State of Mato Grosso do Sul, Brazil (TRAVASSOS; FREITAS, 1940), and with some larvae of Subtriquetra CHIOC 11.424, hots: P. nattereri, Salobra River, State of Mato Grosso do Sul (unpublished information). The specimens collected showed morphological similarities with both voucher specimens. It is the first report of metacercarial type Diplostomulum and larvae of Brevimulticaecum sp., Sebekia oxycephala and Subtriquetra spp. parasitizing S. marginatus.
Table 1. Metazoan endoparasites reported in Serrasalmus marginatus caught in the Negro River (19° 35’ 20.04” S and 56° 11’ 4.19” W), Pantanal, State of Mato Grosso do Sul, Brazil, from October 2007 to August 2008. SI
P (%)
MA ± SD
MI ± SD
RV
inside swimming bladder
1.10
0.10 ± 0.10
1
---
cecum and intestine
5.49
0.05 ± 0.22
1
---
stomach tissue and mesentery
16.48
10.46 ± 41.47
63.46 ± 86.33
3–324
stomach tissue, cecum and mesentery
51.65
1.63 ± 3.09
3.17 ± 3.7
1–15
body cavity
7.69
0.10 ± 0.40
1.42 ± 0.53
1–2
Subtriquetra sp. 1 (ZUFMS-INV No. 005)
swimming bladder
7.69
0.13 ± 0.6
1.71 ± 1.49
1–5
Subtriquetra sp. 2 (ZUFMS-INV No. 006)
swimming bladder
10.98
0.23 ± 0.83
2.1 ± 1.59
1–6
Parasites Digenea Metacercarial type Diplostomulum Poirier, 1886 Nematoda Procamallanus (S.) inopinatus (ZUFMS-INV No. 002) Brevimulticaecum sp. (ZUFMS-INV No. 003) Contracaecum sp. (ZUFMS-INV No. 004) Pentastomida Sebekia oxycephala (Diesing, 1835) (ZUFMS-INV No. 001)
SI = site of infection; P (%) = prevalence; MA = mean abundance; MI = mean intensity; RV = range of variation; SD = standard deviation.
v. 20, n. 1, jan.-mar. 2011
Metazoan endoparasites of Serrasalmus marginatus (Characiformes: Serrasalminae) in the Negro River, Pantanal, Brazil
Acknowledgements The authors thank Marcelo Knoff PhD. This study was partially supported by Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso do Sul (FUNDECT). W. Vicentin and K.R.I. Vieira were supported by a student fellowship from FUNDECT and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), respectively.
References AZEVEDO, R. K.; ABDALLAH, V. D.; LUQUE, J. L. Ecologia da comunidade de metazoários parasitos do acará Geophagus brasiliensis (Quoy e Gaimard, 1824) (Perciformes: Cichlidae) do rio Guandu, Estado do Rio de Janeiro, Brasil. Acta Scientiarum Biological Sciences, v. 28, n. 4, p. 403-411, 2006. BOEGER, W.A.; TANAKA, L. K.; PAVANELLI, G. C. Neotropical Monogenoidea. 39: A new species of Kritskyia (Dactylogyridae, Ancyrocephalinae) from the ureters and urinary bladder of Serrasalmus marginatus and S. spilopleura (Characiformes, Serrasalmidae) from southern Brazil with an emended generic diagnosis. Zoosystema, v. 23, n. 1, p. 5-10, 2001. BUSH, A. O. et al. Parasitology meets ecology on its own terms: Margolis et al. revisited. Journal of Parasitology, v. 83, n. 4, p. 575-583, 1997. EIRAS, J. C.; TAKEMOTO, R. M.; PAVANELLI, G. C. Métodos de estudo e técnicas laboratoriais em parasitologia de peixes. 2. ed. Maringá: EDUEM, 2006. 171 p. GIESE, E. G.; SANTOS, J. N.; LANFREDI, R. M. A new species of Camallanidae from Ageneiosus ucayalensis (Pisces: Siluriformes) from Pará State, Brazil. Journal of Parasitology, v. 95, n. 2, p. 407-412, 2009. GUIDELLI, G. M. Comunidades parasitárias em espécies de peixes congenéricas de diferentes categorias tróficas e ambientes da planície de inundação do Alto rio Paraná. 2006. 91 f. Dissertação (Mestrado)Universidade Estadual de Maringá, Maringá.
63
LACERDA, A. C. F. Endoparasitos de raias fluviais Potamotrygon falkneri e Potamotrygon motoro (Chondrichthyes: Potamotrygonidae) da planície de inundação do alto rio Paraná: taxionomia e aspectos ecológicos. 2007. 45 f. Dissertação (Mestrado)–Universidade Estadual de Maringá, Maringá. MORAVEC, F.; PROUZA, A.; ROYERO, R. Some nematode of freshwater fishes in Venezuela. Folia Parasitologica, v. 44, n. 1, p. 33‑47, 1997. NIEWIADOMSKA, K. Superfamily Diplostomoidea Poirier, 1886. In: GIBSON, D. I.; JONES, A.; BRAY, R. A. (Ed.). Keys to the trematoda. vol. I. London: The Natural History Museum, 2002. p. 159-166. PAVANELLI, G. C. et al. Helminth fauna of fishes: diversity and ecological aspects. In: THOMAZ, S. M.; AGOSTINHO, A. A.; HAHN, N. S. (Ed.). The upper Paraná river and its floodplain: physical aspects, ecology and conservation. Netherlands: Backhuys Publishers, Leiden, 2004. v. 1, p. 309-329. REGO, A. A. Contribuição ao conhecimento dos helmintos de raias fluviais Paratrygonidae. Revista Brasileira de Biologia, v. 39, n. 4, p. 879-890, 1979. REGO, A. A.; EIRAS, J. Identificação das larvas de Sebekia e Leiperia (Pentastomida) histopatologia em peixes de rios. Revista Brasileira de Biologia, v. 49, n. 2, p. 591-595, 1989. SPRENT, J. F. A. Some ascaridoid nematodes of fishes: Heterocheilinae. Systematic Parasitology, v. 16, n. 3, p. 149-161, 1990. TANAKA, L. K. Aspectos ecológicos dos parasitos de Serrasalmus marginatus Valenciennes, 1847 e Serrasalmus spilopleura Kner, 1860 (Characiformes, Serrasalmidae) do rio Baía, Planície de inundação do alto rio Paraná, MS. 2000. 32 f. Dissertação (Mestrado)-Universidade Estadual de Maringá, Maringá. TRAVASSOS, L.; FREITAS, J. F. T. Pesquisas Helmintológicas – II. Memórias do Instituto Oswaldo Cruz, v. 35, n. 3, p. 610-633, 1940.
Review ResearchArticle Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 64-66, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Active surveillance of canine visceral leishmaniasis and american trypanossomiasis in rural dogs from non endemic area Vigilância da leishmaniose visceral e da tripanossomíase americana em cães de área rural indene Rozeani Olimpio Tome1*; Fernanda Conceição Gaio1; Diego Generoso2; Benedito Donizete Menozzi2; Helio Langoni3 Ex Residente do Laboratório de Diagnóstico de Zoonoses, Departamento de Higiene Veterinária e Saúde Pública, Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista – UNESP
1
Laboratório de Diagnóstico de Zoonoses, Departamento de Higiene Veterinária e Saúde Pública, Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista – UNESP
2
Departamento de Higiene Veterinária e Saúde Pública, Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista – UNESP
3
Received May 27, 2010 Accepted July 7, 2010
Abstract The canine visceral leishmaniasis (CVL) and american trypanosomiasis are important zoonoses in public health and dogs are the main domestic reservoir of the parasite for humans. The goal of this study was to estimate the prevalence of circulating antibodies anti-Trypanosoma cruzi and anti-Leishmania sp. in sera of dogs from the rural area of Botucatu, SP, Brazil. During the annual vaccination campaign against canine rabies in rural area, 689 blood samples were taken and processed by indirect immunofluorescent antibody test. The serological tests revealed the absence of antibodies anti-Leishmania spp., but anti-T. cruzi antibodies were detected in 3 (0.4%) dogs. Keywords: Dogs, Chagas disease, indirect immunofluorescence, leishmaniasis.
Resumo A leishmaniose visceral canina (LVC) e a tripanossomíase americana são importantes zoonoses para a saúde pública que encontram no cão o principal reservatório doméstico para o homem. O trabalho procurou estimar a prevalência de anticorpos circulantes anti-Trypanosoma cruzi e anti-Leishmania spp., em amostras de cães provenientes da zona rural do município de Botucatu, SP. Durante a campanha de vacinação antirrábica canina da zona rural do município, foram coletadas 689 amostras de soro e processadas pela técnica de imunofluorescência indireta. Os testes sorológicos revelaram a ausência de anticorpos anti-Leishmania spp. e, na pesquisa dos anticorpos anti-T. cruzi, foram detectados 3 (0,4%) cães. Palavras-chave: Cães, doença de Chagas, imunofluorescência indireta, leishmaniose.
Canine visceral leishmaniasis has been one of the most important emerging zoonoses from a public health point of view in the State of São Paulo, since the confirmation of its autochthonous status in 1998. Until that time, there had been no records of its occurrence (SÃO PAULO, 2006). It is caused by the protozoon Leishmania spp. and is transmitted through the bites of infected female phlebotomines. Dogs form a domestic reservoir that plays the role of a source of immediate infection for humans in urban environments (WERNECK et al., 2008). *Corresponding author: Rozeani Olimpio Tome Médica Veterinária, Rua Santa Catarina, 17, Vila Progresso, CEP 13.202-150, Jundiaí - SP, Brazil; e-mail: olimpio_vet@yahoo.com.br
The presence of the disease in a given region has been correlated with the presence of serologically positive dogs, which confirms that dogs are an individual risk factor for householders (BORGES et al., 2008). In addition to dogs, wild animals like foxes and marsupials are reservoirs and, because of their synanthropic habits, they may promote a link between the wild and domestic cycles (GONTIJO; MELO, 2004). American trypanosomiasis, also known as Chagas disease, is a disease transmitted by the insect vector known as the barbeiro, which belongs to the subfamily Triatominae (KROPF et al., 2000). Studiers on the role of dogs in transmitting Chagas disease are still scarce, but the possibility that they may be important cannot be dismissed. Dogs have great potential as reservoirs since www.cbpv.com.br/rbpv
v. 20, n. 1, jan.-mar. 2011
Active surveillance of canine visceral leishmaniasis and american trypanossomiasis in rural dogs from non endemic area
they come into direct contact with wild reservoirs of the disease (MAYWALD et al., 1996; LUCHEIS et al., 2005). The present study had the aim of estimating the occurrence of anti-Trypanosoma cruzi and anti-Leishmania spp. antibodies in serum from dogs in the rural zone of the municipality of Botucatu, SP. Botucatu is located in the central southern region of the State of São Paulo (latitude 22.88583° S and longitude 48.445° W), at around 805 m above sea level, and covers an area of 1,483 km2, of which 1,329 km2 corresponds to the rural zone and 154 km2 to the urban zone. Native vegetation covers 10.45% of this total area. The total population of Botucatu is 130,348 inhabitants (IBGE, 2009) and the canine population of the municipality was estimated to be 29,788 animals in 2009 (INSTITUTO PASTEUR, 2009). The region’s climate is humid subtropical, with dry winters and hot summers. The mean temperature is 22 °C and the mean rainfall is 1,250 mm. In winter, it is rare for the temperature to fall below 2 °C (BOTUCATU, 2009). The area continues to be free from the disease, possibly because the transmitting vector Lutzomyia longipalpis is absent or because the climatic situation, altitude or other factors do not favor vector maintenance. On the other hand, imported cases have been diagnosed (LANGONI et al., 2001; TRONCARELLI et al., 2009). During the annual anti-rabies vaccination campaign among dogs in the rural zone of the municipality of Botucatu in 2009, blood samples of 2 to 5 mL were taken from 689 dogs by means of jugular or cephalic venous puncture. The samples were centrifuged and the serous fraction was stored at –20 °C until processing in the laboratory of the Zoonosis Research Group (NUPEZO) of the Department of Veterinary Hygiene and Public Health, UNESP, Botucatu. To perform the examinations, the serum samples were prepared as dilutions of 1:20 to 1:320, in flat-bottomed microplates. These were then subjected to the indirect immunofluorescence reaction (IIR), to detect class IgG antibodies, in accordance with the standardized technique described by Camargo (1964). Anti-IgG canine conjugate was used, kindly donated by the Zoonosis Control Center of São Paulo, along with slides for immunofluorescence impregnated with antigens for T. cruzi (strain Y) and leishmaniasis (Leishmania major) supplied by the NUPEZO laboratory. Serum samples that were known to be positive or negative through testing using this method were used as controls. Samples that resulted in fluorescence, including in membranes and flagella, were considered to be positive. Those that presented absence of brilliance, i.e. remaining with a red or brown coloration, were taken to be negative. The readings were made under a Zeiss SH250 immunofluorescence microscope. Samples with titers greater than or equal to 1:40 were considered to be positive in cases of leishmaniasis and 1:20, in cases of T. cruzi. Among the 689 animals evaluated, 56.60% were males, 9.14% were castrated, 73.29% were between one and five years of age and 73.59% were mongrels. From the investigation of anti-T. cruzi antibodies, three animals were found to be positive (0.4%): all of them were mongrels and over the age of one year. None of these animals presented any signs suggestive of the disease, such as lethargy, anorexia, intolerance to exercise, pallid mucosa, hepatomegaly, splenomegaly, neurological signs or ascites.
65
From the investigation of circulating anti-Leishmania sp. antibodies, none were detected under the conditions of the present study, i.e. there were no positive animals among the 689 serum samples tested. These results relating to canine leishmaniasis confirm previous studies that concluded that the disease did not yet constitute a problem in the municipality of Botucatu, SP (LANGONI et al., 2001; CARVALHO, 2007). According to Souza et al. (2009), the seroprevalence among dogs from rural areas in the State of Mato Grosso do Sul was 45.3%, out of a total of 75 dogs tested using IIR and 22.7% using ELISA. The seroprevalence for T. cruzi among the samples analyzed in the present study was 0.4%, which was lower than what was reported from Botucatu by Lucheis et al. (2005), among dogs whose owners had Chagas disease. The occurrence of anti-T. cruzi antibodies suggests that this agent is circulating in the area and that dogs may be participating in the epidemiological transmission chain for Chagas disease. The negative result regarding the presence anti-Leishmania antibodies suggests that the municipality remains free from this disease.
References BORGES, B. K. A. et al. Avaliação do nível de conhecimento e de atitudes preventivas da população sobre a leishmaniose visceral em Belo Horizonte, Minas Gerais, Brasil. Cadernos de Saúde Pública, v. 24, p. 777-784, 2008. BOTUCATU. Site oficial. 2009. Disponível em: <http://www.botucatu. sp.gov.br/dadosgerais/>. Acesso em: 23 fev. 2010. CAMARGO, M. E. Introdução às técnicas de imunofluorescência. Revista Brasileira de Patologia Clínica, v. 10, n. 4, p. 143-169, 1964. CARVALHO, J. L. B. Leishmaniose visceral canina: busca ativa de casos e estudo sobre o conhecimento da doença em proprietários de cães na área urbana de Botucatu. 2007. 66 f. Dissertação (Mestrado em Planejamento Animal e Saúde Pública)–Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista, Botucatu, 2007. GONTIJO, C.M.F.; MELO, M.N. Leishmaniose Visceral no Brasil: quadro atual, desafios e perspectivas. Revista Brasileira de Epidemiologia, v.7, n.3, p.338-349, 2004. INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA IBGE. Censo demográfico. 2009. Disponível em: <http://www.ibge. gov.br>. Acesso em: 23 fev. 2010. INSTITUTO PASTEUR. Governo do Estado de São Paulo. Metas para os municípios em 2009. Disponível em: <http://www.pasteur. saude.sp.gov.br/news/ppi2009.asp>. Acesso em: 23 fev. 2010. KROPF, S. P.; AZEVEDO, N.; FERREIRA, L. O. Doença de Chagas: a construção de um fato científico e de um problema de saúde pública no Brasil. Revista Ciência & Saúde Coletiva, v. 5, n. 2, p. 347-365, 2000. LANGONI, H. et al. Epidemiological vigilance for canine Leishmaniasis in the county of Botucatu, SP, Brazil. Ars. Veterinária, v. 17, n. 3, p. 196-200, 2001.
66
Tome, R.O. et al.
LUCHEIS, S. B. et al. Trypanosomatids in dogs belonging to individuals with chronic Chagas disease living in Botucatu town and surrounding region, São Paulo State, Brazil. Journal of Venomous Animals and Toxins including Tropical Diseases, v. 11, n. 4, p. 492-509, 2005. MAYWALD, P. G. et al. Leishmaniose tegumentar, visceral e doença de Chagas caninas em municípios do Triângulo Mineiro e Alto Paranaíba, Minas Gerais, Brasil. Cadernos de Saúde Pública, v. 12, n. 3, p. 321‑328, 1996. SÃO PAULO (Estado). Secretaria de Estado da Saúde. Superintendência de Controle de Endemias e Coordenadoria de Controle de Doenças. Manual de vigilância e controle da Leishmaniose Visceral Americana do Estado de São Paulo. São Paulo, 2006. 161 p.
Rev. Bras. Parasitol. Vet.
