TECNICA TECNICA
vol. vol.63 63--n. n.13/A 13/A
yearly yearlyissue issue2012 2012
MOLITORIA MOLITORIA
- WITH DIRECTORY - WITH SUPPLIER SUPPLIER DIRECTORY - -
CHIRIOTTI EDITORI CHIRIOTTI EDITORI 10064PINEROLO PINEROLO- -ITALY ITALY- -Tel. Tel.+39 +390121393127 0121393127--Fax Fax+39 +390121794480 0121794480 -- e-mail: e-mail: info@chiriottieditori.it info@chiriottieditori.it 10064 Supplementoalaln째n째32del del2011 2012didiTecnica TecnicaMolitoria Molitoria--Sped. Sped.in in A.P. A.P. -- D.L. D.L. 353/2003 353/2003 (Conv. (Conv. in L. 27/02/2004 n째 46) art. 1 comma Supplemento comma 11 DCB DCB TO TO -- n. n.11anno anno2012 2012- -IPIP
ISSN0040-1862 ISSN0040-1862
INTERNATIONAL INTERNATIONAL
Our constant dedication to research allows us to create unique and innovative solutions to assure that all those aspects, which guarantee pasta of superior quality, are in perfect balance.
Technology for perfect balance
EXHIBITOR PAD.15 - STAND B46-C45
www.fava.it
2
ItAlIAn EngInEErIng
ChAIns
Bianchi Errepi Associati
ExCEllEnt
A trustworthy partner for food industry Creativity and made in Italy quality for the European reference point of the engineering chains. A reliable partner for every industrial application. An advanced model of efficiency, speed and services for food industry.
www.sircatene.com
14
Complete Packaging Solutions
28 FEBRUARY - 3 MARCH VISIT US IN HALL 13 STAND A71 - B64
&
ITALPROJECT
MARTINI S.r.l. ITALY Via Borgo, 21 35015 Galliera Veneta (PD) Tel. +39 049 94 70 600 Fax +39 049 59 68 866 e-mail: info@martinisrl.com www.martinisrl.com
ITALPROJECT S.r.l. Via Leonardo da Vinci, 43 35015 Galliera Veneta (PD) ITALY Tel. +39 049 94 75 211 Fax +39 049 94 75 200 e-mail: sales@italproject.net www.italproject.net www.sanovogroup.com
PART OF
SANOVO - STAALKAT - ITALPROJECT - PROCESS SOLUTIONS - RAME-HART - FOODCRAFT
5
FEEDING SYSTEM
VERTICAL PACKAGING MACHINES
SPECIAL FEEDING SYSTEM FOR LONG CUT PASTA
HORIZONTAL PACKAGING MACHINES
CHECK WEIGHER AND METAL DETECTOR CASE PACKERS
SHRINK WRAPPERS
CARTESIAN PALLETIZERS
ANTHROPOMORPHOUS PALLETIZERS
WRAPPERS
LASER GUIDED VEHICLES
HAMMERS PLATE SIEVES VARIOUS ACCESSORIES FOR FLOUR AND FEED MILLS
10
Dec600, these new wheat debbranning machines combine efficacy and robustness. - Highest bran extraction rate, without overheating the product. - Automatic oil-pressure system for self-control. - Noiseless. - Reliable.
S.S 96 Km 78,800 Via del Grano, 1 - Z.I. 70022 Altamura (BA) - Italy Tel. +39 080 3101167 FAx +39 080 3101307 www.loporcaro.it info@loporcaro.it
5
9
10
BOW-TIES, SHORT GOODS, PENNE PLANT - CAROZZI (SANTIAGO - CHILE) FARFALLE: PRODUCTION 3450 Kg/h SHORT GOODS: PRODUCTION 5550 Kg/h
FOUR STAMPING MACHINES SFOGLIA 1300 TWO CUTTING GROUP PRESSTRAPEN
Also for Carozzi the best recipe for a
FLEXIBLE PLANT NICCOLAI TRAFILE
WWW.NICCOLAI.COM
11
10
1962
HALF A CENTURY WITH YOU
2012 Tel.+39 0498848090
14
www.molitecnicasud.com
I wait for you in Pavillon 13 Stand C09
I also have a soul... Come and see...
MOLITECNICA SUD snc - di Giuseppe Pellicola & Figli Sede legale e stabilimento: S.P. per Ruvo di Puglia, Km.1,300 C.da Torre La Macchia - 70022 Altamura (BA) Tel.+39 080 3101016 - Fax +39 080 3146832 info@molitecnicasud.it
10
Pipe Couplings
16
Long
Pasta
SINCE 1978 AT YOUR DISPOSAL
s t s e N Pasta
m r o f s n a r t o t n i s t s l n a a i l Our pr raw mater quality you lent pasta excel
Short cut Pasta
o t y g o l o n h c e t r Ou nd to maintain a n n o i i t a i t d b a o r t n a i l a t the i
” A T S A P N A I “ITAL
“QUALITY, COLOR, TASTE”
Special Shapes
ANSELMO S.p.A. Systems and Machines for Pasta Production Headquarters and establishment: Via Fossano 33 12041 Bene Vagienna (CN) Tel +39 0172654755 Fax +39 0172654811 anselmo@anselmoitalia.com www.anselmoitalia.com
18
C.M.F. Ferrari Carlo s.r.l. - Via Venezia, 3 - 25037 PONTOGLIO (BS) Tel. +39 030 7376774 - Fax +39030 7470892 - www.cmf-italia.com - cmf.brescia@tin.it
19
20
RECEPTION, STORAGE AND PROCESSING CEREAL SYSTEM FROM ORGANIC AGRICOLTURE
MACHINES AND PLANTS FOR FOOD INDUSTRIES I.M.M.A.C. S.r.l. Via Strada Nuova, 25 - 27050 Codevilla (PV) Italy Tel. +39 0383 373044 - Fax +39 0383 73835 www.immacsrl.com - info@immacsrl.com
20
40
Pad. 15P - Stand B47
macchine ed impianti per industrie alimentari mangimistiche e chimiche
Via A. Diaz, 15 84018 Scafati (SA) - Italy Tel. +39 081 8631205 r.a. Fax +39 081 8630301 e-mail: sircem@tin.it www.sircem.it
GAMMA PRODUTTIVA ♦ Impianti completi di stoccaggio prodotti granulari e polverosi. ♦ Impianti completi di insilamento paste corte ed alimentazione confezionatrici. ♦ Impianti completi di dosaggio e miscelazione. ♦ Impianti di presminuzzatura e macinazione sfridi ed archetti di pasta. ♦ Trasporti pneumatici in compressione ed aspirazione. ♦ Trasporti meccanici: trasporti a nastro, a catena ed a coclea. ♦ Elevatori a tazze: verticali, inclinati ed a zanca. ♦ Filtri autopulenti e statici. ♦ Quadri di comando con P.L.C. e computer. PRODUCTION RANGE ♦ Systems complete with granular and dusty product stockings. ♦ Systems complete with short format pasta ensilage and packaging machine feeding line. ♦ Systems complete with dosing and mixing units. ♦ Systems for scrap and waste pre-crumbling and grinding. ♦ Compression and suction pneumatic conveying lines. ♦ Mechanical conveyance: belt, chain and Archimedean screw conveyors. ♦ Vertical, sloped and Z bucket elevators. ♦ Static and self-cleaning filters. ♦ Control panels with P.L.C. and computer.
31
20
26
28
Pipe a n d c o m p o n e n t cons t r u c t i o n f o r milli n g i n d u s t r y
Ba.co. srl - Via Meucci, 14 - 30010 Liettoli di Campolongo Maggiore (VE) Italy Tel. +39 049 5848955 - Fax +39 049 9744147
info@ba-co.it - www.ba-co.it
29
Download free QR Code Reader (http://reader.kaywa.com)
Scan this QR Code with your mobile phone for more informations.
OCRIM S.p.A. - Via Massarotti, 76 - 26100 Cremona www.ocrim.com
Pad. 13, Stand B57 - C48
31
32
47
GRAIN DRYERS
OFFICINE MINUTE srl - Via Roma, 139 - 31020 VILLORBA (TV) - ITALY Tel. +39 0422 919178 - Fax +39 0422 911192 - e-mail: info@officineminute.it
34
USED MACHINERY OVE NEW CONTINUOUS LIN OF SPECIAL PASTA, NES Viale dell’Industria, 11 36016 THIENE (VI) - Italy Tel. +39 0445 370993 Fax +39 0445 813114 www.ltaitalia.it - info@ltaitalia.it
35
ERHAULING NES WITH FRAMES FOR THE PRODUCTION STS, LASAGNE, COILS
36
Impianti per: Plants for:
Paste precotte Cooked pasta
20842 Besana in Brianza - MB - Italy moriondo@moriondo.com
Paste fresche Fresh pasta
www.moriondo.com www.moriondo.it
Piatti pronti Ready-meals
tel +39.0362.995110 ra fax +39.0362.996300
www.hoerbiger.com
38
HOERBIGER explosion relief valves: The only valves that discharge into confined compartments Wherever pulverized materials are produced,
New plants can be planned even more efficiently and
handled or stored there is the risk of an explosion.
existing plants can be retrofitted very cost-effectively.
HOERBIGER explosion relief valves are the only
For more information please contact
ATEX certified valves that discharge into confined
sales.ev@hoerbiger.com
compartments.
or call
With the special flame absorber HOERBIGER
+43 (1) 740 04-0
explosion relief valves provide optimal protection during dust explosions.
47
40
Progetto6_Layout 1 18/01/12 17:47 Pagina 1
Progetto1_Layout 1 31/01/12 09:32 Pagina 1
PERONTECNICI
47
NOT ONLY FDA - ATEX CONVEYOR BELTS via Marco Polo, 17 - 35020 ALBIGNASEGO (PD) Italy Tel. +39 049 681093 - +39 049 681134 - Fax +39 049 691488 - perontecnici@perontecnici.it
• Belts for conveyors and elevators • ATEX belts for conveyors and elevators • Bolts and buckets for belt elevators • Metallic joints • Assembly and 24 hours a day assistance • Rubber coatings • Technical goods
www.perontecnici.it
42
VISIT US: Pad. 15 Stand A14
43
CONSERVATION, HANDLING AND GRAIN STORAGE SOLUTIONS & SYSTEMS
째 360
08611
in Your Service
44
OFFICINE MAZZOLARI S.r.l. “For over 30 years we produce spare parts and accessories for mills, feedstuff factory and grinding works in general” Via A. Moro, 14 - Zona Ind. Cignone - 26020 Corte de’ Cortesi (CR) Tel. +39 0372.926002 - Fax +39 0372.926107 - info@grazianomazzolari.it - www.grazianomazzolari.it Progetto2_Layout 1 06/02/12 11:04 Pagina 1
www.exitweb.it
26
we join hands with your demands
速
Quality and technology Via Maestra Grande, 20 - 44045 XII Morelli - Cento - (Fe) - Italy Tel. ++39 051 6842166 - Fax ++39 051 6842282 info@axor-italia.com - www.axor-italia.com
We manufacture frames and sieves for replacemet in all kind of plansifters. We have designed a special line of monosifter plansifter for the sorting of various micronized products and the security control of flours
PEDA S.r.l.
Via Rabin 9/A 35016 Piazzola Sul Brenta (PD) Tel. +39 049 9600610 Fax: +39 049 9619180
info@pedasrl.it www.pedasrl.it
47
IN THE WORLD’S FOOD PROCESSING THERE IS OUR KNOW-HOW BRAMBATI TECHNOLOGY RESPECTS AND ENHANCES THE QUALITY OF THE WORLD’S GREATEST FOODS: TURN-KEY SYSTEMS, TOTAL AUTOMATIC PROCESSES, RESPECT FOR THE STANDARDS AND RECIPE OF DIFFERENT CONSUMER CULTURES, ADVANCED STORAGE, FILTERING, WEIGHING, MIXING AND DOSING SYSTEMS, STATE-OF-THE-ART REPORTING TECHNOLOGY, DRASTIC REDUCTION IN ENVIRONMENTAL EMISSIONS.
Food processing plants 27050 Codevilla (Pavia) Italy - Via Strada Nuova 37 Tel. +39.0383.373100 (8 linee r.a.) Fax +39.0383.373078 Fax Tecnico +39.0383.373114 Agencies: USA - CANADA - CENTRAL AMERICA - SOUTH AMERICA - AUSTRALIA - OCEANIA - JAPAN - ASIA - NORTH AFRICA - EUROPE
www.brambati.it info@brambati.it
2
50
TECNA ingl_Layout 1 09/03/11 12.12 Pagina 1
CAPPELLETTI MACHINES R 540 C for new pelmeno shape in disc, closure superimposed weight from 8 to 16 grams
Tecna (Tecnologie Alimentari) srl Via Milano, 52 – 22070 BREGNANO (CO) Italy Tel +39 031 774293 – fax +39 031 774308 tecna@tecnasaima.it - www.tecnasaima.it
51
52
53
www.chiriottieditori.com
the best way to BROWSE our site CHIRIOTTI EDITORI www.chiriotti.com
52
SIMA srl
Constructions - Assembly Agro-Industrial Plants - Technical Assistance Via Marmolada, 15 - Z.I. Nord - 31027 SPRESIANO TV - ITALY Tel. +39 0422 881034 - Fax +39 0422 888533
www.simaimpianti.net
56
Short c 875m続 ut pasta stora Italy Silos 2500 x 2 ge system 500 x 7 000
e system Short cut pasta storag 00 x 5340 25 x 50 22 s Silo m続 2700 Spain
Short cu 540m続 St pasta storage sy ilos 2000 st Italy x 2000 x 5 em 500 Inox
Sho 280mrt cut pa Vene 続 Silos sta stor zuel 2000 age s a x 200 ystem 0x5 800
Via Monte Pelmo, 8 - 35018 San Martino di Lupari (PD) - ITALY Tel. +39.049.9440146 - Fax. +39.049.9440174 www.cusinato.com
Si
4 6 9 1 nce
ign lize s a e e r d nd we a e c u prod made r taylo ons i solut
57
57
Supplement of the Italian
Vol. 63 - February 2012
VOL. 13 - 2012 yearly issue
PAPERS FRESH PASTA Radio-frequency technology for fresh stuffed pasta pasteurization/pre-drying process. Preliminary results
62 F. Alberti - L. Spremulli - M.P. Celano A. Paparella - E. Todaro C. Tamborrino - G.V. Celano
SAFETY Frequency of dust explosion in grain storage
66 G. Demontis - M. Cremante
MAIZE Carotenoid content in Italian maize germplasm
STRISCIA TM ingl_Layout 1 16/02/12 10:47 Pagina 1
82 M. Alfieri - N. Berardo - R. Redaelli
www.tecnicamolitoria.com > Digital Magazines
CHIRIOTTI
EDITORI srl
Viale Rimembranza, 60 - 10064 Pinerolo - TO - Italy - Tel. +39 0121 393127 - Fax +39 0121 794480 e-mail: info@chiriottieditori.it - www.chiriottieditori.it Managing Editor Chiara Chiriotti Direttore Responsabile Assistant Editor Chiara Mancusi Editorial Staff Elena Folco, Nadia Barotto Laura Sbarato, Cristina Quaglia, Simonetta Musso
Managing Director Giuseppe Chiriotti
Marketing Monica Pagliardi
Circulation Monica Primo
Advertising Advertising Manager Luigi Voglino voglino@chiriottieditori.it Carlo Beltrachini - Piemonte, Liguria Raffaella Frigo - Triveneto Giorgio Abbondanza - Emilia, Toscana, Marche, Umbria, Abruzzo
Copyright© 2012 by Chiriotti Editori srl - All rights reserved Supplemento a Tecnica Molitoria n. 2, febbraio 2012 - ISSN 0040-1862 - Spedizione in abb. postale Torino Autorizzazione n. 172 (5-5-1950) del Tribunale di Pinerolo - Printer: Tipolitografia Giuseppini - Pinerolo
YEARLY IN ENGLISH
➠
Tecnica Molitoria International is published once a year with a circulation of 6,000 free copies either sent by air mail or distributed at international exhibitions. If your company is not yet in the mailing list and you wish to receive the next issue in 2013, please complete the form below.
MONTHLY IN ITALIAN
➠
Since 1950 Chiriotti Editori has published the monthly technical magazine Tecnica Molitoria devoted to flour and feed mills, storage, rice and pasta industries. Even though it is in Italian, this 200-250 page journal is sent to paying subscribers all over the world. In each issue, scientific and technical studies carried out by universities and researchers are featured, besides a rich choice of articles and news about new machinery, plants, equipment and technology, new product developments, economical and legislative news, statistics and trends, congresses and exhibitions, and so on. To receive a free sample copy, together with a subscription module, please complete the form below.
!
FREE sample request form to fill in and fax to CHIRIOTTI EDITORI at +39 0121 794480
Please send me:
o the next issue of
o a sample copy of
with subscription form
Surname and name.......................................................................................................................................................... Company name............................................................... Type of business....................................................................... Address.......................................................................................................................................................................... City.................................................................................................. State/Province........................................................ Country............................................................................................................. Zip/postal code..................................... Fax.................................................... e-mail...................................................................................................................
VOL. 13 - 2012 yearly issue
DEPARTMENTS 90 - TECNICA MOLITORIA The monthly Italian milling magazine since 1950 92 - SILOS Automated cereal leveller with temperature/humidity monitoring 94 - MILLING Stone grinding mills - Rollermill, purifier, debranner, plansifter - Grinding/fluting machine and dedicated service packages 99 - SORTING Vision colour sorting machine - Optical and resonance sorting machines 101 - PASTA PRODUCTION New technology for long-cut pasta - Extruders for short and long pasta - Combined production line for pasta - Automated cooker and machine for making tortellini - Long and short-cut pasta lines - 3-stage cooker for continuous pasta sheets - Dry and fresh pasta machines and lines 112 - DOSING, MIXING & HANDLING Dosing, conveying and mixing turn-key plants 114 - ANCILLARY EQUIPMENT Drum diverting valve for pneumatic lines - Stretching system for optimal sifting yield - Laboratory mixer, dust filter, gearbox and loader - Vent panels, bucket elevators, screw conveyors - Handling and safety equipment 122 - PACKAGING Resealable zip bags for pet food - Automatic packaging machines - Bag filling, weighing and bagging - High-speed packaging systems - Weighing and packaging machines 128 - DOWNSTREAM End-of-line solutions for pasta industries - Robotic palletizing systems 132 - SUPPLIER NEWS 50 years of success for La Meccanica 134 - EXHIBITIONS & MEETINGS Packology: packaging and processing exhibition - International dietary fibre conference in Rome - Calendar of International events in Italy 137 - ITALIAN SUPPLIER DIRECTORY 153 - ADVERTISER INDEX - COMPANY ADDRESSES
Fresh pasta
RADIO-FREQUENCY TECHNOLOGY for fresh stuffed pasta pasteurization/pre-drying process. Preliminary results
Keywords: fresh stuffed pasta, pasteurization, pre-drying, radio frequency
Francesca Alberti1* - Luigina Spremulli2 - Maria Palma Celano3 Antonello Paparella4 - Enzo Todaro2 - Carmela Tamborrino1 Gaetano Vitale Celano1** Department of Health and Animal Welfare - Faculty of Veterinary Medicine - University of Bari “Aldo Moro” - Strada Prov. per Casamassima km 3 - 70010 Valenzano - BA - Italy 2 STC Science Technology & Consulting - Via A. Murri 22 - Zona Ind. - 72023 Mesagne - BR - Italy 3 Institute for Flight Propulsion - Technische Universität München - Boltzmannstraße 15 85747 Garching - Germany 4 Department of Food Science - University of Teramo - Via C.R. Lerici - 1 64023 Mosciano Stazione - TE - Italy 1
*francescaalberti@alice.it **g.v.celano@veterinaria.uniba.it
62 - Tecnica Molitoria International - Yearly issue 2012
fresh pasta ABSTRACT Radio frequency (RF) applications to food process are well known due to the possibility of quickly and uniformly heating food matrix (Orsat and Vijaya Raghavan, 2005; Guo et al., 2006). Fresh stuffed pasta conventional production technology consists of a first steam pasteurization for a period varying from 2 to 10 min depending on pasta size and weight, initial microbial density and wet steam or superheated steam, followed by a drying phase with forced hot air at a temperature not exceeding 65°-70°C to increase pasta consistency and stabilize the shape. Fresh semolina pasta RF pasteurization/pre-drying process is already used by some companies to obtain: a reduction of microbiological parameters, reduced time pasteurization, a better cooking bheavior, keeping a great intensity taste and aroma typical of fresh semolina pasta. Fresh stuffed pasta production has several healthy and technology problems with respect to fresh semolina pasta, thus RF pasteurization/ pre-drying process requires a proper implementation and evaluation of effects on different types of products. In this study we have examined three different types of fresh stuffed pasta, cappelletti stuffed with ham, fagottini stuffed with cheese, and tortellini stuffed with meat. Three different RF treatments were carried out: 3 kV were applied to fresh pasta stuffed with ham and meat and 2 kV to fresh pasta stuffed with ricotta cheese for a total time of 10 and 8 min, respectively. RF plant consists of a single steel tunnel, in which electrodes are placed and kept at 27.12 MHz, where simultaneously pre-drying and pasteurization of fresh pasta occur (STC, Science Technology & Consulting). Microbiological analysis of different fresh stuffed pasta samples, pre- and post-pasteurization were made by the Tempo System (bioMérieux, France). Preliminary results in different types of fresh stuffed pasta show that RF pasteurization/predrying process causes reduction of some microbiological parameters.
INTRODUCTION The goals of pasteurization and sterilization are to eliminate pathogenic microorganisms and reduce food spoilage to extend food shelf-life. The availability of water in pasta encourages microbial activity and hence the occurrence of biochemical phenomena that cause alteration of the product until the complete loss of its edibility. Production and storage techniques of fresh pasta therefore aim to either reduction or inactivation of microorganisms involved in the biochemical process able to alter the product. Radio frequency technique is a viable alternative to existing pasteurization of fresh stuffed pasta as it is able to heat the product quickly allowing a simultaneous drying (Wang et al., 2003; Piyasena and Dussault, 2003).
MATERIALS AND METHODS Three different types of fresh stuffed pasta using ham, ricotta cheese and meat were prepared and treated in the RF plant for pasteurizing and pre-drying. RF plan is formed by a steel tunnel including some electrodes for the RF voltage application. The tunnel contains two continuous modules where pre-drying and pasteurization occur simultaneously. In the first module, the steam is also injected in order to facilitate starch gelatinization and reduce the effect of drying excess on pasta. A voltage of 3 kV for 10 min was applied during the process on the fresh stuffed pasta with ham and meat, and 2 kV for 8 min was used for the ricotta cheese stuffing. In both cases the frequency was 27.12 MHz (Wang et al., 2003). Temperature for both
Tecnica Molitoria International - Yearly issue 2012 - 63
Fresh pasta
Table 1 - Operating conditions of the RF oven during the experiment. Fresh pasta samples
V1 (KV)
V2 (KV)
v (m/min)
T1 (°C)
T2 (°C)
P1 (kW)
P2 (kW)
Ham (cappelletti)
3
3
1.5
70
81
4
5
Meat (tortellini)
3
3
1.5
68
86
4
6
Ricotta cheese (fagottini)
2
2
1.6
80
90
4
3
modules was 90°C and measured humidity was 52% in the first module and 22% in the second one. After the pasteurization/pre-drying process, pasta was cooled in a section closely linked to the RF oven, and prepared in appropriate polymeric food packaging where a modified and protective atmosphere, N 65% + CO2 35%, was created. In tab. 1 the operating conditions of the RF oven are reported. V1 and V2 are the voltages applied to the first and second module, respectively; v is the velocity of the conveyor belt on which the pasta is placed; T1 e T2 are the temperatures of the pasta in the first and second module; and P1 and P2 relates to adsorbed energy from fresh pasta into two radiofrequency modules.
Pasteurized and virgin pasta samples were analyzed by using Tempo System (bioMérieux, France) to evaluate total aerobic mesophilic plate count (Tempo TVC, bioMérieux, France), total coliform (Tempo TC, bioMérieux, France), coagulase-positive staphylococci (Tempo STA, bioMérieux, France), yeast and moulds (Tempo YM, bioMérieux, France). On the same samples water activity and % moisture were measured too.
