
44 minute read
Legal Notice To Creators Of the False Alarm
Legal Notice To Creators Of False Alarm
Date: June 29, 2022
Advertisement
To,
1. THE DIRECTOR GENERAL, INDIAN COUNCIL OF
MEDICAL RESEARCH (ICMR) 2. Member Secretary, National Disaster Management
Authority (NDMA) 3. The Home Secretary, Ministry of Home Affairs (MHA) 4. The Health Minister of India via the Chief Secretary (MoHFW)
CC,
5. The Chief Justice of India & his companion Judges,
Supreme Court of India 6. Prime Minister Office via Chief Secretary (PMO) 7. The President of India
8. All Principal District Judges and Constitutional Courts in India
9. All District Magistrates in India 10. The Director, National Institute of Virology (NIV)
Respected Sir/Madam, Ref:
1. Our correspondences with the Director General of ICMR. 2. Evidence/argument/clarification received through RTI and email replies from ICMR & NIV.
Findings: The evidence (scientific documents so far received from the Union of India & its Institutions) lacks substance to prove the existence of SARS-CoV-2 virus, which is the only base of this pandemic-like situation and implementation of the Epidemic Act, 1897 and the Disaster Management Act, 2005.
SL. NO. TITLE OF THE EVIDENCE/ CLARIFICATION RECIEVED GROUND FOR CONTENTIONS
1 On dated 2.2.2022, In reply of our correspondence ICMR mentioned;
‘Virus isolation from human samples is done using cell culture techniques, which is the method of choice for isolating any virus including SARS-CoV-2 responsible for the ongoing pandemic. If intact virus particle is not obtained directly from human samples or body parts, then how can virologists claim the existence of virus and it’s a causative agent of human disease?
Isolation and identification
2 “First isolation of SARSCoV-2 from clinical samples in India”. i. Without obtaining of virus particle directly from human sample, how this cell culture technique scientifically valid to establish the existence of virus and its causation to disease? ii. Secondly, No separation/ Isolation and purification of alleged virus particle. iii. No proper control setups, no multiplication in fresh cell culture without additives to establish the infectiousness, no bio-chemical characterization etc iv.No pathogenicity Experiment with control setups. Therefore, without above steps, how is it possible to claim a particle as ‘disease causing virus’?
3 “Transmission electron microscopy imaging of SARS-CoV-2”.
i.The Questions/findings are mentioned in above points No.2 (from i to iv ii. This TEM images do not represent anything or the research work does not establish the existence of ‘disease causing virus’ without point No.i. Pathogenesis 4 Received in reply of our letter dated 22nd January, 2022 a. ‘Severe acute respiratory syndrome coronavirus infection of golden Syrian hamsters.’ b. Pathogenesis and transmission of SARSCoV-2 in golden hamsters. i. Without purified virus particle, how pathogenicity experiment is scientifically valid? ii. Absence of detailed explanation of the entire process of pathology of generation of each and every symptoms by alleged SARS CoV-2 virus. iii. Lack of evidence to confirm, the alleged virus is ‘disease causing agent’ for human being/ host
RT-PCR Testing protocol 5 In case of First 3 alleged Covid-cases, it was mentioned in the paper that “Confirmatory laboratory tests were performed as per the WHO-recommended test protocols. “Full-genome sequences of the first two SARS-CoV-2 viruses from India”. i. Lack of valid evidence to establish the existence of alleged SARS Cov-2 virus. ii.There is no evidence to confirm the obtaining/ extraction of ‘entire genome sequence’ from purified virus sample. iii.There is no valid evidence to establish the alleged SAR-CoV-2 is a causative agent of any symptom or disease. Therefore, how any test in this situation would be scientifically validated in any manner? iv. As per peer review from 22 renowned scientists across the world, RT-PCR test protocol which was used to detect alleged SARS-CoV-2 is useless. ( mentioned in point 7 in the letter)
Subject: Seeking reliable evidence with respect to Identification (Separation, Isolation and Purification) of the alleged SARSCoV-2 directly obtained from uncultured original sample of the sick person to prove the existence and pathogenicity of it and secondly for clarification/scientific evidence against other crucial aspects of the alleged Covid-19 disease as mentioned herein below, u/s 76 of Indian Evidence Act, 1872 & u/s 12 of Public Records Act, 1993.
Background
In the beginning of 2020, it was widely published in the media and the governments of various countries that the pandemic of Covid-19 was spreading worldwide including India and as such the Government of India invoked, implemented and imposed “The Epidemic Act” and “The Disaster Management Act” on the entire population of India. This was entirely based on an alleged highly contagious and pathogenic virus i.e., SARS-CoV-2.
The Covid-19 infection and its disease to death ratio failed to address the condition of being a dangerous and lethal disease, which corresponds to the panic spread because of it. Secondly, the Government of India took a loan of 1000 Million US Dollar in the name of Pandemic or for pandemic prevention and control vide Project ID.P173586 dated 2nd April 2020 “IndiaCovid-19 Emergency Response and Health Systems preparedness project”1. This created an additional burden of debt on individual citizens of India as well as on the nation. Despite the number of official Covid-19 deaths (14 only, which is minimal and again doubtful) on a pan India level when the loan

was taken i.e., 2nd April 2020), the government of India did not consider the consequences of the loan and the value of Indian traditional therapies. Link:https://projects.worldbank.org/en/projects-operations/ project- detail/P173836 Thirdly, the huge amounts of tax-payer money have been invested to purchase experimental injections dubbed “vaccines” & experimental drugs/ treatments and other test kits, tools, logistics, masks, sanitisers, temperature guns, signage, PPE kits, pulse oximeters etc. to prevent, control and to manage the so-called pandemic. This has made serious impact on the national economy. Fourthly, citizens dependent on daily wages and MSMEs were financially decimated due to the lockdowns aimed at attempting to slow down the spread of an alleged virus, with 99.9% recovery from symptoms allegedly associated with this unproven, imaginary and theoretical virus. Consequently, all voices to investigate the real causes of these symptoms were suppressed in the noise of the alleged pandemic. But, on investigating the evidence claimed to be the basis of this pandemic, we found serious flaws. First of all, the evidence so far provided are not sufficient to prove the claim of the existence of the SARS-CoV-2 virus.