SOUZA, A. I. et al. Soroprevalência da infecção por Trypanosoma cruzi em cães de uma área rural do Estado de Mato Grosso do Sul. Revista Pesquisa Veterinária Brasileira, v. 29, n. 2, p. 150-152, 2009. TRONCARELLI, M. Z. et al. Leishmania spp. and/or Trypanosoma cruzi diagnosis in dogs from endemic and nonendemic areas for canine visceral leishmaniasis. Veterinary Parasitology, v. 164, n. 2-4, p. 118-123, 2009. WERNECK, G. L. et al. Avaliação da efetividade das estratégias de controle da leishmaniose visceral na cidade de Teresina, Estado do Piauí, Brasil: resultados do inquérito inicial – 2004. Revista Epidemiologia e Serviços de Saúde, v. 17, n. 2, p. 87-96, 2008.
Research Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 67-70, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Histopathology of gills of Piaractus mesopotamicus (Holmberg, 1887) and Prochilodus lineatus (Valenciennes, 1836) infested by monogenean and myxosporea, caugth in Aquidauana River, State of Mato Grosso do Sul, Brazil Histopatologia de brânquias de Piaractus mesopotamicus (Holmberg, 1887) e Prochilodus lineatus (Valenciennes, 1836) parasitados por monogêneas e mixosporídios, capturados no Rio Aquidauana, Mato Grosso do Sul, Brasil Cristiane Meldau de Campos1*; Julieta Rondini Engrácia de Moraes2; Flávio Ruas de Moraes2 Unidade Universitária de Aquidauana, Universidade Estadual de Mato Grosso do Sul – UEMS
1
Departamento de Patologia Veterinária, Centro de Aqüicultura, Universidade Estadual Paulista – UNESP
2
Received May 31, 2010 Accepted September 17, 2010
Abstract A histological analysis was conducted on the gills of 15 Piaractus mesopotamicus and 19 Prochilodus lineatus specimens collected between April and November 2004 from the Aquidauana River, State of Mato Grosso do Sul, Central-West Brazil, to describe the anatomopathological characteristics of the gills of these freshwater fish. Gill samples were fixated in 10% buffered formalin and processed following histological routine procedures. The histological examination of the gills of P. mesopotamicus revealed intralamellar monogenean and mixosporean cysts of Henneguya piaractus at several developmental stages over the entire (basal, median and distal) lamella. Intraepithelial cysts caused lamella dilation and deformity of adjacent lamellae. In P. lineatus gills, monogenean cysts were detected. In both host species, hyperplasia of the gill epithelium and structural disorganization of secondary lamellae was seen diffusely in the gills, leading to fused lamellae in the gills. In few cases, there was found mononuclear inflammatory cells and hemorrhagic focal points distally in the lamellae. Keywords: Tissues alterations, parasites, gills, fish.
Resumo Realizou-se análise histológica de brânquias de 15 espécimes de Piaractus mesopotamicus e 19 Prochilodus lineatus coletados de abril a novembro de 2004, no Rio Aquidauana, MS, com intuito de contribuir com achados anatomopatológicos em brânquias dessas espécies de peixes de água doce. Amostras de brânquias foram fixadas em formalina 10%, tamponadas e processadas conforme rotina histológica. Em P. mesopotamicus observou-se presença de monogênea e cistos de mixosporídio da espécie Henneguya piaractus, com localização intralamelar em vários estágios de desenvolvimento, localizados em todas as regiões (basal, mediana ou distal) das lamelas. Cistos intraepiteliais causaram dilatação e deformação das lamelas vizinhas. Em brânquias de P. lineatus, observou-se presença de monogênea. Nas duas espécies de hospedeiro foram registradas hiperplasia do epitélio branquial e desorganização estrutural das lamelas em extensas regiões, alterações que causaram a fusão lamelar. Em poucos casos registrou-se presença de células inflamatórias mononucleares e focos hemorrágicos na região distal das lamelas. Palavras-chave: Alterações teciduais, parasitos, brânquias, peixes.
*Corresponding author: Cristiane Meldau de Campos Unidade Universitária de Aquidauana, Universidade Estadual de Mato Grosso do Sul – UEMS, Rod. Aquidauana-UEMS, Km 12, Zona Rural, CEP 79200-000, Aquidauana - MS, Brazil; e-mail: cmeldau@uems.br
www.cbpv.com.br/rbpv
68
Campos, C.M.; Moraes, J.R.E.; Moraes, F.R.
Introduction Parasites may be found in every fish organ, among them, the gills, causing either little or no damage or serious structural changes in their hosts. Gill lesions caused by parasites generally include structural disorganization, hyperplasia of epithelial and mucous cells increasing mucous production, cellular hypertrophy, necrosis and inflammation (TAKASHIMA; HIBIYA, 1995). These abnormalities are affected by a number of factors, such as disease duration, infection intensity and degree of regeneration. Among the causative parasites of fish diseases, mixosporeans (Myxozoa: Myxobolidae) and monogeneans (Platyhelminthes: Monogenea) infect mainly the gills (MARTINS et al., 1997, 2000, 2001). According to Kent et al. (2001 apud BARASSA et al., 2003), there are approximately 1,350 species of mixosporeans distributed in 52 genus, the majority of which parasite freshwater fish. Mixosporeans may be present in natural and fish farming environments and may have clinical signs only when there is a host, parasite and environment imbalance (LOM; NOBLE 1984). As for monogeneans, up to this day, about 250 species are known according to Pavanelli et al. (2002). Among freshwater fish, Piaractus mesopotamicus, pacu, is a species of great economic importance in the Pantanal wetland, in the State of Mato Grosso do Sul, Central-West Brazil, for its commercial value, food source and potential for aquaculture. Prochilodus lineatus, curimbatá, besides being a food source, it is also very important for the fishing industry, either professional or sport, for use as bait. The gills of Piaractus mesopotamicus and Prochilodus lineatus from the Aquidauana River, infected by mixosporean and monogenean parasites, were carefully examined and their anatomopathological characteristics described.
Material and Methods An histological analysis was conducted in 15 pacu, Piaractus mesopotamicus Holmberg, 1887 and 19 curimbatá, Prochilodus lineatus Valenciennes, 1836 specimens that were collected between April and November 2004 from the Aquidauana River, Camisão District (20° 29’ 08.7” S and 55° 38’ 42.0” W), in the municipality of Aquidauana, State of Mato Grosso do Sul. The fish were killed by cerebral commotion, weighed (g) and measured (cm) to determine total and standard length. After necropsy, the external examination consisted of a careful observation of the fish external surface with the naked eye and with stereoscopic microscope. Gill fragments were collected and compressed between microscope blades for fresh examination to search for spores, cysts or adult parasites. For the histological study, gill samples were collected and fixated in 10% buffered formalin, followed by dehydration, diaphanization and inclusion in paraffin. The 5 μm thick sections were dyed with hematoxylin- eosin (HE) and examined under the microscope.
Results and Discussion The standard length ranged between 34-55 and 23-40 cm and total weight between 1,425-4,970 and 300-1,980 g for Piaractus mesopotamicus and Prochilodus lineatus specimens, respectively.
Rev. Bras. Parasitol. Vet.
There were no macroscopic alterations of the gills in both P. mesopotamicus and P. lineatus species. However, under the stereoscopic microscope, there was seen the presence of monogenean parasite belonging to the Dactylogyridae family and/or mixosporeans cysts in all individuals of both species. Flores Quintana et al. (1992), while analyzing Serrassalmus sp. gills infected by Henneguya sp. (Myxozoa), found an association with certain monogenean parasites. The compression of gill fragments between the slides for microscopic examination caused the cysts to rupture and release spores of mixosporeans that were identified as Henneguya piaractus and Henneguya caudalongula in P. mesopotamicus and P. lineatus, respectively. The genus Henneguya Thelohan, 1892, is among the most abundant mixosporeans in South America with 40 known species in Brazil (EIRAS et al., 2010). The histological examination of P. mesopotamicus gills revealed the presence of monogenean and/or mixosporean cysts in 80% of the samples. The histological sections of P. lineatus gills showed the presence of monogenean parasite in only one sample. As it has been earlier reported by Martins et al. (2000), monogeneans anchored with their hooks in the mid-lamellar region were also found in this study. Hyperplasia of the gill epithelium was seen with proliferation of the interlamellar epithelium and partial fulfillment of the spaces between the lamellae causing its fusion. There was also structural disorganization of gill lamellae, not only on the monogenean fixation region or where the parasite was installed, but also over extensive areas in the filaments. In a few cases, it was seen the presence of mononuclear inflammatory cells and focal interstitial hemorrhage in the distal region of the gill lamella. Mixosporean cysts were located inside the capillary in the gills of the intralamellar development type (Figure 1), as defined by McCraren et al. (1975). The presence of cysts inside gill filaments was reported by Martins and Souza (1997) and Martins et al. (1997, 2000). In the samples analyzed in this study, no interlamellar development was observed. Eiras et al. (1999) reported Henneguya piaractus cysts of the intralamellar type present in the epithelium of cultivated pacu gills. Barassa et al. (2003), while performing a histological analysis in the gills of Astyanax altiparanae from natural environment, described the presence of H. chydadea cysts of intralamellar type. This form of infection is considered less pathogenic than the interlamellar infection, which is frequently associated with host death (McCRAREN et al., 1975; EIRAS et al., 1999). Mixosporean cysts were seen in a variety of sizes, the largest and the smallest cyst had 166.37 and 212.29 μm and 79.22 and 97.81 μm, respectively. Several developmental stages, from early to more mature (Figure 1), were observed, and apparently, unrelated to seasonal distribution since they were found in host collected throughout the months of April, May, June and November. According to Eiras et al. (1999), this asynchronous development suggests different infection periods. Recently Adriano et al. (2005a) described H. caudalongula parasitizing the gills of P. lineatus cultivated in fish farms in the State of São Paulo and asynchronous parasite development. In this study, the most common was to find only one mixosporean cyst in the gill lamella in the basal (Figure 2), mid or distal region (Figure 3). Mature cysts containing mature spores
v. 20, n. 1, jan.-mar. 2011
Histopathology of gills of Piaractus mesopotamicus (Holmberg, 1887) and Prochilodus lineatus (Valenciennes, 1836)
Figure 1. Wet mounts of the gill lamella of Prochilodus lineatus showing cysts (arrows) of Henneguya caudalongula (400×).
Figure 2. Photomicrographs of the gills of Piaractus mesopotamicus with mixosporean cysts (arrows) in the basal region of the gill lamella (400×). Hematoxylin and eosin staining.
69
were within the entire lamella and caused it to dilate and compress the epithelial cells that flattened out. In addition, the lamellae infected with parasites pressed the adjacent lamellae, causing them to deform. According to Adriano et al. (2005b) these alterations may partially compromise gill functions and, therefore, diminish the respiratory capacity and ionic exchange. Henneguya cyst walls were formed by an internal layer of endothelial cells and a thin external layer of connective tissue, as described by Eiras et al. (1999) in cultivated P. mesopotamicus. Epithelial hyperplasia and deformation of adjacent lamella was described by Ferraz de Lima et al. (1991) while histologically characterizing gills of P. mesopotamicus infected with Ichthyrophthirius multifiliis; Martins and Souza (1997) in their study of gills of the same species infected with Henneguya sp.; Martins et al. (1999), while analyzing Leporinus macrocephalus infected with H. leporinicola, and Barassa et al. (2003), while studying gills of Astyanax altiparanae. Therefore, hyperplasia is a common and unspecific response to parasitic infection, as well as inflammatory and circulatory disturbances seen during massive parasite infections (MARTINS et al., 1997, 2000, 2002). According to Moraes and Martins (2004) the parasitic fauna of cultivated fish, from sport fishing or fish farms, shows that parasites found in common situations are, with small variations, the same causative agents of severe epizootic epidemics, with high mortality rates when there is an imbalance in the parasite-host-environment system caused by either poor quality environment or inadequate management. In rivers and large reservoirs, this imbalance rarely occurs since the fish are not subject to the same conditions. In this study, although all fish had some degree of parasite infection, no clinical signs of disease were evident at first. This could be due to the fact that either the intensity of infection was not enough to cause disease manifestations or the fish kept themselves in balance under adequate environmental conditions to the host. Although no massive infection by Henneguya and monogeneans was found in the species analyzed, the histological alterations here described suggest the pathogenic potential of these parasites.
Acknowledgements We thank Maria Inês Yamazaki de Campos and Francisca de Assis Ardisson (Pathology Laboratory of the Department of Veterinary Pathology at UNESP, Jaboticabal campus, SP, Brazil) and to Dr. Edson A. Adriano (CEPTA/IBAMA, Pirassununga, SP, Brazil) for specific identification of Henneguya.
References ADRIANO, E. A.; ARANA, S.; CORDEIRO, N. S. Histophatology and ultrastructure of Henneguya caudalongula sp. n. infecting Prochilodus lineatus (Pisces: Prochilodontidae) cultivated in the State of São Paulo, Brazil. Memórias do Instituto Oswaldo Cruz, v. 100, n. 2, p. 177-181, 2005a.
Figure 3. Photomicrographs of the gills of Piaractus mesopotamicus with mixosporean cysts (arrows) in the distal region of the gill lamella (400×). Hematoxylin and eosin staining.
ADRIANO, E. A.; ARANA, S.; CORDEIRO, N. S. Histology, ultrastructure and prevalence of Henneguya piaractus (Myxosporea) infecting the gills of Piaractus mesopotamicus (Characidae) cultivated in Brazil. Disease Aquatic Organisms, v. 64, n. 3, p. 229-235, 2005b.
70
Campos, C.M.; Moraes, J.R.E.; Moraes, F.R.
BARASSA, B.; CORDEIRO, N. S.; ARANA, S. A new species of Henneguya, a gill parasite os Astyanax altiparanae (Pisces: Characidae) from Brazil, with comments on histopathology and seasonality. Memórias do Instituto Oswaldo Cruz, v. 98, n. 6, p. 761-765, 2003. EIRAS, J. C. et al. Gill histopathology of Piaractus mesopotamicus (Osteichthyes: Serrasalmidae) infected by Henneguya piaractus Martins et Souza, 1997 (Myxozoa: Myxobolidae). Research and Review in Parasitology, v. 59, n. 3-4, p. 117-120, 1999. EIRAS, J. C.; TAKEMOTO, R. M.; PAVANELLI, G. C. Diversidade dos parasitas de peixes de água doce do Brasil. Maringá, PR: Ed. Clichetec: NUPÉLIA, 2010. 333 p. FERRAZ DE LIMA, C. L. B.; REIS, N. S.; CECCARELLI, P. S. Caracterização histológica da ictiofitiríase em pacu, Piaractus mesopotamicus Holmberg, 1887 (Teleostei, Serrasalminae). Boletim do CEPTA, v. 4, n. 2, p. 39-46, 1991. FLORES QUINTANA, C. I.; ROUX, J. P.; DOMITROVIC, H. A. Myxosporidiosis (Henneguya sp.) em brânquias de Serrassalmus sp. (Pisces: Serrassalmídae). Revista de Ictiologia, v. 1, n. 1, p. 11-19, 1992. LOM, J.; NOBLE, E. R. Revised classification of the class Myxosporea Bütschli, 1981. Folia Parasitologica, v. 31, n. 3, p. 193-205, 1984.
Rev. Bras. Parasitol. Vet.
and treatment. Revista Brasileira de Biologia, v. 59, n. 3, p. 527-534, 1999. MARTINS, M. L. et al. Parasitic infections in cultivated freshwater fishes a survey of diagnosticated cases from 1993 to 1998. Revista Brasileira de Parasitologia Veterinária, v. 9, n. 1, p. 23-28, 2000. MARTINS, M. L. et al. Piscinoodinium pillulare (Schäperclaus, 1954) Lom, 1981 (Dinoflagellida) infection in cultivated freshwater fish from Northeast region of São Paulo State, Brazil. Parasitological and pathological aspects. Revista Brasileira de Biologia, v. 61, n. 4, p. 639‑644, 2001. MARTINS, M. L.; SOUZA, V. N. Henneguya piaractus n. sp. (Myxozoa: Myxobolidae), a gill parasite of Piaractus mesopotamicus Holmberg, 1887 (Osteichthyes: Characidae), in Brazil. Revista Brasileira de Biologia, v. 57, p. 239-245, 1997. McCRAREN, J. P. et al. Variation in response of channel catfish to Henneguya sp. infections (Protozoa: Myxosporidea). Journal Wildlife Diseases, v. 11, n. 1, p. 3-7, 1975. MORAES, F. R.; MARTINS, M. L. Condições pré-disponentes e principais enfermidades de teleósteos em piscicultura intensiva. In: CYRINO, J. E. P. et al. (Ed.). Tópicos especiais em piscicultura de água doce tropical intensiva. São Paulo: TecArt, 2004. p. 343-386.
MARTINS, M. L. et al. Pathology and behavioral effects associated with Henneguya sp. (Myxozoa: Myxobolidae) infections of captive pacu Piaractus mesopotamicus in Brazil. Journal World Aquaculture Society, v. 28, n. 3, p. 297-300, 1997.
PAVANELLI, G. C.; EIRAS, J. C.; TAKEMOTO, R. M. Doenças de Peixes: profilaxia, diagnóstico e tratamento. 2nd. ed. Maringá, PR: EDUEM: NUPÉLIA, 2002. 305 p.
MARTINS, M. L. et al. Gill infection of Leporinus macrocephalus Garavello & Britski, 1988 (Osteichthyes: Anostomidae) by Henneguya leporinicola n. sp. (Myxozoa: Myxobolidae). Description, histopathology
TAKASHIMA, F.; HIBIYA, T. (Ed.). An atlas of fish histology: normal and pathological features. 2nd ed. Tokyi: Kodansha, Stuttgart; NewYork: Fischer, 1995. 195 p.