RESULTS AND CONCLUSIONS In tab. 2 the average values of microbiological parameters mentioned in the previous section and the values of water activity (aw)
Table 2 - Average microbiological, water activity (aw) and % moisture (RH) values of fresh unpasteurized stuffed pasta. Fresh pasta samples aw
RH (%)
TVC cfu/g
TC cfu/g
STA cfu/g
YM cfu/g
Ricotta cheese (fagottini)
0.97
32.3
1.3x107
6.2x104
9.1x104
5.7x103
Meat (tortellini)
0.98
33
3.8x106
6x104
8.7x104
1.8x104
Ham (cappelletti)
0.97
32
4.7x106
1.3x104
1.7x105
1.2x104
64 - Tecnica Molitoria International - Yearly issue 2012
fresh pasta
Table 3 - Average microbiological, water activity (aw) and % moisture (RH) values of fresh pasteurized stuffed pasta. Fresh pasta samples aw
RH (%)
TVC cfu/g
TC cfu/g
STA cfu/g
YM cfu/g
Ricotta cheese (fagottini)
0.94
27.7
5.5x104
<10
<10
<100
Meat (tortellini)
0.93
27.15
6.7x10
<10
<10
<100
Ham (cappelletti)
0.93
27.4
8.6x10
<10
<10
<100
3 3
and % moisture (RH) are reported for unpasteurized fresh stuffed pasta. By comparing the experimental results in tab. 2 and 3, it can be observed that radio frequency process induces a significant reduction of the microbiological parameters. Additional experimental work is required to standardize the RF technique for predicting an accurate evaluation of shelf-life. This optimization technique may allow the preparation of healthy fresh stuffed pasta preserving the original taste together with a strong reduction of production costs. In conclusion we have experimentally demonstrated the advantage of RF technique in the preparation of fresh stuffed pasta with respect to the conventional technique, in terms of reduction of microbiological parameters. Preliminary results strongly encourage to spend additional efforts to achieve the standardization of RF processing for fresh stuffed pasta.
plication of radiofrequency technology for drying and pasteurization of fresh stuffed pasta”.
Acknowledgements
Wang Y., Wig T.D., Tang J., Hallberg L.M. “Dielectric properties of foods relevant to RF and microwave pasteurization and sterilization”. Journal of Food Engineering, 57: 257-268, 2003.
Study carried out in collaboration with pasta factory “Soave s.r.l.”, Via dell’Industria Zona Industriale 72021, Francavilla Fontana (BR) Italy, project POR Puglia 2007-2013: “Ap-
Paper published in the Shelf-Life International Meeting Proceedings 2011 Special Issue of Italian Journal of Food Science
BIBLIOGRAPHY Guo Q., Piyasena P., Mittal G.S., Si W., Gong J. “Efficacy of radio frequency cooking in the reduction of Escherichia coli and shelf stability of ground beef”. Food Microbiology, 23(2): 112-118, 2006. Orsat V., Vijaya Raghavan G.S. “Radio frequency processing”. In: Emerging Technologies for food processing, Eds. DA-WEN SUN, 445-463, 2005. Piyasena P., Dussault C. “Continuous radio-frequency heating of a model viscous solution: Influence of active current, flow rate, and salt content on temperature rise”. Canadian Biosystems Engineering, 45: 327-334, 2003. STC Science Technology & Consulting patent 1371330, 8/3/2010.
Wang Y., Wig T.D., Tang J., Hallberg L.M. “Sterilization of foodstuffs using radio frequency heating”. Journal of Food Science, 68 (2): 539-544, 2003.
Tecnica Molitoria International - Yearly issue 2012 - 65
sAFETY
FREQUENCY of DUST EXPLOSION in GRAIN storage
Keywords: grain, dust, explosion, statistics, risk, evaluation, likelihood, ATEX directive
Giorgio Demontis* - Mio Cremante** Essei Servizi s.r.l., società d’ingegneria - SS 131 km 100,200 - 09070 Siamaggiore - OR - Italy *giorgio@demontis.net **m.cremante@gmail.com
66 - Tecnica Molitoria International - Yearly issue 2012
sAFETY ABSTRACT
INTRODUCTION
At present in Italy neither a method to estimate the likelihood (probability) of an explosion in grain handling facilities nor the risk estimates associated with these events in terms of expected casualties are available. The probability is a basic component of risk analysis. Risk R is defined as a numeric value determined as R=PxD, where P is the probability of an event and D is the damage associated to that event. In this paper it is demonstrated that it is possible to estimate, via rational methods, the mean value of the likelihood of cereal explosion P, the quantity of return, the time of return, and the risk R, i.e. the likelihood of occurrence of casualties to operators, such as death or injury. Time and quantity of return determination helps to understand the explosion risk in grain handling facilities well. The values found were obtained thanks to the wide availability of online government data collected in the U.S.A., which is sufficient, focused, strong and consistent. In Europe no databases with similar features and size are available. By comparing European and American laws it has been concluded that the values found in the U.S. data analysis can also be considered a valid basis for European analysis, pending the establishment of a European database, which can provide similar information.
For several years, the worldwide production of cereals has been constantly growing to satisfy the increasing needs of humans and animals for food. The increase in the quantity produced is related to both the growth of the human population and to its direct and indirect consumption. Bread, meat from livestock, milk and its derivatives, all require grain for their production, and furthermore some grain products have become the basis for the production of bio-fuel. It is therefore expected that the production of cereals worldwide will increase significantly. As shown in fig. 1, the last 30 years have recorded increases in the production of mainly corn, rice and wheat. In one ton of grain, keeping in mind that production is measured in millions of tons, 1 to 5 kg of dust are usually contained. Grain dusts, under specific conditions, which are sometimes reached during normal processing, may generate a potentially explosive atmosphere, as defined by the ATEX Directive. The explosion can be assimilated to a very fast combustion. However there are two additional features that must be considered related to the generation of combustion. These are the right concentration of dispersed dust and the confinement of the dust cloud (fig. 2). However, the necessary concentration, required to originate a grain dust explosion, is not normally present in workplaces. According to some American studies, the explosive concentration of many types of cereals can be recognized when it is not possible to clearly distinguish the fingers of your hand, outstretched in front of you. A demonstration of the particular behavior
Tecnica Molitoria International - Yearly issue 2012 - 67
sAFETY of dust can be found at Angel State University - Texas USA research, at the following address: http://www.angelo.edu/faculty/kboudrea/ demos/lycopodium/lycopodium.htm. Another demonstration made with 00 wheat flour by the author, may be viewed at http://www.la7.it/vivoxmiracolo/pvideostream?id=i78312. Several studies have shown that grain dusts are dangerous even if grounded, as they can be easily lifted. In particular, in galleries and tunnels, dusts have been shown to be capable of producing devastating explosions, because the explosion raises dust, which feeds the explosion itself. An example is shown in fig. 3. With the increase of crops and preservation and processing of cereals in industrial plants, which started around 1800, the first documented explosions took place, such as the Washburn mill (1878, U.S.A.). In the United States, since 1970, the number of explosions and victims increased gradually until it reached a peak, in 1978, of 5 explosions with 59 deaths and 49 injuries in one week (between December 21st and 28th) (fig. 4). Given these events, the National Academy of Sciences of the United States was commissioned by the Federal Government to study and solve the problem. One of the effects produced by the research has been the focused and systematic statistical collection of data relative to grain explosions by the University of Kansas (KSU). The National Academy of Sciences produced a series of recommendations that became effective in 1988. Ten years later, on June 8th 1998, an explosion in the storage facility of De Bruce – the world’s largest plant with a capacity of over 730.000 m3 – caused 7 deaths and 20 injuries.
68 - Tecnica Molitoria International - Yearly issue 2012
Thanks to the fact that the data collected by many universities and several U.S. government agencies have been made available online, it has become possible and easy to carry out statistical evaluations of the phenomenon of grain explosions. The USA is one of the largest producers of cereals in the world; it possesses specific laws over the territory as well as a very solid and diffused use of technology.
METHOD Overall view In order to evaluate the trend of grain explosions, historical data from U.S. Government databases and other official publications from Universities have been used. The sources have been the publications of the University of Kansas “Agricultural Dust Explosions”, with the number of explosions and the related deaths and injuries for each year since 1977. The explosions have been classified from 1977, based on the type of industry where the explosion occurred, such as mills, storage plants, etc. Another classification made by the University of Kansas since 1982 is related to the processing products, such as barley, corn, oats, rice, rye, sorghum and wheat at the time of the outbreak. The number of explosions, deaths and injuries for the years prior to 1977, specifically those between 1958 and 1976, were derived from tables published in 2003 by OSHA, an American government agency, which deals with safety at work. The production of cereals has been estimated through multiple government databases queries, published online by the United
sAFETY
Fig. 3 - Dynamics of dust explosions (www.osha.gov).
Fig. 1 - Worldwide cereal production.
Fig. 2 - Dust explosion pentagon.
Fig. 4 - Cereal explosions in the United States (reworking of Grain Dust-Related Explosions in U.S.A.).
Tecnica Molitoria International - Yearly issue 2012 - 69
sAFETY States Department of Agriculture-National Agricultural Statistics Service, USDA-NASS. Databases of the Statistic Service have contained information on U.S. agricultural productions since 1860. Since productions are measured in bushels, it has been necessary to convert the productions in metric tons. Official tables published by USDA-NASS in the Agricultural Statistics have been used to perform these conversions. Historical analysis The production of cereals in the United States has neither been uniform as regards time nor as regards distribution of production. In fact, the production of maize, rice and wheat has been increasing much more than other cereals in the last 50 years, as shown in fig. 1. The first analysis performed was the ratio of
the number of all explosions to the quantity of all cereals produced. The analysis showed that the trend of the ratio of the explosions to the tons of cereals produced has been decreasing against the growth of the average production of cereals. The results are shown in fig. 5. U.S. regulations The introduction of the OSHA recommendations in 1988 changed the trend of the explosions. In 2003, OSHA published a report on the successes achieved by the introduction of its recommendations, based on the percentage rate of the decrease of explosions, deaths and injuries. The results obtained with the introduction of the legislation were stunning, with massive reductions, as reported in tab. 1.
Fig. 5 - Production and grain dust explosions in the United States.
70 - Tecnica Molitoria International - Yearly issue 2012
sAFETY
Table 1 - Explosions, deaths and injuries in the United States (only storage facilities, average for the intended period, source OSHA). Statistics A B C D
Variation between D (93-97) and A (78-82)
Explosions
21
12
8
6
-71%
Injuries
47
10
7
4
-91%
Deaths
19
2
2
1
-95%
Years
1977/78-1982
1983-1987
1988-1992
1993-1997
Terminology and method The term “frequency” is intended as the number of times an event occurred in a defined period of time, according to a series of historical observations. The term identifies an index based on past events. The term “expected frequency” (probability) is intended as the number of times an event may occur in the future, in a defined period of time, according to a series of observations. The term identifies a statistical estimation index based on past events. Frequencies therefore describe a relationship between events and time. The terms “expected frequency” and “probability” are, as defined in ISO/IEC Guide 73:2002, equivalent in this paper. The term “statistical ratio” is intended as the ratio between two variables linked by a logical relationship, including at least one with a statistical nature. The purpose of a statistical ratio is to eliminate the components that make data not comparable. The term “incidence” is intended as the number of times that an event has occurred with respect to a defined quantity, according to a series of observations. The term identifies a statistical ratio based on a series of observations.
The term “expected incidence” is intended as the number of times an event may occur with respect to a defined quantity, according to a series of observations. The term identifies a statistical ratio forecast, based on past series of observations. To better understand the numbers found, and to allow immediate comparisons, values that in usual engineering notation are expressed as 10-y, have also been expressed as return quantities and return period (also referred in this work as time of return or return time). Thanks to available data on the quantities produced for each cereal, on the explosions caused by each type of cereal, and on the explosions occurred in each plant, it has been possible to: a) evaluate the average incidence of explosions for each cereal compared to the amounts produced, obtained by dividing the number of explosions occurred in one period to the quantity produced in the same period; b) evaluate the return quantity for each cereal, i.e. the number of tons of processed product between two explosions; c) obtain the average incidence of explosions per year per million tons for each cereal, obtained by averaging the incidence of the explosions over the years;
Tecnica Molitoria International - Yearly issue 2012 - 71
sAFETY d) obtain the return period per million tons for each cereal, i.e. the number of years between two explosions per million tons; e) obtain the distribution percentage of the explosions by type of activity, such as storage facilities, mills, etc. Combining the information above, for each type of grain, the return period of an explosion in a storage plant per million tons and the annual expected incidence of explosion in the storage plant per million tons have been derived. In the case of the storage plant, percentages of explosions were supposed uniform, as there are no explicit data about the relationships between the type of processed product at the time of the explosion and explosions by type of industry. Based on the values found, the annual expected frequency of an explosion in a storage facility has been determined, depending on the quantity treated.
STATISTICS Return quantities Some events are not time-related, but quantity-related. For example, the maintenance of vehicles is given in kilometres, km, (or miles) and not in years. The return quantity may be seen as the kilometers (miles) covered by a car: hence the grain volumes processed between two accidents, thus allowing to evaluate whether different types of cereal have different behaviors, regardless of the time. After the introduction of the OSHA recommendations, the return quantities are the ones shown in tab. 2. The cereal with more explosions per million tons is oat, and the one with fewer explosions per million tons is wheat. Analyzing tab. 2 it can be deduced that different
72 - Tecnica Molitoria International - Yearly issue 2012
grains have substantially different explosion incidences. To evaluate the importance of the grain type, table 2 shows the different grain productions in the years 1989-2005. Return period The incidence of explosions per million tons has no time reference. It does not take into account that every year new harvests generate new powders. The generation of the explosive base material happens at least once a year. The frequency of explosions must then take into account both the quantity of material processed and the number of material handlings. One million tons can be produced in one harvest or in five harvests. What matters is to know the likelihood of an explosion for each year. It is therefore intended that each year corresponds to an extraction, with exposure of the number of explosions. With the available data it has been possible to evaluate the average likelihood of explosions per year. Fig. 6 shows corn related values. The data used to elaborate the values of fig. 6, with respect to the period 1989-2005, are reported in tab. 3. The mean time laps (years) between two explosions per cereal type are reported in tab. 4. It is noticeable that the average annual incidence of explosions per million tons depends on the type of cereal. Wheat is the least explosion-prone type of cereal. Distribution of explosions per type of facility Tab. 5 shows that storage plants are the most subject to explosions, with more than half of the total explosions. The reasons lie in both the presence of dust or foreign bodies in the
sAFETY
Table 2 - Cereal and explosion production in the United States (years 1989-2005). Classification according to the quantity of return, in million tons. Cereal Quantity produced Explosions Quantity of return (Million tons) (Million tons) Oat Rice Barley Corn Sorghum Wheat Rye Total
47.23 144.94 126.81 3,942.83 239.64 1,035.63 4.15 5,541.23
4 6 4 92 4 16 0 126
11.81 24.16 31.70 42.86 59.91 64.73 NA
Explosion mean incidence per million tons 0.08469 0.04140 0.03154 0.02333 0.01669 0.01545 0.00000
*NA: not available.
Table 3 - Maize production in the period 19892005 and average incidence of explosion in the United States. Year
Fig. 6 - Incidence of the U.S. average annual corn explosions.
Production (tons) Explosions
1989 191.31 4 1990 201.52 2 1991 189.86 5 1992 240.71 4 1993 160.98 9 1994 255.28 8 1995 187.96 3 1996 234.51 5 1997 233.85 8 1998 247.87 9 1999 239.54 7 2000 251.84 2 2001 241.37 5 2002 227.76 5 2003 256.27 6 2004 299.90 3 2005 282.30 7 Total 3,943 92 Average 232 5.4
Incidence 0.02091 0.00992 0.02634 0.01662 0.05591 0.03134 0.01596 0.02132 0.03421 0.03631 0.02922 0.00794 0.02072 0.02195 0.02341 0.01000 0.02480 0.02393 2.39E-02
Tecnica Molitoria International - Yearly issue 2012 - 73
sAFETY
Table 4 - Mean time between two explosions (years) per million tons in the United States (years 1989-2005). Cereal
Mean time between two explosions (years) per million tons
Oat Rice Barley Corn Sorghum Wheat Rye
Annual explosion incidence per million tons
12.54 22.32 38.06 41.78 66.00 67.59 NA
0.0797187 0.0447986 0.0262765 0.0239340 0.0151522 0.0147948 0.0000000
7.97E-02 4.48E-02 2.63E-02 2.39E-02 1.52E-02 1.48E-02 0.00E+00
*NA: not available.
Table 5 - Explosions by type of activity, post-regulation, years 1989-2005. Years
Storage facilities
Feed mills
Flour mills 10
No. explosions
99
34
%
55.00
18.89
5.56
Dry corn
Wet corn
Rice mills
Oat mills
Other
Total
4
9
5
0
19
180
2.22
5.00
2.78
0.00
10.56
100
Table 6 - Mean year incidence of explosions per million tons, in grain storage facilities in the United States. Item Expected year incidence of explosions per million tons Time of return of explosions per million tons
Barley
Corn
Oat
Rice
Rye
Sorghum
Wheat
2.63E-002 2.39E-002 7.97E-002 4.48E-002 0.00E+000 1.52E-002 1.48E-002 38.06
41.78
12.54
22.32
NA
66
67.59
Percent of explosions related to grain storage facilities
55.00%
55.00%
55.00%
55.00%
55.00%
55.00%
55.00%
Expected year incidence of explosions in grain storage facilities per million tons
1.45E-02
1.32E-02
4.38E-02
2.46E-02
0.00E+00
8.33E-03
8.14E-03
Time of return of explosions in grain storage facilities per million tons
69.2
76
22.8
40.6
NA
120
122.9
*NA: not available.
74 - Tecnica Molitoria International - Yearly issue 2012
sAFETY raw product, such as stones and metals, and in the presence of elevators. Elevators are high performance machines, often the cause of the explosions. Considering that in the milling industry raw materials are normally stocked on the premises, cereals reach the storage silos via an elevator. They are then handled within the plant storage through elevators and finally they exit the storage silos again via elevators.
EXPECTED INCIDENCES AND FREQUENCIES Generality The incidences of explosions per million tons are also useful to make predictions in the future. It is not probability as defined internationally, but likelihood: based on observations, deductions and measurements of past events it is likely that the events will recur, in absence of changes, with the same features in the future. From now on we will talk about expected incidences and frequencies, or occurrence probability as well as likelihood, in accordance with common English. Return time per million tons in grain storage facilities We will now develop the case of grain storage facilities. Storage has been the activity in which more than 50% of the explosions have occurred. The storage facilities results will therefore have the highest values, whereas the other activities will have lower values. The interval between explosions shown in tab. 6 is the time (years) likely to elapse, per
million tons of product, between two consecutive explosions. Expected explosion frequencies in grain storage facilities Up to now we have seen explosion incidences per million tons. We can also derive the expected frequencies or explosion probability by assigning the tons processed per year, thereby freeing the denominator. The results are shown in tab. 7. The happening probability found, as shown in tab. 8, is expressed in years and corresponds to the return time between two events.
EVALUATION OF THE EXPECTED FREQUENCY VALUES Choice of the probability scale To evaluate the significance of the numbers found in relation to the expected frequency, the numbers should be compared with a measurement scale. Among the various probability scales used by government agencies, the one that best suits our case is the American Civil Aviation Administration (FAA) scale, based on the operating hours with values related to an entire system or fleet. The scales related to the probability per year and per facility, based on over 8,000 hour runs per year and/or based on Fault Tree Analysis (FTA), in this case would be a life raft in a sea of hypotheses. The FAA scale is shown in tab. 9. Tab. 10 proposes a conversion between the European and American qualitative probability scales. It is noted that the European ones are organized into five levels while the American ones are organised into three.
Tecnica Molitoria International - Yearly issue 2012 - 75
sAFETY
Table 7 - Expected explosions per year in grain storage facility. Item
Barley
Mean incidence of explosion in grain storage facility per year and per 106 tons Time of return (years) in grain storage facility per 106 tons Million of tons handled per year
Corn
Oat
Rice
Rye
Sorghum
Wheat
1.4452E-02 1.3164E-02 4.3845E-02 2.4639E-02 0.0000E+00 8.3337E-03 8.1371E-03
69
76
23
41
0
120
123
Expected mean explosion per year (likelihood) in a grain storage facility
0.05
7.23E-004
6.58E-004
2.19E-003
1.23E-003
4.17E-004
4.07E-004
0.1
1.45E-003
1.32E-003
4.38E-003
2.46E-003
8.33E-004
8.14E-004
0.15
2.17E-003
1.97E-003
6.58E-003
3.70E-003
1.25E-003
1.22E-003
0.2
2.89E-003
2.63E-003
8.77E-003
4.93E-003
1.67E-003
1.63E-003
0.25
3.61E-003
3.29E-003
1.10E-002
6.16E-003
2.08E-003
2.03E-003
0.5
7.23E-003
6.58E-003
2.19E-002
1.23E-002
4.17E-003
4.07E-003
0.75
1.08E-002
9.87E-003
3.29E-002
1.85E-002
6.25E-003
6.10E-003
1
1.45E-002
1.32E-002
4.38E-002
2.46E-002
8.33E-003
8.14E-003
1.25
1.81E-002
1.65E-002
5.48E-002
3.08E-002
1.04E-002
1.02E-002
1.5
2.17E-002
1.97E-002
6.58E-002
3.70E-002
1.25E-002
1.22E-002
Table 8 - Return time (years) between two explosions in grain storage facilities. Million tons handled per year
Barley
Corn
Oat
Rice
0.05
1,383.9
1,519.3
456.1
0.10
691.9
759.7
0.15
461.3
506.4
0.20
346.0
0.25
0.50
Sorghum
Wheat
811.7
2,399.9
2,457.9
228.1
405.9
1,199.9
1,228.9
152.0
270.6
800.0
819.3
379.8
114.0
202.9
600.0
614.5
276.8
303.9
91.2
162.3
480.0
491.6
138.4
151.9
45.6
81.2
240.0
245.8
0.75
92.3
101.3
30.4
54.1
160.0
163.9
1.00
69.2
76.0
22.8
40.6
120.0
122.9
1.25
55.4
60.8
18.2
32.5
96.0
98.3
1.50
46.1
50.6
15.2
27.1
80.0
81.9
76 - Tecnica Molitoria International - Yearly issue 2012
Rye
sAFETY
Table 9 - Likelihood of occurrence definitions (FAA System Safety Handbook, Chapter 3: Principles of System Safety, Table 3-3. December 30, 2000). Likelihood Probable
Descriptive Anticipated to occur one or more times during the entire system//operational life of an item.
Numeric Probability of occurrence per operational hour is greater than 1x10-5 (1 event within 100,000 hours of operation).
Remote Unlikely to occur to each item during its total life. Probability of occurrence per operational hour is less than 1x10-5 May occur several times in the life of an entire system or fleet. but greater than 1x10-7. (1 event between 100,000 and 10 millions hours of operation). Extremely Not anticipated to occur to each item during its total life remote May occur a few times in the life of entire system or fleet.
Probability of occurrence per operational hour is less than 1x10-7 but greater then 1x10-9. (1 event between 10 millions and 1 billion hours of operation).
Extremely So unlikely that is not anticipated to occur during the entire improbable operational life of an entire system or fleet.
Probability of occurrence per operational hour is less than 1x10-9 (1 event over 1 billion hours of operation).
Comparisons Cereal processing plants, unlike other industries such as the chemical industry, usually do not work continuously on three shifts throughout the year. With the aim of making comparisons between values of the occurrence probability calculated with the chosen scale, based on effective working hours, it has been necessary to convert the average annual rate of explosions in the average hourly rate of explosions. One U.S. working year has been made equal to 250 working days of 8 hours, that is 2,000 working hours per year. The values of the average expected frequency of explosions per working hour are presented in tab. 11. The value is in favour of safety. If PYEAR is the probability of explosions per year and the working hours per year are 2,000, the hourly probability of occurrence of an explosion PHOUR will be expressed by PYEAR= PHOUR x 2,000, from which PHOUR = PYEAR/2000. After having converted the expected frequencies per year into expected frequencies per operative hour, the situation is summarized
in tab. 11, in which for each annual volume processed, both the expected frequency and the hours between two events (bold) are given. As stated, besides oats, rice and barley, the operating hours between two explosions are over 100,000, or else, according to the chosen likelihood scale, the classification is thus unprobable. In Sardinia, Italy, the peak amount of overall cereal processing per plant is less than 750,000 tons per year.