Germ theory states that to establish that a germ (i.e., viruses, bacteria, fungi and other micro-organisms) can cause disease/s, the alleged disease-causing germ should be obtained from a diseased person in the pure/intact form. Hence, in the context
of Covid-19 or SARS-CoV-2 we investigated all the research papers obtained from ICMR submitted by scientists and institutions, all RTI replies and other documents that claim the existence of SARS-CoV-2.
While investigating each and every research paper provided by ICMR/NIV or associated institutes or relevant scientists, we found that they have never ever purified or obtained SARSCoV-2 in the form of existing entity. Hence, the existence of SARS-CoV-2 is not scientifically established.
Here, we are presenting our findings & queries on different crucial aspects of the alleged Covid-19 Pandemic -
1. There is not even one unique or uniqueness of symptom: Reasoning:
• There is not even a single unique symptom or uniqueness in the definition of Covid-19 disease. • As per the definition of WHO/Ministry of Health/ICMR/ Centre for Disease Control and Prevention, USA (CDC); all the symptoms of any existing disease even mild diseases like cold, cough, headache, fever, body pain, confusion, sleep disorder, anxiety, depression etc. which shows the common symptoms and might be caused due to many reasons have been grouped together and has been labelled as a new disease named Covid-19.2,3,4,5
Link: https://www.who.int/emergencies/diseases/novel-coronavirus- 2019/question19and-answers-hub/q-a-detail/coronavirusdisease-Covid-19#
https://www.who.int/emergencies/diseases/novel-coronavirus- 2019/question-and-answers-hub/q-a-detail/coronavirusdisease-Covid-
https://timesofindia.indiatimes.com/life-style/health-fitness/ health-news/Covid-19https://timesofindia.indiatimes.com/lifestyle/health-fitness/health-news/Covid-19-second-wave-newsymptoms-to-watch-out- for/articleshow/82425679.cmssecondwave-new-symptoms-to-watch-out- for/articleshow/82425679. cms
And then patients with such common ailments were compelled to go for an RT-PCR test and those tested positive were frightened to succumb to Corona experimental treatment protocol. It is interesting to note that the symptoms listed for Covid-19 normally occurs to patients with respiratory diseases. On an Average 1.6 million Indians died due to Air pollution in India6 . Link:https://www.downtoearth.org.in/news/air/air-pollutionkilled-1-7- million-indians-in-2019-lancet-report-74737
• The Symptoms of most of these individuals would be consistent with the symptoms declared for alleged Covid19. RT-PCR being not a diagnostic tool but with the present primer sequence of Drosten, which is common in almost every living being, it has the ability to detect at certain CT values. The required number of alleged Covid-19 cases can be achieved effortlessly.
Queries / Certified Documents requested:
• How is it possible that, suddenly all common symptoms, humankind has always suffered from and known from time immemorial are being alleged to be caused from only one specific virus and/or its variant/s? The symptoms are of different types and there are hundreds of known reasons responsible for these symptoms. We found no mention as to the basis on which, it was established that the various symptoms generated were because of SARS-CoV-2. • How is it possible that, Suddenly the fever or seasonal fevers and all other common diseases, people always suffer from disappeared from our society and at the same time we have been taught to call these symptoms altogether in a new name that is Covid-19 disease?
• Kindly provide the experimental scientific evidence referred for even healthy persons also to be declared as a Covid-19
‘asymptomatic’ patient.
As a responsible expert authority u / s 106 of Indian Evidence Act, you are required to explain in every detail in what way Covid-19 is recognized as a new disease. Also u / s 111 of Indian Evidence Act, you need to explain, what moral exercise you did to assess before recommending / applying the restrictions which has likely caused more real damage than even the theoretical damage you have projected to be saving people from?
2. Purification and micrograph: Reasons:
a. Purification of particles/organisms is the only way or it is must to ascertain the identity of its existence. b. Micrographs of those purified specific micro-particles/ organisms is the only way to observe and verify the uniformity and morphological identity.
c. The bio-chemical characterization, propagation or multiplication of the virus in fresh culture without any additives, then obtaining entire RNA/DNA string (genome sequencing) and establishing the pathogenicity should be performed. Without these three steps viz., as stated in the clauses 2a, 2b and 2c, it is impossible to identify a virus and to establish the existence of a virus.
(Ref 1: Indian J Med Res 151, February & March 2020, pp 241243 DOI: 10.4103/ijmr.IJMR_577_20 ‘Transmission Electron Microscopy Imaging of SARS- CoV-2’. Transmission electron microscopy imaging of SARS-CoV-2 - PMC (nih.gov)7 This TEM images do not represent anything or the research work does not establish the existence of a virus. As there is no purification, control setup, virus multiplication and pathogenicity etc. as mentioned in above steps. Therefore, this research does not establish the existence of SARS-CoV-28.
(Ref 2: First isolation of SARS-CoV-2 from clinical samples in India - PMC (nih.gov)8
In this research there is no separation and purification, no control setups from human sample, no virus multiplication and no pathogenicity tests etc. have been performed or as mentioned in above steps. Therefore, this research does not establish the existence of SARS-CoV-2.
Queries / Certified documents required:
But these steps mentioned above, are absolutely missing in your research papers. Therefore, u / s 103 & 104 of Indian Evidence Act, 1872 you have the burden of proof to establish the existence of “disease causing agent i.e., SARS- CoV-2 virus through scientific experimental proofs.
3. Separation/ Isolation of virus:
No virus has been obtained directly from the human sample. Reasons:
As per your replies to our letters and RTIs correspondence, the SARS-CoV-2 virus, in intact form, has never been obtained (separated and purified) directly from human sample. i. Because, as per the virus theory, virus multiplication/ replication and CPE (Cytopathic Effect) happens within human body in human cells and this effect is the cause of symptoms/disease. Therefore, this event definitely will reflect in diseased human’s sample viz., saliva, NP, OP, blood or other secretions and also numerous viruses should be present in samples. Then why it is not obtained directly without cell culture?
ii. There is a possibility of immediate contamination to the samples collected as well as the in-vitro cell culture, since both the substances are open to atmosphere and the cell culture may already contain an array of unknown micro-organisms/ particles in it. Hence the protocols used to distinguish and ensure the purity of the sample taken and the in-vitro cell culture should be provided as a part of such research papers.