Research Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 71-74, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Ehrlichia canis (Jaboticabal strain) induces the expression of TNF-α in leukocytes and splenocytes of experimentally infected dogs Amostra Ehrlichia canis (Jaboticabal) induz a expressão de TNF-a em leucócitos e esplenócitos de cães experimentalmente infectados Joice Lara Maia Faria1; Thiago Demarchi Munhoz2; Carolina Franchi João3; Giovanny Vargas-Hernández2; Marcos Rogério André2; Wanderson Adriano Biscola Pereira1; Rosângela Zacarias Machado2; Mirela Tinucci-Costa2* Universidade de Uberaba – UNIUBE
1
Universidade Estadual Paulista – UNESP
2
Universidade Federal do Pará – UFPA
3
Received June 14, 2010 Accepted November 17, 2010
Abstract Canine ehrlichiosis is caused by the bacterium Ehrlichia canis and is characterized by a systemic febrile disease of unknown pathogenesis. This study evaluated the expression of cytokines TNF-α, IL-10, IFN-γ, in splenic cells and blood leukocytes during the acute phase of ehrlichiosis and after treatment with doxycycline hyclate in dogs experimentally infected with the E. canis Jaboticabal strain. The study results showed a significant expression of TNF-α 18 days post-inoculation, reducing by approximately 70% after treatment. There was a unique peak of expression of IL-10 and IFN-γ 18 and 30 days post-inoculation, respectively. This study suggests that TNF-α plays a role in the pathogenesis of the acute phase of canine ehrlichiosis and that treatment with doxycycline hyclate reduces the systemic effects of this cytokine, possibly by reducing or eliminating parasitemia. Keywords: Ehrlichiosis, dogs, experimental infection, IL-10, IFN-γ.
Resumo A erliquiose canina é causada pela bactéria Ehrlichia canis, que desencadeia no hospedeiro uma doença febril e sistêmica, de patogênese pouco conhecida. O presente estudo avaliou a expressão das citocinas TNF-α, IL-10, IFN-γ, em células esplênicas e em leucócitos sanguíneos, durante a fase aguda da erliquiose e após o tratamento com hiclato de doxiciclina, em cães experimentalmente infectados com a amostra E. canis Jaboticabal. Os resultados mostraram expressão significativa de TNF-α 18 dias após a inoculação, reduzindo aproximadante 70% após o tratamento. Houve um único pico de expressão de IL-10 e de IFN-γ entre 18 e 30 dias após a inoculação, respectivamente. Este estudo sugere que o TNF-α participa da patogenia da fase aguda da erliquiose canina, e que o tratamento com hiclato de doxiciclina reduz os efeitos sistêmicos dessa citocina, possivelmente por reduzir ou eliminar a parasitemia. Palavras-chave: Erliquiose, cães, infecção experimental, IL-10, IFN-γ.
Canine ehrlichiosis is a disease transmitted by ticks and caused by the gram-negative bacterium Ehrlichia canis, from genus Ehrlichia and family Anaplasmataceae (DUMLER et al., 2001). The acute phase of this disease begins about 8 to 21 days post-infection and lasts for two to four weeks (NEER; HARRUS, 2006). It is *Corresponding author: Mirela Tinucci-Costa Departamento de Cirurgia e Clínica Veterinária, Universidade Estadual Paulista – UNESP, campus de Jaboticabal, Via de acesso Prof. Paulo Donatto Castellane, s/n, CEP 14884-900, Jaboticabal - SP, Brazil; e-mail: mirelatc@fcav.unesp.br
characterized by hyperthermia, weight loss, anorexia, enlarged lymph nodes, splenomegaly, vasculitis (HARRUS et al., 1999) and thrombocytopenia, which is the most common abnormality (WANER et al., 2000) found in dogs. The subclinical phase may last years indicating parasite persistence in the host (HARRUS et al., 1998) and the chronic phase is characterized by bleeding disorders and pancytopenia (HARRUS et al., 1999). The diagnosis may be established by direct identification of inclusion corpuscles or morulae of E. canis in the buffy coat (ELIAS, 1991), lymph nodes (MYLONAKIS et al., 2003) or splenic aspiration (FARIA et al., 2010); specific antibody detection (OLIVEIRA et al., 2000); or www.cbpv.com.br/rbpv
72
Faria, J.L.M. et al.
ehrlichial DNA detection by nested polymerase chain reaction (PCR) (NAKAGHI et al., 2008). The treatment of choice is doxycycline hydrochloride for 21 days (HARRUS et al., 1999; NEER; HARRUS, 2006). Dogs are free of parasites when the ehrlichial DNA is no longer detected in the blood or tissues after treatment (EDDLESTONE et al., 2007). Although immunopathological mechanisms of diseases caused by species from Anaplasmataceae family have been investigated in many studies, the knowledge on these disease is still limited. Studies have shown that IFN-γ has a protective role in the host against Anaplasma phagocytophilum (MARTIN; CASPERSEN; DUMLER, 2001), and this protective effect seems to be enhanced by TNF-α, a pro-inflammatory cytokine (FENG; WALKER, 2004). In contrast, some of these studies have highlighted that the immune response to microorganisms of this family may cause damage to the host’s tissues (SCORPIO et al., 2006). Regarding the profile of cytokines produced in rickettsial diseases, it has been suggested that pro-inflammatory cytokines (IL1β, IL-6, IL-12 and TNF-α) are associated to clinical aggravation of disease with activation of inflammatory cells and induction of nitric oxide production by macrophages. However, cytokines such as IL-10 and TGF-β may be involved in the modulation of immune response and disease remission (BEINEKE et al., 2008). There are only few studies about cytokines in ehrlichiosis caused by E. canis. Unver, Huang and Rikihisa (2006) have detected significant levels of IL-1β and IL-8 in dogs with ehrlichiosis and suggested that these cytokines could be responsible for the observed clinical signs. In another study, researchers inoculated E. canis Oklahoma in dogs and found that disease severity and the profile of cytokines produced may vary according to the infecting strain (TAJIMA; RIKIHISA, 2005). It is known that ehrlichiosis in dogs is a febrile disease with severe hematological disturbances; from the moment these pathogens penetrate the animal’s body, there is agent dissemination through mechanisms not yet clear. Although unknown, the immune response against E. canis is ineffective. Thus, the present study aimed to evaluate the expression of TNF-α, IL-10, IFN-γ during the acute phase of ehrlichiosis and post-treatment with doxycycline hyclate (5.0 mg.kg–1 PO/bid/21 days) in dogs experimentally infected with pure E. canis Jaboticabal strain (Gene Bank nº DQ401044). The study was approved by the Ethics and Animal Welfare Committee (CEBEA) at the Universidade Estadual de São Paulo (UNESP), Jaboticabal campus (protocol number 002460-08). The evaluations were performed before the experimental infection (Day –1) and 6, 18, 30 and 76 days post-infection. Ten mongrel dogs from the same offspring, 5 males and 5 females, 2 years of age, born and raised at the experimental kennel at the Veterinary University Hospital at UNESP/Jaboticabal, fed with commercial feed and receiving water ad libitum were included in this study. The dogs were immunized against infectious diseases, dewormed and prophylactically treated with parasiticides. Before the experiment, the absence of E. canis infection was confirmed through indirect immunofluorescence reaction (IFAT) and nested polymerase chain reaction (nPCR) for Babesia canis. The dogs were then randomly divided into 2 groups. Five dogs were inoculated with 1.0 mL of DH82 cells infected by E. canis Jaboticabal strain (Ec group) and the remaining five were controls (control group). After inoculation, the dogs from Ec group and controls were examined on a daily
Rev. Bras. Parasitol. Vet.
basis and complete blood counts were regularly performed. The onset of parasitemia was accompanied by the investigation of morulae in the blood smear from the ear tip (ELIAS, 1991). Blood and spleen samples (spleen samples were obtained by fine needle aspiration) were collected prior to the inoculation, at Day –1 and after the inoculation at Day 6*, Day 18*, Day 30* and after treatment with doxycycline hyclate (D76*). They were used for investigating cytokine gene expression using mRNA reverse transcription technique (RT‑PCR) (CHAMIZO et al., 2001). For infection confirmation and assessment of treatment response, IFAT and nPCR were repeated at Day 18 and Day 76. Three days after experimental infection, the dogs in the Ec group had thrombocytopenia, leukopenia and anemia, anorexia, fever, enlarged lymph nodes and splenomegaly. Thrombocytopenia and leukopenia lasted until the end of the experiment. Intracytoplasmic morulae were found in blood smears of ear tip blood of dogs in the Ec group from Day 15 on, confirming parasitemia and infection by E. canis. The clinical progress was similar to that reported by Castro et al. (2004) while studying the same E. canis strain. At Day 18 and Day 76, the dogs from the control group remained negative in the anti-E canis IFAT, quite the opposite of what was seen in dogs in the Ec group at both time points. The titles have ranged from 1:2.560 to 1:5.120 at Day 18 to 1:320 to 1:2.560 at Day 76. All animals in all time points remained negative in the anti-B. canis IFAT. E. canis DNA was detected in dogs from Ec group at Day 18 and was negative after treatment (Day 76), showing that treatment with doxycycline hyclate effectively eliminated infection, which is consistent with the results obtained by Eddlestone et al. (2007). The three targeted genes were expressed in animals in the Ec group and in some dogs in the control group, and TNF-α had the highest and most persistent expression. This gene expression was observed from Day 6 on with a mean rate of 0.40 only in leukocytes from the control group, and 0.05 in leukocytes and 0.77 in splenocytes from the Ec group. At Day 18 TNF-α expression significantly increased in the Ec group compared to controls. The mean expression rate in leukocytes was 1.46 and in splenocytes was 3.99 in the Ec group, while it was 0.38 only in leukocytes in controls. At Day 30, TNF-α in the Ec group reached its highest expression level, around 2.88 in leukocytes and 4.14 in splenocytes. Among controls, the mean expression rate was 0.03 in leukocytes and 1.83 in splenocytes. At Day 76, a reduction of TNF-α gene expression occurred in all animals in both Ec and control group. In the Ec group, the mean expression rate was 0.42 in leukocytes and 0.47 in splenocytes. In controls, the mean expression rate was 0.75 in leukocytes and there was no expression in splenocytes. TNF-α expression at Day 18 was significantly higher than at Day 0 and Day 6. Between Day 30 and Day 76, it was not significantly higher compared to other time points. Only at Day 18, IL-10 expression was detected at a mean rate of 1.23 in leukocytes and 1.87 in splenocytes in the Ec group and there was no expression in controls, with no significant different between both groups. Similarly, only at Day 30 IFN-γ expression was seen in leukocytes from the Ec group, with * Day 6 refers to 6 days post-inoculation, Day 18 to 18 days post-inoculation, Day 30 to 30 days post-inoculation and the beginning of treatment with doxycycline hyclate at 5 mg.kg–1 BID PO for 21 days and Day 76 to 76 days post-inoculation and end of treatment.
Ehrlichia canis (Jaboticabal strain) induces the expression of TNF-α in leukocytes
v. 20, n. 1, jan.-mar. 2011
73
Table 1. Mean expression rate of IL-10, TNF-α, and IFN-γ in leukocytes and splenocytes of experimentally infected dogs (Ec and control groups). Cytokines TNF-α
Sample Splenocytes Leukocytes
IL-10
Splenocytes Leukocytes
IFN-γ
Splenocytes Leukocytes
Groups Cn Ec Cn Ec Cn Ec Cn Ec Cn Ec Cn Ec
Day –1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
Day 6 0.00 0.77 0.40 0.05 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
Evaluations Day 18 0.00a 3.99b 0.38a 1.46b 0.00a 1.87b 0.00a 1.23b 0.0 0.0 0.0 0.0
Day 30 1.83 4.14 0.03 2.88 0.0 0.0 0.0 0.0 0.00 0.00 0.00 1.50
Day 76 0.00 0.47 0.75 0.42 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
Note: Different letters in same column refer to significant differences (p < 0.05) between Ec groups and controls.
a mean 1.50. In all animals and at all time points evaluated, the GAPDH gene was detected, showing the integrity of the extracted RNA. These results are presented in the Table 1. High levels of TNF-α expression were found in dogs experimentally infected with E. canis (TAJIMA; RIKIHISA, 2005), and E. muris (FENG; WALKER, 2004), suggesting this gene is associated with the parasite’s elimination. Thus, TNF-α plays a role in ehrlichial infection pathogenesis, which corroborates our results. Among its functions, TNF-α has a role in the immune response against bacteria and other agents, in addition to its essential activity in modulating local inflammatory immune response. TNF-α is an acute phase protein that induces a cytokine cascade and increases vascular permeability accompanied by macrophage and neutrophil recruitment to the infection site (JANEWAY et al., 2005). Some researchers claim that TNF-α can cause clinical aggravation due to its pro-inflammatory activity (BEINEKE et al., 2008) whereas others believe that TNF-α would enhance the IFN-γ protective effect against Anaplasma phagocytophilum (MARTIN; CASPERSEN; DUMLER, 2001). Martin, Carspersen and Dumler (2001) reported that IFN-γ produced by macrophages activated during the inflammatory response would be inhibited by the IL‑10 effect, which may also have happened in our study since we detected transitory high IL-10 levels and low INF-γ levels. These findings have raised questions about cytokine role in animals and the immunopathological effects these cytokines expression would have in canine ehrlichiosis. The findings of the present study suggest that E. canis Jaboticabal causes a dysfunction in the host’s immune system with high TNF-α expression, indicating its importance in the disease pathogenesis. Besides, treatment with doxycycline hyclate can reduce parasitemia to undetectable levels and this cytokine’s systemic effects.
References BEINEKE, A. et al. Increase of pro-inflammatory cytokine expression in non-demyelinating early cerebral lesions in nervous canine distemper. Viral Immunology, v. 21, n. 4, p. 401-410, 2008.
CASTRO, M. B. et al. Experimental acute canine monocytic erhlichiosis: clinicopathological and immunopathological findings. Veterinary Parasitology, v. 119, n. 1, p. 73-86. 2004. CHAMIZO, C. et al. Semi-quantitative analysis of multiple cytokines in canine peripheral blood mononuclear cells zby a single tube RT‑PCR. Veterinary Immunology and Immunopathology, v. 83, n. 3-4, p. 191‑202, 2001. DUMLER, J. S. et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and HGE agent as subjective synonyms of Ehrlichia phagocytophila. International Journal of Systematic and Evolutionary Microbiology, v. 51, n. 6, p. 2145-2165, 2001. EDDLESTONE, S. M. et al. Doxycycline clearance of experimentally induced chronic Ehrlichia canis infection in dogs. Journal of Veterinary Internal Medicine, v. 21, n. 6, p. 1237-1242, 2007. ELIAS, E. Diagnosis of ehrlichiosis from the presence of inclusion bodies or morulae of E. canis. Journal of Small Animal Practice, v. 33, n. 11, p. 540-543, 1991. FARIA, J. L. M. et al. Erlichia canis morulae and DNA detection in whole blood and spleen aspiration samples. Revista Brasileira de Parasitologia Veterinária, v. 19, n. 2, p. 98-102, 2010. FENG, H. M.; WALKER, D. H. Mechanisms of immunity to Ehrlichia muris: a model of monocytotropic ehrlichiosis. Infection and Immunity, v. 72, n. 2, p. 966-971, 2004. HARRUS, S. et al. Amplification of ehrlichial DNA from dogs 34 months after infection with Ehrlichia canis. Journal of Clinical Microbiology, v. 36, n. 1, p. 73-76, 1998. HARRUS, S. et al. Recent advances in determining the pathogenesis of canine monocytic ehrlichiosis. Journal of Clinical Microbiology, v. 37, n. 9, p. 2745-2749, 1999. JANEWAY Jr., C. A. et al. Immunobiology: the immune system in health and disease. 6th ed. London: Garland Science Publishing, 2005. 778 p. MARTIN, M. E.; CARSPERSEN, K.; DUMLER, J. S. Immunopathology and ehrlichial propagation are regulated by interferon-γ and interleukin-10 in a murine model of human granulocytic ehrlichiosis. American Journal of Pathology, v. 158, n. 5, p. 1881-1888, 2001.
74
Faria, J.L.M. et al.
MYLONAKIS, M. E. et al. Evaluation of cytology in the diagnosis of acute canine monocytic ehrlichiosis (Ehrlichia canis): a comparison between five methods. Veterinary Microbiology, v. 91, n. 2-3, p. 197‑204, 2003. NAKAGHI, A. C. H. et al. Canine ehrlichiosis: clinical, hematological, serological and molecular aspects. Ciência Rural, v. 38, n. 3, p. 766‑770, 2008.
Rev. Bras. Parasitol. Vet.
SCORPIO, D. G. et al. Innate immune response to Anaplasma phagocytophilum contributes to hepatic injury. Clinical and Vaccine Immunology, v. 13, n. 7, p. 806-809, 2006. TAJIMA, T.; RIKIHISA,Y. Cytokine responses in dogs infected with Ehrlichia canis Oklahoma strain. Annals of the New York Academy of Science, n. 1063, p. 429-432, 2005.
NEER, M. T.; HARRUS, S. Ehrlichiosis, Neorickettsiosis, Anaplasmosis and Wolbachia infection. In: GREENE, C. E. Infectious diseases of the dog and cat. 3rd ed. Philadelphia: Elsevier, 2006. P. 203-216.
UNVER, A.; HUANG, H.; RIKIHISA, Y. Cytokine gene expression by peripheral blood leukocytes in dogs experimentally infected with a new virulent strain of Ehrlichia canis. Annals of the New York Academy of Science, n. 1078, p. 482-486, 2006.
OLIVEIRA, D. et al. Anti-Ehrlichia canis antibodies detection by “DotELISA” in naturally infected dogs. Revista Brasileira de Parasitologia Veterinária, v. 9, n. 1, p. 1-5, 2000.