COMPARISON BETWEEN EUROPEAN AND AMERICAN RULES To assess whether it is possible to use results obtained from U.S. data in Europe, it is necessary to determine how similar the European and American regulations are. The European regulation system, relative to dust explosions, is based on two Directives: 1) Directive EEC/EAEC/EC No. 9, Mar. 23rd, 1994, 94/9/EC: “March 23rd,1994 European Parliament and Council Directive on the laws of the mem-
Tecnica Molitoria International - Yearly issue 2012 - 77
sAFETY
Table 10 - Conversion between U.S. and European descriptive probability scale (FAA). Descriptive probability per operating hour in Europe (JAR)
Numeric Probability Operating hours per operating hour
Frequent Reasonably probable
Between 1 and 10-3 Between 10-3 and 10-5
Remote Between 10-5 and 10-7 Extremely remote Between 10-7 and 10-9 Extremely improbable
Over 10-9
Descriptive probability per operating hour in Usa (FAR)
1 to 1.000 1,000 to 100,000
Probable
100,000 to 10,000,000 10,000,000 to 1,000,000,000
Improbable
Over 1,000,000,000
Extremely improbable
Table 11 - Expected mean likelihood occurrence of explosion per operative hour. For each amount processed per year both the expected frequency and the operative hours of waiting time between two events are shown (in bold). Values in red are less than 100,000 hours of operating time between explosions (Barley, Oats, Rice). Expected mean year incidence of explosion in grain storage facility per 106 tons Time of return (year) per 106 tons Operative hours per year Million tons handled per year
0.05
Barley
Corn
Oats
Rice
Rye
Sorghum
Wheat
1.45E-02
1.32E-02
4.38E-02
2.46E-02
0.00E+00
8.33E-03
8.14E-03
69
76
23
41
0
120
123
2000
2000
2000
2000
2000
2000
2000
Expected year frequency (likelihood of occurrence) of explosion in grain storage facility Operative hours (bold values) 3.61E-07
3.29E-07
1.10E-06
6.16E-07
2.08E-07
2.03E-07
2,995,691
3,038,659
912,299
1,623,427
4,799,783
4,915,732
1.81E-06
1.65E-06
5.48E-06
3.08E-06
1.04E-06
1.02E-06
0.25
553,554
607,732
182,460
324,685
959,957
983,146
2.03E-06
3.61E-06
3.29E-06
1.10E-05
6.16E-06
2.08E-06
0.5
276,777
303,866
91,230
162,343
479,978
491,573
5.42E-06
4.94E-06
1.64E-05
9.24E-06
3.13E-06
3.05E-06
184,518
202,577
60,820
108,228
319,986
327,715
4.07E-06
0.75 1
7.23E-06
6.58E-06
2.19E-05
1.23E-05
4.17E-06
138,388
151,933
45,615
81,171
239,989
245,787
9.03E-06
8.23E-06
2.74E-05
1.54E-05
5.21E-06
5.09E-06
1.25
110,711
121,546
36,492
64,937
191,991
196,629
1.08E-05
9.87E-06
3.29E-05
1.85E-005
6.25E-06
6.10E-006
92,300
101,289
30,410
54,114
159,993
163,858
1.5
78 - Tecnica Molitoria International - Yearly issue 2012
sAFETY ber States concerning equipment and system protection to be used in potentially explosive atmosphere”, also known as ATEX 95. 2) “1999/92/EC European Parliament and Council December 16th, 1999 Directive on minimum requirements for improving the safety and the health protection of potentially exposed workers to the risk of explosive atmospheres (15th particular Directive under article 16, paragraph 1, of Directive 89/391/EEC)”, also known as ATEX 137. These guidelines establish a set of general rules and procedures to be adopted in the presence of potentially explosive atmospheres, including those generated from dust. Agricultural dusts are one of these. The American regulation system is based on a set of general rules, such as the NEC (National Electrical Code, comparable to the Italian CEI), and rules dedicated to agricultural dusts, with particular specifications for components or plants. Some of these rules are presented in tab. 12. The similarities between the two regulation systems are mainly the basic rules, the organizational measures, the obligations for employers, worker training and their risks. On the other hand, European regulations differ from the American standards in law enforcement. In fact, the American ones specify procedures such as cleaning of the incoming grain flow and observation of numerical values, such as grid size, dust layer height, tape type, etc. It is very difficult to establish which is superior between the two systems, however, it is clear that they are both very well designed. The main difference today is that the American system has been demonstrated to be effective numerically, due to the amount of data collected over time. Running a similar test is not currently pos-
sible in Europe. Based on the available European data (ARIA database) it is not possible to assume that the phenomenon has reached American proportions. Indeed, cereal explosions in Europe are not so common, probably because of lower production volumes. In Italy, the only analysed explosion occurred in 2007 (see Tecnica Molitoria, June 2010, pag. 594-606). While the Italian wheat production is of eight million tonnes per year (ISTAT data), for many plants producing more than one million tons of product per year is on the wish list.
CONCLUSIONS The surveys on the average probability of explosions in grain storage facilities have highlighted differences among the various kinds of cereals. It follows that some cereals are more subject to explosions, such as oat and rice, and other less subject, such as wheat and sorghum. The values found, based on U.S. data, are not currently comparable with similar European values because of the amount difference between European and U.S. data. Regarding the significance of the numbers found, it is noted that the U.S.A. alone produces 42% of the world’s corn production, as shown in fig. 7. The analysis of the regulations for both countries suggest that the values found in the U.S. may be used as a reference for European regulations, pending similar and hoped for surveys and analysis for Europe. A bitter consideration to make is that it is easier to acquire data for the American production of a single cereal in 1905 than that for any European production in the year 2000.
Tecnica Molitoria International - Yearly issue 2012 - 79
sAFETY
Table 12 - Summary of the safety standards for agricultural plants and powders used in the U.S. 1. Accident Prevention Manual for Industrial Operations; National Safety Council, 425 North Michigan Avenue, Chicago, Illinois 60611. 2. Practical Guide to Elevator Design; National Grain and Feed Association, P.O. Box 28328, Washington, DC 20005. 3. Dust Control for Grain Elevators; National Grain and Feed Association, P.O. Box 28328, Washington, DC 20005. 4. Prevention of Grain Elevator and Mill Explosions; National Academy of Sciences, Washington, DC (Available from National Technical Information Service, Springfield, Virginia 22151). 5. Standard for the Prevention of Fires and Explosions in Grain Elevators and Facilities Handling Bulk Raw Agricultural Commodities, NFPA 61B; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 6. Standard for the Prevention of Fire and Dust Explosions in Feed Mills, NFPA 61C; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 7. Standard for the Prevention of Fire and Dust Explosions in the Milling of Agricultural Commodities for Human Consumption, NFPA 61D; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 8. Standard for Pneumatic Conveying Systems for Handling Feed, Flour, Grain and Other Agricultural Dusts, NFPA 66; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 9. Guide for Explosion Venting, NFPA 68; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 10. Standard on Explosion Prevention Systems, NFPA 69; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 11. Safety-Operations Plans; U.S. Department of Agriculture, Washington, DC 20250. 12. Inplant Fire Prevention Control Programs; Mill Mutual Fire Prevention Bureau, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 13. Guidelines for Terminal Elevators; Mill Mutual Fire Prevention Bureau, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 14. Standards for Preventing the Horizontal and Vertical Spread of Fires in Grain Handling Properties; Mill Mutual Fire Prevention Bureau, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 15. Belt Conveyors for Bulk Materials, Part I and Part II, Data Sheet 570, Revision A; National Safety Council, 425 North Michigan Avenue, Chicago, Illinois 60611. 16. Suggestions for Precautions and Safety Practices in Welding and Cutting; Mill Mutual Fire Prevention Bureau, 1 Pierce Place, Suite1260 West, Itasca, Illinois 60143-1269. 17. Food Bins and Tanks, Data Sheet 524; National Safety Council, 425 North Michigan Avenue, Chicago, Illinois 60611. 18. Pneumatic Dust Control in Grain Elevators; National Academy of Sciences, Washington, DC (Available from National Technical Information Service, Springfield, Virginia 22151). 19. Dust Control Analysis and Layout Procedures for Grain Storage and Processing Plants; Mill Mutual Fire Prevention Bureau, 1 PiercePlace, Suite 1260 West, Itasca, Illinois 60143-1269. 20. Standard for the Installation of Blower and Exhaust Systems for Dust, Stock and Vapor Removal, NFPA 91; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 21. Standards for the Installation of Direct Heat Grain Driers in Grain and Milling Properties; Mill Mutual Fire Prevention Bureau, 1Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 22. Guidelines for Lubrication and Bearing Maintenance; Mill Mutual Fire Prevention Bureau, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 601431269. 23. Organized Maintenance in Grain and Milling Properties; Mill Mutual Fire Prevention Bureau, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 24. Safe and Efficient Elevator Legs for Grain and Milling Properties; Mill Mutual Fire Prevention Bureau, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 25. Explosion Venting and Suppression of Bucket Elevators; National Grain and Feed Association, P.O. Box 28328, Washington, DC 20005. 26. Lightning Protection Code, NFPA 78; National Fire Protection Association, Batterymarch Park, Quincy, Massachusetts 02269. 27. Occupational Safety in Grain Elevators, DHHS (NIOSH) Publication No. 83-126); National Institute for Occupational Safety and Health, Morgantown, West Virginia 26505. 28. Retrofitting and Constructing Grain Elevators; National Grain and Feed Association, P.O. Box 28328, Washington, DC 20005. 29. Grain Industry Safety and Health Center Training Series (Preventing grain dust explosions, operations maintenance safety ,transportation safety, occupational safety and health); Grain Elevator and Processing Society, P.O. Box 15026, Commerce Station, Minneapolis, Minnesota 55415-0026. 30. Suggestions for Organized Maintenance; The Mill Mutuals Loss Control Department, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 31. Safety - The First Step to Success; The Mill Mutuals Loss Control Department, 1 Pierce Place, Suite 1260 West, Itasca, Illinois 60143-1269. 32. Emergency Plan Notebook; Schoeff, Robert W. and James L. Balding, Kansas State University, Cooperative Extension Service, Extension Grain Science and Industry, Shellenberger Hall, Manhattan, Kansas 66506. [52 FR 49625, Dec. 31, 1987, as amended at 53 FR 17696, May 18, 1988; 54 FR 24334, June 7, 1989; 55 FR 25094, June 20, 1990; 61 FR 5507, Feb. 13, 1996; 61 FR 9227, March 7, 1996; 61 FR 9577, March 8, 1996]
80 - Tecnica Molitoria International - Yearly issue 2012
sAFETY
Fig. 7 - 2007 world corn production (Author’s elaboration on FAO data).
In Italy, but probably as well as in most other European countries, considering the quantities processed in each production unit, and considering that expected frequencies found for storage plants are the highest within the milling industry, it can be assumed that in establishments that comply with regulations, the occurrence of grain dust explosions is reasonably “improbable”.
BIBLIOGRAPHY 1999/92/EC, December 16th, 1999 European Parliament and Council Directive on minimum requirements for improving the safety and the health protection of potentially exposed workers to the risk of explosive atmospheres (15th particular Directive under article 16, paragraph 1, of Directive 89/391/EEC) (ATEX 137).
ARIA database (Analyse, Recherche et Information sur les Accidents - Analysis, Research and Information on Accidents), http://www.aria.developpement-durable. gouv.fr/ Demontis G., Cadoni L., Granata V., Sassu F., Savarese S. “L’autocombustione negli stoccaggi di cereali”, (on demand book, www.lulu.com), 2008. (Spontaneous combustion in grain storage plants). Demontis G., Cadoni L., Sassu F. “Statistiche delle esplosioni nei cereali e valutazione del rischio”, (on demand book, www.lulu.com), 2009. (Grain explosion statistics and risk analysis). INRS Institut Nationale de Recherche e de Sécurité, “Ed846 Silos Grains - Prévention de risques de incendie et de explosion de poussières dans les opérations de stockage”. INRS Institut Nationale de Recherche e de Sécurité, Ed845 “La filière Grains - Prévention de risques de incendie et de explosion de poussières dans les opérations de stockage”. Kansas State University, United States Agricultural Dust Explosion Information, www.oznet.ksu.edu/pr_histpubs/Dust_Exp.htm. March 23rd,1994 European Parliament and Council Directive on the laws of the member States concerning equipment and system protection to be used in potentially explosive atmosphere (ATEX 95). National Agricultural Statistics Service, http://www.nass. usda.gov/Publications/Ag_Statistics/ National Materials Advisory Board. “Guidelines for the investigation of grain dust explosions”, (books.nap. edu/catalog.php?record_id=10954), National Academy Press, Washington D.C., 1983. National Materials Advisory Board. “Prevention of grain elevator and mill explosions”, (books.nap.edu/openbook.php?record_id=10953), National Academy Press, Washington D.C., 1982. OSHA (Occupational Safety & Health Administration). “Regulatory review of Osha’s Grain Handling Facilities Standard, [29 CFR 1910.272], Table 5 - Number of Grain Dust-Related Explosions, Deaths, and Injuries, 1958-1998, publish 2003”, www.osha.gov/SLTC/grainhandling/index.html. Saskatchewan Agriculture and Food’s Agriculture Knowledge Centre, http://www.agriculture.gov.sk.ca/AKC. United States department of Agriculture (USDA), www. usda.gov/wps/portal/usdahome.
Tecnica Molitoria International - Yearly issue 2012 - 81
maize
CAROTENOID content in ITALIAN MAIZE germplasm
Keywords: carotenoids, maize inbred lines, b -carotene, TLC, spectrophotometric quantification
Michela Alfieri* - Nicola Berardo - R ita R edaelli CRA-MAC Maize Research Unit - Via Stezzano 24 - 24126 Bergamo - Italy *michela.alfieri@entecra.it
82 - Tecnica Molitoria International - Yearly issue 2012
maize ABSTRACT
INTRODUCTION
Carotenoids are natural compounds that play an important role in human nutrition and health. Among them b-carotene is quite relevant, being a precursor of vitamin A. As the nutritional value of maize could be improved by provitamin A biofortification through conventional breeding, total carotenoids from 11 Italian inbred lines, selected as starting material for a breeding program focused at improving maize nutritional quality, were extracted and quantified by spectrophotometry. The results showed high contents of total carotenoids (mean value = 34.49 ± 8.0 µg/g d.m) and a wide range of variation, from 23.16 (Lo1189) to 50.10 (Lo59) µg/g d.m. The evaluation of the ratio of provitamin A (a-,b-carotene and cryptoxanthin) to non-provitamin A compounds (lutein and zeaxanthin) was carried out by thin layer chromatography (TLC). From this analysis two lines (Lo93 and Lo589) revealed to have an apparent high content of b-carotene. Finally, a fast PCR screening was used to identify the lines carrying the optimal alleles for the gene hydroxylase3, which appeared to be associated with an enhanced provitamin A content. Most of the lines were found to carry allele A, corresponding to a moderate b-carotene content. Line Lo457 carried allele B, whereas lines Lo93 and Lo309 were found to have the favorable composition AB.
Carotenoids constitute a group of over 700 molecules that give fruit and flowers a distinctive red, orange, and yellow colouring. Monoxygenated carotenoids are referred to as carotenes, whereas their oxygenated derivatives are designated as xanthophylls (DellaPenna and Pogson, 2006). In some cases specific carotenoids (such as a-, b-carotene and cryptoxanthin) are essential components of mammalian diets as precursors for vitamin A synthesis (Aluru et al., 2008), whose deficiency remains a significant global health problem that involves many people, especially children, in the Southern part of the world (Underwood, 2004). The biosynthetic pathway of carotenoids (fig. 1) has been extensively studied and described by many Authors (see DellaPenna and Pogson, 2006 for a review). Many studies have also explored the possibility to increase the carotenoid content in staple crops by conventional breeding strategies or metabolic engineering (Sandmann, 2001; Egesel et al., 2003; Kopsell and Kopsell, 2006; Aluru et al., 2008; Giuliano et al., 2008; Ibrahim and Juvik, 2009). Recently, a simple PCR assay was developed, that allowed the alleles of the gene hydroxylase3 (HDY3) to be identified. HYD3 controls the synthesis of one of the hydroxylases involved in the conversion of provitamin A carotenes to non provitamin A xantophylls (fig. 1), and its alleles were found to be associated with an enhanced or reduced provitamin A content (Vallabhaneni et al., 2009). Maize (Zea mays L.) is a potential crop for biofortification through breeding programs because of the presence of considerable natural variability for the main components of the grain. In particular, the traditional Ital-
Tecnica Molitoria International - Yearly issue 2012 - 83
maize duced in the last agronomic season. The objectives of the present study were (1) to assess the carotenoid content in these genotypes, and (2) to test the molecular screening method to identify the lines which are richer in b-carotene.
MATERIALS AND METHODS Plant material
Fig. 1 - Carotenoid biosynthetic pathway (adapted from Vallabhaneni et al., 2009)
ian maize traditional germplasm (open-pollinated populations and inbreds) resulted to be rich in carotenoid content (Berardo et al., 2004; 2009). In the 1950’s the rapid diffusion of maize hybrids, characterized by a superior yield performance, brought about a progressive replacement of local populations. At the same time, a wide group of local maize populations was collected across Italy and are still conserved in the germplasm collection at CRA-MAC. These genotypes could represent in fact an interesting source of alleles to be exploited in breeding programs to develop modern maize lines with increased nutritional value for the food industry. In this framework, a set of traditional lines have been multiplied in the past few years and characterized in terms of agronomic performance and biochemical composition of the grain. From this preliminary characterization, 11 lines were selected and repro-
84 - Tecnica Molitoria International - Yearly issue 2012
The genotypes used in this study consisted of 11 Italian inbred lines (tab. 1). Lines Lo348, Lo452 and Lo457 derived from crosses between some traditional lines, whereas Lo1189 was released by CRA-MAC in 1998. About ten plants for each line were reproduced by selfpollination in 2011. After harvest, the ears were dried at 40°C for three weeks, then the seeds were ground and the flour was immediately used for the analyses. DNA extraction Five seeds of each line were grown in greenhouse for two weeks, and young leaves were collected, freeze-dried in liquid nitrogen and stored at -80°C. Genomic DNA was extracted using a GenElute Plant Genomic DNA Minipreps Kit (Sigma). Extraction and spectrophotometric quantification of total carotenoids The extraction of carotenoids was based on the procedure described by Schaub et al. (2004). About 20 g of grains from each line were milled to fine flour and stored at 4°C. Six mL of EtOH: BHT (1:1 w/v) were added to 500 mg of flour. Samples were incubated for 5 min at 85°C, followed by a saponifica-
maize tion step (10 min at 85°C) with 120 µL of freshly prepared KOH 17.8 M. Samples were vortexed, cooled on ice, then 4 mL of cold distilled water were added. Three mL of 2:1 (v/v) petroleum ether: diethyl ether (PE:DE) were added, then the samples were mixed and centrifuged for 10 min at 3,500 rpm. The upper layer was recovered and the separation was repeated twice with 3 mL of 2:1 PE:DE (v/v). The combined fractions were made up to 10 mL with 2:1 PE:DE (v/v), and optical density (OD) of total carotenoids was recorded at 450 nm using a Lambda UV/VIS spectrophotometer (Perkin Elmer Life Sciences). The values are the mean of three replicates. The content of carotenoids was calculated using the Lambert-Beer equation and expressed on a dry matter basis, as reported in Schaub et al. (2004).
Thin layer chromatography (TLC) Thin layer chromatography (TLC) analysis was performed for the separation of the different components of carotenoids according to the number of their functional (-OH) groups, using a modified version of the protocol described by Mishra et al. (2010). TLC was optimized varying different parameters: the solvents used, the amount of carotenoids loaded, the time of elution, and the support of silica plates. About 0.5 µg of total carotenoids extracted were air dried, re-suspended into chloroform (15 µL) and immediately loaded to silica TLC plates using a micropipette. An aliquot of b-carotene (Sigma) was loaded near the samples as a mobility standard. A mixture of petroleum ether, diethyl ether
Table 1 - Inbred lines used in this work, their origin, total carotenoid content, grain color, estimated amount of b-carotene and HYD3 alleles. Line Origin Lo18 Lo21 Lo39 Lo59 Lo93 Lo309 Lo348 Lo452 Lo457 Lo589 Lo1189
Nostrano dell’Isola Nostrano dell’Isola Scagliolo Marano Scagliolino precoce King Ko Lo5^2 x Lo23 Lo5^2 x Lo19 Lo43 x Lo 58 Nostrano dell’Isola LA47678xP3245 Mean SD
Total Grain color b-carotene* carotenoids µg/g d.m. 30.99 36.66 28.48 50.10 46.91 31.46 33.16 28.49 37.69 35.60 23.16 34.49 8.0
light orange orange light orange red dark orange yellow orange orange dark orange orange light orange
low medium medium low high low low medium medium high low
HYD3 allele
A A A A AB AB A A B A A
*estimate from TLC analysis.
Tecnica Molitoria International - Yearly issue 2012 - 85
maize and acetone (40:10:10, v/v) was chosen as the solvent. After a run of 5-7 minutes, the chromatogram was photographed and analysed, and the Retention factor (Rf) of every compound was calculated. Hydroxylase3 assay A PCR reaction to amplify different alleles of the gene hydroxilase3 (HYD3) was carried out as described by Vallabhaneni et al. (2009). The PCR assay utilized five primers: P1 (GACTTGTGAGCAAGGGGAAG) and P2 (GACGTGACTCCGAGGCTAGA), A (TTATATGG ATAGTTCACATACCTC), B (AACACTCACGCTCCCGCG) and C (AACACTCCCGC TCCCGCGGCTCG). Allele A (163 bp) was amplified by primers A and P1; allele B (476 bp) was amplified by primers B-P2 and allele C (473 bp) was amplified by primers C-P2. Three PCR reactions were carried out separately for each genotype instead of the multiplex reaction proposed by Vallabhaneni et al. (2009).
RESULTS AND DISCUSSION Quantification of total carotenoids The spectrophotometric quantification of total carotenoids in the 11 inbreds showed a range of variation from 23.16 (Lo1189) to 50.10 (Lo59) µg/g d.m. with a mean value of 34.49 ± 8.0 µg/g d.m. (tab. 1). Both the mean value and the range of variation resulted to be quite high as compared to the data reported for inbred lines in recent works (Chander et al., 2008; Ibrahim and Juvik, 2009; Vallabhaneni et al., 2009; Kuhnen et al., 2011). These results confirmed those obtained in previous papers about the rich-
86 - Tecnica Molitoria International - Yearly issue 2012
ness in total carotenoids of most traditional Italian varieties (Berardo et al., 2004; 2009). The variability of total carotenoid content in these lines could be deduced also by the differences in the color of their grains (fig. 2). As expected, lines Lo59 and Lo93, which have a darker grain colour, were the richest in carotenoids, whereas Lo309 and Lo39, presenting a yellow and light orange color respectively, had a lower carotenoid content (fig. 2). The analysis of the chemical composition of these lines indicated that some of them were also characterized by high contents of protein and lipid (data not shown). This characteristic, together with the high content of carotenoids, suggest that these genotypes could be an interesting material to be selected in a breeding program focused on the nutritional quality of maize. Qualitative analysis of provitamin A content Thin layer chromatography (TLC) is a fast and simple method for the preliminary and qualitative analysis of different chemical compounds and was found to have the potential to be the first choice for the analysis of carotenoids in biological samples (Zeb and Murkovic, 2010). Using TLC, three groups of compounds were separated in the samples analysed (fig. 3): carotenes, such as b-carotene, that have no retention and migrate with the solvent front (Rf=0.94); monohydroxylated compounds (cryptoxanthin), that migrate at an intermediate distance (Rf=0.43); dihydroxylated compounds (lutein and zeaxanthin), that remain closer to the origin (Rf=0.18). Although the TLC method allows only a qualitative analysis, the thickness of the
maize
Fig. 2 - Ears of some of the Italian inbred lines used in this work.
Fig. 3 - Separation of carotenoid components by TLC analysis.
Tecnica Molitoria International - Yearly issue 2012 - 87
maize two fastest bands in relation to the slowest one is representative of the relative content of provitamin A (a-carotene, b-carotene and cryptoxanthin) to non-provitamin A compounds (lutein and zeaxanthin). Considering the relative intensity of their band, lines Lo93 and Lo589 appeared to have the largest content of b-carotene. On the other hand, the other genotypes presented a low or medium level of b-carotene (tab. 1). No definite relation was found between the estimated amount of b-carotene and the content of total carotenoids.
LCYE, coding for the enzyme lycopene e-cyclase, bound to the conversion of lycopene to α-carotene (fig. 1). This enzyme has the largest effect on the partitioning of the two branches of carotenoids and, consequently, on the b-carotene and b-cryptoxanthin content (Harjes et al., 2008). Therefore, these two assays may be used together, in order to select the lines containing optimal HYD3 and/ or LCYE alleles.