Queries / Certified documents required:
• Hence u / s 103 & 104 of Indian Evidence Act, 1872 you have the burden of proof to establish the existence of the virus in human sample and its pathogenicity with that sample.
Without which, all theories and assumptions like antibody, antigen, immunity, B and T cells etc. are premature and meaningless assumptions. Also, you have to explain u / s 111 of IEA, 1872 on why such an experiment is not performed or u / s 106 of IEA, 1872 about, why is it not possible to obtain/ isolate specific virus directly from human sample and purify it? Failing which, it goes against the virus theory (Virology).
Because first host is the diseased person and his/her cells are the host cells therefore, why a foreign cell culture or in-vitro culture is required? Mere statement is not enough. • Another question that you have to answer is how much volume of human sample i.e., saliva, BALF or other secretions will be enough to find a specific virus or some viruses?
• If virologists cannot find the virus in the sputum/sample of sick people to analyze, then on which evidence do they think the virus is virulent? - Is there any evidence that proves that the SARS-CoV-2 comes from bat or any other animal?
• Have the virologists ever established how they see the way of actual entry of the alleged virus into a host cell and multiplication in a living host human/animal body? • If the patient’s sample is immediately contaminated with an in-vitro cell culture, how could it then be established and distinguished scientifically that the patient was infected with any micro-organism/pathogenic agent or not? • If virus/viruses are not separated/isolated/purified and characterized directly from human sample, then how it is possible to know/distinguish that how many different types of viruses are there in the human sample, and secondly how it is possible to know how many types of viruses multiply/ replicate in animal cell/tissue culture? • The environment or toxic environment as present in-vitro tissue/ cell culture is not present inside the human body.
Therefore, how is it confirmed that viruses will behave same (replicates or shows CPE) within human body (cells) as shown in in-vitro cell culture?
• So, virologists/concerned scientists need to explain
u / s 106 of IEA, 1872 about, how it is proven that the virus enter, multiply, generate CPE, generate symptoms, pathology of each and every symptom and then the
mechanism of spread in the environment and infect the other human beings. 4. Scientific validity of the Cell culture practice: Reasons:
a) CPE (Cytopathic Effect): May be the causes of cells dying effect are the result from the use of cell-toxic antibiotics, antimycotic and other chemicals, starvation due to withdrawal of the nutrients etc.
Proper and multiple repetitive controlled experiments (including negative control) is must to rule out the above problem. b) The particles which are claimed as viruses/SARS-CoV-2:
• May be these are cellular particles, dead cell debris, extracellular vesicles, exosomes, lysosomes, clusters of proteins etc. • May be these are artifacts of the in-vitro process. • Therefore, purification, multiplication in fresh cell culture without any additive and pathogenesis with these purified alleged virus particles should be performed as mentioned in point no.2. These steps are also missing as per your research papers.
Queries / Certified documents required: Therefore, virologists/concerned scientists need to explain u / s 106 of IEA, 1872 about, how this cell culture practice is scientifically valid for the purpose or for the virus theory?
a) Without separation/isolation (non-tissue culture) and purification of the intact organism, it is not possible to know that the genome, belongs to SARS-CoV-2, which is missing in your research papers. b) The research paper you provided titled- “First isolation of SARS-CoV-2 from clinical samples in India”8, clearly mentions that scientists extracted RNA from the mixture of cell culture medium instead of natural habitat/host i.e., human sample. Hence, the extracted RNA may consist of RNA from other organisms i.e., VERO cells, host cellular nucleotides, bacteria, fungi etc. from the sample. c) In another case, RNA is extracted from human sample but not from intact virus particle. Hence, the extracted sample may consist human cell RNA, bacteria etc. Therefore, how this extracted nucleic acid related to specific virus? d) Critical to your research paper the larger issue in genome sequencing, which is done by reference-based nucleotide sequencing instead of independent nucleotide sequencing, which reveals no original work is done, so the scientists constructed/assembled the entire SARS-CoV-2 RNA string through known RNA that denotes counterfeit RNA string.
Therefore, the claim that the Whole Genome Sequence (WGS) from a specific virus has not been established; instead, it is a computer simulation (in-silico) effort which
is purely theoretical and imaginary genome sequencing/ assembly and not related to reality. e) As per all research paper about SARS-CoV-2 viral RNA assembly, RNA assembly or construction is featured by
REFERENCE BASED ASSEMBLY since the reference sequences are man-made, therefore it is possible to obtain abundance number of new nucleotide sequences for new organisms with the help of in-silico (computer generated) assembly, because there are different kinds of known and unknown organisms are already present with given sample or culture. So, it is impossible to differentiate RNA string of the desired organism from the other organisms directly from the sample. Therefore, the RNA construction of SARS-CoV-2 seems counterfeit.
f) The authors of research papers all over the world including
Indian scientists just imitated previous genome reference but did not perform original work or did not obtain entire and intact nucleic acid of the virus.
Queries / Certified documents required: The genome/nucleic acid reference sequence that was taken to identify SARS- CoV-2 are also not obtained/extracted in intact form and in its entirety, directly from purified virus particle sourced from human host sample. Now, clarify the
scientific validity of this genome sequence. Hence, u / s 111 of IEA, 1872 you need to prove your good faith, in all your declarations regarding SARS- CoV-2 Virus identification.
a) There is no purified infectious agent i.e., virus of the original sample (SARS- CoV-2 virus or its variant) which was collected.
b) There is no explanation to the entire process of pathology of generation of each and every symptom by the SARS-CoV-2 virus.
c) Lack of evidence to confirm the pathogenicity/virulence of the SARS-CoV-2 through natural introduction (inoculation) method in humans/host.
d) Mass population is every time getting exposed to so many factors e.g., harmful radiations, pollution of air, water and land, bad sanitation, toxic chemicals, food and fertilizers, seasonal changes, weather manipulation and various organisms. But without proper and precise techniques and experiments it is unfair to attribute certain factor/s and specifically to infection by a certain alleged virus as a cause of any disease. And this leads further to error in the line of treatment resulting in loss of health and economy. We are finding this has happened during this pandemic period and affected terribly to our citizens with respect to health, finance, socially, emotionally, psychologically and nation as a whole. It is so clear just by looking at the list of the signs and symptoms of Covid-19 that none of it has any nuances and uniqueness and they have existed before the pandemic declaration.