WANER, T. et al. Detection of platelet-bound antibodies in beagle dogs after artificial infection with Ehrlichia canis. Veterinary Immunology and Immunopatology, v. 77, n. 1-2, p. 145-150, 2000.
Research Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 75-77, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Use of a Mycoplasma suis-PCR protocol for screening a population of captive peccaries (Tayassu tajacu and Tayassu pecari) Uso de um protocolo de PCR para a detecção de Mycoplasma suis para avaliação de uma população de catetos e queixadas de cativeiro (Tayassu tajacu and Tayassu pecari) Rafael Felipe da Costa Vieira1*; Marcelo Beltrão Molento2; Ana Marcia Sa Guimarães3; Andrea Pires dos Santos3; Marcelo Bonat4; Manoel Lucas Javorouski4; Luciene Popp4; Leonilda Correia dos Santos5; Wanderlei Moraes5; Zalmir Silvino Cubas5; Thállitha Samih Wischral Jayme Vieira1; Odilon Vidotto1; Ivan Roque Barros Filho2; Alexander Welker Biondo2; Joanne Belle Messick3 Departamento de Medicina Veterinária Preventiva, Universidade Estadual de Londrina – UEL
1
Departamento de Medicina Veterinária, Universidade Federal do Paraná – UFPR
2
Department of Comparative Pathobiology, School of Veterinary Medicine, Purdue University
3
Zoológico Municipal de Curitiba, Prefeitura de Curitiba
4
Refúgio Biológico Bela Vista, Itaipu Binacional
5
Received June 24, 2010 Accepted November 5, 2010
Abstract Mycoplasma suis is a hemotropic bacteria of red blood cells and the causative agent of swine eperythrozoonosis. Diagnosis of infection may be reached by direct examination of blood smears; however, the use of polymerase chain reaction (PCR) of the 16S RNA gene of M. suis improves the sensitivity and specificity of detection. The aim of this study was to screen peccaries (Tayassu tajacu and T. pecari) for M. suis infection using a specific conventional PCR. A total of 28 blood samples from captive collared and white-lipped peccaries were collected, DNA extracted and a specific M. suis PCR assay performed. All samples were negatives by both blood smear examination and PCR testing. To verify the presence of amplifiable DNA, PCR for beta-actin gene was performed in all samples. This study was part of an active surveillance program, which is crucial for monitoring animal health status, particularly in wildlife species. Keywords: Eperythrozoonosis, collared peccaries (Tayassu tajacu), white-lipped peccaries (Tayassu pecari), wild pigs.
Resumo Mycoplasma suis é uma bactéria hemotrópica dos eritrócitos e é o agente causador da eperitrozoonose suína. O diagnóstico da infecção pode ser realizado pelo exame direto de esfregaços sanguíneos; entretanto, o uso da reação em cadeia da polimerase (PCR) baseada no gene 16S RNA de M. suis aumenta a sensibilidade e especificidade da detecção. O objetivo deste estudo foi avaliar catetos e queixadas (Tayassu tajacu e T. pecari) para a infecção por M. suis, utilizando PCR convencional específico. Um total de 28 amostras de sangue de catetos e queixadas de cativeiro foram coletadas, o DNA foi extraído e a PCR específica para a detecção de M. suis realizada. Todas as amostras foram negativas pelo esfregaço sanguíneo e PCR. Para verificar a presença de DNA amplificável, PCR para o gene da beta actina foi realizada em todas as amostras. Este estudo foi parte de um programa de vigilância ativa, o qual é crucial para o monitoramento do estado de saúde animal, particularmente em espécies selvagens. Palavras-chave: Eperitrozoonose, cateto (Tayassu tajacu), queixada (Tayassu pecari), porcos selvagens.
*Corresponding author: Rafael Felipe da Costa Vieira Programa de Pós-Graduação em Ciência Animal, Departamento de Medicina Veterinária Preventiva, Universidade Estadual de Londrina – UEL, Pr 445, Km 380, CEP 86051-990, Londrina - PR, Brazil; e-mail: vieirarfc@gmail.com
www.cbpv.com.br/rbpv
76
Vieira, R.F.C. et al.
Mycoplasma suis (formerly Eperythrozoon suis), the causative agent of eperythrozoonosis in swine, is a small pleomorphic bacterium that attaches to porcine red blood cells and it is known as hemotropic mycoplasma (hemoplasma) (MESSICK, 2004). Two different forms of the disease have been described in domestic pigs: an acute form with severe hemolytic anemia and a chronic stage without clear hematological abnormalities. In commercial pig farms, the chronic form of infection is most commonly found, possibly due to the use of tetracycline in the food. Chronically infected sows may show reproductive alterations and feeder pigs may present with decreased weight gain. The acute form of infection, however, is mostly seen following immunosuppressive events or splenectomy. Common clinical signs include anorexia, weakness, depression, anemia, icterus and fever (HENRY, 1979; HEINRITZI, 1999). Mycoplasma suis has never been successfully cultivated in vitro. Although the diagnosis of M. suis infection in pigs has been based on microscopic observation of organisms attached to red blood cells, this technique is neither sensitive nor specific, particularly in chronic stages of the disease. Amplification of M. suis 16S rRNA gene by polymerase chain reaction (PCR) has reportedly shown a higher specificity and sensitivity, even in chronic infections (MESSICK, 2004). Mycoplasma suis has been detected in domestic pigs throughout the world, including Brazil (GUIMARÃES et al., 2007; HOELZLE et al., 2007). Domestic pigs and peccaries belong to the same order Artiodactyla, but to distinct families Suidae and Tayassuidae, respectively. A single report documenting Eperythrozoon spp. infection in peccaries (Tayassu pecari) in Texas was based on the observation of inclusion-like bacteria attached to red blood cells by light microscopic examination of blood smears stained with Diff-Quick® (HANNON et al., 1985). Therefore, we hypothesized that M. suis may be able to infect wild pigs from the Tayassuidae family, including the collared peccary (T. tajacu) and white-lipped peccary (T. pecari), which are widely found in Brazil (FURTADO; KASHIVAKURA, 2007). The aim of this study was to screen peccaries for M. suis infection using two methods: blood smear examination and a species-specific PCR assay based on 16S rRNA gene of this microorganism. Anticoagulated (EDTA) blood samples were taken from six captive collared peccaries at the Bela Vista Sanctuary, Itaipu Binacional, Foz do Iguaçu, Paraná State, Brazil, and six whitelipped peccaries and 16 collared peccaries at the Curitiba Zoo, Curitiba, Paraná State, Southern Brazil, under specific chemical restraint (ketamine hydrochloride 10%, xylazine hydrochloride 2% and atropine sulfate 1%), and stored at 4 °C for two hours until hematological analyses. Thereafter, samples were stored at –20 °C until molecular procedures. Animal and laboratory procedures were approved and performed in accordance with the regulations of the Instituto Brasileiro do Meio Ambiente e Recursos Renováveis (IBAMA, 2010). Blood smears were prepared and stained by a quick Romanovskytype stain (Panótico Rápido®, Laborclin®, Pinhais, Paraná State, Brazil). They were examined using light microscopy at high magnification (40× and 100× objective lens). DNA was extracted from 200 µL blood using a commercially available kit according to the manufacturer’s instructions (IlustraTM GFXTM Genomic
Rev. Bras. Parasitol. Vet.
Blood DNA Purification Kit, GE Healthcare, Buckinghamshire, UK). To ensure successful DNA extraction and absence of PCR inhibitors, a PCR for the housekeeping gene, β-actin, was performed as previously described (GUIMARÃES et al., 2007). All samples were initially screened by PCR using a bacterial universal primer set (MESSICK et al., 1998). A PCR for the detection of 837bp fragment of the 16S rRNA gene of the M. suis was then performed as previously described (GUIMARÃES et al., 2007). All reactions were performed using DNA from an infected domestic pig and water as positive and negative controls, respectively. Direct examinations of blood smears from all animals were negative for Mycoplasma-like infection. Although housekeeping gene DNA was successfully amplified, all 28 peccary samples were negative by PCR for Mycoplasma spp. infection. Negative results found in both methods may not ensure that animals are free of M. suis infection. Although the examination of blood smears is not a sensitive method, 5/7 (71%) of the blood samples from peccaries in Texas were positive by blood smears examination for Eperythrozoon spp., but PCR amplification was not performed and it is unknown whether the organisms seen in blood smears were M. suis or a not-yet-described hemoplasma species. In another study, the examination of 120 blood smears collected from peccaries revealed no cases of parasitemia (HANNON et al., 1985). On the other hand, if the prevalence of M. suis infection is low (<1%), it is possible that too few animals were sampled to confidently find infected animals, even by PCR. It is also possible that peccaries are infected by other hemoplasma species, which were not be amplified by the primer set used in this study. In a study of pigs from commercial farms in southern Brazil the prevalence of M. suis infection was 18% by PCR, however when Southern Blot technique was used the prevalence increased to 33% (GUIMARÃES et al., 2007). Thus, it is important to mention that data obtained using only conventional PCR is limited, and the use of other more sensitive techniques combined is recommended. Active surveillance programs are crucial for monitoring animal health status, particularly in wild species. These animals may serve as sentinels for infectious agents, and since commercial farms of peccaries are becoming an area of investment, screening these animals to avoid disease spread and economic losses is imperative. In addition, the white-lipped peccary is listed in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES, 2010). Thus, sustained efforts are needed to protect the health and well-being of these animals.
References CITES. Apêndice II da Convenção sobre o comércio internacional das espécies da fauna e da flora selvagens ameaçadas de extinção. Disponível em: <http://www.cites.org/eng/app/appendices.shtml>. Acesso em: 17 jun. 2010. FURTADO, M. M.; KASHIVAKURA, C. K. Artiodactyla – Tayassuidae e Suidae (Cateto, Queixada, Javali) In: CUBAS, Z. S., SILVA, J. C. R.; CATÃO-DIAS, J. L. (Ed.). Tratado de animais silvestres: medicina veterinária. São Paulo: Roca, 2007. p. 615- 629.
v. 20, n. 1, jan.-mar. 2011
Use of a Mycoplasma suis-PCR protocol for screening a population of captive peccaries (Tayassu tajacu and Tayassu pecari) 77
GUIMARÃES, A. M. S. et al. Exploratory study of Mycoplasma suis (Eperythrozoon suis) on four commercial pig farms in southern Brazil. Veterinary Record, v. 160, n. 2, p. 50-53, 2007. HANNON, P. G. et al. Eperythrozoon in Captive Juvenile Collared Peccaries in Texas. Journal of Wildlife Diseases, v. 21, n. 4, p. 439‑440, 1985. HEINRITZI, K. Eperythrozoonosis. In: STRAW, B. E. et al. (Ed). Diseases of swine. 8th ed. Ames: Iowa State University Press, 1999. p. 413-418. HENRY, S. C. Clinical observations on eperythrozoonosis. Journal of the American Veterinary Medical Association, v. 174, n. 6, p. 601‑603, 1979. HOELZLE, L. E. et al. First LightCycler real-time PCR assay for the quantitative detection of Mycoplasma suis in clinical samples. Journal of Microbiological Methods, v. 70, n. 2, p. 346-354, 2007.
INSTITUTO BRASILEIRO DE MEIO AMBIENTE E DE RECURSOS RENOVÁVEIS - IBAMA. Lista oficial do Instituto Brasileiro de Meio Ambiente e de Recursos Renováveis (IBAMA) de espécies da fauna brasileira ameaçadas. Disponível em: <http:// www.mma.gov.br/port/sbf/fauna/index.cfm>. Acesso em: 17 jun. 2010. MESSICK, J. B. Hemotrophic mycoplasmas (hemoplasmas): a review and new insights into pathogenic potencial. Veterinary Clinical Pathology, v. 33, n. 1, p. 2-13, 2004. MESSICK, J. B.; BERENT, L. M.; COOPER, S. K. Development and evaluation of a PCR-based assay for detection of Haemobartonella felis in cats and differentiation of H. felis from related bacteria by restriction fragment length polymorphism analysis. Journal of Clinical Microbiology, v. 36, n. 2, p. 462-466, 1998.
Review ResearchArticle Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 78-81, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Frequency of species of the Genus Eimeria in naturally infected cattle in Southern Bahia, Northeast Brazil Frequência de espécies do gênero Eimeria em bovinos naturalmente infectados no Sudeste da Bahia, Nordeste do Brasil Valter dos Anjos Almeida1; Vanessa Carvalho Sampaio de Magalhães2; Elza de Souza Muniz Neta2; Alexandre Dias Munhoz3* Universidade Estadual de Santa Cruz – UESC, Bolsista CNPq
1
Universidade Estadual de Santa Cruz – UESC, Bolsista FAPESB
2
Departamento de Ciências Agrárias e Ambientais, Universidade Estadual de Santa Cruz – UESC
3
Received July 12, 2010 Accepted November 29, 2010
Abstract The aim of this study was to determine the presence of species of the genus Eimeria species in naturally infected bovines in Southern Bahia, Northeast Brazil. The study population comprised 117 Zebu crossbred cattle that belonged to 10 dairy herds with extensive or semi-extensive production systems. The modified Gordon and Whitlock technique was used to determine positive samples and number of oocysts per gram of feces. Statistical analyses were performed using the chi-square test with Yates correction and a 95% confidence interval. Thirty-nine cattle (33.33%) were positive, and ten different species were identified in infected animals: E. bovis (24.79%); E. canadensis (8.55%); E. zuernii (6.83%); E. ellipsoidalis (5.99%); E. cylindrica (3.42%); E. auburnensis (3.42%); E. brasiliensis (2.56%); E. bukidnonensis (1.71%); E. alabamensis (0.85%), and E. subspherica (0.85%). Higher parasitism was observed in animals up to one year of age (p = 0.005), but no animal presented clinical signs of the disease. As the presence of clinical eimeriosis was not evidenced and all animals were Zebu crossbred cattle from extensive or semi-extensive production systems, further studies should be conducted to investigate the effects of these factors on disease development. Keywords: Coccidian, dairy cattle, age group, frequency.
Resumo O objetivo deste estudo foi determinar a presença de espécies do gênero Eimeria em bovinos naturalmente infectados, na região Sudeste da Bahia, Nordeste do Brasil. A população do estudo incluiu 117 bovinos mestiços de raças Zebuínas que pertenciam a 10 fazendas leiteiras com sistemas de produção extensivo ou semiextensivo. A técnica de Gordon e Whitlock modificada foi utilizada para determinar as amostras positivas e o número de oocistos por grama de fezes. A análise estatística foi realizada utilizando o teste do qui-quadrado com correção de Yates e intervalo de confiança de 95%. Trinta e nove animais (33,33%) foram positivos, e dez diferentes espécies foram identificadas nos animais infectados: E. bovis (24,79%), E. canadensis (8,55%), E. zuernii (6,83%), E. ellipsoidalis (5,99% ), E. cylindrica (3,42%), E. auburnensis (3,42%), E. brasiliensis (2,56%), E. bukidnonensis (1,71%), E. alabamensis (0,85%) e E. subspherica (0,85%). Maior parasitismo foi observado em animais com até um ano de idade (p = 0,005), mas nenhum animal apresentou sinais clínicos que fossem compatíveis com a parasitose. Como não foi observado presença de eimeriose clínica e como todos os animais eram mestiços zebuínos e pertencentes ao sistema de criação extensivo ou semiextensivo, novos estudos devem ser conduzidos para comprovar a influência desses fatores no surgimento da doença. Palavras-chave: Coccídio, gado leiteiro, faixa etária, frequência.
*Corresponding author: Alexandre Dias Munhoz Departamento de Ciências Agrárias e Ambientais, Universidade Estadual de Santa Cruz – UESC, Campus Soane Nazaré de Andrade, Rod. Ilhéus Itabuna, Km 16, CEP 45662-000, Salobrinho, Ilhéus - BA, Brazil; e-mail: munhoz@uesc.br
www.cbpv.com.br/rbpv
v. 20, n. 1, jan.-mar. 2011
Frequency of species of the Genus Eimeria in naturally infected cattle in Southern Bahia, Northeast Brazil
79
Introduction
2. Sample collection and coproparasitologic test
Bovine eimeriosis is an intestinal illness caused by protozoan parasites from the genus Eimeria. Adult animals are usually asymptomatic carriers that often serve as a source of infection for juvenile animals, which are more susceptible to parasitosis (COURTNEY; ERNST; BENZ, 1976; CHIBUNDA et al., 1997; MATJILA; PENZHORN, 2002; DAUGSCHIES; NAJDROWSKI, 2005). During its biological cycle, the coccidian destroys the host’s enterocytes causing loss of blood, water, albumin and electrolytes from the intestinal lumen. The disease’s clinical manifestations, such as diarrhea, anorexia and prostration can cause significant production losses (FITZGERALD, 1980; DAUGSCHIES et al., 2004). Several Eimeria spp. have been shown to be pathogenic in cattle, causing several clinical symptoms (SAMSONHIMMELSTJERNA et al., 2006; SÁNCHEZ; ROMERO; FOUNROGE, 2008). Eimeria alabamensis has been reported to induce clinical coccidiosis (SVENSSON; UGGLA; PEHRSON, 1994; MARSHALL et al., 1998; SAMSONHIMMELSTJERNA et al., 2006) and E. auburnensis and E. ellipsoidalis have been occasionally associated with diarrhea in bovines (MIELKE; RUDNICK; HIEPE, 1993). However, the two most pathogenic species are E. bovis and E. zuernii (STOCKDALE et al., 1981; CHIBUNDA et al., 1997). Although the prevalence of Eimeria species generally reaches 100% in calves of a herd (CORNELISSEN et al., 1995; SAMSON-HIMMELSTJERNA et al., 2006), it varies according to location, climatic conditions, the host’s age (DAUGSCHIES; NAJDROWSKI, 2005), nutritional status and immunity, amount of ingested oocysts and population density (WARUIRU et al., 2000). Despite the fact that climate and environmental characteristics in the state of Bahia, northeastern Brazil, are extremely favorable to oocyst sporulation and the development of Eimeria, there are few known reports on the presence of this protozoan in bovines in this area. The present study aimed to determine the presence of Eimeria spp. in naturally infected bovines.