Molecular analysis
The identification of maize genotypes rich in carotenoids and provitamin A compounds is one of the objectives of the most recent breeding programs, aimed at developing modern maize hybrids with a higher nutritional value. The analytical methods used in the present study (the extraction protocol for carotenoids, the TLC analysis and the PCR assay) resulted to be quite fast and simple, and represented good preliminary methods for the characterization of the lines under selection. In order to evaluate how the good nutritional characteristics of the selected lines can be expressed in the hybrids derived from them, a set of crosses among the inbreds here described have been carried out, and are currently under study from both a genetic and biochemical point of view.
In a recent paper (Vallabhaneni et al., 2009), alleles B and C of the gene hydroxilase3 (HYD3), key enzyme of carotenoid pathway in plants, were found to be correlated with an enhanced content of b-carotene, whereas allele A was amplified in genotypes with a low amount of this molecule. The PCR screening proposed in that work was carried out to identify the HYD3 alleles in our set of inbred lines. Lo93 and Lo309 showed to have both allele A and B, Lo457 was the only line carrying allele B, and the other genotypes had allele A (tab. 1). Comparing these results with the TLC analysis, the only line carrying the optimal allele B and having a high content of provitamin A was Lo93. The two other lines carrying allele B (Lo457 and Lo309) presented medium or low levels of b-carotene respectively, therefore no correlation between the qualitative and molecular analysis was found in these genotypes. To get a more accurate molecular prediction of provitamin A content, additional PCR methods were proposed, involving the amplification of the different alleles of the gene
88 - Tecnica Molitoria International - Yearly issue 2012
CONCLUSIONS
REFERENCES Aluru M., Xu Y., Wang Z., Li S., White W., Wang K., Rodermel S. “Generation of transgenic maize with enhanced provitamin A content”. Journal of Experimental Botany, 59:3551-3562, 2008. Berardo N., Brenna O.V., Amato A., Valoti P., Pisacane V., Motto M. “Carotenoid concentration among maize
maize genotypes measured by near infrared reflectance spectroscopy (NIRS)”. Innovative Food Science and Emerging Technologies, 5:393-398, 2004. Berardo N., Mazzinelli G., Valoti P., Laganà P., Redaelli R. “Characterization of maize germplasm for the chemical composition of the grain”. Journal of Agricultural and Food Chemistry, 57:2378-2384, 2009. Chander S., Meng Y., Zhang Y., Yan J., Li J. “Comparison of nutritional traits variability in selected eightyseven inbreds from Chinese maize (Zea mays L.) germplasm”. Journal of Agricultural and Food Chemistry, 56:6506-6511, 2008. DellaPenna D., Pogson B.J. “Vitamin synthesis in plants: tocopherols and carotenoids”. Annual Rewiev of Plant Biology, 57:711-38, 2006. Egesel C.O., Wong J.C., Lambert R.J., Rocheford T.R. “Gene dosage effects on carotenoid concentration in maize grains”. Maydica, 48:183-190, 2003. Giuliano G., Tavazza R., Diretto G., Beyer P., Taylor M.A. “Metabolic engineering of carotenoid biosynthesis in plants”. Trends in Biotechnology, 26:139145, 2008. Harjes C.E., Rocheford T.R., Bai L., Brutnell T.P., Kandianis C.B., Sowinski S.G., Stapleton A.E., Vallabhaneni R., Williams M., Wurtzel E.T., Yan J., Buckler E.S. “Natural genetic variation in Lycopene Epilon Cyclase tapped for maize biofortification”. Science, 319:330333, 2008. Ibrahim K.E., Juvik J.A. “Feasibility for improving phytonutrient content in vegetable crops using conventional breeding strategies: case study with carotenoids and tocopherols in sweet corn and broccoli”. Journal
of Agricultural and Food Chemistry, 57:4636-4644, 2009. Kopsell D.A., Kopsell D.E. “Accumulation and bioavailability of dietary carotenoids in vegetable crops”. Trends in Plant Science, 11:500-507, 2006. Kuhnen S., Lemos P.M.M., Campestrini L.H., Ogliari J.B., Dias P.F., Maraschin M. “Carotenoid and anthocyanin contents of grains of Brazilian maize landraces”. Journal of Science and Food Agriculture, 91:1548-1553, 2011. Mishra P. and Singh N.K. “Spectrophotometric and TLC based characterization of kernel carotenoids in short duration maize” Maydica, 55:95-100, 2010. Sandmann G. “Genetic manipulation of carotenoid biosynthesis: strategies, problems and achievements”. Trends in Plant Science, 6:14-17, 2001. Schaub P., Beyer P., Islam S., Rocheford T. “Maize quick carotenoid extraction protocol”. http://www.cropsci. uiuc.edu/ faculty/rocheford/quick_carotenoid_analysis_ protocol.pdf, 2004. Underwood B.A. “Vitamin A deficiency disorders: international efforts to control a preventable Pox”. Journal of Nutrition, 134: 231S-236S, 2004. Vallabhaneni R., Gallagher C.E., Licciardello N., Cuttriss A.J., Quinlan R.F., Wurtzel E.T. “Metabolite sorting of a germplasm collection reveals the hydroxylase3 locus as a new target for maize provitamin A biofortification”. Plant Physiology, 151:1635-1645, 2009. Zeb A., Murkovic M. “Thin-layer chromatographic analysis of carotenoids in plant and animal samples”. Journal of Planar Chromatography, 23:94-103, 2010.
FOODEXECUTIVE 1-4 TM_Layout 1 15/02/12 10:05 Pagina 2
the italian food industry supplier portal
Tecnica Molitoria International - Yearly issue 2012 - 89
Tecnica Molitoria
The monthly Italian MILLING MAGAZINE since 1950 “Tecnica Molitoria International” is the English language son of the Italian monthly magazine “Tecnica Molitoria” published by Chiriotti Editori, which enjoys worldwide prestige as the most complete journal dealing with all branches of pasta making, wheat milling, feed mills, silos, and cereal chemistry. Tecnica Molitoria The Italian language “Tecnica Molitoria” journal first appeared in 1950, and now runs about 200 pages per issue, 12 times each year. Technical and scientific articles by Italian and foreign experts (with English abstracts), descriptions of new machinery, equipment, technologies and services, economical and legislative news, exhibition and congress reportages, and current activities are regularly published each month. The summaries of the technical and scientific articles published in the current and past issues of “Tecnica Molitoria” can be viewed at the web page www. tecnicamolitoria.com.
90 - Tecnica Molitoria International - Yearly issue 2012
Further to the usual subscription of “Tecnica Molitoria” hard copy by air-mail, it is now possible to receive the issues in PDF for tablet. The 2012 PDF subscription of 12 issues is offered at the special price of 25 euro. To subscribe write an e-mail to abbonamenti@chiriottieditori.it or subscribe on line at www.tecnicamolitoria.com by clicking “One year subscription rate”. Tecnica Molitoria International Since the year 2000 “Tecnica Molitoria International” is published as well. It is issued once a year completely in English language and with exclusive articles and news. This magazine is sent abroad for free, in order to promote the Italian technology, machinery, and research worldwide. “Tecnica Molitoria International” is also available on-line for free, together with several other English language technical magazines of Chiriotti Editori publishing house, at the web page www.chiriottieditori. com (click “Digital Magazines”).
Tecnica Molitoria
The web page www.tecnicamolitoria.com where “Tecnica Molitoria” updated indexes can be found.
“Tecnica Molitoria International” is freely available on-line at www.chiriottieditori.com (click “Digital Magazines”).
Tecnica Molitoria International - Yearly issue 2012 - 91
Silos
AUTOMATED cereal LEVELLER with temperature/humidity MONITORING In recent years the demand for stored cereals in warehouses has grown in comparison to metallic silos. Two are the main reasons, firstly because it undoubtedly represents a better investment and secondly because
Grainsting Master System for monitoring the temperature and humidity of stored products (Fornasier Tiziano & C.).
92 - Tecnica Molitoria International - Yearly issue 2012
mechanization and automated conservation have reached surprising levels. For this purpose, as regards the loading, unloading and monitoring product conservation parameters such as temperature and humidity, Fornasier Tiziano & C. has developed the Grainsting levelling system with a complete PLC-PC automation. This system includes the autonomous management of loading or unloading warehouses by means of the selection of modality and work quotas, as well as the application of Grainsting Master or Roll. These latter are used in the automatic recording at pre-set quotas of product temperature and humidity by means of a telescopic pneumatic piston with a wireless sensor installed in the stem point for the transmission of the data or a motorized roll/unroll reel, with stainless steel sensor. Grainsting can record up to approximately 6,000 continuous readings before battery recharge of the board sensor,
Silos which is automatically programmed. The system is capable of recording an infinite number of points in the layers of the stored product both by length, width, and depth. Different from the other existing systems, the Grainsting levelling system guarantees a total monitoring of the temperature and humidity, thus optimizing the ventilation or refrigeration process. (Fornasier Tiziano & C. - Via Mercatelli Maglio 26 - 31010 Ponte Della Priula - TV - Italy - Fax +39 0438 759210 - www.fornasi ertiziano.com)
Grainsting Roll System (Fornasier Tiziano & C.).
MEZZA NUOVO SITO SFOGLIABILI TM_Layout 1 16/02/12 09:35 Pagina 2
www.chiriottieditori.com
the best way to BROWSE our site
CHIRIOTTI EDITORI www.chiriotti.it
Tecnica Molitoria International - Yearly issue 2012 - 93
Milling
STONE GRINDING mills From ancient times, men have used stones to grind cereals. Modern technology has improved the frame of the mills in order to increase their efficiency and the quality
The Combi Junior milling plant composed of: stone grinding mill MB250 and centrifugal sifter BD150 (Partisani).
94 - Tecnica Molitoria International - Yearly issue 2012
of the grinded product, looking for simple and cheap maintenance, but the grinding stone has remained the same. Today modern nourishment science has discovered the high value of wholemeal flours produced in stone grinding mills, in fact, they preserve all the vitamins and salts that are inside the grain. Partisani manufactures the milling plant with stone grinding mill, Combi Junior. It consists of the stone grinding mill mod. MB250 especially designed for wholemeal flour products and of the centrifugal sifter mod. BD150. The stone grinding mill, mod. MB250, can only grind dry products and not oily ones. Stones are hard, wear and tear proof and produce soft, light not overheated flours. The wide range of grinding products includes: cereals such as wheat, barley, millet, rice, oat, corn, spelt, kamut, buckwheat, etc.; leguminosea such as broad beans, lentils, chick pea, and spices. The stones are made of only natural material such as emery and flint, a quality magnesite is used as binding. They are solid and have an excellent resistance which means
Milling they are very durable. The frame construction of the 250 mm stone mill is from a “U� shaped drawn product frame, which is welded together, reaching high robustness. The hopper has a load capacity of 15 kg and the granules fall inside through an adjustable system. The fineness degree of the flour is adjustable using a wheel that regulates the distance between the stones. The hopper stone is fixed, while the lower stone is rolling and rotates by means of a trapezoidal belt drive, driven by a kW 1.8 electric motor, which can be supplied, or single-phase 230 Volts or three-phase 400 Volts. The rolling stone is equipped with two small wings to make the cleaning and the emptying of the grinding chamber easier. The centrifugal sifter, mod. BD150, may be considered the ideal completion of the company production of stone mills, in case
the user needs to sieve the wholemeal flour. It makes it possible to obtain a high output with a very good quality of sifted products. A minimum driving power absorption is required and it is driven by a single-phase 230 Volts km 0.12 electric motor, directly coupled with the shaft. The sifter has very small overall dimensions and is designed to fit to the stone mill MB-250. This combined machine allows great flexibility of the flow diagram and very simple and quick interchange of sieves. It allows three different selections to be selected, one kind of flour, brown short (fine bran), and bran. The sifter is coupled with three separate discharge outlets to sack the different types of flours. Every discharge spout is filled with nozzles and leather lacers. (Partisani - Via Buli 2 - 47122 ForlĂŹ - Italy Fax +39 0543 723237 - www.partisani.com)
ROLLERMILL, purifier, debranner, plansifter Golfetto Sangati, now completely integrated into the Pavan Group, presents a selection of the most representative machines of its range: the rollermill Synthesis, the purifier Semolina-HP, the hulling machine PSV/A and the plansifter, Modulo. The new rollermill Synthesis represents the ultimate technology for rollermills. It is the result of combining the constant research and development of expertise established in over 80 years of activity in the flour milling industry by the three historical trademarks Golfetto, Berga and Sangati. These are the credentials for the creation of Synthesis, a machine
capable of satisfying the strictest sanitary standards, ensuring milling precision and easy maintenance, versatile because of its modular construction that adapts itself to any layout requirement. With its solid and elegant structure, Synthesis has a cast-iron base and parts in contact with product are mainly made from hollow anodized aluminum alloy profiles for heat (condensate) and acoustic insulation, or from stainless steel. The 6060 alloy fully complies with the UNI EM 602 European Standard. Its chemical composition, in fact, is specific for use in the food processing industry.
Tecnica Molitoria International - Yearly issue 2012 - 95
Milling
Rollermills mod. Synthesis designed by Golfetto Sangati (Pavan Group).
As an evolution of the models PuriSwing by Sangati and Big Swing by Berga, Golfetto Sangati has created Semolina-HP, a series of semolina purifying machines. The feeding system of Semolina-HP ensures a perfect distribution of the product in the machine, which is an essential condition for the subsequent selection stage. Semolina is classified in a traditional way: 4 sieves in foodgrade aluminum 6060 in series on 3 overimposed rows. Semolina-HP is equipped with the patented “fly back” device which totally exploits the front sieves of the 2nd and 3rd row thus optimizing the cleaning of semolina and increasing machine performance. Semolina-HP is assembled without any welding, using stainless steel screws and bolts. The machine is sealed to avoid dust spillage during operation, which complies with the Atex safety standards for the milling areas classified as areas with dust explosion risk.
96 - Tecnica Molitoria International - Yearly issue 2012
The debranner PSV/A brings about a revolution in the traditional concept of cereal preparation before milling. The use of a debranner in the cleaning cycle ensures an abatement of the bacterial load as well as of plant phytochemicals, fungal toxins and heavy metals and brings the cereal to hygienic conditions ideal for milling. Resting times are significantly shortened as water absorption is enhanced as a consequence of the thinner bran layer. The milling yield and the quality of the so-called “noble products” are thus increased. The debranner PSV/A has a cast iron frame to guarantee solidity and absence of vibrations. The various parts are machined with numeric control units for a perfect coupling. The removal of the hulled product is adjusted by an automatic system that ensures maximum homogenization of the cereal hulling action. A new concept of plansifter has been developed with the model, Modulo. Its aluminum alloy structure has an oscillating drive mechanism that can be attached to 2 up to 10 sections (modules) having a wide range of sieve configurations (number, dimensions, and type of sieves in wood or aluminum) to reach a sifting area of up to 117 square meters depending on the type of cereal or milling flowsheet. A new patented assembly method guarantees a sturdy structure with 30% weight reduction and full compliance with the latest safety standards. The innovative design with special rounded-edges profiles reduces the dead area preventing product build up and infestation. Easy operation and reduced maintenance are assured. (Golfetto Sangati S.p.A - Via Fratelli Bandiera 3 - Quinto di Treviso - TV - Italy - Fax +39 0422 476800 - www.golfettosangati. com)
Milling GRINDING/FLUTING machine and dedicated SERVICE PACKAGES Due to the great success obtained by the grinding/fluting machine type GFA 160 and the continuous sales and new requirements also from the comparisons with customers, Ocrim has launched the new grinding/fluting GFI (Italian Grinding Fluting Machine) onto the market. It was created with a typical Italian DNA. It is characterized by an extremely innovative architecture and technical solutions that drastically reduce the installation times, maintenance, cleaning, and preparation of working processes. Its special features are: ergonomics, safety, precision and rapidity of the working phases; reduced cleaning and maintenance; reliability; easy-learning in the use of the machine; reduced spaces and operating costs. The
time of grinding and fluting has been reduced by adopting abrasive wheels and tools, which allow a higher cutting speed. Also the accelerations and the speed in the return strokes have been increased. The dimensions have been reduced too. The configuration of the new grinding/ fluting machine type GFI consists of a monolithic basement, made of electrowelded stabilized steel, designed with the most modern technologies to guarantee the maximum stability and permanent stiffness. Maintenance and wear are also considerably reduced. Servomotors with permanent, brushless magnets, the adoption of toothed belts and Poly-V, precision reducer and self-lubricated grinding stone all allow long intervals between
The new grinding/fluting GFI machine and a detail (Ocrim).
Tecnica Molitoria International - Yearly issue 2012 - 97
Milling enable the customer to make more convenient choices based on his own needs. The Domotics Pack has been created for the reduction of costs not strictly connected to the production and for an optimization of the plant supervision. The pack provides: control of the plant by the internal circuit of video cameras on the floors (available also in the night version), besides the external circuit to guarantee the safety, with direct checking from the control room; integrated control of the alarms that allows, in any moment, to understand which switch has been turned on and in which part of the plant; remote starting and stopping of all the lights present in the plant and the possibility to have automatic doors and windows; finalBANNER OCRIM INGL_Layout 1 01/02/12 10:11 Pagina 1 ly the automatic management of all the secondary users (air conditioning, treatment of waters, etc.). The new @mobile Pack has been created OCRIM PRESENTS to optimize the management of the millTHREE DEDICATED PACKS ing plants. Through the Wi-Fi network inside the building and web from the outside, an interface man-machine and man-plant to be used via tablet or mobile phone, it is possible to execute all the operations that normally are carried out in the control room. A complete vision of the power consumption of the various sections of the plant, capacities, screenings, yields, moisture and types of products, and specific interaction with the intelligent machines and access to the setting pages are provided. On-line manuals and, finally, a whole series of applications allow the sharing of the information and the automatic reports. (Ocrim - Via Massarotti 76 - 26100 Cremona - Italy - Fax +39 0372 412692 - www. ocrim.com)
maintenances. A simple learning menu with rapid setting of the working parameters makes easy the use of the machine even for unskilled operators. Ocrim has also developed three dedicated packages, integrable among themselves, with the main object being the reduction of costs and the optimization of the plant management, energy saving, domotics, and mobile pack. The Energy Saving Pack is a group of technical solutions, from the intelligent pneumatic conveying systems to the high efficiency bearings. Last generation motors and transformers allow a continuous saving; amortization and saving allowances
98 - Tecnica Molitoria International - Yearly issue 2012
Sorting
VISION colour SORTING machine The launch of the Futura HP model at the last Ipack-Ima exhibition marked a turning point for Asm Advanced Sorting Machines in 2011. The great versatility, stability, output and reliability of this optical sorter has led to the production of over 300 machines, conquering new markets as well as consolidating existing ones. The impulse of this success has led Asm to double its production facilities and strongly increase the number of employees. The product range has been widened too and two new types of sorters have been developed: the Murano series to sort glass waste and the Iron series to spot and expel traces of stainless steel from mixed materials. However, the novelty is the launch of the new optical sorter series, Vision. This series marks a momentous step or, rather, a technological improvement in the field of optical sorters. Asm states that all the theoretical concepts that have been at the base of optical sorting for the past 30 years have been totally surpassed and replaced by this new technology, which is no longer based
on electronic signals but on real vision, hence the name. Further details regarding this new sorter can be obtained by contacting Asm. (Asm - Via del Lavoro 10/12 - 40050 Argelato - BO - Italy - Fax +39 051 897386 - www. sortingasm.com)
The new series of colour sorter, model Vision (Asm).
Tecnica Molitoria International - Yearly issue 2012 - 99
Sorting OPTICAL and RESONANCE sorting machines Sea manufactures optical and resonance sorting machines which are able to meet the various market requirements. The Pixel model is an extremely functional sorter for many different sorting requests. It can foresee from one to five chutes, granting a huge versatility in sorting configurations. The Pixel HDL 1,5 is a compact and hightech sorter. It has been conceived for small milling productions, with a primary chute and a narrower chute for product re-pass, furthermore, it is an optimal solution in case of small installation spaces. Pixel Next is the latest model in the Sea sorters range, it represents the evolution of the Pixel series. The current advantages have been increased by high definition camera control systems and the RGB lighting system. Pixel Next is also the only one
which can offer up to seven chutes to satisfy even the highest production capacities, and up to twenty-eight cameras for monochromatic, bi-chromatic, NIR and InGaAs configurations. Sea also manufactures resonance sorting machines. The Echo-Max model ensures maximum efficiency, minimum operating costs and high flexibility of use. The foreign bodies recognition device is based on the distinct resonance produced by each element. The frequency developed by shelled products differs from those emitted by shells, unshelled and partially shelled products, as well as stones, glass and metal fragments, enabling the software to manage their inspection and separation. (Sea - Via Ercolani 30 - 40026 Imola - BO Italy - Fax +39 0542 643567 - www.seasort. com)
From left, the sorters Echo-Max, Pixel 1,5 HDL, Pixel and Pixel Next (Sea).
100 - Tecnica Molitoria International - Yearly issue 2012
Pasta production
New TECHNOLOGY for long-cut pasta The commitment to innovative trend and technological development has allowed Tecalit to confirm its leading position in the industry for the supply of dry pasta production lines. The trend of steady growth has allowed the Italian company to expand its presence into new markets with a new range of pasta lines with the development of new technologies for innovative products such as gluten free pasta, instant and super dry pasta. Tecalit introduces the latest evolution in the long-cut pasta line with the version PDTHT Progressive Drying Technology - High Temperature in the “single tier� model. The long-cut pasta production line has a capacity of 1,100 kg/h with all the characteristics of the Nova L model that has always given Tecalit the leading-edge as regards the dough quality and the extruded product. In this press, all types of semolina and flours can be used, even with different particle sizes. The dough is developed in a mixer under complete total vacuum, from the dosing units of the flour/liquids up to extrusion through the die. With this type of mixer the colour, as well as the homogeneous hydration of the dough, is improved. In the high speed pre-mixer there is a control system for
the distribution of the water to be added to the dough by means of a device that always keeps the humidity constant. The compression screw has an increased overall diameter and a high efficiency spiral profile in order to guarantee the production at a low number of revolutions (18-20 rpm). The headpiece, which is 2,500 mm in length and fed by a single compression screw, has a compensated distribution chamber which allows to control and distribute the flow of the pasta in a homogeneous way on the whole length of the sticks. The PDT-HT drying technology meets the needs of modern pasta plants and was developed to reduce processing time and energy consumptions related to the production, providing maximum production flexibility (spaghetti, linguine, bucati, vermicelli, etc.) utilizing all types of raw materials. The ventilation scheme and automatic controls of temperature and humidity (extraction and air inlet) allows the drying diagram to be graded with a progression at high temperatures that optimizes the drying effect on the pasta, thus reducing the drying time, energy consumptions and improving the texture of the final product.
Tecnica Molitoria International - Yearly issue 2012 - 101
Pasta production The “single tier” version, with a production capacity of up to 1,500 kg/h, has proven to be an advantageous solution both from an economic and technological point of view, simplifying the mechanical movements of the sticks and facilitating the operations of ordinary maintenance in order to ensure the total quality of the plant. Tecalit offers a 360° service providing
turn-key supplies with all the accessories so as to ensure proper working of the installations and also by implementing quality control systems and HACCP. The whole production of Tecalit machines are designed and 100% made in Italy. (Tecalit - Via Leonardo Da Vinci 60 - 35018 San Martino di Lupari - PD - Italy - Fax +39 049 5953771 - www.tecalit.it)
EXTRUDERS for short and long pasta Pro-Tech Italia is a young and dynamic company in Genoa established by the brothers, Roberto and Stefano Rovati. The company manufactures production lines for short and long pasta, storage systems and transport systems for bulk food products, applying the experience they have obtained from working in their family’s company for more than 30 years. At the beginning of 2012, Pro-Tech Italia tested an extruder for short dry pasta with an output of 500 kg/h at an important European company that is a leader in the production of high quality organic products. The customer was extremely satisfied due to the high quality of the finished product. Reliability, ease of use, minimum maintenance, high levels of hygiene are some of the main characteristics of the extruders of the PPC, PPL, and PPM series. The extruders are available with round heads (for short and sheet pasta), linear heads (for spaghetti), and combined heads (with dual in-line heads for the alternate production of short pasta or spaghetti). Each extruder has a volumetric flour dispenser, dual-screw dispenser for additives, water/additional liquid dispenser pump and flow meter, centrifuge
102 - Tecnica Molitoria International - Yearly issue 2012
pre-mixer, main blade mixer (vacuum), and vacuum mixer bowl. The extrusion unit is equipped with a 140 mm compression screw that has a special profile that ensures high output, thus eliminating mechanical and thermal stress to the dough, combined with a circular die head having a diameter of 350 mm. The cylinder and head are equipped with separate air conditioning systems. The automatic cutter, fixed to the head (therefore without occupying space on the floor) is equipped with hydraulic lifting/ lowering and ventilation in the cutting area. The cutting unit also makes it simple to rotate the head 180° giving easier access to the head/die and making it easier to drain the machine, thus simplifying machine maintenance and cleaning and the insertion of cutting machines. The extruder has a main electric panel on the ground and a remote panel on the extruder bridge, both equipped with an operator touch-screen for the completely automatic management of the production phases and the management of the production recipes. (Pro-Tech Italia - Via Luigi Nino Malerba 47 - 16012 Busalla - GE - Italy - Fax +39 010 9760839 - www.pro-techitalia.com)
Pasta production
Automatic 3,000 kg/h line for short-cut pasta (Tecalit)
Automatic 1,200 kg/h line for long-cut pasta (Tecalit).