Queries / Certified documents required: Therefore, under the above circumstances & u / s 106 of IEA, 1872 you have to prove about, how this kind of pathogenicity experiments, shared with us is valid?
7. Scientific validity of Testing: Reasons:
a) There is no purified sample containing infectious agent i.e.,
SARS-CoV-2 virus or its variant.
b) Secondly, it is impossible to validate any “test” without having entire nucleic acid of the specific organism. That, in turn, is possible only on the basis of purified sample which has been isolated directly from human sample.
Both are missing, therefore, in this situation application of any test is seriously meaningless and misleading. Without proving the existence of the “disease causing agent” use of a test to diagnose that agent is a terrible scientific error. c) RT-PCR test i.e., the base of this Pandemic (which is generating Covid-19 cases and Covid-19 deaths);
• This test cannot detect symptoms, • This test cannot determine the source of the genome under consideration,
• This test cannot determine the pathogenicity of the genome or the source,
• This test cannot detect complete virus/organism. • This test cannot detect entire genome.
• This test cannot differentiate between infectious and noninfectious genetic material. • This test cannot tell specific differences among genetic materials of different germs/organisms. • By changing the number of cut-off of cycle threshold (CT) of
RT-PCR test anything/anyone can be shown as positive or negative. The discoverer, Kary Mullis of the PCR test said that with PCR test you can find anything in anybody. • The RT-PCR protocol for Covid-19 which is developed by
Christian Drosten and fellows, that is universally accepted detection test of SARS-CoV-2 virus, there is huge dilemma in research paper i.e., authors mentioned - “We aimed to develop and deploy robust diagnostic methodology for use in public health laboratory settings without having virus material available”. Hence, it is misleading statement of a flagship testing protocol. • It seems that Christian Drosten deliberately made attempt to confuse the scientific community and the world by misrepresenting and recommending variable bases as a protocol in the primer sequence. The primer (e.g., E-gene- reverse primer, ATATTGCAGCAGTACGCACACA) utilized by Christen Drosten matches with almost any living being on the Earth.
• Moreover, the manufacturers (or in CDC website also) mention that this test is valid only for analytical experimental purposes. They also clearly mention that this test is not for the investigation of any virus/germ or genome and is in no
way a diagnostic tool. And certainly not a gold standard by any means. In other words, RT-PCR test is not a diagnostic tool.
• Most serious issue is that, this test has never been validated.
As per research, RT-PCR protocol was developed before
Chinese publication (this paper is claimed as the origin/ base of SARS-CoV-2 identification, but the reality is this research paper also does not prove any existence of SARS-
CoV-2 Virus) on the basis of computer simulation, theory and assumption. • Moreover, the important fact is that RT-PCR or Ag/Ab test doesn’t reveal symptoms of the person which is significant aspect for confirmation of Covid- 19 disease.
Note: Peer review of Corman- Drosten RT-PCR test protocol of SARS- CoV-2
External Peer review of the RT-PCR test to detect SARSCoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive result9,10 https://www.scienceopen.com/document?vid=eedca1b30bcd-4572- b831
https://www.scienceopen.com/document?vid=eedca1b3-0bcd- 4572-b831-c51d1b977e2fc51d1b977e2f
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/ in the hands of Eurosurveillance. A decision to recognise the errors apparent in the Corman Drosten paper has the benefit to
greatly minimise human cost and suffering going forward. Is it not in the best interest of Euro surveillance to retract this paper? Our conclusion is clear. In the face of all the tremendous PCRprotocol design flaws and errors described here, we conclude: There is not much of a choice left in the framework of scientific integrity and responsibility.
Now, as we explained, this irrelevant RT-PCR test can show anyone and anything positive or negative like tap water, cold drink, chocolate, vegetable, fruits, animals, which have been published all over the world as well as in India. For instance, the then President of Tanzania, John Magufuli proved that RT- PCR of samples of papaya, goat, jackfruit too get positive11,12 . Link:
https://indianexpress.com/article/world/tanzania-presidentquestions- coronavirus-kits-after-goat-tests-positive-6392752/ Dr. Biswaroop Roy Chowdhury also attempted similar experiment13. Link: HOW TO FIND Covid-19 POSITIVE IN MUSKMELON? - www.coronakaal.tv
Link:
https://www.zdf.de/nachrichten/panorama/coronavirus-papayaziege- tansania-test-100.html https://www.independent.co.uk/news/world/africa/coronavirustanzania- test-kits-suspicion-goat-pawpaw-positive-a9501291. html
Therefore, these facts reveal that RT-PCR and other test is/was extensively misused to:-
• Generate Covid-19 cases.
• Generate Covid-19 deaths. All deaths (or as per the requirement) have been labelled as Covid-19 deaths with the help of these tests. From the abovementioned facts and findings, it shows that a) With respect to Disease causing virus theory, virologists did not follow science i.e., scientific principles and methods.
Instead, they have practiced on prejudice belief and assumption but not on evidence. b) The fact is that, no virologist/scientist is able to show an intact physical “disease causing virus particle” (i.e., purified virus directly from sample).
Queries / Certified documents required:
a) What is the scientific validity of Corman-Drosten RT-PCR testing protocol ? b. Provide the recommendation and Caliberation validity of the test?
c. Why there were no independent verification of this Corman-
Drosten RT-PCR test protocol done?