Fecal samples were directly removed from the rectal ampoule of each animal. The samples were collected in plastic bags, labeled and stored in a cool environment until processing. The modified Gordon and Whitlock technique, as described by Ueno and Gonçalves (1998), was used to determine positive samples and number of oocysts per gram of feces (OoPG), with the use of the McMaster camera.
Material and Methods 1. Study area and selection of participants The study was carried out in the municipalities of Ilhéus (14° 47’ SS and 39° 02’’ W) and Uruçuca (14° 36’’ SS and 39° 17’’ W), located in the Southern are of the State of Bahia, Northeastern Brazil, between March and July 2007. The cattle population from these cities comprise 18,293 animals out of 11,099,880 in Bahia (IBGE, 2008). Cattle were selected from 10 different dairy herds with extensive or semi-extensive production systems, with at least 10% of each herd taking part in the study. Dairy herds were selected from a list of the Agricultural Protection Agency of the State of Bahia (ADAB) and animals milking at the time of the visit were sampled by convenience, minimum age of five days and not selection criteria were applied. The study population included a total of 117 Zebu crossbred animals that were divided into two age groups: up to one year old; more than one year old. The study farms and animals were both selected using a non-random method.
3. Oocyst sporulation and species identification For sporulation, positive samples were placed in Petri dishes, conditioned with a solution of 2.5% potassium dichromate at room temperature and aired daily for up to two weeks. The centrifugal flotation technique was used (MENEZES; LOPES, 1995) to concentrate sporulated oocysts from each sample. Their counts were determined with the aid of a reticulum and an Olympus™ (USA) micrometric ruler. Species identification was performed based on their morphological characteristics according to Daugschies and Najdrowski (2005). There were morphologically characterized at least 10 oocysts of each species for identification.
4. Statistical analysis Statistical analyses were performed using the chi-square test with Yates correction (SAMPAIO, 1998). The odds ratio of the bivariate analysis was calculated with association measures and a 95% confidence interval.
Results A total of 39 (33.33%) animals were positive for Eimeria spp., with at least one representative animal from each farm (Table 1). Ten different species were identified in isolated or mixed infections, and their occurrence is presented in Table 2. Eimeria bovis was the most prevalent species found in 90% of the farms studied. In addition, this species infected 24.79% of all animals and was present in 84.6% of the positively infected cattle (Table 1 and 2). Only two (5.1%) of the positive animals (one young and one adult) had OoPG over 800. Higher parasitism was seen in young (51.22%) compared to adult animals (23.68%) (p = 0.005; Table 3). On examination none of the animals had clinical signs of eimeriosis. Even cattle infected by E. bovis and E. zuernii, which are the most pathogenic species in bovines (Stockdale et al., 1981) were asymptomatic.
Discussion This study is the first documentation of bovine eimeriosis in the municipalities of Ilhéus and Uruçuca in the State of Bahia, which has the largest contingent of bovines in Northeast Brazil. The prevalence of Eimeria spp. was similar to that reported in studies by Kasim and Al-Shawa (1985), Chibunda et al. (1997) and Gül, Çiçek and Kilinç (2008) but different from that (>40%) found by Munyua and Ngotho (1990), Rebouças, Grasso and Spósito Filha (1994) and Sánchez, Romero and Founroge (2008).
80
Almeida, V.A. et al.
Rev. Bras. Parasitol. Vet.
Table 1. Number of positive animals, identification of Eimeria species and number of oocysts per gram of feces in herds naturally infected by Eimeria spp. Southern Bahia, Northeastern Brazil. Farm 1 2 3 4 5 6 7 8 9 10
Total number of positive animals (%) 10/4 (40%) 10/4 (40%) 12/9 (75%) 14/6 (43%) 10/3 (30%) 10/2 (20%) 19/6 (32%) 09/1 (11%) 10/1 (10%) 13/3 (23%)
Eimeria spp. E. bovis; E. canadensis; E. ellipsoidalis; E. alabamensis; E. cylindrica; E. subspherica E. bovis; E. zuernii; E. ellipsoidalis; E. cylindrica E. bovis; E. zuernii; E. brasiliensis; E. auburnensis; E. canadensis E. bovis; E. auburnensis; E. zuernii; E. ellipsoidalis; E. canadensis E. bovis; E. bukidnonensis; E. ellipsoidalis; E. cylindrica; E. zuernii E. bovis; E. ellipsoidalis; E. brasiliensis E. bovis; E. zuernii; E. bukidnonensis; E. canadensis; E. auburnensis E. canadensis E. bovis; E. canadensis E. bovis; E. zuernii; E. canadensis
Table 2. Percentage of positive farms and infected animals and number of oocysts per gram of feces by each Eimeria spp. in naturally infected cattle. Southern Bahia, Northeastern Brazil. Species E. bovis E. canadensis E. zuernii E. ellipsoidalis E. cylindrica E. auburnensis E. brasiliensis E. bukidnonensis E. subspherica E. alabamensis
Infection rate (%) Farms Animals 90 24.79 60 8.55 50 6.83 50 5.99 30 3.42 30 3.42 20 2.56 20 1.71 10 0.85 10 0.85
OoPG (Min-Max) 33-5450 17-700 5-3374 14-1557 29-519 11-150 50-100 75-150 29-29 29-29
Table 3. Presence of Eimeria spp. in two different age groups of naturally infected cattle. Southern Bahia, Northeastern Brazil. Age group
Eimeria spp. Positive (%) Negative (%) 21 (51.22) 20 (48.78) 18 (23.68) 58 (76.32) 39 (33.33) 78 (66.67)
< 1 year-old > 1 year-old Total (%) p = 0.005 χ2 7.89 OR: 3.38 1.4 < OR < 8.26
Total (%) 41 (35.04) 76 (64.96) 117 (100)
Among the species identified in this study, E. bovis, E. zuernii, E. canadensis and E. ellipsoidalis were also the most prevalent in other Brazilian studies (FIGUEIREDO; FREIRE; GRISI, 1984, 1985; CARNEIRO et al., 1988; REBOUÇAS et al., 1988; CERQUEIRA; LIMA; FACURY FILHO, 1989; REBOUÇAS et al., 1994). Except for E. canadensis, these species are commonly identified in other countries (KASIM; AL-SHAWA, 1985; MUNYUA; NGOTHO, 1990; CHIBUNDA et al., 1997; MATJILA; PENZHORN, 2002; SÁNCHEZ; ROMERO; FOUNROGE, 2008), evidencing their wide geographical distribution. In fact, E. bovis is often the most prevalent species found in infected animals in various parts of the world (FIGUEIREDO; FREIRE; GRISI, 1984, 1985; KASIM; AL-SHAWA, 1985; CERQUEIRA; LIMA; FACURY FILHO, 1989; MUNYUA; NGOTHO, 1990; REBOUÇAS; GRASSO;
OoPG (Min-Max) 100-700 100-10,900 50-400 50-800 300-4350 100-200 50-200 400 50 100-800
SPÓSITO FILHA, 1994; CHIBUNDA et al., 1997; MATJILA; PENZHORN, 2002; SAMSON-HIMMELSTJERNA et al., 2006; SÁNCHEZ; ROMERO; FOUNROGE, 2008), which corroborates our study findings. High parasitism in calves is corroborated by the observations of Rebouças, Grasso and Spósito Filha (1994). They found that 55.8% of animals up to 18 months of age and only 30.8% of those over 31 months of age were positive. These data support the hypothesis that young animals have more susceptible to infection by this parasite (COURTNEY; ERNST; BENZ, 1976). Some studies have reported the presence of Eimeria oocysts in 70% (MATJILA; PENZHORN, 2002) and 100% of samples from young animals (SAMSON-HIMMELSTJERNA et al., 2006). A potential explanation for these findings is that coccidiosis develops as a result of immunosuppression that naturally occurs during an animal’s weaning (PARKER et al., 1984), which is followed by a gradual decline in the number of eliminated oocysts as they age (FIGUEIREDO; FREIRE; GRISI, 1985). Previous cross-sectional studies of Eimeria spp. in Brazil have not identified any cases of clinical eimeriosis in infected bovines, which is probably due to the low amount of oocysts that are eliminated by cattle (FIGUEIREDO; FREIRE; GRISI, 1985; REBOUÇAS; GRASSO; SPÓSITO FILHA, 1994). Although clinical symptoms are common mainly in calves, especially those between 20 and 35 days old (SÁNCHEZ; ROMERO; FOUNROGE, 2008), with excretion of large numbers of oocysts (CHIBUNDA et al., 1997; SAMSON-HIMMELSTJERNA et al., 2006), only one calf (10,900 OoPG) and one adult cow (4,350 OoPG) without clinical symptoms eliminated moderate amounts of oocysts in the present study. These results contrast with those found in intensive production systems in animals of European origin (SAMSON-HIMMELSTJERNA et al., 2006; SÁNCHEZ; ROMERO; FOUNROGE, 2008). This study evidenced the presence of Eimeria infection in herds in Bahia, with a higher frequency in young animals. As the presence of clinical eimeriosis was not evidenced and all animals were Zebu crossbred cattle from extensive or semi-extensive production systems, further studies should be conducted to investigate the effects of these factors on disease development as infected cattle eliminate a small number of oocysts in their feces and, consequently, are asymptomatic.
v. 20, n. 1, jan.-mar. 2011
Frequency of species of the Genus Eimeria in naturally infected cattle in Southern Bahia, Northeast Brazil
81
Acknowledgements
KASIM, A. A.; AL-SHAWA, Y. R. Prevalence of Eimeria in faeces of cattle in Saudi Arabia. Veterinary Parasitology, v. 17, n. 2, p. 95-99, 1985.
We thank the Agricultural Protection Agency of the State of Bahia (ADAB). This study was supported by the Universidade Estadual de Santa Cruz (UESC). Elza S. M. Neta and Valter A. Almeida were recipients of fellowships from Fundação de Amparo à Pesquisa do Estado da Bahia (FAPESB) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), respectively.
MARSHALL, R. N. et al. Bovine coccidiosis in calves following turnout. The Veterinary Record, v. 143, n. 13, p. 366-367, 1998. MATJILA, P. T.; PENZHORN, B. L. Occurrence and diversity of bovine coccidia at three localities in South Africa. Veterinary Parasitology, v. 104, n. 3, p. 93-102, 2002.
References
MENEZES, R. C. A. A.; LOPES, C. W. G. Epizootiologia da Eimeria arloingi em caprinos na microrregião Serrana Fluminese, Rio de Janeiro, Brasil. Revista da Universidade Rural - Série Ciências da Vida, v. 17, n. 1, p. 2-12, 1995.
CARNEIRO, J. R. et al. Eimeria em bovinos mestiços Zebu-Holandês, procedentes da bacia leiteira de Goiânia. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 40, n. 6, p. 355-360, 1988.
MIELKE, D.; RUDNICK, J.; HIEPE, T. Untersuchungen zur Immunprophylaxe bei der Kokzidiose des Rindes. Mh. Veterinary Medicine, v. 48, p. 425-429, 1993.
CERQUEIRA, M. M. O. P.; LIMA, J. D.; FACURY FILHO, E. J. Controle da coccidiose de bovinos criados extensivamente através da administração contínua de anticoccídicos no sal mineral. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 41, n. 6, p. 483‑492, 1989.
MUNYUA, W. K.; NGOTHO, J. W. Prevalence of Eimeria species in cattle in Kenya. Veterinary Parasitology, v. 35, n. 1-2, p. 163-168, 1990.
CHIBUNDA, R. T. et al. Eimeriosis in dairy cattle farms in Morogoro municipality of Tanzania. Preventive Veterinary Medicine, v. 31, n. 3-4, p. 191-197, 1997. CORNELISSEN, A. W. C. A. et al. An observational study of Eimeria species in housed cattle on Dutch dairy farms. Veterinary Parasitology, v. 56, n. 1-3, p. 7-16, 1995. COURTNEY, C. H.; ERNST, J. V.; BENZ, G. W. Redescription of oocysts of the bovine coccidia Eimeria bukidnonensis Tubangui, 1931 and E. wyomingensis Huizinga and Winger, 1942. The Journal of Parasitology, v. 62, n. 3, p. 372-376, 1976. DAUGSCHIES, A. et al. Prevalence of Eimeria spp. in sows at pigletproducing farms in Germany. Journal of Veterinary Medicine B, v. 51, n. 3, p. 135-139, 2004.
PARKER, R. J. et al. Coccidiosis associated with post-weaning diarrhoea in beef calves in a dry tropical region. Australian Veterinary Journal, v. 61, n. 6, p. 181-183, 1984. REBOUÇAS, M. M. et al. Eimerideos parasitas de bovinos no Estado de São Paulo, Brasil (Apicomplexa: Eimeriidae). Arquivos do Instituto Biológico, v. 55, p. 43-47, 1988. REBOUÇAS, M. M.; GRASSO, L. M. P. S.; SPÓSITO FILHA, E. Prevalência e distribuição de protozoários do gênero Eimeria (Apicomplexa: Eimeriidae) em bovinos nos municípios de Altinópolis, Taquaritinga, São Carlos e Guairá – Estado de São Paulo, Brasil. Revista Brasileira de Parasitologia Veterinária, v. 3, n. 2, p. 125-130, 1994. SAMPAIO, I. B. M. (Ed.). Estatística aplicada à experimentação animal. Belo Horizonte: Fundação de Ensino e Pesquisa em Medicina Veterinária e Zootecnia, 1998. 221 p.
DAUGSCHIES, A.; NAJDROWSKI, M. Eimeriosis in Cattle: Current Understanding 2005. Journal of Veterinary Medicine B, v. 52, n. 10, p. 417-427, 2005.
SAMSON-HIMMELSTJERNA, V. G. et al. Clinical and epidemiological characteristics of Eimeria infections in first-year grazing cattle. Veterinary Parasitology, v. 136, n. 3-4, p. 215-221, 2006.
FIGUEIREDO, P. C.; FREIRE, N. M. S.; GRISI, L. Eimerias de bovinos leiteiros no estado do Rio de Janeiro: Técnica de diagnóstico e espécies identificadas. Atas da Sociedade de Biologia do Rio de Janeiro, v. 24, p. 3-10, 1984.
SÁNCHEZ, R. O.; ROMERO, J. R.; FOUNROGE, R. D. Dynamics of Eimeria oocyst excretion in dairy calves in the Province of Buenos Aires (Argentina), during their first 2 months of age. Veterinary Parasitology, v. 151, n. 2-4, p. 133-138, 2008.
FIGUEIREDO, P. C.; FREIRE, N. M. S.; GRISI, L. Variação da parasitose por Eimerias em bovinos holando-zebu de acordo com a faixa de idade dos hospedeiros. Atas da Sociedade de Biologia do Rio de Janeiro, v. 25, p. 83-88, 1985.
STOCKDALE, P. H. G. et al. Some pathophysiological changes associated with infection of Eimeria zuernii in calves. Canadian Journal of Comparative Medicine, v. 45, n. 1, p. 34-37, 1981.
FITZGERALD, P. R. The economic impact of coccidiosis in domestic animals. Advances in Veterinary Science and Comparative Medicine, v. 24, p. 121-143, 1980.
SVENSSON, C.; UGGLA, A.; PEHRSON, B. Eimeria alabamensis infection as a cause of diarrhoea in calves at pasture. Veterinary Parasitology, v. 53, n. 1-2, p. 33-43, 1994.
GÜL, A., ÇIÇEK, M., KILINÇ, Ö. Prevalence of Eimeria spp., Cryptosporidium spp. and Giardia spp. in Calves in the Van Province. Turkiye Parazitolojii Dergisi, v. 32, n. 3, p. 202-204, 2008.
UENO, H.; GONÇALVES, P. C. Manual para diagnóstico das helmintoses de ruminantes. 4. ed. Tóquio: Japan International Cooperation Agency, 1998. 143 p.
INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATÍSTICA – IBGE. Cidades@. Brasília, DF: IBGE, 2008. Disponível em: <http:// www.ibge.gov.br/cidadesat/topwindow.htm?1>. Acesso em: 09 set. 2010.
WARUIRU, R. M. et al. The prevalence and intensity of helminth and coccidial infections in dairy cattle in central Kenya. Veterinary Research Communications, v. 24, n. 1, p. 39-53, 2000.
Review ResearchArticle Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 82-84, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
Myxobolus sp. (Myxozoa) in the circulating blood of Colossoma macropomum (Osteichthyes, Characidae) Myxobolus sp. (Myxozoa) no sangue circulante de Colossoma macropomum (Osteichthyes, Characidae) Patricia Oliveira Maciel1,2*; Elizabeth Gusmão Affonso2; Cheila de Lima Boijink3; Marcos Tavares-Dias4; Luis Antonio Kioshi Aoki Inoue3 Embrapa Pesca e Aquicultura, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA
1
Departamento de Aquicultura, Instituto Nacional de Pesquisa na Amazônia – INPA
2
Embrapa Amazônia Ocidental, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA
3 4
Embrapa Amapá, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA
Received July 28, 2010 Accepted December 3, 2010
Abstract Myxosporea parasitize many organs in fresh and saltwater fish. Species of the genus Myxobolus parasitizing the gills and other organs of the tambaqui Colossoma macropomum have been described. In the present study, blood smears were made from juvenile tambaqui and were stained with May Grunwald-Giemsa-Wright in order to identify myxozoan parasites. Out of a total of 36 fish examined, one specimen (2.7%) that was reared in a cage presented spores that were identified as M. colossomatis, whereas fish kept in 250 L tanks showed prevalence of 5.5%. This is the first report of M. colossomatis in the blood of farmed tambaqui in the Amazon region. These results indicate that myxozoan parasites should also be investigated in fish blood smears. Some myxosporean species may cause diseases in fish, and these species need to be identified so that adequate preventive sanitary control can be instituted. Keywords: Fish farming, freshwater fish, parasites, Myxobolus.