Detail of the pasta mixer (Pro-Tech Italia).
Press for short-cut pasta 500 kg/h (Pro-Tech Italia).
Tecnica Molitoria International - Yearly issue 2012 - 103
Pasta production COMBINED production line for pasta Over 30 years of experience in the sector, combined with constant technological evolution, have placed Anselmo into a leading position among worldwide designers, manufacturers and installers of pasta making equipment and machinery, offering turnkey and silage solutions, too. The company systems can be found in 25 Countries on 4 different continents throughout the world thanks to the production quality, as well as to the commitment and professionalism of the technician staff. All the systems are entirely manufactured within two production facilities, dedicated respectively to design/construction and storage/pre-assembly. The technolo-
gies utilised within its production processes are amongst the most advanced, and are continuously evolving. Anselmo boasts the use of selected raw materials, advanced manufacturing techniques and rigorous production quality inspections thus ensuring finished products of high quality, capable of satisfying every customer need. In occasion of Ipack-Ima 2012, Anselmo introduced the Combined production line, which is sold in Italy. It is suitable for the production of 2,000 kg/h of short pasta (standard shapes), 500 kg/h of nests, and 700 kg/h of special short pasta (big shapes). (Anselmo - Via Fossano 33 - 12041 Bene Vagienna - CN - Italy - Fax +39 0172 654811 - www.anselmoitalia.com)
Automated COOKER and machine for MAKING TORTELLINI Tecna presents the Vortex cooker and new tortellini machine, model T9. Vortex is an automated system for the cooking, washing and cooling of pasta, rice, vegetables, fish with other food, providing very high capacity levels. It has been developed for companies that cook high volumes of products and require a system which delivers outstanding performance, control, and quality. In cooperation with its English partner, Tecna has installed cooking lines on four continents and thanks to the decades of experience gained together, the company
104 - Tecnica Molitoria International - Yearly issue 2012
can propose a machine adapted to the most stringent hygiene standards of the global market. The Vortex takes its name from the unique rotary flow of water in each of the product baskets. The vorticity also prevents the product from clumping and sticking with no retention during transfer from one basket to another. It ensures the highest levels of product integrity through its hygienic design and construction including features such as self-draining pumps, shell in tube heat exchangers and demountable pipe work. The 750 litre tanks provide for the correct ratio of water
Pasta production
The range of pasta produced with the Combined line and related production capacities (Anselmo).
The Vortex cooker, washing and chilling system (Tecna).
The new tortellini machine T9 for the production of the classic Bologna type tortellini (Tecna).
Tecnica Molitoria International - Yearly issue 2012 - 105
Pasta production to product and the basket size and design allows for typical capacities of up to 2,000 kg/hour. A range of product feed systems is available to suit individual customer requirements with the finished product being delivered into de-watering systems or directly into mobile bins. The new Tecna filled-pasta machine T9 has been designed for the production of the classic tortellini (Bologna type), also available in 11 punches for the Mignon type. The technical solutions adopted and the particularly solid frame, have enabled the realization of a vibration-free machine with an extreme working reliability. Thanks to the new kin-
ematic housed in a sealed box, immersed in an oil bath and lubricated by forced lubricant circulation, the company can propose a compact machine, easy to clean and adapted to the most stringent hygiene standards of the global market. The T9 is also equipped with an opening and closing filling valve to relieve pressure on the rods, which allows the problem of overheating caused by certain types of filling to be solved. So, thanks to these innovations, the production of T9 has been greatly increased. (Tecna - Via Milano 52 - 22070 Bregnano - CO - Italy - Fax +39 031 774308 - www. tecnasaima.it)
LONG and SHORT-CUT pasta lines Fava develops a wide range of lines for short and long-cut pasta, special pasta and also lines for the production of cous cous. This is the main line of business, where the company strives to stand out and excel for its promotion of innovation, reliable service, knowledge and capacity in offering solutions and meeting customer demand. The production ranges from the smaller lines with a capacity of 750 kg/h up to the larger capacity ones of 9,000 kg/h. These lines are already installed and in production at the plants of the most important customers, and not only include the largest pasta factories in the world, featuring an advanced knowhow and outstanding quality, but also new entrepreneurs who wish to enter the pasta production business world. A second central feature characterizing Fava is its research and development de-
106 - Tecnica Molitoria International - Yearly issue 2012
partment. Ever since the very beginning, and as pioneers in the field of production automation, the company has deposited a high number of patents, and today it is still investing significant resources in process and product innovation. Currently, the research activity is focusing on the development of products with alternative raw materials, on drying technologies and on innovative mechanical solutions to increase the efficiency of the lines. This activity is based on previously obtained results, as Fava boasts having been the first company capable of producing machines with the highest production capacity in the world. At Ipack-Ima 2012, Fava has shown the crowning achievement of its production, a long-cut pasta line with a capacity of 5,000 kg/h, featuring a high technological and manufacturing level. Evidence
Pasta production
(A)
(B)
Two lines for long (A) and short-cut (B) pasta production recently developed by Fava.
of the recognition Fava technology has achieved around the world is the fact that, during the last 24 months, as many as 26 long-cut pasta lines were sold, most of which with a production capacity of over 4,000 kg/h. So many significant improvements have resulted in an increase in the performance and efficiency of these lines, where automation software and mechanical and electrical design are optimized in order to assure the highest production efficiency possible, leading to lower maintenance costs, a lower amount of absorbed energy and a greater ease of use. There is also great news in terms of supervision software, with its extremely innovative graphics, touch screen interface and a lot of information useful for the management of the line, such as
consumption, output, preventive maintenance, remote support in an innovative web-style environment, showing an affinity of well-known smartphones and tablets with Fava. As regards technology, during the last few years, the Research and Development staff has never shown so much commitment in laying the basis for new, truly innovative and performing production technologies. Finally, the subsidiary company, Storci, presents a complete line for ready-made multi-product dishes, with an innovative rotary cooker-cooler. As regards the handmade dry pasta production, a robotic system for un-stacking frames, set to work specially for this event, has been developed. (Fava - Via IV Novembre 29 - 44042 Cento - FE - Italy - Fax +39 051 6835740 - www. fava.it)
Tecnica Molitoria International - Yearly issue 2012 - 107
Pasta production 3-STAGE COOKER for continuous pasta sheets Moriondo presents the series of 3-stage cookers for the continuous cooking of pasta sheets mod. CB.3.S. These cookers feed the lasagne, cannelloni, manicotti, interleaf lasagne, roll lines, etc., and are particularly suitable for high-production lines as they allow space to be reduced, lengthwise, by about 70%. Consequently, energy consumption is also considerably cut. The model CB.3.S is characterized by a series of special variable-angle superimposed conveyor belts which allow the pasta sheet to pass through the cooking tank three times. The dilation of the pasta sheet during cooking is offset by the special automatic system for the internal speed differentiation of the drive units, patented by Moriondo. This system totally eliminates any breakages due to internal product tensions. The range includes cookers that vary from a minimum length of 3 metres, corresponding to 9 cooking-bath metres, up to 18 metres, corresponding to 54 cookingbath metres. This series of cookers also features a mechanical system for lifting the belts out of the tank, so as to allow complete and fast machine sanitisation. This system contemplates the use of from 4 to 8 mechanical lifting units, depending on length. Each unit features a double mechanism, one for operation and the other for safety, constantly monitored by an electronic control, in communication with the central line computer. Heating is by means of a heat exchanger purposely designed for the transit of cooking water, located outside the
108 - Tecnica Molitoria International - Yearly issue 2012
The 3-stage cooker for the continuous cooking of pasta sheets mod. CB.3.S (Moriondo).
The scheme of three steps of pasta sheets cooking (Moriondo).
machine. A large interface panel permits both the easy setting of all the operating functions and their display. The operating graphs and tables can be referred to both on the screen on-site or remotely. On request, the cooker can be equipped with a Moriondo online customer support connection for software and diagnostic updates. (Moriondo - Casella Postale 20/B - 20842 Besana in Brianza - MB - Italy - Fax +39 0362 996300 - www.moriondo.com)
Pasta production DRY and FRESH PASTA machines and lines Pavan Division, Pavan Group, dry pasta area produces the press PHP 218/2/D600 designed to manufacture 4,400 kg/h of short-cut pasta. After passing through a flow stabilizing screw, the dry ingredients are pre-mixed in a single-shaft pre-mixer where liquid ingredients are dosed and injected. The fine mixture is then deposited into a mixing tank. The variable pitch screw, having a diameter of 218 mm, compresses the product into two headblocks having a diameter of 600 mm each. Concerning the fresh pasta and ready meals area, the Toresani Division, Pavan Group, proposes the kneader-sheeter SPW630 and the filled pasta forming machine MRW 630, both in the washdown version. These stand out because of their high throughput (up to 570 kg/h) and of
the extremely quick changeover of the forming die (max. estimated time: 5 minutes). This machine is entirely built in stainless steel, in the washdown version, can be washed with a medium pressure water jet. All parts are easily accessible which makes it simple for the user to carry out all operations. The forming machine MRW 630, in the washdown version, can be completely washed and sanitized without removing the protections. This machine has been fully updated to achieve: a significant throughput increase (+40%); a very quick changeover of the forming die, made possible by the use of a mechanical lift, the absence of screws and the automatic phasing; possibility to wash the entire machine with a medium pressure water jet; maxi-
Toresani brand fresh pasta complete line (Pavan Group).
Tecnica Molitoria International - Yearly issue 2012 - 109
Pasta production
Pavan brand dry pasta complete line (Pavan Group). Toresani brand kneader-sheeter SPW 630 (right) and forming machine MRW 630 (Pavan Group).
mum flexibility in the filling processing guaranteed by the use of a lobe pump. The heat treatment section for fresh pasta is composed of a pasteurizer and a predryer. This system has been fully redesigned in the details affecting pasteurization and pre-drying, with significant innovations especially in the management of steam and in the washing features. The pasteurizer reaches a 50% reduction of steam consumption and consistency of the pasteurization value. It is composed of: reduced pasteurization chamber and cover with revolutionary barrel vault design, heated by a steam closed circuit over its all length; steam sealing systems on product inlet and outlet points; steam flow rate managed by a PLC and a flow meter in accordance with the product to be pasteurized. It is easier to wash and to access, for a sim-
110 - Tecnica Molitoria International - Yearly issue 2012
plified maintenance thanks to the open lateral structure for cleaning purposes, the automatic system to lift the cover and belt from the belt sliding surface in order to clean the sliding guides, and the automatic belt washing systems. Finally, the pasteurizer has a simplified recipe management as recipes are set in the PLC and do not require manual operations. Concerning the pre-dryer, a new concept of ventilation flows ensures a high and consistent air speed in all tiers. Heating elements have been installed outside the product treatment area. It features a class 100 air filtering system and reduced noise level. It can be completely accessed and washed. (Pavan Group - Via Monte Grappa 8 35015 Galliera Veneta - PD - Italy - Fax +39 049 9423303 - www.pavan.com)
Dosing, mixing & handling
DOSING, conveying and mixing turn-key plants Cavicchi Impianti has a forty-years-long experience in the engineering and manufacturing of plants for conveying, mixing, feeding and dosing dry products such as powders, granules and ground products, especially for the food industries (flour, rice, starch, spices, salt, sugar, etc.). All the equipment may be supplied with the Atex certification for potentially explosive materials. The company’s aim is to be able to fully satisfy an extremely diversified market, with millions of products to be handled in constantly different logistic circumstances. Cavicchi is in a leading position, being able to manufacture a wide range of reliable, high performance, bulk handling equipment which is engineered to customer needs. Its wide range of equipment and technical solutions are endlessly evolving to comply with customers requirements. Here are some examples. The f lexible screw conveyors are the ideal solution for the transfer of powders,
112 - Tecnica Molitoria International - Yearly issue 2012
granules, and ground products. They can be easily integrated with existing equipment and allow coverage of remarkable distances. The large sized conveyors may handle up to 6,000 kg/h of products having an apparent density of 0.6 kg/dm 3. They are simple and quick to install, easy to clean and practically require no maintenance. The auger rigid conveyors are frequently used when large quantities of bulk solid materials have to be handled, including non free-flowing or otherwise difficultto-handle, also for abrasive and corrosive products. The vacuum conveyors, whose capacity can range from several kilograms to tens of tons per hour, are able to feed from any small packaging lines to large silos, towards any destination. They are built for food contact with FDA certified materials. Horizontal ribbon mixers are available in various sizes ranging from 100 to 9,800 litres. They are designed for a wide
Dosing, mixing & handling application and high efficiency, guaranteeing no dead corner and no external pollution. The automatic vertical mixers are available from 180 to 1,500 litres. Built with a rigid auger, they can be matched to several wheeled hoppers. Having a minimum mixing time, they are ideal for stocking up mixed products and/or for frequent changes. Batching systems, either with auger or vibrating channels, are manufactured for volumetric, gravimetric or continuous dosing. Cavicchi’s equipments also include bulk bag dischargers and loaders for dust-free loading and unloading. For easy discharging of non-flowing products, vibrating systems are added. Versatile weigh batching
systems may also be installed. They can be combined with wheeled hoppers, silos, or any other equipment through spiral or pneumatic conveyors. Weigh batching systems can be placed on mixers, dosers, silos, bulk bags chargers and dischargers, with the possibility of dealing with the recipes automatically. Finally, semi automatic packaging machines, for paper sacks and/or tins, and packaging scales for valve or open mouthed sacks are also produced. Concerning process control systems, all Cavicchi’s equipment may be entirely plc or pc controlled. (Cavicchi Impianti - Via Matteotti 35 - 40055 Villanova di Castenaso - BO - Italy - Fax +39 051 780647 - www.cavicchiimpianti. com)
Automatic vertical mixers mod. MM2/A with removable feedboxes (Cavicchi Impianti).
Tecnica Molitoria International - Yearly issue 2012 - 113
Ancillary equipment
DRUM DIVERTING VALVE for pneumatic lines The new series of drum diverting valves, VPT, designed and manufactured by Olocco are used in pneumatic lines (for pipes from DN65 to DN200 in size) with low, medium and high pressure to convey products in powder, granules and even abrasive products. Available in aluminium or nickel plating treatment as an option, the parts in contact with the product are made of stainless or hardened steel. It is
The new drum diverting valve VPT (Olocco).
114 - Tecnica Molitoria International - Yearly issue 2012
possible to choose between two different configurations, one with static seals for low/medium pressure (for dilute phase transport), the other for high-pressure systems (for dense phase transport). The rotation is controlled by means of a pneumatic actuator with solenoid. The limit switches are placed inside a sealed box. Also available, on request, are valves that comply with EC Directive ATEX 94/9/EC (1D internal - 2GD/3GD external). The work of the Olocco engineers, focused on the development of the main characteristics of the previous model by introducing a series of important changes, is here described: the double flow pipe, which means less wear and longer lifecycle of the machine; the reduced rotation angle of the drum, resulting in faster switching and less air consumption; the encapsulating pipe with high thickness tubes in applications for the food industry or with abrasive products; the new seals, fully compatible with food contact, whose movement has been revised and made more precise for a better seal; the ease to reverse the position of the pneu-
Ancillary equipment matic working in case of unforeseen dimensions emerged during assembly; the possibility to change the shaft in case of damage or breakage of the square end without replacing the whole drum. These
are just some strengths of the new drum diverting valve VPT. (Olocco - Via del Santuario 41 - Zona Industriale - 12045 Fossano - CN - Italy - Fax +39 0172 692578 - www.olocco.it)
STRETCHING SYSTEM for optimal sifting yield The Swiss-based company, Sefar, has developed a stretching system, called Sefar Pneumapp 2, that not only improves the rate of yield of the sifting process but also helps to maintain the effectiveness and service life of the sifting media. Such a versatile stretching system combines a verifiable benefit with smart engineering. For an effective operating of the plansifter, it is absolutely essential that the screening fabric tension is kept within a narrow range, indicated in N/cm. A manual covering of the flour sieves is still customary in many mills. There is basically no objection to the “thumb� method as long as the job is done or supervised by an experienced miller. However, in order to ensure a consistent and optimum sieve tension, the Pneumapp 2 system has been developed. Three available sizes of stretching clamps (630, 730, and 1,000 mm) and the pneumatic control-unit make it a dependable system for use with any mesh size or screens, synthetic as well as metallic. Plugin pneumatic connectors allow rapid and straightforward reconfiguration of clamps and control units. The advantages of the modular system are: the clap guide bars enable a quick and easy adjustment to all sizes and types of frames (wood, steel, aluminium); the design of the clamp makes the gluing area easily accessi-
ble; the sophisticated 3-step closing system eases the clamp operation and provides extra safety measures; increased power when higher screen tensions are necessary, such as for wire or coarser synthetic mesh; stretched frames have consistently good quality; uni-
Tecnica Molitoria International - Yearly issue 2012 - 115
Ancillary equipment
The stretching system Pneumapp 2 (Sefar).
form tension in both direction; robust and low maintenance construction; modular system upgradeable from 1 to 2 frame sizes. Due to new sanitary regulations being introduced in flour mills and other food industries is most countries, wood will be phased out in the near future. Reason why a new robust work table adapted to the stretching unit has been designed. A solid metal base frame with drawer supports the plate made of high-density polyethylene. Further to Pneumapp 2, Sefar has developed the Tensocheck device, to accurately
measure the tension of the sifting fabric. It covers the range of 3 to 50 N/cm, which makes it a universal device. It comes with a zero-setting plate for quick confirmation and push-button adjustment. This ensures reproducible results. Once the tension is set as per the recommended values, the fabric can be fixed to the sifter frame. Too often, the fabric is stapled onto the frame which destroys it over time and is not safe from a hygienic point of view. Moreover, a uniform tensioning is not guaranteed which again has an adverse influence on the yield. To overcome such problems the Sefar Quicktal has been developed a fast drying single-component cyano-acrylic adhesive that is approved for food applications. After stretching the screen, weights are laid on it in order to ensure a good contact between the screen and frame. The liquid adhesive is then applied. Drying time, which is normally around 20 minutes, can be reduced using an accelerator spray. The special type Quicktal Metal is used for steel frames. (Sefar Italia - Via Nazioni Unite 44 - 10093 Collegno - TO - Italy - Fax +39 011 3827253 - www.sefar.it)
Laboratory MIXER, dust FILTER, GEARBOX and LOADER The Mix company, from its portfolio, presents the laboratory mixer MXC, the bag dust filter SFLV, the gearbox RXC suitable for applications on screw conveyors, and the loading bellows SCL. The laboratory mixer MXC with a volumetric capacity of 12 litres, suitable for
116 - Tecnica Molitoria International - Yearly issue 2012
mixing and homogenizing powders and pastes with small percentages of liquid, consists of: an opening driven side with cover, complete with safety limit switches and locking with quick hooks; a discharging outlet, with manual control, with stub pipe and safety grid; a flowed rotor shaft
Ancillary equipment seal divided into two parts for an easy replacement of the packing; a charging inlet with quick opening hopper complete with grid and venting sheet; a hub with chopper and knives (with flowed seal with slinger); an electric panel with control inverter for the rotor motor; a painted frame/base; a nozzle for liquid injection; an easy removable keyed rotor shaft; welded ploughshares; a pneumatic panel integrated in the support structure with connection near the machine and a temperature probe for the
From the top and clockwise: the laboratory mixer MXC, the bag dust filter SFLV, the gearbox RXC suitable for applications on screw conveyors, and the loading bellows SCL (Mix).
inside of the chamber. All parts in contact with the product are made of stainless steel Aisi 304. The dust filter SFLV with a filtering surface of 4.8 m², suitable for dust collection, has a wide cover in aluminium alloy with an opening of more than 90° for an easy access to the internal parts, complete with safety lock and gas cylinder which helps to prevent accidental closing. The filter also presents: manifolds/pulse valves/air tank, all in aluminium alloy, valves servo-controlled by an external sequencer that turns the electric signal into a pneumatic signal which ensures that there are no electrical parts inside the filter, bag filtering elements, and compact fan integrated on one side of the filter body. All external parts exposed to the weather are made of stainless steel Aisi 304 or in aluminium. The gearbox RXC completes the Mix company range of components for screw conveyors Flowmix series and consists of a solid gearbox in cast iron with a built-in compressor for the flowing and the cooling of the seal. This patented solution assures a longer life of the seal, a product flowing with less friction, a lower wearing of the screw. Reliability and durability are its main features. Finally, the loading bellows SCL is suitable for the transport of products in powder or granules from silo tank trucks. It consists of: a built-in filter and fan, the filter sheath and the outer sheath telescopic tubes in transparent material; an underpressure/ overpressure relief valve which automatically adjusts the pressure within the ducts; the internal telescopic tubes with ribs and increasing diameter to reduce the reflux of the powder and to help its descent; the cardan joint to increase the oscillation an-
Tecnica Molitoria International - Yearly issue 2012 - 117
Ancillary equipment gle of the tubes, facilitating the positioning on the tank truck; the compact selfbraking gearbox to ensure a greater safety and precision during descent and ascent of the loading bellows; the vulcanized food grade seal; the counter-cone with integrated level paddle indicator to prevent the fall of the product remaining in the pipes during the ascent and descent phases, and to allow the detection of the product maximum level inside the tank truck;
the control panel and pendant pushbutton with simple led interface; a butterfly valve mounted on the loading inlet controlled by a pneumatic actuator wired to the panel; a semaphore signalling the correct positioning of the vehicle. All parts in contact with the product are made of stainless steel Aisi 304. (Mix - Via Volturno 119/a - 41032 Cavezzo - MO - Italy - Fax +39 0535 46580 - www. mixitaly.com)
VENT panels, bucket ELEVATORS, screw CONVEYORS Colombo Pietro, a traditional and historical company in the Italian milling and food industry, is specialized in the design and production of screw conveyors and bucket elevators. Furthermore, it manufactures a full range of Atex safety and control equipment for elevators, suit-
The explosion vent panel Vigil’Ex (Colombo Pietro).
118 - Tecnica Molitoria International - Yearly issue 2012
able for operation in potentially explosive environments according to EC Directive 94/9CE (Atex 95). In particular, Colombo Pietro presents a series of explosion vent panels, model Vigil’Ex, for overpressure protection and venting of gas or dust explosion. This series includes several types of panels: square, rectangular, round, and domed. In addition to the complete range of safety equipment for elevators and screw conveyors designed for use in potentially explosive environments (Atex 21-22), the company presents the belt alignment system Vigi Belt, the under speed monitor Giro Jet, the bearing temperature sensor Vigi Therm, and the level and choke sensor Vigi Mat. Concerning the components for elevators, Colombo Pietro develops buckets of all kinds: Jet, Euro Jet, and Columbus series, from stamped metal or plastic. They are combined with certified quality belts. The white or black rubber food belts are conform to the Atex Directive, as they can
Ancillary equipment run in potentially explosive environments. They are antistatic, fire-resistant and can resist oils and greases. Finally, the new screw conveyors made of stainless steel are proposed. They have been studied for the food industry and are quite innovating and very accurate in finishing. Continuous metal flights, sectional flights and micro-flights for batching plants complete the company product range. (Colombo Pietro - Via Marco D’Oggiono 21 - 23848 Oggiono - LC - Italy - Fax +39 0341 579005 - www.colombopietro.it)
Buckets and belts for elevators (Colombo Pietro).