8 Attributing the disease causation to a specific virus/ germ: Reasons:
Some points on the basis of common sense:
a) Size of the virus and pathogenicity: A needle point can hold billions of pathogenic viruses (considering claimed size of 80-300 nm). As per our common sense and practical experience we find that even if billions of germs/viruses will not able to cause any disease. b) The presence of virus/germ in the environment v/s their identification (including mutation) and pathogenicity. I. As per the science, we are living in an ocean of germs.
Billions and trillions of numbers of germs, including different types of germs are present in every inch and circulating in our environment and among them, only a little have been identified till today. II. Secondly, almost all those known germs or micro-organisms have random and rapid mutation characteristics. III. Thirdly, we are constantly breathing-in and breathing-out some millions of germs (including unknown germs) every hour. If germs/viruses are so harmful then everybody must be suffering from diseases and many must die. c) Other causes of diseases: We know there are hundreds of factors that affect human body and mind and are responsible for human illness and complications. In this scenario, identification of specific germ/virus and secondly, to conclude it is the only cause of a disease or symptom is unscientific and is based on prejudice.
Queries / Certified documents required:
a) Therefore, we want to know from you how much quantity of viruses / germs are required to generate pathogenic effect to cause disease in human body, with the details of the experiment / protocol used to determine it? b) Provide us with the Protocols and experiments conducted to exclude all other possible causative factors of disease are excluded to arrive at the pathogenicity of the microbial infection?
c) What are the methods & protocols used to track and confirm the mutations of these germs / viruses?
9.Scientific Validity of Covid-19 cases & Covid-19 related Deaths:
Looking right from the beginning at the entire pandemic protocol like the definition and declaration of pandemic, testing, tracking and tracing cases, diagnosis, treatments, dead body management, death certification and vaccination drive etc., seems to be directly influenced and directed by WHO and other international research organizations, which are being heavily funded by pharmaceutical companies.
a) The original definition of the Pandemic by WHO until mid of 2008 is, “An influenza pandemic occurs when a new influenza virus appears against which the human population has no immunity, resulting in several, simultaneous epidemics worldwide with enormous numbers of deaths and illness
When a major change in either one or both of their surface proteins occurs spontaneously, no one will have partial or full immunity against infection because it is a completely new virus. If this new virus also has the capacity to spread from person-to-person, then a pandemic will occur.” However, during 2009, the World Health Organization dropped the words “with enormous numbers of deaths and illness” from their definition. During 2008, they also dropped the requirement of an “influenza pandemic” to be a new subtype with a simple reassortment virus, meaning that many seasonal flu viruses now could be classified as pandemic influenza.”
This change in definition is the primary base of alleged
Covid-19 pandemic declaration. b) First 3 cases in India were reported between 27-31, January, 2020 in Kerala, as per the Indian Journal on the basis of meaningless testing protocol.14 Link: https://www.ncbi. nlm.nih.gov/pmc/articles/PMC7258756/ In page 202, para-
Second in this research paper it is mentioned “The extracted
RNA was immediately used for testing the presence of SARS-
CoV-2 using the real-time RT-PCR protocol published by the
WHO for the detection of RdRp (1), RdRp (2), E gene and
N gene. RNase P gene was used as the internal control for the analysis. Confirmatory laboratory tests were performed as per the WHO- recommended test protocols. c) MCCD modification: We have observed a serious issue that suddenly the guidelines of the “Medical Certificate of Cause
of Death (MCCD)” have been changed in the beginning of the pandemic as given in the image below. 3. Completing Medical Certification of Cause of Death (MCCD) in COVID-19
3.1 Mortality coding of COVID-19 with ICD-10 Codes The ICD-10 codes presently recommended by WHO for mortality Coding are
And it is observed that all alleged Covid-19 deaths, are possibly the result of these “Method of Death Certificate (MCCD) Modification”.
That means, whether a person with any common symptom or without symptom and whether a person got positive or negative RT-PCR results, all deaths were labelled as Covid-19 Deaths15,16 or as per requirement. Link:

https://ncdirindia.org/Downloads/CoD_Covid-19_Guidance.pdf https://eaaf.org/wp-content/uploads/Covid19-PDFs/India/ Covid19_AUTOPSY_GUIDELINES_2020_10052020.pdf
As per the group of 161 Doctors of India “No evidence to prove deaths occurring due to SARS-CoV-2 virus” but all deaths (or as per requirement) have been labelled as Covid-19 deaths through “the Guidelines” and “the RT-PCR test”17 .
Link:
https://biswaroop.com/wp-content/uploads/2021/05/OpenLetter-to- Honble-PM-Narendra-Modiji.pdf
Queries / Certified Documents Required:
1. Hence, you have to provide the actual causes of deaths (which are labelled as Covid-19 deaths) 2. You have to provide the Certified copies of the MOU, agreements and any other documents, that enables you to follow all the Directives and suggestions of WHO, without any indigenous ratification, through scientific experiments, and impose them on the people of this sovereign Nation.
10. Scientific validity of Covid-19 Treatment Protocol: Reasons:
Although we have now disproved the attribution of the so-called Covid-19 symptoms to the alleged coronavirus. Even accepting the clubbing of all symptoms and calling it Covid-19 disease, we are questioning the treatment protocol adopted by the health authorities. Since the beginning, all the time-tested and successful medical treatment systems (Ayurveda, Yoga, Naturopath, Homeopath, Unani, Siddha etc) and even Allopathic
Doctors were censored completely to treat any alleged Covid-19 patient, using traditional methods or as per their expertise. But, on the other side, experimental untested medications and treatments were permitted and promoted / insisted as if humans were experimental guinea pigs that too on a mass scale. Secondly unknown, brand-new (for example: - Gene therapy, Lipid Nano particles based) technological and experimental alleged Covid-19 vaccines have been permitted and promoted to inject to the citizens of India which has no long-term safety data.