Resumo Mixosporídeos parasitam diversos órgãos de peixes de água doce e salgada, tendo sido descrita espécie do gênero Myxobolus parasitando brânquias e outros órgãos de tambaqui Colossoma macropomum. No presente trabalho, extensões sanguíneas de juvenis de tambaquis foram confeccionadas e coradas com May Grunwald-Giemsa-Wright para identificação de parasitos myxozoários. Do total de 36 peixes examinados, um espécime (2,7%) cultivado em tanquerede apresentou esporos identificados como M. colossomatis, enquanto os peixes mantidos em tanques com 250 L apresentaram prevalência de 5,5%. Esse é o primeiro registro de M. colossomatis no sangue de tambaqui cultivado na Amazônia. Esses resultados indicam que parasitos Myxozoa devem ser também investigados em extensões sanguíneas. Algumas espécies de mixosporídeos podem causar doença em peixes, sendo necessária a identificação da espécie para um adequado manejo sanitário preventivo. Palavras-chave: Piscicultura, peixe de água doce, parasitas, Myxobolus.
Introduction The tambaqui (Colossoma macropomum) is one of the mostconsumed fish in the central Amazon region. For this reason, it is sensitive to diminished natural stocks in the areas surrounding large cities like Manaus, and this favors fish farming on a variety of scales, as a commercially profitable alternative (ROUBACH et al., 2003). Currently, as well as being the third most farmed species in Brazil, it is the native species most reared in the Northern *Corresponding author: Patricia Oliveira Maciel Empresa Brasileira de Pesquisa Agropecuária, Embrapa Pesca e Aquicultura, Av. JK ACSO 1, 103 S Conj 1, Lote 17, Piso 1, Centro, CEP 77015-012, Palmas - TO, Brazil; e-mail: patricia.maciel@embrapa.br
region of Brazil. Modern farming techniques have been developed and adopted by rural producers, with significant profits in the regional aquiculture sector (OSTRENSKY et al., 2008). However, problems relating to parasitic diseases among farmed fish still occur frequently, especially diseases that are triggered by improper management. This has stimulated a search for information on the parasites that may affect tambaqui, such as myxosporean parasites (TAVARES‑DIAS et al., 2006; THATCHER, 2006). Among these, the genus Myxobolus has the greatest diversity, with 450 species described (BÉKÉSI; SZÉKELY; MOLNÁR, 2002; MOLNÁR, 2002). Some of the species of Myxobolus are known to be pathogenic, such as M. cerebralis, which causes specific diseases www.cbpv.com.br/rbpv
v. 20, n. 1, jan.-mar. 2011
Myxobolus sp. (Myxozoa) in the circulating blood of Colossoma macropomum (Osteichthyes, Characidae)
83
in the fry of regional and exotic species, such as the whirling disease of salmonids. Myxobolosis of the tambaqui, caused by Myxobolus colossomatis, was first found in Brazil by Molnár and Békési (BÉKÉSI; SZÉKELY; MOLNÁR, 2002). With the aim of contributing towards the knowledge of parasitic diseases among tambaqui in captivity, the present study investigated blood smears to diagnose and identify myxosporean parasites.
Material and Methods Samples were taken from 36 fish (216 ± 7 g and 22 ± 0.4 cm) that were reared in cages of volume 1 m3 laid out in a catch-and-pay lagoon, and from 90 fish (32.0 ± 8.1 g and 10.1 ± 0.9 cm) that were kept in 250 L PVC tanks with constant renewal of the water, under laboratory conditions. The samples were collected in the first and second halves of the year 2008, respectively, in the municipality of Manaus, Amazonas. In both of the rearing schemes, the first were fed every day, at two times of the day, with commercial feed containing 32% raw protein. The parameters relating to water quality in the lagoon were: temperature 29.1 ± 0.8 °C, dissolved oxygen 8.0 ± 0.7 mg.L–1 and pH 5.2 ± 1.5; and in the cages: temperature 26.0 ± 0.7 °C, dissolved oxygen 7.5 ± 0.8 mg.L–1; conductivity 22.2 ± 2.3 µS.cm–3; pH 7.0 ± 0.1; CO2 6.7 ± 2.8 mg.L–1; total alkalinity 1.65 mg.L–1 and total hardness 1.33 ± 0.30 mg.L–1. Blood samples were obtained from the fish by means of puncturing the caudal vein, using syringes containing 10% EDTA. Blood smears were produced and subjected to panchromatic staining using the May-Grünwald-Giemsa-Wright method (TAVARES-DIAS; MORAES, 2003), in order to identify myxozoan spores in accordance with the recommendations of Molnár and Békési (1993) and Thatcher (2006), while the prevalence was calculated in accordance with Bush et al. (1997). The spores were measured using specific software for the Olympus BX51 microscope, in accordance with the recommendations of Békési, Székely and Molnár (2002).
Results, Discussion and Conclusion The blood smears from the tambaqui in the cage system and in the laboratory (PVC tanks) revealed that spores with two polar capsules were present. These were identified as parasites of the genus Myxobolus (Myxobolidae: Myxozoa). Figure 1 shows a blood smear from a caged tambaqui, in which myxobolid spores that are on the point of bursting inside a blood cell can be seen. The spores that were found (n = 4) had a mean length of 9.55 µm (range: 9.08 – 10.28), a mean width of 4.98 µm (range: 4.64 – 5.11), a polar capsule length of 5.52 µm (range: 4.90 – 6.30) and polar capsule width of 1.57 µm (range: 1.31 – 1.70). The prevalences of Myxobolus sp. in the blood smears from the tambaqui in the cage system and laboratory were 2.7% and 5.5%, respectively. The species Myxobolus colossomatis has been described as a parasite of the gills and other organs in tambaqui, pacu (Piaractus mesopotamicus) and their hybrid, the tambacu (MOLNÁR; BÉKÉSI, 1993; MARTINS et al., 1999; BÉKÉSI; SZÉKELY; MOLNÁR, 2002). Myxosporeans parasitize various organs of fresh and saltwater fish and can be found in intercellular spaces
Figure 1. Blood smear from tambaqui (Colossoma macropomum) stained with May-Grünwald-Giemsa-Wright, showing spores of Myxobolus sp. inside a blood cell that is on the point of bursting. Bar = 10 µm.
and/or inside cells, in blood vessels, the swim bladder, gills, spleen, liver, kidney and musculature (NOGA, 2000; AZEVEDO; CORRAL; MATOS, 2002; LUQUE, 2004; MATOS et al., 2004; TAVARES-DIAS et al., 2006; THATCHER, 2006). The pathogenesis of infections due to Myxobolus involves absorption of the cells of the parasitized organ, thereby reducing its functional capacity (THATCHER, 1981), as well as an advanced stage of lysis and even tissue necrosis, which suggests that the host could be killed by the parasitism (MATOS et al., 2004). In pacu, there have been reports of hemorrhage in the primary gill lamellae and pallor in parasitized liver, kidney and spleen, along with histological alterations in these tissues (MARTINS et al., 1999). However, it has been emphasized that in most cases, the infection is asymptomatic (TAVARES-DIAS et al., 2006; THATCHER, 2006). The diagnosis of myxosporidiosis is made mainly through identifying the spore of the parasite in the tissue of the target organ, in imprints of organs stained with Giemsa, in histopathological examinations or in freshly observed scrapings from mucosa and gills (MARTINS et al., 1999; NOGA, 2000; EIRAS; TAKEMOTO; PAVANELLI, 2006; TAVARES-DIAS et al., 2006). In the literature, it was not possible to find any relationship between the prevalence of Myxobolus sp. and the form or condition of rearing tambaqui. Using histopathological techniques, Martins et al. (1999) found a low prevalence (5.6%) of myxosporeans in tambaqui farmed in the State of São Paulo, in contrast with the high prevalence (97.3%) in pacu. Low prevalence of M. colossomatis in tambaqui gills (2.9%) was also reported by Matsunae (2000). On the other hand, Tavares-Dias et al. (2006) found higher prevalence of this myxosporean in the gills and skin of cultivated tambaqui from Experimental Estation of Fish Farm (46.6%). However, in addition to the target organs cited, blood stages of myxosporeans can also be detected in fresh blood (EIRAS; TAKEMOTO; PAVANELLI, 2006). In the present study, the possibility of
84
Maciel, P.O. et al.
blood contamination through the presence of Myxobolus sp., in the form of plasmodium or free spores in the mucosa, epithelium or connective tissues affected during puncture of the caudal vein. However, some studies (MARTINS et al., 1999; MATSUNAE, 2000; TAVARES‑DIAS et al., 2006) have described prevalences of M. colossomatis in apparently healthy tambaqui, using diagnostic methods differing from those used in the present study (which used blood smears). These other studies suggest that there is a possibility that the spores found in the present study were developmental stages of Myxobolus sp. that may form part of its life cycle (plasmodium or free spores) in the peripheral blood of the fish, as reported by Molnár (2002) in relation to another myxosporean species. In addition, blood tissue is also a form of dispersion of myxosporean parasites to other organs in fish. However, it has been suggested that the technique for detecting spores in fresh blood is questionable, since low-intensity parasitosis or apparently asymptomatic infections may go unnoticed (EIRAS; TAKEMOTO; PAVANELLI, 2006). Thus, diagnoses of myxosporeans in fish blood have not been documented with any frequency in the literature. The present study is the first report on Myxobolus sp. in the peripheral blood of tambaqui, and it indicates that the blood is a tissue that should also be investigated for the presence of these parasites. Myxosporeans are identified at species level with the aid of a transmission electron microscope or molecular biology (AZEVEDO; CORRAL; MATOS, 2002; ADRIANO et al., 2009). The spore measurements found in the blood smears recorded in the present study were smaller than those described for M. colossomatis by Molnár and Békési (1993). Therefore, even with frequent occurrences of M. colossomatis in farmed and wild tambaqui, involvement of this species of myxosporean cannot be confirmed in the present study: some of the tools cited earlier would be required for this. Nonetheless, to add information on Myxobolus sp., and in the knowledge that some species of myxosporeans with affinity for fish compromise the health of these fish, studies that broaden the knowledge of these parasites to help in adequate preventive sanitary management are of great importance, thereby avoiding economic losses in commercial fish farming in the future.
Acknowledgements To Dr. Eliana Feldberg and her MSc students Carlos Henrique Schneider and Maria Leandra Terêncio, at the Animal Genetics Laboratory of the National Institute of Amazonian Research, for assistance in measuring the spores.
References ADRIANO, E. A. et al. Myxobolus cordeiroi n. sp., a parasite of Zungaro jahu (Siluriformes: Pimelodiade) from Brazilian Pantanal: Morphology, phylogeny and histopathology. Veterinary Parasitology, v. 162, n. 3-4, p. 221-229, 2009. AZEVEDO, C.; CORRAL, L.; MATOS, E. Myxobolus desaequalis n. sp. (Myxozoa, Myxosporea), parasite of the Amazonian freshwater fish, Apteronotus albifrons (Teleostei, Apteronotidae). Journal Eukaryotic Microbiology, v. 49, n. 6, p. 485-488, 2002.
Rev. Bras. Parasitol. Vet.
BÉKÉSI, L.; SZÉKELY, C.; MOLNÁR, K. Atuais conhecimentos sobre Myxosporea (Myxozoa), parasitas de peixes. Um estágio alternativo dos parasitas no Brasil. Brazilian Journal Veterinary Research Animal Science, v. 39, n. 5, p. 271-276, 2002. BUSH, A. O. et al. Parasitology meets ecology on its own terms: Margolis et al. Revisited. Journal of Parasitology, v. 83, n. 4, p. 575-583, 1997. EIRAS, J. C.; TAKEMOTO, R. M.; PAVANELLI, G. C. Métodos de estudo e técnicas laboratoriais em parasitologia de peixes. 2. ed. Universidade Estadual de Maringá, 2006. 199 p. LUQUE, J. L. Biologia, epidemiologia e controle de parasitos de peixes. Revista Brasileira de Parasitologia Veterinária, v. 13, Supl. 1, p. 161‑165, 2004. MARTINS, M. L. et al. Comparative evaluation of the susceptibility of cultivated fishes to the natural infection with myxosporean parasites and tissue changes in the host. Revista Brasileira de Biologia, v. 59, n. 2, p. 263-269, 1999. MATOS, E. et al. Microorganismos Parasitos de Animais Aquáticos da Amazônia. In: RANZANI-PAIVA, M. J. T.; TAKEMOTO, R. M.; LIZAMA, M. A. Sanidade de Organismos Aquáticos. São Paulo, 2004. p. 159-178. MATSUNAE, J. Monitoramento da parasitofauna de alevinos de tambaqui, Colossoma macropomum (Cuvier, 1818), em barragem de igarapé de terra firme, Iranduba – AM. 2000. 71 f. Dissertação (Mestrado)-Instituto Nacional de Pesquisas da Amazônia, Universidade Federal do Amazonas. MOLNÁR, K. Site preference of fish myxosporeans in the gill. Diseases of Aquatic Organisms, v. 48, n. 3, p. 197-207, 2002. MOLNÁR, K.; BÉKÉSI, L. Description of a new Myxobolus species, M. colossomatis n. sp. from the teleost Colossoma macropomum of the Amazon River basin. Journal of Applied Ichthyology, v. 9, n. 1, p. 57‑63, 1993. NOGA, E. J. Fish disease: diagnosis and treatment. Iowa, U.S.A.: Blackwell Publishing, 2000. 367 p. OSTRENSKY, A.; BORGHETTI, J. R.; SOTO, D. Aqüicultura no Brasil. O desafio é crescer. Brasília, DF, 2008. 276 p. ROUBACH, R. et al. Aquaculture in Brazil. World Aquaculture, n. 34, p. 28-35. 2003. TAVARES-DIAS, M.; MORAES, F. R. Características hematológicas da Tilapia rendalli Boulenger, 1896 (Osteichthyes: Cichlidae) capturada em “Pesque-pague” de Franca, São Paulo, Brasil. Bioscience Journal, v. 19, n. 1, p. 107-114, 2003. TAVARES-DIAS, M. et al. Ocorrência de ectoparasitos em Colossoma macropomum Cuvier, 1818 (Characidae) cutivados em estação de piscicultura na Amazônia Central. CIVA, 2006. p. 726-731. Disponível em: <http://www.revistaaquatic.com/civa2006/coms/ completo.asp?cod=150>. THATCHER, V. E. Patologia de peixes da Amazônia Brasileira, 1. Aspectos gerais. Acta Amazônica, v. 11, n. 1, p. 125-140, 1981. THATCHER, V. E. Amazon fish parasites. Sofia-Moscow: Pensoft Publishers, 2006. 508 p.
Research Note Rev. Bras. Parasitol. Vet., Jaboticabal, v. 20, n. 1, p. 85-87, jan.-mar. 2011 ISSN 0103-846X (impresso) / ISSN 1984-2961 (eletrônico)
First record of Trypanosoma sp. (Protozoa: Kinetoplastida) in tuvira (Gymnotus aff. inaequilabiatus) in the Pantanal wetland, Mato Grosso do Sul State, Brazil Primeiro registro de Trypanosoma sp. (Protozoa: Kinetoplastida) em tuvira (Gymnotus aff. inaequilabiatus) no Pantanal, Mato Grosso do Sul, Brasil Santiago Benites de Pádua1; Márcia Mayumi Ishikawa2*; Fabiana Satake3; Gabriela Tomas Jerônimo4; Fabiana Pilarski1 Centro de Aquicultura, Universidade Estadual Paulista – UNESP
1
Embrapa Agropecuária Oeste, Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA
2
Centro de Ciências Agrárias, Universidade Federal da Paraíba – UFPB
3
Laboratório AQUOS, Departamento de Aquicultura, Universidade Federal de Santa Catarina – UFSC
4
Received December 7, 2010 Accepted January 24, 2011
Abstract The blood infection by Trypanosoma sp. in tuvira (Gymnotus aff. inaequilabiatus) from the Pantanal wetland was reported in this study. Ten fish from the Paraguay River in the Pantanal were evaluated for the presence of hemoflagellates. Trypomastigotes of Trypanosoma sp. were observed in blood smears from three fish (30% prevalence) and some forms were seen to be undergoing division. Using the diagnostic methods of fresh examination and blood centrifugation in hematocrit capillary tubes, the prevalence rate was 80%. This is the first report of Trypanosoma sp. in tuvira in Brazil. Keywords: Hemoflagellate, hemoprotozoa, live bait.
Resumo O objetivo do presente estudo foi reportar a infecção por Trypanosoma sp. em tuviras (Gymnotus aff. inaequilabiatus) oriundas do Pantanal Sul-mato-grossense, Brasil. Dez peixes provenientes do rio Paraguai, Pantanal Sul-mato-grossense, foram avaliados quanto à presença de hemoflagelados. Tripomastigotas de Trypanosoma sp. foram observados nas extensões sanguíneas de três peixes (30% de prevalência), e algumas formas encontravam-se em divisão. Por meio do exame a fresco e da centrifugação do sangue em capilar de hematócrito como métodos para diagnóstico, a taxa de prevalência foi de 80%. Esse é o primeiro relato de Trypanosoma sp. em tuviras no Brasil. Palavras-chave: Hemoflagelado, hemoprotozoário, isca viva.