HANDLING and SAFETY equipment Specialist in bulk, Verdi presents the products for pneumatic systems, scraper chains with nylon flights, buckets made of thermoplastic anti-static and anti-abrasion material, electronic monitoring equipment and vent panels for Atex environments. The new couplings, IL series, provide an
economical solution for pressure pipe connection, thanks to their simplicity and fast assembly. Suitable for pneumatic systems up to 2 bar pressure or in depression, they are made of stainless steel and in two lengths, of 100 and 150 mm, with diameters from 30 to 200 mm.
The buckets mod. AP (on the left) and Polypenco (Verdi).
Tecnica Molitoria International - Yearly issue 2012 - 119
Ancillary equipment Concerning the chain conveyor systems, Verdi manufactures the nylon flights whose use makes it unnecessary to cover the bottom of the redler and greatly reduces the noise level during operation. They are easy to install or replace, reducing installation and maintenance costs. Verdi also proposes buckets made of thermoplastic material in a wide range of models suitable for different type of products. The high-density polyethylene (HDP) suitable for cereals and food quality is also available in antistatic version. Polyurethane is suitable for sharp and sticky products. The range includes buckets for maximum capacity (AP-SPS-
J), standard and for chain elevators (DIN 15232/15234) and Polypenco Budd and Atlas type. Furthermore Verdi proposes a complete range of monitoring and control equipment for elevators and conveyors, all Atex approved. They have been studied in order
RAMBALDO ANTONIO_Layout 1 20/01/10 11:29 Pagina 1
Via Tessara 9/11 35010 Curtarolo (PD) Italy Tel +39 049 557094 - Fax +39 049 9623322 info@rambaldoantonio.com www.rambaldoantonio.com
NEW Thanks to our conversion, the sifting area of your plansifters is increased. Frames and stack-frames for all kinds of plansifters.
120 - Tecnica Molitoria International - Yearly issue 2012
The belt misalignment detector mod. Tapswitch (Verdi).
to prevent explosion risks and to improve the safety level for workers in potentially explosive areas. A new item in this range is the Tapswitch, a mechanical limit-switch with no moving parts that detects the misalignment of both pulleys and belts in conveyors and bucket elevators. Not affected by dust or material built up, it can work even when it is completely covered by material. It is Atex approved as Ex II 1D T120째C IP66 zone 20, 21 e 22. Finally, the vent panels offered by Verdi are an economical way to minimize explosion reaction on silos, elevators, conveyors, filters, ovens, etc. in Atex environments. (Verdi - Via Volta 7/1 - 42024 Castelnuovo di Sotto - RE - Italy - Fax +39 0522 683086 - www.verdispa.com)
DESIGN AND MECHANICAL MANUFACTURING Machinery and equipment for mills, pasta and food industries
Each project is TAYLOR MADE
Packaging
RESEALABLE ZIP bags for pet food While bag producers continue to introduce new solutions onto the pet food market, the Concetti Group, a renowned and experienced manufacturer of filling, closing and palletising systems for bags, offers the ultimate in bagging machine flexibility. The Concetti Group machines not only fill the most complex preformed bags, but can also apply a resealable zip to ordinary PE, PET or Alu-compound bags. This great new feature gives a rapid payback, increasing profitability for pet food manufacturers by reducing packaging costs significantly. For pet food producers, the Concetti Group has developed a complete range of weighers in-house. High accuracy is obtained by a combined feeding system featuring a belt for the main feed and a vibrating trough for fine feed. All the bag fillers for pre-formed bags consist of an integrated unit for safe, clean and reliable packing, featuring one or two discharge spouts and one or two empty bag magazines to ensure an output of up to 1,800 bags/hour. Users benefit from the most flexible baggers available on the market, designed
122 - Tecnica Molitoria International - Yearly issue 2012
to run all bag formats from 1 kg right through to 20 kg, both gusseted or flat bags, while the bag material can be coated paper or PE, PET, aluminated PE, etc. Moreover, it is possible to obtain bags with carrying handles, bags with lateral carrying handle, with easy-peel and front or top zipper, hooded bags, stand-up pouches, single-lip bags, bags with quad-seal or Stabilo-seal. All the Concetti Group machines are equipped with special devices for holding and restoring bag gussets with different sizes and formats. In addition, they also come with patented systems for quad seal or Stabilo bags. An efficient filling includes bottom vibration of the bag for compacting the product and a mechanical device (a roller) can be selected if necessary to evacuate any excess air from inside the top of the bag. The bag can be closed at different heights on the bag face. It is also possible to have two sealing lines on the same bag, according to the bag features. The sealing line itself can vary in height from 4 to 20 mm. On high-speed applications a seal-cooling device is supplied. The pet food producers who require a ma-
Packaging chine that forms bags from a reel of tube stock film may choose the Continua FFS machine, which grants a relatively lowcost package that meets all the market expectations in terms of looks, flexibility, and innovation. In fact, in addition to the standard 10-20 kg bags, Continua FFS can fill 4 kg of pet food in stand-up pouches. It can produce vacuum bags and it allows quad seal or Stabilo bags to be produced from simple, tubular gusseted reel stock. It produces bags with a carrying handle on the top or bottom, or on both top and bottom of the bag. And as a unique feature, it applies a resealable zip closure. Finally, for maximum flexibility in pet food applications the company proposes the PS-3A four-column robot. It features a gripper tool that can take one or two bags
at a time, coping with any bag size in the Concetti Group range. It can overlap bags to ensure loads are inside the pallet dimensions and it provides top and side compression for excellent pallet stability and shape. The PS-3A palletizer reaches a top speed of 1,800 bags/h. On all the Concetti Group machines, the changeover from one bag programme to the other is made through the PLC and operator panel in just 90 seconds without the use of any tools, resulting in higher average outputs. Pet food producers with many different products, bag weights, sizes and short job runs will find this very appealing. (Concetti Group - S.S. 75 c. U. km 4,190 Fraz. Ospedalicchio - 06083 Bastia Umbra - PG - Italy - Fax +39 075 8000894 - www. concetti.com)
IMF bagging machine for preformed bags with two spouts and with the zip applicator (Concetti Group).
Tecnica Molitoria International - Yearly issue 2012 - 123
Packaging AUTOMATIC PACKAGING machines Ricciarelli proposes itself as an ideal partner in the field of automatic machines and for over 150 years it has been synonymous with quality and guarantee of innovation and success. It provides cutting-edge technology serving companies and consumers, supporting customers in their decision-
Top carton applicator AC50 (Ricciarelli).
making process to lay out a project and to realize it achieving success. Among the main innovations proposed is the new group of machines for the weighing and packaging of long pasta that achieves the utmost care in the handling of the product. Such machines are able to make an innovative type of bag with hangers, not yet present on the market. The system to make such bags is provided with automatic size changeover and dual motor-
124 - Tecnica Molitoria International - Yearly issue 2012
ized jaws to ensure the perfect positioning of the hanger on the bag and automatic size change over. Furthermore there are a group of machines for double square bottom bags with a 20-head weigher, a high performance vertical continuous machine with motorized gusset devices, and a group SB20F with double catenary controlled by a brushless motor and innovative stations for bag forming actively operated. The handling and palletizing solutions are customized with anthropomorphic robots and RWDC software for managing machines through an Ethernet network including the complete traceability of the product sold and of all the components of the packaging department, palletizing system, and automated warehouse, data collection and sharing, and remote parameter settings. The companies belonging to the Ricciarelli Group – Ricciarelli Packaging Systems, Ricciarelli Energy, MM Robotics, and Teicom Sistemi – are presented in a new strategic alliance with Stoecklin and Lyto’s, leaders in shelvings and automated warehouses, to combine skills and creative genius, new technologies, energy saving, and environmental protection. The result is a system engineering venture which is able to design, build and install the entire production department, from the cogeneration plant for the production of clean energy, including the equipment to transport and weigh loose product, to the packaging, cartoning, loading, palletizing systems and the automated warehouse. (Ricciarelli - Via U. Mariotti 143 - Z.I. S. Agostino - 51100 Pistoia - Italy - Fax +39 0573 933223 - www.ricciarellispa.it)
Packaging BAG FILLING, weighing and bagging Italpack is specialized in the design and manufacture of automatic packaging equipment for filling ready-made SOS block-bottom bags. The company has recently launched onto the international market the new Pack 50/10. This machine allows the user to reach high-capacity throughputs for bag sizes of 10 and 12.5 kg. For a typical 10 kg bag of wheat flour or maize meal, the throughput is 25 bags per minute, while for the 12.5 kg size the speed is 18 bags per minute. This new machine offers versatility, high-capacity production, and maximum efficiency. The Pack 50/5, has been developed for bag sizes ranging from 500 g to 5 kg. For a typical 5 kg bag of flour, the machine delivers 20 bags per minute, while the speed for 1 kg bags is 37 bags per minute. This
machine offers great versatility and is extremely easy to operate and maintain. The quick-time size changeover is another attractive feature and the ratio between price and return on investment makes it one of the most popular in the whole Italpack range. Finally, also proposed is the fully-automated valve sack weighing and bagging plant for sacks between 10 and 50 kg. The machine is a single spout type for increased productivity requirements and the plant can be configured with up to 4 spouts inline. Additional features on the valve sack bagging plant include the robotic sackplacing machine with empty sacks magazine, automatic date printer or batch code printer, and a valve sealing unit to close the mouth of the valve. Mark Wild, Export Sales Manager at Ital-
Some Italpack lines in South Africa.
Tecnica Molitoria International - Yearly issue 2012 - 125
Packaging pack, is proud to underline that “Italpack, since the company was founded 30 years ago, has always strived to maintain solid principles in all aspects of its business with particular attention being paid to the need to ensure complete customer satisfaction at all times and to constantly research and develop the technical side
of our manufacturing process. Currently Italpack equipment is sold to more than 70 nations on all continents and the biggest single industry that is served is the milling one�. (Italpack - Via Andrea Costa 106 - 47822 Santarcangelo di Romagna - RN - Italy Fax +39 0541 621956 - www.italpack.net)
HIGH-SPEED PACKAGING systems Stiavelli, Pavan Group, has developed a vertical packaging system for granular products. It is a high-speed packaging system for dry granular products (pasta, rice, snacks, dried fruits, candies, etc.) composed of the new 20 head weigher model SPC20 and the continuous motion vertical packaging machine model SVMC. The MCR sealing jaw includes a mechanical device for gusseted and/or flat bottom bags. The system includes a film reel adding device. The integrated touch-screen, full colour panel ensures a user-friendly control and all operation parameters can be immediately and easily set and monitored. There is a self-diagnostics function and the possibility of remote control via internet. Furthermore Stiavelli produces a highspeed packaging system for long-cut pasta (spaghetti), composed of a double motorised doser model SPL-M and a horizontal continuous packaging machine model SO-EVO equipped with the MRC/ Stripping jaw. This system also includes a pasta fragment detecting sensor, a code printer and a checkweigher with metal detector.
126 - Tecnica Molitoria International - Yearly issue 2012
The evolution of the SO series features a high speed, high reliability, maximum weighing accuracy and a dramatically reduced percentage of bags rejected because of fragments within the sealing areas. The integrated touch-screen, full color panel ensures a user friendly control and all operation parameters can be immediately and easily set and monitored. There is a self-diagnostics function and the possibility of remote control via internet. Dizma, Pavan Group, introduces Synchrobox 80, a packaging machine with boxmotion feature. Having a capacity of 80 bags per minute, it features fully electronic operation, continuous cycle and PLC controlled brushless motors. The servo-assisted operation allows for extreme customisation of the products to be packed even in the case of large products. The quick and easy format changeover is managed by pre-set recipes memorised directly from the touch-screen type operator panel. The cantilever frame ensures easy cleaning and maintenance. (Stiavelli - Pavan Group - Via Amendola 7 - 51010 Uzzano - PT - Italy - Fax +39 0572 444642 - www.stiavelli.it)
Packaging WEIGHING and PACKAGING machines The Dolzan Impianti company is specialized in the design and manufacturing of weighing and packaging systems. The company mission is to provide customers with the best possible solution that can meet their individual needs. For this reason Dolzan Impianti has developed 60 models of packaging machines, available in 115 versions and, therefore, it is possible to manufacture packaging machines able to fulfill almost any need.
For instance, they have designed a packaging machine with screw feeder which can be opened, able to handle flour products and a packaging machine with a multi-head dosing unit, specific for cereal products. Having been on the market since 1962, this year Dolzan Impianti celebrates 50 years of successfull Italian know-how. (Dolzan Impianti - Via Roma 260 - 35015 Galliera Veneta - PD - Italy - Fax +39 049 9470138 - www.dolzan.com)
Packaging machine with screw feeder (Dolzan Impianti).
Packaging machine with multihead dosing unit (Dolzan Impianti).
Tecnica Molitoria International - Yearly issue 2012 - 127
Downstream
END-OF-LINE solutions for PASTA industries Italproject develops end-of-line solutions for different sectors such as food and beverage, chemical and pharmaceutical. An interesting importance has been given to case packers for the pasta sector, proposing innovative machinery reflecting the various needs of the worldwide market in the pasta industry. The Italproject highly specialized technical staff offers solutions for any requirement concerning space, performance, and prices. The company provides a wide range of systems such as inflatable tube depalletizers, carton forming machines, carton packers, pick&place machines, wraparound machines, tape machines, Cartesian palletizers, and robotized depalletizers. The R&D department is continuously dedicated to fulfilling ambitious projects, especially within robotics and automated logistics. Aiming for flexibility and quality, Italproject has been able to conquer the trust of prestigious customers all over the world. (Italproject - Via Leonardo Da Vinci 43 35015 Galliera Veneta - PD - Italy - Fax +39 049 9475200 - www.italproject.net)
128 - Tecnica Molitoria International - Yearly issue 2012
The palletising and cartoning robot Flexipal (Italproject).
Downstream Robotic PALLETIZING systems Imp.a.c. is specialized in the production of automatic systems, thanks to its wide range of machines, a robotic palletizing system with articulated arm, developed for medium/high speed packaging lines requiring precision, consistent working capacity and automatic robotic dispensing of pallets and carton sheets in order to save valuable floor space. Robof lex 1801, which is assembled with innovative technologies and has been successfully tested on the international stage, has been equipped with special pliers suitable for seizing bags, bundles, and carton boxes. The machine can be equipped with four to six-axe robotic arms and it can be utilized for empty pallet and interlayer handling. It provides high production standards of up to 600 cycles/h, satisfying all customer requirements. An important quality of this system is its versatility. It is possible to have several infeed lines and also to palletize different products on different pallets. All the software programs are created by the Imp.a.c. technicians. By changing its working program, Robof lex 1801 is able to handle a wide range of products, reducing the operator duties to the supervising functions. In order to provide a valid packaging option, the Cartesian robot palletizer can be utilized with the integrated automatic wrapping system. This machine has a maximum working capacity of up 500 bags-bundles/hour, which is an ideal feature for medium productions. In addition
there is consistent space-saving because of the equipment dimensions. The wrapping process guarantees stability to the pallet thanks to the progressive wrapping for each layer. The wrapping systems can also utilize holed films, particularly suitable for products requiring transpiration in order to avoid inner moisture and overheating. Furthermore, Imp.a.c. has developed two
FLIGHTING TECHNOLOGY
Tecnica Molitoria International - Yearly issue 2012 - 129
Downstream
Two perspectives of the Cartesian robot palletizer with automatic wrapping mod. 125 A-PR (Imp.a.c.).
reliable devices for handling the holed film in the wrapping process. The film pre-stretch unit, to obtain a max stretch ratio of 300% and the film-welding unit to remove imperfections on board. These operating systems are both able to communicate by means of the Ethernet port with other production line machines and, if necessary, with the manufacturer for assistance. They can also automatically utilize various working programs which can be easily modified by the user using the touchscreen. In order to improve the instrumentation management, the Profibus/Devicenet technology has been implemented on all machines, so as to simplify the operator access and maintenance. All the systems are conceived in a modular way, in order to match the user needs and to combine high efficiency to low consumption, and reduced costs.
130 - Tecnica Molitoria International - Yearly issue 2012
(Imp.a.c. - Via Ghisolfi e Guareschi 9 43015 Noceto - PR - Italy - Fax +39 0521 627988 - www.impac.it)
The robotic palletizer with articulated arm mod. Roboflex 1801 (Imp.a.c.).
CHIRIOTTI EDITORI Viale Rimembranza, 60 - 10064 PINEROLO (TO) Tel. +39 0121 378147 - Fax +39 0121 794480 shop@chiriottieditori.it 7 LANGUAGE DICTIONARY 538 pages - 45,738 records - Hardbound Price ₏ 68.00 ISBN 978-88-85022-85-0 Today communication between cereal scientists, technologists and industry operators is more important than ever to the development and the furtherance of cereals-related research and all cereal-based industry. With so many languages and cultures contributing, ICC clearly recognised that the use of words and their meanings is very important and has developed a dictionary to help with communication. Thanks to over 6,500 cereals, milling and baking terms - that translated in seven languages count 45,738 words - the ICC Dictionary is invaluable for all of those involved in: cereal storage and drying, milling technology, feedstuff production, baked goods production, confectionary and cerealbased alimentary products, cereal chemistry, cereal research.
Supplier news
50 YEARS of success for LA MECCANICA “First and foremost I want to create jobs”, Roberto Reffo, owner of the La Meccanica said. In the year 2012, where one in four young Italians is unemployed, he is setting a fine example of how to face the challenge of the global economic crisis. La Meccanica is a healthy company specialized in the animal feed and biomass sectors, employing over 50 people. Mr. Reffo’s “jobs” slogan is a concrete reality and part of the mission for this company with 50 years of
A view of the Paduan La Meccanica.
132 - Tecnica Molitoria International - Yearly issue 2012
experience in production in the name of continuity and innovation. La Meccanica story started in 1961, at the end of a decade characterized by post-war recovery and a growing request for the production of animal feed. In the following years the animal feed market was transformed with the introduction of specialised one-product plants and new production processes, such as pellet feed, first used by the Canadians. “We”, says Mr. Reffo, “made the best of the favourable conditions in the animal feed market, and in just a few years we had stopped milling parts for lathes and shearing machines for third parties in small machine shops based in the country, and started producing our own products.” Thanks to individual skill, knowledgeable management and the ability to interpret economic and social trends, the company grew from the family firm to a major competitive company on the international market. Mr. Reffo reveals the secret, “Continuity, tradition and innovation have always represented the strong points of our business, and currently 75% of our turno-
Supplier news The staff of La Meccanica on the occasion of its 50th anniversary.