This type of act makes no sense, instead, it is an extremely wrong and insensitive decision or act. This is nothing but a serious medical experiment which is crime against humanity and this act clearly shows that health authorities have no intention of public health and welfare of citizens of India. A serious issue is, if any disease/symptom cannot be cured by Allopathy (alternate) Medical System, it is declared as incurable disease/symptom or epidemic or pandemic by ignoring the other mainstream medicinal systems of AYUSH at the outset. This is serious injustice to scientifically established Vedic and other centuries-old, time-tested, globally admired and recognized medical streams of AYUSH. Thus, most trustworthy Indian Medical Systems, their practitioners and citizens of India are disrespected and deceived. Our finding is that, in the initial stages of the alleged pandemic, if the patients were allowed to be treated by the above-mentioned mainstream medical treatment systems, as per pre-existing
treatment methods, then it was incorrect to declare it a pandemic or new disease.
Queries / Certified Documents Required:
1. You have to explain the reason for adopting the treatment protocols circulated by Health authorities, over time from
Dec 2019 to present day. 2. You have to share the certified copies of the minutes of meeting documents, in which the decision of the treatment protocols is taken.
Summary of Allegations
1. We observed that one of the main tools through which people were made fearful were the mythical images of the alleged virus, which were again computer-generated images (CGI).
Because there is not a single document witnessing purified images of SARS-CoV-2, but the same were used in display to the public, which was one of the primary causes that terrified the people at large. 2. Going through the timelines after the declaration of this pandemic, it shows that respective national authorities of India viz., ICMR, NIV, CDSCO, MoHFW, DCGI acted in haste, under the influence of WHO, they seem to have forgotten their duty to safeguard the sovereignty of our country & without undergoing essential verifications, validations and scientific research to establish Covid-19 epidemic in India.
3. We, the citizens of India are completely unaware regarding what types of international protocols, treatises or agreements are in force, which the authorities of Government of India have tied up and/or are going to tie-up with agencies like WHO. But we are making it very clear to you and all the concerned that the citizens of the Republic of India, have never given any such consents to our government authorities, scientists and research institutions to bind our
Nation into such types of agreements/ treatises as a result of which any international organization/institution like WHO will rule on us and which will overleap the Indian Constitution and our Fundamental Rights. These types of activities are unacceptable, unlawful, illegal, unconstitutional and will be a serious deception to citizens of India. 4. Irrespective of any agreement or protocol, it is the prime duty of Government of India to prove to the citizens of India, the existence of the virus, its pathogenicity and its relevancy in creating pandemic-like/epidemic-like situation by appointing national or international agencies including the WHO. 5. Experts too can err. Theories and conclusions need to face challenge and refutation is the only solution. a. Experts and scientists being humans can err naturally, despite being careful. When it comes to public health decision making, the ultimate beneficiary or sufferer is the tax-payer. Hence every scientific outcome has to undergo the test of public trust, by involving researchers and experts from the public domain.
For instance,
Drug approval and ban:
Almost every drug that arrives in the market goes through stringent regulations for at least 10-12 years and then only gets the approval for efficacy and safety, but then, after a certain period, usually after about 10-15 years of consumption by the population, it is found affecting the health of the people adversely generating serious complications like multi-organ damage and it eventually gets banned and is withdrawn from the market. This gives rise to a very pertinent question with respect to the entire process of drug research, development and approval and on the overall machinery and authorities involved in it. It makes the common man to think whether the entire drug development process run by the pharmaceutical/ healthcare research institutions and industries are used to eyewash the clinical fraternity and general public. The intrinsic scientific flaw behind this approach seems as follows:
i. Lack of holistic approach or deficiency in the experts’ ability of perception and understanding the subject. ii. Drawbacks in research procedures or mapping or protocol. iii. Drawbacks in problem finding. iv. Influence or Conflict of interest.
v. Negligence in research. vi. Correlation and application of animal studies to human.
vii. Extrapolation of statistical data to clinical outcomes. viii. Ignorance towards the Law of Probability (w.r.t the expected / simulated adverse effects).
Unfortunately, the ultimate sufferer is the common man who incidentally turns out to be a guinea pig too. Like, all experts know that almost every chemical is being used for the drugs (modern medicine) have already existing adverse effects marketed under the guise of the so-called “established” safety profile. Under such circumstances the experts need to state the reason as to why the experts do not emphasize natural remedies which are time tested, safe, effective and easily available in abundance. b. Even if any concept/theory/belief exists for long time, it does not mean that it becomes the truth or a reality. A misconception or belief may be perceived and accepted as the truth over time, if not challenged into proper investigation and questioning. Secondly, probably many beliefs or misconceptions or false-facts have intentionally been programmed to portray as science. Therefore, in these cases, the scientists/experts involved are the primary victims of this programming or conspiracy due to lack of doubt and questioning and the public are the ultimate.
c. We should remember, science can survive only through scrutiny. More check and balance, less the harm. d. The germ theory of disease is just a theory proposed for last two centuries. Yet, the national health policies worldwide are based on this hypothetical theory. The prevalent belief
system in the scientific world is at a level that no one dares to question its premise. To establish the germ theory on scientific parameters the principles and methods need to be fulfilled and the lack of it is indeed a serious concern. These concerns have to be dealt only at the national levels by reputed and authentic authorities & each and every phenomenon & entities to the core need to be challenged, probed and reviewed critically as they affect the whole of the Nation.
For instance
i. The intact virus particle/other germs (bacteria, fungi etc) need to be obtained directly from the sample/body parts of the host in abundant quantity, through processes such as separation, isolation and purification of the particles. ii. Evidence of multiplication/propagation of purified virus particle, in a fresh tissue/cell culture without adding / allowing any additives. iii. To state that the virus particle/other germs (bacteria, fungi, protozoa etc) are pathogenic, you need to establish through any valid and rational scientific method, in the first place, to prove that the particle / organism is a disease-causing agent. Note: The presence of something in somebody, does not prove the causation of disease. Correlation does not imply causation.
e. Another crucial aspect of the healthcare system are the doctors who interact and deal with the patients on a regular
basis. Therefore, this subject-matter-expert group is the most relevant stakeholder in the entire clinical process of investigation, diagnosis and treatment that is directly related to the patients’ health. Today, the authorities seem to have completely side-lined the doctors in the decision-making process. On the contrary, they are forced to rely on the nonclinical research scientists’ questionable advice to impose their protocols. 6. Instead of making public the evidence of existence and pathogenicity of the SARS-CoV-2, the government with the help of media engaged in mass fear psychosis by spreading terror, which resulted into psychosomatic disorder claimed as Covid-19 by them. Therefore, we allege that you have claimed a pandemic falsely, without following the strict scientific logic, principles and methods:
There are two ways of proving or establishing any claim or conclusion. One is, on the basis of logic and reasoning and second and final decisive way is the practical demonstration.