Introduction Trypanosomes are kinetoplastid protozoa that cause blood infection in many species of fish worldwide, including both freshwater species (FIGUEROA et al., 1999; SMIT et al., 2004; GU et al., 2007; KONAS et al., 2010) and marine species (SAUNDERS, 1959; OVERATH et al., 1999; KARLSBAKK, 2004; BURRESON, 2007). Transmission of these hemoflagellates between fish has been attributed to different species of leeches. The leech Hemiclepsis marginata is responsible for transmission of T. carassii among European carp (OVERATH et al., 1999). In Canada, Actinobdella inequiannulata is the most abundant leech species *Corresponding author: Márcia Mayumi Ishikawa Doutorado em Parasitologia Veterinária, Laboratório de Piscicultura, Embrapa Agropecuária Oeste, BR 163, Km 253,6, CP 661, CEP 79804-970, Dourados - MS, Brazil; e-mail: marcia@cpao.embrapa.br
and is the specific vector of T. catostomi for Catostomus commersoni (JONES; WOO 1992). The main vector of trypanosomiasis in fish belonging to the family Loricariidae in Brazil is the leech Batracobdella gemmata (D’AGOSTO; SERRA-FREIRE 1993). The tuvira (Gymnotus aff. inaequilabiatus) (Teleostei: Gymnotidae) is a knifefish native species in the Pantanal basin that inhabits lentic environments, with turbid water and aquatic vegetation that is rich in organic matter coming from the flooding process. This species has economic importance because of its use as live bait, driven by the demand for sport fishing in the Pantanal, such as for the dourado (Salminus brasiliensis) and for two catfish species: pintado (Pseudoplatystoma corruscans) and cachara (Pseudoplatystoma reticulatum). However, constant exploitation has caused its numbers to diminish in its natural environment (MORAES; ESPINOSA, 2001). Production in captivity may be www.cbpv.com.br/rbpv
86
Pádua, S.B. et al.
an economic alternative for riverbank peoples, and it may diminish the capture pressure on the natural environment. However, lack of information about health issues relating to tuvira has limited their rearing. The aim of the present study was to report the blood infection by Trypanosoma sp. in tuvira (G. aff. inaequilabiatus) from the Pantanal wetland, Mato Grosso do Sul State, Brazil.
Material and Methods Tuvira specimens that had been caught by bait gatherers in the Paraguay river (18° 04’ 15,00” S and 57° 28’ 17,00” W), in the Pantanal, and had been put on the market in the Corumbá city, were acquired and transported to the Fish-farming Laboratory of Embrapa Western Region Agriculture, located in the Dourados, Mato Grosso do Sul State. The fish were kept in round fiberglass tanks with 1000 L of capacity, which were supplied with a continuous flow of water coming from an artesian well (10 L.min–1). To diagnose the presence of hemoflagellates, ten fish specimens were subjected to venous puncture of the caudal vein, to collect blood. Blood smears on slides were produced in duplicate and stained panchromatically with the May Grünwald-GiemsaWright combination, and were then evaluated under an optical photomicroscope (Nikon® E200, Japan). Fresh blood between a slide and a coverslip was also examined, by means of phase contrast microscopy (Nikon® E200, Japan). The same procedure
a
Rev. Bras. Parasitol. Vet.
was used for observations after centrifugation of blood samples in hematocrit capillary tubes, just above the white blood cell layer (WOO, 1969).
Results and Discussion Trypomastigotes of Trypanosoma sp. were observed in the blood smears from three fish (30%) (Figure 1a, b), and some of them were found to be undergoing division (Figure 1d). From evaluating both the fresh samples and the results from centrifugation of blood samples in hematocrit capillary tubes, from the same fish specimens, the prevalence rate was found to be 80% (Figure 1c, d). This characterized the most efficient method for diagnosis. The prevalence rate of these blood parasites is generally high in fish from the natural environment (OVERATH et al., 1999; SMIT et al., 2004; KONAS et al., 2010). This is possibly related to the immunity mechanisms of the fish against infections. Overath et al. (1999) stated that the immune response of nonmammalian vertebrates is of limited efficacy and/or these parasites evade or manipulate the immune response of their respective hosts. Multiplication of these hemoflagellates in blood tissue has been described in some vertebrate hosts (PATERSON; WOO, 1984; BURRESON; KARLSBAKK, 2007). This division may be an adaptive mechanism, if the pathogenicity of these trypanosomes for their hosts is dependent on the intensity of the parasitemia (BURRESON; KARLSBAKK, 2007).
b
c
d
e
Figure 1. Trypanosoma sp. in the circulating blood of tuvira (Gymnotus aff. inaequilabiatus) from the Pantanal wetland, State of Mato Grosso do Sul. Trypomastigotes (a-b) and stage undergoing division (d). May-Grünwald-Giemsa-Wright staining, bar = 5 µm. Trypomastigotes observed after centrifugation of blood in a capillary tube (c – 1: red blood cells; 2: white blood cell paste; 3: plasma). Magnification 100×. Trypanosoma observed through direct examination by means of phase contrast microscopy (e). Bar = 5 µm.
v. 20, n. 1, jan.-mar. 2011
First record of Trypanosoma sp. (Protozoa: Kinetoplastida) in tuvira (Gymnotus aff. inaequilabiatus) in the Pantanal
87
Conclusion
sequences. The Journal of Eukaryotic Microbiology, v. 46, n. 5, p. 473-481, 1999.
This is the first report of Trypanosoma sp. in tuvira in Brazil. Additional studies need to be conducted in order to identify this parasite systematically and molecularly, and to identify its biological cycle, pathogenicity and impact on tuvira populations in the natural environment and on populations reared by bait gatherers.
GU, Z. M. et al. Morphological and genetic differences of Trypanosoma in some Chinese freshwater fishes: difficulties of species identification. Parasitology Research, v. 101, n. 3, p. 723-730, 2007. JONES, S. R. M.; WOO, P. T. K. Vector specificity of Trypanosoma catostomi and its infectivity to freshwater fishes. Journal of Parasitology, v. 78, n. 1, p. 87-92, 1992.
Acknowledgements
KARLSBAKK, E. A trypanosome of Atlantic cod, Gadus morhua L., transmitted by the marine leech Calliobdella nodulifera (Malm, 1863) (Piscicolidae). Parasitology Research, v. 93, n. 2, p. 155-158, 2004.
The authors thank Dr. M.A. Rotta for supplying and transporting the fish used in this study and the Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso do Sul (FUNDECT) for financial support.
KONAS, E. et al. Occurrence of Trypanosoma sp. in wild African sharptooth catfish (Clarias gariepinus Burchell, 1822) from River Asi (north-eastern Mediterranean), Turkey. Turkish Journal of Zoology, v. 34, n. 2, p. 271-273, 2010.
References
MORAES, A. S.; ESPINOZA, L. W. Captura e comercialização de iscas vivas em Corumbá, MS. Corumbá: Embrapa Pantanal, 2001. 37 p. (Boletim de pesquisa, 21).
BURRESON, E. M. Hemoflagellates of Oregon marine fishes with the description of new species of Trypanosoma and Trypanoplasma. Journal of Parasitology, v. 93, n. 6, p. 1442-1451, 2007.
OVERATH, P. et al. Freshwater fish trypanosomes: definition of two types, host control by antibodies and lack of antigenic variation. Parasitology, v. 119, n. 6, p. 591-601, 1999.
BURRESON, E. M.; KARLSBAKK, E. Multiplication of Trypanosoma pacifica (Euglenozoa: Kinetoplastea) in the English sole, Parophrys vetulus, from Oregon coastal waters. Journal of Parasitology, v. 93, n.4, p. 932-933, 2007.
PATERSON, W. B.; WOO, P. T. K. Ultrastructural studies on mitosis in Trypanosoma danilewskyi (Mastigophora: Zoomastigophorea). Canadian Journal of Zoology, v. 62, n. 6, p. 1167-1171, 1984.
D’AGOSTO, M.; SERRA-FREIRE, N. M. Estádios evolutivos de tripanossomas de Hipostomus punctatus Valenciennes (Osteichthyes, Loricariidae) em infecção natural de Batracobdella gemmata Blanchard (Hirudinea, Glossiphoniidae). Revista Brasileira de Zoologia, v. 10, n. 3, p. 417-426, 1993. FIGUEROA, F. et al. Fish trypanosomes: their position in kinetoplastid phylogeny and variability as determined from 12S rRNA kinetoplast
SAUNDERS, D. C. Trypanosoma balistes n. sp. from Balistes capriscus Gmelin, the Common Triggerfish, from the Florida Keys. Journal of Parasitology, v. 45, n. 6, p. 623-626, 1959. SMIT, N. J. et al. Fish trypanosomes from the Okavango Delta, Botswana. Folia Parasitologica, v. 51, n. 4, p. 299-303, 2004. WOO, P. T. K. The haematocrit centrifuge for the detection of trypanosomes in blood. Canadian Journal of Zoology, v. 47, n. 5, p. 921-923, 1969.
Sumário Summary
Artigo de Revisão / Review Article Ehrlichiosis in Brazil................................................................................................................................ 1 Erliquiose no Brasil Rafael Felipe da Costa Vieira; Alexander Welker Biondo; Ana Marcia Sá Guimarães; Andrea Pires dos Santos; Rodrigo Pires dos Santos; Leonardo Hermes Dutra; Pedro Paulo Vissotto de Paiva Diniz; Helio Autran de Morais; Joanne Belle Messick; Marcelo Bahia Labruna; Odilon Vidotto
Artigo Completo / Full Article Selective control of Rhipicephalus (Boophilus) microplus in fipronil-treated cattle raised on natural pastures in Lages, State of Santa Catarina, Brazil.................................................................................... 13 Controle seletivo do Rhipicephalus (Boophilus) microplus em bovinos criados em campo nativo, no município de Lages, Santa Catarina, Brasil Fernanda Paim; Antonio Pereira de Souza; Valdomiro Bellato; Amélia Aparecida Sartor
Phthiraptera (Arthropoda, Insecta) in Gallus gallus from isolated and mixed backyard rearing systems.......17 Phthiraptera (Arthropoda, Insecta) em Gallus gallus de criações de fundo de quintal isoladas e mistas Ana Clara Gomes dos Santos; Albério Lopes Rodrigues; Sandra Batista dos Santos; Roberto César Araújo Lima; Rita de Maria Seabra Nogueira de Candanedo Guerra
Isospora coerebae n. sp. (Apicomplexa: Eimeriidae) from the bananaquit Coereba flaveola (Passeriformes: Coerebidae) in South America................................................................................................................ 22 Isospora coerebae n. sp. do caga-sebo Coereba flaveola (Passeriformes: Coerebidae) na América do Sul Bruno Pereira Berto; Walter Flausino; Hermes Ribeiro Luz; Ildemar Ferreira; Carlos Wilson Gomes Lopes
Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae) in Southern Pantanal, Brazil...................................................................................................................................................... 27 Sazonalidade de Cochliomyia macellaria (Diptera: Calliphoridae) no Pantanal Sul-mato-grossense, Brasil Wilson Werner Koller; Antonio Thadeu Medeiros de Barros; Elaine Cristina Corrêa
In vitro activity of Artemisia annua L (Asteraceae) extracts against Rhipicephalus (Boophilus) microplus....31 Atividade in vitro de extratos de Artemisia annua L (Asteraceae) sobre Rhipicephalus (Boophilus) microplus Ana Carolina de Souza Chagas; Cynthia Sanches Georgetti; Camila Olivo de Carvalho; Márcia Cristina de Sena Oliveira; Rodney Alexandre Rodrigues; Mary Ann Foglio; Pedro Melillo de Magalhães
The use of conjunctival swab samples for PCR screening for visceral leishmaniasis in vaccinated dogs........36 O uso de amostras de swab conjuntival para triagem por PCR da leishmaniose visceral em cães vacinados Rodrigo Souza Leite; Virginia Carregal Mendes; Aline Leandra Carvalho Ferreira; Antero Silva Riberiro de Andrade
A novel A2 allele found in Leishmania (Leishmania) infantum chagasi.................................................. 42 Novo alelo do gene A2 descrito em Leishmania (Leishmania) infantum chagasi Trícia Maria Ferreira de Sousa Oliveira; Elton José Rosas de Vasconcelos; Andréa Cristina Higa Nakaghi; Tânia Paula Aquino Defina; Márcia Mariza Gomes Jusi; Cristiane Divan Baldani; Ângela Kaysel Cruz; Rosangela Zacarias Machado
Prevalence of liver condemnation due to bovine fasciolosis in Southern Espírito Santo: temporal distribution and economic losses............................................................................................................ 49 Prevalência de condenação de fígados bovinos por fasciolose no Sul do Espírito Santo: distribuição temporal e perdas econômicas Cíntia das Chagas Bernardo; Milena Batista Carneiro; Barbara Rauta de Avelar; Dirlei Molinari Donatele; Isabella Vilhena Freire Martins; Maria Julia Salim Pereira
Production of recombinant EMA-1 protein and its application for the diagnosis of Theileria equi using an enzyme immunoassay in horses from São Paulo State, Brazil................................................................. 54 Produção da proteína recombinante EMA-1 e sua aplicação para o diagnóstico baseado no imunoensaio enzimático de Theileria equi em equinos do Estado de São Paulo, Brasil Cristiane Divan Baldani; Eduardo Hilario; Andréa Cristina Higa Nakaghi; Maria Célia Bertolini; Rosangela Zacarias Machado
Nota de Pesquisa / Research Note Metazoan endoparasites of Serrasalmus marginatus (Characiformes: Serrasalminae) in the Negro River, Pantanal, Brazil...................................................................................................................................... 61 Metazoários endoparasitos de Serrasalmus marginatus (Characiformes: Serrasalminae) no Rio Negro, Pantanal, Brasil Wagner Vicentin; Kelly Regina Ibarrola Vieira; Fábio Edir dos Santos Costa; Ricardo Massato Takemoto; Luiz Eduardo Roland Tavares; Fernando Paiva
Active surveillance of canine visceral leishmaniasis and american trypanossomiasis in rural dogs from non endemic area........................................................................................................................................... 64 Vigilância da leishmaniose visceral e da tripanossomíase americana em cães de área rural indene Rozeani Olimpio Tome; Fernanda Conceição Gaio; Diego Generoso; Benedito Donizete Menozzi; Helio Langoni
Histopathology of gills of Piaractus mesopotamicus (Holmberg, 1887) and Prochilodus lineatus (Valenciennes, 1836) infested by monogenean and myxosporea, caugth in Aquidauana River, State of Mato Grosso do Sul, Brazil..................................................................................................................... 67 Histopatologia de brânquias de Piaractus mesopotamicus (Holmberg, 1887) e Prochilodus lineatus (Valenciennes, 1836) parasitados por monogêneas e mixosporídios, capturados no Rio Aquidauana, Mato Grosso do Sul, Brasil Cristiane Meldau de Campos; Julieta Rondini Engrácia de Moraes; Flávio Ruas de Moraes
Ehrlichia canis (Jaboticabal strain) induces the expression of TNF-α in leukocytes and splenocytes of experimentally infected dogs................................................................................................................... 71 Amostra Ehrlichia canis (Jaboticabal) induz a expressão de TNF-a em leucócitos e esplenócitos de cães experimentalmente infectados Joice Lara Maia Faria; Thiago Demarchi Munhoz; Carolina Franchi João; Giovanny Vargas-Hernández; Marcos Rogério André; Wanderson Adriano Biscola Pereira; Rosângela Zacarias Machado; Mirela Tinucci-Costa
Use of a Mycoplasma suis-PCR protocol for screening a population of captive peccaries (Tayassu tajacu and Tayassu pecari) ................................................................................................................................ 75 Uso de um protocolo de PCR para a detecção de Mycoplasma suis para avaliação de uma população de catetos e queixadas de cativeiro (Tayassu tajacu and Tayassu pecari) Rafael Felipe da Costa Vieira; Marcelo Beltrão Molento; Ana Marcia Sá Guimarães; Andrea Pires dos Santos; Marcelo Bonat; Manoel Lucas Javorouski; Luciene Popp; Leonilda Correia dos Santos; Wanderlei Moraes; Zalmir Silvino Cubas; Thállitha Samih Wischral Jayme Vieira; Odilon Vidotto; Ivan Roque Barros Filho; Alexander Welker Biondo; Joanne Belle Messick
Frequency of species of the Genus Eimeria in naturally infected cattle in Southern Bahia, Northeast Brazil...................................................................................................................................................... 78 Frequência de espécies do gênero Eimeria em bovinos naturalmente infectados no Sudeste da Bahia, Nordeste do Brasil Valter dos Anjos Almeida; Vanessa Carvalho Sampaio de Magalhães; Elza de Souza Muniz Neta; Alexandre Dias Munhoz
Myxobolus sp. (Myxozoa) in the circulating blood of Colossoma macropomum (Osteichthyes, Characidae)...82 Myxobolus sp. (Myxozoa) no sangue circulante de Colossoma macropomum (Osteichthyes, Characidae) Patricia Oliveira Maciel; Elizabeth Gusmão Affonso; Cheila de Lima Boijink; Marcos Tavares-Dias; Luis Antonio Kioshi Aoki Inoue
First record of Trypanosoma sp. (Protozoa: Kinetoplastida) in tuvira (Gymnotus aff. inaequilabiatus) in the Pantanal wetland, Mato Grosso do Sul State, Brazil.......................................................................... 85 Primeiro registro de Trypanosoma sp. (Protozoa: Kinetoplastida) em tuvira (Gymnotus aff. inaequilabiatus) no Pantanal, Mato Grosso do Sul, Brasil Santiago Benites de Pádua; Márcia Mayumi Ishikawa; Fabiana Satake; Gabriela Tomas Jerônimo; Fabiana Pilarski
Instruções aos Autores Revista Brasileira de Parasitologia Veterinária Brazilian Journal of Veterinary Parasitology Apresentação A Revista Brasileira de Parasitologia Veterinária é um órgão oficial do Colégio Brasileiro de Parasitologia Veterinária. Nesta revista, são abordados temas relativos a Helmintos, Protozoários e Artrópodes bem como assuntos correlatos. O periódico publica suas pesquisas regularmente a cada três meses.