ver is from exports.” Today La Meccanica, with a factory of over 10,000 m3, is in a leading position in Italy and its products are sold in more than 50 countries all over the world (including Germany, France, Russia, South Africa, and Egypt) through 28 agents and specialized distributors. Over the years the company has focused on the continuous specialisation of its technical staff and the diversification of its products to meet the request of the market. Furthermore, thanks to attention on research and innovation in both products and services, the company has obtained important results in terms of growth. Currently the company has 5 production lines: plants, machinery, spares, extruders and technical service, as well as a specialised green machinery line. “Design and production”, adds Mr. Reffo, “are subject to direct real-time, in-house quality control on all aspects of the core business, consisting of the production of pelleting plant machinery for feedstuffs factories, mills, dehydrators, sugar and oil mills. Today, we also produce plants for organic and organic-mineral fertilizers
and machinery for producing pellets from wood shavings and biomass”. “The company’s jewel in the crown is our technical service team, who can solve any problem related to pellet production systems in record time, thanks to 50 years of experience in the sector, offering services designed to meet the client’s requirements”. “Interpreting the current global economic trend, all the more characterised by the need to be competitive, and to keep the quality of its products and services high, La Meccanica continues to invest in training, making the most of opportunities for school leavers to gain valuable work experience. In recent years, thanks to our partnership with specialized international institutes, we are promoting highly specialised technical training courses in feedstuffs. This approach”, concludes Mr. Reffo, “aims to develop and promote a culture with companies and operators in the foodstuffs sector, characterised by continuous evolution, in harmony with the life our people are living.” (La Meccanica - Via Padre Nicolini 1 Loc. Facca - 35013 Cittadella - PD - Italy - Fax +39 049 5972171 - www.lameccanica.it)
Tecnica Molitoria International - Yearly issue 2012 - 133
Exhibitions & meetings
PACKOLOGY: packaging and processing EXHIBITION The second edition of the triennial exhibition Packology, for packaging and processing technology, will take place from 11th to 14th June 2013 in Rimini (Italy). The event is organised by Ucima, the national trade association of Italian packaging machinery manufacturers (a member of Confindustria) and Rimini Fiera, which is specialised in organising events for highly globalized sectors of the machinery industry, and can boast a modern, efficient expo centre, as well as the excellent accommodation and logistics of the Romagna Riviera. The leading companies in this sector will participate showcasing technology that will offer major Italian and international buyers a top-level, comprehensive response to the needs of all their markets. Packology 2013 will also be an opportunity for professionals to catch up on the latest innovations in the sector, thanks to an extensive calendar of events and initiatives which will not be confined to the
134 - Tecnica Molitoria International - Yearly issue 2012
dates of the trade fair but will be getting underway in the next few months. This is a tangible sign of the organisers´ desire to move beyond the usual expo approach and turn the fair into an ongoing touchstone for everyone in the packaging and processing business. Packology trade sectors include: machinery and technology for primary, secondary and end-of-line packaging; machinery and technology for processing; packaging material and accessories; labelling machinery and technology; coding, track & trace and marking systems; automation, accessories and components; handling, in-house logistics; storage systems and technology; tertiary packaging; services, consultancy and planning; associations and institutions; trade press. (Packology - Rimini Fiera - Via Emilia 155 - 47921 Rimini - RN - Italy - Fax +39 0541 744751 - www.packologyexpo.com - Foreign Marketing Manager, Mr. Alessandro Piccinini, e-mail: a.piccinini@riminifiera. it)
Exhibitions & meetings International DIETARY FIBRE CONFERENCE in Rome The 5th International Dietary Fibre Conference, DF12, takes place in Rome (Italy) from 7th to 9 th May 2012. DF12 continues the highly successful series of the earlier DF Conferences as seen during the past 4 editions, from Ireland in 2000, to latest in Vienna 2009: integration of nutritional and consumer science with food technology, product development, analysis and legal aspects. DF12 is the occasion where scientists, regulators and industry representatives from all over the world can meet in a unique location where participants can develop modern ideas while drawing inspiration from the beauty of Rome, the cradle of progress and civilization of the Ancient World. DF12 discusses all sources of dietary fibre: natural fibres (from vegetables, cereals, legumes, fruits, etc.), isolated and synthetic fibres and their role in human nutrition and innovative food products. DF12 offers therefore a wide forum for all disciplines and industrial sectors involved in the research, exploitation and utilization of dietary fibre. A table top exhibition of products, machinery and scientific tools contributes to giving the participants a comprehensive overview of the state of the art in the field of dietary fibre. During the 5th International Dietary Fibre Conference 2012 it is presented the “General Mills Award for Health Innovation� to the research project, poster or oral presentation, that demonstrates
the most innovative and novel association between consumption of fibre or whole grains and health improvement. The conference main topics are as follows. Workshop, Analysis of dietary fibre: development and evaluation of an integrated total dietary fibre assay procedure; ongoing evaluation, challenges and improvements to the integrated procedure for measurement of TDF; general discussion. Session 1, Fibre definition, analysis, impact on food composition databases, dietary recommendations and labelling. Session 2, Nutritional roles of intrinsic, isolated and synthetic fibres. Session 3, Dietary fibre in food processing. How to deliver dietary fibre in processed foods. Session 4, Challenges in formulating fibrerich foods to address the dietary fibre consumption gap. Session 5, Fibre, fermentation and health. Session 6, Benefits of dietary fibres and their co-passengers. Session 7, Dietary fibre impacts on human physiology and physical and mental health. Session 8, Consumers acceptance of fibrerich products. Session 9, Where do we go from here? (DF12 Conference Secretariat - ICC Int. Ass. for Cereal Science and Technology - Marxergasse 2 - 1030 Vienna - Austria - Fax +43 1 7077204 - www.df2012.icc. or.at - Anita Habershuber, e-mail: anita. habershuber@icc.or.at)
Tecnica Molitoria International - Yearly issue 2012 - 135
Exhibitions & meetings Calendar of international EVENTS IN ITALY 28th February - 3rd March 2012 - Rho-Pero (Milan): Ipack-Ima, int. packaging, food processing, milling and pasta exhibition. Ipack-Ima - Corso Sempione 4 - 20154 Milano - Italy - Fax +39 02 33619826 - www. ipackima.it - e-mail: ipackima@ipackima.it 7th - 9th May 2012 - Roma: 5th ICC int. dietary fibre conference. ICC - Marxergasse 2 - 1030 Vienna - Austria - Fax +43 1 7077204 - www.df2012.icc.or.at - e-mail: anita.habershuber@icc.or.at 7th - 10th May 2012 - Parma: Cibus, 16th int. food show. Fiere di Parma - Viale delle Esposizioni 393A - 43126 Parma - Italy - Fax +39 0521 996235 - www.cibus.it - e-mail: cibus@fiereparma.it 23rd - 24th October 2012 - Verona: Save, int. show on automation and instrumentation. E.I.O.M. Ente Italiano Organizzazione Mostre - Viale Premuda 2 - 20129 Milano - Italy - Fax +39 02 55184161 - www. exposave.com - e-mail: eiom@eiomfiere.it 11th - 13th April 2013 - Forlì: 48th FierAvicola, int. poultry and rabbit expo. Fiera di Forlì - Via Punta di Ferro - 47122 Forlì - Italy - Fax +39 0543 724488 - www.fieravicola.com - e-mail: info@fieravicola.com 19th - 22nd May 2013 - Rho (Milan): Tuttofood, int. food exhibition. Fiera Milano - Strada Statale del Sempione 28 - 20017 Rho - MI - Italy - Fax +39 02 49976587 - www.tuttofood.it - e-mail: info@tuttofood.it 11th - 14th June 2013 - Rimini: Packology, int. packaging & processing industry exhibition. Rimini Fiera - Via Emilia 155 - 47921 Rimini - RN - Italy - Fax +39 0541 744751 - www.packologyexpo.com - e-mail: a.piccinini@riminifiera.it MEZZA NUOVO SITO SFOGLIABILI TM_Layout 1 16/02/12 15:25 Pagina 3
www.chiriottieditori.com
the best way to BROWSE our site
CHIRIOTTI EDITORI www.chiriotti.it 136 - Tecnica Molitoria International - Yearly issue 2012
2012
SUPPLIER DIRECTORY
Italian
cereal milling equipment - feed equipment - mixers, blenders - sifters - dust collectors, cyclones - screws, worms - bucket elevators - hammer mills - silos - sieves feed mixers - hoppers - rice milling - conveyors - vibrators - pneumatic conveyors
Name Street City Tel. Fax e-mail web
AMANDUS KAHL GMBH & CO KG Dieselstrasse 5-9 D 21465 - REINBEK - GERMANY +49 40727710 +49 4072771100 info@amandus-kahl-group.de www.akahl.de
feed equipment
Name Street City Tel. Fax e-mail web
ANSELMO SPA Via Fossano 33 12041 - BENE VAGIENNA CN +39 0172 654755 +39 0172 654811 anselmo@anselmoitalia.com www.anselmoitalia.com
pasta machines
Name Street City Tel. Fax e-mail web
ASM SRL Via Del Lavoro 10/12 40050 - ARGELATO BO +39 051 6630419 +39 051 897386 info@sortingasm.com www.sortingasm.com
graders, sorters
Name Street City Tel. Fax e-mail web
AXOR SRL Via Maestra Grande 20 - Fraz. XII Morelli 44042 - CENTO FE +39 051 6842166 +39 051 6842282 info@axor-italia.com www.axor-italia.com
pasta machines - pasta presses
Name Street City Tel. Fax e-mail web
BACO SRL Via Meucci 14 30010 - LIETTOLI DI CAMPOLONGO VE +39 049 5848955 +39 049 9744147 info@ba-co.it www.ba-co.it
cereal milling equipment - ancillary equipment - pipes, piping
Name Street City Tel. Fax e-mail web
BECCARIA SRL Via Sperino 46 12030 - SCARNAFIGI CN +39 0175 274737 +39 0175 274748 beccaria@beccaria.it www.beccaria.it
cereal milling equipment - feed equipment - hammer mills - silos - feed mixers - extractors - pneumatic conveyors
Name Street City Tel. Fax e-mail web
BEVINI SRL Via Dell’elettronica 5/7 - Loc. Graziosa 41018 - SAN CESARIO SUL PANARO MO +39 059 9530911 +39 059 9535041 adelmo.bevini@bevini.it www.beviniimpianti.it
material handling and storage - bucket elevators - conveyor belts
Name Street City Tel. Fax e-mail web
BONA SRL Via Volterra 17 20052 - MONZA MB +39 039 741117 +39 039 741172 bonasrl@fastwebnet.it
analysis equipment
Name Street City Tel. Fax e-mail web
BORGHI SRL Via Paradello 7 45037 - MELARA RO +39 0425 89689 +39 0425 89636 info@borghigroup.it www.borghigroup.it
cereal milling equipment - ancillary equipment - sifters dust collectors, cyclones - bucket elevators - silos - sieves - hoppers - rice milling - pipes, piping - fans, blowers
Ancillary
ALFREDO BRAGLIA SPA Via Fermi 33/A 42030 - FOGLIANO RE +39 0522 520121 +39 0522 520125 info@officinebraglia.it www.officinebraglia.it
•
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
cereal milling equipment - ancillary equipment - bucket elevators - brushes - sieves - stitching - sleeves - belts clothing, gaskets - pipes, piping
Pasta Production
AGRINOVA SNC Via Togliatti 52 12038 - SAVIGLIANO CN +39 0172 715488 +39 0172 33408 info@agrinova.it www.agrinova.it
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
analysis and ancillary equipment
Name Street City Tel. Fax e-mail web
BÜHLER SPA Via Rivoltana 2/D - Palazzo A 20090 - SEGRATE MI +39 02 703111 +39 02 70311444 buhler.milan@buhlergroup.com www.buhlergroup.com
cereal milling equipment - feed equipment - pasta machines confectionery bakery equipment - coffee equipment - pasta driers - alveographs - dampers - sifters - pellet mills - scourers - driers - farinographs - roller mills - washers - moisture testers - hammer mills - plansifter - pasta presses - purifiers - silos extruders - granulators - granulating machines - cocoa processing machines - refiners - rice milling - degerminators
Name Street City Tel. Fax e-mail web
CAMLOGIC SNC Via Dell’Industria 12 42025 - CAVRIAGO RE +39 0522 941172 +39 0522 942643 camlogic@camlogic.it www.camlogic.it
ancillary equipment - level indicators
Name Street City Tel. Fax e-mail web
CAREDI SRL Via Sant'Elena 52 31057 - SANT’ELENA DI SILEA TV +39 0422 94073 +39 0422 94812 info@caredi.it www.caredi.it
silos - trieurs
Name Street City Tel. Fax e-mail web
CAVICCHI IMPIANTI SRL Via Matteotti 35 40055 - VILLANOVA DI CASTENASO BO +39 051 6053164 +39 051 780647 cavicchi@cavicchiimpianti.com www.cavicchiimpianti.com
material handling and storage - feeders, proportioners, dosers - hoppers - recycling plants - conveyors - pneumatic conveyors
Name Street City Tel. Fax e-mail web
packaging equipment - depalletizers - sacks filling CBC SRL machines - palletizers - weight checker S.S. 75 C.U. Km 4,190 - Z.I. 06083 - OSPEDALICCHIO BASTIA UMBRA PG +39 075 808151 +39 075 8081508 sales@concetti.com www.concetti.com
Name Street City Tel. Fax e-mail web
CHIARINI E FERRARI IMP. TECN. SRL Via 1 Maggio 8 40015 - ANZOLA DELL’EMILIA BO +39 051 734270 +39 051 733704 info@chiarinieferrari.it www.chiarinieferrari.it
conditioners
Name Street City Tel. Fax e-mail web
CIMBRIA HEID ITALIA SRL Via Ronzani 5/3 40033 - CASALECCHIO DI RENO BO +39 051 575635 +39 051 576910 info@cimbria.it www.cimbria.com
cereal milling equipment - graders, sorters - trieurs
Name Street City Tel. Fax e-mail web
CMB SRL Via Torino 6/B 36063 - MAROSTICA VI +39 0424 780176 +39 0424 472196 info@cmbsrl.com www.cmbsrl.com
feeders, proportioners, dosers
Name Street City Tel. Fax e-mail web
CMF SNC Via Venezia 3 25037 - PONTOGLIO BS +39 030 7376774 +39 030 7470892 cmf.brescia@tin.it www.cmf-italia.com
feed equipment - scourers - driers - flakers - roller mills sacks filling machines - toasters
•
Ancillary
BÜCHI ITALIA SRL Centro Dir. Milano Fiori Palazzo A4 Str. 4 20090 - ASSAGO MI +39 02 8245011 +39 02 57512855 italia@buchi.com www.buchi.it
•
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
pasta machines - coffee equipment - feeders, proportioners, dosers - silos - extractors - peelers - peelers - cutting machines - roasters - crackers
Pasta Production
BRAMBATI SPA Via Strada Nuova 37 27050 - CODEVILLA PV +39 0383 373100 +39 0383 373078 info@brambati.it www.brambati.it
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Name Street City Tel. Fax e-mail web
COLOMBO PIETRO SNC Via Marco D’Oggiono 21 - C.P. 63/64 23848 - OGGIONO LC +39 0341 576251 +39 0341 579005 info@colombopietro.it www.colombopietro.it
ancillary equipment - screws, worms
Name Street City Tel. Fax e-mail web
COMAV SRL Via Statale 337 44047 - DOSSO FE +39 0532 848348 +39 0532 848390 info@comav-srl.com www.comav-srl.com
cereal milling equipment - roller mills - plansifter
Name Street City Tel. Fax e-mail web
COMECF IMPIANTI SRL Strada Provinciale Per Alessandria 7 27032 - FERRERA ERBOGNONE PV +39 0382 998943 +39 0382 998005 staff@comecf.it www.comecf.it
cereal milling equipment - material handling and storage - driers - silos - engineering, consultant
Name Street City Tel. Fax e-mail web
packaging equipment - stitching - depalletizers - sacks CONCETTI SPA SS 75 C.U. Km 4,190 - Fraz. Ospedalicchio filling machines - palletizers - palletizing robots 06083 - BASTIA UMBRA PG +39 075 801561 +39 075 8000894 salesitaly@concetti.com www.concetti.com
•
Name Street City Tel. Fax e-mail web
CPS SRL Via Montecassino 47 - Località Larghe 40050 - FUNO DI ARGELATO BO +39 051 6647979 +39 051 6647978 info@cpscucitrici.it www.cpscucitrici.it
stitching - sacks filling machines
•
Name Street City Tel. Fax e-mail web
CUSINATO GIOVANNI SRL Via Monte Pelmo 8 35018 - SAN MARTINO DI LUPARI PD +39 049 9440146 +39 049 9440174 info@cusinato.com www.cusinato.com
pasta machines - material handling and storage screws, worms - bucket elevators - silos - sieves - sifters - hoppers - conveyor belts - pipes, piping - vibrators
Name Street City Tel. Fax e-mail web
DEFINITIVE INNOVATION SRL Via Allende 47 - Z Z Torrazzi 41122 - MODENA MO +39 059 9786266 +39 059 3682000 info@definn.eu www.definn.eu
feeders, proportioners, dosers
Name Street City Tel. Fax e-mail web
DEFINO & GIANCASPRO SRL Via Archimede 27/33 - Zona Pip 70024 - GRAVINA IN PUGLIA BA +39 080 3266196 +39 080 3265854 info@defino-giancaspro.it www.defino-giancaspro.it
cereal milling equipment - ancillary equipment - pipes, piping
Name Street City Tel. Fax e-mail web
DELLAVALLE SAS Via Per Suno 2 28040 - MEZZOMERICO NO +39 0321 97097 +39 0321 97401 nuovambn@tin.it www.emmebienne.com
aspirators, suction units, exhaust units - dust collectors, cyclones - scourers - bucket elevators - plansifter - bleachers - graders, sorters - rice milling
Name Street City Tel. Fax e-mail web
DOLZAN IMPIANTI SRL Via Roma 260 35015 - GALLIERA VENETA PD +39 049 5969375 +39 049 9470138 dolzan@dolzan.com www.dolzan.com
packaging equipment - vacuum packaging machines filling closing machines - vffs vertical form fill seal machines
Name Street City Tel. Fax e-mail web
ELEKTRON SRL Via delle Tuje 1 06083 - BASTIA UMBRA PG +39 075 8011758 +39 075 8011758 info@elektron-automazioni.it www.elektron-automazioni.it
automation and controls
•
•
Ancillary
Packaging
Feed Milling
Pasta Production
Flour Milling
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
analysis equipment - moisture testers
Name Street City Tel. Fax e-mail web
ESSEBIEMME PLAST SRL Via Fosso Guidario 101/B 55049 - VIAREGGIO LU +39 0584 340202 +39 0584 359987 essebiemme@virgilio.it www.essebiemmeplast.it
pasta machines - ancillary equipment
Name Street City Tel. Fax e-mail web
FAS TECHNOLOGY SRL Statale Padana 11 N. 1 24050 - MOZZANICA BG +39 0363 82173 +39 0363 321064 info@officinefasoli.com www.officinefasoli.com
cereal milling equipment
Name Street City Tel. Fax e-mail web
FAVA SPA Via IV Novembre 29 44042 - CENTO FE +39 051 6843411 +39 051 6835740 info@fava.it www.fava.it
pasta machines - pasta driers - pasta presses
Name Street City Tel. Fax e-mail web
FIKE ITALIA Via Eustachi 2 20129 - MILANO MI +39 02 29524166 +39 02 29514414 webmaster@fike.it www.fike.it
ancillary equipment
Name Street City Tel. Fax e-mail web
FLITECH SRL Via Marco Biagi 21 46025 - POGGIO RUSCO MN +39 0386 522911 +39 0386 522912 info@flitech.it www.flitech.it
screws, worms - conveyors
Name Street City Tel. Fax e-mail web
FORNASIER TIZIANO & C SAS Via Mercatelli Maglio 26 31010 - PONTE DELLA PRIULA SUSEGANA TV +39 0438 445354 +39 0438 759210 info@fornasiertiziano.com www.fornasiertiziano.com
automation and controls
Name Street City Tel. Fax e-mail web
FOSS ITALIA SPA Corso Stati Uniti 1/77 35127 - PADOVA PD +39 049 8287211 +39 049 8287222 fossitalia@foss.it www.foss.it
analysis equipment - fermentators, fermenters - analyzers - spectrophotometers
Name Street City Tel. Fax e-mail web
FRAGOLA F.LLI SPA Via Del Caminaccio 2 06088 - SANTA MARIA ANGELI PG +39 075 805291 +39 075 8042717 commerciale@fragolaspa.com www.fragolaspa.com
feed equipment - pellet mills - crumblers - silos
Name Street City Tel. Fax e-mail web
FREERAY SRL Via Meucci 8 37067 - VALEGGIO SUL MINCIO VR +39 0376 7952411 +39 0376 6371261 info@freeray.it www.freeray.it
samplers
Ancillary
PERTEN INSTRUMENTS ITALIA SRL Via Arturo Reali 24 00047 - MARINO RM +39 06 9385909 +39 06 93802520 info@esetek.it www.esetek.it
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
automation and controls - switch boards
Pasta Production
ELETTROTECNICA ZAMBELLI SRL Via Amendola 8 47039 - SAVIGNANO SUL RUBICONE FC +39 0541 941104 +39 0541 941152 zambelli@zambellionline.com www.zambellionline.com
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
magnets
Name Street City Tel. Fax e-mail web
GEELEN TECHNIEK BV Peter Schreursweg 38 NL 6081 - HAELEN, NX - NETHERLAND +31 475592315 +31 475592767 info@geelencounterflow.com www.geelencounterflow.com
refrigerating units - driers
Name Street City Tel. Fax e-mail web
GIEFFE SYSTEMS SRL Via Ponte Taro 28/B 43015 - NOCETO PR +39 0521 621221 +39 0521 620883 info@gieffesystems.it www.gieffesystems.it
ancillary equipment - pasta presses - vacuum pumps
Name Street City Tel. Fax e-mail web
GOLFETTO SANGATI SPA Via Flli Bandiera 3 31055 - QUINTO DI TREVISO TV +39 0422 476700 +39 0422 476800 info@golfettosangati.com www.golfettosangati.com
handling and storage - flour, feed, rice mills - hygiene and sanitization
Name Street City Tel. Fax e-mail web
GRESPAN COSTR. MECC. SRL Via Roma 144 31020 - CASTRETTE DI VILLORBA TV +39 0422 608848 +39 0422 608083 info@grespan.it www.grespan.it
feed equipment - silos
Name Street City Tel. Fax e-mail web
GVF COMPONENTS SRL Via E. Mattei 19 41043 - CASINALBO DI FORMIGINE MO +39 059 285413 +39 059 2861979 info@gvf.it www.gvf.it
ancillary equipment - scrapers - level indicators - valves
Name Street City Tel. Fax e-mail web
HIGH TEC SRL Via Cavaccina 8/A 35019 - TOMBOLO PD +39 049 9471972 +39 049 5998384 hightec@hightecnet.com www.hightecnet.com
automation and controls
Name Street City Tel. Fax e-mail web
HOERBIGER ITALIANA SPA Via Dell’elettronica 8 - ZI Bassona 37139 - VERONA VR +39 045 8510151 +39 045 8510153 info-hit@hoerbiger.com www.hoerbiger.com
valves
Name Street City Tel. Fax e-mail web
ICMI SRL Via Praga 4 24040 - ZINGONIA BG +39 035 883450 +39 035 885151 icmi@icmi.it www.icmi.it
ancillary equipment
Name Street City Tel. Fax e-mail web
IMMAC SRL Via Strada Nuova 25 27050 - CODEVILLA PV +39 0383 373044 +39 0383 73835 info@immacsrl.com www.immacsrl.com
cereal milling equipment - material handling and storage - aspirators, suction units, exhaust units - roller mills - plansifter
Ancillary
GAUSS MAGNETI SRL Via Scaroni 27 - Fornaci 25131 - BRESCIA BS +39 030 3580375 +39 030 3580846 info@gaussmagneti.it www.gaussmagneti.it
Packaging
Name Street City Tel. Fax e-mail web
•
Feed Milling
cereal milling equipment - pasta machines
Pasta Production
G&AS SRL Via Visco 20 35010 - LIMENA PD +39 049 8841894 +39 049 8846567 info@geassrl.it www.geassrl.it
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Packaging
Ancillary
Feed Milling
Pasta Production
Flour Milling
Cereal Equipment
SUPPLIER DIRECTORY
•
•
Name Street City Tel. Fax e-mail web
IMPAC SRL Via Ghisolfi e Guareschi 9 43015 - NOCETO PR +39 0521 620841 +39 0521 627988 info@impac.it www.impac.it
Name Street City Tel. Fax e-mail web
ITALPACK SRL packaging equipment - feeders, proportioners, dosers Via Costa 106 sacks filling machines - filling closing machines - shrink 47822 - S. ARCANGELO DI ROMAGNA RN tunnels - vffs vertical form fill seal machines +39 0541 625157 +39 0541 621956 italpack@italpack.net www.italpack.net
•
Name Street City Tel. Fax e-mail web
ITALPROJECT SRL Via Leonardo Da Vinci 6 35015 - GALLIERA VENETA PD +39 049 9475211 +39 049 9475200 sales@italproject.net www.italproject.net
packaging equipment - wrappers - cans, pots - blisters cases, crates - lids - unstackers - labellers - carton erectors - stackers - gluing machines - palletizers - palletizing robots - weighers, scales
•
Name Street City Tel. Fax e-mail web
ITALSAVE SRL Via Vecellio 13 - Sarano 31025 - SANTA LUCIA DI PIAVE TV +39 0438 460640 +39 0438 460672 info@italsave.it www.italsave.it
paints, lining, coating - assistance, maintenance
Name Street City Tel. Fax e-mail web
ITALVIBRAS SPA Via Ghiarola Nuova 22/26 41042 - FIORANO MODENESE MO +39 0536 804634 +39 0536 804720 italvibras@italvibras.it www.italvibras.it
vibrators
Name Street City Tel. Fax e-mail web
LA MECCANICA SRL Via Padre Nicolini 1 Loc. Facca 35013 - CITTADELLA PD +39 049 9419000 +39 049 5972171 lameccanica@lameccanica.it www.lameccanica.it
feed equipment - pellet mills - hammer mills - feed mixers - coolers
Name Street City Tel. Fax e-mail web
LANDUCCI SRL Via Landucci 1 51100 - PISTOIA PT +39 0573 532546 +39 0573 533067 landucci@landucci.it www.landucci.it
pasta machines - dies - cutting machines - washing machines
Name Street City Tel. Fax e-mail web
LTA SNC Viale Dell'industria 11 36016 - THIENE VI +39 0445 370993 +39 0445 813114 info@ltaitalia.it www.ltaitalia.it
pasta machines - pasta driers
Name Street City Tel. Fax e-mail web
MAKROS SRL Via Fermi 3/5 25027 - QUINZANO D'OGLIO BS +39 030 933170 +39 030 9923905 makros@tin.it www.makros.com
conveyors and hoppers
Name Street City Tel. Fax e-mail web
MAZZETTI SAS Via Dei Bersaglieri 3 - Z I Stelloni 40010 - SALA BOLOGNESE BO +39 051 6815024 +39 051 6873465 mazzetti@mazzettisas.com www.mazzettisas.com
sifters - scourers - destoners - sieves - trieurs - sifters textiles