7. In the absence of valid scientific evidence, considering socio-economic impact & assessing collateral damage, this pandemic or declaration of a pandemic associated restrictions / curbs is frivolous. The implementation of The
Epidemic Diseases Act, 1897 and The Disaster Management
Act, 2005 in our Nation is hence alleged, a serious misuse of power.
8. There was/is no base, no logic behind Covid-19 Vaccine,
Face Mask, Lockdown with restrictions and all prevention and control measures that were/are implemented.
List of Documents Required:
We request you to provide the following documents as certified copies as per Indian Evidence Act, 1872 Section 76 & Public Records Act, 1993 Section 12.
S.No. Certified Document Copy Respondent
1 Experimental scientific evidence to prove that even healthy persons also can be declared as a Covid-19 ‘asymptomatic’ Carriers / Patients. 1.THE DIRECTOR GENERAL, ICMR 2.Member Secretary, NDMA 3. The Home secretary, MHA
4. The Chief Secretary, MoHFW
2 Experimental scientific evidence that enabled Covid-19 to be recognized as a new disease which manifests unique symptom, which is dangerous and is causing by the SARSCoV-2 virus and/or its variants. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
3 Copies of all the minutes of meetings held from November 2019 to June 2022 regarding alleged Covid-19 and its variants related disease and associated policy matters. 1. THE DIRECTOR GENERAL, ICMR
2. Member Secretary, NDMA
3. The Home secretary, MHA 4. The Chief Secretary, MoHFW
4 Date & Age wise National ‘all-causes mortality’ data from 01/01/2015 to 31/12/2021, Data must include medical history and cause of death of the persons. 5 Date & Age wise National MCCD data from 01/01/2015 to 31/12/2021. 6 Date & Age wise National Vaccination data with overall numbers from 16/01/2021 to 31/05/2022. The Chief Secretary, MoHFW
The Chief Secretary, MoHFW
The Chief Secretary, MoHFW
7 Experimental Scientific evidence to establish the existence of “disease causing agent i.e., SARS-CoV-2 virus.
8 Experimental Scientific evidence to establish the existence of the virus in human sample and its pathogenicity with that sample. 9 Experimental Scientific evidence that proves that the SARS-CoV-2 comes from bat or any other animal? 1.THE DIRECTOR GENERAL, ICMR
2. Member Secretary, NDMA 3. The Home secretary, MHA
4. The Chief Secretary, MoHFW 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
10 Experimental Scientific evidence to establish the way of actual entry of the alleged virus into a host cell in a living host human/animal body. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
11 Experimental Scientific evidence to establish that the virus RNA/DNA takes control of the cell, multiply inside the cell and thereafter there is cytopathic effect and the new-born viruses are spread into the body. 12 Experimental Scientific evidence to establish the phase in which the virus spread from human to human. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
13 Experimental Scientific evidence to establish that the virus enters, multiplies, generates CPE, generates symptoms, pathology of each and every symptom and then mechanism of spread in the environment and infecting the other human beings. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
14 Experimental Scientific evidence to establish the quantity of viruses / germs required to generate pathogenic effect to create disease in human body 15 Experimental Scientific evidence to the effect that all other possible causative factors of disease, are excluded to arrive at the inference of pathogenicity of a particular microbial infection. 16 All Memorandum of Understandings (MOUs) signed with WHO and any other international research organizations. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
17 All Minutes of meetings through which mortality coding of Covid-19 with ICD-10 Codes is adopted in India. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
18 ‘Minutes of meeting’ Documents which lead to the decision of the treatment protocols for Covid-19 are taken. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
19 All national and international scientific evidence/ recommendations/ experts’ reports (published/unpublished records) based on which the pandemic was imposed on our Nation. 20 Experimental scientific evidence of wet lab and dry lab, right from isolation, purification and identification of the SARS- CoV-2/ its variants up to its pathogenicity, using control experiments at all stages. 1. THE DIRECTOR GENERAL, ICMR
2. Member Secretary, NDMA 3. The Home secretary,MHA 4. The Chief Secretary, MoHFW 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
21 Evidence/records of any findings on any disease causing virus/germ/insect or toxic particles which was/were artificial/lab- created or engineered or manipulated but not in its original natural form (Ref. Bio-terrorism/ Bioweapon has been men-tioned in upcoming Public Health Bill 2017/ 2022 and 166 plus VRDLaboratories program was implemented to handle such situation) . 22 Experimental scientific evidence in which the Chinese / Indian scientists have separated/isolated and purified intact form of SARS-CoV-2 (and its variants). 1. THE DIRECTOR GENERAL, ICMR
2. Member Secretary, NDMA 3. The Home secretary, MHA 4. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
23 Experimental scientific evidence in which, the Chinese / Indian scientists have performed control experiments for Cytopathic effect (CPE) regarding SARS- CoV-2 virus. 24 Experimental scientific evidence in which, the Chinese / Indian scientists did experiment of the pathogenicity including control set up with purified (except tissue culture) SARSCoV-2. 25 Evidence that the Chinese scientists ever extracted whole nucleic acid from intact SARSCoV-2. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
26 Experimental Scientific evidence in which, the scientists have done the research, under a condition in which cells die from natural process and under the other conditions in which cells die in presence of virus, are micro-graphed and analyzed. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
List of All Queries:
We request you to provide the answers for the following queries, with respect to Indian Evidence Act, 1872 Section 103, 104, 106 &111.