Política Editorial Os artigos submetidos à Revista Brasileira de Parasitologia deverão caracterizar-se como científicos e originais. O(s) autor(res) deverá(ão) anexar uma carta, previamente assinada, responsabilizando-se pela originalidade do artigo (não publicados anteriormente), salvo Resumo(s) apresentado(s) em Eventos Científicos. Trabalhos com mais de uma autoria deverão seguir com uma declaração de concordância de todos os autores, referente à publicação. O processo de avaliação do trabalho dependerá da observância das Normas Editoriais, dos Pareceres do Corpo Editorial e/ou do Relator ad hoc. Neste processo, o Editor-chefe e os editores científicos assistentes poderão sugerir ou solicitar as modificações necessárias, apesar de ser de responsabilidade dos autores os conceitos emitidos no mesmo. A Revista Brasileira de Parasitologia atribui a seus artigos as categorias de: Artigos Completos, Notas de Pesquisa e Artigos de Revisão, sendo este último condicionado a solicitação do corpo editorial.
Taxa de Tramitação Da submissão do artigo, será cobrada uma taxa de R$ 40,00 (quarenta reais) referente ao processo de tramitação. Para início do processo de avaliação do trabalho, será observado o pagamento da taxa de tramitação estipulada acima, através de depósito bancário: Banco do Brasil/ Conta Corrente: 28.848-9/ Agência: 0269-0, cuja cópia de comprovante deverá ser enviada junto ao trabalho a ser submetido.
Taxa de Revisão Do autor responsável será cobrado o valor da revisão da língua inglesa, referente ao trabalho aceito para publicação.
Apresentação dos Manuscritos Na elaboração do texto serão observadas as seguintes normas: • Os trabalhos deverão ser apresentados em fonte Times New Roman, tamanho 12, com margem superior e inferior de 2,5 cm, esquerda e direita com 3 cm e espaçamento entre linhas de 1,5 cm com as páginas numeradas. • Para a categoria Artigo Completo, o trabalho não deverá exceder 15 páginas. • Para a categoria Notas de Pesquisa, o trabalho não deverá exceder 5 páginas. • As tabelas e ilustrações deverão ser apresentadas separadas do texto e anexadas ao final do trabalho, sem legendas. As respectivas legendas deverão vir no texto logo após as referências bibliográficas. As imagens deverão ser apresentadas em alta resolução (300 dpi) e de preferência coloridas. • O(s) trabalho(s) deverão ser encaminhados para: rbpv-secretaria@rbpv.org.br.
• Os trabalhos podem ser redigidos nos idiomas português, espanhol ou inglês, de forma concisa, com linguagem impessoal e com os sinais de chamadas de rodapé em números arábicos, lançados ao pé da página em que estiver o respectivo número e em ordem crescente. • Siglas e abreviações de nomes institucionais deverão aparecer entre parênteses e precedidas do nome por extenso. • As citações no texto devem aparecer pelo sistema autor-data, conforme norma NBR 10520/2002, da Associação Brasileira de Normas Técnicas – ABNT. • Os Artigos Completos devem ser organizados obedecendo à seguinte sequência: Título Original, Título Traduzido, Autor (es), Filiação, Referência (ABNT), Abstract, Keywords Resumo, Palavras-chave, Introdução, Material e Métodos, Resultados, Discussão, Conclusões (ou combinação destes três últimos), Agradecimentos (facultativo) e Referências Bibliográficas. • As Notas de Pesquisa obedecem à sequência acima sem a necessidade de se destacar os tópicos, sendo escritas em texto corrido.
Características dos Elementos de um Trabalho Científico Título Original “Deve designar o conteúdo ou assunto de uma publicação”. (ABNT 6022). O título “cheio” e o subtítulo (se houver) deverão ser apresentados no idioma do artigo e não devem exceder 15 palavras. No título, não deverá aparecer nenhuma abreviatura, e os nomes de espécie ou palavras em latim deverão vir em itálico.
Autor(es)/ Filiação “Pessoa(s) física(s) responsável(is) pela criação do conteúdo intelectual de um documento”. (ABNT 6022). Na identificação, deve constar: nome completo e por extenso do primeiro autor (sem abreviação), seguido (na próxima linha) de um breve currículo que o qualifique na área de conhecimento do artigo e seu endereço completo. E assim sucessivamente para os demais autores. A qualificação/afiliação na área deve conter: Laboratório, Departamento, Faculdade ou Escola, Instituto, Universidade, exatamente nessa ordem, e-mail atualizado (do autor), nessa ordem.
Referência Após a filiação, deverá aparecer a referência do próprio artigo, seguindo as normas da ABNT (6023), para artigo completo de periódico e nota de pesquisa. Não serão aceitas referências de trabalhos publicados em anais de congressos e as citações de teses devem estar disponíveis para consulta.
Resumo Deve conter no máximo 200 palavras, em um só parágrafo sem deslocamento, redigido na língua de origem do trabalho. Não deve conter citações bibliográficas, siglas e abreviações. Deve ser informativo, apresentando o objetivo do trabalho, metodologia sucinta, os resultados mais relevantes e a conclusão. Os trabalhos redigidos em língua inglesa deverão apresentar o resumo em língua portuguesa, seguido das palavras-chave.
Palavras-chave
Figuras
Palavra(s) representativa(s) do conteúdo do documento, preferencialmente escolhida(s) de vocabulário controlado. Deve(m) aparecer logo abaixo do resumo na língua do texto, antecedida(s) da expressão que as designe.
As figuras são ilustrações, tais como: desenho, fotografia, prancha, gráfico, fluxograma e esquema. Devem ser de boa qualidade (300 dpi), de preferência coloridas e numeradas consecutivamente. As legendas devem ser precedidas da palavra Figura, seguida da numeração em algarismo arábico e inseridas abaixo das mesmas. Listar as legendas numeradas com os respectivos símbolos e convenções, em folha separada em espaço duplo. O número de ilustrações deve ser restrito ao mínimo necessário. Fotografias digitais deverão ser enviadas em arquivos separados, como foram obtidas.
Abstract Deve ser sempre escrito em língua inglesa, em um único parágrafo sem deslocamento, e inserido logo após as palavras-chave, constituindo‑se em tradução fiel do resumo, seguido por keywords.
Keywords
Conclusões
As palavras-chave devem expressar com precisão o conteúdo do trabalho. São limitadas em no máximo 5 (cinco).
As conclusões podem estar inseridas na discussão ou em resultados e discussão, conforme a escolha dos autores. Neste caso, este item não será necessário.
Introdução
Agradecimentos
Explanação clara e objetiva do problema, da qual devem constar a relevância e objetivos do trabalho, restringindo as citações ao necessário.
Material e Métodos Descrição concisa, sem omitir o essencial para a compreensão e reprodução do trabalho. Métodos e técnicas já estabelecidos devem ser apenas citados e referenciados. Trabalhos submetidos à avaliação em Comitê de Ética deverão incluir um parágrafo nesta seção para notificação.
Resultados Sempre que necessário devem ser acompanhados de tabelas, figuras ou outras ilustrações, autoexplicativas. O conteúdo deve ser informativo e não interpretativo.
Discussão Deve ser limitada aos resultados obtidos no trabalho e o conteúdo deve ser interpretativo. Poderá ser apresentada como um elemento do texto ou juntamente com os resultados e conclusão.
Tabelas Elaboradas apenas com linhas horizontais de separação no cabeçalho e no final. A legenda (título) é precedida da palavra Tabela, seguida pelo número de ordem em algarismos arábicos, devendo ser descritivas, concisas e inseridas acima das mesmas. As tabelas devem estar limitadas a um número mínimo necessário, pois tabelas grandes são difíceis de serem lidas. Devem ser digitadas em espaço duplo em arquivos separados. Todos os dados das tabelas devem ser digitados em minúsculo, exceto as siglas.
Quando necessário, limitados ao indispensável.
Referências bibliográficas A lista de referências deverá ser apresentada em ordem alfabética pelo sobrenome do primeiro autor, sem numeração, registrando‑se o nome de todos os autores, usando as normas da ABNT (NBR 6023/2002), simplificada conforme exemplos:
1. Livro LEVINE, J. D. Veterinary Protozoology. Ames: ISU Press, 1985. 414 p.
2. Artigo de Periódico Completo BUGG, R. J. et al. Gastrointestinal parasites of urban dogs in Perth, Western Australia. Veterinary Journal, v. 157, n. 3, p. 295-301, 1999.
3. Tese, Dissertação ARAUJO, M. M. Aspectos ecológicos dos helmintos gastrintestinais de caprinos do município de Patos, Paraíba – Brasil. 2002. 40 f. Dissertação (Mestrado) - Universidade Federal Rural do Rio de Janeiro, Rio de Janeiro.
4. Documento Eletrônico CDC. Epi Info, 2002. Disponível em: <http://www.cdc.gov/epiinfo/ ei2002.htm>. Acesso em: 10 Jan. 2003. Revista Brasileira de Parasitologia Veterinária Faculdade de Ciências Agrárias e Veterinárias, Departamento de P atologia Veterinária, Universidade Estadual Paulista – UNESP, Campus Jaboticabal Via de Acesso Prof. Paulo Donato Castellane s/n - Zona Rural, CEP 14884-900 Jaboticabal - SP, Brasil Profa. Dra. Rosangela Zacarias Machado (Editora-chefe) Contato pelo e-mail: rbpv-secretaria@rbpv.org.br Telefones: (16) 3209-2662; (16) 3209-2663; (16) 3209-2664
Instructions for Authors Brazilian Journal of Veterinary Parasitology Revista Brasileira de Parasitologia Veterinária Introduction Revista Brasileira de Parasitologia Veterinária is an official publication of the Brazilian College of Veterinary Parasitology. The journal covers topics on helminthes, protozoans and arthropods as well as other related subjects and it regularly publishes research studies on a trimonthly basis.
Editorial Guidelines All manuscripts submitted to Revista Brasileira de Parasitologia Veterinária should be original scientific articles. Authors are required to send a signed cover letter certifying the entire manuscript is an original (unpublished) article, except for the Abstract(s) which may have been presented in scientific gatherings. All manuscripts with more than one author should be submitted together with a statement of agreement signed by all authors regarding its publication. The process of manuscript review will follow the journal’s Editorial Guidelines as well as the Editors’ and/or ad hoc Reporter’s opinions. The Editor-in-chief and assistant scientific editors may make suggestions or request changes to the manuscript but the authors are the exclusively responsible for the entire text content. Revista Brasileira de Parasitologia categorizes manuscripts as Full Articles, Research Notes and Review Articles; the latter are submitted under the Editors’ request.
Submission Fee There is a fee of R$ 40.00 (forty reais) to cover the submission process. The manuscript review process is initiated with the payment of the submission process fee through bank deposit at Banco do Brasil/ Checking Account # 28848-9, Branch 0269-0. A copy of the deposit slip should be sent together with the manuscript.
Review Fee The responsible author will be charged a fee English language review of the manuscript accepted for publication.
Manuscript Preparation The following guidelines should be followed in the manuscript preparation: • All manuscripts should be typed in Times New Roman font, size 12, page setup with 2.5 cm top and bottom margins, 3 cm left and right margins, and 1.5 cm line spacing. All pages should be numbered. • Full Articles should have a maximum of 15 pages and Research Notes should have a maximum of 5 pages. • All tables and illustrations should be presented separately from the main text body and attached to the final manuscript without captions. The related captions should be included in the text after the References. • All manuscripts should be sent to: rbpv-secretaria@rbpv.org.br.
• Manuscripts can be written in Portuguese, Spanish or English. Always use concise impersonal language. Footnotes should be placed at the bottom of the applicable page and numbered with Arabic numerals in an ascending order. • Acronyms and abbreviations of institution names should come between parentheses and their full names should be spelled out in the preceding text. • Citations should appear in the text according to the author-date system of NBR Guideline 10520/2002 of the Brazilian Technical Standards Association (ABNT). • Full Articles should be structured as follows: Original Title, Translated Title, Author(s), Affiliations, (ABNT) Reference, Abstract plus Keywords, English Language Abstract plus Keywords, Introduction, Material and Methods, Results, Discussion, Conclusions (or a combination of the latter three), Acknowledgements (optional), and References. • Research Notes should follow the same structure as described above but they can be presented as a continuous stream of body text with no need to include headings.
Description of Each Item of the Manuscript Original Title “It should designate the content or subject of a publication.” (ABNT 6022). The “full” title and subtitle (if any) should be presented in the same language of the article and should not exceed 15 words. The title should not include any abbreviations or species names and Latin words should be italicized.
Author(s)/ Affiliation “Individual(s) who is(are) responsible for the creation of the intellectual content of a document.” (ABNT 6022). Identification should include: first author’s full name (with no abbreviations), followed by (in the next line) a brief resume description of his/her qualifications in the article’s field of knowledge and his/her full address. The same should apply to all other authors. Qualification/affiliation should include: Laboratory, Department, College or School, Institute, University, in this exact order, and the author’s current e-mail.
ABNT Reference The author’s affiliation should be followed by the article’s reference according to ABNT guidelines (6023) for full articles. References of abstracts presented in conferences or scientific meetings will not be accept.
Abstract It should not exceed 200 words structured in a single paragraph, with no indentations, written in the article’s original language. It should not include references, acronyms or abbreviations. It should be informative and present the objectives, a brief description of methods, the main results, and a conclusion. All manuscripts written in English should have a Portuguese abstract plus keywords.
Keywords
Figures
Reference word(s) of the document’s content, preferably extracted from a controlled glossary. They should come immediately after the Abstract in the original language of the text, preceded by the expression that designates them.
Figures are illustrations such as drawings, photographs, boards, charts, flow charts, and diagrams. They should have good quality and be sequentially numbered. All headings should be preceded by the word Figure numbered with Arabic numerals and places below the figure. List all numbered headings with their related symbols and standard signs in a separate file using double spacing. Illustrations should be limited to a minimum. Digital pictures should be sent in separate files.
English Language Abstract It should be written in English language structured in a single paragraph, with no indentations, and come right after keywords. It should be a consistent translation of the abstract plus keywords.
English Language Keywords Keywords should precisely express the manuscript content. They are limited to no more than 5 (five).
Introduction A clear and concise explanation of the issue, including the study relevance and objectives and limiting citations to a minimum.
Material and Methods A concise description including core information for the understanding and reproduction of the study. Well-established methods and techniques should be only cited and referenced. Studies submitted to the approval of an Institutional Review Board should include a reporting paragraph in this section.
Results They should be accompanied by self-explanatory tables, figures or other illustrations as needed. The content of this section should be informative rather than interpretative.
Discussion It should present study results only and its content should be interpretative. It can be presented as part of the text or together with results and conclusions.
Tables Its format should include horizontal lines for separating the table heading and the last row. The heading is preceded by the word Table followed by a sequential Arabic numeral. Headings should be concise and descriptive and placed above the tables. The number of tables in the manuscript should be limited to a minimum, and authors should always bear in mind that large tables are hard to follow. All information should be typed in lower case, except for acronyms, double line spacing, and delivered in separate files.
Conclusions The authors can choose to add the conclusions as part of the Discussion or Results and Discussion section. In this case, a separate conclusion section is required.
Acknowledgements Limited to a minimum as needed.
References References should be listed alphabetically according to the first author’s last name, without any numbering, and including all authors’ names following the simplified ABNT guidelines (NBR 6023/2002) as shown below:
1. Book LEVINE, J. D. Veterinary Protozoology. Ames: ISU Press, 1985. 414 p.
2. Full article BUGG, R. J. et al. Gastrointestinal parasites of urban dogs in Perth, Western Australia. Veterinary Journal, v. 157, n. 3, p. 295-301, 1999.
3. Thesis, dissertation ARAUJO, M. M. Aspectos ecológicos dos helmintos gastrintestinais de caprinos do município de Patos, Paraíba – Brasil. 2002. 40 f. Dissertação (Mestrado) - Universidade Federal Rural do Rio de Janeiro, Rio de Janeiro. Note: Only those theses available at CAPES database will be accepted: http://servicos.capes.gov.br/capesdw/
4. Electronic document CDC. Epi Info, 2002. Available at: <http://www.cdc.gov/epiinfo/ei2002. htm>. Access on: 10 Jan. 2003. Revista Brasileira de Parasitologia Veterinária Faculdade de Ciências Agrárias e Veterinárias, Departamento de P atologia Veterinária, Universidade Estadual Paulista – UNESP, Campus Jaboticabal Via de Acesso Prof. Paulo Donato Castellane s/n - Zona Rural, CEP 14884-900 Jaboticabal - SP, Brazil Profa. Dra. Rosangela Zacarias Machado (Editor-in-chief ) Contact e-mail: rbpv-secretaria@rbpv.org.br Phones: (16) 3209-2662; (16) 3209-2663; (16) 3209-2664