Name Street City Tel. Fax e-mail web
METALPLAST SRL Via 5 Maggio 19 20157 - MILANO MI +39 02 3556335 +39 02 33200318 italy@mpmetalplast.it www.mpmetalplast.it
stitching
pallet wrapping, hooding machines - depalletizers carton erectors - stackers - sacks filling machines - palletizers - palletizing robots - overturning equipment conveyor belts
•
•
•
•
•
•
•
•
•
•
•
feed equipment - mixers, blenders - screws, worms silos
Name Street City Tel. Fax e-mail web
MILL SERVICE SPA Via Pelosa 78 35030 - SELVAZZANO DENTRO PD +39 049 8978743 +39 049 8978780 info@ms-italia.com www.ms-italia.com
cereal milling equipment
Name Street City Tel. Fax e-mail web
MIOZZO SRL Via E. Fermi 15 35010 - SALETTO DI VIGODARZERE PD +39 049 767451 +39 049 8845941 miozzo@miozzosrl.com www.miozzosrl.com
pipes, piping
Name Street City Tel. Fax e-mail web
MIX SRL Via Volturno 119/A 41032 - CAVEZZO MO +39 0535 46577 +39 0535 46580 info@mixsrl.it www.mixsrl.it
ancillary equipment - feed mixers - granulators - granulating machines - filters - level indicators - nozzles
Name Street City Tel. Fax e-mail web
cereal milling equipment MOLITECNICA SUD SNC Sp per Ruvo di Puglia Km 1,300 - Cda Torre La Macchia 70022 - ALTAMURA BA +39 080 3101016 +39 080 3146832 info@molitecnicasud.com www.molitecnicasud.com
Name Street City Tel. Fax e-mail web
MONTENEGRO SRL Via Volturno 37 20047 - BRUGHERIO MB +39 039 883107 +39 039 870023 info@montenegrosrl.it www.montenegrosrl.it
feeders, proportioners, dosers
Name Street City Tel. Fax e-mail web
MORIONDO SNC Casella Postale 20/B 20045 - BESANA BRIANZA MB +39 0362 995110 +39 0362 996300 moriondo@moriondo.com www.moriondo.com
pasta machines - fresh pasta machinery - pasta presses - fresh pasta pasteurizers - micro-wave cooking
Name Street City Tel. Fax e-mail web
MORO SRL Via Pirandello 10 20030 - BARLASSINA MB +39 0362 565586 +39 0362 557261 info@moro.it www.moro.it
ancillary equipment - aspirators, suction units, exhaust units - fans, blowers
Name Street City Tel. Fax e-mail web
MTD SRL Via Volta 2 - Z I Settimo 37026 - PESCANTINA VR +39 045 7157266 +39 045 7157360 info@mtdsrl.it www.mtdsrl.it
feed equipment - pellet mills
Name Street City Tel. Fax e-mail web
MULMIX FACCO SRL Via Palladio 7 - Marsango 35010 - CAMPO SAN MARTINO PD +39 049 9638211 +39 049 9630511 mulmix@mulmix.it www.mulmix.it
feed equipment - driers - hammer mills - silos
•
•
Ancillary
MIAL F.LLI MASSINI SRL Zona Industriale 06088 - TORDANDREA DI ASSISI PG +39 075 8042312 +39 075 80043278 info@mial.it www.mial.it
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
feed equipment - packaging equipment - stitching depalletizers - sacks filling machines - palletizers - palletizing robots
Pasta Production
MF TECNO SRL Via Porziuncola 28 06081 - TORDANDREA DI ASSISI PG +39 075 7827487 +39 075 7827493 info@mftecno.it www.mftecno.it
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
analysis equipment - waste water - pumps - mass spectrometers
Name Street City Tel. Fax e-mail web
NICCOLAI TRAFILE SRL Via Cardarelli 19 - Z.I. Sant'Agostino 51100 - PISTOIA PT +39 0573 92731 +39 0573 934394 niccolai@niccolaitrafile.it www.niccolai.com
pasta machines - dies - dough sheeter - cutting machines - washing machines
Name Street City Tel. Fax e-mail web
OBR DI BULGARELLI & C SNC Via Parri 3 42045 - LUZZARA RE +39 0522 976972 +39 0522 970909 obr@obr.it www.obr.it
cereal milling equipment - feed equipment - ancillary equipment
Name Street City Tel. Fax e-mail web
OCRIM SPA Via Massarotti 76 26100 - CREMONA CR +39 0372 4011 +39 0372 412692 info@ocrim.com www.ocrim.com
cereal milling equipment - roller mills - washers - hammer mills - purifiers - silos - degerminators - pneumatic conveyors - cleaners
Name Street City Tel. Fax e-mail web
OFFICINE FACCHINI SRL Via Zara 6/8 20032 - CORMANO MI +39 02 66305527 +39 02 66309960 info@officinefacchini.it www.officinefacchini.it
pasta machines
Name Street City Tel. Fax e-mail web
OFFICINE LOPORCARO SAS S S 96 Km 78,800 - Via del Grano 1 70022 - ALTAMURA BA +39 080 3101167 +39 080 3101307 info@loporcaro.it www.loporcaro.it
cereal milling equipment
Name Street City Tel. Fax e-mail web
OFFICINE MAZZOLARI SRL Via Aldo Moro 14 - Z. I. Cignone 26020 - CORTE DE’ CORTESI CR +39 0372 926002 +39 0372 926107 info@grazianomazzolari.it www.grazianomazzolari.it
services
Name Street City Tel. Fax e-mail web
OFFICINE MINUTE SRL Via Roma 139 31020 - VILLORBA TV +39 0422 919178 +39 0422 911192 info@officineminute.it www.officineminute.it
driers - silos
Name Street City Tel. Fax e-mail web
OLOCCO SRL Via Del Santuario 41 12045 - FOSSANO CN +39 0172 692579 +39 0172 692578 olocco@olocco.it www.olocco.it
ancillary equipment - pipe fittings - valves - pneumatic conveyors
Name Street City Tel. Fax e-mail web
OMB SRL - VIBRATOR MOTORS Via Mariano 3 41040 - CORLO DI FORMIGINE MO +39 059 556316 +39 059 572762 info@ombvibrators.com www.ombvibrators.com
motors - vibrators
Ancillary
NETZSCH MILANTECNICA SRL Via Fleming 17 37135 - VERONA VR +39 045 8200755 +39 045 8200807 info@nmv.netzsch.com www.netzsch-pumpen.de
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
pasta driers - frames - textiles
Pasta Production
MUNDIALNYL Via Salardi 19 22100 - COMO CO +39 031 523089 +39 031 523482 mundialnyl@mundialnyl.it www.mundialnyl.it
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
pallet wrapping, hooding machines - depalletizers bundling machines - sacks filling machines - palletizers - filling closing machines - palletizing robots - sealing welding machines
Name Street City Tel. Fax e-mail web
PARTISANI SRL Via Buli 2 47122 - FORLI’ FC +39 0543 796165 +39 0543 723237 info@partisani.it www.partisani.it
cereal milling equipment - stones - cleaners
Name Street City Tel. Fax e-mail web
PAVAN SRL Via Monte Grappa 8 35015 - GALLIERA VENETA PD +39 049 9423111 +39 049 9423303 sales@pavan.com www.pavan.com
pasta machines - pasta driers - fresh pasta machinery pasta presses - fresh pasta pasteurizers - map packaging machines - extruders - dough sheeter - micro-wave cooking
Name Street City Tel. Fax e-mail web
PEDA SRL Via Rabin 9/a 35016 - PIAZZOLA SUL BRENTA PD +39 049 9600610 +39 049 9619180 info@pedasrl.it www.pedasrl.it
ancillary equipment - plansifter - frames
Name Street City Tel. Fax e-mail web
PERONTECNICI SRL Via M. Polo 17 35020 - ALBIGNASEGO PD +39 049 681093 +39 049 691488 perontecnici@perontecnici.it www.perontecnici.it
conveyor belts
Name Street City Tel. Fax e-mail web
PETKUS TECHNOLOGIE GMBH Via Curiel 5, Corte Tegge 42025 - CAVRIAGO RE +39 0522 943612 +39 0522 943625 pellizzi@petkus.it www.petkus.de
driers - silos - conveyors - cleaners
Name Street City Tel. Fax e-mail web
PISA DI LAMBO GIUSEPPE SNC Strada Prov. Andria Trani Km 1,5 70031 - ANDRIA BA +39 0883 557543 +39 0883 557543 info@pi-sa.it www.pi-sa.it
paints - lining - coating
Name Street City Tel. Fax e-mail web
PIZETA SRL Via Europa 27 35015 - GALLIERA VENETA PD +39 049 9470669 +39 049 9471739 info@pizeta.com www.pizeta.com
pasta machines - sifters - dust collectors, cyclones screws, worms - feeders, proportioners, dosers - bucket elevators - mills - plansifter - silos - sieves - tapes, ribbons - stirrers, shakers - extractors - extruders - dough loaders - proofers - rollers - filters - weighers, scales air compressors - compressors - conveyor belts - plc textiles - conveyors - vibrators - pneumatic conveyors
Name Street City Tel. Fax e-mail web
PLP LIQUID SYSTEMS SRL Via 1° Maggio 4 29018 - LUGAGNANO VAL D’ARDA PC +39 0523 891629 +39 0523 891013 info@plp-liquidsystems.net www.plp-liquidsystems.net
recycling plants
Name Street City Tel. Fax e-mail web
PRO-TECH ITALIA SRL Via Luigi Nino Malerba 47 16012 - BUSALLA GE +39 010 9642386 +39 010 9760839 info@pro-techitalia.com www.pro-techitalia.com
pasta plant - material handling and storage - bucket elevators - silos - hoppers - conveyor belts
Ancillary
PAGLIERANI SRL Via Santarcangiolese 5 47825 - TORRIANA RN +39 0541 311111 +39 0541 675460 info@paglierani.com www.paglierani.com
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
pallet wrapping, hooding machines - depalletizers bundling machines - sacks filling machines - palletizers - palletizing robots - sealing welding machines
Pasta Production
PAGANI IMBALLAGGI SNC Via G. Morandi 32 21047 - SARONNO VA +39 02 96701343 +39 02 96701377 info@paganiimballaggi.com www.paganiimballaggi.com
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
RE PIETRO OFF. MECCANICA Via Galilei 55 20083 - GAGGIANO MI +39 02 9085025 +39 02 90842014 info@repietro.com www.repietro.com
Name Street City Tel. Fax e-mail web
RICCIARELLI PACKAGING MACHINERY SPA pasta machines - pasta driers - packaging sealing machines - vacuum packaging machines Via Mariotti 143 - Z I Sant’ Agostino 51100 - PISTOIA PT +39 0573 44571 +39 0573 933223 info@ricciarellispa.it www.ricciarellispa.it
Name Street City Tel. Fax e-mail web
RIMA ARTICOLI TECNICI Via Viazza Sinistra 2 40050 - MEZZOLARA DI BUDRIO BO +39 051 805912 +39 051 805912 rimarticolitecnici@libero.it www.rimapack.it
stitching - ancillary
Name Street City Tel. Fax e-mail web
ROSTA SRL Via Bergamo 6 20020 - LAINATE MI +39 02 93655101 +39 02 93655200 rostaitalia@rostaitalia.com www.rostaitalia.com
ancillary equipment - coupling
Name Street City Tel. Fax e-mail web
S.COM SRL Via Pierobon 31 35010 - LIMENA PD +39 049 8848090 +39 049 8848070 info@sicom-italy.com www.sicom-italy.com
cereal milling equipment - roller mills - plansifter - purifiers - silos - extractors - pneumatic conveyors - cleaners
Name Street City Tel. Fax e-mail web
SARA TECHNOLOGY SRL Via Brunelleschi 11 42048 - RUBIERA RE +39 0522 629684 +39 0522 6857779 info@saratechnology.it www.saratechnology.it
computers consulting
Name Street City Tel. Fax e-mail web
pasta machines - fresh pasta machinery - fresh pasta SARP SNC Via Montebelluna 43 - Loc. S. Andrea O. M. pasteurizers - freezing tunnels - proving tunnel 31033 - CASTELFRANCO VENETO TV +39 0423 482633 +39 0423 482468 sarp@sarp.it www.sarp.it
Name Street City Tel. Fax e-mail web
SCHULE F.H. MUHLENBAU GMBH Dieselstrasse 5-9 D 21465 - REINBEK - GERMANY +49 40727710 +49 4072771710 schule@amandus-kahl-group.de www.schulefood.de
plansifter - bleachers - cleaners
Name Street City Tel. Fax e-mail web
SCOLARI SRL Via Padana Superiore 178 25035 - OSPITALETTO BS +39 030 6848012 +39 030 6848032 info@scolarisrl.com www.scolarisrl.com
cereal driers
Ancillary
Name Street City Tel. Fax e-mail web
Packaging
RAMBALDO ANTONIO ancillary equipment Via Tessara 9/11 35010 - S. MARIA DI NON CURTAROLO PD +39 049 557094 +39 049 9623322 info@rambaldoantonio.com www.rambaldoantonio.it
Feed Milling
Name Street City Tel. Fax e-mail web
Pasta Production
R-BIOPHARM ITALIA SRL Via Dell’artigianato 19 20070 - CERRO AL LAMBRO MI +39 02 98233330 +39 02 9834100 info@r-biopharm.it www.r-biopharm.com
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY analysis equipment
•
•
scourers - bucket elevators - rice milling
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
packaging equipment - pallet wrapping, hooding machines - stitching - sacks filling machines - filling closing machines - weighers, scales - weight checker
Name Street City Tel. Fax e-mail web
SEFAR ITALIA SRL Via Nazioni Unite 44 10093 - COLLEGNO TO +39 011 42001 +39 011 3827253 info@sefar.it www.sefar.it
ancillary equipment - frames - textiles
Name Street City Tel. Fax e-mail web
SEVEN SRL Via Dell’industria 2 35012 - CAMPOSAMPIERO PD +39 049 8874518 +39 049 8874517 seven@sevensrl.it www.sevensrl.it
cereal milling equipment - ancillary equipment - pipes, piping
Name Street City Tel. Fax e-mail web
SIAT SRL Via Circonvallazione Ovest 53 40050 - CASTELLO D'ARGILE BO +39 051 977027 +39 051 977252 info@siat.it www.siat.it
brushes
Name Street City Tel. Fax e-mail web
SILESFOR DP SRL Via Pitagora 45 35030 - RUBANO PD +39 049 8975307 +39 049 631499 silesfor@silesfor.com www.silesfor.com
silos
Name Street City Tel. Fax e-mail web
SIMA SRL Via Marmolada 15 - Z I Nord 31027 - SPRESIANO TV +39 0422 881034 +39 0422 888533 info@simaimpianti.net www.simaimpianti.net
ancillary equipment - aspirators, suction units, exhaust units - dust collectors, cyclones
Name Street City Tel. Fax e-mail web
SIRCATENE SPA Via Rossini 17 - Località Campù 23873 - MISSAGLIA LC +39 039 9200551 +39 039 9200814 info@sircatene.com www.sircatene.com
chains
Name Street City Tel. Fax e-mail web
SIRCEM SPA Via Diaz 15 84018 - SCAFATI SA +39 081 8631205 +39 081 8630301 sircem@sircem.it www.sircem.it
pasta machines - feeders, proportioners, dosers - bucket elevators - silos - filters - industrial pc - control panels - pneumatic conveyors
Name Street City Tel. Fax e-mail web
SMERI SRL Via Balduccio Da Pisa 12 20139 - MILANO MI +39 02 5398941 +39 02 5692507 smeri@smeri.com www.smeri.com
instruments
Name Street City Tel. Fax e-mail web
TECALIT SRL Via Leonardo Da Vinci 60 35018 - SAN MARTINO DI LUPARI PD +39 049 9460985 +39 049 5953771 tecalit@tecalit.it www.tecalit.it
pasta machines - pasta driers - pasta presses
•
Ancillary
SECAM SRL Via Curiel 17/19 20017 - MAZZO DI RHO MI +39 02 93901220 +39 02 93901292 info@secamsrl.com www.secamsrl.com
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
cereal graders, sorters
Pasta Production
SEA SRL Via Ercolani 30 40026 - IMOLA BO +39 0542 361423 +39 0542 643567 info@seasort.com www.seasort.com
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
packaging sealing machines
Name Street City Tel. Fax e-mail web
TECHNOBINS SRL Via Curiel 5 - Corte Tegge 42025 - CAVRIAGO RE +39 0522 943002 +39 0522 494105 techbins@tin.it www.technobins.it
material handling and storage - silos
Name Street City Tel. Fax e-mail web
TECNA SRL Via Milano 52 22070 - BREGNANO CO +39 031 774293 +39 031 774308 tecna@tecnasaima.it www.tecnasaima.it
fresh pasta machinery - pasta presses - fresh pasta pasteurizers - dough sheeter
Name Street City Tel. Fax e-mail web
TECNOGRAIN CARLINI SRL Via Aldo Moro 23 46010 - S. SILVESTRO DI CURTATONE MN +39 0376 478584 +39 0376 478530 info@tecnograin.com www.tecnograin.com
refrigerating units
Name Street City Tel. Fax e-mail web
TECNOIMPIANTI SNC Via Maggiore 81 35045 - OSPEDALETTO EUGANEO PD +39 0429 679060 +39 0429 670222 info@tecnoimpiantisnc.it www.tecnoimpiantisnc.it
feed equipment - driers - extractors
Name Street City Tel. Fax e-mail web
TECOM DI DEL VACCHIO Via Emilia Est 1420/3 41100 - MODENA MO +39 059 282353 +39 059 282363 info@te-com.it www.te-com.it
ancillary equipment - pipe fittings - valves - pneumatic conveyors
Name Street City Tel. Fax e-mail web
TEKNO UNO TRATT. ACCIAI SRL Via Lombardia 12 37012 - SAN VITO BUSSOLENGO VR +39 045 7157088 +39 045 7157287 informazioni@teknouno.com www.teknouno.com
feed equipment - ancillary equipment
Name Street City Tel. Fax e-mail web
TENCHINI SNC Strada Dell’ Orsina 4 29100 - PIACENZA PC +39 0523 594180 +39 0523 594185 tenchini@libero.it www.tenchini.it
feed equipment - pellet mills - hammer mills - crumblers
Name Street City Tel. Fax e-mail web
TESTO SPA Via Flli Rosselli 3/2 20019 - SETTIMO MILANESE MI +39 02 335191 +39 02 33519200 info@testo.it www.testo.it
automation and controls - flowmeters - hygrometers pressure gauges - thermometers
Name Street City Tel. Fax e-mail web
TMG IMPIANTI SRL Via Regia 5 35018 - SAN MARTINO DI LUPARI PD +39 049 9467911 +39 049 9467900 sales@tmgimpianti.it www.tmgimpianti.it
palletizers - conveyors - packaging equipment
Ancillary
TECHNO D SNC Via Marche 19 27029 - VIGEVANO PV +39 0381 348294 +39 0381 090590 info@techno-d.it www.techno-d.it
Packaging
Name Street City Tel. Fax e-mail web
Feed Milling
pallet wrapping, hooding machines - stitching - sacks filling machines - palletizers - filling closing machines weighers, scales - weight checker
Pasta Production
TECHNIPES SRL Via Del Gelso 12 47822 - S.ARCANGELO DI ROMAGNA RN +39 0541 624970 +39 0541 625902 technipes@technipes.com www.technipes.com
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Name Street City Tel. Fax e-mail web
TRE EMME SNC Via Samuel Morse 22 - San Leonardo 47122 - FORLI’ FC +39 0543 720590 +39 0543 796868 info@treemmemaraldi.com www.treemmemaraldi.com
cereal milling equipment
Name Street City Tel. Fax e-mail web
TUBIMONT SRL Corso Asti 2/I 12050 - GUARENE CN +39 0173 228414 +39 0173 33272 tubimont@tubimontsrl.191.it
feeders, proportioners, dosers
Name Street City Tel. Fax e-mail web
UMBRA PACKAGING SRL Viale Dei Pini 46/48 06086 - PETRIGNANO DI ASSISI PG +39 075 809780 +39 075 80978127 info@umbrapackaging.it www.umbrapackaging.it
depalletizers - stackers - sacks filling machines - palletizers - palletizing robots - conveyors
Name Street City Tel. Fax e-mail web
VERDI SPA Via Volta 7/1 42024 - CASTELNUOVO DI SOTTO RE +39 0522 683899 +39 0522 683086 info@verdispa.com www.verdispa.com
ancillary equipment - screws, worms - bucket elevators - level indicators - conveyor belts
Name Street City Tel. Fax e-mail web
VISENTIN ANTENORE SRL Via Cartera 39 31100 - TREVISO TV +39 0422 300311 +39 0422 301614 info@antenorevisentin.com www.antenorevisentin.com
cereal milling equipment
Name Street City Tel. Fax e-mail web
VOMM IMPIANTI E PROCESSI SPA Via Curiel 252 20089 - ROZZANO MI +39 02 57510808 +39 02 57510909 vomm@vomm.it www.vomm.it
pasta driers - fresh pasta machinery - fresh pasta pasteurizers - extruders - granulators - cookers - granulating machines - kneaders, mixers
Name Street City Tel. Fax e-mail web
YOUNG-MASSA SRL Via Santa Maria 5 20040 - CAVENAGO DI BRIANZA MB +39 02 95019613 +39 02 95019413 info@youngmassa.it www.youngmassa.it
handling and storage - sub supplying
Name Street City Tel. Fax e-mail web
ZANIN F.LLI SRL Viale Delle Industrie 1 31032 - CASALE SUL SILE TV +39 0422 785444 +39 0422 785805 info@zanin-italia.com www.zanin-italia.com
ancillary equipment - driers
Name Street City Tel. Fax e-mail web
ZINDO SRL Via Foggia 71/73 70051 - BARLETTA BA +39 0883 510672 +39 0883 510741 info@zindobaresina.com www.zindobaresina.com
fresh pasta machinery - fresh pasta pasteurizers dough sheeter
Ancillary
packaging equipment
Packaging
TOTAL PACK SRL Via Italia 80 96100 - SIRACUSA SR +39 0931 493462 +39 0931 490339 info@totalpack.it www.totalpack.it
Feed Milling
Name Street City Tel. Fax e-mail web
Pasta Production
TOREX SPA rotary valves Via Canaletto 139/A 41030 - S. PROSPERO SULLA SECCHIA MO +39 059 8080811 +39 059 908204 torex@torex.it www.torex.it
Flour Milling
Name Street City Tel. Fax e-mail web
Cereal Equipment
SUPPLIER DIRECTORY
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
News Newsletter Appointments Trade Shows database for combined searches for product categories, by type or Country
the Italian food industry supplier portal
advertiser index Agrinova - Savigliano............................ 50
G&AS - Limena................................... 121
Off. Minute - Villorba............................. 33
Anselmo - Bene Vagienna..................16-17
Gauss Magneti - Brescia........................ 52
Olocco - Fossano................................... 19
ASM - Argelato..................................... 57
Grespan - Castrette di Villorba............... 53
Omb - Corlo di Formigine........................ 9
Axor - Cento........................................ 45
GVF Components - Casinalbo di F......... 115
Partisani - Forlì..................................... 11
Ba.Co - Liettoli di Campolongo............... 28
Hoerbiger Ventilwerke - Verona.............. 38
Peda - Piazzola Sul Brenta..................... 46
Borghi - Melara.................................... 43
Immac - Codevilla................................. 20
Perontecnici - Albignasego..................... 41
Brambati - Codevilla............................. 47
Italpack - Santarcangelo di R................. 58
Pizeta - Galliera Veneta........................... 7
Cavicchi - Villanova Castenaso............... 40
Italproject - Galliera Veneta....................4-5
Rambaldo Antonio - S. Maria di Non.... 120
Chiriotti Editori - Pinerolo..... 54-93-131-136
Italvibras - Fiorano Modenese................ 13
Ricciarelli - Pistoia...........................cover 4
CMF Ferrari Carlo - Pontoglio................. 18
La Meccanica - Cittadella.................cover 3
S.Com - Limena..................................... 12
Colombo - Oggiono.............................. 32
LTA - Thiene......................................34-35
Sara Technology - Rubiera...................... 36
Concetti - Bastia Umbra......................... 21
Mill Service -
Sarp - Castelfranco Veneto..................... 42
Cusinato - San Martino di Lupari............ 56
Selvazzano Dentro............. gatefold cov. 1
Sea - Imola............................................. 3
Defino & Giancaspro -
Mix - Cavezzo...................................... 46
Siat - Castello d’Argile........................... 48
Gravina in Puglia................................ 39
Molitecnica Sud - Altamura..................... 14
Silesfor - Rubano................................... 44
Dolzan - Galliera Veneta........................ 25
Moriondo - Besana B............................. 37
Sima - Spresiano................................... 55
Essebiemme Plast - Viareggio................. 49
Mulmix - Campo San Martino.............. 111
Sircatene - Missaglia............................... 2
Fava - Cento............................ cover 1-2-1
Mundialnyl - Como............................... 51
Sircem - Scafati.................................22-23
Flitech - Poggio Rusco.......................... 129
Niccolai Trafile - Pistoia.......................... 10
Tecalit - S. Martino di Lupari................... 30
Food Executive.com.........................89-152
OBR Bulgarelli - Luzzara.......................... 6
Technipes - Santarcangelo di R............... 31
Fornasier Tiziano -
Ocrim - Cremona..............................29-98
Tecna - Bregnano.................................. 50
Ponte della Priula................................ 40
Off. Loporcaro - Altamura........................ 8
Torex - San Prospero sulla Secchia.......... 15
Fragola - S. Maria Angeli..................26-27
Off. Mazzolari - Corte Dè Cortesi........... 44
Zindo - Barletta..................................... 24
company addresses Anselmo - Bene Vagienna..............................104 Asm - Argelato...............................................99 Cavicchi Impianti Villanova di Castenaso................................112 Colombo Pietro - Oggiono..............................118 Concetti Group - Bastia Umbra........................122 Dolzan Impianti - Galliera Veneta....................127 Fava - Cento.................................................106 Fornasier Tiziano & C. - Ponte della Priula..........92 Golfetto Sangati - Quinto di Treviso...................95 Imp.a.c - Noceto...........................................129 Italpack - Santarcangelo di Romagna..............125 Italproject - Galliera Veneta............................128 La Meccanica - Cittadella................................132
Mix - Cavezzo..............................................116 Moriondo - Besana in Brianza........................108 Ocrim - Cremona............................................97 Olocco - Fossano...........................................114 Partisani - Forlì...............................................94 Pavan Group - Galliera Veneta.......................109 Pro-Tech Italia - Busalla..................................102 Ricciarelli - Pistoia..........................................124 Sea - Imola...................................................100 Sefar - Collegno............................................115 Stiavelli - Uzzano..........................................126 Tecalit - San Martino di Lupari.........................101 Tecna - Bregnano...........................................104 Verdi - Castelnuovo di Sotto............................119
1961/2011
Amazing
Top carton applicator AC50
innovations at Ricciarelli's stand G12-RM new long goods weigher
Corner sealing system for long goods bag
Via U. Mariotti, 143 - S. Agostino - 51100 Pistoia ITALY Tel. +39 0573 44571 - fax +39 0573 933223 e.mail: info@ricciarellispa.it - www.ricciarellispa.it
100% ItalIan know how. The whole world recognizes the quality of our plants, the precious result of the Italian expertise. The heart and mind of every project designed by Mill Service are deeply linked to the excellence of our country. Great attention to details, consolidated know-how of production processes and propensity to innovation, resulting in the capability of engineering more efficient milling systems and install highly performing plants, in full respect of the environment, mankind and strict international regulations.
MIll ServIce Spa Via Pelosa, 78 Selvazzano Dentro, Padova / Italia Ph. +39 049 8978743 + 39 049 8978744 Fax +39 049 8978780 info@ms-italia.com www.ms-italia.com