S.No. Queries to be answered Respondent
1 How is it possible that, suddenly all common symptoms, humankind has always suffered from and known from times immemorial, are being alleged to be caused from only one specific virus and/or its variant/s? The symptoms are of different types and there are hundreds of known reasons responsible for these symptoms. We found no mention as to the basis on which, it was established that the various symptoms generated were because of SARS-CoV-2. 1. THE DIRECTOR GENERAL, ICMR
2. Member Secretary, NDMA
3. The Home secretary, MHA
4. The Chief Secretary, MoHFW
2 How is it possible that, suddenly the fever or seasonal fevers and all other common diseases, people always suffer from disappeared from our society and at the same time we have been taught to call these symptoms altogether in a new name that is Covid19 disease? 3 What moral exercises were done towards assessment before recommending / applying the restrictions which have likely caused more real damage than even the theoretical damage you have projected to be saving people from? 1. THE DIRECTOR GENERAL, ICMR
2. Member Secretary, NDMA
3. The Home secretary, MHA
4. The Chief Secretary, MoHFW
1. Member Secretary, NDMA
2. The Home secretary, MHA
3. The Chief Secretary, MoHFW
4 If Experimental Scientific evidence, to establish the existence of the virus in human sample and its pathogenicity with that sample is not available, explain why such an experiment is not performed or why it is not possible to obtain / isolate specific virus directly from human sample and purify it? 5 Why it is not possible to separate/isolate/ purify viruses directly from human sample? Because first host is the diseased person and his/her cells are the host cells therefore, why a foreign cell culture or in-vitro culture is required? 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
6 How much volume of human sample i.e., saliva, BALF or other secretions will be enough to find a specific virus or some viruses? 7 If Virologists cannot find the virus in the sputum/ sample of sick people to analyze, then on which evidence do they think the virus is dangerous, causing specific symptom and that it is lethal? 8 If you have established, that the virus RNA/DNA takes control of the cell, multiply inside the cell and thereafter there is cytopathic effect and the new- born viruses are spread into the body, then state whether the virus or the virus RNA/ DNA was obtained from host human/animal body or cell culture. 1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR
2. The Chief Secretary, MoHFW
9 What are the techniques / protocols used to ensure that the patient sample is not immediately contaminated with an in- vitro cell culture? 10 If virus/viruses are not isolated/purified and characterized directly from human sample, then how it is possible to know/distinguish that how many different types of viruses are there in the human sample, and secondly how it is possible to know how many types of viruses replicate in animal cell/ tissue culture? 11 The environment or toxic environment as present in animal cell culture is not present inside the human body. Therefore, how is it confirmed that viruses will behave same (multiply or create CPE) within human body (cells) as shown in in-vitro tissue culture? 1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
12 How is tissue culture practice scientifically valid for the purpose of experimenting / diagnosing or for the virus theory? 13 The reference that was taken to detect SARS-CoV-2 are also not isolated or purified directly from human sample, according to your research papers. Hence, how would you prove your good faith, in all your declarations regardingSARS-CoV-2 Virus. 14 In the absence of, a) Separated and purified infectious agent, i.e., virus of the original sample (SARS-CoV-2 virus or its variant) which was collected. b) Explanation to the entire process of pathology of generation of each and every symptom by the SARSCoV-2 virus. 1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
c) Evidence to confirm pathogenicity/virulence of the SARS-CoV2 through natural introduction (inoculation) method in humans/host, how can a pathogenicity experiment, be confirmed valid? 15 What is the rationale behind using Christian Drosten’s protocol based on RT- PCR as a Diagnostic tool? 1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
16 What is the scientific basis of your declaration, that the alleged Covid-19 is indeed a disease?
17 What is the Scientific basis of all other diseases, which you have attributed to the Viruses? 1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW 1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
18 What are the experimental Scientific methods & protocols used to track and confirm the mutations of these germs/ viruses? 1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
19 What are the reasons for adopting the treatment protocols for Covid-19, circulated over time from Dec 2019 to Present day? 20 Did you engage with the doctors who interact and deal with the patients on a regular basis, in your decision-making process? If yes, provide their details. If no, explain your rationale to exclude the doctors practicing regularly, from your decision-making process. 1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
1. THE DIRECTOR GENERAL, ICMR 2. The Chief Secretary, MoHFW
Conclusion:
Since March 2020 we are suffering from this huge crisis. So, it is the matter of our lives and liberties. We are ready to pay the legal charges if any to receive the certified copies of documents in electronic format. Hence, immediate response to this legal notice, is being expected within 7 days, failing which we will be forced to institute legal proceedings against you, assuming you have accepted to all the allegations.
Regards
Dr. Sachin Pethkar, Pune, Maharashtra Dr. Biswaroop Roy Chowdhury, Faridabad, Haryana Dr. Mufassil Dingankar, Mumbai, Maharashtra Mr. Jitendra Banjara, Chhattisgarh Mrs. Soni Sharma, Karnataka Mr. Pankaj Sen, Assam Ms. Malavi Chaudhari, Ahmedabad Mr. Mayank Pincha, Bangalore Mr. Vikash Diwan, Gaya (Bihar) Mr. Umamaheshwar, Hyderabad Mr. Antarang Anand, Delhi Mr. Kamatchi Shanker Arumugam, (TNRM), Tamilnadu Mr. Jayaseelan.G, President of TNRM, Tamilnadu Dr. Susan Raj, Pune, Maharashtra Dr. Akhilesh Sahu, Raipur, Chhattisgarh
Email: imis.world@protonmail.com, freeearthalliance@protonmail.com
N.I.C.E (Network of Influenza Care Experts)
Email: biswaroop@biswaroop.com Mobile: +91-9312286540
For the live links of the references, go to www.biswaroop.com/dicecovidtest
SECTION - IV
Open Letter to Prime Minister Shri Narendra Modi with the consent from 161 doctors Subject: No Evidence to prove death occurring due to Novel Corona Virus
What you know by now, was already communicated to the honorable Prime Minister Shri Narendra Modi by me and my team of 160 doctors on 24 May, 2021 and CC copy was sent to more than 5000 govt. authorities/ officials including all members of parliament, MLA’s, State Governments, health ministry etc. Here in this section, we have included that “Open letter to Hon’ble Prime Minister Narendra Modi with consent from 161 doctors from PAN India”
